DOCSLIB.ORG

Oligonucleotide-Based Therapies for Renal Diseases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oligonucleotide-Based Therapies for Renal Diseases biomedicines Review Oligonucleotide-Based Therapies for Renal Diseases Fernando Cartón-García 1,2 , Cassondra Jeanette Saande 2 , Daniel Meraviglia-Crivelli 1, Rafael Aldabe 2,3,* and Fernando Pastor 1,3,* 1 Molecular Therapeutics Program, Center for Applied Medical Research, CIMA, University of Navarra, 31008 Pamplona, Spain; [email protected] (F.C.-G.); [email protected] (D.M.-C.) 2 Gene Therapy and Regulation of Gene Expression Program, Center for Applied Medical Research, CIMA, University of Navarra, 31008 Pamplona, Spain; [email protected] 3 Instituto de Investigación Sanitaria de Navarra (IDISNA), Recinto de Complejo Hospitalario de Navarra, 31008 Pamplona, Spain * Correspondence: [email protected] (R.A.); [email protected] (F.P.) Abstract: The global burden of chronic kidney disease (CKD) is increasing every year and represents a great cost for public healthcare systems, as the majority of these diseases are progressive. Therefore, there is an urgent need to develop new therapies. Oligonucleotide-based drugs are emerging as novel and promising alternatives to traditional drugs. Their expansion corresponds with new knowledge regarding the molecular basis underlying CKD, and they are already showing encouraging preclinical results, with two candidates being evaluated in clinical trials. However, despite recent technological advances, efficient kidney delivery remains challenging, and the presence of off-targets and side- effects precludes development and translation to the clinic. In this review, we provide an overview of the various oligotherapeutic strategies used preclinically, emphasizing the most recent findings in the field, together with the different strategies employed to achieve proper kidney delivery. The use of different nanotechnological platforms, including nanocarriers, nanoparticles, viral vectors or aptamers, and their potential for the development of more specific and effective treatments is Citation: Cartón-García, F.; Saande, also outlined. C.J.; Meraviglia-Crivelli, D.; Aldabe, R.; Pastor, F. Oligonucleotide-Based Keywords: chronic kidney disease; kidney; oligonucleotide therapeutics; kidney delivery; nanocar- Therapies for Renal Diseases. rier; nanoparticle; aptamer Biomedicines 2021, 9, 303. https:// doi.org/10.3390/biomedicines9030303 Academic Editor: Bernard Lebleu 1. Introduction Received: 18 February 2021 Recent studies have estimated that chronic kidney diseases (CKDs) affect around 850 Accepted: 12 March 2021 million people worldwide (one in ten adults). The global burden of CKD is increasing and Published: 16 March 2021 is projected to become the fifth most common cause of years of life lost globally by 2040 [1]. Since CKD is mostly irreversible and progressive, patients who advance to end-stage renal Publisher’s Note: MDPI stays neutral disease (ESRD) require dialysis or renal transplantation, which negatively affect quality of with regard to jurisdictional claims in life and have a large impact on healthcare systems. It has been estimated that the costs of published maps and institutional affil- dialysis and transplantation consume 2–4% of annual healthcare budgets in high-income iations. countries [1,2]. Moreover, kidney transplantation is associated with a high risk of morbidity and mortality, after rejection, infections, and cancer development, as a consequence of the continuous immunosuppression required [3]. Therefore, kidney disease has a major effect on global health and deserves greater attention for the development and improvement of Copyright: © 2021 by the authors. new detection methods and treatments. Licensee MDPI, Basel, Switzerland. Oligonucleotide (ON) therapeutics, such as those based on antisense oligonucleotides This article is an open access article (ASOs), small interfering RNA (siRNA), microRNA (miRNA), aptamers, and decoys, are distributed under the terms and promising agents that have gained importance during the last decades. As of January 2020, conditions of the Creative Commons ten oligonucleotide drugs have received regulatory approval from the United States Food Attribution (CC BY) license (https:// and Drug Administration (FDA) and dozens are under clinical trials [4,5]. However, a creativecommons.org/licenses/by/ major obstacle that still hampers the development of new oligonucleotide-based therapies 4.0/). Biomedicines 2021, 9, 303. https://doi.org/10.3390/biomedicines9030303 https://www.mdpi.com/journal/biomedicines Biomedicines 2021, 9, 303 2 of 24 is the difficulty in directing them to specific organs. The kidneys are highly vascular- ized organs that receive up to 25% of cardiac output, and are susceptible to targeting by most systemic