foods

Article Exogenous Promotes γ-Aminobutyric Acid Accumulation and Alleviates the Negative Effect of NaCl Stress in Germinating Soybean (Glycine max L.)

Weiming Fang, Fei Qi, Yongqi Yin * and Zhengfei Yang

College of Food Science and Engineering, Yangzhou University, Yangzhou, Jiangsu 210095, China; [email protected] (W.F.); [email protected] (F.Q.); [email protected] (Z.Y.) * Correspondence: [email protected]; Tel.: +86-514-89786551

 Received: 5 February 2020; Accepted: 27 February 2020; Published: 2 March 2020 

Abstract: We investigated the effects of exogenous spermidine (Spd) on the physiological status, γ-aminobutyric acid (GABA) synthase activity, and gene expressions in germinating soybeans under NaCl stress. The results show that Spd significantly increases sprout growth and biomass, decreases malonaldehyde and H2O2 contents, and markedly promotes the activities of superoxide dismutase, catalase, peroxidase, and glutathione peroxidase of germinating soybeans. The harmful effect of NaCl stress was alleviated by exogenous Spd. GABA accumulation in germinating soybeans was caused by the activation of diamine oxidase, polyamine oxidase, aminoaldehyde dehydrogenase, and activities and by up-regulating their gene expression under Spd-NaCl treatment. The GABA content decreased by 57% and 46% in germinating soybeans with the application of aminoguanidine under Spd and Spd-NaCl treatments, respectively. In conclusion, spermidine induces the accumulation of GABA and increases sprouts biomass, thereby enhancing the functional quality of germinating soybeans.

Keywords: germinating soybeans; γ-aminobutyric acid; spermidine; NaCl stress

1. Introduction Gamma-aminobutyric acid (GABA), a four-carbon non-protein amino acid, is a major inhibitory in the mammalian brain [1]. Clinical research showed that it can lower blood pressure, prevent cancers, and reduce cardiovascular diseases [2–4]. However, the GABA content in natural food is far from meeting the physiological needs of the human body. Hence, many functional foods and dietary supplements with GABA as the main raw material are supplied on the market [5,6]. Currently, the most common and effective methods to accumulate GABA in edible plants include germinating under stressful conditions such as salt stress. However, the concomitant growth and biomass of germinating plants are markedly suppressed [7–9]. Polyamines (PAs) are commonly known to have protective effects on abiotic stress. The application of exogenous PAs can improve the inhibition of growth, increase the level of endogenous PAs, remove reactive oxygen species (ROS), protect the activity of the system, and maintain the integrity of the cell function of plants under abiotic stress [10,11]. More importantly, in higher plants, PAs is the substrate of GABA. GABA can be formed through the polyamine degradation pathway where polyamine is firstly converted to γ-aminobutyraldehyde by diamine oxidase (DAO, EC 1.4.3.6) or polyamine oxidase (PAO, EC 1.5.3.11) and then γ-aminobutyraldehyde is converted to GABA by aminoaldehyde dehydrogenase (AMADH, EC1.2.1.19). Meanwhile, it can be synthesized by glutamate decarboxylation via glutamate decarboxylase (GAD, EC 4.1.1.15), which is called GABA shunt [12]. Studies demonstrated that exogenous application of PAs can increase phytochemicals in various plants

Foods 2020, 9, 267; doi:10.3390/foods9030267 www.mdpi.com/journal/foods Foods 2020, 9, 267 2 of 12 such as mung bean and cucumber seedlings [11,13–15]. These studies indicate that PAs might be an ideal biotechnological target for improvement of GABA-enriched plant grown under stressful conditions. Soybean (Glycine max L.) is one of the most important foods due to its nutritional and pharmacological importance. GABA-enriched germinating soybeans can be harvested under NaCl stress [8,16,17]. However, soybean is a salt-sensitive crop, as NaCl stress seriously inhibits its growth and reduces its biological yield [16]. According to our previous studies, spermidine (Spd), one of the important PAs, was selected as the most appropriate agent and its concentration was optimized. Exogenous Spd (0.10 mM) countered the harmful effects of NaCl (50 mM) stress and increased the biomass and GABA content in germinating soybeans. However, the precise molecular mechanism underlying the role of Spd in resistance to NaCl stress is not yet completely understood. In the present study, the effect of Spd treatment on the physiology, activities, and gene expressions of GABA key synthases (including DAO, PAO, AMADH, and GAD) in germinating soybean under NaCl stress were investigated. The objective was to reveal the molecular mechanism of Spd on GABA accumulation in soybeans under NaCl stress during germination.

2. Materials and Methods

2.1. Materials and Reagents Soybean seeds (cv. Yunhe) were purchased from Jilin Academy of Agricultural Sciences (Jilin, China) in 2017 and stored at 18 C prior to use. Spermidine (purity >99%), GABA standard, − ◦ p-dimethylaminobenzene sulfonyl chloride, and aminoguanidine (AG, specific inhibitor of DAO) were purchased from Sigma-Aldrich (Shanghai, China). A plant RNA extraction kit (R6827) was purchased from Omega (GA, USA); and the RNA reverse transcription kit (RR047A), TB Green Premix Dimer Eraser (RR091A), and ROX Reference Dye (RR091A) were purchased from Takara (Dalian, China). All other reagents were analytical grade.

2.2. Material Treatment and Experimental Design

2.2.1. Effects of Exogenous Spd on Physiology and Biochemistry of Germinating Soybeans under NaCl Stress The dry seeds were washed with deionized water and soaked in 1% (v/v) NaClO solution for 15 min. After disinfection, they were steeped with distilled water at 30 1 C for 4 h. The soaked seeds ± ◦ were then placed in a bean sprouting machine to germinate in a dark incubator at 30 1 C with water ± ◦ containing the following additives: (1) Control: deionized water; (2) NaCl stress treatment: 50 mM NaCl; (3) Spd treatment: 0.10 mM Spd; and (4) NaCl + Spd treatment: 50 mM NaCl + 0.10 mM Spd. The culture solution was replaced every 1 day. Germinating soybeans were randomly sampled on the 4th and 6th day and frozen in liquid nitrogen for further biochemical measurements.

