Int..I. IJc,. Hi"I. 41: 389-396 (1997) 389 Chick noggin is expressed in the organizer and neural plate during axial development, but offers no evidence of involvement in primary axis formation DAVID. J. CONNOllY', KETAN PATEL' and JONATHAN COOKE' Division of Developmental Neurobiology, National Institute for Medical Research, London, United Kingdom ABSTRACT We have cloned and examined the early developmental expression of the chick homolog of noggin, a gene originally isolated in Xenopus that can dorsalize gastrular mesoderm and induce anterior neural tissue from gastrular ectoderm when expressed experimentally. Chick noggin is expressed at relatively low levels. but at sites equivalent to those seen in amphibian development. namely Hensen's node and the endo- and mesodermal head process. There is also diffuse expression in the early CNS, centered on the ventral midline, and later hindbrain-associated expression. Since the earlier of these expression sites are consistent with endogenous organizer functions suggested by the properties of the protein in Xenopus experiments, we have used recombinant mammalian Noggin protein secreted by CHO cells in tests for developmental disturbance on the early gastrula-staged chick blastoderm. Comparable tests sensitively detect effects, on chick, of various other secreted proteins that simulate or replicate early developmental signals in Xenopus. We have been unable to observe such effects with a range of Noggin concentrations including those that dramatically dorsalize Xenopus ventral marginal zones. To illustrate effects observed in such tests with secreted proteins active on early stages, we show results with the known Xenopus ventralizer Bone Morphogenetic Protein 4 (BMP-4). KEY WORDS: Noggill, chir'" dou;ali:'(llioll, /If'lIrai induction, lJJlP-.J Introduction induce neural tissue directly in ectoderm at similar stages (Lamb et al., 1993), though the protein concentration reported to be required Noggin, a gene cloned recently in Xenopus and mammals for the latter function is perhaps higher than might be expected for (Smith and Harland, 1992; Lamb etat.1993; Smith etat., 1993), a naturally functioning ligand. Recombinant mammalian Noggin encodes a secreted protein of a novel family. The original expres- protein is active in these Xenopus assays, suggesting strong sion cloning strategy used was designed to select Xenopus RNAs, conservation of steric specificity as has been observed for various expressed during early development, that cause blastomeres into early developmental signals. which they are injected to develop with properties of the 'organizer'. At the time of discovery of the organizer properties of the The natural organizer of the amphibian embryo exists first as a amphibian dorsal lip (Spemann and Mangold, 1924), Spemann signaling centre in dorsal vegetal material (Nieuwkoop, 1969; was inclined to believe that the same signals might be responsible GimJich, 1985), and then as the dorsal anterior mesoderm (dorsal both for organizing pattern within mesoderm and for inducing the blastoporal lip) induced by proximity to that center (Spemann, neural rudiment in adjacent or overlying ectoderm (see Ham- 1938). This latter region in turn emits dorsalizing and neuralizing burger, 1988). But his students and other workers have mainly signals into its mesodermal and ectodermal surroundings during propagated the contrary view that mesodermal patterning and gastrulation (Cooke and Gimlich, 1983; Smith and Slack 1983). neural induction, while overlapping in time, are quite separate Since Noggin protein is secreted, and the protein or RNA is able to processes. It has recently been realized again that this need not simulate the two major signaling functions expected of the organ- be so. At least the initial signals that locate and pattern the izer in appropriate Xenopus functional assays, it is a candidate for nervous system may spread while its presumptive territory is an intercellular signal functioning in this way in vivo.ltcan dorsalize ventral mesoderm during gastrula stages (Smith et al., 1993), and +Address for reprints: Division of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA. United Kingdom. FAX: 181.9064477. e-mail: [email protected] 'These authors contributed equally to this work. 021 ~-6282/97/$05.00 I} lHiC Pr~'\ Prin\~J ill Spain 390 /).1. COl/I/olly el al. GTACCATGGCCGGACGTCGCACGCACAGCCGGTCCGGGTATCCGCCTCCG what is described for Xenopus (Smith and Harland, 1992), includ- ACTnJCTCATCCATTTGCTCCCACCTTCTTCCCCCCCTGCTTGCTGAAC ing dynamic expression within the mesodermal organizer, this CCAGCCCCCCTCCCCCCCCCCCCCCGCTCTCCCAAGGATC GAT CAT Tee M 0 H S chick pattern suggests at least some quantitative differences in M 0 H 5 deployment of the gene among different vertebrates. Noggin is CAG Tce CTT GTG ACT AT AT AC Gee ccc GTC ere ere GGG ere CGG QClVTIYA R V l L G l R also known to have specific expressions in later vertebrate devel- QCLVT!YAL MVFLGLR opmental stages, and