DOCSLIB.ORG

Presentation Headline Subhead

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Presentation Headline Subhead IBM Spectrum Scale IBM Life Sciences Madhav Ponamgi [email protected] Alignment Paths Finish City block traversal problem. Beginning from the start travel North / East to the finish. • How many possible paths in a M x N grid? • How long is a path? • Is there an optimal path? • What if we weight the edges, can there be an optimal path? • How do we compute an optimal path? • What are all the optimal paths? Start IBM Systems | 2 Genomic Alignment Paths Finish Determining the optimal alignment of short sequence of base pairs. C A T G T A C A A T C G A C C T • Non-trivial to find “best” alignment G • Scoring matrix for multi-dimensional alignment • Using weighted edges, a Dynamic Programming method can be used to construct T matchings A • V. Levenshtein introduced edit distance – A T C G A C C shortest sequence of single line edits match two Start sequences IBM Systems | 3 Phylogenetics . Sort by reversal: 612345 -> 162345 -> 126345-> 123645-> 123465->123456 . Used for comparing genome to genome sequences . Across species similar genes are laid in different groups – called Synteny. Mouse and human genomes are similar with about 300 blocks re-arranged. How to get from one arrangement to another in the most “parsimonious” sequence of steps . Depending on length of genomes can be I/O intensive . Faster method: : 612345 -> 543216->123456 IBM Systems | 4 Motif finding methods CGGGGCTGGTCGTCACATTCCCCCTTTTGATATTTGAGGGGTGCTGCCAATAA CCAAAAGCGGACAAGGGGATCCGTTGACGACCTAAATCAACGGCCAAGGCC AAGGCCAGGAGGCGCCTTTGCTGGTTCTACCTGAATTTCTAAAAAAGATTATA ATGTAATGTCGGTCCTCCTGCTGTACAACTGAGATCATGCTGCTGCTTTCAAC Genomic sequences often contain motifs, short Possible solution methods: sequences of base pairs, that frame gene • Brute-force method encoding sequences • Examine all size sequences of size k contained • The motifs may not be known in advance within a sequence of size n • This results in an exponential algorithm of order • The length or size of the motif may not be O(n^k) known (i.e. how many base pairs) • Branch-and-Bound • It’s not unusual for the motifs to vary slightly • Using branch-and-bound techniques and search within the genomic sequence (i.e. the motif trees the brute force method can be improved may have slight mutations as it recurs) upon • Goal is to identify and locate these sequences • The I/O pattern for this type search is not so gene can be identified restricted serial apart from the initialization because the parallel methods evaluate the genome independently (k << n) IBM Systems | 5 Life Sciences §- §- § Computational / Quantum § Molecular Dynamics § Genomics / Proteomics § Translational Medicine / Chemistry Imaging . Mass spectometry . Large molecules / enzymes . Ab Inito / Hartree-Fock . Personalized genomics . De novo sequencing . Classical physics / empirical . Gaussian . Health records / HIPPA . Sequest . NWChem . GAMESS . Functional MRI . Scaffold . NAMD . MOPAC . Data mining / Security . Illumina / Accelerys / CLC . Charmm Traditional Sequencing Method – SANGER Method § Sanger sequencing Fewer toxic chemicals Less radioactive materials Long continuous reads Separate DNA into single strand Add Primer (known sequence) Place into 4 separate ddNTP The ddNTP stop reaction Sort across gel electrophloresis The first whole human genome was delivered in 2003 It cost $3B and took 13 years to complete Read back top to bottom IBM Systems Next Generation Sequencers .Data needs to be assembled and analyzed for gene identification, gene variations and gene functionality .8 .2015. All rights reserved. Evolution of DNA Sequencers $149,000, Life Technology Ion Proton Sequencer (late 2012) Source: A decade’s perspective on DNA http://www.youtube.com/watch?v=OKhxoGcr4Rk sequencing technology Elaine R. Mardis