2.2.2. Effect of Exogenous Spd on GABA of Germinating Soybeans under NaCl Stress Dry seeds were sterilized, steeped, and germinated as stated above. The treatments were as follows: Control: deionized water; (2) NaCl stress treatment: 50 mM NaCl; (3) Spd treatment: 0.10 mM Spd; (4) NaCl + Spd treatment: 50 mM NaCl + 0.10 mM Spd; (5) NaCl + AG treatment: 50 mM NaCl + 1.50 mM AG; (6) NaCl + Spd + AG treatment: 50 mM NaCl + 0.10 mM Spd + 1.50 mM AG; and (7) Spd + AG treatment: 0.10 mM Spd + 1.50 mM AG. AG is a specific inhibitor of DAO, blocking the polyamine degradation pathway. Our previous experiment showed that 5th day germinating soybeans under AG treatment were decayed and softened, which could not be sampled for further study. Hence, germinating soybeans were randomly sampled on the 2nd and 4th day for further biochemical measurements. Foods 2020, 9, 267 3 of 12

2.3. Measurement of Main Physiological and Biochemical Indexes Sprout length and respiratory rate were measured as described by Yin et al. [18]. Malondialdehyde (MDA) content was measured following the method reported by Madhava and Sresty [19]. Contents of H2O2, soluble protein, soluble sugar, and free amino acids were measured according to the method reported by Yin et al. [16].

2.4. Measurement of Antioxidant Activities The superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), and glutathione peroxidase (GPX) activities were determined using a SOD Assay Kit (A001-1 Nanjing Jiancheng Bioengineering Institute, Nanjing, China), CAT Assay Kit (A007-1 Nanjing Jiancheng Bioengineering Institute, Nanjing, China), POD Assay Kit (A084-3 Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and GPX Assay Kit (A004-3 Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively, according to the manufacturer’s instructions.

2.5. Measurements of GABA Contents GABA content was analyzed as described by Yang et al. [20].

2.6. GAD, DAO, PAO, and AMADH Activity Assay GAD, DAO, and AMADH activity were determined according to Yin et al. [18]. PAO activity was determined according to Yang et al. [20].

2.7. GABA Synthase Gene Expression (Quantitative Real-Time PCR). Total RNA was isolated from mustard sprouts using an E.Z.N.A™ Plant RNA Kit (R6827-01, Omega, GA, USA). The RNA samples were reverse transcribed into cDNA. Triplicate quantitative assays were performed on each cDNA using SYBRR Premix Ex-Taq™ (RR420A, Takara, Dalian, China) and an ABI 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. The sequence-specific primers that were used in this study are shown in Table1.

Table 1. Sequence-specific primer used for quantitative real-time (qRT)-PCR assay in germinating soybean.

Primer Sequences (50–30) GAD1-F 1 AGCAGGTGAAGAAAATGACGA GAD1-R 2 TCTTCTTCCTGTCCATCACAAA GAD2-F CCACTCACCCAGATGAAAAAG GAD2-R AGCTGCATCCTTTGGTATTGA GAD3-F TTCCTGTGTGAGTACGTGTGC GAD3-R CATCATTGCGCTCATAATCCT GAD4-F GGTGAGAAGATTAAGAAAGCTGC GAD4-R GGTAAGCCTAGCATGCTCCA GAD5-F CTCAGTGCAGAAGAAAATGGC GAD5-R ACACCCCCTTGAAGCTAACAC DAO1-F AGATGATACTTTAGCCGTTTGGAC DAO1-R CAATAAGCAGATCGCATTTCAC DAO2-F TCCTTGCAAGCAGTTGTGTC DAO2-R TGGTTTGATGGATTCCCATT PAO2-F GGCAGCTTTCTTGAAACACA PAO2-R TAACCCAAGTAGCCAAACCC PAO2-F CTTCCTCCAAGGAAAGCAAG PAO2-R GTGTCCACCTCGAGTTGTTG AMADH1-F TGAAGCTGGTGCTCCTTTGT AMADH1-R AAGATGGTCCATTCAGCAGT Foods 2020, 9, 267 4 of 12

Foods 2020, 9, x FOR PEER REVIEW 4 of 12 Table 1. Cont. AMADH2-F TGAAGCGGGTGCTCCTTTAG AMADH2Primer-R AATATGGTCCATTCAGCAGC Sequences (50–30) UBiAMADH2-F-F TGAAGCGGGTGCTCCTTTAGGTGTAATGTTGGATGTGTTCCC UBiAMADH2-R-R ACACAATTGAGTTCAACACAAACCG AATATGGTCCATTCAGCAGC 1 F: ForwardUBi-F primer GTGTAATGTTGGATGTGTTCCCsequence, 2 R: Reverse primer sequence. UBi-R ACACAATTGAGTTCAACACAAACCG 2.8. Statistical Analyses 1 F: Forward primer sequence, 2 R: Reverse primer sequence.

2.8. StatisticalAll experiments Analyses in this study were repeated at least three times in independent experiments. Average values and standard deviations were computed according to the experimental data. One- All experiments in this study were repeated at least three times in independent experiments. way analysis of variance (ANOVA) with Tukey’s test were conducted on the data and a p-value of Average values and standard deviations were computed according to the experimental data. One-way 0.05 was considered significant. The gene relative expression was analyzed using the 2−ΔΔCt method analysis of variance (ANOVA) with Tukey’s test were conducted on the data and a p-value of 0.05 was [21]. ∆∆Ct considered significant. The gene relative expression was analyzed using the 2− method [21].

3.3. Results Results

3.1.3.1. Growth Growth C Characteristicsharacteristics of GerminatingGerminating SoybeansSoybeans AsAs shown shown in Figure1 1A,A, compared compared with with the the control, control, NaCl NaCl treatment treatment significantly significantly inhibited inhibited the the growthgrowth and and development of germinatinggerminating soybeans,soybeans, whereaswhereas the the addition addition of of Spd Spd alone alone significantly significantly promotedpromoted growth and the combination ofof SpdSpd withwith NaCl NaCl treatment treatment e ffeffectivelyectively alleviated alleviated the the growth growth inhibitioninhibition causedcaused byby stress stress during during germination germination (Figure (Figure1A). Similarly,1A). Similarly, a stimulatory a stimulatory e ffect of effect Spd under of Spd underNaCl stress NaCl was stress also w observedas also observed on the sprout on the length, sprout fresh length, weight, fresh and respirationweight, and rate respiration in germinating rate in germinatingsoybeans compared soybeans with compared the NaCl with treatment the NaCl (Figure treatment1B–E). (Figure 1B–E).

