Large Gene Deletion and Changes in Corneal Endothelial Cells in a Family with Choroideremia

Multidisciplinary Ophthalmic Imaging Large Gene Deletion and Changes in Corneal Endothelial Cells in a Family With Choroideremia

Shih-Yun Lee,1–4 Wei-Kuang Yu,1,4 and Po-Kang Lin1,4,5

1Department of Ophthalmology, Faculty of Medicine, National Yang-Ming University, Taipei, Taiwan 2Department of Ophthalmology, Cardinal Tien Hospital, New Taipei City, Taiwan 3School of Medicine, College of Medicine, Fu Jen Catholic University, New Taipei City, Taiwan 4Department of Ophthalmology, Taipei Veterans General Hospital, Taipei, Taiwan 5Graduate Institute of Biomedical Electronics and Bioinformatics, National Taiwan University, Taipei, Taiwan

Correspondence: Po-Kang Lin, De- PURPOSE. We provided the first report of an association between changes in corneal partment of Ophthalmology, Faculty endothelial cells, retina, and choriocapillaris in a choroideremia family. of Medicine, National Yang-Ming University, No. 155, Sec. 2, Linong METHODS. Four members of an Asian choroideremia family, comprising two affected patients Street, Beitou District, Taipei City and two carriers, were evaluated. All participants underwent complete eye examinations, 11221, Taiwan, ROC; including visual acuity (VA), slit-lamp examination, ophthalmoscopy, perimetry, and [email protected]. electrophysiology tests. In addition, images of corneal endothelium were captured with a Submitted: December 21, 2014 noncontact specular microscope. Genomic DNA amplification and whole-genome cytogenic Accepted: February 18, 2015 array analysis were used to confirm the diagnosis of choroideremia and determine the molecular basis of the phenotype. Citation: Lee S-Y, Yu W-K, Lin P-K. Large gene deletion and changes in RESULTS. In the affected patients, funduscopy revealed characteristic features of RPE and corneal endothelial cells in a family chorioretinal atrophy. The slit-lamp biomicroscopy disclosed unexpected pigmented punctate with choroideremia. Invest Ophthal- lesions in the corneal endothelium in one of them. Surprisingly, specular microscopy detected mol Vis Sci. 2015;56:1887–1893. decreased endothelial cell density (ECD) with features of pleomorphism and polymegethism. DOI:10.1167/iovs.14-16302 Genomic DNA analysis revealed large deletion (~4.5 mega base pairs) of the entire CHM gene and encompassed region. In carriers, funduscopy revealed stippling pigmentary change despite normal electrophysiological results. Specular microscopy also disclosed reduced ECD with features of pleomorphism and polymegethism.

CONCLUSIONS. To our knowledge, this is the ﬁrst description of corneal changes in choroideremia patients. The loss of corneal ECD is conspicuous and is accompanied by pleomorphism and polymegethism in this family. The observed changes in corneal endothelium may be associated with larger encompassed regions of the CHM gene defect or dysfunction in the blood–aqueous barrier. It warrants further investigation and clariﬁcation of the pathophysiology and associations between retinal and corneal changes in choroideremia. Keywords: choroideremia, endothelium, keratopathy