Nature, Volume: 470, Pages: 198–203 Date published: (10 February 2011) $740,000, Illumina HiSeq 2500 Availability Output Run time Average read Cost/run Proton 1 Sept 2012 10Gb 2-4 hrs 200 bp $999 Proton 2 Mar 2013 100Gb 2-4 hrs >200bp <$999 HiSeq 2500 Mid 2012 600Gb 11 days 150bp $11,000 Source: http://blueseq.com/knowledgebank/sequencing-platforms/ Oxford Nanopore MinION Cost per Genome .10 https://www.genome.gov/27541954/dna-sequencing-costs/ Explosive Growth of Data 14K 13K § NCBI GenBank 12K 2001 first human genome 11K 2005 NGS publication 10K 9K 2008 Solexa sequencer 8K 2010 BGI center opens 7K 2012 78TB analysis 1 week Terabytes § 6K 5K 4K 3K 2K 1K 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 Disk Challenge • 20 Petabytes by 2018 • If current 3.5” 8TB disks are a guide.. then we'd be looking at 2,500 disk farm • Stacked horizontally, this would be a tower 127 meters in height – Statue of Liberty, 93 M – Eiffel Tower, 324 M IBM Systems . NEED Analytics . NEED High Performance Computing . NEED High Performance Storage Genomics Data High-Level Pipeline Base Calling Alignment or §Sam / Bam (Vendor Tool) §FastQ/FastA Assembly §Aligned NGS §Raw NGS Reads Reads .13 TB .8TB Variant .2 TB Calling §VCF file .200 GB §Genomic Variant §Downstream Analysis IBM Systems Spectrum Scale: A File System for Genomic Pipelines .Instruments .Sequencers .Users and applications .Compute Farm .Single name space .POSIX .SMB/ .Map Reduce .NFS CIFS Connector .Site A .Spectrum Scale .Sit e B Automated data placement and data migration .Off .Sit e C Premise .Tape .Flash .Storage Rich Servers .Disk §Source §Information Extraction / Data Integration and Management §Analytics §Interface §Publication §Information Extraction §Insight and Discovery §Cognitive Analytics §User Interfaces s §LuceGene / SRS §Watson Discovery §Watson Healthcare §Web Portals §Patents §Google Analytics §NLP / Nuance §Ontologies Science Data §Knowledge Hub §BigInsight, Vivisimo, Varicent § EMR §MDM §ETL §NLP §Predictive Analytics §Cohort Query §Clinical §MDM Server, RDM §ETL Server §Content §SAS, R, SPSS, Rev §i2b2 Analytics R §Studies § GWAS § Data Explore TR §Clinical & Omics §Translational DW DW §PLINK, VAAST §tranSMART, Workbench Translational §Imaging HUB §Cognos CDM, Data §NextBio, § tranSMART §Ab §Computational §Molecular Modeling § Safety & Efficacy §Distribution Inito Chemistry §Quantum / Hartree-Fock §Large Molecule / §Clinical Trials §Marketing / Sales §Experimental Empirical Discovery Discovery § §Simulation §Drug Discovery §Target Enzymes §In vivo Efficacy §FDA: Phase I-III §Approval / § Manufacture §Genomics §Radiomics §Proteomics §Cytometry §NGS §De Novo Assembly §Variant Analysis §Annotatio §Pathway §Application Analysis Management n §PID, Reactome §Reference DB Map §Picard, GATK, SAM, SOAP §Annovar §LIMS §Bionimbus, Galaxy §Bowtie, BWA, SOAP, CLCbio §TCGA, dbSNP, GEO, §GO §Expression Analysis Genomics §Ref DB §Velvet, Allpaths, Biovia §Partek, GenePattern § .I/O .ILM .AFM Scale: Global Storage & File System Scale / ESS .NFS/AFM Protect, Archive, HPSS Spark .WLM .RTM .Security Speed: Workload & Workflow Platform LSF, RTM, PAC, Symphony Cluster Big Data .Cloud Smart: Infrastructure PPM, PCM, EGO Galaxy IBM Systems Multi-Site Pharmaceutical AFM Deployment .4 Sites with roving users .IW Mode with no Pre-Fetch Spectrum Scale Spectrum Scale .Each site consists of ESS storage with two CES nodes Spectrum Scale.Users are in separate directories without common shared files .Campus inter-connect is 1GigE Spectrum Scale Spectrum Scale IBM Systems .Major Cancer Center .HPC .HPC . Research .Clients .NFS Servers .40 GbE Network .InfiniBand .NSD .NSD .Servers .Servers .Head Nodes .SAN Fiber .SAS .NSD2 .TSM servers . TSM . TSM .Disk .Disk .Stage 1 – 500 TB’s scratch .Stage 2- 2 Petabytes .Stage 3 – Existing .Pool .Pool storage .New storage .New storage .Stage 