DOCSLIB.ORG

Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 3, 2018 CONTENTS

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 3, 2018 CONTENTS Journal of Blood Group Serology and Molecular Genetics VOLUME 34, N UMBER 3, 2018 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 3, 2018 CONTENTS R EVIEW 85 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology, Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, September 2, 2016, Dubai Clinical significance of antibodies to antigens in the Raph, John Milton Hagen, I, Globoside, Gill, Rh-associated glycoprotein, FORS, JR, LAN, Vel, CD59, and Augustine blood group systems M. Moghaddam and A.A. Naghi S E R OLOGIC M ETHOD R EVIEW 91 Rouleaux and saline replacement K.L. Waider O R IGINAL R EPO R T 93 Method-specific and unexplained reactivity in automated solid- phase testing and their association with specific antibodies M.E. Harach, J.M. Gould, R.P. Brown, T. Sanders and J.H. Herman S E R OLOGIC M ETHOD R EVIEW 98 Utility of chloroquine diphosphate in the blood bank laboratory T. Aye and P.A. Arndt R EVIEW 103 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology, Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai Clinical significance of antibodies to antigens in the Scianna, Dombrock, Colton, Landsteiner-Weiner, Chido/Rodgers, H, Kx, Cromer, Gerbich, Knops, Indian, and Ok blood group systems S. Lejon Crottet C A S E R EPO R T 109 A delayed and acute hemolytic transfusion reaction mediated by an anti-c in a patient with variant RH alleles T.K. Walters and T. Lightfoot S E R OLOGIC M ETHOD R EVIEW 113 Detecting polyagglutinable red blood cells C. Melland and C. Hintz I N M E M O R IA M 118 Marjory Stroup Walters J. Hegarty and T.S. Casina 120 127 131 134 A NNOUNCE M ENT S A DVE R TI S E M ENT S I N S T R UCTION S S UB S C R IPTION FO R A UTHO rs I NFO rm AT I O N E DITO R - IN -C HIEF E DITO R IAL B OA R D Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Geralyn M. Meny, MD Pomona, California San Antonio, Texas M ANAGING E DITO R Cynthia Flickinger, MT(ASCP)SBB Barbara J. Bryant, MD Paul M. Ness, MD Wilmington, Delaware Galveston, Texas Baltimore, Maryland Lilian M. Castilho, PhD Thierry Peyrard, PharmD, PhD TECHNICAL E DITO rs Campinas, Brazil Paris, France Janis R. Hamilton, MS, MT(ASCP)SBB Detroit, Michigan Martha R. Combs, MT(ASCP)SBB S. Gerald Sandler, MD Durham, North Carolina Washington, District of Columbia Christine Lomas-Francis, MSc New York City, New York Geoffrey Daniels, PhD Ira A. Shulman, MD Bristol, United Kingdom Los Angeles, California Joyce Poole, FIBMS Bristol, United Kingdom Anne F. Eder, MD Jill R. Storry, PhD Washington, District of Columbia Lund, Sweden Dawn M. Rumsey, ART(CSMLT) Norcross, Georgia Melissa R. George, DO, FCAP Nicole Thornton Hershey, Pennsylvania Bristol, United Kingdom Tiffany Walters, MT(ASCP)SBBCM Julie K. Karp, MD Charlotte, North Carolina Philadelphia, Pennsylvania E M E R ITU S E DITO rs S ENIO R M EDICAL E DITO R Jose Lima, MD Delores Mallory, MT(ASCP)SBB David Moolten, MD Douglassville, Georgia Supply, North Carolina Philadelphia, Pennsylvania Christine Lomas-Francis, MSc Marion E. Reid, PhD, FIBMS A ss O C I AT E M EDICAL E DITO rs New York City, New York Bristol, United Kingdom P. Dayand Borge, MD Philadelphia, Pennsylvania Corinne L. Goldberg, MD Durham, North Carolina M OLECULA R E DITO R Margaret A. Keller, PhD Immunohematology is published quarterly (March, June, September, and December) by the Philadelphia, Pennsylvania American Red Cross, National Headquarters, Washington, DC 20006. Immunohematology is indexed and included in Index Medicus and MEDLINE on the E DITO R IAL A ss I S TA N T MEDLARS system. The contents are also cited in the EBASE/Excerpta Medica and Elsevier Linda Frazier BIOBASE/Current Awareness in Biological Sciences (CABS) databases. P R ODUCTION A ss I S TA N T The subscription price is $50 for individual, $100 for institution (U.S.), and Linda Frazier $60 for individual, $100 for institution (foreign), per year. Subscriptions, Change of Address, and Extra Copies: C OPY E DITO R Frederique Courard-Houri Immunohematology, P.O. Box 40325 Philadelphia, PA 19106 P R OOF R EADE R Or call (215) 451-4902 Wendy Martin-Shuma Web site: www.redcrossblood.org/hospitals/immunohematology E LECT R ONIC P UBLI S HE R Copyright 2018 