horoideremia, a rare X-linked recessive chorioretinal deficient melanosome transport and, consequently, a lack of C dystrophy, produces diffuse and progressive degeneration protection against harmful light exposure.4 of the RPE, retina, and choriocapillaris. It is characterized by The most remarkable clinical findings of choroideremia are night blindness, visual field constriction, and confluent hypopigmented and atrophic fundi with exposure of choroidal scalloped areas of RPE atrophy and choriocapillaris loss. Only vessels, eventually leaving only scattered small areas of intact males are affected, while female carriers usually are asymptom- choroid in the macula and periphery.1,6 It has been reported atic with variable chorioretinal changes in the fundus.1,2 Now it that retinal disorders may be associated with keratopathy in is known that choroideremia is caused by deletion or mutation Bietti crystalline dystrophy and Fabry’s disease.7,8 However, of the CHM gene, encoding Ras-associated binding (Rab) escort there are no corneal abnormalities mentioned in choroideremia protein-1 (REP-1).1,3 Rab and Rab-associated proteins are key in the previous literature. Herein, we present a rare association regulators of vesicle transport, which is essential for the between chorioretinal degeneration and corneal endotheliop- delivery of proteins to specific intracellular locations. Rab and athy in a choroideremia family. Changes in corneal endothelium REP-1 proteins form a stable complex that is the substrate for with reduced endothelial cell counts and altered cellular the phenylation via Rab geranylgeranyl transferase; the com- morphology are clearly manifested in the patients with plex interacts with its effectors to perform its physiological choroideremia and carriers we report. In the affected patients functions.4 Seabra et al.5 proposed that a lack of REP-1 leads to with typical clinical manifestations of choroideremia, the a lack of functional Rab27a specifically in the RPE. The reduction of corneal endothelial cell density (ECD) was more degeneration of RPE and its adjacent layers may be due to conspicuous with marked pleomorphism and polymegethism.

Downloaded from tvst.arvojournals.org on 10/01/2021 Corneal Endothelium Changes in Choroideremia IOVS j March 2015 j Vol. 56 j No. 3 j 1888

TABLE. Primer Used for PCR

Exon Forward, 50–30 Reverse, 50–30 Product Size, bp

1 TGCCTGGACCTTCCACCCAAG ACTCTCGACCCACGATGTTTGTC 283 2 AGCAAGGATGGGTCTCTTTGGTG TGAGGTTTCCAAGCCTCTTGGAG 491 3 CCTACCACTTCCACTTATGTGAG CTGTGTTACAGGTGAAGCTTAGG 345 4 TGGTGACTCTGAGGTGATATCC ACGTGACTTGTAGCAACCAATGC 373 5 ACGTGACTTGTAGCAACCAATGC AGGTTGTAGTATGTGCTCAAGCAC 736 6 AGCCAGAGTGCCTTATCAGTATG TGTAAATCACCACGGAGGACTGG 509 7 AAGCCTGGCTAGAGTGGAAACG TGGCTCACTAAATCAGAGCAAGC 321 8 ACCACCTATGTCCTTTGTGAGG ACTTAGGTGGGTAGATAGGTAGG 508 9 CAGTAACACCTCTACTGTGTCAAG ACCAAGGAGGATCTTTGAAGAATC 495 10 GTCAGAAAACATGGAATTGTAGGC CTAGGCTTCCCTAAAACCAGACC 402 11 ACTTGACTTGGTTTTGGGAGGTG AGTAGATCTTAAGTGTTCTCACCAC 354 12 GATACTCAGTTTAGAAGTTAACAGC AGGGGATGGTGTGAAATGACTTAC 361 13 ACCACCATGACTTGCTCAGCTC TCCCATTTCAGTTCAGGTTGCAG 311 14 TCGGTAATAGGCTACACAGTGTAG AGAAATGGTACTACTGAGAGATGC 355 15 AGTTAATGCCAGAAATGCACACAC CATATCCACAGTTACATTCCTGAG 544 Summary of the primers used for the ampliﬁcation of all exons of CHM and product size.

