Multi-Scale Analysis and Clustering of Co-Expression Networks

Total Page:16

File Type:pdf, Size:1020Kb

Multi-Scale Analysis and Clustering of Co-Expression Networks Multi-scale analysis and clustering of co-expression networks Nuno R. Nen´e∗1 1Department of Genetics, University of Cambridge, Cambridge, UK September 14, 2018 Abstract 1 Introduction The increasing capacity of high-throughput genomic With the advent of technologies allowing the collec- technologies for generating time-course data has tion of time-series in cell biology, the rich structure stimulated a rich debate on the most appropriate of the paths that cells take in expression space be- methods to highlight crucial aspects of data struc- came amenable to processing. Several methodologies ture. In this work, we address the problem of sparse have been crucial to carefully organize the wealth of co-expression network representation of several time- information generated by experiments [1], including course stress responses in Saccharomyces cerevisiae. network-based approaches which constitute an excel- We quantify the information preserved from the origi- lent and flexible option for systems-level understand- nal datasets under a graph-theoretical framework and ing [1,2,3]. The use of graphs for expression anal- evaluate how cross-stress features can be identified. ysis is inherently an attractive proposition for rea- This is performed both from a node and a network sons related to sparsity, which simplifies the cumber- community organization point of view. Cluster anal- some analysis of large datasets, in addition to being ysis, here viewed as a problem of network partition- mathematically convenient (see examples in Fig.1). ing, is achieved under state-of-the-art algorithms re- The properties of co-expression networks might re- lying on the properties of stochastic processes on the veal a myriad of aspects pertaining to the impact of constructed graphs. Relative performance with re- genes [2], as well as group features, such as struc- spect to a metric-free Bayesian clustering analysis is tural clusters or communities, highlighting similar evaluated and possible extensions are discussed. We expression profiles. The structure of co-expression further cluster the stress-induced co-expression net- networks can also be compared with other types of works generated independently by using their com- networks, e.g. protein-protein interaction, genetic arXiv:1703.02872v2 [q-bio.QM] 2 Dec 2017 munity organization at multiple scales. This type of interaction or gene regulatory, by using simple and protocol allows for integration of multiple datasets scalable graph-theoretical methods such as the one that may not be immediately comparable, either due explored here. Additionally, the use of graphs may to diverse experimental variations or because they also help to shed light on the evolutionary differences represent different types of information about the or commonalities between cellular responses across same genes. species [4,5,6]. Clustering methodologies have been an invaluable tool in unravelling the structure of time-course data ∗[email protected], [email protected] [1,7]. Either by using standard approaches rely- 1 Figure 1: Co-expression networks for a selection of stresses for two dissimilarity functions. HS25 − 37: heat- shock from a temperature of 25◦C to 37◦C. HS29−33(I): mild heat-shock from 29◦C to 33◦C. Hyper−OS: hyper-osmotic stress. These networks were plotted via a standard spatial embedding force-based algorithm available in Gephi. See Methods for details. ing on cosine dissimilarities and hierarchical clus- ficient to eliminate possible inconsistencies between tering [8,9] or by adopting a Bayesian framework datasets. Here, we will resort to a graph-theoretical without choosing a priori a particular distance func- based protocol that is able to avoid the pitfalls of ex- tion [10, 11, 12, 13], most of the techniques rely on perimental variation. This protocol is based on ideas the assumption that the necessary standardization related to community detection on graphs [14, 15], methods that precede the clustering analysis are suf- which makes it possible to address the character- 2 ization of expression dynamics with methods that [23, 24]. take into account multi-level organization informa- The paper is organized as follows: we initially tion. Overall, the method explores aspects of proba- quantify how much information the network con- bility flow and containment across a network [16, 17]. struction algorithm used in our work retains from Although several other algorithms that rely on sim- the whole set of selected genes, under different co- ilar principles are available, the one we test here is expression metrics (section 2.1.1); this is achieved by very fast. This makes the analysis of large datasets evaluating both structural and diffusion properties of such as those used in the present work a feasible task. each network; following this analysis the constructed In conjunction with this approach, we also resort to networks serve as the basis for the study of diffusion methodologies stemming from the field of non-linear patterns across its structures, at