4 – Backup .Base FM . FM2 . FM3 . FM4 . FM5 . FM6 .Slots .10 – .Total Slots .Total Slots .Total Slots .Total Slots .Total Slots LTO6 .10 – LTO6 .Physical tape Library University System Architecture .Omega .Louise .BulldogN .Core GPFS Cluster IBM Systems Typical Genomics File Size Histogram Personalized Medicine Acute Lymphoblastic Leukemia (ALL) . Relapse 2014 (variation) . Full Exome sequenced . Connection to Philadelphia Chromosome and 1-nucleotide mutant NT5C2 + NUP214-ABL1 (resistance to chemo drug) . Treatment with BMS Sprycel IBM Systems | 21 .Help is on the way .3 weeks .Diagnosis and Cure .Dr. Wartman, WashU .Cancer researcher and .leukemia survivor .IBM CONFIDENTIAL .Help is on the way .3 weeks .Diagnosis and Cure .$32 Billion .Healthcare analytics market by 2022 .Dr. Wartman, WashU .Cancer researcher and .leukemia survivor .$88 Billion .Precision medicine market by 2022 .IBM CONFIDENTIAL Crispr CAS9 Genome Editing IBM Systems | 24 Molecular Biology Dogma Big Data §DNA §Transcription §RNA §Translation §Proteins IBM Systems Established & proven with blue-chip organizations ENTERPRISE HEALTHCARE PUBLIC SECTOR Government PARTNERS .27 27 • Single Name Space Spectrum Scale is the backbone of the data hub • Supports multiple tiers of storage: flash, spinning disk, tape and archive • Geographically dispersed management of data including disaster recovery • Encryption for protection of regulatory/patient data .Clients • Support multiple protocols for instruments, compute loads, File and Object storage .Instruments Single Name Space Site .File/Data Site A B Servers AFM/DR .ILM .ILM Site C .JBOD Disk Enclosures .Shared storage Pool .Active Pool .Tape /optical Pool End-to-End NIST / FIPS2-40 Certified Encryption .IBM Security) IBM Systems Thank you. ibm.com/systems IBM Systems | 29 Legal notices Copyright © 2015 by International Business Machines Corporation. All rights reserved. No part of this document may be
Load more

Recommended publications
  • Limp Bizkit Behind Blue Eyes Mp3, Flac, Wma
    Limp Bizkit Behind Blue Eyes mp3, flac, wma DOWNLOAD LINKS (Clickable) Genre: Rock Album: Behind Blue Eyes Country: US Released: 2003 Style: Pop Rock MP3 version RAR size: 1151 mb FLAC version RAR size: 1732 mb WMA version RAR size: 1280 mb Rating: 4.2 Votes: 880 Other Formats: AUD AAC WMA MMF ASF MPC MIDI Tracklist Hide Credits Behind Blue Eyes (Album Version) 1 4:30 Written By – Pete Townshend Companies, etc. Phonographic Copyright (p) – Flip/Interscope Records Copyright (c) – Flip/Interscope Records Credits Edited By – Dave Holdridge* Engineer – Dave Holdridge*, Elvis Baskette Mixed By – Brendan O'Brien Producer – Fred Durst Notes FOR PROMOTINAL USE ONLY - NOT FOR SALE Barcode and Other Identifiers Matrix / Runout: DISCTRONICS LIMPCDP2 01 Mastering SID Code: IFPI L136 Mould SID Code: IFPI 04AD Other versions Category Artist Title (Format) Label Category Country Year Behind Blue Eyes Interscope 0602498147450 Limpbizkit* 0602498147450 Europe 2003 (CD, Maxi, Enh) Records Behind Blue Eyes Motor / Urban / none Limp Bizkit (CD, Single, Promo, none Germany 2003 Def Jam Group Car) Behind Blue Eyes Interscope 06024 9814743 Limp Bizkit 06024 9814743 Europe 2003 (7") Records Behind Blue Eyes Interscope 0602498147467 Limp Bizkit 0602498147467 Europe 2003 (CD, Single, Car) Records Behind Blue Eyes 06024 9861883 Limp Bizkit (CD, Mini, Single, Motor Music 06024 9861883 Germany 2003 Copy Prot.) Related Music albums to Behind Blue Eyes by Limp Bizkit Limp Bizkit - Rollin' Limp Bizkit - Limp Bizkit - New Old Songs Limp Bizkit - My Generation Limp Bizkit / Dr. Dre & Eminem - N2 Gether Now Limp Bizkit - Gold Cobra Limp Bizkit - If Only We Could Fly Limp Bizkit - Significant Other Limp Bizkit - Results May Vary Limp Bizkit - Chocolate Starfish And The Hot Dog Flavored Water Limp Bizkit - Re-Arranged Limp Bizkit - Three Dollar Bill, Yall$.
