DOCSLIB.ORG

Chick Noggin Is Expressed in the Organizer and Neural Plate During Axial Development, but Offers No Evidence of Involvement in Primary Axis Formation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chick Noggin Is Expressed in the Organizer and Neural Plate During Axial Development, but Offers No Evidence of Involvement in Primary Axis Formation Int..I. IJc,. Hi"I. 41: 389-396 (1997) 389 Chick noggin is expressed in the organizer and neural plate during axial development, but offers no evidence of involvement in primary axis formation DAVID. J. CONNOllY', KETAN PATEL' and JONATHAN COOKE' Division of Developmental Neurobiology, National Institute for Medical Research, London, United Kingdom ABSTRACT We have cloned and examined the early developmental expression of the chick homolog of noggin, a gene originally isolated in Xenopus that can dorsalize gastrular mesoderm and induce anterior neural tissue from gastrular ectoderm when expressed experimentally. Chick noggin is expressed at relatively low levels. but at sites equivalent to those seen in amphibian development. namely Hensen's node and the endo- and mesodermal head process. There is also diffuse expression in the early CNS, centered on the ventral midline, and later hindbrain-associated expression. Since the earlier of these expression sites are consistent with endogenous organizer functions suggested by the properties of the protein in Xenopus experiments, we have used recombinant mammalian Noggin protein secreted by CHO cells in tests for developmental disturbance on the early gastrula-staged chick blastoderm. Comparable tests sensitively detect effects, on chick, of various other secreted proteins that simulate or replicate early developmental signals in Xenopus. We have been unable to observe such effects with a range of Noggin concentrations including those that dramatically dorsalize Xenopus ventral marginal zones. To illustrate effects observed in such tests with secreted proteins active on early stages, we show results with the known Xenopus ventralizer Bone Morphogenetic Protein 4 (BMP-4). KEY WORDS: Noggill, chir'" dou;ali:'(llioll, /If'lIrai induction, lJJlP-.J Introduction induce neural tissue directly in ectoderm at similar stages (Lamb et al., 1993), though the protein concentration reported to be required Noggin, a gene cloned recently in Xenopus and mammals for the latter function is perhaps higher than might be expected for (Smith and Harland, 1992; Lamb etat.1993; Smith etat., 1993), a naturally functioning ligand. Recombinant mammalian Noggin encodes a secreted protein of a novel family. The original expres- protein is active in these Xenopus assays, suggesting strong sion cloning strategy used was designed to select Xenopus RNAs, conservation of steric specificity as has been observed for various expressed during early development, that cause blastomeres into early developmental signals. which they are injected to develop with properties of the 'organizer'. At the time of discovery of the organizer properties of the The natural organizer of the amphibian embryo exists first as a amphibian dorsal lip (Spemann and Mangold, 1924), Spemann signaling centre in dorsal vegetal material (Nieuwkoop, 1969; was inclined to believe that the same signals might be responsible GimJich, 1985), and then as the dorsal anterior mesoderm (dorsal both for organizing pattern within mesoderm and for inducing the blastoporal lip) induced by proximity to that center (Spemann, neural rudiment in adjacent or overlying ectoderm (see Ham- 1938). This latter region in turn emits dorsalizing and neuralizing burger, 1988). But his students and other workers have mainly signals into its mesodermal and ectodermal surroundings during propagated the contrary view that mesodermal patterning and gastrulation (Cooke and Gimlich, 1983; Smith and Slack 1983). neural induction, while overlapping in time, are quite separate Since Noggin protein is secreted, and the protein or RNA is able to processes. It has recently been realized