SUPPLEMENTARY METHODS
Cell culture.-Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats from normal donors over a Lymphoprep (Nycomed Pharma) gradient. Monocytes were purified from PBMC by magnetic cell sorting using CD14 microbeads (Miltenyi Biotech). Monocytes were cultured at 0.5 x 106 cells/ml for 7 days in RPMI 1640 (standard RPMI, which contains 1 mg/L folic acid) supplemented with 10% fetal calf serum, at 37ºC in a humidified atmosphere with 5% CO2, and containing GM-CSF (1000U/ml) or M-CSF (10 ng/ml, ImmunoTools) to generate GM-CSF- polarized macrophages (GM-MØ) or M-CSF-polarized macrophages (M-MØ). MTX pharmacokinetic studies in RA patients administered 25 mg MTX showed peak plasma levels of 1-2
µM MTX two hours after drug administration, but plasma levels decline to 10-50 nM MTX within
24-48 hours [1, 2]. MTX (50 nM), pemetrexed (PMX, 50 nM), folic acid (FA, 50 nM) [3], thymidine (dT, 10 µM), pifithrin-α (PFT, 25-50 µM), nutlin-3 (10 µM, Sigma-Aldrich) was added once on monocytes together with the indicated cytokine, or on monocytes and 7-day differentiated macrophages for 48h.
Gene expression profiling.-For long-term MTX treatment, RNA was isolated from three independent preparations of monocytes either unexposed or exposed to MTX (50 nM) and differentiated to GM-MØ or M-MØ for 7-days. For short-term schedule, RNA was isolated from three independent samples of fully differentiated GM-MØ either unexposed or exposed to MTX (50 nM) for 48h, by using RNeasy Mini kit (QIAGEN). Labeled RNA (200 ng) was hybridized to an
Agilent Human v2 4x44K array (G4845A, Agilent Technologies). Raw data files were pre- processed with GeneSpring v12 (Agilent). Raw signal values (in log base 2) were thresholded to 1 and arrays were normalized using quantiles [4]. Probes with normalized signal values greater than the 20th lower percentile and flagged as Detected (Present) or Not Detected (Marginal) in 100% of the replicates in 1 out of the 4 conditions were retained (22266 probes). The Limma package from
Bioconductor was used for differential gene expression analysis and the following paired comparisons on the filtered dataset were performed (Mo+GM (MTX) vs Mo+GM and Mo+M
(MTX) vs Mo+M). Raw p-values were corrected for false discovery rate control using the
Benjamini-Hochsberg method to obtain the final adjusted p values. Adjusted p values smaller than
0.05 were considered significant, and upregulated or downregulated genes were defined as those exhibiting a log2 fold change >1 or log2 fold change <1, respectively. Microarray data have been deposited in the Gene Expression Omnibus (GSE71253). Functional analysis was performed using
Ingenuity Pathway Analysis (IPA) software (www.ingenuity.com). GSEA was performed using
GSEA version 2.0.14 from the Broad Institute at MIT [5]. The t statistic values derived from the differential expression analysis were used as the metric for ranking the genes. Enrichment scores were calculated using the weighted option with the value of p equal to 1.
Quantitative real time RT-PCR.-Total RNA was retrotranscribed and cDNA was quantified using the Universal Human Probe Roche library (Roche Diagnostics). Oligonucleotides for selected genes were designed according to the Roche software. Quantitative real-time PCR (qRT-PCR) was performed on a LightCycler® 480 (Roche Diagnostics). Assays were made in triplicates and results normalized according to the expression levels of TBP. Results were obtained using theCT method for quantitation. The oligonucleotides used to quantify mRNA transcripts were:
Gene name GeneBank ID Sense oligonucleotides Antisense oligonucleotides CCL20 NM_004591 gctgctttgatgtcagtgct gcagtcaaagttgcttgctg LIF NM_002309 tgccaatgccctctttattc gtccaggttgttggggaac MET NM_000245 aaatgtgcatgaagcaggaa tctctgaattagagcgatgttga GDF15 NM_004864 ccggatactcacgccaga agagatacgcaggtgcaggt TYMS NM_001071 cccagtttatggcttccagt gcagttggtcaactccctgt MTHFR NM_005957 ccgggttaattaccaccttg attcggctgcagttcagg GGH NM_003878 aggctggatcttacagagaaagac ctgagcgtctgaggtcaaca FPGS NM_004957 ccctgccagtttgactatgc ctgtgaagttctgttggtctgc DHFR NM_000791 tcccagaacatgggcatc tggtcattctctggaaatatctga GART NM_000819 tccctgagaaacttggggta gctgcaaccatgagaagacc ATIC NM_004044 gagggactgcaaaagctctc ggaaatcccgtcaactcaga SLC19A1 NM_194255 cagttcctcgtgcccatc ggcaaagaacgtgttgacc TBP NM_003194 cggctgtttaacttcgcttc cacacgccaagaaacagtga ELISA.-Supernatants from monocytes, GM-MØ and M-MØ were tested for the presence of CCL20
(R&D Systems) and LIF (eBioscience) using ELISA.
