SUNY Geneseo KnightScholar Biology Faculty/Staff Works Department of Biology 2019 Discovery of adults linked to cloning oceanic starfish larvae (Oreaster, asteroidea: Echinodermata) Daniel Janies Yoalli Quetzalli Hernández-Díaz Francisco Alonso Solís-Marín Karen Lopez Boyan Alexandrov See next page for additional authors Follow this and additional works at: https://knightscholar.geneseo.edu/biology Recommended Citation Janies D., Hernández-Díaz Y.Q., Solís-Marín F.A., Lopez K., Alexandrov B., Galac M., Herrera J., Cobb J., Ebert T.A., Bosch I. (2019) Discovery of adults linked to cloning oceanic starfish larvae (Oreaster, asteroidea: Echinodermata). Biological Bulletin 236: 174-185. doi: 10.1086/703233 This Article is brought to you for free and open access by the Department of Biology at KnightScholar. It has been accepted for inclusion in Biology Faculty/Staff Works by an authorized administrator of KnightScholar. For more information, please contact [email protected]. Authors Daniel Janies, Yoalli Quetzalli Hernández-Díaz, Francisco Alonso Solís-Marín, Karen Lopez, Boyan Alexandrov, Madeline Galac, Joan Herrera, Janessa Cobb, Thomas A. Ebert, and Isidro Bosch This article is available at KnightScholar: https://knightscholar.geneseo.edu/biology/9 Reference: Biol. Bull. 236: 000–000. (June 2019) © 2019 The University of Chicago DOI: 10.1086/703233 Discovery of Adults Linked to Cloning Oceanic Starfish Larvae (Oreaster, Asteroidea: Echinodermata) 1,* 2 3 DANIEL JANIES , YOALLI QUETZALLI HERNÁNDEZ-DÍAZ , FRANCISCO ALONSO SOLÍS-MARÍN , 1 4 1 5 6 KAREN LOPEZ , BOYAN ALEXANDROV , MADELINE GALAC , JOAN HERRERA , JANESSA COBB , 7 8 THOMAS A. EBERT , AND ISIDRO BOSCH 1Department of Bioinformatics and Genomics, University of North Carolina at Charlotte, 9201 University City Boulevard, Charlotte, North Carolina 28223; 2Unidad Multidisciplinaria de Docencia e Investigación-Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de México, Yucatán 97356, México; 3Laboratorio de Sistemática y Ecología de Equinodermos, Instituto de Ciencias del Mar y Limnología, UNAM. Apdo. Post. 70-305, Ciudad de México 04510, México; 4CoverMyMeds, 2 Miranova Place, Columbus, Ohio 43215; 5Department of Biological Sciences, University of South Florida, 140 7th Avenue South, St. Petersburg, Florida 33701; 6Florida Fish and Wildlife Research Institute, Specimen Collections, 100 8th Avenue SE, St. Petersburg, Florida 33701; 7Oregon State University, 1500 SW Jefferson Way, Corvallis, Oregon 97331; and 8State University of New York at Geneseo, 1 College Circle, Geneseo, New York 14454 Abstract. Two juvenile specimens of a new species of Oreas- closely related to Oreaster reticulatus and Oreaster clavatus ter were collected at Parque Nacional Arrecife Alacranes and in the western and eastern Atlantic, respectively. A question is Triángulos Oeste in the southern Gulf of Mexico. DNA of mi- whether the unidentified clonal larvae might actually be self- tochondrial loci identifies them as members of the same clade sustaining, as suggested as a possibility (Eaves and Palmer, as cloning larvae of Oreaster found abundantly in waters of 2003), or whether such larvae have a benthic stage. Here we the Florida Current-Gulf Stream system, and distinct from present evidence of a link between the unidentified clonal lar- Oreaster clavatus and Oreaster reticulatus, the two known vae and a previously unknown benthic stage collected from Oreasteridae species in the North Atlantic. Larvae from the 10–15-m depths at Parque Nacional Arrecife Alacranes and new species of Oreaster persist as clones but also metamor- Triángulos Oeste in the southern Gulf of Mexico. phose and settle to the benthos with typical asteroid morphol- ogy. Materials and Methods Introduction In 2016 and 2017, Hernández-Díaz and Solís-Marín dis- covered specimens of a putative new species of Oreaster Several clades of echinoderms clone as larvae (reviewed in Müller & Troschel, 1842, vouchers ICML-UNAM-18240- Allen et al., 2018). Bosch et al. (1989) discovered cloning as- QH411 and ICML-UNAM-18241-FM066 (hereafter QH411 teroid larvae in the Gulf Stream and in the Sargasso Sea (Fig. 1). and FM066), at Parque Nacional Arrecife Alacranes and Tri- fi Neither Knott et al. (2003) nor Galac et al. (2016) identi ed ángulos Oeste, in the southern Gulf of Mexico (Fig. 2). The the clonal larvae as Oreasteridae, but they could associate the small sea stars were attached to the underside of boulders at larvae with known species of Oreaster. Galac et al. (2016) 10–15-m depths in a coral reef habitat. Their morphology was found that clonal larvae belonged to clades distinct from but so distinct from that of small Oreaster reticulatus (Linnaeus, 1758) that they were recognized as a new form. Received 14 July 2018; Accepted 