different time-scales, dimensionality reduction. The additional treatment with the intent of identifying clusters of similar time- has the objective of successfully identifying relation- dependent behaviour (section 2.2); finally, all the ships between genes that better represent the under- partition solutions identified for each stress are clus- lying high-dimensional geometry of the data [18] and, tered once again, with respect to other stresses, by naturally, create sparse and manageable datasets. taking into account the geometry in partition space We test the protocol with two dissimilarity functions (section 2.3). This sequential analysis allowed us capturing different features of the expression dynam- to compare how genes are clustered across stresses ics. Each leads to differentiated network representa- and ultimately to identify a joint clustering solution. tions of the same patterns. This allow us to verify if We also compare the multi-resolution organization of additional information improves performance of the all the co-expression networks with those of protein- protocol under different metrics. protein and genetic interaction networks (section S8) The data used in this work is a compendium extracted from BioGRID (http : ==thebiogrid:org). of stress-induced expression microarrays for This overall analysis, under the graph-theoretical S.cerevisiae, originally published by Gasch and paradigm, leads to efficient multi-dataset integration. co-workers [8]. We chose this dataset due to the The work-flow underlying the protocol explored here variety of stresses applied and the fact that it is still is presented in Fig.7. one of the biggest datasets for time-course data, in addition to being a benchmark for testing inference of networks in general [3, 19]. The work published in 2 Results [8] includes both single and serial stress responses, and one experiment with a combinatorial-like stress. 2.1 Identification of stress-induced co- The subject of combinatorial stress in yeasts has expression networks been further explored in more recent work (see for example [20]). A gene co-expression network is an undirected graph The results of Gasch and co-workers [8] were a sem- where nodes represent genes and edges proximity be- inal contribution to the analysis of whole-genome ex- tween expression profiles [25, 26]. It does not include pression and identified crucial features of stress re- or attempt to explicitly represent regulatory or phys- sponse in yeast. Specifically, the presence of a Com- ical interactions, but simply highlights common fea- mon or Environmental Stress Response (ESR), also tures of the data pertaining to the nodes it connects. a hallmark in several other species [5, 21, 22], was Traditionally, co-expression networks have been used extracted by hierarchical clustering analysis and pos- to determine co-expression modules or sets of genes tulated to be fundamental in equipping S.cerevisiae that exhibit similar patterns under the considered ex- to combat serial and combinatorial stress. More re- perimental conditions. Usually, the full co-expression cently, the ESR feature has been further analysed matrix under a specific dissimilarity function is used and studies have concluded that there is more struc- or a significance threshold is imposed, either under ture to the signals measured than previously expected a specific density kernel or simply ad hoc. The lat- 3 ter leads to removal of links that under the chosen time-course data and it contributes to the core group model are not significant and increases speed and of graph-based approaches that have performed very performance in the clustering step [26]. Here, we re- well when applied to time-series analysis in biology sort to a method for sparsifying co-expression matri- (see, for example, several applications in [37, 38]). ces that avoids imposing statistical thresholds to at- Unlike some of the traditional methods for manifold tain edge significance. This method has been tested identification, the RMST algorithm avoids the prob- widely across multiple datasets and provides a robust lem of under-sampling that hinders other method- starting point [18, 27]. ologies (see for example [33] where this is thoroughly Throughout this work a co-expression network will addressed). be represented by G = fV; E; W g, where V repre- In the following section we will highlight several sents the set of vertices or nodes/genes, E represents structural properties of the generated co-expression the set of edges or links between genes in matrix graphs, for both distance functions mentioned above. form, in our case determined by a particular algo- We also evaluate the information that is preserved rithm [18], and W represents the set of weights as- from the original pair-wise distance matrix between sociated with each of the edges in E, again in ma- genes. We focus our analysis on a restricted set of trix form. The network G derived for each stress genes selected by appropriate filtering methods that will represent the overall intra-stress relationships in take into account the order of events as a contributing the expression time-series matrix, g(t), for all genes factor.