again that this need not simulate the two major signaling functions expected of the organ- be so. At least the initial signals that locate and pattern the izer in appropriate Xenopus functional assays, it is a candidate for nervous system may spread while its presumptive territory is an intercellular signal functioning in this way in vivo.ltcan dorsalize ventral mesoderm during gastrula stages (Smith et al., 1993), and +Address for reprints: Division of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA. United Kingdom. FAX: 181.9064477. e-mail: [email protected] 'These authors contributed equally to this work. 021 ~-6282/97/$05.00 I} lHiC Pr~'\ Prin\~J ill Spain 390 /).1. COl/I/olly el al. GTACCATGGCCGGACGTCGCACGCACAGCCGGTCCGGGTATCCGCCTCCG what is described for Xenopus (Smith and Harland, 1992), includ- ACTnJCTCATCCATTTGCTCCCACCTTCTTCCCCCCCTGCTTGCTGAAC ing dynamic expression within the mesodermal organizer, this CCAGCCCCCCTCCCCCCCCCCCCCCGCTCTCCCAAGGATC GAT CAT Tee M 0 H S chick pattern suggests at least some quantitative differences in M 0 H 5 deployment of the gene among different vertebrates. Noggin is CAG Tce CTT GTG ACT AT AT AC Gee ccc GTC ere ere GGG ere CGG QClVTIYA R V l L G l R also known to have specific expressions in later vertebrate devel- QCLVT!YAL MVFLGLR opmental stages, and since these might correspond with functions CTG CAe CAG Gce Tce Tce CAG CAC TAC ere CAC ATC CGC eeG ccr ece essential for normal phenotype, the gene could be functionally LQQGSCQHYLHI RP AP I DQGGCQH YLHI RP redundant with respect to others in the earliest parts of its expres- AI' Ace CAC AAC CTG ece crc GTG GAT CT A A TC CAG CAC eCG CAC CCT A TC sion pattern (Brookfield, 1992). S DNlPlVDLI EHPDPI We have used recombinant mammalian Noggin protein, ex- 5 E Nl!' LVDll EHPDPI pressed by transfected cells and active in the Xenopus gastrula- TTi CAC ece MG GAG AAG CAT CTT e HG CT A AGC AGC ere FDPKE K DL.,,"E T llRS L stage assays, in two different tests for signaling functions at YDI'KEK DLNE m TLlRTL equivalent stages of bird development. The chick blastoderm, A TG GCA CCA CAC TIC CAC CCT AAC TlT Ace GCT ATT Tce erG ece GAG incubated off its vitelline membrane in simple media at stages MGGHFDPNFTAISLPE MVCHFDPNFMAT (LPE before node regression, is equivalent to the ligand-receptive Xeno- CAC eGC eTe Gee GT A CAC GAT CTG Gee GAG CTG CAC TIC CTe erG CGG pus blastular and gastrular animal cap and marginal zone (Cooke ORlGVDDLAElDllLR ERLC VEDLGELDLLLR and Smith, 1989). It is highly sensitive to several proteins that are, CAG CAG eee TeG CGA GeG A TG eee GGe GAA ATC AAG GGG CTG GAG TIC or that mimic, early developmental signals in the Xenopus system QGl'SGA MP GEl K GLE F (Cooke and Wong, 1991; Cooke el al., 1994; Streit et al., 1995; QKPSGAMPAEIKCLEF Connolly et a/., in preparation). When replaced on membranes and GAC CAC GCG CTG CAG CCG GGC AAG AAG CAC AGG CTG AGC AAG AAG CTG DDGLQPGKKHRlSKKL cultured onwards with the ring culture method (New, 1955). YEGLQ SKKHRLSKKL blastoderms pre-incubated with such active proteins exhibit sys- eGC AGG AAGCTG CAGATG TGC TCC CAG ACC TIeTGC CCC GTC RRKLQM WSQTFCPv tematic perturbation or even obliteration of axial development, in RR K LQM\'w'L WSQT FCPV ways that may be equivalent to results of global ectopic CT A GAC ACG TCG MC GAT erc ceT ACC CGC m TGG CCC CGG A TC GTC overexpression of the developmental signals. We have been LDTWNDLGS R FWP RI V LYTW~DLGTRFWPRYV unable to observe any such perturbations of body-pattern develop- AAA GTG GGC ACC TCC TAC AGT AAA ACG TCT TGCTCT GTC CCA CAA CGC ment by Noggin protein in two different tests. It could be that the KVGS CYS KR SCSVP EG relative degrees of involvement of a gene such as noggin, in early KVCSCYSKRSCSVPEG and then later developmental functions, differ among embryo A~~~~CCTGITAACTIT~aT~~~~~~G MVCKPAK SVHlTI LRW types, and that to perturb the relevant developmental steps, .".1 V C K A A K 5 M H L T I L No W abnormalities of expression for noggin and for one or more other CCG TCC CAG CGG CGG Gee GCG CAG CGe