Deliverable Title Report on the Phytoplasma Detection And

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Deliverable Title Report on the phytoplasma detection and identification in Haplaxius crudus nymphs and other potential cixiid lethal yellowing (LY) vector identification. Deliverable Number Work Package D2.2 WP2 Lead Beneficiary Deliverable Author(S) COLPO Carlos Fredy Ortiz Beneficiaries Deliverable Co-Author (S) COLPO Carlos Fredy Ortiz UCHIL Nicola Fiore UNIBO Assunta Bertaccini Planned Delivery Date Actual Delivery Date 31/10/2019 28/10/2019

R Document, report (excluding periodic and final X reports) Type of deliverable DEC Websites, patents filing, press & media actions, videos

E Ethycs

PU Public X

Dissemination Level CO Confidential, only for members of the consortium

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Table of contents

List of figures 5 List of tables 6 List of acronyms and abbreviations 7 Executive summary 8 1. Introduction 9 2. Reproduction in captivity of Haplaxius crudus 10 2.1. Material and methods 10 Preliminary assays for reproduction in captivity of H. crudus 11 Assays for reproduction in captivity of H. crudus 12 2.2. Results and discussion 13 Preliminary assays for reproduction in captivity of H. crudus 13 Assays for reproduction in captivity of H. crudus 14 2.3. Conclusions 14 3. Detection and identification of phytoplasmas in nymphs of cixiids 15 3.1. Material and methods 15 DNA extraction 15 Nested Polymerase Chain Reaction (nested PCR) 15 PCR products purification and sequencing 16 3.2. Results and discussion 16 3.3 Conclusions 18 4. Molecular identification of H. crudus and H. caldwelli nymphs 18 4.1. Material and methods 18 Insect collection and DNA extraction 18 PCR amplification of the cytochrome C oxidase subunit I region in the mtDNA 18 (mitochondrial DNA) (mitochondrial DNA) PCR products purification and sequencing 18 Sequencing and restriction fragment length polymorphism (RFLP) analyses 20 of amplified DNA obtained by the primers C1-J-2183 and UEA8 4.2. Results and discussion 20

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

PCR amplification of the cytochrome C oxidase subunit I region in the mtDNA 20 (mitochondrial DNA) Sequencing and restriction fragment length polymorphism (RFLP) analyses 20 of amplified DNA obtained by the primers C1-J-2183 and UEA8 4.3. Conclusions 21 5. References 22

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

List of figures

Figure 1: Sampling during 2019 in the locality of Pailebot 11

Figure 2: Preliminary assays for reproduction in captivity of H. crudus 12

Figure 3: Assays for reproduction in captivity of H. crudus with pot-cages and P. 13 laxum grass Figure 4: Cixiid nymph in the 4th instar, associated to the rhizosphere of Eustachys 17 petreae Figure 5: Phylogenetic tree derived by the sequence analysis of the primers 17 503F/LY16Sr Figure 6: Phylogenetic tree derived by the sequence analysis of the primers C1-J- 21 2183/UEA8

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

List of tables

Table 1: Alternative host families and species found in the coconut localities 10 visited. Soil parameters measured

Table 2: Number of adult individuals of H. crudus emerged in the pot-cages used 13 in the preliminary assay for reproduction in captivity

Table 3: Adult insects of H. crudus born in captivity 14 Table 4: Sequences of primers used for the PCR amplification of a fragment of the 19 COI gene of H. crudus and H. caldwelli Table 5: Virtual RFLP analyses of DNA from H. crudus and H. caldwelli with AluI, 21 SspI, ClaI, RsaI and TaqI on C1-J-2183/UEA8 amplicons

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

List of acronyms and abbreviations 16S rDNA - 16S ribosomal deoxyribonucleic acid 16S rRNA - 16S ribosomal ribonucleic acid 18S rDNA - 18S ribosomal deoxyribonucleic acid μM - micromolar bp - base pair BSA - bovine serum albumin CICY - Centro de Investigación Científica de Yucatán C. nucifera - Cocos nucifera COLPO - Colegio de Postgraduados CTAB - cetyl trimethylammonium bromide DNA - deoxyribonucleic acid dNTPs - deoxynucleotides EDTA - ethylenediaminetetraacetic acid E. petreae - Eustachys petreae

H2O - water H. caldwelli - Haplaxius caldwelli H. crudus - Haplaxius crudus H. skarphion - Haplaxius skarphion LY - lethal yellowing M - molar ml - milliliter mtCOI DNA - mitochondrial cytochrome C oxidase I deoxyribonucleic acid mtDNA - mitochondrial deoxyribonucleic acid NaCl - sodium chloride NJ - Neighbor Joining PCR - polymerase chain reaction P. laxum - Panicum laxum

