DOCSLIB.ORG

Oreaster, Asteroidea: Echinodermata)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oreaster, Asteroidea: Echinodermata) SUNY Geneseo KnightScholar Biology Faculty/Staff Works Department of Biology 2019 Discovery of adults linked to cloning oceanic starfish larvae (Oreaster, asteroidea: Echinodermata) Daniel Janies Yoalli Quetzalli Hernández-Díaz Francisco Alonso Solís-Marín Karen Lopez Boyan Alexandrov See next page for additional authors Follow this and additional works at: https://knightscholar.geneseo.edu/biology Recommended Citation Janies D., Hernández-Díaz Y.Q., Solís-Marín F.A., Lopez K., Alexandrov B., Galac M., Herrera J., Cobb J., Ebert T.A., Bosch I. (2019) Discovery of adults linked to cloning oceanic starfish larvae (Oreaster, asteroidea: Echinodermata). Biological Bulletin 236: 174-185. doi: 10.1086/703233 This Article is brought to you for free and open access by the Department of Biology at KnightScholar. It has been accepted for inclusion in Biology Faculty/Staff Works by an authorized administrator of KnightScholar. For more information, please contact [email protected]. Authors Daniel Janies, Yoalli Quetzalli Hernández-Díaz, Francisco Alonso Solís-Marín, Karen Lopez, Boyan Alexandrov, Madeline Galac, Joan Herrera, Janessa Cobb, Thomas A. Ebert, and Isidro Bosch This article is available at KnightScholar: https://knightscholar.geneseo.edu/biology/9 Reference: Biol. Bull. 236: 000–000. (June 2019) © 2019 The University of Chicago DOI: 10.1086/703233 Discovery of Adults Linked to Cloning Oceanic Starfish Larvae (Oreaster, Asteroidea: Echinodermata) 1,* 2 3 DANIEL JANIES , YOALLI QUETZALLI HERNÁNDEZ-DÍAZ , FRANCISCO ALONSO SOLÍS-MARÍN , 1 4 1 5 6 KAREN LOPEZ , BOYAN ALEXANDROV , MADELINE GALAC , JOAN HERRERA , JANESSA COBB , 7 8 THOMAS A. EBERT , AND ISIDRO BOSCH 1Department of Bioinformatics and Genomics, University of North Carolina at Charlotte, 9201 University City Boulevard, Charlotte, North Carolina 28223; 2Unidad Multidisciplinaria de Docencia e Investigación-Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de México, Yucatán 97356, México; 3Laboratorio de Sistemática y Ecología de Equinodermos, Instituto de Ciencias del Mar y Limnología, UNAM. Apdo. Post. 70-305, Ciudad de México 04510, México; 4CoverMyMeds, 2 Miranova Place, Columbus, Ohio 43215; 5Department of Biological Sciences, University of South Florida, 140 7th Avenue South, St. Petersburg, Florida 33701; 6Florida Fish and Wildlife Research Institute, Specimen Collections, 100 8th Avenue SE, St. Petersburg, Florida 33701; 7Oregon State University, 1500 SW Jefferson Way, Corvallis, Oregon 97331; and 8State University of New York at Geneseo, 1 College Circle, Geneseo, New York 14454 Abstract. Two juvenile specimens of a new species of Oreas- closely related to Oreaster reticulatus and Oreaster clavatus ter were collected at Parque Nacional Arrecife Alacranes and in the western and eastern Atlantic, respectively. A question is Triángulos Oeste in the southern Gulf of Mexico. DNA of mi- whether the unidentified clonal larvae might actually be self- tochondrial loci identifies them as members of the same clade sustaining, as suggested as a possibility (Eaves and Palmer, as cloning larvae of