    [Show full text]
  • Limp Bizkit Three Dollar Bill, Yall$ Mp3, Flac, Wma
    Limp Bizkit Three Dollar Bill, Yall$ mp3, flac, wma DOWNLOAD LINKS (Clickable) Genre: Rock Album: Three Dollar Bill, Yall$ Country: Russia Style: Nu Metal MP3 version RAR size: 1579 mb FLAC version RAR size: 1752 mb WMA version RAR size: 1807 mb Rating: 4.3 Votes: 415 Other Formats: AA VOX MP3 VOX DXD APE AA Tracklist 1 Intro 2 Pollution 3 Counterfeit 4 Stuck 5 Nobody Loves Me 6 Sour 7 Stalemate 8 Clunk 9 Faith 10 Stinkfinger 11 Indigo Flow 12 Leech 13 Everything Notes CD comes with a 4-page booklet in a standard jewel case Barcode and Other Identifiers Barcode (Text): 6 06949 01242 7 Barcode (String): 606949012427 Matrix / Runout: LA-021 Other versions Category Artist Title (Format) Label Category Country Year Limp Three Dollar Bill, Interscope Records, INTD-90124 INTD-90124 US 1997 Bizkit Yall$ (CD, Album) Flip Records Interscope Records, Three Dollar Bill, IND 90124, Limp Flip Records , Flip IND 90124, Yall$ (CD, Album, Russia 2000 490 124-2 Bizkit Records , Interscope 490 124-2 Unofficial) Records IND 90124, Limp Three Dollar Bill, Flip Records , IND 90124, Europe 1997 490 124-2 Bizkit Yall$ (CD, Album) Interscope Records 490 124-2 Interscope Records, Limp Three Dollar Bill, Flip Records, ЗАО 490 124-9 490 124-9 Russia 1997 Bizkit Yall$ (CD, Album) "Юниверсал Мьюзик" Three Dollar Bill, Limp 50899 013 Yell$ (Cass, Interscope Records 50899 013 Russia 1997 Bizkit Album, Unofficial) Related Music albums to Three Dollar Bill, Yall$ by Limp Bizkit Limp Bizkit - Significant Other Limp Bizkit - New Old Songs [Explicit Version] limp bizkit - results may vary Limp Bizkit - Star Profile Limp Bizkit - My Generation Limp Bizkit - Rough Limp Bizkit - N 2 Gether Now Limp Bizkit - New Old Songs Limp Bizkit - Icon Limp Bizkit - The Unquestionable Truth (Part 1).