Western-blot and TS cloning.-Cell lysates were obtained in RIPA buffer containing 2 mMPefabloc, 2 mg/ml aprotinin/antipain/leupeptin/pepstatin, 10 mMNaF, and 1 mM Na3VO4. 50 micrograms cell lysate was subjected to SDS-PAGE and transferred onto an
Immobilonpolyvinylidene difluoride membrane (Millipore). Protein detection was carried out using an anti-human TS polyclonal Ab (Abcam, ab108995), mAb against GAPDH (sc-32233; Santa Cruz
Biotechnology) or vinculin (hVIN-1; Sigma-Aldrich). The TS-pcDNA3 construct was generated by
PCR amplification with oligonucleotides 5´-CTCGAGCCGCCGCGCCATGCCTGTG-3´ and 5´-
CCCCAAGCTTGAAAGCACCCTAAACAGCCATT-3´, and the resulting fragment was cloned into
XhoI/HindIII-digested pcDNA3.1(-) plasmid. HEK 293T cells were transiently transfected with
SuperFect (QIAGEN).
Immunohistochemistry and multicolor confocal microscopy.-The following antibodies were used: FITC-labeled anti-CD163 (Ber-Mac3, MBL International Corp., MA), anti-TS (Abcam, ab108995), anti-TNFα (Abcam, ab1793), isotype matched control antibodies and fluorochrome- conjugated secondary antibodies (Jackson ImmunoResearch). RA synovial tissues were obtained by surgical synovectomy from 9 RA patients with progressive disease requiring knee joint replacement surgery. Normal synovial tissues were obtained from 6 patients undergoing elective knee arthroscopic examination for minor orthopedic conditions on otherwise normal joints according to
MRI, arthroscopy and histology. Patients received informed consent and Hospital General
Universitario Gregorio Marañón ethics committees approved the study.Tissues were snap frozen in
OCT, and 4 µm cryosections were blocked for 10 min with 1% human immunoglobulins, and incubated with primary (1-5 µg/ml) and appropriate secondary antibodies. Imaging was performed with an inverted confocal microscope (SP2, Leica Microsystems), using the 20x PL-APO NA 0.7 and the 63x PL-APO NA 1.3 glycerol immersion objectives. For imaging of macrophages, cells were plated on Poly-L-Lysine coated coverslips, fixed with 4% formaldehyde and permeabilized with 0.1% saponin for 10 min. Quantification of TS staining was performed as described[6].
RNA interference.- Two different siRNA for TYMS (silencer select s14538, s14539) and one control siRNA (silencer select Negative Control #1) (Ambion, Life Technologies) were used at 100 nM. GM-MØ were transfected with HiPerFect transfection reagent (QIAGEN), treated with MTX,
PMX or PFT, and 48h later tested for mRNA levels by qRT-PCR.
MTX uptake.-[3´,5´,7-3H(N)]MTX (25 Ci/mmol, MoraveckBiochemicals) was used at 50 nM.
Uptake experiments were performed in Krebs buffer (123 mMNaCl, 4.9 mMKCl, 1.2 mM MgSO4,
0.85 mM CaCl2, 5 mM D-glucose, 10 mM HEPES, and 10 mM MES, adjusted to pH 5.5 or pH 7.4 with NaOH). Macrophages (3x105) were rinsed twice with Krebs buffer at 37ºC, after which uptake was initiated by adding 300 l uptake medium containing 3H-MTX for 5 min at 37ºC. Cells were washed with ice-cold Krebs buffer at pH 7.4, solubilized with 1%SDS 0.2N NaOH and used for determination of radioactivity by liquid scintillation spectrometry. Protein concentrations of the lysates were determined using the DC Protein Assay (Bio-Rad).
MTX quantitation.- MTX (MTX-Glu1) and MTX polyglutamates (MTX-Glu2, MTX-Glu3, MTX-
Glu4, MTX-Glu5, MTX-Glu6 and MTX-Glu7) were purchased from Schircks Laboratories (Jona,
Switzerland). MTX and its polyglutamates were detected and quantified as described [7] using a
7200 Infinity ultra-high performance liquid chromatograph coupled to a 6490 triple quadrupole mass spectrometer provided with an iFunnel electrospray ionization source (UHPLC-ESI-QqQ-MS)
(Agilent Technologies, Santa Clara, USA) and a Acquity UPLC HSS T3 column (2.1 x 100 mm, 1.8 µm) (Waters Corporation, Mildford, USA). UHPLC conditions were as follow: mobile phase A:
50 mM ammonium acetate + 0.2% formic acid in water and B: acetonitrile. Gradient (in minutes/%B): 0/0%; 1.5/15%; 5/30%; 7/55%; 10/65%; 11/100%; 13/100%; 14/0%; 16/0%. Flow at
0.2 mL/min. Injection volume, 2 µL.