Oreaster found abundantly in waters of 2003), or whether such larvae have a benthic stage. Here we the Florida Current-Gulf Stream system, and distinct from present evidence of a link between the unidentified clonal lar- Oreaster clavatus and Oreaster reticulatus, the two known vae and a previously unknown benthic stage collected from Oreasteridae species in the North Atlantic. Larvae from the 10–15-m depths at Parque Nacional Arrecife Alacranes and new species of Oreaster persist as clones but also metamor- Triángulos Oeste in the southern Gulf of Mexico. phose and settle to the benthos with typical asteroid morphol- ogy. Materials and Methods Introduction In 2016 and 2017, Hernández-Díaz and Solís-Marín dis- covered specimens of a putative new species of Oreaster Several clades of echinoderms clone as larvae (reviewed in Müller & Troschel, 1842, vouchers ICML-UNAM-18240- Allen et al., 2018). Bosch et al. (1989) discovered cloning as- QH411 and ICML-UNAM-18241-FM066 (hereafter QH411 teroid larvae in the Gulf Stream and in the Sargasso Sea (Fig. 1). and FM066), at Parque Nacional Arrecife Alacranes and Tri- fi Neither Knott et al. (2003) nor Galac et al. (2016) identi ed ángulos Oeste, in the southern Gulf of Mexico (Fig. 2). The the clonal larvae as Oreasteridae, but they could associate the small sea stars were attached to the underside of boulders at larvae with known species of Oreaster. Galac et al. (2016) 10–15-m depths in a coral reef habitat. Their morphology was found that clonal larvae belonged to clades distinct from but so distinct from that of small Oreaster reticulatus (Linnaeus, 1758) that they were recognized as a new form. Received 14 July 2018; Accepted 25 February 2019; Published online We sequenced the DNA coding for mitochondrial loci (Ta- 20 May 2019. ble 1) from Oreaster QH411 and FM066, O. reticulatus from * To whom correspondence should be addressed. Email: djanies@uncc the Gulf of Mexico off of Florida, and cloning larvae of .edu. Abbreviations: BLAST, Basic Local Alignment Search Tool; COI, cyto- Oreaster from various points in the Florida Current-Gulf chrome c oxidase I; PCR, polymerase chain reaction; SNP, single nucleotide Stream system. All voucher data were deposited in GenBank polymorphism. (Table 2). We sampled tube feet from benthic stages and 000 This content downloaded from 132.248.015.253 on May 20, 2019 10:42:37 AM All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c). 000 D. JANIES ET AL. Figure 1. Bipinnaria of Oreaster sp. nov. in the process of cloning. whole larvae for DNA extractions with Qiagen (Venlo, The (2) 95 7C for 50 s, (3) 58 7C for 30 s, (4) 72 7C for 1 min, (5) re- Netherlands) DNeasy Blood and Tissue Kit, following the peat steps 2–4 for 34 more cycles, and (6) 72 7C for 10 min. manufacturer’s Spin-Column protocol for animal tissue. We We set PCR conditions for the 1200-bp fragment at (1) 94 7C measured DNA concentration and quality on a NanoDrop for 5 min, (2) 94 7C for 50 s, (3) 52 7C for 30 s, (4) 72 7C for (Thermo Fisher Scientific, Waltham, MA) ND-1000 spectro- 1 min, (5) repeat steps 2–4 for 34 more cycles, and (6) 72 7C photometer to ensure that the amplicons were adequate for se- for 10 min. We cleaned PCR products with 10 