DOCSLIB.ORG

Developmental Genetics of the Female Reproductive Tract in Mammals

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Developmental Genetics of the Female Reproductive Tract in Mammals REVIEWS DEVELOPMENTAL GENETICS OF THE FEMALE REPRODUCTIVE TRACT IN MAMMALS Akio Kobayashi and Richard R. Behringer The female reproductive tract receives the oocytes for fertilization, supports the development of the fetus and provides the passage for birth. Although abnormalities of this organ system can result in infertility and even death, until recently relatively little was known about the genetic processes that underlie its development. By drawing primarily on mouse mutagenesis studies and the analysis of human mutations we review the emerging genetic pathways that regulate female reproductive-tract formation in mammals and that are implicated in congenital abnormalities of this organ system. We also show that these pathways might be conserved between invertebrates and mammals. AGENESIS The female reproductive tract is essential for the con- review examines our knowledge of the genetic pathways A condition in which a body tinuation of mammalian species: it provides the site that regulate the organogenesis of the female reproduc- part is absent or does not for the fertilization of oocytes by spermatozoa, for tive tract in mammals. Many of these studies show that develop completely. implantation and subsequent development of the interactions between the mesenchyme and epithelium of ATRESIA embryo, and for delivery of the fetus. Abnormalities in the developing female reproductive tract are important A condition in which an opening female reproductive-tract formation — which are esti- for its formation and differentiation. Interestingly, or passage for the tracts of the mated to occur in 0.1–3.0% of live births in humans1 — although mammals and invertebrates differ markedly body is absent or closed. can lead to infertility and even death during pregnancy both in the morphology of their reproductive organs and or childbirth. The range of documented defects includes in their mode of reproduction, some genetic pathways for SEPTATION Refers to the state of being AGENESIS, ATRESIA and SEPTATION of the female reproductive female reproductive-tract organ development seem to be divided internally by a partition tract1,which are thought to result from abnormalities conserved between them. Other important related issues, or partitions. In the female that occur during embryonic development. such as embryo implantation and postnatal hormone- reproductive tract, septation is The female reproductive tract, which in mammals regulated differentiation, have been reviewed elsewhere3,4. observed longitudinally or transversely. includes the oviducts (fallopian tubes), uterus, cervix and vagina (FIG. 1a), is also a prominent organ site for dis- Embryology of the female reproductive tract ease. Malignancies of the cervix and uterus accounted The development of the vertebrate urogenital system — Program in Developmental for 14.8% of all cancers among women in the United which comprises the kidneys, gonads, and urinary and Biology, Baylor College of States in the year 2000 (REF.2).Surprisingly, despite the reproductive tracts — begins soon after gastrulation, Medicine and Department importance of this organ system for the fertility and through the differentiation of the INTERMEDIATE MESODERM. of Molecular Genetics, University of Texas M. D. health of women, relatively little is known about the This embryonic tissue subsequently proliferates and Anderson Cancer Center, molecular and cellular mechanisms that regulate its some cells undergo the transition from the mesenchy- 1515 Holcombe Boulevard, development during embryogenesis. Recent findings, mal to the epithelial cell type to generate the tubules that Houston, Texas 77030, USA. predominantly from mouse knockout studies, have compose the male and female reproductive tracts, as well Correspondence to R.R.B. e-mail: identified a set of genes that are essential for the devel- as the kidneys and testes. Before sexual differentiation, [email protected] opment of this organ system (TABLE 1).By primarily mammalian embryos have two pairs of genital ducts: the doi:10.1038/nrg1225 drawing on mouse and human genetic studies, this Wolffian ducts (MESONEPHRIC DUCTS) and the Müllerian NATURE REVIEWS | GENETICS VOLUME 4 | DECEMBER 2003 | 969 REVIEWS a Ovaries