administration routes. Additionally, the glomerular filtration barrier has evolved to filter molecules smaller than 50 kDa in size, which includes the majority of oligonucleotides commonly used in therapeutics, allowing their access to the tubular epithelium. However, this route mostly favors targeting of the liver and other peripheral organs, such as the spleen, due to its vascularized anatomy and scavenging functions. Indeed, at least half of the approved oligonucleotide-based drugs have been developed for liver therapy [4,5]. The unresolved problem of non-specific and off-target effects is a second major obstacle yet to be overcome by improving delivery methods. Importantly, toxicity, and side-effects of oligonucleotides have already been described, including inhibition of unspecific genes, oversaturation of the endogenous small RNA processing pathways, or non-complementary binding of the oligonucleotide to unintended RNAs with a sequence similar to the target RNA [6–10]. In this review, we will outline the different oligotherapeu- tic strategies developed to date for the treatment of renal diseases, with a specific focus on the delivery methods and nanotechnological platforms developed, and their potential to achieve efficient kidney delivery. 2. Oligonucleotides Used in Therapeutics Oligonucleotide therapies have received considerable attention in recent years, mainly because of their advantages over conventional treatments. Contrary to traditional small molecule drugs, which typically combat disease pathology by modulating the downstream pathways of a disease-causing gene, oligonucleotide-based therapies may directly modify the gene encoding intermediates at fault by targeting DNA or mRNA precursors. Therefore, ONs can also be effective against a wide variety of targets, including proteins and posttrans- lational protein modifications, carbohydrates, lipids, and metabolites, by directly targeting them with aptamers, or by modulating gene expression. Their versatility is derived from their simple structure, easy synthesis, and the possibility of a rational design. In contrast to conventional drugs that are usually limited to binding specific protein pockets or active sites, DNA and RNA targeting is mostly based on sequence recognition or the presence of unique three-dimensional conformations that allow ONs to potentially bind any target molecule [11,12]. To date, many different oligonucleotide-based therapeutic strategies have been designed, including both DNA and RNA ONs. However, the active roles that RNAs play in cell biology and metabolism, together with our increasing understanding of their role in gene expression and endogenous regulatory machinery, make RNA-based therapeutics the preferred option for their use in medicine [13]. One of the major drawbacks of using extra-cellular oligonucleotides, especially those based on RNA, is their susceptibility to degradation by nucleases and poor pharmacoki- netics. To overcome these limitations, such drugs often include chemical modifications of their backbone and nucleobases that increase stability, enzymatic resistance, and efficacy, which will be explained in further detail in the next chapter of this review. A notable advantage of targeting the kidney is that oligonucleotide therapies are rapidly cleared from the circulation via renal filtration, favoring their biodistribution in the kidney over other organs [14]. Here, we will outline the main strategies employed in the development of oligonucleotide-based therapies and the most recent advances for their use in renal diseases, which are also summarized in Table1. Biomedicines 2021, 9, 303 3 of 24 Table 1. Summary of preclinical studies targeting the kidney with oligonucleotide-based therapies. RENAL TARGETS CARRIER AND STRATEGY REFERENCE (Target; Cell/Tissue Type; SEQUENCE (50-30) ROUTE OF Animal Model) ADMINISTRATION Trp53; PTECs; Molitoris et al., 2009 cisplatin-induced and GAAGAAAAUUUCCGCAAAA Naked; IV [15] ischemic AKI models in rats Egfp and Tgfb1; glomeruli; Takabatake et al., Egfp—GGCUACGUCCAGGAGCGCA glomerulonephritis model in Naked, RA 2009 [16] Tgfb1—GUCAACUGUGGAGCAACACdTdT rats Mapk1; glomeruli; Shimizu et al., 2010 Polyion complex glomerulonephritis model in UGCUGACUCCAAAGCUCUGdTdT [17] nanocarriers; IP mice and rats Gao et al., 2014 [18] Aqp1; PTECs; mice CGCAACUUCUCAAACCACUTT Chitosan NPs; IV Smad4; tubulointerstitium and Morishita et al., tubule epithelial cells; renal GAUGAAUUGGAUUCUUUAATT Naked; IV 2014 [19] fibrosis model in mice Cox2; peritoneal macrophages Yang et al., 2015 [20] recruited to the kidney; UUO GGAUUUGACCAGUAUAAGUTT Chitosan NPs; IP model in mice siRNA Polycationic cyclodextrin NPs Zuckerman et al., Egfp; glomerular mesangium; GGCUACGUCCAGGAGCGCACC functionalized with 2015 [21] mice mannose and transferrin; IV Fas, C3 and RelB; glomeruli Fas—GUGCAAGUGCAA ACCAGAC Zheng et al., 2016 and