units of Exo- quencing. Using the primers referenced in Table 1, we targeted nuclease I (Thermo Fisher Scientific) and 0.5 units of shrimp 2 amplicons for polymerase chain reaction (PCR) and direct alkaline phosphatase (Affymetrix; Thermo Fisher Scientific) at sequencing, including (1) a 1650-bp fragment consisting of 37 7C for 1 h, followed by a 15-min incubation at 65 7Ctode- the mitochondrial markers cytochrome c oxidase I (COI )and activate the enzymes. We sequenced PCR products with Ap- tRNA-Ala, tRNA-Leu, tRNA-Asn, tRNA-Gln,andtRNA-Pro, plied Biosystem’s BigDye Terminator (Thermo Fisher Scien- and (2) a 1250-bp fragment consisting of the mitochondrial tific), following the manufacturer’s protocol. We used the markers 12S rDNA, tRNA-Glu, tRNA-Thr,and16S rDNA. sequencing instrument and software as follows: Applied Bio- We completed PCR using PuReTaq Ready-to-Go PCR beads system’s 3130/3130xl Series Data Collection Software 4 and (GE Healthcare Life Sciences, Marlborough, MA). We set PCR Sequencing Analysis Software 6 running under a Microsoft conditions for the ∼1600-bp fragment at (1) 95 7C for 5 min, (Redmond, WA) Windows 7 operating system. This content downloaded from 132.248.015.253 on May 20, 2019 10:42:37 AM All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c). PHYLOGENY OF CLONING LARVAE AND A NEW SPECIES OF OREASTER 000 Figure 2. (A) Aboral and (B) oral views of QH411, now Oreaster sp. nov. (Photo credit Benjamin Magaña.) We edited and trimmed the sequencing trace files, using nucleotide database with BLAST (Altschul et al., 1990) under CodonCode Aligner (CodonCode, Centerville, MA). We ob- default conditions. Among those data retrieved were COI and tained comparable asteroid sequences that covered the same tRNA-Ala, tRNA-Leu, tRNA-Asn, tRNA-Gln,andtRNA-Pro for genetic regions as the novel sequence data produced herein several larvae that Knott et al. (2003) sequenced and recorded by using the novel sequence data to search GenBank’s core in GenBank as “valvatids” and in their publication as “larval This content downloaded from 132.248.015.253 on May 20, 2019 10:42:37 AM All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c). 000 D. JANIES ET AL. Table 1 Primers, references, and parameters used in polymerase chain reaction (PCR) and Sanger sequencing Amplicon Primer Sequence 50 to 30 Source PCR parameters 95 7C for 5 min PAT-2 CTTTGAAGGCTTTTAGTTTAGATTAAC Knott and Wray, 2000 35 cycles: 95 7C for 30 s 48 7C for 30 s ECOIB GGTAGTCTGAGTATCGTCG(A/T)G Knott and Wray, 2000 72 7C for 1 min, 42 s 72 7C for 10 min tRNAs 1 COI 95 7C for 5 min COIceF ACTGCCCACGCCCTAGTAATGATATTTTTTATGGTNATGCC Hoareau and Boissin, 2010 35 cycles: 95 7C for 50 s 58 7C for 30 s COIceR TCGTGTGTCTACGTCCATTCCTACTGTRAACATRTG Hoareau and Boissin, 2010 72 7C for 1 min 72 7C for 10 min 95 7C for 5 min 12Sa ACACATCGCCCGTCACTCTC Smith et al., 1993 35 cycles: 95 7C for 30 s 60 7C for 30 s 16Sb GACGAGAAGACCCTATCGAGC Smith et al., 1993 72 7C for 1 min, 16 s 72 7C for 10 min 12S, tRNAs, 16S 94 7C for 5 min 16SAN-R GCTTACGCCGGTCTGAACTCAG Zanol et al., 2010 35 cycles: 94 7C for 50 s 52 7C for 30 s 16SarL CGCCTGTTTATCAAAAACAT Palumbi et al., 1991 72 7C for 1 min 72 7C for 10 min group 1” and recorded in their table 2.