    [Show full text]
  • LIMP BIZKIT 2018 Veranstaltungsort Westfalenhalle Beginn 20:00 Uhr
    20.06.2018 LIMP BIZKIT 2018 Veranstaltungsort Westfalenhalle Beginn 20:00 Uhr Veranstalter handwerker promotion e.GmbH LIMP BIZKIT Live 2018 Mittwoch, 20.06.2018 – Dortmund, Westfalenhalle Beginn: 20:00 Uhr Support: Blvck Ceiling Große Sommer-Tournee der Nu Metal-Pioniere im Juni 2018 Nach ihrer erfolgreichen Tournee im Sommer 2015 haben LIMP BIZKIT ihre erneute Rückkehr nach Deutschland angekündigt. Die Mitbegründer des Nu Metal sind für sieben Shows im Juni 2018 hierzulande bestätigt. Das Quintett um Frontmann Fred Durst wird am 20. Juni 2018 in der Westfalenhalle in Dortmund zu sehen sein. Der einzige Auftritt in NRW! LIMP BIZKIT gehören zu den innovativsten Bands ihres Genres und sind mit über 40 Millionen verkauften Tonträgern eine der erfolgreichsten dazu. Seit ihrer Gründung 1994 in Jacksonville/Florida beeinflussen LIMP BIZKIT im Laufe der letzten beiden Jahrzehnte eine Unzahl von Nachwuchsmusikern. Ihr innovativer, mitreißender Mix aus peitschenden Rhythmen, massiven Gitarrenwänden und funkigen HipHop-Elementen, der Nu Metal, ist eine Neuinterpretation der Crossover-Musik aus den frühen 90ern. Damals gründet Bandleader Fred Durst mit dem Bassisten Sam Rivers und John Otto am Schlagzeug sein erstes Musikprojekt, einige Monate später stößt Gitarrist Wes Borland hinzu. Mithilfe der befreundeten Band Korn touren sie mit den Deftones und House Of Pain. Von letzteren steigt DJ Lethal von House Of Pain ein. Das im Juli 1997 veröffentlichtes Debüt „Three Dollar Bill, Y’all“ wird mit über zwei Millionen Verkäufen zum überwältigenden Erfolg. Die Nachfolger „Significant Other“ (1999) und „Chocolate Starfish And The Hot Dog Flavored Water“ (2000) verkaufen sich zusammen über 16 Millionen Mal, es folgen drei Grammy-Nominierungen, die Singlehits wie „Nookie“, „Rollin’“, „Take A Look Around“ oder die Coverversion von George Michaels „Faith“ untermauern ihre Stilbreite und Experimentierfreude.
    [Show full text]
  • "Jeder Tag Ist Bedeutsam"
    "Jeder Tag ist bedeutsam" Limp Bizkit , Interview vom 28. Februar 2004 Erst nach ihrem zweiten Album "Significant Other" kam der weltweite Durchbruch für die US-amerikanische Band Limp Bizkit. Das Album schoss weltweit auf Platz eins und verkaufte sich etwa zehn Millionen mal. Bei Wetten, dass ...? präsentiert die Band ein Remake des Titels "Behind Blue Eyes", mit dem schon The Who große Erfolge feiern konnten. Mit Mirjam Weichselbraun sprach der Sänger Fred Durst über Erfolg, sein aktuelles Album und was ein Kuss alles verrät. Mirjam Weichselbraun: Bei mir ist jetzt Fred Durst von Limp Bizkit. Er sagt, dass er heute sehr schlecht aussieht. Das kann ich nicht bestätigen. Vielleicht ein bisschen müde... Habt Ihr gestern groß gefeiert? Fred Durst: Nein eigentlich nicht. Sehe ich so müde aus? Mirjam Weichselbraun: Ja, schon ein bisschen. Fred Durst: Weißt Du, wie ich aussehe, wenn ich nicht müde bin? Mirjam Weichselbraun: Nein. Fred Durst: Du hast sehr schöne Augen. Mirjam Weichselbraun: Danke, Du aber auch, Fred. Euer neues Album ist ja sehr erfolgreich, es wurde mit Platin ausgezeichnet. Wie stehst Du zu diesem Erfolg? Ist er etwas Besonderes für Dich? Fred Durst: Ich denke, dass eigentlich jeder Tag bedeutsam ist. Ich nehme es nicht als selbstverständlich hin, dass ich den nächsten Tag erlebe. Ich bin glücklich, jetzt am Leben zu sein und dass mir all das widerfährt. Ich blicke nicht auf die Vergangenheit zurück, sondern schaue auf das Hier und Jetzt. Die Bewältigung einer neuen Aufgabe, ein neuer Erfolg oder irgendeine Sache, die mich emotional sehr stark bewegt, bedeuten mir wirklich sehr viel. Jeder Tag in meinem Leben ist ein neuer Tag des Wachsens und Lernens, und jedes Mal, wenn ich etwas erlebe, ist es eine neue Erfahrung für mich.