Load more

Recommended publications
  • RNA Pull-Down Procedure to Identify RNA Targets of a Long Non-Coding
    RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA Manon Torres, Denis Becquet, Séverine Guillen, Bénédicte Boyer, Mathias Moreno, Marie-Pierre Blanchard, Jean-Louis Franc, Anne-Marie François-Bellan To cite this version: Manon Torres, Denis Becquet, Séverine Guillen, Bénédicte Boyer, Mathias Moreno, et al.. RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA. Journal of visualized experiments : JoVE, JoVE, 2018, 10.3791/57379. hal-02093065 HAL Id: hal-02093065 https://hal-amu.archives-ouvertes.fr/hal-02093065 Submitted on 20 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License Journal of Visualized Experiments www.jove.com Video Article RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA Manon Torres1, Denis Becquet1, Séverine Guillen1, Bénédicte Boyer1, Mathias Moreno1, Marie-Pierre Blanchard2, Jean-Louis Franc1, Anne- Marie François-Bellan1 1 CNRS, CRN2M-UMR7286, Faculté
    [Show full text]
  • Advances in Oligonucleotide Drug Delivery
    REVIEWS Advances in oligonucleotide drug delivery Thomas C. Roberts 1,2 ✉ , Robert Langer 3 and Matthew J. A. Wood 1,2 ✉ Abstract | Oligonucleotides can be used to modulate gene expression via a range of processes including RNAi, target degradation by RNase H-mediated cleavage, splicing modulation, non-coding RNA inhibition, gene activation and programmed gene editing. As such, these molecules have potential therapeutic applications for myriad indications, with several oligonucleotide drugs recently gaining approval. However, despite recent technological advances, achieving efficient oligonucleotide delivery, particularly to extrahepatic tissues, remains a major translational limitation. Here, we provide an overview of oligonucleotide-based drug platforms, focusing on key approaches — including chemical modification, bioconjugation and the use of nanocarriers — which aim to address the delivery challenge. Oligonucleotides are nucleic acid polymers with the In addition to their ability to recognize specific tar- potential to treat or manage a wide range of diseases. get sequences via complementary base pairing, nucleic Although the majority of oligonucleotide therapeutics acids can also interact with proteins through the for- have focused on gene silencing, other strategies are being mation of three-dimensional secondary structures — a pursued, including splice modulation and gene activa- property that is also being exploited therapeutically. For tion, expanding the range of possible targets beyond example, nucleic acid aptamers are structured
    [Show full text]
  • Guide for Morpholino Users: Toward Therapeutics
    Open Access Journal of Drug Discovery, Development and Delivery Special Article - Antisense Drug Research and Development Guide for Morpholino Users: Toward Therapeutics Moulton JD* Gene Tools, LLC, USA Abstract *Corresponding author: Moulton JD, Gene Tools, Morpholino oligos are uncharged molecules for blocking sites on RNA. They LLC, 1001 Summerton Way, Philomath, Oregon 97370, are specific, soluble, non-toxic, stable, and effective antisense reagents suitable USA for development as therapeutics and currently in clinical trials. They are very versatile, targeting a wide range of RNA targets for outcomes such as blocking Received: January 28, 2016; Accepted: April 29, 2016; translation, modifying splicing of pre-mRNA, inhibiting miRNA maturation and Published: May 03, 2016 activity, as well as less common biological targets and diagnostic applications. Solutions have been developed for delivery into a range of cultured cells, embryos and adult animals; with development of a non-toxic and effective system for systemic delivery, Morpholinos have potential for broad therapeutic development targeting pathogens and genetic disorders. Keywords: Splicing; Duchenne muscular dystrophy; Phosphorodiamidate morpholino oligos; Internal ribosome entry site; Nonsense-mediated decay Morpholinos: Research Applications, the transcript from miRNA regulation; Therapeutic Promise • Block regulatory proteins from binding to RNA, shifting Morpholino oligos bind to complementary sequences of RNA alternative splicing; and get in the way of processes. Morpholino oligos are commonly • Block association of RNAs with cytoskeletal motor protein used to prevent a particular protein from being made in an organism complexes, preventing RNA translocation; or cell culture. Morpholinos are not the only tool used for this: a protein’s synthesis can be inhibited by altering DNA to make a null • Inhibit poly-A tailing of pre-mRNA; mutant (called a gene knockout) or by interrupting processes on RNA • Trigger frame shifts at slippery sequences; (called a gene knockdown).
