Acute Amygdalar Activation Induces an Upregulation of Multiple

Molecular Psychiatry (2004) 9, 932–945 & 2004 Nature Publishing Group All rights reserved 1359-4184/04 $30.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Acute amygdalar activation induces an upregulation of multiple monoamine G protein coupled pathways in rat hippocampus FM Benes1,2, RE Burke1, J Walsh1, S Berretta1, D Matzilevich1, M Minns1 and C Konradi1,2 1Program in Structural and Molecular Neuroscience, McLean Hospital, Belmont, MA, USA; 2Program in Neuroscience and Department of Psychiatry, Harvard Medical School, Boston, MA, USA

A ‘partial’ rodent model for schizophrenia has been used to characterize the regulation of hippocampal genes in response to amygdalar activation. At 96 h after the administration of picrotoxin into the basolateral nucleus, we have observed an increase in the expression of genes associated with 18 different monoamine (ie adrenergic alpha 1, alpha 2 and beta 2, serotonergic 5HT5b and 5HT6, dopamine D4 and muscarinic m1, m2 and m3) and peptide (CCK A and B, angiotensin 1A, mu and kappa opiate, FSH, TSH, LH, GNRH, and neuropeptide Y) G- protein coupled receptors (GPCRs). These latter receptors are associated with three different G protein signaling pathways (Gq, Gs, and Gi) in which significant changes in gene expression were also noted for adenylate cyclase (AC4), phosphodiesterase (PDE4D), protein kinase A (PKA), and protein kinase C (PKC). Quantitative RT-PCR was used to validate the results and demonstrated that there were predictable increases of three GPCRs selected for this analysis, including the dopamine D4, alpha 1b, and CCK-B receptors. Eight out of the nine monoamine receptors showing these changes have moderate to high affinity for the atypical antipsychotic, clozapine. Taken together, these results suggest that amygdalar activation may play a role in the pathophysiology and treatment of psychosis by regulating the activity of multiple GPCR and metabolic pathways in hippocampal cells. Molecular Psychiatry (2004) 9, 932–945. doi:10.1038/sj.mp.4001524 Published online 1 June 2004 Keywords: picrotoxin; intracellular signaling; metabolism; apoptosis; limbic lobe