Recommended publications
  • Gene Discovery and Annotation Using LCM-454 Transcriptome Sequencing Scott J
    Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Gene discovery and annotation using LCM-454 transcriptome sequencing Scott J. Emrich,1,2,6 W. Brad Barbazuk,3,6 Li Li,4 and Patrick S. Schnable1,4,5,7 1Bioinformatics and Computational Biology Graduate Program, Iowa State University, Ames, Iowa 50010, USA; 2Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50010, USA; 3Donald Danforth Plant Science Center, St. Louis, Missouri 63132, USA; 4Interdepartmental Plant Physiology Graduate Major and Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, Iowa 50010, USA; 5Department of Agronomy and Center for Plant Genomics, Iowa State University, Ames, Iowa 50010, USA 454 DNA sequencing technology achieves significant throughput relative to traditional approaches. More than 261,000 ESTs were generated by 454 Life Sciences from cDNA isolated using laser capture microdissection (LCM) from the developmentally important shoot apical meristem (SAM) of maize (Zea mays L.). This single sequencing run annotated >25,000 maize genomic sequences and also captured ∼400 expressed transcripts for which homologous sequences have not yet been identified in other species. Approximately 70% of the ESTs generated in this study had not been captured during a previous EST project conducted using a cDNA library constructed from hand-dissected apex tissue that is highly enriched for SAMs. In addition, at least 30% of the 454-ESTs do not align to any of the ∼648,000 extant maize ESTs using conservative alignment criteria. These results indicate that the combination of LCM and the deep sequencing possible with 454 technology enriches for SAM transcripts not present in current EST collections.
    [Show full text]
  • EMBL-EBI Powerpoint Presentation
    Processing data from high-throughput sequencing experiments Simon Anders Use-cases for HTS · de-novo sequencing and assembly of small genomes · transcriptome analysis (RNA-Seq, sRNA-Seq, ...) • identifying transcripted regions • expression profiling · Resequencing to find genetic polymorphisms: • SNPs, micro-indels • CNVs · ChIP-Seq, nucleosome positions, etc. · DNA methylation studies (after bisulfite treatment) · environmental sampling (metagenomics) · reading bar codes Use cases for HTS: Bioinformatics challenges Established procedures may not be suitable. New algorithms are required for · assembly · alignment · statistical tests (counting statistics) · visualization · segmentation · ... Where does Bioconductor come in? Several steps: · Processing of the images and determining of the read sequencest • typically done by core facility with software from the manufacturer of the sequencing machine · Aligning the reads to a reference genome (or assembling the reads into a new genome) • Done with community-developed stand-alone tools. · Downstream statistical analyis. • Write your own scripts with the help of Bioconductor infrastructure. Solexa standard workflow SolexaPipeline · "Firecrest": Identifying clusters ⇨ typically 15..20 mio good clusters per lane · "Bustard": Base calling ⇨ sequence for each cluster, with Phred-like scores · "Eland": Aligning to reference Firecrest output Large tab-separated text files with one row per identified cluster, specifying · lane index and tile index · x and y coordinates of cluster on tile · for each
    [Show full text]
  • An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identification and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging field of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs.
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • NGS Raw Data Analysis
    NGS raw data analysis Introduc3on to Next-Generaon Sequencing (NGS)-data Analysis Laura Riva & Maa Pelizzola Outline 1. Descrip7on of sequencing plaorms 2. Alignments, QC, file formats, data processing, and tools of general use 3. Prac7cal lesson Illumina Sequencing Single base extension with incorporaon of fluorescently labeled nucleodes Library preparaon Automated cluster genera3on DNA fragmenta3on and adapter ligaon Aachment to the flow cell Cluster generaon by bridge amplifica3on of DNA fragments Sequencing Illumina Output Quality Scores Sequence Files Comparison of some exisng plaGorms 454 Ti RocheT Illumina HiSeqTM ABI 5500 (SOLiD) 2000 Amplificaon Emulsion PCR Bridge PCR Emulsion PCR Sequencing Pyrosequencing Reversible Ligaon-based reac7on terminators sequencing Paired ends/sep Yes/3kb Yes/200 bp Yes/3 kb Read length 400 bp 100 bp 75 bp Advantages Short run 7mes. The most popular Good base call Longer reads plaorm accuracy. Good improve mapping in mulplexing repe7ve regions. capability Ability to detect large structural variaons Disadvantages High reagent cost. Higher error rates in repeat sequences The Illumina HiSeq! Stacey Gabriel Libraries, lanes, and flowcells Flowcell Lanes Illumina Each reaction produces a unique Each NGS machine processes a library of DNA fragments for single flowcell containing several sequencing. independent lanes during a single sequencing run Applications of Next-Generation Sequencing Basic data analysis concepts: • Raw data analysis= image processing and base calling • Understanding Fastq • Understanding Quality scores • Quality control and read cleaning • Alignment to the reference genome • Understanding SAM/BAM formats • Samtools • Bedtools Understanding FASTQ file format FASTQ format is a text-based format for storing a biological sequence and its corresponding quality scores.