    [Show full text]
  • Recent Advances in Oligonucleotide Therapeutics in Oncology
    International Journal of Molecular Sciences Review Recent Advances in Oligonucleotide Therapeutics in Oncology Haoyu Xiong 1, Rakesh N. Veedu 2,3 and Sarah D. Diermeier 1,* 1 Department of Biochemistry, University of Otago, Dunedin 9016, New Zealand; [email protected] 2 Centre for Molecular Medicine and Innovative Therapeutics, Murdoch University, Perth 6150, Australia; [email protected] 3 Perron Institute for Neurological and Translational Science, Perth 6009, Australia * Correspondence: [email protected] Abstract: Cancer is one of the leading causes of death worldwide. Conventional therapies, including surgery, radiation, and chemotherapy have achieved increased survival rates for many types of cancer over the past decades. However, cancer recurrence and/or metastasis to distant organs remain major challenges, resulting in a large, unmet clinical need. Oligonucleotide therapeutics, which include antisense oligonucleotides, small interfering RNAs, and aptamers, show promising clinical outcomes for disease indications such as Duchenne muscular dystrophy, familial amyloid neuropathies, and macular degeneration. While no approved oligonucleotide drug currently exists for any type of cancer, results obtained in preclinical studies and clinical trials are encouraging. Here, we provide an overview of recent developments in the field of oligonucleotide therapeutics in oncology, review current clinical trials, and discuss associated challenges. Keywords: antisense oligonucleotides; siRNA; aptamers; DNAzymes; cancers Citation: Xiong, H.; Veedu, R.N.; 1. Introduction Diermeier, S.D. Recent Advances in Oligonucleotide Therapeutics in According to the Global Cancer Statistics 2018, there were more than 18 million new Oncology. Int. J. Mol. Sci. 2021, 22, cancer cases and 9.6 million deaths caused by cancer in 2018 [1].
    [Show full text]
  • Locked Nucleic Acid: Modality, Diversity, and Drug Discovery
    Downloaded from orbit.dtu.dk on: Sep 23, 2021 Locked nucleic acid: modality, diversity, and drug discovery Hagedorn, Peter H.; Persson, Robert; Funder, Erik D.; Albæk, Nanna; Diemer, Sanna L.; Hansen, Dennis J.; Møller, Marianne R; Papargyri, Natalia; Christiansen, Helle; Hansen, Bo R. Total number of authors: 13 Published in: Drug Discovery Today Link to article, DOI: 10.1016/j.drudis.2017.09.018 Publication date: 2018 Document Version Publisher's PDF, also known as Version of record Link back to DTU Orbit Citation (APA): Hagedorn, P. H., Persson, R., Funder, E. D., Albæk, N., Diemer, S. L., Hansen, D. J., Møller, M. R., Papargyri, N., Christiansen, H., Hansen, B. R., Hansen, H. F., Jensen, M. A., & Koch, T. (2018). Locked nucleic acid: modality, diversity, and drug discovery. Drug Discovery Today, 23(1), 101-114. https://doi.org/10.1016/j.drudis.2017.09.018 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Users may download and print one copy of any publication from the public portal for the purpose of private study or research. You may not further distribute the material or use it for any profit-making activity or commercial gain You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • Ribozyme-Catalyzed Primer Extension by Trinucleotides: a Model for the RNA-Catalyzed Replication of RNA+ Jennifer A
    Biochemistry 1993, 32, 21 11-21 15 2111 Ribozyme-Catalyzed Primer Extension by Trinucleotides: A Model for the RNA-Catalyzed Replication of RNA+ Jennifer A. Doudna,t Nassim Usman,$ and Jack W. Szostak’ Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 021 I4 Received October 2. 1992; Revised Manuscript Received November 25, I992 ABSTRACT: The existence of RNA enzymes that catalyze phosphodiester transfer reactions suggests that RNA-catalyzed RNA replication might be possible. Indeed, it has been shown that the Tetrahymena and sunY self-splicing introns will catalyze the template-directed ligation of RNA oligonucleotides (Doudna et al., 1989, 1991). We have sought to develop a more general RNA replication system in which arbitrary template sequences could be copied by the assembly of a limited set of short oligonucleotides. Here we examine the use of tetranucleotides as substrates for a primer-extension rea ion in which the 5’-nucleoside of the tetranucleotide is the leaving group, and the primer is extended by the remaining three nucleotides. When the 5’-nucleoside is guanosine, the reaction is quite efficient, but a number of competing side reactions occur, in which inappropriate guanosine residues in the primer or the template occupy the guanosine binding site of the ribozyme. We have blocked these side reactions by using the guanosine analogue 2-aminopurine riboside (2AP) as the leaving group, in a reaction catalyzed by a mutant sunYribozyme that binds efficiently to 2AP and not to guanosine. We have begun to address the issue of the fidelity of the primer-extension reaction by measuring reaction rates with a number of different triplet/template combinations.