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

PVP-40 - polyvinylpyrrolidone 40 RFLP - restriction fragment length polymorphism rDNA - ribosomal deoxyribonucleic acid RNA - ribonucleic acid rpm - revolution per minute Tris - tris(hydroxymethyl) aminomethane Tris-HCl - tris(hydroxymethyl) aminomethane chloridrate U - unit UCHIL - Universidad de Chile UNIBO - Alma Mater Studiorum - University of Bologna UV - ultraviolet

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Executive summary Nowadays the only species that has been confirmed as vector of the phytoplasmas 16SrIV- A and -D in coconut palms in Mexico, is Haplaxius crudus. However, other species of Haplaxius, such as H. skarphion, H. caldwelli, among others, captured in coconut palm orchards in Mexico, have been found positive for the presence of these phytoplasmas, but it has not yet been possible to confirm their role as insect vectors. To generate information in this regard, the focus of the present work was to develop the rearing technique for Haplaxius species, detect phytoplasmas in nymphs of cixiids and identify molecularly the Haplaxius species when the insects are still in the nymph stage. For the first time, the rearing of H. crudus in captivity was obtained and the first report about the detection of the phytoplasma 16SrIV-A in nymphs of the Cixiidae is presented here. Moreover, by using PCR and RFLP analyses, it was possible identify rapidly and specifically H. crudus and H. caldwelli in their nymph stages.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

1. Introduction

The genus Haplaxius Fowler has a distribution in the New World (Ferreira et al., 2010), which includes 34 species from North America and Northern Mexico; in addition, there are 31 species in the Neotropic (Bartlett et al., 2011). However, currently the only species that has been confirmed as vector of the phytoplasmas belonging to the ribosomal subgroups 16SrIV- A and -D, is Haplaxius (Myndus) crudus (Narvaez et al., 2018), however other species are suspected to play this role in areas with presence of lethal palms decay (Dollet et al., 2010; Halbert et al., 2014). In some coconut plantations, it is reasonable to think that other Haplaxius species, such as H. skarphion, H. caldwelli, among the others, may be participating in the transmission of phytoplasmas due to their phylogenetic proximity to the main vector (Bertin et al., 2010a), also having overlapping ecological niches in coconut plantations (Ramos et al., 2018). Certainly, H. skarphion and H. caldwelli have already been found to be positive for the phytoplasma of group 16SrIV (Ramos, 2018), but it is necessary to identify the ribosomal subgroup and which are the vectors involved in the transmission. Moreover, in some exploratory surveys in these plantations, phytoplasma-positive cixiids nymphs have been found which have not been identified in either genus or species. Bertin et al. (2010b), mention that the modern identification of cixiids is based on morphological characteristics and is restricted to a small number of specialist entomologists with extensive experience about the families belonging to the Cixiidae genus. Even for experts, the morphological distinction of closely related species is difficult. The morphological identification of H. crudus, H. skarphion and H. caldwelli is possible for adults with dichotomous clues such as those of Kramer (1983), but not for their nymph stages. These nymph stages of cixiids species are difficult to observe in the field, because they feed on roots of their host plants (Sforza et al., 1999) and have a low mobility. The molecular identification of insects provides a fast and reliable key tool that can contribute to expand the knowledge about the identifications of cixiids. In addition, these markers can also be applied successfully to nymphs, whose morphological characteristic is limited to a few species of the Cixiidae family. Ceotto et al. (2008) demonstrated that the phylogenetic trees obtained using the mitochondrial cytochrome C oxidase I (mtCOI DNA) and the 18S rDNA nucleotide sequences were congruent, and that the trees were consistent with the morphological classification. Nuclear and mitochondrial genomes have different modes of inheritance, and the effectiveness of nuclear loci and mitochondrial DNA for monitoring phylogeny may differ between phylogenetic levels (Song and Liang, 2013). Mitochondrial and ribosomal DNA, as well as some nuclear genes are more conserved and have repeatedly provided knowledge about the genetic evolution of species and genera that recently diverged (Behura, 2006). Therefore, the genes encoding mtDNA, rDNA and other nuclear DNAs are commonly used for the species identification (Bertin and Bosco, 2013). The focus of this work was to develop

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

the rearing technique for Haplaxius crudus, detect phytoplasmas in nymphs of cixiids and identify molecularly the Haplaxius species when the insects are still in the nymph stage.

2. Reproduction in captivity of Haplaxius crudus

2.1. Material and methods The main host species of Haplaxius crudus nymphs are Brachiaria humidicola, B. mutica, Eustachis petraea and Paspalum maximum (Ramos et al., 2018). Three localities in Mexico (Pailebot, Cárdenas, Tabasco) with coconut orchards in which LY disease is active, were monthly monitored with the objective to characterize the initial environmental conditions in which the immature stages of H. crudus reproduce and develop. In these orchards, in addition to the main H. crudus host plants indicated above, six other weeds were also present (Table 1). The reproduction in captivity of H. crudus, was carried out in cages of own design, and with adult insects captured in the field.