Tee Ace TCG ATC CCC A TC CAG genes might be simultaneously required. Our results are not R CQRRGGQRCT WI PI Q RCQRRVQQKCAWITIQ relevant to possible noggin functions at later stages of refining the TAC CCC ATC ATC eee GACTCC AAG Tce Tec TCC TAGGeT GeG Chick axial pattern. YPIIAECKCSC. Chick YPV[SECKesc X..nlJp1J.5 Results Fig. 1. The sequence of chick noggin. DNA sequence (top) and optimal alignment of chick (middle) and Xenopus (bottom) amino acid sequences. Cloning, sequence and structure Boxed amino acids indicate possible glycosylarion sires Using the Xenopus noggin gene, an avian homolog was isolated from a stage 11 chick embryo cDNA library. Sequence analysis reveals that this gene encodes a protein of 220 amino acids with a within the same cell layer as the organizer, i.e. before gastrulation predicted Mr of 26.4 kDa (Fig. 1), which has 91 % amino acid (Ruiz i Altaba, 1990; Doniach et a/., 1992; Keller el al., 1992). similarity with the Xenopus gene when conservative substitutions Also, by onset of gastrulation, most of the future ectoderm has are taken into account. Like the Xenopus homolog, it has a signal already been left aside as a distinct cell lineage from mesoderm, peptide suggesting that it is a secreted protein, as well as a single so that one signal coming from the axial mesoderm could in potential site for N-linked glycosylation. The only significant differ- principle be involved both in specifying the future differentiations ence is that the chicken gene has two fewer amino acid residues. of surrounding mesoderm and in neuralizing dorsal ectoderm. Southern blot analysis of chicken genomic DNA failed to reveal the Noggin has thus been a candidate gene for a major signal presence of additional noggin-related sequences (data not shown). emanating from the organizer (Harland, 1994). In addition to the Examination of expression during embryogenesis by northern need for such function ultimately to be demonstrated in a pheno- blotting revealed that, as in Xenopus, two major noggin transcripts type of homozygous mutant animals, presumably mice or zebrafish, are seen, but these are larger than their amphibian counterparts at great evolutionary interest attaches to the degree of conservation 5.3 and 2.9 kb (data not shown).
Load more

Recommended publications
  • Spemann Organizer Transcriptome Induction by Early Beta-Catenin, Wnt
    Spemann organizer transcriptome induction by early PNAS PLUS beta-catenin, Wnt, Nodal, and Siamois signals in Xenopus laevis Yi Dinga,b,1, Diego Plopera,b,1, Eric A. Sosaa,b, Gabriele Colozzaa,b, Yuki Moriyamaa,b, Maria D. J. Beniteza,b, Kelvin Zhanga,b, Daria Merkurjevc,d,e, and Edward M. De Robertisa,b,2 aHoward Hughes Medical Institute, University of California, Los Angeles, CA 90095-1662; bDepartment of Biological Chemistry, University of California, Los Angeles, CA 90095-1662; cDepartment of Medicine, University of California, Los Angeles, CA 90095-1662; dDepartment of Microbiology, University of California, Los Angeles, CA 90095-1662; and eDepartment of Human Genetics, University of California, Los Angeles, CA 90095-1662 Contributed by Edward M. De Robertis, February 24, 2017 (sent for review January 17, 2017; reviewed by Juan Larraín and Stefano Piccolo) The earliest event in Xenopus development is the dorsal accumu- Wnt8 mRNA leads to a dorsalized phenotype consisting entirely of lation of nuclear β-catenin under the influence of cytoplasmic de- head structures without trunks and a radial Spemann organizer terminants displaced by fertilization. In this study, a genome-wide (9–11). Similar dorsalizing effects are obtained by incubating approach was used to examine transcription of the 43,673 genes embryos in lithium chloride (LiCl) solution at the 32-cell stage annotated in the Xenopus laevis genome under a variety of con- (12). LiCl mimics the early Wnt signal by inhibiting the enzymatic ditions that inhibit or promote formation of the Spemann orga- activity of glycogen synthase kinase 3 (GSK3) (13), an enzyme nizer signaling center.