Load more

Recommended publications
  • Handbook of Texas Cretaceous Fossils
    University of Texas Bulletin No. 2838: October 8, 1928 HANDBOOK OF TEXAS CRETACEOUS FOSSILS B y W. S. ADKINS Bureau of Economic Geology J. A. Udden, Director E. H. Sellards, Associate Director PUBLISHED BY THE UNIVERSITY FOUR TIMES A MONTH, AND ENTERED AS SECOND-CLASS MATTER AT THE POSTOFFICE AT AUSTIN, TEXAS. UNDER THE ACT OF AUGUST 24. 1912 The benefits of education and of useful knowledge, generally diffused through a community, are essential to the preservation of a free govern­ m en t. Sam Houston Cultivated mind is the guardian genius of democracy. It is the only dictator that freemen acknowl­ edge and the only security that free­ men desire. Mirabeau В. Lamar CONTENTS P age Introduction __________________________________________________ 5 Summary of Formation Nomenclature_______________________ 6 Zone Markers and Correlation_______________________________ 8 Types of Texas Cretaceous Fossils___________________________ 36 Bibliography ________________________________________________ 39 L ist and Description of Species_________________________________ 46 P lants ______________________________________________________ 46 Thallophytes ______________________________________________ 46 Fungi __________________________________________________ 46 Algae __________________________________________________ 47 Pteridophytes ____________________________________________ 47 Filices __________________________________________________ 47 Spermatophytes __________________________________________ 47 Gymnospermae _________________________________________
    [Show full text]
  • New Species, Corallivory, in Situ Video Observations and Overview of the Goniasteridae (Valvatida, Asteroidea) in the Hawaiian Region
    Zootaxa 3926 (2): 211–228 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2015 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3926.2.3 http://zoobank.org/urn:lsid:zoobank.org:pub:39FE0179-9D06-4FC2-9465-CE69D79B933F New species, corallivory, in situ video observations and overview of the Goniasteridae (Valvatida, Asteroidea) in the Hawaiian Region CHRISTOPHER L. MAH Dept. of Invertebrate Zoology, Smithsonian Institution, Washington, D.C. 20007 Abstract Two new species of Goniasteridae, Astroceramus eldredgei n. sp. and Apollonaster kelleyi n. sp. are described from the Hawaiian Islands region. Prior to this occurrence, Apollonaster was known only from the North Atlantic. The Goniasteri- dae is the most diverse family of asteroids in the Hawaiian region. Additional in situ observations of several goniasterid species, including A. eldredgei n. sp. are reported. These observations extend documentation of deep-sea corallivory among goniasterid asteroids. New species occurrences presented herein suggested further biogeographic affinities be- tween tropical Pacific and Atlantic goniasterid faunas. Key words: Goniasteridae, Valvatida, deep-sea, Hawaiian Islands, predation Introduction Recent discoveries of new genera and species from deep-sea habitats along with new in situ video observations have provided us with new ecological insight into these poorly understood and formerly inaccessible settings (e.g., Mah et al. 2010, 2014; Mah & Foltz 2014). Hawaiian deep-sea Asteroidea are taxonomically diverse and occur in an active area of oceanographic and biological research (Chave and Malahoff 1998). New data on asteroids in this area presents an opportunity to review and highlight this diverse fauna.
    [Show full text]
  • Starfish Saponins, 19
    3 266 STARFISH SAPONINS, 19. ‘ A NOVEL STEROIDAL GLYCOSIDE SULFATE FROM THE STARFISHES PROTOREASTER NODOSUS AND PENTACERASTER ALVEOLATUS2 RAFFAELERICCIO, FRANCO ZOLLO, ESTERFINAMORE, LUIGIhfINALE* Dipartitnetlin di CbitnicL~dtlle Sostanze ì%ttirali, Uiiivcrsiiù~ Via L. Rodimi 22. 80138 Napoli, Itufy. ---DOhïINImE3T, - GEORGESBAKGIB ANT, Cetitre ORSTOM, BP AS, Noimia, Ntw Cdrdoniu and JACQUE PUSSET Laboratoire dus Plunta h.Ii&irzalus, CNRS, B P 643, Not~t~éa,Neu, Cal&niLr ABSTRACT.-A new sulfated asterosaponin (l),containing the unprecedented (20R,22S)- Sa-cholesta-9(1 l), 24(25)-diene-3ß,Ga 20,22-tetraol aglycone, has been isolated from the Pacific starfishes Platmastw tiodosus and Pmtawu.ster alceolntm. The sulfate residue is at C-3 and the oligosaccharide chain, ß-D-fucopyranosyl(11+2)-ß-D-quinovopyranosyl(l++4) [-ß-D- quinovopyranosyl( 11+2)1-ß-D-xylopyranosyl( 1~3)-ß-D-quinovopyranosyl,is at C-6. We have reported previously the occurrence of a novel type of steroidal glycoside, nodososide, (24S)-24-0-E2-0-methyl-ß-D-xylopyranosyl-(1~2)-a-L-arabino-furano- syl)-5a-cholestane-3ß, 5,6ß,8,15a,24-hexol, along with several polyhydroxylated sterols, from the Pacific starfish Protoreaster nodosils L. (order Phanerozonia, family Oreasteridae) (1-3). We have now examined the more polar components and have iso- lated a new sulfated asterosaponin (11, which we named protoreasteroside, along with R -13 & H OH 2 R= ‘v ’For Part 18, seel Nat Pivd , 48, 97 1985) of the Progetto Finalizzato “Chimica Fine e Secondana” del GN O 10001373 thte g - -. - - - OH 1 268 Journal of Natural Products {Vol.