Table 1: Alternative host families and species found in the coconut localities visited. Soil parameters measured Coconut Soil parameters Host family Host species locality measured Brachiaria decumbens Stapf

*Brachiaria humidicola (Rendle) Schweick

*Brachiaria mutica (Forssk.) Stapf

Digitaria abyssinica (Hochst. Ex A. Rich.) -Humidity Poaceae Stapf -Temperature -Pailebot * Eustachys petraea (Sw.) Desv. -Texture -Cárdenas -Freatic mantle Leersia hexandra Sw. -Tabasco -Depth Panicum laxum Sw. -others *Paspalum maximun Jacq.

Portulacacea Portulaca pilosa L e

Cyperaceae Cyperus ligularis L.

*Main host species of H. crudus nymphs (Ramos et al., 2018).

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Preliminary assays for reproduction in captivity of H. crudus

To this purpose, the most favorable conditions for the development of the insect vector were adopted. These were the ones existing in Pailebot (Figure 1), in association to the grass species Panicum laxum. This site remains flooded from December to February. The water gradually withdraws during the following months, leaving favorable soil conditions for the development of nymphs (Figure 1). In order to confirm that the nymphs developed in this locality correspond to H. crudus, four soil samples with nymphs and waxy exudate were collected, two in April and two in May 2019, respectively. Each sample was introduced in a pot-cage and transferred to the laboratory. The cages were maintained at room temperature (25-30°C), and monitored every 15 days for two months, to record the emergence of adult insects (Figure 2).

Figure 1: Sampling during 2019 in the locality of Pailebot. Above: monthly sequence of the soil drying process. Below left and center: nymphs with waxy exudates. Below right: nymph of H. crudus

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Figure 2: Preliminary assays for reproduction in captivity of H. crudus. Left: inside of a pot-cage with waxy secretions of nymph. Right: pot-cages in the laboratory

Assays for reproduction in captivity of H. crudus

Four one-year-old palms Pritchardia pacifica 30-50 cm high, were planted in plastic pots (0.5 m diameter x 0.47 m high) whit sandy soil sterile from Pailebot site. P. laxum seeds were sown in each pot. Oviposition take place in the weed, simulating what happen in the field. For each pot a cylindrical cage with iron frame of 1 m height x 0.2 m radius was designed. The cage coat consists of transparent tulle. On the cover of the cage, openings were made to allow the introduction of insects (Figure 3). The insects released in each pot-cage have been captured in the center of the Adonidia merrillii palm orchards, in the localities of Pomoca, Huimanguillo and Tabasco. The capture occurred in the morning, with CICY´s modified dispositive of capture (Narvaez et al., 2018). The modification consists in the assembly of two falcon tubes: The first 15 ml tube, with an opening in the lower end, was inserted in the opening of another 50 ml tube. In each cage, 18 to 22 insects were released, using the same number of males and females. The insect collection was carried out weekly during one month, and for each capture one assay cage was used, being the cage number 1 the first used for the assay (Table 3). The cages were placed in a shaded greenhouse at 30-35°C, and the soil moisture was maintained by means of continuous irrigation.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Figure 3: Assays for reproduction in captivity of H. crudus with pot-cages and P. laxum grass. A: general appearance of insect cages and their components; B: grass base of P. laxum with waxy exudate; C and D: nymphs in 4 and 5 instars; E: H. crudus adults born in captivity

2.2. Results and discussion

Preliminary assays for reproduction in captivity of H. crudus

Seventy-five adult insects emerged in the four pots-cages (Table 2). The emergence was discontinuous possibly due to the different egg laying times of the females. The survival average of the adults was nine days. Some insects born in captivity were introduced into Eppendorf tubes in 90% alcohol and conserved at -20ºC.

Table 2: Number of adult individuals of H. crudus emerged in the pot-cages used in the preliminary assay for reproduction in captivity

Range of days for insect’s emergence and number of Total number Pot- insects emerged of insects cage 31-45 < 15 days 16-30 days >45 days emerged days 1 5 4 6 3 18

2 7 7 6 1 21

3 2 5 4 2 13

4 6 9 5 3 23

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Total 20 25 21 9 75

All the insects emerged in the pot-cages were identify as H. crudus, this means that P. laxum behaves as a suitable host for it use in the assays for the reproduction in captivity of this insect species. The number of adult insects that have emerged during this test could be considered low. However, it must be taken into account that the number of males and females present at the start of the assay was unknown. In addition, there was no information available about the amount of adult individuals that one insect pair is capable of generating. P. laxum is a weed native to America and can grow between 30 and 60 cm in height (Melendez, 1997). It is a very good host of H. crudus and grows very well in the pot-cages. In this work, the weed has been used for the first time to achieve, successfully, the reproduction in captivity of H. crudus.