METHODS gel electrophoresis through 1% agarose in the presence of ethidium bromide. For each primer combination, a non- This study followed the tenets of the Declaration of Helsinki template control sample was included. and was approved by the Institutional Review Board of Taipei To search for the breaking points, array comparative Veterans General Hospital, Taipei, Taiwan. Informed consent genomic hybridization (array CGH) was performed at Gene- was obtained from all subjects before entry into the study. Phile BioScience Laboratory (Taiwan, ROC), using combined genome-wide and targeted oligo microarrays, the 8 3 60 K ISCA Patients and Clinical Investigations v2 array (Agilent Technologies, Santa Clara, CA, USA), in which 60,000 oligo probes tile along the human genome at a mean Four patients in a family, 2 males and 2 females, with suspected backbone spacing of 60 kb. Genomic DNA extracted from choroideremia were referred to a medical center between 2010 patients and controls were labeled, hybridized, washed, and and 2011. They were generally healthy except for presumed scanned following the manufacturer’s protocol. The arrays retinal disease. All participants underwent complete eye examinations, including best-corrected visual acuity (BCVA), were scanned using the Agilent G4900DA SureScan Microarray slit-lamp biomicroscopy, indirect ophthalmoscopy, fundus Scanner System (Agilent Technologies). The scanned arrays color photography (Canon CF-60DSi digital mydriatic fundus were analyzed using Feature Extraction (version 10.7.3.1) and camera; Canon, Inc., Melville, NY, USA), and electrophysiology CytoGenomics (version 1.5.1) analytic software (Agilent examinations. Fluorescein angiography (FA) was performed in Technologies) to determine copy number losses and gains. three patients. In addition, a noncontact specular microscope To confirm our claim of the first description of unusual (Noncon ROBO Pachy SP-9000; Konan Medical, Inc., Tokyo, corneal findings in choroideremia patients, we searched the Japan) was used to capture the images of the endothelium in online database PubMed for all reports of choroideremia, the central cornea in all patients. Endothelial cell density was keratopathy in choroideremia, and endotheliopathy. We have assessed using Frame method, by projecting photographs to a read all appropriate English literature on this topic and found known magnification and counting cells in an area of known no evidence of articles reporting any associated keratopathy in size (0.24 3 0.4 mm) by computer. Coefficient variation (CV) of patients with choroideremia. cell area and percentage of hexagonal cells were also analyzed. The diagnosis of choroideremia was based on clinical findings and family history in accordance with an X-linked inheritance, RESULTS and was confirmed by genetic analysis, as described in the Figure 1 illustrates the pedigree of this family. The pedigree following section. was in accordance with X-linked transmission. All the participants denied ocular history of trauma or surgery, and Molecular Analysis of Candidate Genes no concomitant ocular disease except choroideremia was Genomic DNA of the four patients was extracted from blood found. samples using a Genomic DNA Extraction Kit (Blood-Bacteria- Cultured Cells; RBC Bioscience, Taiwan, ROC) according to the Ophthalmic Manifestations in Patients With manufacturer’s protocol. DNA was quantified by spectropho- Choroideremia tometry (NanoDrop Products, Wilmington, DE, USA) and integrity was evaluated by agarose gel electrophoresis. All Patient III–3. This 58-year-old man suffered from progres- coding exons and their flanking regions were amplified by PCR sive poor vision in both eyes for decades. Night blindness was with the primers listed in the Table. Polymerase chain reaction noted since high school, and then he was diagnosed with conditions were as follows: activation of the DNA polymerase retinal dystrophy. His medical history was notable for diabetes for 10 minutes at 958C, followed by denaturing at 958C, mellitus. annealing at 608C, and extending at 728C in 35 cycles, each His BCVA was hand motion (HM) in both eyes. Intraocular step lasting 1 minute. Final extension at 728C was continued pressure (IOP) was normal. Horizontal nystagmus also was for 10 minutes. Amplified DNA fragments were visualized after noted.

Downloaded from tvst.arvojournals.org on 10/01/2021 Corneal Endothelium Changes in Choroideremia IOVS j March 2015 j Vol. 56 j No. 3 j 1889

FIGURE 1. Pedigree of the family with choroideremia. An X-linked inheritance pattern is clear. Filled symbols indicate individuals affected by choroideremia and unﬁlled symbols indicate unaffected individuals. Dotted circles indicate female carriers. Arrows indicate probands. Slash indicates a deceased person.

