DOCSLIB.ORG

The Structure of the SAM File

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Structure of the SAM File 10/9/14 The majority of data analyses split off aer 2014 - BMMB 852: Applied Bioinformacs generang a SAM file Week 7, Lecture 14 Sequencing Reads István Albert Alignment So8ware Bioinformacs Consul:ng Center Penn State SAM file Chip-Seq RNA-Seq SNPs Create test queries: The structure of the SAM file exact match, one mismatch, 1 dele:on etc. SAM Headers Alignments 1 10/9/14 Resource: SAM specificaon SAM format: tabular text format 11 required column + op:onal fields Published as The Sequence Alignment/Map format and SAMtools by Heng Li et al Bioinformacs 25, Volume 25, Issue 16, 2009 “A TAB-delimited text format consis:ng of a header sec:on, which is op:onal, and an alignment sec:on.” An aligment consist of 11 tab Column 1 and 2: QNAME and FLAG delimited columns (Query name and bitwise flags) QNAME: the name of the query sequence 2 10/9/14 Column 2: FLAG Columns 3, 4: RNAME and POS the bitwise representaon Reference and Posi:on 1 = 00000001 à paired end read 2 = 00000010 à mapped as proper pair 4 = 00000100 à unmappable read 8 = 00001000 à read mate unmapped 16 = 00010000 à read mapped on reverse strand The flag 11 à 1 + 2 + 8 = 0001011 (condions 1, 2 and 8 sasfied) It is used to save space – but it does make things a bit more difficult. Usually very few flags are needed in prac:ce – 0, 4, 16 are the most generic ones Column 4 POS: 1-based lemost mapping POSion of the first matching base. If you need to construct a more complex flag search for explain SAM flags: Very important to remember later when we need to find the 5’ end (the actual start) hp://picard.sourceforge.net/explain-flags.html Details of the mapping quality Column 5: MAPQ - Mapping Quality computaon – hard to find good answers • • Tool specific – there is no standard of what it should be Phred score, iden:cal to the quality measure in the fastq file. quality Q, probability P: • The repeat structure of the reference. Reads falling in repe::ve regions usually get very low mapping quality. P = 10 ^ (-Q / 10.0) • The base quality of the read. Low quality means the observed read sequence is possibly wrong, and wrong sequence may lead to a wrong alignment. If Q=30, P=1/1000 à on average, one of out 1000 • The sensi:vity of the alignment algorithm. The true hit is more likely to be alignments will be wrong missed by an algorithm with low sensi:vity, which also causes mapping errors. As good as this sounds it is not easy to compute • Paired end or not. Reads mapped in pairs are more likely to be correct. such a quality. (from the MAQ manual) 3 10/9/14 BWA specific high scores BWA specific low scores A read alignment with a mapping quality 30 or Surprisingly difficult to track down the exact behavior above usually implies • Q=0 à if a read can be aligned equally well to mul:ple • The overall base quality of the read is good. posi:ons, BWA will randomly pick one posi:on and give it a mapping quality zero. • The best alignment has few mismatches. • Q=25 à the edit distance equals mismatches and is greater • The read has few or Just one `good' hit on the than zero reference, which means the current alignment is s:ll the best even if one or two bases are actually mutaons or sequencing errors. Columns 7, 8, 9: RNEXT, PNEXT, TLEN Column 6: CIGAR (used in paired end read sequencing) • CIGAR = Compact Idiosyncrac Gapped Alignment Report • RNEXT: the name of the pair • PNEXT: the posi:on of the pair • TLEN: the distance between the leMmost posi:ons of the pairs We will discuss these in more detail later. These can show the posi:on of reads that are distant – allow us to infer genomic variaons 4 10/9/14 Column 10, 11 Column 12 and beyond • SEQ: the query sequence • QUAL: the phred encoded quality sequence SEQ may contain the original sequence or the segment it was aligned to. Not all tools do the same thing. Specific informaon about the alignment process that the tools was able to establish. more details in later lectures Homework 14 Download data-14.tar.gz Align the data in paired end more with bwa. How many dis:nct alignment flags do you get? What does each flag mean? 5 .