Statistical analysis.-Statistical analysis was performed using paired student´s t-test and a p value <
0.05 was considered significant (*, p<0.05; **, p<0.01, ***, p<0.001).
References
1. Hoekstra M, Haagsma C, Neef C, Proost J, Knuif A, van de Laar M. Bioavailability of higher dose methotrexate comparing oral and subcutaneous administration in patients with rheumatoid arthritis. J Rheumatol. 2004 Apr; 31(4):645-648. 2. Godfrey C, Sweeney K, Miller K, Hamilton R, Kremer J. The population pharmacokinetics of long-term methotrexate in rheumatoid arthritis. Br J Clin Pharmacol. 1998 Oct; 46(4):369-376. 3. van Ede AE, Laan RF, Blom HJ, Boers GH, Haagsma CJ, Thomas CM, et al. Homocysteine and folate status in methotrexate-treated patients with rheumatoid arthritis. Rheumatology (Oxford). 2002 Jun; 41(6):658-665. 4. Bolstad BM, Irizarry RA, Astrand M, Speed TP. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics. 2003 Jan 22; 19(2):185-193. 5. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005 Oct 25; 102(43):15545-15550. 6. Soler Palacios B, Estrada-Capetillo L, Izquierdo E, Criado G, Nieto C, Municio C, et al. Macrophages from the synovium of active rheumatoid arthritis exhibit an activin A- dependent pro-inflammatory profile. J Pathol. 2015 Feb; 235(3):515-526. 7. van Haandel L, Becker ML, Leeder JS, Williams TD, Stobaugh JF. A novel high- performance liquid chromatography/mass spectrometry method for improved selective and sensitive measurement of methotrexate polyglutamation status in human red blood cells. Rapid communications in mass spectrometry : RCM. 2009 Dec; 23(23):3693-3702.
SUPPLEMENTARY TABLES
Ingenuity Canonical -log Ratio Genes Pathways (p-value)
CCL4L1/CCL4L2,CLDN7,CCL20,IL36B,CCL3L3,CLDN1, Granulocyte SDC1,CLDN14,IL1R1,ITGB3,CCL4,CCL3,CCL7,CCL5, Adhesion and 9.35 1.6E-01 IL1B,CXCL10,CXCL2,CXCL8,CCL22,MMP19,IL1A,MMP10, Diapedesis IL36G,CXCL14,MMP1,MMP14
CCR7,TNFSF15,COL6A1,PGF,COL27A1,PDGFB,IL1R1,ECE1, Hepatic Fibrosis 7.09 1.29E-01 EDN1,MET,LTB,PDGFRB,CCL5,IL1B,KDR,CD70,CXCL8,TNFSF4, CXCR3,IL1A,COL4A2,TNFSF10,SERPINE1,COL11A2,MMP1
Pathogenesis of 5.08 5.56E-01 CXCR3,CCL3,CCL5,CXCL10,CCL4 Multiple Sclerosis
Role of
Hyperchemokinemia 5.05 2.37E-01 CCL3,IL1B,CCL5,CXCL10,IL1A,IL36B,CCL4,IL36G,CXCL8 in the Pathogenesis