since these might correspond with functions CTG CAe CAG Gce Tce Tce CAG CAC TAC ere CAC ATC CGC eeG ccr ece essential for normal phenotype, the gene could be functionally LQQGSCQHYLHI RP AP I DQGGCQH YLHI RP redundant with respect to others in the earliest parts of its expres- AI' Ace CAC AAC CTG ece crc GTG GAT CT A A TC CAG CAC eCG CAC CCT A TC sion pattern (Brookfield, 1992). S DNlPlVDLI EHPDPI We have used recombinant mammalian Noggin protein, ex- 5 E Nl!' LVDll EHPDPI pressed by transfected cells and active in the Xenopus gastrula- TTi CAC ece MG GAG AAG CAT CTT e HG CT A AGC AGC ere FDPKE K DL.,,"E T llRS L stage assays, in two different tests for signaling functions at YDI'KEK DLNE m TLlRTL equivalent stages of bird development. The chick blastoderm, A TG GCA CCA CAC TIC CAC CCT AAC TlT Ace GCT ATT Tce erG ece GAG incubated off its vitelline membrane in simple media at stages MGGHFDPNFTAISLPE MVCHFDPNFMAT (LPE before node regression, is equivalent to the ligand-receptive Xeno- CAC eGC eTe Gee GT A CAC GAT CTG Gee GAG CTG CAC TIC CTe erG CGG pus blastular and gastrular animal cap and marginal zone (Cooke ORlGVDDLAElDllLR ERLC VEDLGELDLLLR and Smith, 1989). It is highly sensitive to several proteins that are, CAG CAG eee TeG CGA GeG A TG eee GGe GAA ATC AAG GGG CTG GAG TIC or that mimic, early developmental signals in the Xenopus system QGl'SGA MP GEl K GLE F (Cooke and Wong, 1991; Cooke el al., 1994; Streit et al., 1995; QKPSGAMPAEIKCLEF Connolly et a/., in preparation). When replaced on membranes and GAC CAC GCG CTG CAG CCG GGC AAG AAG CAC AGG CTG AGC AAG AAG CTG DDGLQPGKKHRlSKKL cultured onwards with the ring culture method (New, 1955). YEGLQ SKKHRLSKKL blastoderms pre-incubated with such active proteins exhibit sys- eGC AGG AAGCTG CAGATG TGC TCC CAG ACC TIeTGC CCC GTC RRKLQM WSQTFCPv tematic perturbation or even obliteration of axial development, in RR K LQM\'w'L WSQT FCPV ways that may be equivalent to results of global ectopic CT A GAC ACG TCG MC GAT erc ceT ACC CGC m TGG CCC CGG A TC GTC overexpression of the developmental signals. We have been LDTWNDLGS R FWP RI V LYTW~DLGTRFWPRYV unable to observe any such perturbations of body-pattern develop- AAA GTG GGC ACC TCC TAC AGT AAA ACG TCT TGCTCT GTC CCA CAA CGC ment by Noggin protein in two different tests. It could be that the KVGS CYS KR SCSVP EG relative degrees of involvement of a gene such as noggin, in early KVCSCYSKRSCSVPEG and then later developmental functions, differ among embryo A~~~~CCTGITAACTIT~aT~~~~~~G MVCKPAK SVHlTI LRW types, and that to perturb the relevant developmental steps, .".1 V C K A A K 5 M H L T I L No W abnormalities of expression for noggin and for one or more other CCG TCC CAG CGG CGG Gee GCG CAG CGe Tee Ace TCG ATC CCC A TC CAG genes might be simultaneously required. Our results are not R CQRRGGQRCT WI PI Q RCQRRVQQKCAWITIQ relevant to possible noggin functions at later stages of refining the TAC CCC ATC ATC eee GACTCC AAG Tce Tec TCC TAGGeT GeG Chick axial pattern. YPIIAECKCSC. Chick YPV[SECKesc X..nlJp1J.5 Results Fig. 1. The sequence of chick noggin. DNA sequence (top) and optimal alignment of chick (middle) and Xenopus (bottom) amino acid sequences. Cloning, sequence and structure Boxed amino acids indicate possible glycosylarion sires Using the Xenopus noggin gene, an avian homolog was isolated from a stage 11 chick embryo cDNA library. Sequence analysis reveals that this gene encodes a protein of 220 amino acids with a within the same cell layer as the organizer, i.e. before gastrulation predicted Mr of 26.4 kDa (Fig. 1), which has 91 % amino acid (Ruiz i Altaba, 1990; Doniach et a/., 1992; Keller el al., 1992). similarity with the Xenopus gene when conservative substitutions Also, by onset of gastrulation, most of the future ectoderm has are taken into account. Like the Xenopus homolog, it has a signal already been left aside as a distinct cell lineage from mesoderm, peptide suggesting that it is a secreted protein, as well as a single so that one signal coming from the axial mesoderm could in potential site for N-linked glycosylation. The only significant differ- principle be involved both in specifying the future differentiations ence is that the chicken gene has two fewer amino acid residues. of surrounding mesoderm and in neuralizing dorsal ectoderm. Southern blot analysis of chicken genomic DNA failed to reveal the Noggin has thus been a candidate gene for a major signal presence of additional noggin-related sequences (data not shown). emanating from the organizer (Harland, 1994). In addition to the Examination of expression during embryogenesis by northern need for such function ultimately to be demonstrated in a pheno- blotting revealed that, as in Xenopus, two major noggin transcripts type of homozygous mutant animals, presumably mice or zebrafish, are seen, but these are larger than their amphibian counterparts at great evolutionary interest attaches to the degree of conservation 5.3 and 2.9 kb (data not shown).