Load more

Recommended publications
  • Analysis of the Impact of Sequencing Errors on Blast Using Fault Injection
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Illinois Digital Environment for Access to Learning and Scholarship Repository ANALYSIS OF THE IMPACT OF SEQUENCING ERRORS ON BLAST USING FAULT INJECTION BY SO YOUN LEE THESIS Submitted in partial fulfillment of the requirements for the degree of Master of Science in Electrical and Computer Engineering in the Graduate College of the University of Illinois at Urbana-Champaign, 2013 Urbana, Illinois Adviser: Professor Ravishankar K. Iyer ABSTRACT This thesis investigates the impact of sequencing errors in post-sequence computational analyses, including local alignment search and multiple sequence alignment. While the error rates of sequencing technology are commonly reported, the significance of these numbers cannot be fully grasped without putting them in the perspective of their impact on the downstream analyses that are used for biological research, forensics, diagnosis of diseases, etc. I approached the quantification of the impact using fault injection. Faults were injected in the input sequence data, and the analyses were run. Change in the output of the analyses was interpreted as the impact of faults, or errors. Three commonly used algorithms were used: BLAST, SSEARCH, and ProbCons. The main contributions of this work are the application of fault injection to the reliability analysis in bioinformatics and the quantitative demonstration that a small error rate in the sequence data can alter the output of the analysis in a significant way. BLAST and SSEARCH are both local alignment search tools, but BLAST is a heuristic implementation, while SSEARCH is based on the optimal Smith-Waterman algorithm.
    [Show full text]
  • Advancing Solutions to the Carbohydrate Sequencing Challenge † † † ‡ § Christopher J
    Perspective Cite This: J. Am. Chem. Soc. 2019, 141, 14463−14479 pubs.acs.org/JACS Advancing Solutions to the Carbohydrate Sequencing Challenge † † † ‡ § Christopher J. Gray, Lukasz G. Migas, Perdita E. Barran, Kevin Pagel, Peter H. Seeberger, ∥ ⊥ # ⊗ ∇ Claire E. Eyers, Geert-Jan Boons, Nicola L. B. Pohl, Isabelle Compagnon, , × † Göran Widmalm, and Sabine L. Flitsch*, † School of Chemistry & Manchester Institute of Biotechnology, The University of Manchester, 131 Princess Street, Manchester M1 7DN, U.K. ‡ Institute for Chemistry and Biochemistry, Freie Universitaẗ Berlin, Takustraße 3, 14195 Berlin, Germany § Biomolecular Systems Department, Max Planck Institute for Colloids and Interfaces, Am Muehlenberg 1, 14476 Potsdam, Germany ∥ Department of Biochemistry, Institute of Integrative Biology, University of Liverpool, Crown Street, Liverpool L69 7ZB, U.K. ⊥ Complex Carbohydrate Research Center, University of Georgia, Athens, Georgia 30602, United States # Department of Chemistry, Indiana University, Bloomington, Indiana 47405, United States ⊗ Institut Lumierè Matiere,̀ UMR5306 UniversitéLyon 1-CNRS, Universitéde Lyon, 69622 Villeurbanne Cedex, France ∇ Institut Universitaire de France IUF, 103 Blvd St Michel, 75005 Paris, France × Department of Organic Chemistry, Arrhenius Laboratory, Stockholm University, S-106 91 Stockholm, Sweden *S Supporting Information established connection between their structure and their ABSTRACT: Carbohydrates possess a variety of distinct function, full characterization of unknown carbohydrates features with
    [Show full text]
  • Gene Discovery and Annotation Using LCM-454 Transcriptome Sequencing Scott J
    Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Gene discovery and annotation using LCM-454 transcriptome sequencing Scott J. Emrich,1,2,6 W. Brad Barbazuk,3,6 Li Li,4 and Patrick S. Schnable1,4,5,7 1Bioinformatics and Computational Biology Graduate Program, Iowa State University, Ames, Iowa 50010, USA; 2Department of Electrical and Computer Engineering, Iowa State University, Ames, Iowa 50010, USA; 3Donald Danforth Plant Science Center, St. Louis, Missouri 63132, USA; 4Interdepartmental Plant Physiology Graduate Major and Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, Iowa 50010, USA; 5Department of Agronomy and Center for Plant Genomics, Iowa State University, Ames, Iowa 50010, USA 454 DNA sequencing technology achieves significant throughput relative to traditional approaches. More than 261,000 ESTs were generated by 454 Life Sciences from cDNA isolated using laser capture microdissection (LCM) from the developmentally important shoot apical meristem (SAM) of maize (Zea mays L.). This single sequencing run annotated >25,000 maize genomic sequences and also captured ∼400 expressed transcripts for which homologous sequences have not yet been identified in other species. Approximately 70% of the ESTs generated in this study had not been captured during a previous EST project conducted using a cDNA library constructed from hand-dissected apex tissue that is highly enriched for SAMs. In addition, at least 30% of the 454-ESTs do not align to any of the ∼648,000 extant maize ESTs using conservative alignment criteria. These results indicate that the combination of LCM and the deep sequencing possible with 454 technology enriches for SAM transcripts not present in current EST collections.