FigureFigure 1. 1. ChangingChanging patterns patterns in in a a(A (A) )photograph photograph in in terms terms of of (B ()B sprout) sprout length, length, (C ()C fresh) fresh weight, weight, (D) dry(D) drymatter matter content content,, and and(E) (respiratoryE) respiratory rate rate in inger germinatingminating soybeans. soybeans. Lowercase Lowercase letters letters reflect reflect the the significance of differences in index among treatments of 4-day germinating soybeans and capital significance of differences in index among treatments of 4-day germinating soybeans and capital letters reflect the significance of differences in index among treatments of 6-day germinating soybeans letters reflect the significance of differences in index among treatments of 6-day germinating soybeans (p < 0.05). CK, Control; N, NaCl; S, Spd; NS, NaCl + Spd. (p < 0.05). CK, Control; N, NaCl; S, Spd; NS, NaCl + Spd.

3.2. Soluble Protein, Soluble Sugar, MDA, and H2O2 Contents in Germinating Soybeans 3.2. Soluble Protein, Soluble Sugar, MDA, and H2O2 Contents in Germinating Soybeans Compared with the control, the soluble protein content in germinating soybeans increased significantlyCompared under with other the control,treatments the during soluble germination protein content (p < 0.05; in germinating Figure2A). The soybeans di fference increased in significantly under other treatments during germination (p < 0.05; Figure 2A). The difference in soluble sugar content under Spd-NaCl treatment was not statistically significant compared with NaCl treatment (Figure 2B). During germination, compared with NaCl treatment, MDA and H2O2 contents both decreased significantly in the control and following treatment with Spd (p < 0.05) (Figure 2C,D). We found no significant difference in MDA content between the control and Spd-NaCl treatment (p

Foods 2020, 9, 267 5 of 12

soluble sugar content under Spd-NaCl treatment was not statistically significant compared with NaCl Foods 2020, 9treatment, x FOR PEER (Figure REVIEW2B). During germination, compared with NaCl treatment, MDA and H 2O2 contents 5 of 12 both decreased significantly in the control and following treatment with Spd (p < 0.05) (Figure2C,D). > 0.05). WithWe the found combin no significanted Spd di withfference NaCl in MDA treatment, content betweenH2O2 content the control was and significantly Spd-NaCl treatment higher than that of the control(p > 0.05and). Spd With thetreatment. combined Spd with NaCl treatment, H2O2 content was significantly higher than that of the control and Spd treatment.

180 240 4d (A) (B) 6d a ab A AB b 180 B a A 120 c ab ab B b C BC 120 C

60 60 Soluble sugar content (mg/g DW) (mg/g content sugar Soluble

Soluble protein content(gprot/L DW) protein content(gprot/L Soluble 0 0

0.18 2.4 (C) a (D) a 1.8 0.12 b A b b μmol/g DW) μmol/g c

（ 1.2 B B 0.06 C A 0.6 c c B content (mM/g protein DW) protein (mM/g content 2 C D O MDA content MDA 2 0.00 H 0.0 CK N S NS CK N S NS Figure 2. Changing pattern of (A) soluble protein content, (B) soluble sugar content, (C) malonaldehyde Figure 2. Changing pattern of (A) soluble protein content, (B) soluble sugar content, (C) (MDA) content, and (D)H2O2 content in germinating soybeans. Lowercase letters reflect the significance malonaldehydeof differences (M inDA index) content among treatments, and (D) ofH 4-day2O2 content germinating in germinating soybeans and capital soybeans. letters reflectLowercase the letters reflect thesignificance significance of di offferences differences in index in among index treatments among oftreatments 6-day germinating of 4-day soybeans germinating (p < 0.05). soybeans CK, and Control; N, NaCl; S, Spd; NS, NaCl + Spd. capital letters reflect the significance of differences in index among treatments of 6-day germinating soybeans3.3. Antioxidant(p < 0.05). CK Enzyme, Control; Activity N, NaCl; S, Spd; NS, NaCl + Spd. Compared with the control and the addition of spermidine alone, both SOD and CAT activities 3.3. Antioxidantchanged Enzyme significantly Activity under NaCl treatment (p < 0.05) (Figure3A,C). The POD and GPX activities in germinating soybeans treated with NaCl were not significantly (p > 0.05) different compared Comparedwith the with soybeans the control under Spd and treatment, the addit whereasion of they spermidine were significantly alone, ( pboth< 0.05) SOD higher and than CAT in activities changed significantlythose under the under control NaCl (Figure treatment3B,D). Under (p Spd-NaCl < 0.05) (Figure treatment, 3A, the activitiesC). The ofPOD major and antioxidant GPX activities in germinatingenzymes soybeans (SOD, POD,treated CAT, with and GPX)NaCl increased were not significantly significantly (p < 0.05) (p in> germinating0.05) different soybeans compared during with the germination compared with NaCl treatment (Figure3). soybeans under Spd treatment, whereas they were significantly (p < 0.05) higher than in those under the control3.4. (Figure GABA Contents 3B, D). in Germinating Under Spd Soybeans-NaCl treatment, the activities of major antioxidant (SOD, POD, CATAfter germinating, and GPX for) four increased days and significantly six days under NaCl (p < treatment, 0.05) in the germinating GABA content increased soybeans during germinationsignificantly compared (p < with0.05), NaCl being 1.52-treatment and 1.32-fold (Figure higher 3). than the control in germinating soybeans, respectively (Figure4). Compared with the control and NaCl treatment, the GABA content in four-day germinating soybeans under Spd-NaCl treatment increased by 116% and 73% compared with the control and increased by 42% and 74% compared with the NaCl treatment, respectively (Figure4).