of Influenza Communication between Innate and CCR7,CCL3,IL1B,CCL5,CXCL10,IL1A,IL36B,CCL4,CCL3L3, 4.13 1.53E-01 Adaptive Immune IL36G,CXCL8 Cells
Bladder Cancer MYC,RRAS2,MMP19,CDKN1A,PGF,MMP10,CDH1,MDM2, 4.05 1.4E-01 Signaling THBS1,MMP1,CXCL8,MMP14
FOS,PDGFRB,RRAS2,IL1B,IL1R1,PTGS2,IL1A,NR1H3,IL36B, PPAR Signaling 3.86 1.33E-01 PDGFB,IL36G,CITED2
Disease or # Functions p-value Genes genes Annotations ABCB1,ABCB5,ABL2,ABLIM1,ADA,ADRA2B,ADRB2,AKAP12,ANG,ANGPTL6, APLN,AREG,ARG1,ARHGEF7,ASGR1,ATF3,AZU1,BCL11A,BCL2L11,BEX2,BIK, BIRC3,BMF,BMP6,BUB1B,C3,CAMK1,CAMK2N2,CAV1,CCL20,CCL3,CCL3L3, CCL4,CCL5,CCNA1,CCNB1,CCR2,CCR7,CCT5,CD180,CD70,CDC20,CDCP1, CDH1,CDKN1A,CDKN1C,CDKN2D,CEACAM1,CELA1,CELA2A,CHGA,CITED2, CLDN1,CLDN7,COL4A2,COL6A1,CPEB1,CR1,CR1L,CRADD,CRH,CSPG4,CTSF, CTTN,CXCL10,CXCL14,CXCL2,CXCL8,CXCR3,CYP19A1,CYP27B1,CYSLTR1, DAPK2,DDIT3,DEFB1,DLG5,DPYSL3,DSP,E2F7,EBI3,EDN1,EFNB2,EGFL7, EGR3,EGR4,ELOVL7,EREG,ETS2,F12,F2RL1,FA2H,FBXO2,FCER1A,FCGR2B, FDXR,FHL2,FOLR1,FOS,FXYD2,FZD4,GADD45A,GAL,GATA2,GCAT,GDF15, GDNF,GEM,GHRL,GJC1,GLI3,GPC1,GPC3,GPR56,GRASP,GRB10,GREB1, GZMB,H2AFB3,HAS1,HDAC2,HEY1,HIC1,HIST1H1B,HOPX,HSPA8,HTRA1, ICAM3,IER3,IL1A,IL1B,IL1R1,IL20RB,IL23A,IL24,INSIG1,ISG20,ITGB3,ITGB7, Cellular ITGB8,JAK3,KCNMA1,KDR,KIF20A,KITLG,KLF2,KLF4,KLK4,KRT14,KRT17, Growth and 3.98E-20 287 KRT23,LAMA2,LAMP3,LAT,LEPREL2,LGALS7/LGALS7B,LIF,LMNB1,LOC1027 Proliferation 24788/PRODH,LTB,MAP3K1,MAP7,MDM2,MET,MIR17HG,MKI67,MLLT3, MLXIPL,MMP1,MMP14,MMP19,MXD3,MYC,MYLK,NABP1,NAMPT,NCF1, NEDD4L,NEDD9,NEK2,NES,NEU4,NFE2,NINL,NKX31,NPTX2,NR1D1,NR1H3, NUAK1,NUCB2,OLIG2,OPTN,OSBP2,OSM,P2RX7,PAEP,PCDH1,PDGFB, PDGFRB,PDK4,PDLIM4,PGF,PIGR,PKP2,PLK1,PLK2,PLK3,PLS3,PMEPA1, PPIF,PRDM1,PTGIR,PTGS2,PTPRF,PTPRU,PVRL4,RASD1,RASGRF1,RASGRP1 RASGRP3,RASL10A,RCAN1,RELB,RGS16,RHBDF1,RHOB,RHOD,RNASE3, RND3,RRAS2,S1PR1,SCIN,SCN4B,SDC1,SERPINB2,SERPINE1,SERPINE2, SHC4,SIGLEC10,SLAMF7,SLC1A2,SLC1A3,SLC25A4,SLC52A1,SLC7A11,SLIT3, SMARCA1,SOX13,SPHK1,SPINK1,SQSTM1,SSTR2,STK17A,STK17B,STX3, SULF2,TACC2,TACSTD2,TAGLN3,TBX21,TCF7,TEAD4,TG,THBS1,TJP1,TLE4, TNFAIP3,TNFAIP6,TNFRSF9,TNFSF10,TNFSF15,TNFSF4,TP53BP2,TRAF1, TRIB3,TSC22D1,UBE2C,UCN2,ULBP1,ULBP2,VCAN,VGF,VPS53,VWF,WNT1, YME1L1,ZEB1,ZFP36