The amygdala plays a central role in emotional excitatory activity from the amygdala may play a role responses and the encoding of context-dependent in the induction of GABAergic abnormalities in the explicit memory by the hippocampus.1 There is hippocampus. To explore this possibility further, we growing interest in the possibility that the amygdala have developed a ‘partial’ rodent model in which a and hippocampus may contribute to the pathophy- low, nonepileptogenic dose of picrotoxin, a noncom- 2,3 siology of psychotic disorders. Postmortem studies petitive antagonist of the GABAA receptor, is infused in which a variety of approaches have been employed into the basolateral nucleus to diminish GABAergic have presented evidence for a defect of GABAergic activity and increase the flow of excitatory activity to function in schizophrenia4–7 and, more recently, the hippocampal formation. Using this paradigm, it bipolar disorder.3,8,9 Using quantitative microscopic has been possible to induce changes in GABA cells approaches, diminished GABA cell function has been that are remarkably similar to those reported in repeatedly observed in sectors CA3 and CA2 of postmortem microscopic analyses of the hippocam- hippocampus of subjects with schizophrenia and pus in postmortem studies of schizophrenia and bipolar disorder (for a review see Benes3). Interest- bipolar disorder.13,14 ingly, anterograde tracing studies have demonstrated Neuropsychiatric disorders pose a unique chal- that both of these sectors receive abundant projec- lenge to the field of neuroscience when the regulation tions from the basolateral nucleus of the amygdala10,11 of genes associated with complex neural circuitry, where a decrease of GABAergic function is also like that found in the limbic lobe, are the targets for believed to coincide.12 Based on these observations, investigation. The ‘partial’ rodent model described it has been postulated that an increased outflow of above has significantly contributed to our under- standing of how the activation of amygdalar projec- tions may alter the regulation of hippocampal Correspondence: FM Benes, MD, PhD, Program in Structural and neurons. Since a discrete experimental manipulation Molecular Neuroscience, McLean Hospital, 115 Mill Street, of this type is only capable of inducing relatively Belmont, MA 02478, USA. subtle changes in the expression of genes within E-mail: [email protected] Received 05 February 2004; revised 31 March 2004; accepted 31 particular subregions, sublaminae and/or cellular March 2004 subtypes of the hippocampus, novel approaches to Amygdalo-hipp microarray study FM Benes et al 933 the analysis of such data are greatly needed to changes in the amount of protein associated with improve the sensitivity of gene expression profiling. various markers for the GABA system. Although the microarray approach has the strength of After medicating the surgical wound, the rats were providing information about thousands of genes, placed in their home cages and killed 96 h later. The relatively small changes in response to functional brains were promptly removed, the hippocampal alterations of a complex circuit often fall below the formation ipsilateral to the injected amygdalae were level of detection when conventional statistical dissected whole, frozen on dry ice and stored at approaches are employed. To overcome this pitfall, À701C in microcentrifuge tubes until RNA extraction. we have developed a novel post hoc statistical During the survival period, the animals were periodi- approach to analyze gene expression profiling data cally monitored for behavioral effects and/or seizure within the context of the specific biopathways and/or activity. None were detected and no difference was clusters available through GenMapp (www.genmap- noticed between vehicle- and picrotoxin-treated rats. p.org). In the study described below, we have applied All procedures were approved by an IACUC Commit- this approach to the analysis of gene expression tee at McLean Hospital (Protocol Number 00-11/2-14) profiling in the hippocampus of rats receiving and were in compliance with principles expressed in picrotoxin infusion in the basolateral amygdala. To the National Institute of Health, United States Public our knowledge, this is the first instance in which a Health Service Guide for the Care and Use of microarray approach has been used to study changes Laboratory Animals. in the genetic regulation of specific signaling pathways that occur in response to an experimental Preparation of RNA extracts manipulation of a complex circuit like the amygda- Total RNA extracts were obtained using the Totally lohippocampal pathway. RNA Kit from Ambion, Inc. (Austin, TX, USA). Whole frozen hippocampi from each animal were homo- Methods genized (PowerGen 125, Fisher Scientific) in dena- turation/lysis solution containing guanidinium Surgical and experimental procedures thiocyanate and cationic detergents. The RNA was In total, 20 adult (300 g) Sprague–Dawley male rats, then recovered from each lysate in a two-step organic were anesthetized (100 mg/kg ketamine; 40 mg/kg extraction. First, the lysate was mixed with an equal xylazine) and placed in a stereotaxic device (Stoelt- volume of phenol : chloroform : isoamyl alcohol, vor- ing, Wood Dale, IL, USA). A burrhole was drilled into texed, chilled, and centrifuged at 12 000 g. The the skull and a Hamilton syringe (1.0 ml) was used to resulting aqueous layer was transferred to a new tube, infuse picrotoxin (n ¼ 10; 50 ng/0.8 ml; RBI, Natick, 1/10th the volume of sodium acetate was added and MA, USA) or vehicle (n ¼ 10; 0.8 ml saline) in the BLn the solution mixed vigorously. An equal volume of (A 5.3, L 5.0, H 1.6, interaural15). A slow rate (0.8 ml acid-phenol : chloroform was then added and the over 50 min, continuous infusion) was used for both solution was vortexed, chilled, and centrifuged at picrotoxin and vehicle. As previously described,16,17 12 000 g. The resulting second aqueous phase was the use of local infusion of a GABAA antagonist into then drawn off and an equal volume of isopropanol the amygdala to alter amygdalar activity elicits an was added. This preparation was stored at À201C for increase of discharge activity in local neurons with- 1 h followed by centrifugation at 12 000 g for 20 min at out activation of fibers en passant.18 A strength of this 41C. The supernatant was aspirated off and the RNA activation paradigm is that it relies on endogenous pellets were resuspended in RNase-free dH2O/0.1 mM excitatory activity induced by blockade of an intrinsic EDTA. To ensure the highest quality total RNA inhibitory mechanism. Although diffusion of picro- preparation, the extracts were processed further with toxin to other regions surrounding the deep nuclei of a clean-up step involving passage over a Qiagen the amygdala could have potentially influenced the RNeasy mini column (Qiagen, Valencia, CA, USA), results reported below, previous studies have sug- followed by series of ethanol/proprietary buffer gested that picrotoxin does not show widespread washes. Enriched RNA was then eluted from the 16 diffusion beyond a local infusion site. columns in RNase-free dH2O and stored at À701C. In a preliminary series of experiments, acute The quality of the RNA was assessed using an Agilent picrotoxin administration was followed by killing at Bioanalyzer 2100 (Agilent Technologies, Palo Alto, 2,13 24, and 96 h14 after drug administration in the CA, USA) to obtain 28S/18S ribosomal RNA ratios for basolateral nucleus. These timepoints were asso- each extract. Total RNA yield was determined from ciated with decreases, no change, and increases of optical density readings at 260 nm with a SpectraMax GAD65 and GAD67 expression at 2, 24, and 96 h, Plus spectrophotometer (Molecular Devices, Sunny- respectively. In designing the current experiment, the vale, CA, USA). 2 h time point would have been too early for the detection of significant changes in the expression of Gene expression profiling genes other than immediate-early genes (IEGs). On the Biotinylated target RNA was prepared from the total other hand, at 24 h, early acute changes may have RNA extracts of each animal according to the returned to baseline, whereas at 96 h the preliminary recommended Affymetrix Protocols (flowchart at immunocytochemical studies demonstrated extensive http://www.affymetrix.com/support/technical/data-