ducts (PARAMESONEPHRIC DUCTS) (BOX 1).The Wolffian ducts Oviduct differentiate into structures of the male reproductive tract, such as the epididymides, vas deferentia and semi- A nal vesicles. By contrast, the Müllerian ducts, which sub- sequently form adjacent to the Wolffian ducts (FIG. 2a), differentiate into the oviducts, uterus, cervix and upper portion of the vagina of the female reproductive tract. P Uterus The expression of a lin-11, Isl1 and mec-3 homologue (Lim1, also known as Lhx1), which encodes a LIM class Myometrium Endometrium Cervix homeodomain protein, in the epithelium of the Vagina Wolffian and Müllerian ducts highlights the initial sex- ual duality of the forming reproductive systems (see b Duplex uterus without vagina c Duplex uterus with two lateral vaginae below; FIGS 2b,c, 3). (monotremes) and a median birth canal (marsupials) The morphology of the female reproductive tract can differ markedly among mammalian species (FIG. 1b–g). Müllerian duct formation is similar between species and the morphological diversity mainly results from differences in the extent of fusion of the two Müllerian ducts anteriorly5.At one extreme are monotremes and marsupials in which Müllerian fusion is absent or lim- ited, which leads to the formation of two uteri (‘duplex’ US US uteri in FIG. 1b,c). At the other extreme, the Müllerian ducts of higher primates (including humans) fuse more anteriorly, which results in the formation of a sin- d Duplex uterus with a single vagina e Bipartite uterus seen in pigs, seen in rodents and rabbits marine mammals and mice gle (‘simplex’) uterus with a single cervix and vagina (FIG. 1g).Anatomical variation of the female reproduc- tive tract can even be observed within a species; for example, subspecies of bats can have different types of uterus6. Molecular genetics in the mouse Targeted mutagenesis in the mouse has identified several genes that are essential for female reproductive-tract development. On the basis of their mutant phenotypes, the genes that are knocked out in these mice can be cate- gorized into those that are required for initial Müllerian duct formation in both sexes, for its regression in males f Bicornuate uterus seen in g Simplex uterus seen in most higher most bats, cows and horses primates, including humans or for its differentiation in females. Each of these three main developmental stages are discussed below. Molecular expression analyses in wild type and knockout mice have also contributed to understanding the relation- ships between genes and have been used to build a mole- cular genetic pathway for female reproductive-tract development. Müllerian duct formation. A small set of homeodomain- containing transcription factors and signalling molecules Figure 1 | Female reproductive-tract variation in mammals. a | Basic anatomical features of are required for female reproductive-tract formation in the female reproductive tract. Oocytes leave the ovaries and move into the oviduct, where mice. One of these, paired-box gene 2 (Pax2), encodes a fertilization occurs. The cervix is the boundary between the uterus and the vagina or urogential homeodomain transcription factor that is homologous sinus. With the exception of in the egg-laying mammals (monotremes), embryos implant in the to the Drosophila PAIR-RULE GENE paired (prd) (REF. 7). uterus and are delivered through the vagina. The developing female reproductive tract has two layers, the epithelium and the surrounding mesenchyme, which differentiate into the endometrium Pax2-null mutant mice die soon after birth, have no and the myometrium, respectively, in the uterus. b,c | Absent (or limited) fusion of the Müllerian kidneys and lack a reproductive tract owing to the ducts leads to the presence of two uteri. The urogenital sinus (US) is connected to the female degeneration of the Wolffian and Müllerian ducts dur- reproductive tract (b). Müllerian duct fusion is physically blocked by the presence of the ureters, ing embryogenesis — a phenotype that is consistent which leads to the formation of three vaginae (c). d | The duplex uterus shown here has a pair of with the expression of this gene in the kidney and in the cervices. e | In the duplex bipartite uterus seen in many mammalian species, Müllerian fusion in epithelium of the Wolffian and Müllerian ducts. the uterine region does not occur, or is limited, which leads to the formation of a pair of uterine horns that can