Foods 2020, 9, x FOR PEER REVIEW 6 of 12

240 10.0 4d (A) (B) a 6d b A 180 7.5 a B ab A AB c bc B 120 c 5.0 C C d Foods 2020, 9, 267 D 6 of 12 60 2.5 SOD activity (U/g FW) (U/g activity SOD POD activity (U/mg prot DW) prot (U/mg activity POD Moreover, compared0 with the Spd treatment, when AG0.0 was added under the Spd treatment, the GABA 240 140 content in two-day4d and four-day germinating(C) soybeans decreased by 35% and 58%,(D) respectively. The addition of AG6d resulted in a decrease inA GABA content by 21% and 46% in two-dayA and four-day 180 105 germinating soybeans under Spd-NaClB treatment, respectively (FigureB 4). TheB contenta of GABA C C a a synthesized by the polyamineD degradation pathway under Spd and NaCl-Spdb treatments accounted 120 b 70 b c c forFoods 57% 2020 and, 9, x 46%FOR PEER of the REVIEW total GABA content in four-day germinating soybeans, respectively. 6 of 12 60 35 240 10.0 CAT activity (U/mg prot DW) prot (U/mg activity CAT 4d (A) DW) prot (U/mg activity GPX (B) a 0 6d b A 0 180 CK Na S NS 7.5 CK Na S aNS B ab A AB Figure 3. Changes in (A) superoxide dismutase (SOD), (B) peroxidasec (PbcODB ), (C) catalase (CAT), and 120 c 5.0 C (D) glutathione peroxidase (GPX) Cactivity in germinating soybeans. Lowercase letters reflect the d significance of differencesD in index among treatments of 4-day germinating soybeans and capital 60 2.5 lettersFW) (U/g activity reflectSOD the significance of differences in index among treatments of 6-day germinating soybeans

(p < 0.05). CK, Control; N, NaCl; S, Spd; NS, NaCl + DW) prot Spd(U/mg activity POD . 0 0.0 240 140 3.4. GABA Content4d in Germinating Soybeans (C) (D) 6d A A 180 105 After germinating for four days andB six days under NaCl treatment,B the GABAB acontent increased C C significantly (p < 0.05), being 1.52-a and 1.32a -fold higher than the control in germinating soybeans, D b 120 b 70 b respectively (Figure 4). Comparedc with the control and NaCl ctreatment, the GABA content in four- day germinating soybeans under Spd-NaCl treatment increased by 116% and 73% compared with 60 35 the control and increased by 42% and 74% compared with the NaCl treatment, respectively (Figure CAT activity (U/mg prot DW) prot (U/mg activity CAT 4). Moreover, compared with the Spd treatment, whenDW) prot (U/mg activity GPX AG was added under the Spd treatment, the 0 0 GABA content in twoCK-dayNa and fourS -dayNS germinating soybeansCK NadecreasedS byNS 35% and 58%, respectively. The addition of AG resulted in a decrease in GABA content by 21% and 46% in two-day FigureFigure 3. ChangesChanges in in (A (A) superoxide) superoxide dismutase dismutase (SOD (SOD),), (B) ( Bperoxidase) peroxidase (POD (POD),), (C) (catalaseC) catalase (CAT (CAT),), and and four-day germinating soybeans under Spd-NaCl treatment, respectively (Figure 4). The content and(D) (glutathioneD) glutathione peroxidase peroxidase (GPX (GPX)) activity activity in in germinating germinating soybeans. soybeans. Lowercase Lowercase letters letters reflectreflect the the of GABA synthesized by the polyamine degradation pathway under Spd and NaCl-Spd treatments significancesignificance of of di differencesfferences in in index index among among treatments treatments ofof 4-day4-day germinatinggerminating soybeanssoybeans andand capital capital accounted for 57% and 46% of the total GABA content in four-day germinating soybeans, lettersletters reflectreflect thethe significancesignificance ofof didifferencesfferences inin indexindex amongamong treatmentstreatments ofof 6-day6-day germinatinggerminating soybeanssoybeans respectively. ((pp << 0.05). CK CK,, Control; N N,, NaCl; S,S, Spd; NS,NS, NaCl + SpdSpd..

1.5 3.4. GABA Content in Germinating Soybeans 2d A 4d After germinating for four1.2 days and six days under NaCl treatment, the GABA content increased 6d B significantly (p < 0.05), being 1.52- and 1.32-fold higher than the control in germinating soybeans, a a respectively (Figure 4). Compared0.9 with thebBC controlb andb NaCl treatment, the GABA content in four- c day germinating soybeans under Spdc -NaCl treatment increasedCD by 116% and 73% compared with d the control and increased by 42% andD 74% comparedc with the NaCle treatment, respectively (Figure 0.6 D 4). Moreover, compared with the Spd dtreatment, when AG was added under the Spd treatment, the GABA content in two-day0.3 and four-day germinating soybeans decreased by 35% and 58%, E respectively. The additioncontent GABA DW) (mg/g of AG resulted in a decrease in GABA content by 21% and 46% in two-day and four-day germinating soybeans0.0 under Spd-NaCl treatment,ND respectivelyND ND (Figure 4). The content of GABA synthesized by the polyamine degradation pathway under Spd and NaCl-Spd treatments CK Na S NS NA NAS SA accounted for 57% and 46% of the total GABA content in four-day germinating soybeans, γ respectively.Figure 4. 4. E ffEffectect of of Spd Spd on on-aminobutyric γ-aminobutyric acid (GABA) acid (GABA) content in content germinating in germinating soybeans. Lowercase soybeans. lettersLowercase reflect letters the significance reflect the of di significafferencesnce in ofindex differences among treatments in index of among 2-day germinating treatments soybeans,of 2-day capital letters reflect the significance1.5 of differences of 4-day germinating soybeans, and lowercase letters in italics reflect the significance of differences2d of 6-dayA germinating soybeans (p < 0.05). CK, Control; N, NaCl; S, Spd; NS, NaCl + Spd; NA,4d NaCl + AG; NAS, NaCl + AG + Spd; SA, Spd + AG; AG, 1.2 Aminoguanidine; ND, Non detection. 6d B a a 0.9 bBC b b c cCD d 0.6 D c e d D

0.3 E GABA content GABA DW) (mg/g

0.0 ND ND ND CK Na S NS NA NAS SA Figure 4. Effect of Spd on γ-aminobutyric acid (GABA) content in germinating soybeans. Lowercase letters reflect the significance of differences in index among treatments of 2-day