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 934 sheets/t7_datasheet.pdf). A measure of 8 mg total RNA Score, R (R ¼ PMÀMM/PM þ MM) was determined for was used for cDNA synthesis with a SuperScript II each probe pair and ‘present’ and ‘absent’ calls were double-stranded cDNA synthesis kit (Invitrogen, assigned to each probe set based on previously Carlsbad, CA, USA). The SuperScript II kit employs established Detection P-values, alpha 1 (eg P ¼ 0.04) a standard two-step reverse transcription reaction and alpha 2 (eg P ¼ 0.06), respectively. As shown in to generate cDNA complimentary to target mRNA. Table 1, the number of ‘present’ calls varied between In vitro transcription of biotinylated RNA (bRNA) was 36.8 and 45.6%, while the average 30–50 ratio was performed with an Enzo-IVT kit (Affymetrix, Santa approximately 1.3. In addition, the expression values Clara, CA, USA), which utilizes T7 RNA polymerase for the ‘housekeeping’ genes, glyceraldehyde-3-phos- to produce a linear amplification of target cDNA phate dehydrogenase (G3PDH) and b-actin, were generated during the previous reverse transcription separately evaluated in both the saline- and picro- step. Target bRNA from each animal was then treated groups. The mean7the standard error were fragmented and individually hybridized to the RG- found to be virtually identical for the two genes in U34A array (Affymetrix) overnight in a ‘rotisserie both groups, providing support for the assumption oven’ at 451C. The microarrays were then stained on that the linear amplification of mRNA was consistent the Affymetrics fluidics station with two rounds of across experimental and control tissue extracts. streptavidin–phycoerythrin (Molecular Probes, Eu- Furthermore, in QRT-PCR experiments, the endogen- gene, OR, USA) and one round of biotinylated anti- ous control G3PDH was not significantly changed streptavidin antibody (Vector Labs, Burlingame, CA, between the two groups, indicating uniform amplifi- USA). The microarrays were then scanned twice and cation of target mRNA in that portion of our study as visually inspected for evidence of artifacts, including well (see below). ‘edge’ effects, bright spots, or blemishes, that might have led to aberrant readings for genes located on Data analyses those portions of the chips. The Affymetrix Micro- Array Suite 5.0 Software (Affymetrix) was used to General considerations To analyze the microarray control the scanner, average the two images, define data, the Affymetrix Data Mining Tool Version 3.0. the probe cells and compute an intensity value for (DMT 3.0) and the DNA Chip Analyzer (dChip) each cell. The data for each probe set (ie consisting of software package20 were both used to evaluate the Perfect Match (PM) and Mismatch (MM) probe cells quality of the chip data by assessing the expression for a given gene) were evaluated. Based on match- indices for each probe array. The dChip program mismatch values for each probe pair, a Discrimination provided a statistical method for reducing errors due