by The American National Red Cross Paul Duquette ISSN 0894-203X O N O U R C OVE R Perhaps Gustav Klimt’s best-known work, The Kiss (1907), dazzlingly melds the sensual with the abstract. The painting depicts a man and woman intertwined, he standing, bowed, while she kneels on an idealized quilt-like meadow of flowers. Their proximity to the top of the painting heightens the sense of intimacy and also suggests the possibility of transcending worldly constraints. We see little of the lovers—the back of his head, her face, their hands and feet, simply rendered but wrapped in golden raiment decorated with distinct mosaics. The man’s figure is comprised of juxtaposed rectangles and the woman’s of clustered circles, a geometry that hints at both the contrast and complement of their union. Despite its shapelessness, the gilded mass of clothing serves to intensify and exalt the physical act of the kiss and thus consecrates the couple and love itself. This issue includes Waider’s review on the use of saline replacement to identify rouleaux—the stacked coin appearance of the red cells likened to “clustered circles.” David Moolten, MD ii IMMUNOHEMATOLOGY, Volume 34, Number 3, 2018 R EVIEW Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology, Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, September 2, 2016, Dubai Clinical significance of antibodies to antigens in the Raph, John Milton Hagen, I, Globoside, Gill, Rh-associated glycoprotein, FORS, JR, LAN, Vel, CD59, and Augustine blood group systems M. Moghaddam and A.A. Naghi This article reviews information on the clinical significance and 6 shared missense mutation c.511C>T (p.Argl71Cys) as of antibodies to antigens in the Raph, John Milton Hagen, I, well as a synonymous single-nucleotide mutation (c.579A>G) Globoside, Gill, Rh-associated glycoprotein, FORS, JR, LAN, Vel, and had no clinical features. Although the CD151 protein is CD59, and Augustine blood group systems. Antibodies to many of the antigens in these groups are rarely encountered because of the critical to cell adhesion and signaling and is implicated in high prevalence of the associated antigens in most populations. cancer progression, its significance in transfusion medicine is For many of these antibodies, the clinical significance—that is, limited to only one report of a hemolytic transfusion reaction the potential to cause reduced survival of transfused antigen- 3 positive red blood cells or a transfusion reaction (e.g., anti-P, (HTR). Least-incompatible RBC units should be selected anti-Jra, and anti-Lan), and/or hemolytic disease of the fetus and for transfusion to patients with anti-MER2.2 No information newborn (e.g., anti-RHAG4 and anti-Vel)—has been documented. on anti-MER2 causing hemolytic disease of the fetus and For other antibodies, their prevalence is so rare that information newborn (HDFN) is available.4 on the clinical significance of their antibodies is not available (e.g., anti-FORS1). Immunohematology 2018;34:85–90. John Milton Hagen Blood Group System Key Words: clinical significance, antibodies to red blood cell antigens, Raph, John Milton Hagen, I, Globoside, Gill, Rh- The John Milton Hagen (JMH) blood group system associated glycoprotein, FORS, JR, LAN, Vel, CD59, Augustine consists of six high-prevalence antigens that are recognized by the International Society of Blood Transfusion (ISBT) and are Raph Blood Group System numbered sequentially from JMH1 through JMH6. Confirmed JMH variants are named with the first letter from the antibody The Raph blood group system contains just one maker’s first name following JMH (JMH2 named JMHK, antigen, MER2 (RAPH1), located on the tetraspanin CD151 JMH3 named JMHL, JMH4 named JMHG, JMH5 named glycoprotein (TM4SF).1,2 The true MER2– phenotype, JMHM, JMH6 named JMHQ).5 These antigens are located on associated with the presence of anti-MER2, is very rare and the Sema7A protein.5,6 The chromosomal location of SEMA7A results from mutations in CD151, but there is a quantitative is 15q22.3-q23. JMH1 is the primary antigen in the system red blood cell (RBC) polymorphism in which RBCs of about 8 and is present in greater than 99 percent of all individuals. The percent of white individuals are serologically MER2–.2 JMH1– phenotype is more commonly acquired by depression of the antigen. This finding might explain the serologic Clinical Significance observation of a positive direct antiglobulin test (DAT) seen in There have been six reports of human alloantibodies to many individuals with anti-JMH.5 MER2. Three of the subjects were found to have a stop codon in the CD151 gene, which encodes a member of the tetraspanin Clinical Significance family of proteins. These three individuals had nephropathy and JMH1, commonly known as JMH, is most notable because deafness, and two of the three, who were siblings, also had skin transient depression of the antigen occurs, and (auto)anti-JMH lesions, deafness, and β-thalassemia minor.