support the development of many fetuses. f | A larger portion of the uterus However, the anterior portion of both tracts initially 8 forms the uterine body. g | Müllerian ducts fuse anteriorly to generate a single uterine body that forms in Pax2-null mutants .A closely related gene, supports a single fetus or a small number of fetuses per pregnancy. A, anterior (cranial); Pax8, is co-expressed with Pax2 in the developing P, posterior (caudal). Panels b–g adapted with permission from REF. 5 © (2003) McGraw-Hill. Wolffian and Müllerian ducts and kidney, although 970 | DECEMBER 2003 | VOLUME 4 www.nature.com/reviews/genetics REVIEWS Table 1 | Mouse genes that are required for female reproductive tract development Gene name Genetic map Molecule encoded Tissue of Female reproductive-tract References position expression phenotype abnormality (mode of inheritance) Formation Pax2
Load more

Recommended publications
  • Te2, Part Iii
    TERMINOLOGIA EMBRYOLOGICA Second Edition International Embryological Terminology FIPAT The Federative International Programme for Anatomical Terminology A programme of the International Federation of Associations of Anatomists (IFAA) TE2, PART III Contents Caput V: Organogenesis Chapter 5: Organogenesis (continued) Systema respiratorium Respiratory system Systema urinarium Urinary system Systemata genitalia Genital systems Coeloma Coelom Glandulae endocrinae Endocrine glands Systema cardiovasculare Cardiovascular system Systema lymphoideum Lymphoid system Bibliographic Reference Citation: FIPAT. Terminologia Embryologica. 2nd ed. FIPAT.library.dal.ca. Federative International Programme for Anatomical Terminology, February 2017 Published pending approval by the General Assembly at the next Congress of IFAA (2019) Creative Commons License: The publication of Terminologia Embryologica is under a Creative Commons Attribution-NoDerivatives 4.0 International (CC BY-ND 4.0) license The individual terms in this terminology are within the public domain. Statements about terms being part of this international standard terminology should use the above bibliographic reference to cite this terminology. The unaltered PDF files of this terminology may be freely copied and distributed by users. IFAA member societies are authorized to publish translations of this terminology. Authors of other works that might be considered derivative should write to the Chair of FIPAT for permission to publish a derivative work. Caput V: ORGANOGENESIS Chapter 5: ORGANOGENESIS
    [Show full text]
  • Structure of Pronephros and Development of Mesonephric Kidney in Larvae of Russian Sturgeon, Acipenser Gueldenstaedtii Brandt (Acipenseridae)
    Zoologica5 PRONEPHROS Poloniae-AND (2012)-MESONEPHRIC 57/1-4: 5-20-KIDNEY-IN-LARVAE-OF-A.-GUELDENSTAEDTII 5 DOI: 10.2478/v10049-012-0001-6 STRUCTURE OF PRONEPHROS AND DEVELOPMENT OF MESONEPHRIC KIDNEY IN LARVAE OF RUSSIAN STURGEON, ACIPENSER GUELDENSTAEDTII BRANDT (ACIPENSERIDAE) L.S. KRAYUSHKINA*1, A.A. GERASIMOV1, A.A. KIRSANOV1, M.V. MOSYAGINA1, A. OGORZA£EK2 1Department of Ichthyology and Hydrobiology, St. Petersburg State University, 16-th Line 29, 199178, St. Petersburg, Russia, [email protected] 2 Department of Animal Developmental Biology, Zoological Institute, University of Wroclaw, Sienkiewicza 21, 50-335 Wroclaw, Poland. *Corresponding author Abstract. The structure of the pronephros and development of mesonephric kidney in Russian sturgeon larvae, Acipenser gueldenstaedtii Brandt at different stages of early postembryonic development (from hatching to 14 days), were studied with histological and electronic microscopy methods. The larval pronephros is represented by the system of bilaterally located pronephric tubules with ciliated nephrostomes and funnels and exog- enous single glomus, which is not integrated directly into pronephric tubules and located in the pronephric chamber. The glomus is positioned below the dorsal aorta and vascular- ized by its capillaries. The glomus has the same features of the thin structure that are typical of and necessary for the function of a filtering organ. The structure of the prone- phros in acipenserids is discussed and compared with teleosts and amphibians. Histogen- esis of the mesonephric kidney is observed during the period of pronephros functioning; it is complete by the time the larvae transfer to exogenous feeding. At this moment, the pronephros undergoes significant structural degradation.