    [Show full text]
  • Exponential Growth by Cross-Catalytic Cleavage of Deoxyribozymogens
    Exponential growth by cross-catalytic cleavage of deoxyribozymogens Matthew Levy and Andrew D. Ellington* Department of Chemistry and Biochemistry, Institute for Cell and Molecular Biology, University of Texas, Austin, TX 78712 Edited by Gerald F. Joyce, The Scripps Research Institute, La Jolla, CA, and approved April 10, 2003 (received for review January 9, 2003) We have designed an autocatalytic cycle based on the highly efficient 10–23 RNA-cleaving deoxyribozyme that is capable of exponential amplification of catalysis. In this system, complemen- tary 10–23 variants were inactivated by circularization, creating deoxyribozymogens. Upon linearization, the enzymes can act on their complements, creating a cascade in which linearized species accumulate exponentially. Seeding the system with a pool of linear catalysts resulted not only in amplification of function but in sequence selection and represents an in vitro selection experiment conducted in the absence of any protein enzymes. emonstrating molecular self-amplification is essential for Dunderstanding origins and can potentially foment biotech- nology applications, especially in diagnostics. In modern biology, molecular replication is dominated by cycles in which nucleic acids encode and are replicated by protein enzymes. However, the discovery and subsequent engineering of nucleic acid cata- lysts raises the possibility that nucleic acid-based, autocatalytic cycles might be designed. In this regard, von Kiedrowski (1) and Zielinski and Orgel (2) showed that oligonucleotide palindromes can serve as templates for the ligation of shorter oligonucleotide substrates, and thus for their own reproduction. Variations on this theme have led to proof that short oligonucleotide templates are capable of semi- Fig. 1. Design of linear and circular 10–23 deoxyribozymes.
    [Show full text]
  • Catalytic DNA: Scope, Applications, and Biochemistry of Deoxyribozymes
    Review Catalytic DNA: Scope, Applications, and Biochemistry of Deoxyribozymes 1, ,@ Scott K. Silverman * The discovery of natural RNA enzymes (ribozymes) prompted the pursuit of Trends artificial DNA enzymes (deoxyribozymes) by in vitro selection methods. A key As a synthetic catalyst identified by in motivation is the conceptual and practical advantages of DNA relative to pro- vitro selection, single-stranded DNA has many advantages over proteins teins and RNA. Early studies focused on RNA-cleaving deoxyribozymes, and and RNA. The growing reaction scope more recent experiments have expanded the breadth of catalytic DNA to many of deoxyribozymes is increasing our fi other reactions. Including modi ed nucleotides has the potential to widen the fundamental understanding of biocata- lysis, enabling applications in chemistry scope of DNA enzymes even further. Practical applications of deoxyribozymes and biology. include their use as sensors for metal ions and small molecules. Structural fi studies of deoxyribozymes are only now beginning; mechanistic experiments Including modi ed DNA nucleotides enhances the catalytic ability of will surely follow. Following the first report 21 years ago, the field of deoxy- deoxyribozymes. Several approaches ribozymes has promise for both fundamental and applied advances in chemis- for this purpose are being evaluated. try, biology, and other disciplines. Investigators are pursuing practical applications for deoxyribozymes, such Nucleic Acids as Catalysts as in vivo mRNA cleavage and sensing Nature has evolved a wide range of protein enzymes for biological catalysis. The notion that of metal ions and small molecules. biomolecules other than proteins can be catalysts was largely disregarded until the early 1980s, when the enzymatic abilities of natural RNA catalysts (ribozymes; see Glossary) were discov- High-resolution structural analysis of deoxyribozymes is a new field; the first ered [1,2].