Load more

Recommended publications
  • Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock
    Review: other blood group systems—Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner- Wiener, and Indian K.M. B YRNE AND P.C. B YRNE Introduction Diego Blood Group System This review was prepared to provide a basic The Diego blood group system (ISBT: DI/010) has overview of “Other Blood Groups.” Some of the more expanded from its humble beginnings to now include major blood group systems, i.e., ABO, Rh, Kell, Duffy, up to 21 discrete antigens (Table 1). 3 Band 3, an anion and Kidd, are also reviewed in this issue and are not exchange, multi-pass membrane glycoprotein, is the covered here. The sheer mass of data on the MNS basic structure that carries the Diego system antigenic blood group system is so extensive and complicated determinants. 4 The gene that encodes the Band 3 that it justifies a review all of its own, and it is therefore protein is named SLC4A1 and its chromosomal location not discussed in this article. However, various aspects is 17q12–q21. 4 of MNS were described in recent papers in Di a and Di b are antithetical, resulting from a single Immunohematology. 1,2 nucleotide substitution (2561T>C) that gives rise to The blood group systems that are covered are those amino acid changes in the Band 3 protein (Leu854Pro). that most workers believe to have some degree of To date, the Di(a–b–) phenotype has not been clinical importance or interesting features: Diego (DI), described. The Di a and Di b antigens are resistant to Yt (YT), Xg (XG), Scianna (SC), Dombrock (DO), Colton treatment with the following enzymes/chemicals: (CO), Landsteiner-Wiener (LW), and Indian (IN).
    [Show full text]
  • Requirements for Blood and Blood Components Intended for Transfusion Or for Further Manufacturing Use
    Requirements for Blood and Blood Components Intended for Transfusion or for Further Manufacturing Use Office of Blood Research and Review CBER, FDA Ask the FDA Session – AABB Annual Meeting October 26, 2015 1 Outline • Overview – Historical Background – Intent of the Rule – Organization of the Rule • Selected Provisions – Relevant Transfusion-Transmitted Infection – Control of Bacterial Contamination of Platelets – Medical Supervision – Donor Acknowledgement – Alternative Procedures – Donor Eligibility • Implementation 2 GAO Oversight and FDA Concerns • Publish in the form of regulations the guidelines that FDA deems essential to ensure the safety of the blood supply • Concern about the delay in requiring testing for emerging infectious agents, e.g. HTLV • Concern about blood safety and the regulations being out-of-date • Concerns about donor safety 3 Intent of the Final Rule • To better assure the safety of the blood supply and to help protect donor health • To make donor eligibility and testing requirements more consistent with current practices and to provide flexibility with regard to emerging infectious diseases • To accommodate technological advances • To establish requirements for donor education, donor history, and donor testing 4 Organization of the Final Rule - 1 • A. General • B. Definitions (§§ 606.3, 610.39, 630.3, 640.125) • C. Standard Operating Procedures (§ 606.100) • D. Control of Bacterial Contamination of Platelets (§ 606.145) • E. Records (§ 606.160) • F. Test Requirements (§§ 610.40, 640.5, 640.71(a)) • G. Donor Deferral (§ 610.41) 5 Organization of the Final Rule - 2 • H. Purpose and Scope (§ 630.1) • I. Medical Supervision (§ 630.5) • J. General Donor Eligibility Requirements(§ 630.10) • K. Donor Eligibility Requirements Specific to Whole Blood, Red Blood Cells and Plasma Collected by Apheresis (§ 630.15) • L.