Table 1 Quality control parameters

Chip Treatment Noise Background % P Call 30/50 Ratio

1 Saline 1.4 42.7 45.6 1.04 2 Picrotoxin 2.3 52.4 45.0 0.98 3 Picrotoxin 1.4 41.9 42.2 1.88 4 Saline 1.4 43.8 44.4 1.45 5 Picrotoxin 2.4 53.1 36.8 2.63 6 Saline 1.4 45.2 41.9 1.37 7 Picrotoxin 2.3 60.4 41.8 1.20 8 Saline 1.8 60.3 44.2 1.21 9 Picrotoxin 2.5 63.9 47.2 1.22 10 Picrotoxin 2.5 70.5 40.4 1.03 11 Picrotoxin 2.4 66.2 41.8 1.12 12 Saline 3.3 76.1 41.5 1.11 13 Saline 5.2 115.0 41.8 1.16 14 Saline 6.7 145.0 41.6 1.15 15 Picrotoxin 7.4 182.0 39.4 1.08 16 Saline 6.4 146.0 43.0 1.22 17 Saline 3.2 86.6 41.1 1.15 18 Picrotoxin 5.3 118.0 41.4 1.38 19 Picrotoxin 2.4 64.0 43.8 1.14 20 Saline 2.6 80.5 40.4 1.46

Average 3.2 80.7 42.3 1.30

The data shown were obtained from Affymetrix RU-34A rat genome chips that were run for each of 10 saline- and 10 picrotoxin-treated rats. The RNA extracts for each of the rats were hybridized and analyzed randomly to avoid a sequencing bias. The noise, background, % P (Present) Calls and 30/50 ratios are listed for each of the 20 microarrays that were run. The average value for each variable is shown at the bottom of the respective lists.