    [Show full text]
  • The Sea Stars (Echinodermata: Asteroidea): Their Biology, Ecology, Evolution and Utilization OPEN ACCESS
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/328063815 The Sea Stars (Echinodermata: Asteroidea): Their Biology, Ecology, Evolution and Utilization OPEN ACCESS Article · January 2018 CITATIONS READS 0 6 5 authors, including: Ferdinard Olisa Megwalu World Fisheries University @Pukyong National University (wfu.pknu.ackr) 3 PUBLICATIONS 0 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Population Dynamics. View project All content following this page was uploaded by Ferdinard Olisa Megwalu on 04 October 2018. The user has requested enhancement of the downloaded file. Review Article Published: 17 Sep, 2018 SF Journal of Biotechnology and Biomedical Engineering The Sea Stars (Echinodermata: Asteroidea): Their Biology, Ecology, Evolution and Utilization Rahman MA1*, Molla MHR1, Megwalu FO1, Asare OE1, Tchoundi A1, Shaikh MM1 and Jahan B2 1World Fisheries University Pilot Programme, Pukyong National University (PKNU), Nam-gu, Busan, Korea 2Biotechnology and Genetic Engineering Discipline, Khulna University, Khulna, Bangladesh Abstract The Sea stars (Asteroidea: Echinodermata) are comprising of a large and diverse groups of sessile marine invertebrates having seven extant orders such as Brisingida, Forcipulatida, Notomyotida, Paxillosida, Spinulosida, Valvatida and Velatida and two extinct one such as Calliasterellidae and Trichasteropsida. Around 1,500 living species of starfish occur on the seabed in all the world's oceans, from the tropics to subzero polar waters. They are found from the intertidal zone down to abyssal depths, 6,000m below the surface. Starfish typically have a central disc and five arms, though some species have a larger number of arms. The aboral or upper surface may be smooth, granular or spiny, and is covered with overlapping plates.
    [Show full text]
  • The Bulletin of Zoological Nomenclature, Vol19, Part 3
    Volume 19. Part 3. 28$. May, 1962 pp. 129-192. THE BULLETIN OF ZOOLOGICAL NOMENCLATURE The Official Organ of THE INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE Contents Page Notices prescribed by the International Congress of Zoology : Date of commencement by the International Commission on Zoological Nomenclature of voting on applications published in the Bulletin of Zoological Nomenclature 129 Notice of the possible use by the International Commission on Zoological Nomenclature of its plenary powers in certain cases 129 (icontinued inside back wrapper) LONDON: Printed by Order of the International Trust for Zoological Nomenclature and Sold on behalf of the International Commission on Zoological Nomenclature by the International Trust at its Publications Office, 19, Belgrave Square, London, S.W.I 1962 Price Three Pounds (All rights reserved) Original from and digitized by National University of Singapore Libraries INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE A. The Officers of the Commission President-. Professor James Chester Bradley (Cornell University, Ithaca, N.T., U.S.A.) (12 August 1953) Vice-President: Senhor Dr. Afranio do Amaral (Sao Paulo, Brazil) (12 August 1953) Secretary: Mr. N. D. Riley (British Museum (Natural History), London) (23 July 1958) Assistant Secretary: Dr. W. E. China (British Museum (Natural History), Cromwell Road, London, S.W. 7) B. The Members of the Commission (Arranged in order of precedence by reference to date of election or of most recent re-election, as prescribed by the International Congress of Zoology) Senhor Dr. Afranio do Amakal (S. Paulo, Brazil) (12 August 1953) (Vice-President) Professor J. Chester Bradley (Cornell University, Ithaca, N.Y., U.S.A.) (12 August 1953) (President) Professor Harold E.