25 February 2019; Published online We sequenced the DNA coding for mitochondrial loci (Ta- 20 May 2019. ble 1) from Oreaster QH411 and FM066, O. reticulatus from * To whom correspondence should be addressed. Email: djanies@uncc the Gulf of Mexico off of Florida, and cloning larvae of .edu. Abbreviations: BLAST, Basic Local Alignment Search Tool; COI, cyto- Oreaster from various points in the Florida Current-Gulf chrome c oxidase I; PCR, polymerase chain reaction; SNP, single nucleotide Stream system. All voucher data were deposited in GenBank polymorphism. (Table 2). We sampled tube feet from benthic stages and 000 This content downloaded from 132.248.015.253 on May 20, 2019 10:42:37 AM All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c). 000 D. JANIES ET AL. Figure 1. Bipinnaria of Oreaster sp. nov. in the process of cloning. whole larvae for DNA extractions with Qiagen (Venlo, The (2) 95 7C for 50 s, (3) 58 7C for 30 s, (4) 72 7C for 1 min, (5) re- Netherlands) DNeasy Blood and Tissue Kit, following the peat steps 2–4 for 34 more cycles, and (6) 72 7C for 10 min. manufacturer’s Spin-Column protocol for animal tissue. We We set PCR conditions for the 1200-bp fragment at (1) 94 7C measured DNA concentration and quality on a NanoDrop for 5 min, (2) 94 7C for 50 s, (3) 52 7C for 30 s, (4) 72 7C for (Thermo Fisher Scientific, Waltham, MA) ND-1000 spectro- 1 min, (5) repeat steps 2–4 for 34 more cycles, and (6) 72 7C photometer to ensure that the amplicons were adequate for se- for 10 min. We cleaned PCR products with 10 units of Exo- quencing. Using the primers referenced in Table 1, we targeted nuclease I (Thermo Fisher Scientific) and 0.5 units of shrimp 2 amplicons for polymerase chain reaction (PCR) and direct alkaline phosphatase (Affymetrix; Thermo Fisher Scientific) at sequencing, including (1) a 1650-bp fragment consisting of 37 7C for 1 h, followed by a 15-min incubation at 65 7Ctode- the mitochondrial markers cytochrome c oxidase I (COI )and activate the enzymes. We sequenced PCR products with Ap- tRNA-Ala, tRNA-Leu, tRNA-Asn, tRNA-Gln,andtRNA-Pro, plied Biosystem’s BigDye Terminator (Thermo Fisher Scien- and (2) a 1250-bp fragment consisting of the mitochondrial tific), following the manufacturer’s protocol. We used the markers 12S rDNA, tRNA-Glu, tRNA-Thr,and16S rDNA. sequencing instrument and software as follows: Applied Bio- We completed PCR using PuReTaq Ready-to-Go PCR beads system’s 3130/3130xl Series Data Collection Software 4 and (GE Healthcare Life Sciences, Marlborough, MA). We set PCR Sequencing Analysis Software 6 running under a Microsoft conditions for the ∼1600-bp fragment at (1) 95 7C for 5 min, (Redmond, WA) Windows 7 operating system. This content downloaded from 132.248.015.253 on May 20, 2019 10:42:37 AM All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c). PHYLOGENY OF CLONING LARVAE AND A NEW SPECIES OF OREASTER 000 Figure 2. (A) Aboral and (B) oral views of QH411, now Oreaster sp. nov. (Photo credit Benjamin Magaña.) We edited and trimmed the sequencing trace files, using nucleotide database with BLAST (Altschul et al., 1990) under CodonCode Aligner (CodonCode, Centerville, MA). We ob- default conditions. Among those data retrieved were COI and tained comparable asteroid sequences that covered the same tRNA-Ala, tRNA-Leu, tRNA-Asn, tRNA-Gln,andtRNA-Pro for genetic regions as the novel sequence data produced herein several larvae that Knott et al. (2003) sequenced and recorded by using the novel sequence data to search GenBank’s core in GenBank as “valvatids” and in their publication as “larval This content downloaded from 132.248.015.253 on May 20, 2019 10:42:37 AM All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c). 000 D. JANIES ET AL. Table 1 Primers, references, and parameters used in polymerase chain reaction (PCR) and Sanger sequencing Amplicon Primer Sequence 50 to 30 Source PCR parameters 95 7C for 5 min PAT-2 CTTTGAAGGCTTTTAGTTTAGATTAAC Knott and Wray, 2000 35 cycles: 95 7C for 30 s 48 7C for 30 s ECOIB GGTAGTCTGAGTATCGTCG(A/T)G Knott and Wray, 2000 72 7C for 1 min, 42 s 72 7C for 10 min tRNAs 1 COI 95 7C for 5 min COIceF ACTGCCCACGCCCTAGTAATGATATTTTTTATGGTNATGCC Hoareau and Boissin, 2010 35 cycles: 95 7C for 50 s 58 7C for 30 s COIceR TCGTGTGTCTACGTCCATTCCTACTGTRAACATRTG Hoareau and Boissin, 2010 72 7C for 1 min 72 7C for 10 min 95 7C for 5 min 12Sa ACACATCGCCCGTCACTCTC Smith et al., 1993 35 cycles: 95 7C for 30 s 60 7C for 30 s 16Sb GACGAGAAGACCCTATCGAGC Smith et al., 1993 72 7C for 1 min, 16 s 72 7C for 10 min 12S, tRNAs, 16S 94 7C for 5 min 16SAN-R GCTTACGCCGGTCTGAACTCAG Zanol et al., 2010 35 cycles: 94 7C for 50 s 52 7C for 30 s 16SarL CGCCTGTTTATCAAAAACAT Palumbi et al., 1991 72 7C for 1 min 72 7C for 10 min group 1” and recorded in their table 2.