Slit-lamp biomicroscopy showed normal cornea and mild present in both eyes (Fig. 2B). Central corneal thickness (550 cataract in both eyes. Fundus examination showed typical, and 543 lm in the right and left eyes, respectively) was within diffuse atrophy of the RPE and choriocapillaris in the posterior the normal population range (535 6 62 lm).9 pole and midperiphery. The macula also was involved. The Patient IV–1. This 32-year-old male patient suffered from large retinal vessels and optic nerve were relatively normal night blindness since high school, and he was diagnosed as (Fig. 2A). Fluorescein angiography disclosed diffuse loss of choroideremia at the age of 17. His medical history was choriocapillaris with very poor chorioretinal dye perfusion. otherwise unremarkable. His uncle suffered from choroidere- Electroretinogram (ERG) showed ﬂat response with abnormal mia (patient III–3). cone and rod waveforms. His BCVA was 20/50 and 20/25 in the right and left eyes, Under specular microscope, there was a noticeable respectively. Intraocular pressure was normal. Slit-lamp exam- decrease in ECD of 1650 cells/mm2 and 1912 cells/mm2 in ination revealed multiple small punctate endothelial lesions the right and left eyes, respectively. In addition, pleomorphism disseminated in the whole corneal endothelium. They ap- and polymegethism of the corneal endothelial cells were peared yellow, and did not look like guttae (Fig. 3A). The

FIGURE 2. Clinical images of patient III–3. (A) Diffuse atrophy in the RPE and choriocapillaris over the posterior pole and midperiphery was noted in color fundus photographs. Macula also was involved. (B) Pleomorphism and polymegethism of endothelial cells were clearly evident in the images of noncontact specular microscopy. Endothelial cell density was 1650 and 1912 cells/mm2 in the right and left eyes, respectively. CD, cell density; 6A, percentage of six-sided cells.

Downloaded from tvst.arvojournals.org on 10/01/2021 Corneal Endothelium Changes in Choroideremia IOVS j March 2015 j Vol. 56 j No. 3 j 1890

FIGURE 3. Clinical images of patient IV–1. (A) In cornea slit-lamp photography, multiple small punctate endothelial lesions disseminated in the whole corneal endothelium. (B) Color fundus photography showed diffuse chorioretinal atrophy with large choroidal vessel exposure. Macular area was relatively preserved. (C) Great variation in endothelial cell shape and size was obvious in the specular microscopy images. Endothelial cell density was 2036 and 1996 cells/mm2 in the right and left eyes, respectively.

anterior chamber was silent, and the lens was clear. Fundus Genetic Analysis of This Family examination disclosed diffuse chorioretinal atrophy that spared the macular area (Fig. 3B). Fluorescein angiography showed Genetic analysis of this family is shown in Figure 4. DNA clear hypofluorescence in areas of missing choriocapillaris amplifications of all REP-1 coding exons (1–15) from the with patches of bright hyperfluorescence over the macula. affected males (patients III–3 and IV–1) and carriers (patients Visual field examination (Humphrey Field Analyzed; Carl III–2 and IV–2) revealed that DNA fragments of expected sizes Zeiss Meditec, Dublin, CA, USA) showed loss of peripheral were lost in probands, indicative of a deletion of entire coding visual fields in both eyes. Electroretinogram showed decreased regions of REP-1. To search for the breaking points, we used cone and rod response. whole-genome cytogenic array analysis with markers flanking Specular microscopy revealed features of mild pleomor- the deletions. This revealed a large gene deletion in Xq 21.1 to phism and polymegethism of the corneal endothelium. 21.31, approximately 4.5 mega base pairs (Mbp) in length, Endothelial cell density was reduced in both eyes (2036 and including genes of UBE2DNL, APOOL, SATL1, ZNF711, 1996 cells/mm2 in the right and left eyes, respectively, Fig. 3C) POF1B, CHM, DACH2, KLHL4, and CPXCR1 missed in probands and carriers. compared to normal adult values (2700 to 2900 cells/mm2 in middle-aged adults).10 Central corneal thickness was 606 and 599 lm in the right and left eyes, respectively. Review of Systems Because large deletion of the CHM gene and encompassed Ophthalmic Observations in the Carriers regions were detected, and complex syndromic choroideremia phenotypes associated with deletions of the X chromosome These carriers (patients III–2 and IV–2) did not have visual have been reported,11,12 a detailed review of systems was symptoms related to choroideremia. Visual acuity, IOP, anterior performed in affected males and female carriers. None of the segment, visual field, and electrophysiological tests were family members showed any contributory systemic findings, normal. However, fundus examination showed diffuse tiny such as mental retardation, sensorineural deafness, agenesis of yellowish spots over the posterior pole. the corpus callosum, or cleft lip. Hence, the deletion affecting Specular microscopy revealed reduced endothelial cell the CHM gene in this family appeared not to be associated with counts in the carriers. Patient III 2 had an ECD of 1776 and – any overt syndromic features. 1838 cells/mm2 in the right and left eyes, respectively, while patient IV–2 had an ECD of 2136 and 2336 cells/mm2 in the right and left eyes, respectively. Features of polymegethism of DISCUSSION corneal endothelial cells also were noted (CV was 0.43 in patient III–2 and 0.49 in patient IV–2, respectively). However, Choroideremia has been linked to the REP-1 gene located on no corneal guttae were found. The corneal thickness was the Xq 21.2 region, which contains 15 exons that span a normal. genomic sequence of approximately 150 kb. Different muta-