    [Show full text]
  • Follistatin and Noggin Are Excluded from the Zebrafish Organizer
    DEVELOPMENTAL BIOLOGY 204, 488–507 (1998) ARTICLE NO. DB989003 Follistatin and Noggin Are Excluded from the Zebrafish Organizer Hermann Bauer,* Andrea Meier,* Marc Hild,* Scott Stachel,†,1 Aris Economides,‡ Dennis Hazelett,† Richard M. Harland,† and Matthias Hammerschmidt*,2 *Max-Planck Institut fu¨r Immunbiologie, Stu¨beweg 51, 79108 Freiburg, Germany; †Department of Molecular and Cell Biology, University of California, 401 Barker Hall 3204, Berkeley, California 94720-3204; and ‡Regeneron Pharmaceuticals, Inc., 777 Old Saw Mill River Road, Tarrytown, New York 10591-6707 The patterning activity of the Spemann organizer in early amphibian embryos has been characterized by a number of organizer-specific secreted proteins including Chordin, Noggin, and Follistatin, which all share the same inductive properties. They can neuralize ectoderm and dorsalize ventral mesoderm by blocking the ventralizing signals Bmp2 and Bmp4. In the zebrafish, null mutations in the chordin gene, named chordino, lead to a severe reduction of organizer activity, indicating that Chordino is an essential, but not the only, inductive signal generated by the zebrafish organizer. A second gene required for zebrafish organizer function is mercedes, but the molecular nature of its product is not known as yet. To investigate whether and how Follistatin and Noggin are involved in dorsoventral (D-V) patterning of the zebrafish embryo, we have now isolated and characterized their zebrafish homologues. Overexpression studies demonstrate that both proteins have the same dorsalizing properties as their Xenopus homologues. However, unlike the Xenopus genes, zebrafish follistatin and noggin are not expressed in the organizer region, nor are they linked to the mercedes mutation. Expression of both genes starts at midgastrula stages.
    [Show full text]
  • Nodal Signaling Is Required for Mesodermal and Ventral but Not For
    © 2015. Published by The Company of Biologists Ltd | Biology Open (2015) 4, 830-842 doi:10.1242/bio.011809 RESEARCH ARTICLE Nodal signaling is required for mesodermal and ventral but not for dorsal fates in the indirect developing hemichordate, Ptychodera flava Eric Röttinger1,2,3,*, Timothy Q. DuBuc4, Aldine R. Amiel1,2,3 and Mark Q. Martindale4 ABSTRACT early fate maps of direct and indirect developing hemichordates, are Nodal signaling plays crucial roles in vertebrate developmental similar to those of indirect-developing echinoids (Colwin and processes such as endoderm and mesoderm formation, and axial Colwin, 1951; Cameron et al., 1987; Cameron et al., 1989; Cameron patterning events along the anteroposterior, dorsoventral and left- and Davidson, 1991; Henry et al., 2001). While the bilaterally right axes. In echinoderms, Nodal plays an essential role in the symmetric echinoderm larvae exhibit strong similarities to establishment of the dorsoventral axis and left-right asymmetry, but chordates in axial patterning and germ layer specification events, not in endoderm or mesoderm induction. In protostomes, Nodal adult body plan comparisons in echinoderms have been difficult due signaling appears to be involved only in establishing left-right to their unique adult pentaradial symmetry. However, both the larval asymmetry. Hence, it is hypothesized that Nodal signaling has and adult body plans of enteropneust hemichordates are bilaterally been co-opted to pattern the dorsoventral axis of deuterostomes and symmetric, and larvae from indirect developing hemichordates for endoderm, mesoderm formation as well as anteroposterior such as Ptychodera flava (P. flava) share similarities in patterning in chordates. Hemichordata, together with echinoderms, morphology, axial organization, and developmental fate map with represent the sister taxon to chordates.