ABL2,ADA,ADRB2,APLN,AQP3,AREG,ARG1,ARHGEF7,ATF3,AZU1,BANP, BMP6,C3,CAMK1,CAV1,CCL20,CCL22,CCL3,CCL3L3,CCL4,CCL5,CCL7,CCR2, CCR7,CCRL2,CDCP1,CDH1,CDKN1A,CEACAM1,CES1,CFH,CHGA,CHST2, CITED2,CLDN7,COL4A2,CPEB1,CR1,CR1L,CRH,CSPG4,CTTN,CXCL10,CXCL14 CXCL2,CXCL8,CXCR3,CYP19A1,CYSLTR1,DEFB1,DPYSL3,EBI3,ECSCR,EDN1, EFNB2,EGFL7,EREG,F13A1,F2RL1,FCER1A,FCGR2B,FHL2,FOLR1,FOS,FZD4, GADD45A,GATA2,GDF15,GDNF,GHRL,GLI3,GPC1,GPC3,GPR56,GZMB, HAS1,HCAR2,HEY1,HIC1,HP,IL1A,IL1B,IL1R1,IL23A,IL24,ITGB3,ITGB7,ITGB8 Cellular JAK3,KANK1,KCNMA1,KDR,KITLG,KLF2,KLF4,LAMA2,LAMB3,LAT,LIF,LMNB Movement 1.07E-19 177 1,LRRC16A,LTB,LTC4S,MAP3K1,MAT1A,MET,MIR17HG,MMP1,MMP10,
MMP14,MMP19,MYC,MYLK,NAMPT,NCF1,NEDD9,NES,NKX31,NPTX2, NR1D1,NUCB2,OSM,P2RX7,PAEP,PDE4DIP,PDGFB,PDGFRB,PGF,PHACTR1, PIGR,PKP2,PPIF,PRDM1,PTGIR,PTGS2,PTPRF,PTPRU,RASGRF1,RASGRP1, RCAN1,RGS16,RHOB,RHOD,RNASE2,RND3,ROBO4,RRAS2,RSPO3,S100A2, S1PR1,SCHIP1,SDC1,SERPINB2,SERPINE1,SERPINE2,SERPING1,SHC4, SLC1A2,SLC1A3,SLIT3,SPHK1,TACSTD2,TBX21,TG,THBS1,TNFAIP3,TNFAIP6, TNFRSF9,TNFSF10,TNFSF15,TNFSF4,TP53BP2,VCAN,VGF,VWF,WNT1,ZEB1
ABCB1,ABL2,ADA,ADRB2,AKAP12,ANG,APLN,AREG,ARG1,ARG2,ATF3, ATP2B2,AZU1,BCL11A,BCL2L11,BEX2,BIK,BIRC3,BMF,BMP6,BUB1B,C3, CAMK2N2,CAV1,CCDC80,CCL3,CCL3L3,CCL4,CCL5,CCNA1,CCNB1,CCR2, CCR7,CCT5,CD70,CDC20,CDCP1,CDH1,CDKN1A,CDKN1C,CDKN2D, CEACAM1,CELA2A,CES1,CFH,COL4A2,COL6A1,CR1,CR1L,CRADD,CRH, CSPG4,CTTN,CXCL10,CXCL2,CXCL8,CXCR3,CYP19A1,DAPK2,DDIT3,DEFB1, DEPDC1,DPYSL3,DRAXIN,DSP,DST,ECSCR,EDN1,EFNB2,EGR3,EREG,ERN2, ETS2,F13A1,F2RL1,FCER1A,FCGR2B,FDXR,FHL2,FOS,FRAT1,GADD45A,GAL, GATA2,GDF15,GDNF,GEM,GHRL,GLI3,GPC1,GPC3,GRB10,GZMB,H2AFB3, HAS1,HCAR2,HDAC2,HIC1,HRK,HSPA8,HTRA1,IER3,IL1A,IL1B,IL1R1,IL24, Cell Death IRAK2,ISM1,ITGB3,JAK3,KDR,KITLG,KLF2,KLF4,KRT14,LAMA2,LAT,LGALS7/ 4.10E-19 219 and Survival LGALS7B,LIF,LMNB1,LOC102724788/PRODH,LTB,MAP3K1,MDM2,MET,
MIR17HG,MKI67,MLLT3,MMP1,MMP14,MXD3,MYC,MYLK,NABP1,NAMPT NCF1,NCS1,NEDD9,NEFM,NEK2,NR1D1,NR1H3,NRGN,NUAK1,OPTN,OSM, P2RX7,PAEP,PCDHGA8,PDGFB,PDGFRB,PDLIM4,PGF,PIGR,PKP2,PLEKHF1, PLK1,PLK2,PLK3,PMEPA1,PPIF,PRDM1,PTGS2,PTPRF,RASD1,RASGRP1, RCAN1,RELB,RGS16,RHOB,RNASE2,RNASE3,RND3,RRAS2,S1PR1,SCIN, SDC1,SERPINB2,SERPINE1,SERPINE2,SGCB,SLC1A2,SLC1A3,SLC25A4, SLC7A11,SLIT3,SMARCA1,SPHK1,SQSTM1,SSTR2,STAR,STK17A,STK17B, SULF2,TBX21,TCF7,THBS1,TMCC3,TMEM132A,TNFAIP3,TNFRSF10D, TNFRSF9,TNFSF10,TNFSF15,TNIP2,TP53BP2,TRAF1,TRIB3,TRIM54, TSC22D1,UBE2C,UCN2,VCAN,VGF,VWF,WNT1,YME1L1,ZEB1,ZFP36