Assays for reproduction in captivity of H. crudus

The 83 mature insects that were born in the four cages were all identified as H. crudus. The days for the emergence of insects ranged from 40 to 64 (Table 3). The days for the emergence in the pot-cages 1 and 2, coincide with the means reported by Tsai and Kirsch (1978), for nymphs produced in the laboratory in Saint Agustin grass, Stenotaphrum secundatum. On the other hand, for the pot-cages 3 and 4, the reproduction time was 40 days, due to the increase of the number of the hours with temperature higher than 30°C, during the assays weeks at the end of March and beginning of April. During these trials no nymphs were captured, in order to maintain the habitat stability in the pot-cages. However, nymphs and exudates of the nymph waxes were observed in the field early, as described (Howard, 2012). In addition, it was not necessary to capture nymphs since the morphological descriptions of the five instants of nymphs of H. crudus are known (Wilson and Tsai, 1982).

Table 3: Adult insects of H. crudus born in captivity

H. crudus introduced in Days for the Number of H. crudus Pot-cage pot-cage (1:1- emergence adults born female:male) 1 18 64 8

2 22 47 21

3 20 40 28

4 22 40 26 2.3. Conclusions

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

The reproduction of H. crudus in captivity was possible, with pot-cages, sandy soils and an average daytime temperature of 30-35°C. This is the first reproduction in captivity of H. crudus. 3. Detection and identification of phytoplasmas in nymphs of cixiids

3.1. Material and methods In previous studies it was found that the weed E. petreae was positive to the phytoplasma 16SrIV-A (Teran, 2014). Because of this, it was considered to determine if the nymphs of the cixiids associated with the rhizosphere of this weed were also positive to phytoplasma presence. In a coconut palm plantation where 12 coconut palm hybrids were established to assess their resistance to LY, 15 plant of E. petreae were surveyed for the presence of cixiids nymphs. The nymphs were captured using a mouth aspirator with collecting vial (pooter). This system allows storing the captured nymphs in a plastic container (collecting vial). Once the nymphs were collected they were transported to the phytopathology laboratory. The nymphs were separated, inserted in 2 ml tubes with 90% ethanol, and stored at -20°C until DNA extraction.

DNA extraction

The total DNA of each insect was extracted using the CTAB method described by Harrison et al. (1996) and Brown et al. (2006). Before starting the DNA extraction process, the ethanol was removed from the insect by evaporation. The insects were placed individually in 1.5 ml tubes containing 300 μl of CTAB extraction buffer (2% CTAB; 100 mM Tris-HCl, pH 8.0; 20 mM EDTA, pH 8.0; 3 M NaCl; 1% PVP-40 and 1% 2-mercaptoethanol) and macerated with micro pestles. Subsequently, extracts were incubated at 65°C for one hour in a water bath, then 300 μl of phenol-chloroform-isoamyl alcohol (25: 24: 1) was added and centrifuged (Eppendorf Centrifuge 5427R, Germany) at 14,000 rpm for 10 minutes. The supernatant was placed in a new 1.5 ml tube and the DNA was precipitated by adding 3 M sodium acetate and cold isopropanol volumes (30 μl and 180 μl, respectively), mixed by inversion and incubated at -20°C for 1 hour. In order to precipitate the DNA pellet, it was centrifuged at 14,000 rpm for 10 minutes and the supernatant was discarded. Two washes of the DNA pellet were performed with 100 μl of 70% ethanol and allowed to dry at room temperature for 15-20 minutes. The pellet was re-suspended in 30 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). The total DNA obtained from the insects was visualized by electrophoresis in 1% agarose gels in TAE 1 X buffer (Tris base, acetic acid and EDTA) stained with ethidium bromide.

Nested Polymerase Chain Reaction (nested PCR)