    [Show full text]
  • Inhibition of Activin/Nodal and Wnt Signaling Andrey V
    RESEARCH ARTICLE 5345 Development 138, 5345-5356 (2011) doi:10.1242/dev.068908 © 2011. Published by The Company of Biologists Ltd Novel functions of Noggin proteins: inhibition of Activin/Nodal and Wnt signaling Andrey V. Bayramov*, Fedor M. Eroshkin*, Natalia Y. Martynova, Galina V. Ermakova, Elena A. Solovieva and Andrey G. Zaraisky‡ SUMMARY The secreted protein Noggin1 is an embryonic inducer that can sequester TGF cytokines of the BMP family with extremely high affinity. Owing to this function, ectopic Noggin1 can induce formation of the headless secondary body axis in Xenopus embryos. Here, we show that Noggin1 and its homolog Noggin2 can also bind, albeit less effectively, to ActivinB, Nodal/Xnrs and XWnt8, inactivation of which, together with BMP, is essential for the head induction. In support of this, we show that both Noggin proteins, if ectopically produced in sufficient concentrations in Xenopus embryo, can induce a secondary head, including the forebrain. During normal development, however, Noggin1 mRNA is translated in the presumptive forebrain with low efficiency, which provides the sufficient protein concentration for only its BMP-antagonizing function. By contrast, Noggin2, which is produced in cells of the anterior margin of the neural plate at a higher concentration, also protects the developing forebrain from inhibition by ActivinB and XWnt8 signaling. Thus, besides revealing of novel functions of Noggin proteins, our findings demonstrate that specification of the forebrain requires isolation of its cells from BMP, Activin/Nodal and Wnt signaling not only during gastrulation but also at post-gastrulation stages. KEY WORDS: Noggin, Activin, Nodal, Wnt, Forebrain, Xenopus INTRODUCTION laevis embryos, to bind to and antagonize several secreted proteins The secreted protein Noggin (Noggin1) was first discovered in known to be involved in regulation of TGF and Wnt signaling.
    [Show full text]
  • Signal Transduction Pathway Through Activin Receptors As a Therapeutic Target of Musculoskeletal Diseases and Cancer
    Endocr. J./ K. TSUCHIDA et al.: SIGNALING THROUGH ACTIVIN RECEPTORS doi: 10.1507/endocrj.KR-110 REVIEW Signal Transduction Pathway through Activin Receptors as a Therapeutic Target of Musculoskeletal Diseases and Cancer KUNIHIRO TSUCHIDA, MASASHI NAKATANI, AKIYOSHI UEZUMI, TATSUYA MURAKAMI AND XUELING CUI Division for Therapies against Intractable Diseases, Institute for Comprehensive Medical Science (ICMS), Fujita Health University, Toyoake, Aichi 470-1192, Japan Received July 6, 2007; Accepted July 12, 2007; Released online September 14, 2007 Correspondence to: Kunihiro TSUCHIDA, Institute for Comprehensive Medical Science (ICMS), Fujita Health University, Toyoake, Aichi 470-1192, Japan Abstract. Activin, myostatin and other members of the TGF-β superfamily signal through a combination of type II and type I receptors, both of which are transmembrane serine/threonine kinases. Activin type II receptors, ActRIIA and ActRIIB, are primary ligand binding receptors for activins, nodal, myostatin and GDF11. ActRIIs also bind a subset of bone morphogenetic proteins (BMPs). Type I receptors that form complexes with ActRIIs are dependent on ligands. In the case of activins and nodal, activin receptor-like kinases 4 and 7 (ALK4 and ALK7) are the authentic type I receptors. Myostatin and GDF11 utilize ALK5, although ALK4 could also be activated by these growth factors. ALK4, 5 and 7 are structurally and functionally similar and activate receptor-regulated Smads for TGF-β, Smad2 and 3. BMPs signal through a combination of three type II receptors, BMPRII, ActRIIA, and ActRIIB and three type I receptors, ALK2, 3, and 6. BMPs activate BMP-specific Smads, Smad1, 5 and 8. Smad proteins undergo multimerization with co-mediator Smad, Smad4, and translocated into the nucleus to regulate the transcription of target genes in cooperation with nuclear cofactors.