ADA,ADRB2,ATF3,AZU1,BCL2L11,BIRC3,C3,CAV1,CCL20,CCL22,CCL3, CCL3L3,CCL4,CCL5,CCL7,CCR2,CCR7,CCRL2,CDKN1A,CELA1,CFH,CHGA,CR1, CR1L,CRH,CSPG4,CXCL10,CXCL14,CXCL2,CXCL8,CXCR3,CYSLTR1,DDIT3, DEFB1,EDN1,F12,F2RL1,FCGR2B,FOS,GADD45A,GAL,GDNF,GHRL,GPR68, Inflammatory 1.28E-16 91 HCAR2,HP,IER3,IL1A,IL1B,IL1R1,IL23A,IL24,IRAK2,ITGB3,ITGB7,KDR,KITLG, Response KLF4,KRT1,LAT,LIF,MMP1,MMP14,MMP19,MYLK,NCF1,NEDD9,NR1D1,
NR1H3,OSM,P2RX7,PDGFB,PIGR,PRDM1,PTGS2,RNASE2,S1PR1,SDC1, SERPINE1,SERPING1,SPHK1,THBS1,TNFAIP3,TNFAIP6,TNFRSF9,TNFSF4, TNIP2,TPST1,ULBP1,VNN1,ZFP36
ABCB1,ADA,ADAMTS14,ADRA2B,ADRB2,AHI1,ANG,AREG,ARG1,AZU1, BCL2L11,C1R,C1S,C3,CACNA2D3,CAMK1,CCL20,CCL3,CCL3L3,CCL4,CCL5, CCL7,CCNB1,CCR2,CCRL2,CD180,CD200R1,CD70,CDH1,CDKN1A,CDKN2D, CEACAM1,CEACAM8,COL11A2,COL4A2,CR1,CR1L,CXCL10,CXCL14,CXCL2, Connective CXCL8,CYP19A1,DDIT3,DUSP2,EDN1,EGR3,F2RL1,FCGR2B,FOS,GRB10, Tissue GZMB,HDAC2,HLADOA,HP,HSPA8,HTRA1,IL1A,IL1B,IL1R1,IL23A,ITGB7, Disorders, 2.99E-15 109 JAK3,KDR,L3MBTL4,LTB,MDM2,MMP1,MMP10,MMP14,NAMPT,NCF1, Skeletal NR1H3,OSM,P2RX7,PDGFRB,PRDM1,PTGIR,PTGS2,RASGRF1,RNASE2, Disorders RNASE3,S1PR1,SCN4B,SDC1,SERPINB2,SLAMF6,SLAMF7,SLC1A2,SLC1A3, SLC7A11,SPHK1,SQLE,STK17B,TBX21,TCF7,THBS1,TJP1,TNFAIP3,TNFAIP6, TNFRSF10D,TNFRSF9,TNFSF10,TNFSF15,TNFSF4,TPST1,TRAF1,TRIM31, WNT1,ZFP36
Supplementary Table 1. Genes annotated to the significant canonical pathways and the top 5 biological and disease processes identified in IPA on MTX-treated monocytes after 7 day of the GM-CSF (Mo+GM)-induced differentiation. Ratio means the number of molecules from the data set that map to the pathway divided by the total number of molecules that map to the canonical pathway. “Log value” is log10.
monocytes differentiated with GM with differentiated monocytes Table Supplementary Up-regulated genes Gene Symbol PNLIPRP3 CAMK1G MMP10 NEURL3 SLC1A2 SHISA3 EDA2R MMP1 GDF15 ABCB5 AIM1L KRT23 CCL20 NEFM GDNF RND3 RHCG IGFL2 NEU4 AREG CCR7 MET IL24 VGF LIF
2 6.4112 7.1199 8.3252 3.2824 4.1230 4.4451 4.4723 4.5044 4.5252 4.5337 4.6045 4.6831 4.7228 4.7896 4.8218 5.0962 5.1239 5.2062 5.5040 5.5581 5.5940 5.7181 5.8349 5.8545 5.9945 Log .