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

The P1/P7 primers (Deng and Hiruki, 1991; Schneider et al., 1995) were used for the amplifications. Resulting products were diluted 1: 40 with ultrapure water, and 2 µl of the dilution was amplified for 35 cycles using LY-specific 16S rRNA gene primer pair 503F/LY16Sr (Harrison et al., 1999). PCR amplifications were performed with a C1000TM Thermal Cycler (Bio-Rad, Hercules, CA, USA) using 1 U of the Mango TaqTM DNA polymerase (Bioline, UK) in a total volume reaction of 25 µl, that contained 2 µl of dNTPs (1.25 mM), 5 µl of 10 X PCR buffer, 5 units of Taq- polymerase, and 2 µl of each primer (25 ng/µl). The reaction was performed with an initial 2 minutes cycle at 94°C, followed by 35 cycles of 1 minute at 94°C, annealing for 50 seconds at 60°C, and extension for 80 seconds at 72°C. Reactions were terminated with 10 minutes at 72°C extension step and cooled to 4°C. The PCR products were analysed by electrophoresis with a 1% agarose gel stained with ethidium bromide and visualized examined by using a UV translluminator Molecular Image® Gel DocTM XR System (BioRad, Hercules, CA). Negative controls were DNA extracted from non-symptomatic plants and sterile water. Coconut palm DNA (GenBank accession number GU473590) previously identified as infected by LY was used as a positive control (Vazquez-Euan et al., 2011). PCR products purification and sequencing PCR amplicons from the 503F/LY16Sr primers were purified in columns of the QIAquick GelExtraction kit (QIAGEN®, Hilden, DE, USA) according to the manufacturer’s instructions. All purified products were quantified in a nanodrop spectrophotometer (Jenway- GenovaNano, UK). The sequencing was performed with the 3500xl Genetic Analyzer (Applied Biosystems, USA). The sequencing was performed in both directions.

3.2. Results and discussion Six out of 33 nymphs (Figure 4), whose species was unknown, collected in the rhizosphere of E. petreae, were positive to the phytoplasma 16SrIV-A (Figure 5). H. crudus, in its nymph stages, may coexist with nymphs of H. skarphion and H. caldwelli in some species of poaceas and also with nymphs of another cixiid, Oeclus snowi (Ramos et al., 2018). This means that in the coconut palm there is a complex pathosystem enclosing multitrophic interactions that deserve further research.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Figure 4: Cixiid nymph in the 4th instar, associated to the rhizosphere of Eustachys petreae

Figure 5: Phylogenetic tree derived by the analysis of the sequences obtained with primers 503F/LY16Sr. The tree was build using the Neighbor-Joining method. The model was Tajima-Nei (Tajima and Nei, 1984). Bacillus subtilis (GenBank accession number AJ544638) was used as an external group. The sequences of the phytoplasma strains in Eustachys petraea and nymph of Cixiidae are in bold. The length of the branches represents the distances between sequences. Bootstrap values for 2,000 replicas are shown in the branches. The GenBank accession number for each sequence is in parentheses, followed by phytoplasma ribosomal subgroup 3.3. Conclusions This is the first report about the detection of the phytoplasma 16SrIV-A in nymphs of the Cixiidae family. It is possible that the nymphs have acquired the phytoplasma feeding on the roots of the E. petreae. It was necessary to identify the nymphs by a molecular tool as described below.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

4. Molecular identification of H. crudus and H. caldwelli nymphs.

4.1. Material and methods

Insect collection and DNA extraction

Adult individuals were collected with a hand-held leaf blower by vacuum under coconut (C. nucifera) and kerpi (Adonidia merrillii) palms leaflets, early in the morning or in the afternoon. The capture of H. crudus and H. caldwelli was carried out during 2017-2018 in palms with symptoms of lethal yellowing in several locations in the Chontalpa region, Tabasco, Mexico. All the specimens were preserved in 90% ethanol and stored at -20°C. Subsequently, the specimens were stored at -80°C in the genomics laboratory of the University Juárez Autónoma of Tabasco. Genomic DNA was extracted from adults using cetyltrimethylammonium bromide (CTAB) according to the Harrison et al. (1996) and Brown et al. (2006). The ethanol was removed from the insect before starting the extraction process. The DNA extraction was carried on as described in 3.1.

PCR amplification of the cytochrome C oxidase subunit I region in the mtDNA (mitochondrial DNA)

The nucleotide sequence data were generated using the cytochrome C oxidase I (COI) gene. The mtDNA genes have many advantages including a relatively rapid, easy to used mutation rate and known PCR primers (Bazrafkan et al., 2016). A fragment of the COI gene of approximately de 1 kb was amplified for the three species through a series of PCR assays (Simon et al., 1994; 2006; Lunt et al., 1996) whose amplification products overlap (Table 4). The primers HCCOI F/R (Table 4) were designed in this work from sequences of H. crudus genome (GenBank accession number KF472314).

The PCRs were carried out in 25 μl of reaction volume, with 5 X of PCR buffer, MgCl2 50 mM, 100 ng of each primer, 100 μM of dNTP (Invitrogen, USA), 0.5 U of Mango TaqTM (Bioline, United Kingdom) and 50 ng of template. The PCR cycle conditions for mtDNA were: initial denaturation at 95°C for 2 minutes, 35 cycles at 94°C for 1 minute, 48-60°C according to the first pair used for 1 minute, 72°C for 1 minute and a final extension at 72°C for 5 minutes. PCR products were visualized by electrophoresis on a 2.0% agarose gel stained with ethidium bromide.