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials + - NUMB E2F2 PCBP2 CDKN1B MTOR AKT3 HOXA9 HNRNPA1 HNRNPA2B1 HNRNPA2B1 HNRNPK HNRNPA3 PCBP2 AICDA FLT3 SLAMF1 BIC CD34 TAL1 SPI1 GATA1 CD48 PIK3CG RUNX1 PIK3CD SLAMF1 CDKN2B CDKN2A CD34 RUNX1 E2F3 KMT2A RUNX1 T MIXL1 +++ +++ ++++ ++++ +++ 0 0 0 0 hematopoietic potential H1 H1 PB7 PB6 PB6 PB6.1 PB6.1 PB12.1 PB12.1 Figure S1. Unsupervised hierarchical clustering of hPSC-derived EBs according to the mRNA expression of hematopoietic lineage genes (microarray analysis). Hematopoietic-competent cells (H1, PB6.1, PB7) were separated from hematopoietic-deficient ones (PB6, PB12.1). In this experiment, all hPSCs were tested in duplicate, except PB7. Genes under-expressed or over-expressed in blood-deficient hPSCs are indicated in blue and red respectively (related to Table S1). 1 C) Mesoderm B) Endoderm + - KDR HAND1 GATA6 MEF2C DKK1 MSX1 GATA4 WNT3A GATA4 COL2A1 HNF1B ZFPM2 A) Ectoderm GATA4 GATA4 GSC GATA4 T ISL1 NCAM1 FOXH1 NCAM1 MESP1 CER1 WNT3A MIXL1 GATA4 PAX6 CDX2 T PAX6 SOX17 HBB NES GATA6 WT1 SOX1 FN1 ACTC1 ZIC1 FOXA2 MYF5 ZIC1 CXCR4 TBX5 PAX6 NCAM1 TBX20 PAX6 KRT18 DDX4 TUBB3 EPCAM TBX5 SOX2 KRT18 NKX2-5 NES AFP COL1A1 +++ +++ 0 0 0 0 ++++ +++ ++++ +++ +++ ++++ +++ ++++ 0 0 0 0 +++ +++ ++++ +++ ++++ 0 0 0 0 hematopoietic potential H1 H1 H1 H1 H1 H1 PB6 PB6 PB7 PB7 PB6 PB6 PB7 PB6 PB6 PB6.1 PB6.1 PB6.1 PB6.1 PB6.1 PB6.1 PB12.1 PB12.1 PB12.1 PB12.1 PB12.1 PB12.1 Figure S2. Unsupervised hierarchical clustering of hPSC-derived EBs according to the mRNA expression of germ layer differentiation genes (microarray analysis) Selected ectoderm (A), endoderm (B) and mesoderm (C) related genes differentially expressed between hematopoietic-competent (H1, PB6.1, PB7) and -deficient cells (PB6, PB12.1) are shown (related to Table S1).
    [Show full text]
  • Embryonic Regeneration by Relocalization of the Spemann
    Embryonic regeneration by relocalization of the PNAS PLUS Spemann organizer during twinning in Xenopus Yuki Moriyamaa,b,1 and Edward M. De Robertisa,b,2 aHoward Hughes Medical Institute, University of California, Los Angeles, CA 90095; and bDepartment of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, CA 90095-1662 Contributed by Edward M. De Robertis, April 3, 2018 (sent for review February 16, 2018; reviewed by Makoto Asashima, Atsushi Suzuki, and Naoto Ueno) The formation of identical twins from a single egg has fascinated side of the embryo in regularly cleaving embryos (9). The op- developmental biologists for a very long time. Previous work had posite, darker side of the embryo gives rise to the ventral (belly) shown that Xenopus blastulae bisected along the dorsal–ventral side. The displacement of egg cytoplasmic determinants along (D-V) midline (i.e., the sagittal plane) could generate twins but at microtubules toward the dorsal side triggers an early Wnt signal very low frequencies. Here, we have improved this method by (10), which is responsible for localizing the subsequent formation using an eyelash knife and changing saline solutions, reaching of the Spemann organizer signaling center in the marginal zone frequencies of twinning of 50% or more. This allowed mechanistic at the gastrula stage. The Spemann organizer is a tissue that analysis of the twinning process. We unexpectedly observed that secretes a mixture of growth factor antagonists, such as Chordin, the epidermis of the resulting twins was asymmetrically pig- Noggin, Follistatin, Cerberus, Frzb1, and Dickkopf, which are mented at the tailbud stage of regenerating tadpoles.