    [Show full text]
  • (2017) Emerging Significance of Bile Acids
    Texas Medical Center Digestive Diseases Center 8th Annual Frontiers in Digestive Diseases Symposium: Emerging Significance of Bile Acids in Digestive & Liver Diseases Saturday, February 11, 2017 Onstead Auditorium, Houston, Texas 77030 Table of Contents ....................................................................................................................................................................... 1 Agenda .......................................................................................................................................................................................... 2 CME Activity............................................................................................................................................................................... 3 List of Abstracts .................................................................................................................................................................... 4 - 6 Abstracts............................................................................................................................................................................... 7 - 41 TMC DDC Leadership ............................................................................................................................................................ 42 List of Participants ............................................................................................................................................................ 43 - 46 Acknowledgements
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Stem Cells in the Embryonic Kidney R Nishinakamura1
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector http://www.kidney-international.org mini review & 2008 International Society of Nephrology Stem cells in the embryonic kidney R Nishinakamura1 1Division of Integrative Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Kumamoto, Japan The mammalian kidney, the metanephros, is formed by a STRATEGY TOWARD KIDNEY RECONSTITUTION USING reciprocally inductive interaction between two precursor PROGENITOR CELLS tissues, the metanephric mesenchyme and the ureteric bud. Stem cells are defined by two criteria: self-renewal and The ureteric bud induces the metanephric mesenchyme to multipotency. Few reports in the kidney field have addressed differentiate into the epithelia of glomeruli and renal tubules. both of these criteria at a clonal level, so it is better to use the Multipotent renal progenitors that form colonies upon Wnt4 term ‘progenitor’ rather than ‘stem cells.’ In this review, renal stimulation and strongly express Sall1 exist in the progenitors in the embryonic kidney, not those in the adult metanephric mesenchyme; these cells can partially kidney, from the viewpoint of developmental biology and reconstitute a three-dimensional structure in an organ stem/progenitor cell biology will be discussed. To generate culture setting. Six2 maintains this mesenchymal progenitor multiple cell lineages for kidney regeneration, the identifica- population by opposing Wnt4-mediated epithelialization. tion of renal progenitors is a prerequisite. Furthermore, there Upon epithelial tube formation, Notch2 is required for the exist three obstacles to be overcome: (1) derivation of the differentiation of proximal nephron structures (podocyte and renal progenitors; (2) expansion of the renal progenitors; and proximal tubules).
    [Show full text]
  • The Reproductive System
    27 The Reproductive System PowerPoint® Lecture Presentations prepared by Steven Bassett Southeast Community College Lincoln, Nebraska © 2012 Pearson Education, Inc. Introduction • The reproductive system is designed to perpetuate the species • The male produces gametes called sperm cells • The female produces gametes called ova • The joining of a sperm cell and an ovum is fertilization • Fertilization results in the formation of a zygote © 2012 Pearson Education, Inc. Anatomy of the Male Reproductive System • Overview of the Male Reproductive System • Testis • Epididymis • Ductus deferens • Ejaculatory duct • Spongy urethra (penile urethra) • Seminal gland • Prostate gland • Bulbo-urethral gland © 2012 Pearson Education, Inc. Figure 27.1 The Male Reproductive System, Part I Pubic symphysis Ureter Urinary bladder Prostatic urethra Seminal gland Membranous urethra Rectum Corpus cavernosum Prostate gland Corpus spongiosum Spongy urethra Ejaculatory duct Ductus deferens Penis Bulbo-urethral gland Epididymis Anus Testis External urethral orifice Scrotum Sigmoid colon (cut) Rectum Internal urethral orifice Rectus abdominis Prostatic urethra Urinary bladder Prostate gland Pubic symphysis Bristle within ejaculatory duct Membranous urethra Penis Spongy urethra Spongy urethra within corpus spongiosum Bulbospongiosus muscle Corpus cavernosum Ductus deferens Epididymis Scrotum Testis © 2012 Pearson Education, Inc. Anatomy of the Male Reproductive System • The Testes • Testes hang inside a pouch called the scrotum, which is on the outside of the body