    [Show full text]
  • October 8, 2003 Civil Engineering Technology Hosts Open House Ing
    Des Moines Area Community College, Boone Campus Volume 3, Issue 3 October 8, 2003 Civil Engineering Technology hosts open house ing. Laura Griffin Students in the program take courses Banner Staff in surveying, global positioning systems, construction materials and design, high- The Civil Engineering Technology way design, computer aided drafting, Materials Lab held an open house on mathematics and human relations. Sept. 30. Students have a paid internship in their Faculty and staff were greeted by Renee second year of the program to give them White, CET instructor, who showed them experience. A CET graduate gets paid around the lab. between $14 to $18 per hour. Visitors to the CET lab are met at the Civil engineers survey, inspect and front door by Kelli Bennett at the recep- design highways and bridges. They also tion desk. Also in the building is a com- test soil and structural materials. puter lab, and two regular classrooms, one The Civil Engineering Technology pro- with dual monitors, a conference room, gram is part of the Accelerated Career a materials laboratory area, two spacious Education program. offices and rest rooms. Steve Rittger teaches the math and Vending machines inside the entrance automated design courses. Rittger teaches provide snacks for students and faculty in the classroom with the dual monitors. who are there during the day. “The programs we use require a lot of Tracey Kingsley, a freshman in the pro- screen space for multiple tools and views,” gram, said, “I am excited because when Rittger said, about why dual monitors are I graduate from the Civil Engineering used.
    [Show full text]
  • Overcoming Variability in Consumer Response to Advertising Music
    Results May Vary: Overcoming Variability in Consumer Response to Advertising Music Lincoln G. Craton and Geoffrey P. Lantos Stonehill College Richard C. Leventhal Ashford University ABSTRACT Although listening to music seems effortless, it actually involves many separate psychological mechanisms. This article describes and extends the multimechanism framework proposed by Juslin and colleagues, highlighting how the operation of psychological mechanisms leads to two general types of variability in consumer response to advertising music. First, the risk of between-consumer variability (individual differences) in musical response is moderate or high for most mechanisms, and it often depends on each individual’s particular history of exposure to music (listening biography). Second, within-consumer variability occurs when different mechanisms have contrasting effects, so that an individual consumer’s musical response is often mixed (e.g., guilty pleasures, bittersweet feelings, pleasurable sadness). Both types of variability can negatively impact advertising objectives (message reception, recall, acceptance, brand attitudes, etc.). The article offers preliminary suggestions for how marketers can use a multimechanism approach to successfully incorporate music in commercials and reduce the risk of unanticipated consumer responses. It ends with proposals for further research. © 2016 Wiley Periodicals, Inc. Business is booming in the field of music percep- Scope and Goals of the Article tion and cognition (hereafter, music cognition). Re- search activity is surging (Levitin, 2010), member- According to Levitin and Tirovolas (2010, p. 599), ship in the Society for Music Perception and Cognition (SMPC) is rising, and “after a long drought” (Ashley, Music cognition . is the scientific study of those 2010, p. 205) new introductory textbooks are emerg- mental and neural operations underlying music lis- ing (e.g., Honing, 2009; Tan, Pfordrescher, & Harre´ tening, music making, dancing (moving to music), 2010; Thompson, 2015).