    [Show full text]
  • Repair of Ultraviolet Irradiation Damage to a Cytoplasmic
    Proc. Nat. Acad. Sci. USA Vol. 72, No. 4, pp. 1235-1239, April 1975 Repair of Ultraviolet Irradiation Damage to a Cytoplasmic Component Required for Neural Induction in the Amphibian Egg (cortex/vegetal hemisphere/gray crescent/dorsal lip/gastrulation) HAE-MOON CHUNG AND GEORGE M. MALACINSKI Department of Zoology, Indiana University, Bloomington, Ind. 47401 Communicated by Robert Briggs, January 2, 1975 ABSTRACT Localized ultraviolet irradiation of the am- In order to gain direct insight into whether an ultraviolet phibian egg destroys a cytoplasmic component that is sensitive component(s) localized in the egg cytoplasm prior required for neural induction. Destruction of that com- ponent severely diminishes the inducing capacity of the to first cleavage division is actually involved in neural dorsal lip at gastrulation, as determined by embryological induction, the following question was posed: Does regional assays. Repair of the ultraviolet lesion can be achieved by UV damage to the egg affect the subsequent inducing capacity replacing the dorsal lip of the irradiated embyro with a of the dorsal lip during gastrulation? By assaying for inducing lip from an unirradiated embryo. capacity of dorsal lips from irradiated embryos and replacing Various types of analyses have established that components the dorsal lips of irradiated embryos with normal lips it was of the amphibian egg cytoplasm influence the pattern of early possible to conclude that UV does indeed damage a localized morphogenesis (see ref. 1 for a review). One of the most component of the egg cytoplasm that is necessary for neural conveniently demonstrated, yet most incompletely under- morphogenesis. stood, cytoplasmic components in the amphibian egg is the MATERlALS AND METHODS gray crescent.
    [Show full text]
  • Vg1-Nodal Heterodimers Are the Endogenous Inducers of Mesendoderm Tessa G Montague1*, Alexander F Schier1,2,3,4,5*
    RESEARCH ARTICLE Vg1-Nodal heterodimers are the endogenous inducers of mesendoderm Tessa G Montague1*, Alexander F Schier1,2,3,4,5* 1Department of Molecular and Cellular Biology, Harvard University, Cambridge, United States; 2Center for Brain Science, Harvard University, Cambridge, United States; 3Broad Institute of MIT and Harvard, Cambridge, United States; 4Harvard Stem Cell Institute, Cambridge, United States; 5FAS Center for Systems Biology, Harvard University, Cambridge, United States Abstract Nodal is considered the key inducer of mesendoderm in vertebrate embryos and embryonic stem cells. Other TGF-beta-related signals, such as Vg1/Dvr1/Gdf3, have also been implicated in this process but their roles have been unclear or controversial. Here we report that zebrafish embryos without maternally provided vg1 fail to form endoderm and head and trunk mesoderm, and closely resemble nodal loss-of-function mutants. Although Nodal is processed and secreted without Vg1, it requires Vg1 for its endogenous activity. Conversely, Vg1 is unprocessed and resides in the endoplasmic reticulum without Nodal, and is only secreted, processed and active in the presence of Nodal. Co-expression of Nodal and Vg1 results in heterodimer formation and mesendoderm induction. Thus, mesendoderm induction relies on the combination of two TGF-beta- related signals: maternal and ubiquitous Vg1, and zygotic and localized Nodal. Modeling reveals that the pool of maternal Vg1 enables rapid signaling at low concentrations of zygotic Nodal. DOI: https://doi.org/10.7554/eLife.28183.001 Introduction *For correspondence: tessa. [email protected] (TGM); The induction of mesoderm and endoderm (mesendoderm) during embryogenesis and embryonic [email protected] (AFS) stem cell differentiation generates the precursors of the heart, liver, gut, pancreas, kidney and other internal organs.
    [Show full text]
  • Activin/Nodal Signalling in Stem Cells Siim Pauklin and Ludovic Vallier*
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 607-619 doi:10.1242/dev.091769 REVIEW Activin/Nodal signalling in stem cells Siim Pauklin and Ludovic Vallier* ABSTRACT organisms. Of particular relevance, genetic studies in the mouse Activin/Nodal growth factors control a broad range of biological have established that Nodal signalling is necessary at the early processes, including early cell fate decisions, organogenesis and epiblast stage during implantation, in which the pathway functions adult tissue homeostasis. Here, we provide an overview of the to maintain the expression of key pluripotency factors as well as to mechanisms by which the Activin/Nodal signalling pathway governs regulate the differentiation of extra-embryonic tissue. Activins, β stem cell function in these different stages of development. dimers of different subtypes of Inhibin , are also expressed in pre- We describe recent findings that associate Activin/Nodal signalling implantation blastocyst but not in the primitive streak (Albano to pathological conditions, focusing on cancer stem cells in et al., 1993; Feijen et al., 1994). However, genetic studies have β tumorigenesis and its potential as a target for therapies. Moreover, shown that Inhibin s are not necessary for early development in the we will discuss future directions and questions that currently remain mouse (Lau et al., 2000; Matzuk, 1995; Matzuk et al., 1995a,b). unanswered on the role of Activin/Nodal signalling in stem cell self- Combined gradients of Nodal and BMP signalling within the renewal, differentiation and proliferation. primitive streak control endoderm and mesoderm germ layer specification and also their subsequent patterning whilst blocking KEY WORDS: Activin, Cell cycle, Differentiation, Nodal, neuroectoderm formation (Camus et al., 2006; Mesnard et al., Pluripotency, Stem cells 2006).