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 935 to nonspecific cross-hybridizing probes and image together in one region of the chip and, if so, whether contamination20 and generally yielded more robust an artifact induced during processing could cause findings when the Perfect Match Model (PM) was several clustered genes to show changes in expression used. that are dependent upon chip position. This hypothe- tical situation would be unlikely to occur, however, Biopathway/cluster analyses: In order to identify since the Perfect Match/Mismatch (PM/MM) ratio biologically relevant clusters of inter-related genes, generated by the Affymetrix system must show a GenMapp algorithms (www.genmapp.org) were used detectable signal (PM) over background (MM) in order to relate the dChip findings to several different for significant changes in expression to be detected. If biochemical pathways and/or biologically related a chip artifact were to influence the hybridization of clusters of genes. The general strategy for the RNA to the probes or perhaps the fluorescent analyses involved the establishment of both low and emissions emanating from the probes, it would be high stringency levels for inclusion of individual difficult to observe significant changes in expression genes in the GenMapp analyses (see below). because the PM/MM ratio would tend to not show a Generally, the fold changes were predictably small detectable signal over background for the genes in the (rangeD1.05–1.32), whereas the P-values were cluster. In practice, when small disruptions in the generally larger than 0.05. The first stage of the expression profiles on a single region of the chip are analysis involved selecting genes according to high observed, this portion of the chip is demarcated and and low stringency criteria for inclusion in the excluded from the analysis, that is, if all other quality GenMapp biopathways analysis. The high control parameters are acceptable for that chip. In our stringency criterion was set at P ¼ 0.05. For the low experience, when such chip defects do occur, they stringency criterion, the inclusionary P-value was have not shown any apparent clustering of genes increased progressively to 0.1 and 0.25, respectively. according to biopathways or function. Finally, visual When P ¼ 0.1, the numbers of genes included in the inspection of microarrays for the location of single GenMapp pathway analysis showed a discernible genes represented within a particular GenMapp increase which occurred almost exclusively in those pathway has demonstrated a broad degree of scatter, pathways previously showing substantial activations even when only the genes showing changes in when the p was set at 0.05. When the inclusionary expression are individually inspected. Based on these criterion was increased to P ¼ 0.25, further increases various considerations, we have concluded that the in the number of genes showing altered expression in arrangement of the probe sets for the genes on the the GenMapp pathways were observed. However, in Affymetrix RG-U34A microarrays are sufficiently contrast to the situation that was observed with independent of one another to justify the post hoc P ¼ 0.05 or P ¼ 0.1, some of the GenMapp pathways analysis based on probability theory. that previously had not shown any activation now In using the post hoc approach, a composite showed a random scatter of a small number of genes probability, Pc, for each of the respective pathways when the P-value was set at 0.25. This latter was computed by multiplying the individual P-values observation suggested that further increases of the P- for each gene meeting high or low stringency criteria value would likely increase the background and (ie P1, P2yPi). This number was divided by the ratio compromise the signal-to-noise ratio of the post hoc of the number of genes meeting high or low stringency analysis. criteria (ni) and the number of genes potentially In order to assess the statistical significance of showing significant changes (nt) in each pathway. changes in gene expression in specific GenMapp The total number of GenMapp pathways examined biopathways/clusters, an ad hoc statistic was devel- (Np) was also used to correct for multiple compar- oped based on a combination of probability theory isons. The following equation expresses these rela- and two separate corrections for multiple compar- tionships, isons. A requirement for such an analysis is that P ¼½ðP ÂP ÂP ...P Þ=ðn =n ÞN changes in the hybridization of any particular gene to c 1 2 3 i i t p its probe sets must occur independently of probe sets This equation provided two separate corrections for for other genes. If the probe sets for all of the genes in multiple comparisons by multiplying by both Np and one particular biopathways were all clustered within nt. The a-level of significance for each GenMapp a discrete sector of a microarray, then the hybridiza- biopathway or cluster was established by examining tion of the respective mRNAs to their appropriate the distribution of genes that met criteria for inclusion probe sets could not be assumed to be independent of in the analysis and the final P ¼ value obtained with one another and probability theory could not be used the equation described above. Most GenMapp path- for the analysis. The Affymetrix RG-U34A micro- ways showed one or no genes meeting the stringency arrays employed in this study were tiled with criteria and the P-values tended to be greater than nondispersed probe sets, such that all 16–20 probe 5 Â 10À4. A minority, however, showed two or more pairs representing a particular gene sequence were genes meeting the stringency criteria for inclusion positioned together. We considered whether the probe and the resulting P-value tended to be less than sets for several different genes associated with one 5 Â 10À4. By visually comparing the pathways accord- particular biopathway might be similarly clustered ing to the number of genes showing changes in