Foods 2020, 9, x FOR PEER REVIEW 7 of 12

germinating soybeans, capital letters reflect the significance of differences of 4-day germinating soybeans, and lowercase letters in italics reflect the significance of differences of 6-day germinating soybeans (p < 0.05). CK, Control; N, NaCl; S, Spd; NS, NaCl + Spd; NA, NaCl + AG; NAS, NaCl + AG Foods 2020+ Spd;, 9, S 267A, Spd + AG; AG, Aminoguanidine; ND, Non detection. 7 of 12

3.5. Changes in GABA Synthase Activity 3.5. Changes in GABA Synthase Activity DAO activity decreased with germination time and could not be detected after AG addition. AfterDAO germinating activity for decreased two days with under germination Spd-NaCl time treatment, and could DAO not activity be detected was 2.65 after- and AG addition.1.64-fold Afterhigher germinating than the control for two and days the NaCl under treatment, Spd-NaCl respectively treatment, DAO(Figure activity 5A). The was presence 2.65- and of 1.64-foldAG also decreasedhigher than PAO the activity control andin ger theminating NaCl treatment, soybeans. respectively Spd-NaCl treatment (Figure5A). dramatically The presence increased of AG PAO also activitydecreased during PAO germination activity in germinating compared soybeans.with the other Spd-NaCl treatments treatment (Figure dramatically 5B). AMADH increased activity PAO in germinatingactivity during soybeans germination under comparedboth NaCl withand theSpd other-NaCl treatmentstreatments (Figureincreased5B). significantly AMADH activity (p < 0.05) in cgerminatingompared with soybeans the control under and both Spd NaCltreatment. and Spd-NaClThe addition treatments of AG increased increased AMADH significantly activity (p during< 0.05) germinationcompared with (Figure the control 5C). Compared and Spd treatment. with other The treatments, addition GAD of AG activity increased under AMADH Spd-NaCl activity treatment during alsogermination increased (Figure markedly5C). during Compared germination with other (Figure treatments, 5D). The GAD presen activityce of underAG significantly Spd-NaCl treatmentdecreased GADalso increased activity under markedly Spd- duringNaCl treatment, germination whereas (Figure we5D). found The no presence significant of AG difference significantly (p > 0.05) decreased under NaClGAD activitytreatment. under Spd-NaCl treatment, whereas we found no significant difference (p > 0.05) under NaCl treatment.

480 750 (A) (B) 2d A 4d 600 360 a a B 450 a b 240 b b C 300 CD c cd 120 AB A BC 150 de E de DE PAOprot) (U/g activity DAO activity prot) (U/g C e E

0 Ud Ud Ud 0

240 1350 (C) (D) A a

a A b 160 900 B B b c c bc B C c d C 80 d 450 C C C e C D de D e D GAD(U/g activity prot)

AMADH activity prot) (U/g e

0 0 CK N S NS NA NAS SA CK N S NS NA NAS SA

Figure 5. Changes in ( A) diamine oxidase ( (DAO),DAO), ( B) polyamine oxidase ( (PAO),PAO), (C) aminoaldehyde dehydrogenasdehydrogenasee (AMADH), (AMADH) and, and (D ) ( glutamateD) glutamate decarboxylase decarboxylase (GAD) ( activityGAD) activity in germinating in germinating soybeans. soybeans.Lowercase Lowercase letters reflect letters the significancereflect the significance of differences of indifferences index among in index treatments among of treatments 2-day germinating of 2-day germinatingsoybeans and soybeans capital letters and reflect capital the letters significance reflect of the di significancefferences in index of differences among treatments in index of among 4-day treatmentsgerminating of soybeans 4-day germinating (p < 0.05).CK, soybeans Control; (p N,< 0.05). NaCl; CK S,, Spd; Control; NS, NaClN, NaCl;+ Spd; S, NA,Spd; NaClNS, NaCl+ AG; + NAS,Spd; NANaCl, NaCl+ AG + +AG;Spd; NAS SA,, NaCl Spd + +AG; AG AG,+ Spd; Aminoguanidine; SA, Spd + AG; AG Ud,, Aminoguanidine; Undetected. Ud, Undetected. 3.6. Changes in GABA Synthase Gene Expression 3.6. Changes in GABA Synthase Gene Expression 3.6.1. GADs Relative Expression 3.6.1. GADs Relative Expression Compared with the control, the NaCl and Spd-NaCl treatments significantly induced GAD1 and GAD3Comparedexpression with the during control, germination the NaCl and (p Spd< 0.05).-NaCl Under treatment thes Spd-NaCl significantly treatment, induced GAD1GAD1 and GAD3 expression induring two-day germination germinating (p < soybeans0.05). Under and the all GADsSpd-NaClexpression treatment, in four-day GAD1 and soybeans GAD3 expressiondecreased, whereas in two-GAD2day germinatingexpression in soybeans two-day germinating and all GADs soybeans expression increased in four compared-day soybeans with the NaCl treatment (Figure6). The addition of AG markedly induced GADs expression in germinating soybeans. These results suggest that variations in the activities of GABA synthase are in accordance with gene expression. Foods 2020, 9, x FOR PEER REVIEW 8 of 12

decreased, whereas GAD2 expression in two-day germinating soybeans increased compared with the NaCl treatment (Figure 6). The addition of AG markedly induced GADs expression in germinating Foodssoybeans2020, 9., These 267 results suggest that variations in the activities of GABA synthase are in accordance8 of 12 with gene expression.

4 8

a (A) 2d (B) 4d GAD1 GAD2 6 3 A a B AB 2 bc 4 b bc bc C b bc cd D DE A A 1 2 E bc B BC d bc BCD c D bcCD Relative expression of of expression Relative Relative expression of 0 0 3 12

(C) (D) a

a GAD3 GAD4 2 A a 8 ab B abd abc b C cd bc bc CD DE 4 1 E E A b b b C D B B Relative expression of expression Relative b E E Relative expression of expression Relative 0 0 CK N S NS NA NAS SA 40 (E) a GAD5 30

20

b 10

Relative expression of A A c BC C c BC c c BC c B 0 CK N S NS NA NAS SA

FigureFigure 6.6. ChangesChanges ofof ((AA)) GAD1GAD1,(, (BB)) GAD2GAD2,(, (CC)) GAD3,GAD3, ((DD)) GAD4GAD4,, andand ((EE)) GAD5GAD5 relativerelative expressionexpression inin germinating germinating soybeans. soybeans. Lowercas Lowercasee letters reflectreflect the significancesignificance of di differencesfferences in in index index among among treatmentstreatments ofof 2-day2-day germinatinggerminating soybeanssoybeans andand capitalcapital lettersletters reflectreflect thethe significancesignificance ofof didifferencesfferences inin indexindex amongamong treatmentstreatments ofof 4-day4-day germinatinggerminating soybeanssoybeans ((pp< < 0.05).0.05). CK,CK, Control; N,N, NaCl; S,S, Spd; NS,NS, NaClNaCl ++ Spd; NA,NA, NaCl + AG; NAS NAS,, NaCl + AGAG ++ Spd;Spd; S SA,A, Spd Spd ++ AGAG;; AG AG,, Aminoguanidine Aminoguanidine..