Top 25 MTX up MTX 25 Top 2 FC
- Adj Adj CSF (Mo+GM). 0.0186 0.0094 0.0118 0.0107 0.0447 0.0269 0.0096 0.0058 0.0208 0.0134 0.0058 0.0116 0.0205 0.0185 0.0068 0.0058 0.0094 0.0058 0.0058 0.0063 0.0058 0.0058 0.0176 0.0078 0.0120 p - value - regulated and down and regulated
Down-regulated genes Gene Symbol CACNA2D3 HIST1H1D CEACAM8 HIST1H1B COL27A1 RNASE4 RNASE3 RNASE2 RNF175 ADSSL1 ACSM1 KIF20A STON1 HSPA8 F13A1 CELA1 VCAN ARG1 PNCK NFE2 CCR2 ANG HPR CRH HP - regulated genes in genes regulated
------Log 3.0402 2.9956 2.9666 2.7913 2.7842 2.6430 2.6245 2.6035 2.5623 2.4296 2.4276 2.3353 2.3238 2.3103 2.3010 2.2981 2.2424 2.2242 3.9503 3.5897 3.5715 3.4908 3.3465 3.3143 3.2015 2 FC
Adj Adj 0.0058 0.0137 0.0470 0.0263 0.0457 0.0330 0.0218 0.0489 0.0211 0.0499 0.0377 0.0298 0.0155 0.0172 0.0399 0.0272 0.0283 0.0151 0.0180 0.0405 0.0282 0.0398 0.0302 0.0345 0.0451 p - value
Supplementary Figure 1
A MET GDF15 0.08 * 3.0 Mo GM-MØ 2.0 0.06 M-MØ
0.04 1.0 * 0.3 0.02 0.2 Relative mRNA levels Relative mRNA
Relative mRNA levels Relative mRNA 0.1 0.00 0.0 MTX - + - + - + - + - + - + MTX - + - + - + - + - + - + 24h 48h 24h 48h 24h 48h 24h 48h 24h 48h 24h 48h B Fibroblast HEK 293T 40 2.0 CCL20 30 1.5 LIF MET 20 1.0 GDF15 10 0.5
0.08 0.03 0.06 0.02 Relative mRNA levels Relative mRNA 0.04 levels Relative mRNA 0.02 0.01 0.00 0.00 MTX - + - + - + - + - + - + - + - + MTX - + - + - + - + - + - + - + - + 24h 48h 24h 48h 24h 48h 24h 48h 24h 48h 24h 48h 24h 48h 24h 48h
C TYMS 100 Fibroblast HEK 293T 80
60
40
Relative mRNA levels Relative mRNA 20
0 MTX - + - + - + - + 24h 48h 24h 48h
Supplementary Figure 1.- Effect of MTX on gene expression on myeloid cells, fibroblast and HEK 293T cells. A. MET (left panel) and GDF15 (right panel) mRNA expression levels determined by qRT-PCR on monocytes (Mo), GM-MØ or M-MØ in the absence or in the presence of 50 nM of MTX for the indicated time points. Mean and SEM of four independent donors are shown (*p<0.05). B. CCL20, LIF, MET and GDF15 mRNA expression levels determined by qRT-PCR on fibroblast (upper panel) and HEK 293T cells (lower panel) in the absence or in the presence of 50 nM of MTX for the indicated time points. Mean and SEM of four independent experiments are shown (*p<0.05). C. TYMS mRNA expression levels determined by qRT-PCR on fibroblast and HEK 293T cells in the absence or in the presence of 50 nM of MTX for the indicated time points. Mean and SEM of four independent experiments are shown (*p<0.05). Supplementary Figure 2
1.0
0.8
0.6
0.4 * H-MTX uptake
3 0.2 (pmol/mg protein/5 min.) 0.0 GM-MØ M-MØ
Supplementary Figure 2.- Uptake of MTX in GM-MØ and M-MØ. [3H]-MTX (50 nM) uptake was assessed at pH 7.4 for the indicated time in GM-MØ and M-MØ. Supplementary Figure 3
A CCL20 LIF MET GDF15 0.5 5 0.4 5 * * ** * * *** 0.4 * 4 4 0.3 ** 0.3 3 *** 3 * 0.2 * 0.2 2 2 0.1 0.1 1 1 Relative mRNA levels Relative mRNA levels Relative mRNA Relative mRNA levels Relative mRNA levels Relative mRNA * 0.0 0 0.0 0 - MTX PMX ZD - MTX PMX ZD - MTX PMX ZD - MTX PMX ZD
B C D MET GDF15 MET GDF15 MET GDF15 * 0.3 * 2.5 * 15 100 ** * * * 100 2.0 * 80 ** 80 0.2 * 10 1.5 * 60 60 *** 1.0 40 ** * 0.1 5 ** * 40 * 0.5 Fold induction 20 20 ** Relative mRNA levels Relative mRNA 0.0 0 % Induction with MTX 0 0.0 % Induction with PMX 0 MTX - + + - - - MTX - + + - - - siTYMS c si8 si9 c si8 si9 MTX + + + + + + PMX + + + + + + PMX - - - + + - PMX - - - + + - siTYMS c si8 si9 c si8 si9 siTYMS c si8 si9 c si8 si9 dT - - + - + + dT - - + - + +
E MET GDF15 F G MET GDF15 MET GDF15 1.5 10 * 100 * 1.5 8 75 1.0 50 1.0 6 45 4 30 0.5 0.5 ** Fold induction 2 Fold induction 15 ***
Relative mRNA levels Relative mRNA levels Relative mRNA 0 0.0 0.0 0 MTX + + + + + + siTYMS(si8) + + + + MTX - + + - + + MTX - + + - + + PFT 25 - + - - + - FA - - + - - + FA - - + - - + PFT 50 - - + - - + PFT - + - + GM-MØ M-MØ GM-MØ M-MØ
