Samtools-View (Format Conversion) Introduction:SAM File <=> BAM File
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
De Novo Genomic Analyses for Non-Model Organisms: an Evaluation of Methods Across a Multi-Species Data Set
De novo genomic analyses for non-model organisms: an evaluation of methods across a multi-species data set Sonal Singhal [email protected] Museum of Vertebrate Zoology University of California, Berkeley 3101 Valley Life Sciences Building Berkeley, California 94720-3160 Department of Integrative Biology University of California, Berkeley 1005 Valley Life Sciences Building Berkeley, California 94720-3140 June 5, 2018 Abstract High-throughput sequencing (HTS) is revolutionizing biological research by enabling sci- entists to quickly and cheaply query variation at a genomic scale. Despite the increasing ease of obtaining such data, using these data effectively still poses notable challenges, especially for those working with organisms without a high-quality reference genome. For every stage of analysis – from assembly to annotation to variant discovery – researchers have to distinguish technical artifacts from the biological realities of their data before they can make inference. In this work, I explore these challenges by generating a large de novo comparative transcriptomic dataset data for a clade of lizards and constructing a pipeline to analyze these data. Then, using a combination of novel metrics and an externally validated variant data set, I test the efficacy of my approach, identify areas of improvement, and propose ways to minimize these errors. I arXiv:1211.1737v1 [q-bio.GN] 8 Nov 2012 find that with careful data curation, HTS can be a powerful tool for generating genomic data for non-model organisms. Keywords: de novo assembly, transcriptomes, suture zones, variant discovery, annotation Running Title: De novo genomic analyses for non-model organisms 1 Introduction High-throughput sequencing (HTS) is poised to revolutionize the field of evolutionary genetics by enabling researchers to assay thousands of loci for organisms across the tree of life. -
A Comprehensive Workflow for Variant Calling Pipeline Comparison and Analysis Using R Programming
www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 8 August 2020 | ISSN: 2320-2882 A COMPREHENSIVE WORKFLOW FOR VARIANT CALLING PIPELINE COMPARISON AND ANALYSIS USING R PROGRAMMING 1Mansi Ujjainwal, 2Preeti Chaudhary 1MSc Bioinformatics, 2Mtech Bioinformatics, 1Amity Institute of Biotechnology 1Amity University, Noida, India Abstract: The aim of the article is to provide variant calling workflow and analysis protocol for comparing results of the two using two variant calling platforms. Variant calling pipelines used here are predominantly used for calling variants in human whole exome data and whole genome data. The result of a variant calling pipeline is a set of variants( SNPS, insertions, deletions etc) present in the sequencing data. Each pipeline is capable of calling its certain intersecting and certain unique variants. The intersecting and unique variants can further be distinguished on the basis of their reference SNP ID and grouped on the basis of its annotation. The number of variants called can be humongous depending upon the size and complexity of the data. R programming packages and ubuntu command shell can be used to differentiate and analyse the variants called by each type of pipeline. Index Terms – Whole Exome Sequencing, Variant Calling, Sequencing data, R programming I. INTRODUCTION The Human Genome Project started in 1990, makes up the single most significant project in the field of biomedical sciences and biology. The project was set out to change how we see biology and medicine. The project was set out to sequence complete genome of Homo sapiens as well as several microorganisms including Escherichia coli, Saccharomyces cerevisiae, and metazoans such as Caenorhabtidis elegans. -
Gene Discovery and Annotation Using LCM-454 Transcriptome Sequencing Scott J
Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Gene discovery and annotation using LCM-454 transcriptome sequencing Scott J. Emrich,1,2,6 W. Brad Barbazuk,3,6 Li Li,4 and Patrick S. Schnable1,4,5,7 1Bioinformatics and Computational Biology Graduate Program, Iowa State University, Ames, Iowa 50010, USA; 2Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50010, USA; 3Donald Danforth Plant Science Center, St. Louis, Missouri 63132, USA; 4Interdepartmental Plant Physiology Graduate Major and Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, Iowa 50010, USA; 5Department of Agronomy and Center for Plant Genomics, Iowa State University, Ames, Iowa 50010, USA 454 DNA sequencing technology achieves significant throughput relative to traditional approaches. More than 261,000 ESTs were generated by 454 Life Sciences from cDNA isolated using laser capture microdissection (LCM) from the developmentally important shoot apical meristem (SAM) of maize (Zea mays L.). This single sequencing run annotated >25,000 maize genomic sequences and also captured ∼400 expressed transcripts for which homologous sequences have not yet been identified in other species. Approximately 70% of the ESTs generated in this study had not been captured during a previous EST project conducted using a cDNA library constructed from hand-dissected apex tissue that is highly enriched for SAMs. In addition, at least 30% of the 454-ESTs do not align to any of the ∼648,000 extant maize ESTs using conservative alignment criteria. These results indicate that the combination of LCM and the deep sequencing possible with 454 technology enriches for SAM transcripts not present in current EST collections. -
MATCH-G Program
MATCH-G Program The MATCH-G toolset MATCH-G (Mutational Analysis Toolset Comparing wHole Genomes) Download the Toolset The toolset is prepared for use with pombe genomes and a sample genome from Sanger is included. However, it is written in such a way as to allow it to utilize any set or number of chromosomes. Simply follow the naming convention "chromosomeX.contig.embl" where X=1,2,3 etc. For use in terminal windows in Mac OSX or Unix-like environments where Perl is present by default. Toolset Description Version History 2.0 – Bug fixes related to scaling to other genomes. First version of GUI interface. 1.0 – Initial Release. Includes build, alignment, snp, copy, and gap resolution routines in original form. Please note this project in under development and will undergo significant changes. Project Description The MATCH-G toolset has been developed to facilitate the evaluation of whole genome sequencing data from yeasts. Currently, the toolset is written for pombe strains, however the toolset is easily scalable to other yeasts or other sequenced genomes. The included tools assist in the identification of SNP mutations, short (and long) insertion/deletions, and changes in gene/region copy number between a parent strain and mutant or revertant strain. Currently, the toolset is run from the command line in a unix or similar terminal and requires a few additional programs to run noted below. Installation It is suggested that a separate folder be generated for the toolset and generated files. Free disk space proportional to the original read datasets is recommended. The toolset utilizes and requires a few additional free programs: Bowtie rapid alignment software: http://bowtie-bio.sourceforge.net/index.shtml (Langmead B, Trapnell C, Pop M, Salzberg SL. -
Property Graph Vs RDF Triple Store: a Comparison on Glycan Substructure Search
RESEARCH ARTICLE Property Graph vs RDF Triple Store: A Comparison on Glycan Substructure Search Davide Alocci1,2, Julien Mariethoz1, Oliver Horlacher1,2, Jerven T. Bolleman3, Matthew P. Campbell4, Frederique Lisacek1,2* 1 Proteome Informatics Group, SIB Swiss Institute of Bioinformatics, Geneva, 1211, Switzerland, 2 Computer Science Department, University of Geneva, Geneva, 1227, Switzerland, 3 Swiss-Prot Group, SIB Swiss Institute of Bioinformatics, Geneva, 1211, Switzerland, 4 Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, Australia * [email protected] Abstract Resource description framework (RDF) and Property Graph databases are emerging tech- nologies that are used for storing graph-structured data. We compare these technologies OPEN ACCESS through a molecular biology use case: glycan substructure search. Glycans are branched Citation: Alocci D, Mariethoz J, Horlacher O, tree-like molecules composed of building blocks linked together by chemical bonds. The Bolleman JT, Campbell MP, Lisacek F (2015) molecular