PCR products purification and sequencing

PCR amplicons obtained were purified in columns of the QIAquick GelExtraction kit (QIAGEN®, Hilden, DE, USA) according to the manufacturer’s instructions. All purified

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

products were quantified in a nanodrop spectrophotometer (Jenway-GenovaNano, UK). The amplicons sequences were obtained with 3500xl Genetic Analyzer (Applied Biosystems, USA) at the Biotechnology Institute of the National Autonomous University of Mexico. The sequencing was performed in both directions.

Table 4: Sequences of primers used for the PCR amplification of a fragment of the COI gene of H. crudus and H. caldwelli

Primer Sequence (5´ - 3´) Reference

HCCOI (R) AATGAAAATGGGCGACTA This work

HCCOI (F) ATTGCAGTACCGACAGGA This work

UEA1 (F) GAATAATTCCCATAAATAGATTTACA Lunt et al., 1996

Zhang and Hewitt TY-N-1438d (F) GAAWAATTCCYATAAWTARATTTACA 1996

LCO1490-L (F) GGTCWACWAATCATAAAGATATTGG Nelson et al., 2007

LCO1490 (F) GGTCAACAAATCATAAAGATATTGG Folmer et al., 1994

C1-J1709 (F) AATTGGGGGGTTTGGAAATTG Simon et al., 2006

C1-J-1718 (F) GGGGGGTTTGGAAATTGATTAGTGCC Simon et al., 1994

C1-N1738 (R) TTTATTCGTGGGAATGCTATGTC Simon et al., 2006

HCO2198 (R) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al., 1994

HCO2198-L (R) TAAACTTCWGGRTGWCCAAARAATCA Nelson et al., 2007

C1-J-2183 (Jerry) CAACATTTATTTTGATTTTTTGG Simon et al., 1994 (F)

C1-N-2659 (Mila1) GTCAATCCAGTAAATAATGG Simon et al., 1994 (R)

UEA8 (R) AAAAATGTTGAGGGAAAAATGTTA Lunt et al., 1996

UEA9 (F) GTAAACCTAACATTTTTTCCTCAACA Lunt et al., 1996

C1-N2776 (R) GGTAATCTGAATAACGTCGAGG Simon et al., 2006

TL2-N-3014 (Pat) TCCATTGCACTAATCTGCCATATTA Simon et al., 1994 (R)

UEA10 (R) TCCAATGCACTAATCTGCCATATTA Lunt et al., 1996

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Sequencing and restriction fragment length polymorphism (RFLP) analyses of amplified DNA obtained by the primers C1-J-2183 and UEA8

Using the sequences obtained from H. crudus and H. caldwelli with the primers C1-J-2183 and UEA8 (Ceotto et al., 2008; Halbert et al., 2014; Silva et al., 2019), a phylogenetic tree was constructed with the Neighbor Joining method (Saitou and Nei, 1987) using the MEGA7 program (Kumar et al., 2016). Further, the same sequences were analyzed with the NEBcutter V2.0 program (http://nc2.neb.com/NEBcutter2/) to define the restriction sites. Based on these, the restriction enzymes selected were: AluI, SspI, ClaI, RsaI and TaqI (Promega Corporation, Madison, USA). The digestion of the PCR products was carried out according to the manufacturer’s instructions. A reaction volume of 20 µl contain: 13 µl of ultrapure H2O, 2 µl of corresponding buffer for each enzyme, 2 µl of BSA, 2 µl of PCR product and 1 U of the enzyme. Ten µl of the digested product was mixed with 2 µl of loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol). The RFLP profiles will be separated by electrophoresis on a 3% agarose gel at 80 V for 1 h and stained with ethidium bromide. The amplicons from H. crudus and H. caldwelli obtained using the primer pair C1- J-2183/UEA8, were analyzed in the NEBcutter V2.0 program.

4.2. Results and discussion

PCR amplification of the cytochrome C oxidase subunit I region in the mtDNA (mitochondrial DNA)

Among the primers listed in Table 4, only from 15 pairs was possible to obtain an amplification product from H. crudus and H. caldwelli. Five out 15 primer pairs were able to amplify the COI gene of both species of cixiids. Direct PCR amplicons were generated with the primer pairs UEA1/ C1-N1738 (TM: 55°C), UEA 9/UEA10 (TM: 55°C), LCO1490-L/HCO2198-L (TM: 55°C). Meanwhile, positive results were obtained by semi-nested PCR amplification using C1-J-1718/C1-N2776 (TM: 64°C) primers above on C1-J1709/C1-N2776 (TM: 49°C) amplicons.