    [Show full text]
  • 27. Clinical Indications for Cryoprecipitate And
    27. CLINICAL INDICATIONS FOR CRYOPRECIPITATE AND FIBRINOGEN CONCENTRATE Cryoprecipitate is indicated in the treatment of fibrinogen deficiency or dysfibrinogenaemia.1 Fibrinogen concentrate is licenced for the treatment of acute bleeding episodes in patients with congenital fibrinogen deficiency, including afibrinogenaemia and hypofibrinogenaemia,2 and is currently funded under the National Blood Agreement. Key messages y Fibrinogen is an essential component of the coagulation system, due to its role in initial platelet aggregation and formation of a stable fibrin clot.3 y The decision to transfuse cryoprecipitate or fibrinogen concentrate to an individual patient should take into account the relative risks and benefits.3 y The routine use of cryoprecipitate or fibrinogen concentrate is not advised in medical or critically ill patients.2,4 y Cryoprecipitate or fibrinogen concentrate may be indicated in critical bleeding if fibrinogen levels are not maintained using FFP. In the setting of major obstetric haemorrhage, early administration of cryoprecipitate or fibrinogen concentrate may be necessary.3 Clinical implications y The routine use of cryoprecipitate or fibrinogen concentrate in medical or critically ill patients with coagulopathy is not advised. The underlying causes of coagulopathy should be identified; where transfusion is considered necessary, the risks and benefits should be considered for each patient. Specialist opinion is advised for the management of disseminated intravascular coagulopathy (MED-PP18, CC-PP7).2,4 y Cryoprecipitate or fibrinogen concentrate may be indicated in critical bleeding if fibrinogen levels are not maintained using FFP. In patients with critical bleeding requiring massive transfusion, suggested doses of blood components is 3-4g (CBMT-PP10)3 in adults or as per the local Massive Transfusion Protocol.
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Role of C5ar1 and C5L2 Receptors in Ischemia-Reperfusion Injury
    Journal of Clinical Medicine Article Role of C5aR1 and C5L2 Receptors in Ischemia-Reperfusion Injury Carlos Arias-Cabrales 1,* , Eva Rodriguez-Garcia 1, Javier Gimeno 2, David Benito 3, María José Pérez-Sáez 1, Dolores Redondo-Pachón 1, Anna Buxeda 1, Carla Burballa 1, Marta Crespo 1, Marta Riera 3,* and Julio Pascual 1,* 1 Department of Nephrology, Parc de Salut Mar, 08003 Barcelona, Spain; [email protected] (E.R.-G.); [email protected] (M.J.P.-S.); [email protected] (D.R.-P.); [email protected] (A.B.); [email protected] (C.B.); [email protected] (M.C.) 2 Department of Pathology, Parc de Salut Mar, 08003 Barcelona, Spain; [email protected] 3 Kidney Research Group, Hospital del Mar Medical Research Institute, IMIM, 08003 Barcelona, Spain; [email protected] * Correspondence: [email protected] (C.A.-C.); [email protected] (M.R.); [email protected] (J.P.) Abstract: The role of C5a receptors (C5aR1 and C5L2) in renal ischemia-reperfusion injury (IRI) is uncertain. We generated an in vitro model of hypoxia/reoxygenation with human proximal tubule epithelial cells to mimic some IRI events. C5aR1, membrane attack complex (MAC) and factor H (FH) deposits were evaluated with immunofluorescence. Quantitative polymerase chain reaction evaluated the expression of C5aR1, C5L2 genes as well as genes related to tubular injury, inflammation, and profibrotic pathways. Additionally, C5aR1 and C5L2 deposits were evaluated in kidney graft biopsies (KB) from transplant patients with delayed graft function (DGF, n = 12) and compared with Citation: Arias-Cabrales, C.; a control group (n = 8). We observed higher immunofluorescence expression of C5aR1, MAC and FH Rodriguez-Garcia, E.; Gimeno, J.; as higher expression of genes related to tubular injury, inflammatory and profibrotic pathways and Benito, D.; Pérez-Sáez, M.J.; of C5aR1 in the hypoxic cells; whereas, C5L2 gene expression was unaffected by the hypoxic stimulus.