structure of a glycan can be encoded into a direct acyclic graph where each node Property Graph vs RDF Triple Store: A Comparison on Glycan Substructure Search. PLoS ONE 10(12): represents a building block and each edge serves as a chemical linkage between two build- e0144578. doi:10.1371/journal.pone.0144578 ing blocks. In this context, Graph databases are possible software solutions for storing gly- Editor: Manuela Helmer-Citterich, University of can structures and Graph query languages, such as SPARQL and Cypher, can be used to Rome Tor Vergata, ITALY perform a substructure search. Glycan substructure searching is an important feature for Received: July 16, 2015 querying structure and experimental glycan databases and retrieving biologically meaning- ful data. -
Genomic Alignment (Mapping) and SNP / Polymorphism Calling
GenomicGenomic alignmentalignment (mapping)(mapping) andand SNPSNP // polymorphismpolymorphism callingcalling Jérôme Mariette & Christophe Klopp http://bioinfo.genotoul.fr/ Bioinfo Genotoul platform – Since 2008 ● 1 Roche 454 ● 1 MiSeq ● 2 HiSeq – Providing ● Data processing for quality control ● Secure data access to end users http://bioinfo.genotoul.fr/ http://ng6.toulouse.inra.fr/ 2 Bioinfo Genotoul : Services – High speed computing facility access – Application and web-server hosting – Training – Support – Project partnership 3 Genetic variation http://en.wikipedia.org/wiki/Genetic_variation Genetic variation, variations in alleles of genes, occurs both within and in populations. Genetic variation is important because it provides the “raw material” for natural selection. http://studentreader.com/genotypes-phenotypes/ 4 Types of variations ● SNP : Single nucleotide polymorphism ● CNV : copy number variation ● Chromosomal rearrangement ● Chromosomal duplication http://en.wikipedia.org/wiki/Copy-number_variation http://en.wikipedia.org/wiki/Human_genetic_variation 5 The variation transmission ● Mutation : In molecular biology and genetics, mutations are changes in a genomic sequence: the DNA sequence of a cell's genome or the DNA or RNA sequence of a virus (http://en.wikipedia.org/wiki/Mutation). ● Mutations are transmitted if they are not lethal. ● Mutations can impact the phenotype. 6 Genetic markers and genotyping ● A set of SNPs is selected along the genome. ● The phenotypes are collected for individuals. ● The SNPs are genotyped -
EMBL-EBI Powerpoint Presentation
Processing data from high-throughput sequencing experiments Simon Anders Use-cases for HTS · de-novo sequencing and assembly of small genomes · transcriptome analysis (RNA-Seq, sRNA-Seq, ...) • identifying transcripted regions • expression profiling · Resequencing to find genetic polymorphisms: • SNPs, micro-indels • CNVs · ChIP-Seq, nucleosome positions, etc. · DNA methylation studies (after bisulfite treatment) · environmental sampling (metagenomics) · reading bar codes Use cases for HTS: Bioinformatics challenges Established procedures may not be suitable. New algorithms are required for · assembly · alignment · statistical tests (counting statistics) · visualization · segmentation · ... Where does Bioconductor come in? Several steps: · Processing of the images and determining of the read sequencest • typically done by core facility with software from the manufacturer of the sequencing machine · Aligning the reads to a reference genome (or assembling the reads into a new genome) • Done with community-developed stand-alone tools. · Downstream statistical analyis. • Write your own scripts with the help of Bioconductor infrastructure. Solexa standard workflow SolexaPipeline · "Firecrest": Identifying clusters ⇨ typically 15..20 mio good clusters per lane · "Bustard": Base calling ⇨ sequence for each cluster, with Phred-like scores · "Eland": Aligning to reference Firecrest output Large tab-separated text files with one row per identified cluster, specifying · lane index and tile index · x and y coordinates of cluster on tile · for each -
Large Scale Genomic Rearrangements in Selected Arabidopsis Thaliana T