Sequencing and restriction fragment length polymorphism (RFLP) analyses of amplified DNA obtained by the primers C1-J-2183 and UEA8

The sizes of the sequences amplified with these pairs of primer ranged from 550 to 560 bp. A phylogenetic tree was constructed (Figure 6). The individuals of H. crudus found in Tabasco grouped in the same cluster with those from USA (Halbert et al., 2014; Ceotto et al., 2008) and clearly separated from insects belonging to the species H. caldwelli. The virtual RFLP,

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

allows to infer that the restriction enzymes AluI, SspI, ClaI, RsaI and TaqI can specifically identify both species (Table 5).

Figure 6: Phylogenetic tree derived by the sequence analysis of the sequences obtained with the primers C1-J-2183/UEA8. The tree was build using the NJ method. The model was Tajima-Nei (1984). Aetalion reticulatum (GenBank accession number KX924889) was used as an out group. The sequences of the insects obtained in this work are in bold. The length of the branches represents the distances between sequences. Bootstrap values for 2,000 replicas are shown in the branches. The GenBank accession number for each sequence is in parentheses

Table 5: Virtual RFLP analyses of DNA from H. crudus and H. caldwelli with AluI, SspI, ClaI, RsaI and TaqI on C1-J-2183/UEA8 amplicons

H. crudus RFLP H. caldwelli RFLP Restriction enzyme fragments (bp) fragments (bp)

AluI 271, 215,114 270, 152, 99, 42, 21, 15

SspI 321, 279 321, 237, 41

ClaI - 398, 201

RsaI 351, 249 -

TaqI - 398, 201

4.3. Conclusions With these new molecular tools, it is possible detect and identify rapidly the Haplaxius species in their nymph stages.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

5. References

Bartlett CR, Adams ER, Anthony JrT (2011) Planthoppers of Delaware (Hemiptera, Fulgoroidea), excluding Delphacidae, with species incidence from adjacent States. ZooKeys 83, 1.

Bazrafkan S, Vatandoost H, Heydari A, Bakhshi H, Panahi-Moghadam S, Hashemi-Aghdam S, Oshaghi MA (2016) Discrimination of Paederus fuscipes and Paederus littoralis by mtDNA-COI PCR-RFLP. Journal of Arthropod-Borne Diseases 10(4), 454.

Behura SK (2006) Molecular marker systems in insects: current trends and future avenues. Molecular Ecology 15, 3087-3113.

Bertin S, Bosco D (2013Molecular identification of phytoplasma vector species. In: Phytoplasma: Methods and Protocols, Methods in Molecular Biology. Edited by Dickinson M and Hodgetts J, 87-108.

Bertin S, Picciau L, Ács Z, Alma A, Bosco D (2010a) Molecular identification of the Hyalesthes species (Hemiptera: Cixiidae) occurring in vineyard agroecosystems. Annals of Applied Biology 157(3), 435-445.

Bertin S, Picciau L, Ács Z, Alma A, Bosco D (2010b) Molecular differentiation of four Reptalus species (Hemiptera: Cixiidae). Bulletin of Entomological Research 100(5), 551-558.

Brown S, Been BO, McLaughlin W (2006) Detection and variability of the lethal yellowing group (16Sr IV) phytoplasmas in the Cedusa sp. (Hemiptera: Auchenorrhyncha: Derbidae) in Jamaica. Annals of Applied Biology 149, 53-62.

Ceotto P, Kergoat GJ, Rasplus JY, Bourgoin T (2008) Molecular phylogenetics of cixiid planthoppers (Hemiptera: Fulgoromorpha): New insights from combined analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution 48 (2), 667-678.

Deng S, Hiruki C (1991) Amplification of 16S rRNA genes from culturable and nonculturable Mollicutes. Journal of Microbiological Methods 14. 53-61.

Dollet M, Llauger R, Fabre S, Julia JF, Gonzalez C, Cueto J (2010) Nymphocixia caribbea (Fennah) (Homoptera: Cixiidae) potential candidate as coconut lethal yellowing vector in the Carribean. COST action FA0807 "Integrated Management of Phytoplasma Epidemics in Different Crop Systems", 2010/02/01-02, Sitges, Spain.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Ferreira M, Mckamey SH, Martinez RT (2010) New records of Haplaxius (Hemiptera: Cixiidae) in the Dominican Republic, with description of a new species. Zootaxa 2614, 65-68.

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294-299.

Halbert SE, Wilson SW, Bextine B, Youngblood SB (2014) Potential planthopper vectors of palm phytoplasmas in Florida with a description of a new species of the genus Omolicna (Hemiptera: Fulgoroidea). Florida Entomologist 97(1), 90-98.

Harrison N, Richardson P, Tsai J, Ebbert M, Kramer J (1996) PCR assay for detection of the phytoplasma associated with maize bushy stunt disease. Plant Disease 80, 263- 269.

Harrison N, Cordova I, Richardson P, Dibonito R (1999) Detection and diagnosis of lethal yellowing. Pages 183-196 in: Current Advances in Coconut Biotechnology. C Oropeza, JL Verdeil, GR Ashburner, R Cardeña, JM Santamaría eds. Springer Netherlands, Dordrecht.