    [Show full text]
  • Sequence Data
    Sequence Data SISG 2017 Ben Hayes and Hans Daetwyler Using sequence data in genomic selection • Generation of sequence data (Illumina) • Characteristics of sequence data • Quality control of raw sequence • Alignment to reference genomes • Variant Calling Using sequence data in genomic selection and GWAS • Motivation • Genome wide association study – Straight to causative mutation – Mapping recessives • Genomic selection (all hypotheses!) – No longer have to rely on LD, causative mutation actually in data set • Higher accuracy of prediction? • Not true for genotyping-by-sequencing – Better prediction across breeds? • Assumes same QTL segregating in both breeds • No longer have to rely on SNP-QTL associations holding across breeds – Better persistence of accuracy across generations Using sequence data in genomic selection and GWAS • Motivation • Genotype by sequencing – Low cost genotypes? – Need to understand how these are produced, potential errors/challenges in dealing with this data Technology – NextGenSequence • Over the past few years, the “Next Generation” of sequencing technologies has emerged. Roche: GS-FLX Applied Biosystems: SOLiD 4 Illumina: HiSeq3000, MiSeq Illumina, accessed August 2013 Sequencing Workflow • Extract DNA • Prepare libraries – ‘Cutting-up’ DNA into short fragments • Sequencing by synthesis (HiSeq, MiSeq, NextSeq, …) • Base calling from image data -> fastq • Alignment to reference genome -> bam – Or de-novo assembly • Variant calling -> vcf ‘Raw’ sequence to genotypes FASTQ File • Unfiltered • Quality metrics
    [Show full text]
  • BAM Alignment File — Output: Alignment Counts and RPKM Expression Measurements for Each Exon • Calculate Coverage Profiles Across the Genome with “Sam2wig”
    01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD TM Bioinformatics Overview (I) July 2010 1 Secondary and Tertiary Primary Analysis Analysis BioScope in cluster SETS ICS Export BioScope in cloud •Satay Plots •Auto Correlation •Heat maps On Instrument Other mapping tools 2 Auto-Export (cycle-by-cycle) Collect Primary Analysis Generate Secondary Images (colorcalls) Csfasta & qual Analysis Instrument Cluster Auto Export delta spch run definition Merge Generate Tertiary Spch files Csfasta & qual Analysis Bioscope Cluster 3 Manual Export Collect Primary Analysis Generate Secondary Images (colorcalls) Csfasta & qual Analysis Instrument Cluster Option in SETS to export All run data or combination of Spch, csfasta & qual files Tertiary Analysis Bioscope Cluster 4 Auto-Export database requirement removed Instrument Cluster Remote Cluster JMS Broker JMS Broker Export ICS Hades Bioscope (ActiveMQ) (ActiveMQ) Daemon Postgres Postgres SETS Bioscope UI Tomcat Tomcat Disco installer Auto-export installer Bioscope installer System installer 5 SOLiDSOLiD DataData AnalysisAnalysis Workflow:Workflow: Secondary/Tertiary Analysis (off -instrument) Primary Analysis Secondary Analysis Tertiary Analysis BioScope BioScope Reseq WT SAET •SNP •Coverage .csfasta / .qual Accuracy Enhanced .csfasta •InDel •Exon Counting •CNV •Junction Finder •Inversion •Fusion Transcripts Mapping Mapped reads (.ma) Third Party Tools Mapped reads (.bam) maToBam 6 01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD TM Bioinformatics Overview (II) July 2010 7 OutlineOutline • Color
    [Show full text]
  • Introduction to High-Throughput Sequencing File Formats
    Introduction to high-throughput sequencing file formats Daniel Vodák (Bioinformatics Core Facility, The Norwegian Radium Hospital) ( [email protected] ) File formats • Do we need them? Why do we need them? – A standardized file has a clearly defined structure – the nature and the organization of its content are known • Important for automatic processing (especially in case of large files) • Re-usability saves work and time • Why the variability then? – Effective storage of specific information (differences between data- generating instruments, experiment types, stages of data processing and software tools) – Parallel development, competition • Need for (sometimes imperfect) conversions 2 Binary and “flat” file formats • “Flat” (“plain text”, “human readable”) file formats – Possible to process with simple command-line tools (field/column structure design) – Large in size – Space is often saved through the means of archiving (e.g. tar, zip) and human-readable information coding (e.g. flags) • File format specifications (“manuals”) are very important (often indispensable) for correct understanding of given file’s content • Binary file formats – Not human-readable – Require special software for processing (programs intended for plain text processing will not work properly on them, e.g. wc, grep) – (significant) reduction to file size • High-throughput sequencing files – typically GBs in size 3 Comparison of file sizes • Plain text file – example.sam – 2.5 GB (100 %) • Binary file – example.bam – 611 MB (23.36 %) – Possibility of indexing
    [Show full text]
  • Magic-BLAST, an Accurate DNA and RNA-Seq Aligner for Long and Short Reads
    bioRxiv preprint doi: https://doi.org/10.1101/390013; this version posted August 13, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. Magic-BLAST, an accurate DNA and RNA-seq aligner for long and short reads Grzegorz M Boratyn, Jean Thierry-Mieg*, Danielle Thierry-Mieg, Ben Busby and Thomas L Madden* National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, 8600 Rockville Pike, Bethesda, MD, 20894, USA * To whom correspondence should be addressed. Tel: 301-435-5987; Fax: 301-480-4023; Email: [email protected]. Correspondence may also be addressed to [email protected]. ABSTRACT Next-generation sequencing technologies can produce tens of millions of reads, often paired-end, from transcripts or genomes. But few programs can align RNA on the genome and accurately discover introns, especially with long reads. To address these issues, we introduce Magic-BLAST, a new aligner based on ideas from the Magic pipeline. It uses innovative techniques that include the optimization of a spliced alignment score and selective masking during seed selection. We evaluate the performance of Magic-BLAST to accurately map short or long sequences and its ability to discover introns on real RNA-seq data sets from PacBio, Roche and Illumina runs, and on six benchmarks, and compare it to other popular aligners. Additionally, we look at alignments of human idealized RefSeq mRNA sequences perfectly matching the genome.
    [Show full text]
  • Institute for Glycomics Annual Report 2019
    INSTITUTE FOR GLYCOMICS ANNUAL REPORT 2019 1 Our MissionFighting diseases of global impact through discovery and translational science. 2 Griffith University | Institute for Glycomics 2019 Annual Report | CRICOS No. 00233E Contents 4 About us 56 2019 publications 6 Director’s report 64 New grants in 2019 8 Institute highlights 67 Remarkable people 9 Remarkable science 68 Membership in 2019 12 Remarkable achievements 71 Plenary/keynote/invited lectures in 2019 18 Translation and commercialisation 73 Remarkable support 20 Commercialisation case study 22 Internationalisation 24 Community engagement 28 Community engagement case studies 30 Selected outstanding publications 40 Research group leader highlights 54 Our facilities Our Vision To be a world-leader in the discovery and development of drugs, vaccines and diagnostics through the application of innovative multidisciplinary science in a unique research environment. 3 About Us The Institute boasts state-of-the-art facilities combined with some of the world’s most outstanding researchers with a significant focus on ‘Glycomics’, a constantly expanding field that explores the structural and functional properties of carbohydrates (sugars). Glycomics research is conducted worldwide in projects that cut across multiple disciplines, applying new approaches to treatment and prevention of diseases. Our unique research expertise makes us the only institute of its kind in Australia and one of very few integrated translational institutes using this approach in the world. The Institute for Glycomics is one of Australia’s flagship multidisciplinary biomedical research institutes. The Institute’s research primarily targets prevention and cures for infectious diseases and cancer, with a focus on translational Established in February 2000, the Institute strives to be research which will inevitably have a positive impact on human a world leader in the discovery and development of next health globally.