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 936 regulation and the resulting post hoc P-values, it was forward and reverse) and the dual-labeled apparent that those with a post hoc P ¼ 5 Â 10À4 hybridization probes is shown in Table 2. The PCR appeared to show a significant amount of change amplifications were performed on a Smartcycler and this number was chosen as the a-level for these (Cepheid, Sunnyvale, CA, USA)) using Platinum post hoc analyses. Quantitative PCR Supermix-UDG (Invitrogen) with 300 nM primers and 150 nM fluorogenic probe. For the signal detection, the Smartcycler was FRET-based quantitative RT-PCR In order to programmed to an initial step of 2 min at 501C and quantitate the amount of RNA associated with 2 min at 951C, followed by 45 thermal cycles of 15 s at

various target genes, a fluorescence resonance 951C and 1 min at 601C. The threshold cycle Ct, which emission energy transfer (FRET) approach to RT-PCR correlates inversely with the target mRNA levels, was was employed. Total RNA used for QRT-PCR was measured as the cycle number at which the reporter obtained from RNA used in the microarray analysis fluorescent emission increased significantly above a (see above) for both saline controls (n ¼ 7) and 96 h pre-set threshold level. Relative standard curve picrotoxin-treated animals (n ¼ 7). First-strand cDNA methods were used to determine the transcript was synthesized from 1 mg of total RNA using levels for all genes. Standard curves for all gene Superscript II reverse transcriptase and oligo-dT targets and constitutively expressed ‘house-keeping primers (Invitrogen). The 20 ml reaction volume was gene’ GAPDH were constructed using serial dilutions diluted five-fold for use in the PCR. Based on the of cDNA amplicons amplified from control templates. expression profiles obtained in the microarray Differences in the total amount of RNA present in analysis, five genes were selected for QRT-PCR: each target sample were normalized with respect to glutamic acid decarboxylase (GAD65) (M72422), the reference gene using a relative expression GAD67 (M76177), cholecystokinin receptor B (CCKB- software tool (REST) for group-wise comparison of R) (X79208), Dopamine receptor D4 (RATD4) the resulting expression ratios.21 (M84009) and a-1B adrenergic receptor (Alpha1B) (M60655). Primer pairs and dual-labeled hybridization probes were designed using web-based Results applications Primer3 (www.genome.wi.mit.edu) and the Oligo Toolkit (Integrated DNA Technologies). The When the gene expression profiling data were sequence information for each of the primer pairs (ie analyzed in relation to several different GenMapp

Table 2 Sequence of primer sets and dual-labeled hybridization probes

Gene (accession Sequence of primer (forward and reverse) and hybridization probe (50–30) Amplicon size number) (bp)

GAD65 (M72422) TGTCTGCTTCTGGTTTGTACCTCC 207 GTCAATGTCTTGGTGAGTTGCTGC TET/AAAGGTGGCGCCAGTGATTAAAGCCA/6-TAMTph

GAD67 (M76177) GCTTCTTGCAAAGGACCAATAGCC 219 TCAACCACCTCCAGTAAGAACTGC TET/ACGGACTTCTCCAACCTGTTTGCTCA/6-TAMTph CCK-R (X79208) GACTGGAGATGACAACGCTAACCA 255 GACGTAGCTCAGCAAGTGGATGAA TET/TTTCTTCCTGTGTTGGCTGCCAGTGT/6-TAMTph Dopamine D4 (M84009) GACACCCACCAACTACTTCATCGT 142 CAGTAAAGCAGTAGCATGAGCGGA TET/TCCATCTTCAACCTGTGCGCCATCA/6-TAMTph Adrenergic a-1b AGTTTCACAGTACTGCCCTTCTCC 428 receptor (M60655) TCAATGGAGATGGCACATAGGCTC TET/TGGCTACTGGGTGCTGTTGAGTTTCT/6-TAMTph GAPDH (M17701) CCAGTATGATTCTACCCACGGCAA 268 GGTTCACACCCATCACAAACATGG TexRed/AAGGCTGAGAATGGGAAGCTGGTCAT/BHQ-2