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Development of the Urogenital System of the Dog
    DEVELOPMENT OF THE UROGENITAL SYSTEM OF THE DOG MAJID AHMED AL-RADHAWI LICENCE, Higher Teachers' Training College, Baghdad, Iraq, 1954 A. THESIS submitted in partial fulfillment of the requirements for the degree MASTER OF SCIENCE Department of Zoology KANSAS STATE COLLEGE OF AGRICULTURE AND APPLIED SCIENCE 1958 LD C-2- TABLE OF CONTENTS INTRODUCTION AND HEVIEW OF LITERATURE 1 MATERIALS AND METHODS 3 OBSERVATIONS 5 Group I, Embryos from 8-16 Somites 5 Group II, Embryos from 17-26 Somites 10 Group III, Embryos from 27-29 Somites 12 Group 17, Embryos from 34-41 Somites 15 Group V , Embryos from 41-53 Somites 18 Subgroup A, Embryos from 41-<7 Somites 18 Subgroup B, Embryos from 4-7-53 Somites 20 Group VI, Embryos Showing Indifferent Gonad 22 Group VII, Embryos with Differentiatle Gonad 24 Subgroup A, Embryos with Seoondarily Divertioulated Pelvis ... 25 Subgroup B, Embryos with the Anlagen of the Uriniferous Tubules . 26 Subgroup C, Embryos with Advanced Gonad 27 DISCUSSION AND GENERAL CONSIDERATION 27 Formation of the Kidney .... 27 The Pronephros 31 The Mesonephros 35 The Metanephros 38 The Ureter 39 The Urogenital Sinus 4.0 The Mullerian Duot 40 The Gonad 41 1 iii TABLE OF CONTENTS The Genital Ridge Stage 41 The Indifferent Stage , 41 The Determining Stage, The Testes . 42 The Ovary 42 SUMMARI , 42 ACKNOWLEDGMENTS 46 LITERATURE CITED 47 APJENDEC 51 j INTRODUCTION AND REVIEW OF LITERATURE Nephrogenesis has been adequately described in only a few mammals, Buchanan and Fraser (1918), Fraser (1920), and MoCrady (1938) studied nephrogenesis in marsupials. Keibel (1903) reported on studies on Echidna Van der Strioht (1913) on the batj Torrey (1943) on the rat; and Bonnet (1888) and Davles and Davies (1950) on the sheep.
    [Show full text]
  • HOX D13 Expression Across 79 Tumor Tissue Types
    Int. J. Cancer: 125, 1532–1541 (2009) ' 2009 UICC HOX D13 expression across 79 tumor tissue types Monica Cantile1,3, Renato Franco3, Adrienne Tschan2, Daniel Baumhoer2, Inti Zlobec2, Giulia Schiavo2, Iris Forte3, Michel Bihl2, Giuseppina Liguori3, Gerardo Botti3, Luigi Tornillo2, Eva Karamitopoulou-Diamantis4, Luigi Terracciano2,5 and Clemente Cillo1,2* 1Department of Clinical & Experimental Medicine, Federico II University Medical School, Naples, Italy 2Molecular Pathology Department, Institute of Pathology, University of Basel, Basel, Switzerland 3Surgical Pathology Department, National Cancer Institute ‘‘G.Pascale,’’ Naples, Italy 4Second Department of Pathology, University of Athens, Athens, Greece 5Health Science Department, University of Molise, Italy HOX genes control normal development, primary cellular proc- (CREB1, CREB2, Neuro D1) lying several hundred kilobases from esses and are characterized by a unique genomic network organi- one another.18 zation. Locus D HOX genes play an important role in limb genera- The most posterior located HOXD gene, HOXD13, was the first tion and mesenchymal condensation. Dysregulated HOXD13 19 expression has been detected in breast cancer, melanoma, cervical HOX gene to be described as mutated in human synpolidactyly. During normal morphogenesis, HOXD13 is involved in the deter- cancer and astrocytomas. We have investigated the epidemiology 20–22 of HOXD13 expression in human tissues and its potential deregu- mination of the terminal digestive and urogenital tracts. lation in the carcinogenesis of specific tumors. HOXD13 homeo- HOXD13 deregulation has been further detected in different tumor protein expression has been detected using microarray technology types, such as breast cancer, melanoma, cervical cancer and atroc- comprising more than 4,000 normal and neoplastic tissue samples ytomas,23–26 and in the neuro-endocrine differentiation of human including 79 different tumor categories.