    [Show full text]
  • Multifunctional Delivery Systems for Peptide Nucleic Acids
    pharmaceuticals Review Multifunctional Delivery Systems for Peptide Nucleic Acids Stefano Volpi , Umberto Cancelli, Martina Neri and Roberto Corradini * Department of Chemistry, Life Sciences and Environmental Sustainability, University of Parma, 43124 Parma, Italy; [email protected] (S.V.); [email protected] (U.C.); [email protected] (M.N.) * Correspondence: [email protected]; Tel.: +39-0521-905410 Abstract: The number of applications of peptide nucleic acids (PNAs)—oligonucleotide analogs with a polyamide backbone—is continuously increasing in both in vitro and cellular systems and, parallel to this, delivery systems able to bring PNAs to their targets have been developed. This review is intended to give to the readers an overview on the available carriers for these oligonucleotide mimics, with a particular emphasis on newly developed multi-component- and multifunctional vehicles which boosted PNA research in recent years. The following approaches will be discussed: (a) conjugation with carrier molecules and peptides; (b) liposome formulations; (c) polymer nanopar- ticles; (d) inorganic porous nanoparticles; (e) carbon based nanocarriers; and (f) self-assembled and supramolecular systems. New therapeutic strategies enabled by the combination of PNA and proper delivery systems are discussed. Keywords: peptide nucleic acids; delivery; nanoparticles; conjugates; multifunctional systems 1. Introduction 1.1. Peptide Nucleic Acids and Their Uses Peptide nucleic acids (PNAs, Figure1) are DNA analogues in which the sugar- Citation: Volpi, S.; Cancelli, U.; phosphate units connecting the nucleobases are replaced by N-(2-aminoethyl)glycine Neri, M.; Corradini, R. moieties [1]. These molecules are excellent binding partners for cognate DNA and RNA Multifunctional Delivery Systems for strands, being able to exploit both the canonical Watson–Crick (WC) base pairing to form Peptide Nucleic Acids.
    [Show full text]
  • Designing Chemically Modified Oligonucleotides for Targeted Gene
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Chemistry & Biology Review Designing Chemically Modified Oligonucleotides for Targeted Gene Silencing Glen F. Deleavey1,* and Masad J. Damha1,* 1Department of Chemistry, McGill University, 801 Sherbrooke Street West, Montre´ al, QC H3A 0B8, Canada *Correspondence: [email protected] (G.F.D.), [email protected] (M.J.D.) http://dx.doi.org/10.1016/j.chembiol.2012.07.011 Oligonucleotides (ONs), and their chemically modified mimics, are now routinely used in the laboratory as a means to control the expression of fundamentally interesting or therapeutically relevant genes. ONs are also under active investigation in the clinic, with many expressing cautious optimism that at least some ON-based therapies will succeed in the coming years. In this review, we will discuss several classes of ONs used for controlling gene expression, with an emphasis on antisense ONs (AONs), small interfering RNAs (siRNAs), and microRNA-targeting ONs (anti-miRNAs). This review provides a current and detailed account of ON chemical modification strategies for the optimization of biological activity and therapeutic application, while clarifying the biological pathways, chemical properties, benefits, and limitations of oligo- nucleotide analogs used in nucleic acids research. The concept of using synthetic oligonucleotides (ONs) to control stability, (2) low efficiency of intracellular delivery to targets cells the expression of specific genes dates back to the late 1970s, or tissues, and (3) the potential for ‘‘off-target’’ gene silenc- when Zamecnik and Stephenson first demonstrated targeted ing, immunostimulation, and other side effects. Fortunately, in gene silencing using a short synthetic oligonucleotide (Zamecnik attempts to overcome the therapeutically limiting features of and Stephenson, 1978; Stephenson and Zamecnik, 1978).