Downloaded from tvst.arvojournals.org on 10/01/2021 Corneal Endothelium Changes in Choroideremia IOVS j March 2015 j Vol. 56 j No. 3 j 1891

FIGURE 4. Genetic analysis of candidate gene. (A) Results of microarray analysis in a proband (patient III–3). Copy number loss from q21.1 to 21.31 in chromosome X is clearly shown, which signiﬁes a large deletion of the entire CHM gene and encompassed region. Gel electrophoresis results of PCR fragments in this family are shown in (B) and (C). Bands shown on agarose indicate the corresponding gene product is present. Polymerase chain reaction products from exons 1 to 15 were missing in 1A and 1D, implicating a complete absence of REP-1 protein (arrowhead). DNA template source: normal adult (N), patient III–3(1A), patient III–2(1B), patient IV–2(1C), patient IV–1(1D), an unaffected member in this family (1E), no-DNA control (B). A molecular weight standard marker (M) was run on each gel to estimate fragment size.

tions, including deletion, insertion, translocation, or aberrant deletions that vary in size from 45 kbp to several Mbp in splicing at the mRNA level, lead to nonfunctional or complete previous studies.11,12 Large deletions of various parts of Xq21 absence of REP-1 protein and are responsible for the usually are associated with complex or syndromic pheno- disease.13–15 Patients with classic choroideremia have shown types.12 Nevertheless, two families with approximately 6-Mbp

Downloaded from tvst.arvojournals.org on 10/01/2021 Corneal Endothelium Changes in Choroideremia IOVS j March 2015 j Vol. 56 j No. 3 j 1892