    [Show full text]
  • "Phylogenetic Analysis of Protein Sequence Data Using The
    Phylogenetic Analysis of Protein Sequence UNIT 19.11 Data Using the Randomized Axelerated Maximum Likelihood (RAXML) Program Antonis Rokas1 1Department of Biological Sciences, Vanderbilt University, Nashville, Tennessee ABSTRACT Phylogenetic analysis is the study of evolutionary relationships among molecules, phenotypes, and organisms. In the context of protein sequence data, phylogenetic analysis is one of the cornerstones of comparative sequence analysis and has many applications in the study of protein evolution and function. This unit provides a brief review of the principles of phylogenetic analysis and describes several different standard phylogenetic analyses of protein sequence data using the RAXML (Randomized Axelerated Maximum Likelihood) Program. Curr. Protoc. Mol. Biol. 96:19.11.1-19.11.14. C 2011 by John Wiley & Sons, Inc. Keywords: molecular evolution r bootstrap r multiple sequence alignment r amino acid substitution matrix r evolutionary relationship r systematics INTRODUCTION the baboon-colobus monkey lineage almost Phylogenetic analysis is a standard and es- 25 million years ago, whereas baboons and sential tool in any molecular biologist’s bioin- colobus monkeys diverged less than 15 mil- formatics toolkit that, in the context of pro- lion years ago (Sterner et al., 2006). Clearly, tein sequence analysis, enables us to study degree of sequence similarity does not equate the evolutionary history and change of pro- with degree of evolutionary relationship. teins and their function. Such analysis is es- A typical phylogenetic analysis of protein sential to understanding major evolutionary sequence data involves five distinct steps: (a) questions, such as the origins and history of data collection, (b) inference of homology, (c) macromolecules, developmental mechanisms, sequence alignment, (d) alignment trimming, phenotypes, and life itself.
    [Show full text]
  • EMBL-EBI Powerpoint Presentation
    Processing data from high-throughput sequencing experiments Simon Anders Use-cases for HTS · de-novo sequencing and assembly of small genomes · transcriptome analysis (RNA-Seq, sRNA-Seq, ...) • identifying transcripted regions • expression profiling · Resequencing to find genetic polymorphisms: • SNPs, micro-indels • CNVs · ChIP-Seq, nucleosome positions, etc. · DNA methylation studies (after bisulfite treatment) · environmental sampling (metagenomics) · reading bar codes Use cases for HTS: Bioinformatics challenges Established procedures may not be suitable. New algorithms are required for · assembly · alignment · statistical tests (counting statistics) · visualization · segmentation · ... Where does Bioconductor come in? Several steps: · Processing of the images and determining of the read sequencest • typically done by core facility with software from the manufacturer of the sequencing machine · Aligning the reads to a reference genome (or assembling the reads into a new genome) • Done with community-developed stand-alone tools. · Downstream statistical analyis. • Write your own scripts with the help of Bioconductor infrastructure. Solexa standard workflow SolexaPipeline · "Firecrest": Identifying clusters ⇨ typically 15..20 mio good clusters per lane · "Bustard": Base calling ⇨ sequence for each cluster, with Phred-like scores · "Eland": Aligning to reference Firecrest output Large tab-separated text files with one row per identified cluster, specifying · lane index and tile index · x and y coordinates of cluster on tile · for each
    [Show full text]
  • A SARS-Cov-2 Sequence Submission Tool for the European Nucleotide
    Databases and ontologies Downloaded from https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btab421/6294398 by guest on 25 June 2021 A SARS-CoV-2 sequence submission tool for the European Nucleotide Archive Miguel Roncoroni 1,2,∗, Bert Droesbeke 1,2, Ignacio Eguinoa 1,2, Kim De Ruyck 1,2, Flora D’Anna 1,2, Dilmurat Yusuf 3, Björn Grüning 3, Rolf Backofen 3 and Frederik Coppens 1,2 1Department of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Ghent, Belgium, 1VIB Center for Plant Systems Biology, 9052 Ghent, Belgium and 2University of Freiburg, Department of Computer Science, Freiburg im Breisgau, Baden-Württemberg, Germany ∗To whom correspondence should be addressed. Associate Editor: XXXXXXX Received on XXXXX; revised on XXXXX; accepted on XXXXX Abstract Summary: Many aspects of the global response to the COVID-19 pandemic are enabled by the fast and open publication of SARS-CoV-2 genetic sequence data. The European Nucleotide Archive (ENA) is the European recommended open repository for genetic sequences. In this work, we present a tool for submitting raw sequencing reads of SARS-CoV-2 to ENA. The tool features a single-step submission process, a graphical user interface, tabular-formatted metadata and the possibility to remove human reads prior to submission. A Galaxy wrap of the tool allows users with little or no bioinformatic knowledge to do bulk sequencing read submissions. The tool is also packed in a Docker container to ease deployment. Availability: CLI ENA upload tool is available at github.com/usegalaxy- eu/ena-upload-cli (DOI 10.5281/zenodo.4537621); Galaxy ENA upload tool at toolshed.g2.bx.psu.edu/view/iuc/ena_upload/382518f24d6d and https://github.com/galaxyproject/tools- iuc/tree/master/tools/ena_upload (development) and; ENA upload Galaxy container at github.com/ELIXIR- Belgium/ena-upload-container (DOI 10.5281/zenodo.4730785) Contact: [email protected] 1 Introduction Nucleotide Archive (ENA).