Howard FW (2012) Featured creatures, American palm cixiid, Myndus crudus van Duzee (Insecta: Hemiptera: Auchenorrhyncha: Fulgoroidea: Cixiidae). University of Florida Institute of Food and Agricultural Sciences and Florida Department of Agriculture and Consumer Services. EENY-389.

Kramer JP (1983) Taxonomic study of the planthopper family Cixiidae in the United States (Homoptera: Fulgoroidea). Transactions of the American Entomological Society 109, 1-57.

Kumar S, Stecher G, Tamura K (2016) MEGA 7: Molecular evolutionary genetics analysis version 7 for bigger datasets. Molecular Biology and Evolution 33, 1870-1874.

Lunt DH, Zhand DX, Szymura JM, Hewitt GM (1996) The insect cytochrome oxidase I gene evolutionary patterns and conserved primers for phylogenetic studies. Insect Molecular Biology 5, 153-165.

Meléndez NF (1997) Siembra y manejo de pastos para la zona de la Chontalpa, Tabasco. Manual para productores INIPAP-ISPROTAB. Tabasco, México. 18 pp.

Narvaez M, Vázquez-Euán R, Harrison NA, Nic-Matos G, Julia JF, Dzido JL, Fabre S, Dollet M, Oropeza C (2018) Presence of 16SrIV phytoplasmas of subgroups -A, -D and - E in planthopper Haplaxius crudus van Duzee insects in Yucatán, Mexico. 3 Biotech 8(1), 61.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Nelson LA, Wallman JF, Dowton M (2007) Using COI barcodes to identify forensically and medically important blowflies. Medical and Veterinary Entomology 21(1), 44-52.

Ramos E (2018) Ecologia del Fitoplasma del grupo 16SrIV asociado a un patosistema de coco en Tabasco, Mexico. PhD thesis. University Juárez Autonoma de Tabasco, Mexico. Mexico. 117 pp.

Ramos E, Magaña AMA, Ortiz CF, Oropeza C, Lesher JM, Sánchez S (2018) The coconut pathosystem: weed hosts of nymphs of the American palm Cixiid Haplaxius crudus (Hemiptera: Fulgoroidea). Journal of Natural History 52(5-6), 255-268.

Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolutions 4(4), 406-425.

Schneider B, Seemüller E, Smart CD, Kirkpatrick BC (1995) Phylogenetic classification of plant pathogenic mycoplasmalike organisms or phytoplasmas. In: Molecular and Diagnostic Procedures in Mycoplasmology, Ed Razin S, Tully JG. 369-380.

Sforza R, Bourgoin T, Wilson SW, Boudon-Padieu E (1999) Field observations, laboratory rearing and descriptions of immatures of the planthopper Hyalesthes obsoletus (Hemiptera: Cixiidae). European Journal of Entomology 96(4), 409-418.

Silva FG, Passos EM, Diniz LEC, Teodoro AV, Talamini V, Fernandes MF, Dollet M (2019) Occurrence in Brazil of Haplaxius crudus (Hemiptera: Cixiidae), vector of coconut lethal yellowing. Neotropical Entomology 48(1), 171-174.

Simon C, Buckley TR, Frati F, Stewart JB, Beckenbach AT (2006) Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annual Review of Ecological Evolutionary Systematic 37, 545-579.

Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651–702.

Song N, Liang A-P (2013) A preliminary molecular phylogeny of planthoppers (Hemiptera: Fulgoroidea) based on nuclear and mitochondrial DNA sequences. Plos One 8, e58400.

Tajima F, Nei M (1984) Estimation of evolutionary distance between nucleotide sequences. Molecular Biology and Evolution 1(3), 269-285.

This project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No. 727459

Teran N (2014) Importancia de las arvenses en la dispersion del amarillamiento letal del cocotero. Master's thesis. Colegio de Postgraduados (COLPO) Campus Tabasco, Tabasco, Mexico. 75 pp.

Tsai JH, Kirsch OH (1978) Bionomics of Haplaxius crudus (Homoptera: Cixiidae). Environmental Entomology 7(2), 305-308.

Vázquez-Euán R, Harrison NA, Narvaez M, Oropeza C (2011) Occurrence of a 16SrIV group phytoplasma not previously associated with palm species in Yucatan, Mexico. Plant Disease 95, 256–262.

Wilson SW, Tsai JH (1982) Descriptions of the immature stages of Myndus crudus (Homoptera: Fulgoroidea: Cixiidae). New York Entomological Society 90(3), 166- 175.

Zhang D-X, Hewitt GM (1996) Nuclear integrations: challenges for mitochondrial DNA markers. Trends in Ecology and Evolution 11, 247-251.