    [Show full text]
  • 39Th Annual J.P. Morgan Healthcare Conference January 11, 2021 Nasdaq/AIM: HCM Safe Harbor Statement & Disclaimer
    39th Annual J.P. Morgan Healthcare Conference January 11, 2021 Nasdaq/AIM: HCM Safe harbor statement & disclaimer The performance and results of operations of the Chi-Med Group contained within this presentation are historical in nature, and past performance is no guarantee of future results. This presentation contains forward-looking statements within the meaning of the “safe harbor” provisions of the U.S. Private Securities Litigation Reform Act of 1995. These forward-looking statements can be identified by words like “will,” “expects,” “anticipates,” “future,” “intends,” “plans,” “believes,” “estimates,” “pipeline,” “could,” “potential,” “first-in-class,” “best-in-class,” “designed to,” “objective,” “guidance,” “pursue,” or similar terms, or by express or implied discussions regarding potential drug candidates, potential indications for drug candidates or by discussions of strategy, plans, expectations or intentions. You should not place undue reliance on these statements. Such forward-looking statements are based on the current beliefs and expectations of management regarding future events, and are subject to significant known and unknown risks and uncertainties. Should one or more of these risks or uncertainties materialize, or should underlying assumptions prove incorrect, actual results may vary materially from those set forth in the forward-looking statements. There can be no guarantee that any of our drug candidates will be approved for sale in any market, or that any approvals which are obtained will be obtained at any particular
    [Show full text]
  • "Your Results May Vary": Protecting Students and Taxpayers Through Tighter Regulation of Proprietary School Representations Aaron N
    Saint Louis University School of Law Scholarship Commons All Faculty Scholarship 2010 "Your Results May Vary": Protecting Students and Taxpayers Through Tighter Regulation of Proprietary School Representations Aaron N. Taylor Saint Louis University School of Law Follow this and additional works at: https://scholarship.law.slu.edu/faculty Part of the Education Law Commons Recommended Citation Taylor, Aaron N., 'Your Results May Vary': Protecting Students and Taxpayers Through Tighter Regulation of Proprietary School Representations (2010). 62 ADMIN. L. REV. 729 (2010). This Article is brought to you for free and open access by Scholarship Commons. It has been accepted for inclusion in All Faculty Scholarship by an authorized administrator of Scholarship Commons. For more information, please contact [email protected], [email protected]. ADMINISTRATIVE LAW REVIEW "Your Results May Vary": Protecting Students and Taxpayers Through Tighter Regulation of Proprietary School Representations Aaron N. T qylor Reprinted from Administrative Law Review Volume 62, Number 3, Summer 2010 Cite as 62 ADMIN. L. REV. 729 (2010). The Administrative Law Revieiv is a joint publication of the ABA Section of Administrative Law & Regulatory Practice and the Washington College of Law, American University. Reproduced by permission. All rights reserved. This information or any portion thereof may not be copied or disseminated in any form or by any means or downloaded or stored in an electronic database or retrieval system without the express written consent of the American Bar Association. "YOUR RESULTS MAY VARY": PROTECTING STUDENTS AND TAXPAYERS THROUGH TIGHTER REGULATION OF PROPRIETARY SCHOOL REPRESENTATIONS AARON N. TAYLOR* TABLE OF CONTET\'TS Introduction ............................................................................................
    [Show full text]
  • Emeli Sandé Signs to Chrysalis Records
    Emeli Sandé signs to Chrysalis Records August 20, 2021 LONDON, Aug. 20, 2021 (GLOBE NEWSWIRE) -- Emeli Sandé has signed a global record deal with the iconic Chrysalis Records as the label continues to grow its roster of artists since relaunching as a frontline label in February 2020. Emeli’s debut album Our Version of Events spent ten weeks at number 1 on the UK album charts and became the best-selling UK album of 2012. Heaven which married her soaring vocal with gospel and breakbeat reached Number 2 in the UK singles chart. In 2016, she released Long Live the Angels, which reached number 2 on the UK album chart and her last album Real Life went Top 10 in 2019. Across her career she has collaborated with a huge range of artists including David Guetta, Rudimental, Ghetts, Giggs, Bugzy Malone, Chip, Labrinth and Naughty Boy. A run of Brit Awards began in 2012 when she received the Critics’ Choice Award. That same year she performed both at the Opening and Closing ceremonies at the London Olympics including an incredible version of the hymn Abide With Me. In 2013 she won two more Brits for Best British Female Solo Artist and British Album of the Year. She was again honoured in 2017 winning the Brit Award for Best British Female Solo Artist. Emeli said, “I am thrilled by my new partnership with the legendary Chrysalis Records! I have been inspired by many of the artists on their impressive catalogue. I’m very proud to now be a part of this legacy.