    [Show full text]
  • Reproductive Biology in the Starfish Echinaster (Othilia) Guyanensis (Echinodermata: Asteroidea) in Southeastern Brazil
    ZOOLOGIA 27 (6): 897–901, December, 2010 doi: 10.1590/S1984-46702010000600010 Reproductive biology in the starfish Echinaster (Othilia) guyanensis (Echinodermata: Asteroidea) in southeastern Brazil Fátima L. F. Mariante1; Gabriela B. Lemos1; Frederico J. Eutrópio1; Rodrigo R. L. Castro1 & Levy C. Gomes1, 2 1 Centro Universitário Vila Velha. Rua Comissário José Dantas de Melo 21, Boa Vista, 29102-770 Vila Velha, ES, Brazil. E-mail: [email protected]; [email protected]; [email protected]; [email protected] 2 Corresponding author. E-mail: [email protected] ABSTRACT. Echinaster (Othilia) guyanensis Clark, 1987 is an endangered starfish distributed throughout the Caribbean and Atlantic Ocean. Even though it has been extensively harvested, little is known about the biology and ecology of this starfish. Here, we examine reproduction seasonality in E. (O.) guyanensis. Individuals were collected monthly for one year, including four complete lunar phases. The gonad index (GI) was calculated to determine annual and monthly reproductive peaks. Gametogenesis stages were also determined. Sex ratio was 1:1.33 (M:F). Gonadosomatic index, body weight, central disc width and arm length were similar for both sexes. Gonads were present in all animals with arm length greater than 36.2 mm. Lunar phase was not associated with E. (O.) guyanensis reproduction. GI and gametogenesis patterns suggest that starfish have an annual reproductive peak with spawning during autumn months (March to May). KEY WORDS. Brazil; reproduction; gametogenesis;
    [Show full text]
  • Spp List.Xlsx
    Common name Scientific name ANGIOSPERMS Seagrass Halodule wrightii Manatee grass Syringodium filiforme Turtle grass Thalassia testudinium ALGAE PHAEOPHYTA Y Branched algae Dictyota sp Encrusting fan leaf algae Lobophora variegata White scroll algae Padina jamaicensis Sargassum Sargassum fluitans White vein sargassum Sargassum histrix Saucer leaf algae Turbinaria tricostata CHLOROPHYTA Green mermaid's wine glass Acetabularia calyculus Cactus tree algae Caulerpa cupressoides Green grape algae Caulerpa racemosa Green bubble algae Dictyosphaeria cavernosa Large leaf watercress algae Halimeda discoidea Small-leaf hanging vine Halimeda goreaui Three finger leaf algae Halimeda incrassata Watercress algae Halimeda opuntia Stalked lettuce leaf algae Halimeda tuna Bristle ball brush Penicillus dumetosus Flat top bristle brush Penicillus pyriformes Pinecone algae Rhipocephalus phoenix Mermaid's fans Udotea sp Elongated sea pearls Valonia macrophysa Sea pearl Ventricaria ventricosa RHODOPHYTA Spiny algae Acanthophora spicifera No common name Ceramium nitens Crustose coralline algae Corallina sp. Tubular thicket algae Galaxaura sp No common name Laurencia obtusa INVERTEBRATES PORIFERA Scattered pore rope sponge Aplysina fulva Branching vase sponge Callyspongia vaginalis Red boring sponge Cliona delitrix Brown variable sponge Cliona varians Loggerhead sponge Spheciospongia vesparium Fire sponge Tedania ignis Giant barrel sponge Xestospongia muta CNIDARIA Class Scyphozoa Sea wasp Carybdea alata Upsidedown jelly Cassiopeia frondosa Class Hydrozoa Branching
    [Show full text]
  • Parvulastra Exigua in South Africa: One Species Or More?