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Large scale genomic rearrangements in selected 2 Arabidopsis thaliana T-DNA lines are caused by T-DNA 3 insertion mutagenesis 4 5 Boas Pucker1,2+, Nils Kleinbölting3+, and Bernd Weisshaar1* 6 1 Genetics and Genomics of Plants, Center for Biotechnology (CeBiTec), Bielefeld University, 7 Sequenz 1, 33615 Bielefeld, Germany 8 2 Evolution and Diversity, Department of Plant Sciences, University of Cambridge, Cambridge, 9 United Kingdom 10 3 Bioinformatics Resource Facility, Center for Biotechnology (CeBiTec, Bielefeld University, 11 Sequenz 1, 33615 Bielefeld, Germany 12 + authors contributed equally 13 * corresponding author: Bernd Weisshaar 14 15 BP: [email protected], ORCID: 0000-0002-3321-7471 16 NK: [email protected], ORCID: 0000-0001-9124-5203 17 BW: [email protected], ORCID: 0000-0002-7635-3473 18 19 20 21 22 23 24 25 26 27 28 29 30 page 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.03.433755; this version posted March 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. -
Genetics 211 - 2018 Lecture 3
Genetics 211 - 2018 Lecture 3 High Throughput Sequencing Pt II Gavin Sherlock [email protected] January 23rd 2018 Long “Synthetic Reads” aka Moleculo Genomic DNA Fragment Size Select (10kb) Polish, ligate amplification adaptors ~10 kb DNA Dilute to 500 molecules per well Amplify, fragment, add sequencing adaptors Pool Sequence Separate, based on well barcode Remove barcodes, assemble 10kb fragments Assemble genome from 10kb fragments Synthetic Read Characteristics 10x Genomics • Similar in concept to CPT-Seq from last week’s paper • Idea is to uniquely barcode reads that derive from a long molecule - ~50-100kb • 10x Chromium system automates much of the process for you ~10 HMW gDNA molecules per GEM 10x Barcoded Beads HMW gDNA Oil Benefits of 10x • Correct placement in difficult to align regions: Paralog A Paralog B Benefits of 10x • Correct placement in difficult to align regions: Paralog A Paralog B Benefits of 10x • Correct placement in difficult to align regions: Paralog A Paralog B Benefits of 10x • Correct placement in difficult to align regions: Paralog A Paralog B Benefits of 10x • Correct placement in difficult to align regions: Paralog A Paralog B Benefits of 10x • Haplotype phasing: Benefits of 10x • Haplotype phasing: Benefits of 10x • Haplotype phasing: Benefits of 10x • Haplotype phasing: Using Hi-C data to aid assemblies • Hi-C is a proximity ligation method, aimed at reconstructing the 3 dimensional structure of a genome • Originally developed with the idea of looking at how the genome of an organism for which a good reference exists is physically organized • But, probability of intrachromosomal contacts is much higher than that of interchromosomal contacts. -
An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identification and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging field of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Assembly Exercise
Assembly Exercise Turning reads into genomes Where we are • 13:30-14:00 – Primer Design to Amplify Microbial Genomes for Sequencing • 14:00-14:15 – Primer Design Exercise • 14:15-14:45 – Molecular Barcoding to Allow Multiplexed NGS • 14:45-15:15 – Processing NGS Data – de novo and mapping assembly • 15:15-15:30 – Break • 15:30-15:45 – Assembly Exercise • 15:45-16:15 – Annotation • 16:15-16:30 – Annotation Exercise • 16:30-17:00 – Submitting Data to GenBank Log onto ILRI cluster • Log in to HPC using ILRI instructions • NOTE: All the commands here are also in the file - assembly_hands_on_steps.txt • If you are like me, it may be easier to cut and paste Linux commands from this file instead of typing them in from the slides Start an interactive session on larger servers • The interactive command will start a session on a server better equipped to do genome assembly $ interactive • Switch to csh (I use some csh features) $ csh • Set up Newbler software that will be used $ module load 454 A norovirus sample sequenced on both 454 and Illumina • The vendors use different file formats unknown_norovirus_454.GACT.sff unknown_norovirus_illumina.fastq • I have converted these files to additional formats for use with the assembly tools unknown_norovirus_454_convert.fasta unknown_norovirus_454_convert.fastq unknown_norovirus_illumina_convert.fasta Set up and run the Newbler de novo assembler • Create a new de novo assembly project $ newAssembly de_novo_assembly • Add read data to the project $ addRun de_novo_assembly unknown_norovirus_454.GACT.sff