    [Show full text]
  • Predicting False Positives of Protein-Protein Interaction Data by Semantic Similarity Measures§ George Montañez1 and Young-Rae Cho*,2
    Send Orders of Reprints at [email protected] Current Bioinformatics, 2013, 8, 000-000 1 Predicting False Positives of Protein-Protein Interaction Data by Semantic Similarity Measures§ George Montañez1 and Young-Rae Cho*,2 1Machine Learning Department, Carnegie Melon University, Pittsburgh, PA 15213, USA 2Bioinformatics Program, Department of Computer Science, Baylor University, Waco, TX 76798, USA Abstract: Recent technical advances in identifying protein-protein interactions (PPIs) have generated the genomic-wide interaction data, collectively collectively referred to as the interactome. These interaction data give an insight into the underlying mechanisms of biological processes. However, the PPI data determined by experimental and computational methods include an extremely large number of false positives which are not confirmed to occur in vivo. Filtering PPI data is thus a critical preprocessing step to improve analysis accuracy. Integrating Gene Ontology (GO) data is proposed in this article to assess reliability of the PPIs. We evaluate the performance of various semantic similarity measures in terms of functional consistency. Protein pairs with high semantic similarity are considered highly likely to share common functions, and therefore, are more likely to interact. We also propose a combined method of semantic similarity to apply to predicting false positive PPIs. The experimental results show that the combined hybrid method has better performance than the individual semantic similarity classifiers. The proposed classifier
    [Show full text]
  • For the Identification of Forensically Important Diptera from Belgium and France
    A peer-reviewed open-access journal ZooKeys 365: 307–328Utility (2013) of GenBank and the Barcode of Life Data Systems (BOLD)... 307 doi: 10.3897/zookeys.365.6027 RESEARCH ARTICLE www.zookeys.org Launched to accelerate biodiversity research Utility of GenBank and the Barcode of Life Data Systems (BOLD) for the identification of forensically important Diptera from Belgium and France Gontran Sonet1, Kurt Jordaens2,3, Yves Braet4, Luc Bourguignon4, Eréna Dupont4, Thierry Backeljau1,3, Marc De Meyer2, Stijn Desmyter4 1 Royal Belgian Institute of Natural Sciences, OD Taxonomy and Phylogeny (JEMU), Vautierstraat 29, 1000 Brussels, Belgium 2 Royal Museum for Central Africa, Department of Biology (JEMU), Leuvensesteenweg 13, 3080 Tervuren, Belgium 3 University of Antwerp, Evolutionary Ecology Group, Groenenborgerlaan 171, 2020 Antwerp, Belgium 4 National Institute of Criminalistics and Criminology, Vilvoordsesteenweg 100, 1120 Brussels, Belgium Corresponding author: Gontran Sonet ([email protected]) Academic editor: Z. T. Nagy | Received 1 August 2013 | Accepted 13 November 2013 | Published 30 December 2013 Citation: Sonet G, Jordaens K, Braet Y, Bourguignon L, Dupont E, Backeljau T, De Meyer M, Desmyter S (2013) Utility of GenBank and the Barcode of Life Data Systems (BOLD) for the identification of forensically important Diptera from Belgium and France. In: Nagy ZT, Backeljau T, De Meyer M, Jordaens K (Eds) DNA barcoding: a practical tool for fundamental and applied biodiversity research. ZooKeys 365: 307–328. doi: 10.3897/ zookeys.365.6027 Abstract Fly larvae living on dead corpses can be used to estimate post-mortem intervals. The identification of these flies is decisive in forensic casework and can be facilitated by using DNA barcodes provided that a representative and comprehensive reference library of DNA barcodes is available.
    [Show full text]