Supplementary Figure 3. MET and GDF15 as MTX-response genes in macrophages. A. CCL20, LIF, MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ in the absence (-) or in the presence of 50 nM of MTX, pemetrexed (PMX) or ZD1694 (ZD) for 48 h. Mean and SEM of seven independent donors are shown. B. MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ treated with MTX or PMX in the absence or in the presence of thymidine (dT) for 48 h. Mean and SEM of eight independent donors are shown. C. MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ transfected with control siRNA (c) and two different siRNA for TYMS (si8, s39). The values in the presence of control siRNA were given an arbitrary value of 1. D. MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ transfected with control siRNA (c) and two different siRNA for TYMS (si8, si9) and exposed to MTX (50nM, left) or PMX (50 nM, right) for 48 h. Results are expressed as % induction, which indicates the expression of each gene in MTX or PMX- treated relative to its expression in untreated cells. The values in the presence of control siRNA were given an arbitrary value of 100. Mean and SEM of eight independent donors for si8 and five independent donors for si9 are shown. E. MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ or M-MØ, generated in RPMI 1640 medium without folic acid supplemented with 10% fetal calf serum during 7 days, in the absence or in the presence of 50 nM of MTX for 48 h. Cells were treated with MTX, 24 h later folic acid (FA, 50 nM) was added and mRNA levels were determined. Mean and SEM of six independent donors are shown. F. MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ stimulated with 50 nM of MTX in the absence or in the presence of pifitrin-α (PFT, 25 µM or 50 µM) during 48 h. Results are expressed as fold induction, which indica- tes the expression of each gene in MTX-treated relative to its expression in untreated cells. Mean and SEM of six independent donors are shown. G. MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ transfected with control siRNA (-) and siRNA for TYMS (si8) and exposed to PFT (50 µM) for 48h. Results are expressed as fold induction, which indicates the expression of each gene in siRNA TYMS-transfected relative to its expression in siRNA control transfected cells, and untreated (-) or treated with PFT. Mean and SEM of six indepen- dent donors are shown. (*p<0.05, **p<0.01, ***p<0.001). Supplementary Figure 4
FPGS GGH 15 5
4 10 3 * 5 2
Relative mRNA levels Relative mRNA 1
* levels Relative mRNA
0 0 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d Mo + GM Mo + M Mo + GM Mo + M
DHFR TYMS
6 15
4 10 *
2 5 * Relative mRNA levels Relative mRNA Relative mRNA levels Relative mRNA
0 0 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d Mo + GM Mo + M Mo + GM Mo + M
GART ATIC
20 15
15 10 10 * 5 5 Relative mRNA levels Relative mRNA Relative mRNA levels Relative mRNA
0 0 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d Mo + GM Mo + M Mo + GM Mo + M
MTHFR 15
10 *
5 * Relative mRNA levels Relative mRNA
0 1d 2d 3d 4d 5d 6d 7d 1d 2d 3d 4d 5d 6d 7d Mo + GM Mo + M
Supplementary Figure 4.- Expression of folate/MTX metabolizing enzymes during macrophage differen- tiation. FPGS, GGH, DHFR, TYMS, GART, ATIC and MTHFR mRNA expression levels determined by qRT-PCR on monocytes differentiated to GM-MØ or M-MØ at the indicated time points along GM-CSF (Mo+GM) or M-CSF (Mo+M)-induced differentiation. Mean and SEM of four independent donors are shown (*p<0.05, compared with the level detected in GM- or M-CSF-differentiated monocytes in day 1). Supplementary Figure 5 A B C Active RA Synovium p53 100 p53 CD163 p53 CD163 DAPI *** Active RA Synovium 80 p53 CD163 p53 CD163 DAPI 60
1 2 MIF 40
20 1 2 0 Normal RA Synovium 100 µm
Supplementary Figure 5. Expression of p53 by macrophages from RA joints. A. Immu- nofluorescence analysis of active RA synovial tissue, as determined by confocal microscopy using CD163-, and p53-specific antibodies. Nuclei were counterstained with DAPI. The experiment was done on three independent samples from each type, and a representative experiment is shown. Scale bars: 100 µm. B. Magnification (20X) of the areas indicated by a dotted square in A. C. Quantification of p53 staining in CD163 macrophages from normal (normal synovium) and active RA synovial tissue (RA). Background-subtracted mean intensi- ties (in a.u.) from 150-300 macrophages/tissues were plotted, and average ± SEM are shown (3 independent samples and 3 random fields by tissue type). Percentage of positive cells (> 25 a.u.) is indicated for each sample. Scale bars, as indicated (***p<0.001). Supplementary Figure 6
5000 4000 CCL20 3000 LIF 2000 MET 1000 GDF15 25
Fold induction 20 15 10 5 0 GM M GM M GM M GM M MØ MØ MØ MØ
Supplementary Figure 6. Nutlin-3 induces p53- dependent gene expression in GM-MØ and M-MØ. CCL20, LIF, MET and GDF15 mRNA expression levels determined by qRT-PCR on GM-MØ and M-MØ treated for 48 h with 10 µM of nutlin-3. Mean and SEM of six independent donors are shown.