large deletions surrounding the CHM gene have been deficiency in the anterior chamber, affecting the endothelial described as having choroideremia with rather mild systemic cells’ ability to thrive, and decreasing cell density during manifestations.12 The loss of the entire CHM gene and prenatal development. encompassed regions of comparable size and location in our patients do not show overt systemic comorbidities. In accordance with the X-linked inheritance, choroidere- CONCLUSIONS mia affects males with progressive RPE and choroid atrophy, concentric visual field loss, and finally, visual impairment. In To our knowledge, this study is the first description of corneal contrast, female carriers present various abnormal fundus endothelial changes in choroideremia patients. We described findings, such as pigmented fundus periphery; however, their an Asian choroideremia family with classic clinical manifesta- retinal function remains normal. The variability of phenotype tions and unexpected corneal findings. Multiple pigmented in the carrier can be explained by lyonization. It is a random punctate lesions on the endothelium in both eyes were inactivation of one of the X chromosomes in females, thus revealed for one of the affected probands. The reduction of explaining the cellular phenotypic variability.2 Patients with corneal ECD is obvious and accompanied by pleomorphism choroideremia have been reported variously to have comor- and polymegethism. We speculated that the decrease in bid posterior polar cataract,16 cystoid macular edema,17 and endothelial cells may be attributable to blood–aqueous barrier recurrent uveitis.18 However, abnormal corneal findings have dysfunction and relative hypoperfusion of ocular circulation, not been reported. The unexpected corneal abnormalities in perhaps resulting from a genetic defect of the CHM gene. probands and carriers in this family are difficult to explain Changes in corneal endothelium may be associated with solely by the X-linked inheritance pattern and lyonization. choroideremia. Compared to retinal manifestations, however, The penetrance pattern of keratopathy in our cases also is these changes are subtle and usually overlooked. The current unclear. study reminds clinicians to examine carefully not only the The normal corneal endothelium is a monolayer of retina, but also the cornea in choroideremia patients. Our uniformly sized cells with a predominantly hexagonal shape. results warrant further investigation and clarification of the Endothelial cell density is more than 3000 cell/mm2 in pathophysiology and associations between retinal and corneal newborns, and gradually declines with an average rate of changes in choroideremia. approximately 0.6% per year throughout adult life.19 Reduced ECD is associated with age, presence of guttae, and an increase Acknowledgments in cellular pleomorphism, while corneal thickness is a poor predictor of cell density.20 It is known that trauma, surgery, The authors thank Jeremy Huang and GenePhile Bioscience uveitis, or Fuchs endothelial dystrophy may result in significant Company for their support with gene analysis. corneal endothelial changes in cell density and morpholo- Disclosure: S.-Y. Lee, None; W.-K. Yu, None; P.-K. Lin, None gy.21,22 However, the patients in this study do not have any of the aforementioned factors to which to attribute endothelial References cell loss. In addition, there are no reports of corneal endothelial abnormalities in choroideremia in the previous 1. Ogden TE, Hinton DR. Choroideremia. In: Ryan SJ, ed. Retina: literature. Basic Science and Inherited Retinal Disease. Vol. 1. 3rd ed. A potential etiology for the decreased ECD observed in our St. Louis, MO: CV Mosby; 2001:468–469. patients may have been inflammation. T-lymphocytic infiltra- 2. Renner AB, Kellner U, Cropp E, et al. Choroideremia: tion and gliosis within the choroid and surrounding vessels variability of clinical and electrophysiological characteristics have been observed previously in patients with choroideremia, and first report of a negative electroretinogram. Ophthalmol- which implies inflammation could have a role in the ogy. 2006;113:2066–2073. 3 18 pathogenesis of the disease. In addition, Sung et al. 3. McDonald IM, Russell L, Chan CC. Choroideremia: new described a case report of choroideremia with recurrent 23 findings from ocular pathology and review of recent literature. anterior uveitis. Perhaps most tellingly, Chen et al. described Surv Ophthalmol. 2009;54:401–407. an increased aqueous flare intensity in a patient with 4. Corbeel L, Freson K. Rab proteins and rab-associated proteins: choroideremia, and suggested this increase might be associated major actors in the mechanism of protein-trafficking disorders. with altered blood–aqueous barrier function in choroideremia. Eur J Pediatr. 2008;167:723–729. The dysfunction of the blood–aqueous barrier may lead to long-term low grade inflammation in the anterior chamber, 5. Seabra MC, Brown MS, Goldstein JL. Retinal degeneration in which puts the endothelial cells under physiological stress and choroideremia: deficiency of rab geranylgeranyl transferase. results in endothelial cell loss accompanied by increased cell Science. 1993;259:377–381. pleomorphism and polymegethism. 6. McDonald IM, Smaoui N, Seabra MC. Choroideremia. In: Pagon The endotheliopathy in our cases also may relate to the RA, eds. GeneReviews [Internet]. Seattle, WA: University of large deletion of CHM. Disruption of the CHM gene in mice Washington, Seattle; 1993-2014. results in photoreceptor degeneration and severe defects in 7. Kaiser-Kupfer MI, Chan CC, Markello TC, et al. Clinical vasculogenesis in the yolk sac and placenta.24 Changes in the biochemical and pathologic correlations in Bietti’s crystalline vascular endothelium of choroidal and iris stromal vessels also dystrophy. Am J Ophthamol. 1994;118:569–582. have been observed in human choroideremia from histopath- 8. Lin HY, Huang CH, Yu HC, et al. Enzyme assay and clinical ological examinations.25 It is known that chronic hypoperfu- assessment in subjects with a Chinese hotspot late-onset Fabry sion of the iris with microneovascularization is a major factor mutation. J Inherit Metab Dis. 2010;33:619–624. affecting corneal endothelial cell counts and morphology in 9. Doughty MJ, Zaman ML. Human corneal thickness and its several anterior segment diseases.21 Combining the results of impact on intraocular pressure measures: a review and meta- these studies, we postulated the genetic defects in choroide- analysis approach. Surv Ophthalmol. 2000;44:367–408. remia patients may affect not only the intracellular trafficking 10. McCarey BE, Edelhauser HF, Lynn MJ. Review of corneal in the RPE and photoreceptors, but also the vascular system of endothelial specular microscopy for FDA clinical trials of the choroid and ciliary body. The impaired vascular circulation refractive procedures, surgical devices and new intraocular in the ciliary body leads to relative hypoperfusion and nutrient drugs and solutions. Cornea. 2008;27:1–16.