    [Show full text]
  • An Open-Sourced Bioinformatic Pipeline for the Processing of Next-Generation Sequencing Derived Nucleotide Reads
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.20.050369; this version posted May 28, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. An open-sourced bioinformatic pipeline for the processing of Next-Generation Sequencing derived nucleotide reads: Identification and authentication of ancient metagenomic DNA Thomas C. Collin1, *, Konstantina Drosou2, 3, Jeremiah Daniel O’Riordan4, Tengiz Meshveliani5, Ron Pinhasi6, and Robin N. M. Feeney1 1School of Medicine, University College Dublin, Ireland 2Division of Cell Matrix Biology Regenerative Medicine, University of Manchester, United Kingdom 3Manchester Institute of Biotechnology, School of Earth and Environmental Sciences, University of Manchester, United Kingdom [email protected] 5Institute of Paleobiology and Paleoanthropology, National Museum of Georgia, Tbilisi, Georgia 6Department of Evolutionary Anthropology, University of Vienna, Austria *Corresponding Author Abstract The emerging field of ancient metagenomics adds to these Bioinformatic pipelines optimised for the processing and as- processing complexities with the need for additional steps sessment of metagenomic ancient DNA (aDNA) are needed in the separation and authentication of ancient sequences from modern sequences. Currently, there are few pipelines for studies that do not make use of high yielding DNA cap- available for the analysis of ancient metagenomic DNA ture techniques. These bioinformatic pipelines are tradition- 1 4 ally optimised for broad aDNA purposes, are contingent on (aDNA) ≠ The limited number of bioinformatic pipelines selection biases and are associated with high costs.
    [Show full text]
  • Genomic Sequencing of SARS-Cov-2: a Guide to Implementation for Maximum Impact on Public Health
    Genomic sequencing of SARS-CoV-2 A guide to implementation for maximum impact on public health 8 January 2021 Genomic sequencing of SARS-CoV-2 A guide to implementation for maximum impact on public health 8 January 2021 Genomic sequencing of SARS-CoV-2: a guide to implementation for maximum impact on public health ISBN 978-92-4-001844-0 (electronic version) ISBN 978-92-4-001845-7 (print version) © World Health Organization 2021 Some rights reserved. This work is available under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 IGO licence (CC BY-NC-SA 3.0 IGO; https://creativecommons.org/licenses/by-nc-sa/3.0/igo). Under the terms of this licence, you may copy, redistribute and adapt the work for non-commercial purposes, provided the work is appropriately cited, as indicated below. In any use of this work, there should be no suggestion that WHO endorses any specific organization, products or services. The use of the WHO logo is not permitted. If you adapt the work, then you must license your work under the same or equivalent Creative Commons licence. If you create a translation of this work, you should add the following disclaimer along with the suggested citation: “This translation was not created by the World Health Organization (WHO). WHO is not responsible for the content or accuracy of this translation. The original English edition shall be the binding and authentic edition”. Any mediation relating to disputes arising under the licence shall be conducted in accordance with the mediation rules of the World Intellectual Property Organization (http://www.wipo.int/amc/en/mediation/rules/).