    [Show full text]
  • Corporate Presentation January 2021 Nasdaq/AIM: HCM Safe Harbor Statement & Disclaimer
    Corporate Presentation January 2021 Nasdaq/AIM: HCM Safe harbor statement & disclaimer The performance and results of operations of the Chi-Med Group contained within this presentation are historical in nature, and past performance is no guarantee of future results. This presentation contains forward-looking statements within the meaning of the “safe harbor” provisions of the U.S. Private Securities Litigation Reform Act of 1995. These forward-looking statements can be identified by words like “will,” “expects,” “anticipates,” “future,” “intends,” “plans,” “believes,” “estimates,” “pipeline,” “could,” “potential,” “first-in-class,” “best-in-class,” “designed to,” “objective,” “guidance,” “pursue,” or similar terms, or by express or implied discussions regarding potential drug candidates, potential indications for drug candidates or by discussions of strategy, plans, expectations or intentions. You should not place undue reliance on these statements. Such forward-looking statements are based on the current beliefs and expectations of management regarding future events, and are subject to significant known and unknown risks and uncertainties. Should one or more of these risks or uncertainties materialize, or should underlying assumptions prove incorrect, actual results may vary materially from those set forth in the forward-looking statements. There can be no guarantee that any of our drug candidates will be approved for sale in any market, or that any approvals which are obtained will be obtained at any particular time, or that any such
    [Show full text]
  • Company Overview
    Company Overview November 2017 0 Cautionary Statements Forward-Looking Statements BWX Technologies, Inc. (“BWXT”) cautions that statements in this presentation that are forward-looking and provide other than historical information involve risks and uncertainties that may impact actual results and any future performance suggested in the forward-looking statements. The forward-looking statements in this presentation include, but are not limited to, statements relating to our strategy and key highlights; bookings and backlog, to the extent they may be viewed as an indicator of future revenues; the expected U.S. Navy long-term procurement schedules and forecasts; the expected Canadian nuclear power forecast for services, refurbishment timelines and opportunities; R&D target market information, efforts and opportunities; the expected impact of adoption of updated accounting guidance; anticipated benefits of the acquisition of GE Hitachi Nuclear Energy Canada, Inc. (“GEH-C”) joint venture, which was re-named BWXT Nuclear Energy Canada Inc. (“BWXT NEC”); our outlook, priorities, growth opportunities in our businesses and guidance for 2017 and beyond. These forward-looking statements are based on current management expectations and involve a number of risks and uncertainties, including, among other things, the availability of Federal appropriations to government programs in which we participate; our ability to win new project awards; capital spending of power generating utilities; adverse changes in the industries in which we operate; termination, delays and other difficulties executing on contracts in backlog and adverse changes in the demand for or competitiveness of nuclear power. If one or more of these or other risks materialize, actual results may vary materially from those expressed.
    [Show full text]
  • Dead Kennedys Punk Legends Rock the House of Blues Page 3
    SEX: When one can be the loneliest number Full MOVIE: 'House of D' touches hearts and funny bones , MUSIC: Louis XIV love women, substance abuse EFFECTTitan Entertainment Guide Dead Kennedys Punk legends rock the House of Blues Page 3 Style scouts debate over fashion Boho VS. Hobo chic Page 7 A p r i l 2 1, 2 0 0 5 scheduled for late 2005 or early has cancelled the remaining dates 2006, but three songs have been on its current tour. According to CONTENTS completed of which one features the band, guitarist Paul Hinojos Compton rapper the Game… suffered a ruptured disc in his back Northern California band Dredg recently. No plans have been made have decided to release their next by the band to reschedule the can- 02 Entertainment Briefs—The Buzz album on June 21. Catch Without celled dates but plan to make up BY NIYAZ PIRANI 03 Music—Seasoned punks still Arms will feature the single “Bug for them on the next tour…After Daily Titan Assistant News Editor Eyes” which has been making months of speculation by tabloids standing strong quite a buzz on the Web…White as well as fans, Britney Spears is 04 Movie Review—'Horror remake Stripes members Jack and Meg offi cially pregnant. To watch the Limp Bizkit has slated a tenta- White are putting the fi nishing moments that led to conception, spooks with grotesque imagery tive May 3 release date for their touches on their June 7 release tune in to Spears and husband new album The Unquestionable Get Behind Me Satan.
    [Show full text]