    [Show full text]
  • The Membrane Complement Regulatory Protein CD59 and Its Association with Rheumatoid Arthritis and Systemic Lupus Erythematosus
    Current Medicine Research and Practice 9 (2019) 182e188 Contents lists available at ScienceDirect Current Medicine Research and Practice journal homepage: www.elsevier.com/locate/cmrp Review Article The membrane complement regulatory protein CD59 and its association with rheumatoid arthritis and systemic lupus erythematosus * Nibhriti Das a, Devyani Anand a, Bintili Biswas b, Deepa Kumari c, Monika Gandhi c, a Department of Biochemistry, All India Institute of Medical Sciences, New Delhi 110029, India b Department of Zoology, Ramjas College, University of Delhi, India c University School of Biotechnology, Guru Gobind Singh Indraprastha University, India article info abstract Article history: The complement cascade consisting of about 50 soluble and cell surface proteins is activated in auto- Received 8 May 2019 immune inflammatory disorders. This contributes to the pathological manifestations in these diseases. In Accepted 30 July 2019 normal health, the soluble and membrane complement regulatory proteins protect the host against Available online 5 August 2019 complement-mediated self-tissue injury by controlling the extent of complement activation within the desired limits for the host's benefit. CD59 is a membrane complement regulatory protein that inhibits the Keywords: formation of the terminal complement complex or membrane attack complex (C5b6789n) which is CD59 generated on complement activation by any of the three pathways, namely, the classical, alternative, and RA SLE the mannose-binding lectin pathway. Animal experiments and human studies have suggested impor- Pathophysiology tance of membrane complement proteins including CD59 in the pathophysiology of rheumatoid arthritis Disease marker (RA) and systemic lupus erythematosus (SLE). Here is a brief review on CD59 and its distribution, structure, functions, and association with RA and SLE starting with a brief introduction on the com- plement system, its activation, the biological functions, and relations of membrane complement regu- latory proteins, especially CD59, with RA and SLE.
    [Show full text]
  • Genetic Screening for the Vel- Phenotype Circumvents Difficult Serological Screening Due to Variable Vel Expression Levels
    UvA-DARE (Digital Academic Repository) Genetic basis of rare blood group variants Wigman, L. Publication date 2013 Link to publication Citation for published version (APA): Wigman, L. (2013). Genetic basis of rare blood group variants. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:28 Sep 2021 Chapter 6 Genetic screening for the Vel- phenotype circumvents difficult serological screening due to variable Vel expression levels Lonneke Haer-Wigman1 Shabnam Solati1 Aïcha Ait Soussan1 Erik Beckers2 Pim van der Harst3 Marga van Hulst-Sundermeijer4 Peter Ligthart1 Dick van Rhenen5 Hein Schepers3 Tamara Stegmann1 Masja de Haas1 C. Ellen van der Schoot1 1 Sanquin Research, Amsterdam and Landsteiner Laboratory, Academic Medical Centre, University of Amsterdam, Amsterdam, the Netherlands 2 Maastricht University Medical Centre+, Maastricht, The Netherlands 3 University Medical Center Groningen, University of Groningen, Groningen, The Netherlands 4 Sanquin Diagnostic Services, Amsterdam, The Netherlands 5 Sanquin Blood Bank, Rotterdam, Netherlands Manuscript under preparation Chapter 6 Abstract Background: Serological determination of the Vel- phenotype is challenging due to variable Vel expression levels.