    Parvulastra exigua in South Africa: one species or more? Robyn P. Payne 2013 Town Supervisors: Prof. Charles GriffithsCape Department of Biological Sciences, University of Capeof Town, Private Bag X3, Rondebosch 7701, South Africa Dr Sophie von der Heyden Department of Botany and Zoology, University of Stellenbosch, Private Bag X1, Matieland 7602, South Africa University 1 The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgementTown of the source. The thesis is to be used for private study or non- commercial research purposes only. Cape Published by the University ofof Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University Abstract Parvulastra exigua is a widely distributed and prominent member of the temperate intertidal fauna in the southern hemisphere, occurring along the southern coastline of Africa, southeastern Australia and several oceanic islands. In South Africa, it is found in sympatry with the endemic Parvulastra dyscrita and the two are differentiated predominantly by gonopore placement. P. exigua gives rise to distinct lecithotrophic benthic larvae that hatch from sticky egg masses laid via oral gonopores. In contrast, P. dyscrita has aboral gonopores that release eggs into the water column, from which pelagic larvae hatch. Several recent studies have suggested that there is a cryptic species of P. exigua in South Africa, based on genetic evidence or the differential placement of the gonopores. A morphological, anatomical and genetic investigation was performed on a total collection of 346 P. exigua and 8 P.
    [Show full text]
  • Life History Diversity and Molecular Phylogeny in the Australian Sea Star Genus Patiriella
    Life history diversity and molecular phylogeny in the Australian sea star genus Patiriella Maria Byrne,' Anna Cerra,' Mike W. Hart^^ and Mike J. Smith^ 'Department of Anatomy and Histology, F13, University of Sydney, New South Wales 2006 ^Institute of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, BC, Canada 'Biology Department, Dalhousie University, Halifax, Nova Scotia, Canada B3H 4JI The sea star genus Patiriella in Australia lias tlie greatest diversity of life histories known for the Asteroidea. While the adults have similar phenotypes and life styles, their larvae are highly divergent. Patiriella includes species with unmodified development through typical feeding bipinnaria and brachiolaria larvae and several patterns of modified development through non- feeding planktonic, benthic or intragonadal brachiolaria. Comparative embryology and molecular phylogeny indicate that divergence of Patiriella was closely tied to developmental change. Phylogenetic analysis divided the Patiriella species into two clades. With feeding larvae representing the ancestral state for these sea stars, one clade exhibited one identifiable change Downloaded from http://meridian.allenpress.com/rrimo/book/chapter-pdf/2643123/rzsnsw_1999_031.pdf by guest on 28 September 2021 in larval form, while the other clade exhibited four changes in larval form. Life history traits in Patiriella appear to have evolved freely, contrary to the widely assumed evolutionary conservatism of early development. The range of life histories exhibited by Patiriella'appears unique to these sea stars and is an important resource for investigation of the evolution of development. INTRODUCTION gonad dissection. P. regularis, a native of New Zealand, was collected from populations The diversity of the asteroid genus Patiriella established in the Derwent River Estuary, is an unusual feature of Australia's echinoderm Tasmania.
    [Show full text]
  • Feeding Habits of <I>Oreaster Reticulatus</I>
    BULLETIN OF MARINE SCIENCE, 32(2): 504-510, 1982 FEEDING HABITS OF OREASTER RETICULATUS (ECHINODERMATA: ASTEROIDEA) R. E. Scheibling ABSTRACT In situ feeding observations among eight populations in various grassbed and sand-bottom habitats in the Grenadines and off St. Croix. U.S. Virgin Islands indicate that Oreaster reticulatus is primarily an omnivorous. microphagous substratum grazer. It extrudes its extensive cardiac stomach upon seagrass. sand, and/or algal substrates and ingests associated micro-organisms and particulate detritus. O. reticulatus also functions as an opportunistic predator and scavenger of any available slow-moving, sessile or moribund macrofauna and is occasionally cannibalistic. The feeding habits of O. reticulatus may be exemplary of tropical, shallow-water asteroids in general. Oreaster reticulatus (Linnaeus) is an abundant and conspicuous inhabitant of seagrass and sand bottoms in the Caribbean (Scheibling, 1980a,b). However, published information on its feeding biology is limited. A few incidental obser- vations and circumstantial evidence have led to divergent conclusions: O. reti- culatus typically digests microscopic organic material upon the substratum but occasionally feeds on sponges (Thomas, 1960); it preys upon the urchin Meoma ventricosa (Kier and Grant, 1965); and, based on anatomical specialization of the gut, it functions as a suspension feeder (Anderson, 1978). Anderson (1978) has expressed the need that "studies soon be made on the feeding biology of Oreaster reticulatus, to supplement incidental observations, and to determine the validity of conclusions that can now be only inferred from considerations of the anatomy of the digestive system." This study surveys the feeding habits of Oreaster reticulatus in situ in several populations from various habitats in the Carribbean.