    [Show full text]
  • A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
    Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.
    [Show full text]
  • Cranial Cavitry
    Embryology Endo, Energy, and Repro 2017-2018 EMBRYOLOGY OF THE REPRODUCTIVE SYSTEM Janine Prange-Kiel, Ph.D. Office: L1.106, Phone: 83117 Email: [email protected] LEARNING OBJECTIVES: • Name the structures in kidney development that contribute to the development of the reproductive organs. • Predict how the presence or absence of the Y chromosome and the expression of the SRY gene would influence the development of the gonads. • Predict how the presence or absence of testosterone, dihydrotestosterone, and anit- Mullerian hormone would influence the development of the genital ducts and indifferent primordia of the external genitalia. I. Introduction In general, the function of the genital (reproductive) system in males and females is the formation, nurture, and transport of germ cells. In females, an additional function is to provide the proper milieu for the fetal development after conception. Like the urinary system, the genital system derives from intermediate mesoderm. The development of these two systems is tightly interwoven as structures that develop as parts of the urinary system gain function in the genital system. In the adult, the sexual organs differ between males and females. The early genital system, however, is similar in both sexes, and the sexual differentiation of this initially indifferent, bipotential system starts only in the seventh week of embryonic development. The details on how sexual differentiation is determined will be discussed below, but it is worth mentioning here that irregularities in this process result in disorders of sexual differentiation (DSDs). DSDs occur in approximately 1 in 4,500 live births and will be discussed in a separate lecture.
    [Show full text]
  • Short Communication Clinical and Pathological
    Reprod Dom Anim 45, 368–372 (2010); doi: 10.1111/j.1439-0531.2009.01495.x ISSN 0936-6768 Short Communication Clinical and Pathological Findings of a Sac-like Formation in the Tunica Vaginalis of a Nelore (Bos indicus) Bull J Chaco´n1 and A Berrocal2,* 1Section of Andrology, Research Program on Applied Animal Andrology; 2Department of Pathology, School of Veterinary Medicine, Universidad, Nacional (UNA), Heredia, Costa Rica Contents and abnormalities in the ejaculate compared with A seven-month-old purebred Nelore calf was diagnosed with a normal bulls (Chaco´n et al. 1999; Chaco´n 2001). bilateral finger-shaped swelling although more prominent at Regarding the tunica vaginalis in the bull, abnormal- the left side of the scrotum, located longitudinal and parallel to ities reported in this serosa are mainly limited to epididymis corpus. The finding was present from 7 months of conditions such as hydrocele and adherences within age up to castration (performed at 25 months of age). Scrotal tunica layers secondary to orchitis. Blom and Christen- circumference, testicular and epididymis consistency and sen (1958) described also the presence of cyst like symmetry as well as seminal quality were normal during the formations (paradidymis), in the funiculus spermaticus follow-up period. The ultrasonographic appearance of the scrotal wall, pampiniform plexus, gonad and epididymis was (mesorchium), presumable derived from remnants of the normal. However, an anechoic region surrounded by a wall mesonephric duct. It is unknown that sac-like forma- forming a sac-like structure with a blind end at its dorsal pole tions in the tunica vaginalis of the bull or any other was seen on the swelling area.
    [Show full text]