    [Show full text]
  • The Evolution of Antisense Oligonucleotide Chemistry—A Personal Journey
    biomedicines Review The Evolution of Antisense Oligonucleotide Chemistry—A Personal Journey Sudhir Agrawal 1,2 1 ARNAY Sciences LLC, Shrewsbury, MA 01545, USA; [email protected] or [email protected] 2 Department of Medicine, University of Massachusetts Medical School, 55 N Lake Ave, Worcester, MA 01655, USA Abstract: Over the last four decades, tremendous progress has been made in use of synthetic oligonu- cleotides as therapeutics. This has been possible largely by introducing chemical modifications to provide drug like properties to oligonucleotides. In this article I have summarized twists and turns on use of chemical modifications and their road to success and highlight areas of future directions. Keywords: oligonucleotide; therapeutic; antisense; medicinal chemistry; structure activity relationship 1. Introduction Today RNA therapeutics are a clinical reality with approved drugs that employ a variety of different mechanisms of action (reviewed recently in [1]). However, here I would like to take you back to the beginnings of antisense and show you how the evolution of antisense chemistry played an essential role in turning oligonucleotides into therapeutics. I Citation: Agrawal, S. The Evolution would like to dedicate this chapter to Paul Zamecnik (1912–2009), my mentor, friend, and of Antisense Oligonucleotide colleague who introduced me to the field of antisense therapeutics and who first dreamed Chemistry—A Personal Journey. of using antisense oligonucleotides as therapeutics [2]. To achieve his dream, we had to Biomedicines 2021, 9, 503. improve antisense oligonucleotide chemistry, understand how the chemistry, structure, and https://doi.org/10.3390/ sequence influences antisense oligonucleotide function, and how the immune system deals biomedicines9050503 with exogenous nucleic acids.
    [Show full text]
  • Oligonucleotide Clamps Arrest DNA Synthesis on a Single-Stranded DNA Target (Triplex/Psoralen/Replication) CARINE GIOVANNANGELI*, NGUYEN T
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 10013-10017, November 1993 Biochemistry Oligonucleotide clamps arrest DNA synthesis on a single-stranded DNA target (triplex/psoralen/replication) CARINE GIOVANNANGELI*, NGUYEN T. THUONGt, AND CLAUDE HtLtNE* *Laboratoire de Biophysique, Institut National de la Sante et de la Recherche Mddicale Unite 201, Centre National de la Recherche Scientifique Unit6 Associde 481, Museum National d'Histoire Naturelle, 43, Rue Cuvier, 75231 Paris Cedex 05, France; and tCentre de Biophysique Moldculaire, 45071 Orleans Cedex 02, France Communicated by I. Tinoco, June 1, 1993 ABSTRACT Triple helices can be formed on single- bound to a polypurine sequence (5, 6). Here we show that stranded oligopurine target sequences by composite oligonu- different linkers can be used to tether the Watson-Crick and cleotides consisting oftwo oligonucleotides covalently linked by Hoogsteen base-pair-forming portions of the OLO without either a hexaethylene glycol linker or an oligonucleotide se- loss of stability of the resultant triple helix. A psoralen quence. The first oligomer forms Watson-Crick base pairs with derivative attached to the 5' end of the OLO may be the target, while the second oligomer engages in Hoogsteen base crosslinked to its target sequence in such a way that the three pairing, thereby acting as a molecular clamp. The triple-helical strands of the resultant triplex become covalently linked to complex formed by such an oligonucleotide clamp, or "oligo- one another. These complexes act as strong stop signals, nucleotide4oop-oligonucleotide" (OLO), is more stable than blocking chain elongation during replication. This inhibition either the corresponding trimolecular triple helix or the double is much more efficient than that obtained with an antisense helix formed upon binding of the oligopyrimidine complement oligonucleotide carrying a reactive psoralen group.
    [Show full text]