3.6.2.3.6.2. DAOs,DAOs, PAOs,PAOs, andand AMADHsAMADHs RelativeRelative ExpressionExpression ComparedCompared withwith thethe control,control, thethe NaCl treatment significantlysignificantly increasedincreased four-dayfour-day DAO1,DAO1, two-daytwo-day PAO1PAO1,, andand AMADH2AMADH2 expressions, but but decreased decreased two two-day-day DAO1DAO1 andand four four-day-day PAO1PAO1 expressionsexpressions (p (

Foods 2020, 9, 267 9 of 12 Foods 2020, 9, x FOR PEER REVIEW 9 of 12

10 4 (A) A 2d (B) a 4d 8

DAO1 3 DAO2 6 A 2 AB b 4 bcABC a ABC c BC cd BC 1 C 2 ab B ab d b BC B b B BC d

Relativeexpression of b C

b of expression Relative 0 0 3 8

(C) a (D) PAO1 b PAO2 6 A 2 bc bc bc 4 a c A ABC b 1 AB BC BC BC c B C 2 BC cd BC de BC de BC C e Relative of Relative expression

d of expression Relative 0 0

140 4 (E) a (F)

120 AMADH1 3 a AMADH2 AMADH2 A a

100 2 B 10 b bc BC cd BC b BC BC d 5 1 e C b A b b Relative expression of expression Relative b B B B B b B B 0 of expression Relative 0 CK N S NS NA NAS SA CK N S NS NA NAS SA Figure 7.7. Changes of ( A) DAO1,,( (B) DAO2,,( (C) PAO1,(, (D)) PAO2,(, (EE)) AMADH1AMADH1,, andand ((FF)) AMADH2AMADH2 relativerelative expressionexpression inin germinating germinating soybeans. soybeans. Lowercase Lowercase letters letters reflect reflect the the significance significance of of di ffdifferenceserences in indexin index among among treatments treatments of 2-dayof 2-day germinating germinating soybeans soybeans and and capital capital letters letters reflect reflect the the significance significance of diofff differenceserences in index in index among among treatments treatments of 4-day of 4- germinatingday germinating soybeans soybeans (p < 0.05). (p < 0.05). CK, Control; CK, Control; N, NaCl; N, S,NaCl; Spd; NS,S, Spd; NaCl NS+,Spd; NaCl NA, + NaClSpd; + NAAG;, NaCl NAS, + NaCl AG;+ NASAG +, NaClSpd; SA, + AG Spd + AG;Spd; AG, SA, Aminoguanidine. Spd + AG; AG, Aminoguanidine. 4. Discussion 4. DiscussionIn this study, exogenous Spd effectively alleviated the growth inhibition caused by NaCl stress in germinating soybeans. Salt stress leads to water exosmosis in plants and elevated levels of ROS produce In this study, exogenous Spd effectively alleviated the growth inhibition caused by NaCl stress oxidative stress [22]. The growth and biological yield of germinating soybeans was inhibited by NaCl in germinating soybeans. Salt stress leads to water exosmosis in plants and elevated levels of ROS treatment (Figure1). MDA and H O contents, as indicators of membrane damage and ROS level, produce oxidative stress [22]. The growth2 2 and biological yield of germinating soybeans was inhibited increased significantly (Figure2). Spd is an internal and external stress signal molecule; its addition by NaCl treatment (Figure 1). MDA and H2O2 contents, as indicators of membrane damage and ROS under NaCl stress-induced germinating soybeans initiated regulations mechanisms to alleviate the level, increased significantly (Figure 2). Spd is an internal and external stress signal molecule; its stress damage. In the present study, GABA-enriched germinating soybeans were germinated in a addition under NaCl stress-induced germinating soybeans initiated regulations mechanisms to dark artificial environment and soybeans cannot absorb nutrients from the external environment and alleviate the stress damage. In the present study, GABA-enriched germinating soybeans were especially cannot synthesize organic compounds via photosynthesis. The growth of germinating germinated in a dark artificial environment and soybeans cannot absorb nutrients from the external soybeans under NaCl stress was inhibited, resulting in soybeans that were unable to use storage environment and especially cannot synthesize organic compounds via photosynthesis. The growth nutrients for growth during the germination stage and, therefore, showed the highest dry matter of germinating soybeans under NaCl stress was inhibited, resulting in soybeans that were unable to content. The activities of major ROS detoxifying enzymes (SOD, POD, CAT, and GPX) increased use storage nutrients for growth during the germination stage and, therefore, showed the highest dry significantly (p < 0.05) in germinating soybeans under Spd-NaCl treatment. This result is consistent matter content. The activities of major ROS detoxifying enzymes (SOD, POD, CAT, and GPX) increased significantly (p < 0.05) in germinating soybeans under Spd-NaCl treatment. This result is consistent with a study of other soybeans [23] and salt-responsive plants [14,24,25]. MDA and H2O2