    [Show full text]
  • Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS
    Journal of Blood Group Serology and Molecular Genetics VOLUME 34, N UMBER 1, 2018 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS S EROLOGIC M ETHOD R EVIEW 1 Warm autoadsorption using ZZAP F.M. Tsimba-Chitsva, A. Caballero, and B. Svatora R EVIEW 4 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A brief overview of clinical significance of blood group antibodies M.J. Gandhi, D.M. Strong, B.I. Whitaker, and E. Petrisli C A S E R EPORT 7 Management of pregnancy sensitized with anti-Inb with monocyte monolayer assay and maternal blood donation R. Shree, K.K. Ma, L.S. Er and M. Delaney R EVIEW 11 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A review of in vitro methods to predict the clinical significance of red blood cell alloantibodies S.J. Nance S EROLOGIC M ETHOD R EVIEW 16 Recovery of autologous sickle cells by hypotonic wash E. Wilson, K. Kezeor, and M. Crosby TO THE E DITOR 19 The devil is in the details: retention of recipient group A type 5 years after a successful allogeneic bone marrow transplant from a group O donor L.L.W.
    [Show full text]
  • Genes and Human History
    Genes and human history Gil McVean, Department of Statistics, Oxford Contact: [email protected] 2 3 • Where does the variation come from? • How old are the genetic differences between us? • Are these differences important? How different are our genomes? 5 Serological techniques for detecting variation Rabbit Anti-A antibodies Human A A B AB O 6 Blood group systems in humans • 28 known systems – 39 genes, 643 alleles System Genes Alleles Knops CR1 24+ ABO ABO 102 Landsteiner- ICAM4 3 Wiener Colton C4A, C4B 7+ Lewis FUT3, FUT6 14/20 Chido-rodgers AQP1 7 Lutheran LU 16 Colton DAF 10 MNS GYPA,GYPB,G 43 Diego SLC4A1 78 YPE Dombrock DO 9 OK BSG 2 Duffy FY 9 P-related A4GALT, 14/5 Gerbich GYPC 9 B3GALT3 GIL AQP3 2 RAPH-MER2 CD151 3 H/h FUT1, FUT2 27/22 Rh RHCE, RHD, 129 I GCNT2 7 RHAG Indian CD44 2 Scianna ERMAP 4 Kell KEL, XK 33/30 Xg XG, CD99 - Kidd SLC14A1 8 YT ACHE 4 http://www.bioc.aecom.yu.edu/bgmut/summary.htm 7 Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected Starch or agar gel -- +- + +- - - - -- - + - + +- -- Direction of travel • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Lewontin and Hubby (1966) Harris(1966) 8 The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCC CGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGT GAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATAT AAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCT
    [Show full text]
  • Changes to the Technical Manual, 18Th Edition Monday, November 17, 2014 12:00 P.M
    Changes to the Technical Manual, 18th Edition Monday, November 17, 2014 12:00 p.m. – 1:30 p.m. (ET) / 5:00p.m. – 6:30 p.m. (GMT) When this file is opened, Acrobat Reader will, by default, display the slides including the Acrobat reader controls. To return to full screen mode, hit Ctrl-L on your computer keyboard or use your mouse to click View>Full Screen on the menu bar of the Acrobat Reader program. To take the slides out of full screen mode and display the Acrobat Reader controls, simply hit the Esc key on your computer keyboard. To advance slides during the program, use the Enter, Page Down, down arrow or right arrow on your computer keyboard. To back up slides during the program, use the Page Up, up arrow of left arrow on your computer keyboard. Please remember to logon to the Live Learning Center using your email address and password to complete an evaluation of the program and speakers. At this time, advance to the next slide and wait for the audioconference to begin. A 2014 Audioconference presented to you by AABB The AABB Technical Manual 18th Edition What’s new? www.aabb.org Technical Manual by the Numbers • 1953 =year of first edition • 69 = number of authors/editors this edition • 370,378 = word count • 96 = number of methods • 60 = number of countries where TM is used www.aabb.org It’s a Process www.aabb.org Overview of Changes Major • Molecular testing • Patient blood management • Cellular therapy • Methods Minor • Throughout www.aabb.org 1: Quality Systems 2: Facilities and Safety • These 2 chapters are comprehensive discussions