    [Show full text]
  • GTPBP2 Is a Positive Regulator of TGF- Signaling, and Is Required for Embryonic Patterning in Xenopus
    SSStttooonnnyyy BBBrrrooooookkk UUUnnniiivvveeerrrsssiiitttyyy The official electronic file of this thesis or dissertation is maintained by the University Libraries on behalf of The Graduate School at Stony Brook University. ©©© AAAllllll RRRiiiggghhhtttsss RRReeessseeerrrvvveeeddd bbbyyy AAAuuuttthhhooorrr... GTPBP2 is a positive regulator of TGF- signaling, and is required for embryonic patterning in Xenopus. A Dissertation Presented by Arif Kirmizitas to The Graduate School in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Molecular and Cellular Biology Stony Brook University December 2008 Stony Brook University The Graduate School Arif Kirmizitas We, the dissertation committee for the above candidate for the Doctor of Philosophy degree, hereby recommend acceptance of this dissertation. Gerald H. Thomsen – Dissertation Advisor Professor, Department of Biochemistry and Cell Biology Howard I. Sirotkin – Chairperson of Defense Associate Professor, Department of Neurobiology and Behavior Nancy C. Reich Professor, Department of Molecular Genetics and Microbiology A. Wali Karzai Associate Professor, Department of Biochemistry and Cell Biology Bernadette C. Holdener Associate Professor, Department of Biochemistry and Cell Biology Daniel S. Kessler Associate Professor, Department of Cell and Developmental Biology,University of Pennsylvania School of Medicine, Philadelphia, PA This Dissertation is accepted by the Graduate School. Lawrence Martin Dean of the Graduate School ii Abstract of the Dissertation GTPBP2 is a positive regulator of TGF- signaling, and is required for embryonic patterning in Xenopus. by Arif Kirmizitas Doctor of Philosophy in Molecular and Cellular Biology Stony Brook University 2008 The Transforming Growth Factor (TGF-) superfamily of signaling proteins regulate a diverse set of biological processes, including cell proliferation, adhesion, migration, apoptosis, differentiation and embryonic pattern formation.
    [Show full text]
  • Nodal Facilitates Differentiation of Fibroblasts to Cancer-Associated
    cells Article Nodal Facilitates Differentiation of Fibroblasts to Cancer-Associated Fibroblasts that Support Tumor Growth in Melanoma and Colorectal Cancer Ziqian Li 1, Junjie Zhang 1, Jiawang Zhou 1, Linlin Lu 1, Hongsheng Wang 1, Ge Zhang 1, Guohui Wan 1, Shaohui Cai 2 and Jun Du 1,* 1 Department of Microbial and Biochemical Pharmacy, School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006, China; [email protected] (Z.L.); [email protected] (J.Z.); [email protected] (J.Z.); [email protected] (L.L.); [email protected] (H.W.); [email protected] (G.Z.); [email protected] (G.W.) 2 Department of Pharmacology, School of Pharmaceutical Sciences, Jinan University, Guangzhou 510632, China; [email protected] * Correspondence: [email protected]; Tel.: +86-20-3994-3022; Fax: +86-20-3994-3022 Received: 15 May 2019; Accepted: 3 June 2019; Published: 4 June 2019 Abstract: Fibroblasts become cancer-associated fibroblasts (CAFs) in the tumor microenvironment after activation by transforming growth factor-β (TGF-β) and are critically involved in cancer progression. However, it is unknown whether the TGF superfamily member Nodal, which is expressed in various tumors but not expressed in normal adult tissue, influences the fibroblast to CAF conversion. Here, we report that Nodal has a positive correlation with α-smooth muscle actin (α-SMA) in clinical melanoma and colorectal cancer (CRC) tissues. We show the Nodal converts normal fibroblasts to CAFs, together with Snail and TGF-β signaling pathway activation in fibroblasts. Activated CAFs promote cancer growth in vitro and tumor-bearing mouse models in vivo.
    [Show full text]