    [Show full text]
  • 2006-2007 Intertidal Reef Biodiversity on Kangaroo
    2006-2007 Kangaroo Island Natural Resources Management Board INTERTIDAL REEF BIODIVERSITY Intertidal Reef Biodiversity on Kangaroo Island – 2007 ON KANGAROO ISLAND 1 INTERTIDAL REEF BIODIVERSITY ON KANGAROO ISLAND Oceans of Blue: Coast, Estuarine and Marine Monitoring Program A report prepared for the Kangaroo Island Natural Resources Management Board by Kirsten Benkendorff Martine Kinloch Daniel Brock June 2007 2006-2007 Kangaroo Island Natural Resources Management Board Intertidal Reef Biodiversity on Kangaroo Island – 2007 2 Oceans of Blue The views expressed and the conclusions reached in this report are those of the author and not necessarily those of persons consulted. The Kangaroo Island Natural Resources Management Board shall not be responsible in any way whatsoever to any person who relies in whole or in part on the contents of this report. Project Officer Contact Details Martine Kinloch Coast and Marine Program Manager Kangaroo Island Natural Resources Management Board PO Box 665 Kingscote SA 5223 Phone: (08) 8553 4980 Fax: (08) 8553 0122 Email: [email protected] Kangaroo Island Natural Resources Management Board Contact Details Jeanette Gellard General Manager PO Box 665 Kingscote SA 5223 Phone: (08) 8553 0111 Fax: (08) 8553 0122 Email: [email protected] © Kangaroo Island Natural Resources Management Board This document may be reproduced in whole or part for the purpose of study or training, subject to the inclusion of an acknowledgment of the source and to its not being used for commercial purposes or sale. Reproduction for purposes other than those given above requires the prior written permission of the Kangaroo Island Natural Resources Management Board.
    [Show full text]
  • Download The
    Behaviour (2016) DOI:10.1163/1568539X-00003401 brill.com/beh Improved performance, within-individual consistency and between-individual differences in the righting behaviour of the Caribbean sea star, Oreaster reticulatus Lee F.G. Gutowsky ∗, Jacob W. Brownscombe, Alexander D.M. Wilson, Petra Szekeres and Steven J. Cooke Fish Ecology and Conservation Physiology Laboratory, Department of Biology, Carleton University, Ottawa, ON, Canada K1S 5B6 *Corresponding author’s e-mail address: [email protected] Accepted 21 August 2016; published online ??? Abstract Individuals cope differently to challenging and stressful situations. Being inverted is challenging and stressful for animals, as the position leaves them vulnerable to predators and desiccation. Al- though sea star self-righting was first studied in the 19th century, efforts to quantify patterns of within-individual consistency and among-individual differences are limited. Here we examined the performance and repeatability of righting behaviour in the Caribbean sea star (Oreaster retic- ulatus). Oreaster reticulatus were wild caught and transported to a nearby facility where they were inverted up to five times. Most animals improved their righting times and exhibited within- individual consistency and among individual differences in righting method. We posit that it may be favourable to employ a consistent righting method to effectively achieve an upright position. Predation pressure and stress physiology are hypothesized to shape individual differences in right- ing behaviour. Moreover, these results provide preliminary evidence of personality in sea stars. Keywords personality, starfish, self-righting, stress physiology, invertebrate behaviour. 1. Introduction Repeatable behaviour (i.e., behaviours that can be quantified to show between-individual variation and within-individual consistency, Sinn et al., 2008; Rudin & Briffa, 2012; Briffa et al., 2013) occurs in an extensive range of animal taxa (Bell et al., 2009).
    [Show full text]