    [Show full text]
  • Blood Bank I D
    The Osler Institute Blood Bank I D. Joe Chaffin, MD Bonfils Blood Center, Denver, CO The Fun Just Never Ends… A. Blood Bank I • Blood Groups B. Blood Bank II • Blood Donation and Autologous Blood • Pretransfusion Testing C. Blood Bank III • Component Therapy D. Blood Bank IV • Transfusion Complications * Noninfectious (Transfusion Reactions) * Infectious (Transfusion-transmitted Diseases) E. Blood Bank V (not discussed today but available at www.bbguy.org) • Hematopoietic Progenitor Cell Transplantation F. Blood Bank Practical • Management of specific clinical situations • Calculations, Antibody ID and no-pressure sample questions Blood Bank I Blood Groups I. Basic Antigen-Antibody Testing A. Basic Red Cell-Antibody Interactions 1. Agglutination a. Clumping of red cells due to antibody coating b. Main reaction we look for in Blood Banking c. Two stages: 1) Coating of cells (“sensitization”) a) Affected by antibody specificity, electrostatic RBC charge, temperature, amounts of antigen and antibody b) Low Ionic Strength Saline (LISS) decreases repulsive charges between RBCs; tends to enhance cold antibodies and autoantibodies c) Polyethylene glycol (PEG) excludes H2O, tends to enhance warm antibodies and autoantibodies. 2) Formation of bridges a) Lattice structure formed by antibodies and RBCs b) IgG isn’t good at this; one antibody arm must attach to one cell and other arm to the other cell. c) IgM is better because of its pentameric structure. P}Chaffin (12/28/11) Blood Bank I page 1 Pathology Review Course 2. Hemolysis a. Direct lysis of a red cell due to antibody coating b. Uncommon, but equal to agglutination. 1) Requires complement fixation 2) IgM antibodies do this better than IgG.
    [Show full text]
  • Immuno 2014 No. 1
    Journal of Blood Group Serology and Molecular Genetics VOLUME 30, N UMBER 1, 2014 Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 30, Number 1, 2014 CONTENTS R EPORT 1 Indirect antiglobulin test-crossmatch using low-ionic-strength saline–albumin enhancement medium and reduced incubation time: effectiveness in the detection of most clinically significant antibodies and impact on blood utilization C.L. Dinardo, S.L. Bonifácio, and A. Mendrone, Jr. R EV I EW 6 Raph blood group system M. Hayes R EPORT 11 I-int phenotype among three individuals of a Parsi community from Mumbai, India S.R. Joshi C A SE R EPORT 14 Evans syndrome in a pediatric liver transplant recipient with an autoantibody with apparent specificity for the KEL4 (Kpb) antigen S.A. Koepsell, K. Burright-Hittner, and J.D. Landmark R EV I EW 18 JMH blood group system: a review S.T. Johnson R EPORT 24 Demonstration of IgG subclass (IgG1 and IgG3) in patients with positive direct antiglobulin tests A. Singh, A. Solanki, and R. Chaudhary I N M EMOR ia M 28 George Garratty, 1935–2014 Patricia A. Arndt and Regina M. Leger 30 A NNOUNCEMENTS 34 A DVERT I SEMENTS 39 I NSTRUCT I ONS FOR A UTHORS E D I TOR - I N -C H I EF E D I TOR ia L B OA RD Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Paul M. Ness, MD Pomona, California Baltimore, Maryland M A N AG I NG E D I TOR James P.
    [Show full text]