Foods 2020, 9, 267 10 of 12

with a study of other soybeans [23] and salt-responsive plants [14,24,25]. MDA and H2O2 contents were decreased significantly in germinating soybeans. GABA is another of the stress-tolerance substances and functions to regulate infiltration in plants [26]. The application of Spd under the NaCl treatment significantly increased the GABA content in soybeans. These results support the conclusion that exogenous application of Spd results in salt stress resistance via the induction of antioxidant enzyme activity and GABA content, which also suggests that germinating soybeans under Spd-NaCl treatment can be used as a material to produce GABA-enriched functional ingredients. The level of GABA in plants is mediated by GABA synthase gene expression and GABA synthase activities. In the present study, the activities of DAO, PAO, GAD, and AMADH, which are key GABA synthases, increased significantly (p < 0.05) under NaCl treatment compared with the controls, where the largest increase (52%) in GABA content was observed. This result is consistent with a study of other plants under abiotic stress [27,28]. GABA content increased significantly with Spd (p < 0.05) under NaCl treatment, and this increment was due to the increase of GAD and PAO activities. No significant change of DAO and AMADH activities in the Spd-NaCl treatment was observed. Under the Spd-NaCl treatment, expression of DAO2 and PAO2 in two-day germinated soybeans were dramatically increased while DAO1 in four-day germinating soybeans was strongly suppressed compared with the NaCl stress. Furthermore, five GAD genes (GAD 1 to 5) displayed differential expression either in their transcript abundance or in their expression patterns under different environmental conditions like flooding, salt, drought, and cold [29–31]. Compared with the control, both the NaCl and Spd-NaCl treatments significantly induced GAD1 and GAD3 expression during germination. These results indicate that compared with other GADs, GAD1 and GAD3 might be an important GAD family for salt and Spd responses in soybeans. It is noteworthy that the expression of all GADs in four-day germinating soybeans was lower after the addition of Spd, which is inconsistent with the increased GABA content compared with the NaCl treatment. This result suggests that the increment of GAD activity was caused by the stimulation of conditions instead of GADs expression. Furthermore, NaCl stress can up-regulate the expression of AMADH2 but has no significant effect on the expression of AMADH1. This is consistent with the results of a study where NaCl stress was found to up-regulate the expression of rice BADH1 in the AMADH gene family [32]. Although the above results indicate a correlation between GABA accumulation and the expression of soybean GABA synthase genes under Spd-NaCl treatment, the expression profiles of these genes in various tissues still require further study to fully understand this relationship. AG is a specific inhibitor of DAO and can inhibit polyamine degradation [20]. In this study, the addition of AG completely suppressed DAO activity and then decreased GABA content. Mechanisms have been suggested for the production of GABA, the dynamic balances of GABA shunt, and polyamine degradation pathway in plants. The polyamine degradation pathway was reported to contribute 39% of GABA accumulation in soybeans under salt stress. However, in this study, the results indicated that 57% and 46% of GABA accumulation was contributed by the PA degradation under Spd and Spd-NaCl treatments, respectively. We suggest that the polyamine degradation pathway in germinating soybeans occupies an important proportion of the GABA synthesis pathway.

5. Conclusions

Spd significantly increased antioxidant enzyme activity and decreased MDA and H2O2 contents in germinating soybeans under NaCl stress. The activities of GABA synthase were increased significantly and the expressions of the GABA synthase gene were markedly regulated by Spd. The addition of Spd changed the contribution ratio of GABA shunt and the polyamine degradation pathway for GABA formation under NaCl stress. As a result, exogenous Spd alleviated the harmful effect of NaCl stress and increased the biomass and GABA content, which is beneficial for the enhancement of nutrition health value in germinating soybeans.

Author Contributions: Conducted the experiments, W.F. and F.Q.; Supervision, Y.Y.; Analyzed the data and wrote the manuscript, W.F. and Z.Y. All authors have read and agreed to the published version of the manuscript. Foods 2020, 9, 267 11 of 12

Funding: This work was funded by the China Postdoctoral Science Foundation funded project (2019M651978) and the Qing Lan Project of Yangzhou University (2018xlpyyq). Conflicts of Interest: The authors declare no conflict of interest.

References

1. Lee, S.E.; Lee, Y.; Lee, G.H. The regulation of decarboxylases in GABA neurotransmission in the brain. Arch. Pharm. Res. 2019, 42, 1031–1039. [CrossRef][PubMed] 2. Sved, A.F.; Sved, J.C. Plasticity of GABA function in the nucleus tractus solitarius in hypertension. Am. J. Physiol. Reg. Integr. Comp. Physiol. 2003, 285, R1272–R1273. [CrossRef][PubMed] 3. Al-Wadei, H.A.; Ullah, M.F.; Al-Wadei, M. GABA (γ-aminobutyric acid), a non-protein amino acid counters the β-adrenergic cascade-activated oncogenic signaling in pancreatic cancer: A review of experimental evidence. Mol. Nutr. Food Res. 2011, 55, 1745–1758. [CrossRef][PubMed] 4. Yang, Y.; Luo, H.; Cheng, L.X.; Liu, K. Inhibitory role for GABA in atherosclerosis. Med. Hypotheses 2013, 81, 803–804. [CrossRef][PubMed] 5. Diana, M.; Quílez, J.; Rafecas, M. Gamma-aminobutyric acid as a bioactive compound in foods: A review. J. Funct. Foods 2014, 10, 407–420. [CrossRef] 6. Poojary, M.M.; Dellarosa, N.; Roohinejad, S.; Koubaa, M.; Tylewicz, U.; Gómez-Galindo, F.; Saraiva, J.A.; Rosa, M.D.; Barba, F.J. Influence of innovative processing on γ-aminobutyric acid (GABA) contents in plant food materials. Compr. Rev. Food Sci. Food Saf. 2017, 16, 895–905. [CrossRef]