Downloaded from tvst.arvojournals.org on 10/01/2021 Corneal Endothelium Changes in Choroideremia IOVS j March 2015 j Vol. 56 j No. 3 j 1893

11. Cremers FPM, Sankila EM, Brunsmann F, et al. Deletions in 18. O SJ, Kim SH, Lee HY. A case with choroideremia with patients with classic choroideremia vary in size from 45 kb to recurrent anterior uveitis. Korean J Ophthalmol. 2003;17:55– several megabases. Am J Hum Genet. 1990;47:622–628. 62. 12. Poloschek CM, Kloeckener-Gruissem B, Hansen LL, et al. 19. Bourne WM, Nelson LR, Hodge DO. Central corneal endothe- Syndromic choroideremia: sublocalization of phenotypes lial cell changes over a ten-year period. Invest Ophthalmol Vis associated with Martin-Probst deafness mental retardation Sci. 1997;38:779–782. syndrome. Invest Ophthalmol Vis Sci. 2008;49:4096–4104. 20. Rose GE. Clinical assessment of cornea endothelial cell 13. McTaggart KE, Tran M, Mah DY, et al. Mutational analysis of density: an original system of grading using a slit-lamp biomicroscope. . 1986;70:510–515. patients with the diagnosis of choroideremia. Hum Mutat. Br J Ophthalmol 2002;20:189–196. 21. Brooks AM, Grant G, Robertson IF, et al. Progressive corneal endothelial cell changes in anterior segment disease. Aust N Z 14. Mukkamala K, Gentile RC, Willner J, et al. Choroideremia in a J Ophthalmol. 1987;15:71–78. woman with ectodermal dysplasia and complex translocation 22. Delmonte DW, Kim T. Anatomy and physiology of the cornea. involving chromosomes X, 1, and 3. Ophthalmic Genet. 2010; J Cataract Refract Surg. 2011;37:588–598. 31:178–182. 23. Chen MS, Chang CC, Ho TC, et al. Blood-aqueous barrier 15. Garcia-Hoyos M, Lorda-Sanchez I, Gomez-Garre´ P, et al. New function in a patient with choroideremia. J Formos Med Assoc. type of mutations in three Spanish families with choroidere- 2010;109:167–171. mia. Invest Ophthalmol Vis Sci. 2008;49:1315–1321. 24.ShiW,vandenHurkJA,Alamo-BethencourtV,etal. 16. Binkhorst PG, Valk LE. A case of familial dwarﬁsm, with Choroideremia gene product affects trophoblast development choroideremia, myopia, posterior polar cataract, and zonular and vascularization in mouse extra-embryonic tissues. Dev cataract. Ophthalmologica. 1956;132:299. Biol. 2004;272:53–65. 17. Genead MA, Fishman GA. Cystic macular oedema on spectral- 25. Cameron JD, Fine BS, Shapiro I. Histopathologic observation in domain optic coherence tomography without cystic changes choroideremia with emphasis on vascular changes of the uveal on fundus examination. Eye (Lond). 2011;25:84–90. tract. Ophthalmology. 1987;94:187–196.

Downloaded from tvst.arvojournals.org on 10/01/2021