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • The Biogrid Interaction Database
    D470–D478 Nucleic Acids Research, 2015, Vol. 43, Database issue Published online 26 November 2014 doi: 10.1093/nar/gku1204 The BioGRID interaction database: 2015 update Andrew Chatr-aryamontri1, Bobby-Joe Breitkreutz2, Rose Oughtred3, Lorrie Boucher2, Sven Heinicke3, Daici Chen1, Chris Stark2, Ashton Breitkreutz2, Nadine Kolas2, Lara O’Donnell2, Teresa Reguly2, Julie Nixon4, Lindsay Ramage4, Andrew Winter4, Adnane Sellam5, Christie Chang3, Jodi Hirschman3, Chandra Theesfeld3, Jennifer Rust3, Michael S. Livstone3, Kara Dolinski3 and Mike Tyers1,2,4,* 1Institute for Research in Immunology and Cancer, Universite´ de Montreal,´ Montreal,´ Quebec H3C 3J7, Canada, 2The Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Ontario M5G 1X5, Canada, 3Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544, USA, 4School of Biological Sciences, University of Edinburgh, Edinburgh EH9 3JR, UK and 5Centre Hospitalier de l’UniversiteLaval´ (CHUL), Quebec,´ Quebec´ G1V 4G2, Canada Received September 26, 2014; Revised November 4, 2014; Accepted November 5, 2014 ABSTRACT semi-automated text-mining approaches, and to en- hance curation quality control. The Biological General Repository for Interaction Datasets (BioGRID: http://thebiogrid.org) is an open access database that houses genetic and protein in- INTRODUCTION teractions curated from the primary biomedical lit- Massive increases in high-throughput DNA sequencing erature for all major model organism species and technologies (1) have enabled an unprecedented level of humans. As of September 2014, the BioGRID con- genome annotation for many hundreds of species (2–6), tains 749 912 interactions as drawn from 43 149 pub- which has led to tremendous progress in the understand- lications that represent 30 model organisms.
    [Show full text]
  • The Interpro Database, an Integrated Documentation Resource for Protein
    The InterPro database, an integrated documentation resource for protein families, domains and functional sites R Apweiler, T K Attwood, A Bairoch, A Bateman, E Birney, M Biswas, P Bucher, L Cerutti, F Corpet, M D Croning, et al. To cite this version: R Apweiler, T K Attwood, A Bairoch, A Bateman, E Birney, et al.. The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Research, Oxford University Press, 2001, 29 (1), pp.37-40. 10.1093/nar/29.1.37. hal-01213150 HAL Id: hal-01213150 https://hal.archives-ouvertes.fr/hal-01213150 Submitted on 7 Oct 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. © 2001 Oxford University Press Nucleic Acids Research, 2001, Vol. 29, No. 1 37–40 The InterPro database, an integrated documentation resource for protein families, domains and functional sites R. Apweiler1,*, T. K. Attwood2,A.Bairoch3, A. Bateman4,E.Birney1, M. Biswas1, P. Bucher5, L. Cerutti4,F.Corpet6, M. D. R. Croning1,2, R. Durbin4,L.Falquet5,W.Fleischmann1, J. Gouzy6,H.Hermjakob1,N.Hulo3, I. Jonassen7,D.Kahn6,A.Kanapin1, Y. Karavidopoulou1, R.
    [Show full text]
  • Multi-Scale Analysis and Clustering of Co-Expression Networks
    Multi-scale analysis and clustering of co-expression networks Nuno R. Nen´e∗1 1Department of Genetics, University of Cambridge, Cambridge, UK September 14, 2018 Abstract 1 Introduction The increasing capacity of high-throughput genomic With the advent of technologies allowing the collec- technologies for generating time-course data has tion of time-series in cell biology, the rich structure stimulated a rich debate on the most appropriate of the paths that cells take in expression space be- methods to highlight crucial aspects of data struc- came amenable to processing. Several methodologies ture. In this work, we address the problem of sparse have been crucial to carefully organize the wealth of co-expression network representation of several time- information generated by experiments [1], including course stress responses in Saccharomyces cerevisiae. network-based approaches which constitute an excel- We quantify the information preserved from the origi- lent and flexible option for systems-level understand- nal datasets under a graph-theoretical framework and ing [1,2,3]. The use of graphs for expression anal- evaluate how cross-stress features can be identified. ysis is inherently an attractive proposition for rea- This is performed both from a node and a network sons related to sparsity, which simplifies the cumber- community organization point of view. Cluster anal- some analysis of large datasets, in addition to being ysis, here viewed as a problem of network partition- mathematically convenient (see examples in Fig.1). ing, is achieved under state-of-the-art algorithms re- The properties of co-expression networks might re- lying on the properties of stochastic processes on the veal a myriad of aspects pertaining to the impact of constructed graphs.
    [Show full text]