7. Yin, Y.; Yang, R.; Guo, Q.; Gu, Z. NaCl stress and supplemental CaCl2 regulating GABA metabolism pathways in germinating soybean. Eur. Food Res. Tech. 2014, 238, 781–788. [CrossRef] 8. Guo, Y.; Yang, R.; Chen, H.; Song, Y.; Gu, Z. Accumulation of γ-aminobutyric acid in germinated soybean (Glycine max L.) in relation to glutamate decarboxylase and diamine oxidase activity induced by additives under hypoxia. Eur. Food Res. Tech. 2012, 234, 679–687. [CrossRef] 9. Wang, P.; Liu, K.; Gu, Z.; Yang, R. Enhanced γ-aminobutyric acid accumulation, alleviated componential deterioration and technofunctionality loss of germinated wheat by hypoxia stress. Food Chem. 2018, 269, 473–479. [CrossRef] 10. Chen, D.; Shao, Q.; Yin, L.; Younis, A.; Zheng, B. Polyamine function in plants: Metabolism, regulation on development, and roles in abiotic stress responses. Front. Plant Sci. 2019, 9, 1945–1952. [CrossRef] 11. Nahar, K.; Hasanuzzaman, M.; Rahman, A.; Alam, M.; Mahmud, J.A.; Suzuki, T.; Fujita, M. Polyamines confer salt tolerance in mung bean (Vigna radiata L.) by reducing sodium uptake, improving nutrient homeostasis, antioxidant defense, and methylglyoxal detoxification systems. Front. Plant Sci. 2016, 7, 1104–1112. [CrossRef] [PubMed] 12. Seifikalhor, M.; Aliniaeifard, S.; Hassani, B.; Niknam, V.; Lastochkina, O. Diverse role of γ-aminobutyric acid in dynamic plant cell responses. Plant Cell Rep. 2019.[CrossRef][PubMed] 13. Nag, S.; Choudhuri, M. Role of endogenous auxin and polyamines in adventitious root formation in mungbean cuttings. Indian J. Plant Physiol. 2007, 12, 228–236. [CrossRef] 14. Zhou, T.; Wang, P.; Gu, Z.; Ma, M.; Yang, R. Spermidine improves antioxidant activity and energy metabolism in mung bean sprouts. Food Chem. 2020, 309, 125759. [CrossRef][PubMed] 15. Wang, X.; Wang, S.; Chen, Z.; Gong, B.; Wang, X.; Win, M.; Shi, Q.; Li, Y.; Yang, F. Effects of exogenous polyamines on nitrate tolerance in cucumber. Russ. J. Plant Physiol. 2016, 63, 549–557. [CrossRef] 16. Yin, Y.; Qi, F.; Gao, L.; Rao, S.; Yang, Z.; Fang, W. iTRAQ-based quantitative proteomic analysis of dark-germinated soybeans in response to salt stress. RSC Adv. 2018, 8, 17905–17913. [CrossRef] 17. Xing, S.G.; Jun, Y.B.; Hau, Z.W.; Liang, L.Y. Higher accumulation of γ-aminobutyric acid induced by salt stress through stimulating the activity of diamine oxidases in Glycine max (L.) Merr. roots. Plant Physiol. Biochem. 2007, 45, 560–566. [CrossRef] 18. Yin, Y.; Yang, R.; Gu, Z. Calcium regulating growth and GABA metabolism pathways in germinating soybean (Glycine max L.) under NaCl stress. Eur. Food Res. Tech. 2014, 239, 149–156. [CrossRef] 19. Rao, K.M.; Sresty, T. Antioxidative parameters in the seedlings of pigeonpea (Cajanus cajan (L.) Millspaugh) in response to Zn and Ni stresses. Plant Sci. 2000, 157, 113–128. [CrossRef] Foods 2020, 9, 267 12 of 12

20. Yang, R.; Guo, Q.; Gu, Z. GABA shunt and polyamine degradation pathway on γ-aminobutyric acid accumulation in germinating fava bean (Vicia faba L.) under hypoxia. Food Chem. 2013, 136, 152–159. [CrossRef] 21. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and ∆∆CT the 2− method. Methods 2001, 25, 402–408. [CrossRef][PubMed] 22. Tanou, G.; Molassiotis, A.; Diamantidis, G. Induction of reactive oxygen species and necrotic death-like destruction in strawberry leaves by salinity. Env. Exp. Bot. 2009, 65, 270–281. [CrossRef] 23. Zhang, G.; Xu, S.; Hu, Q.; Mao, W.; Gong, Y. plays a positive role in salt-tolerance mechanisms by reducing oxidative damage in roots of vegetable soybean. J. Integr. Agric. 2014, 13, 349–357. [CrossRef] 24. Ahanger, M.A.; Qin, C.; Maodong, Q.; Dong, X.X.; Ahmad, P.; Abd_Allah, E.F.; Zhang, L. Spermine application alleviates salinity induced growth and photosynthetic inhibition in Solanum lycopersicum by modulating osmolyte and secondary metabolite accumulation and differentially regulating antioxidant metabolism. Plant Physiol. Biochem. 2019, 144, 1–13. [CrossRef][PubMed] 25. Deng, C.; Li, J.; Liu, S.; Zhu, X.; Chen, Y.; Shen, X. Effects of spermidine and salinity stress on growth and biochemical response of paraquat-susceptibe and-resistant goosegrass (Eleusine indica L.). Weed Biol. Manag. 2019, 19, 75–84. [CrossRef] 26. Ramos-Ruiz, R.; Martinez, F.; Knauf-Beiter, G. The effects of GABA in plants. Cogent Food Agric. 2019, 5, 12–18. [CrossRef] 27. Yang, R.; Feng, L.; Wang, S.; Yu, N.; Gu, Z. Accumulation of gamma-aminobutyric acid in soybean by hypoxia germination and freeze-thawing incubation. J. Sci. Food Agric. 2016, 96, 2090–2096. [CrossRef] 28. Liao, J.; Wu, X.; Xing, Z.; Li, Q.; Duan, Y.; Fang, W.; Zhu, X. Gamma-aminobutyric acid (GABA) accumulation in tea (Camellia sinensis L.) through the GABA shunt and polyamine degradation pathways under anoxia. J. Agric. Food Chem. 2017, 65, 3013–3018. [CrossRef] 29. Hyun, T.; Eom, S.; Jeun, Y.; Han, S.; Kim, J. Identification of glutamate decarboxylases as a γ-aminobutyric acid (GABA) biosynthetic enzyme in soybean. Ind. Crop. Prod. 2013, 49, 864–870. [CrossRef] 30. Souza, S.; Mazzafera, P.; Sodek, L. Flooding of the root system in soybean: Biochemical and molecular aspects of N metabolism in the nodule during stress and recovery. Amino Acids 2016, 48, 1285–1295. [CrossRef] 31. Hyun, T.; Eom, S.; Han, X.; Kim, J. Evolution and expression analysis of the soybean glutamate decarboxylase gene family. J. Biosci. 2014, 39, 899–907. [CrossRef][PubMed] 32. Lapuz, R.R.; Javier, S.; Aquino, J.D.C.; Undan, J.R. Gene Expression and Sequence Analysis of BADH1 Gene in CLSU Aromatic Rice (Oryza sativa L.) Accessions Subjected to Drought and Saline Condition. J. Nutr. Sci. Vitam. 2019, 65, S196–S199. [CrossRef][PubMed]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).