The sequences shown represent primer pairs and dual-labeled hybridization probes that were designed using web-based applications (www.genome.wi.mit.edu) and the Oligo Toolkit from Integrated DNA Technologies. The numbers in parentheses are the Genbank accession numbers for each gene. The number of base pairs associated with each primer is shown in the right column. For the target genes, tetrachlorofluorescein (TET) was used as the reporter and 6-TAMT as the ‘quencher.’ For the ‘housekeeping’ gene GAPDH, Texas Red was used as the ‘recorder’ and Black Hole Quencher (BHQ-2) were used because they have spectral properties that are different from those for TET and 6-TAMT and this made it possible to run a duplex assay in which both a target and reference gene were analyzed in the same tube.

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 937 Table 3 Significant GenMapp pathway genes

Pathway Significant genes Fold change P value Direction

Monoamine GPCRs Dopamine D4 1.07 0.24 Up 5-HT- 5B 1.10 0.16 Up 5-HT-6 1.06 0.20 Up Adrenergic alpha 1b 1.09 0.05 Up Adrenergic alpha 2a 1.05 0.23 Up Adrenergic beta-2 1.07 0.24 Up Acetylcholine M1 1.08 0.23 Up Acetylcholine M2 1.07 0.10 Up Acetylcholine M3 1.12 0.07 Up

Peptide GPCRs Angiotensin receptor AT1A-R 1.32 0.02 Up Angtiotensin receptor AT2 À1.16 0.18 Down Chemokine receptor CCR-2 1.14 0.11 Up Chemokine receptor CXCR-4 1.07 0.10 Up CCKA-R 1.11 0.21 Up CCKB-R 1.08 0.07 Up Endothelin receptor ETB-R À1.09 0.23 Down FSH-R 1.08 0.22 Up LSH-R 1.11 0.07 Up TSH-R 1.07 0.14 Up Melanocortin receptor MC4-R 1.10 0.13 Up Neuropeptide Y receptor 1.13 0.03 Up Opioid receptor KOR-1 1.22 0.14 Up Opioid receptor MOR-1 1.06 0.25 Up GNRH-R 1.06 0.20 Up TRH-R À1.06 0.23 Down Somatostatin type 2 receptor 1.06 0.19 Up

G-Protein signaling G gamma 8 1.05 0.21 Up Gi alpha o 1 À1.1 0.08 Down Gi alpha i 2 À1.07 0.21 Down Adenylate cyclase AC4 1.09 0.08 Up CAMP phosphodiesterase PDE 4D 1.11 0.17 Up kRAS B À1.10 0.16 Down PKC delta À1.11 0.14 Down PKC epsilon À1.23 0.04 Down

Glycolysis 6- Phosphofructokinase C, platelet À1.08 0.18 Down Aldolase B, liver 1.11 0.11 Up Phosphoglycerate mutase, muscle 1.07 0.15 Up Phosphoglycerate mutase, brain À1.12 0.18 Down Lactate dehydrogenase B, heart À1.07 0.22 Down Lactate dehydrogenase C, testis 1.11 0.23 Up

Electron transport chain Complex I, chain 1 À1.08 0.22 Down Complex I, 13 kDa subunit À1.11 0.25 Down Complex IV, COX 5a À1.10 0.14 Down Complex IV, COX 6a, liver À1.08 0.20 Down Complex V, ATP synthase delta À1.16 0.10 Down Complex V, OSCP À1.15 0.23 Down Uncoupling protein 2 1.12 0.16 Up Uncoupling protein 3 1.05 0.20 Up

Fatty acid degradation Lipoprotein lipase À1.22 0.06 Down Glycerol-3-PO4 dehydrogenase À1.06 0.20 Down Long-chain fatty acid CoA ligase 5 À1.09 0.23 Down Long-chain fatty acid CoA ligase 6 À1.18 0.05 Down Carnitine palmitoyltransferase I, liver 1.05 0.18 Up Carnitine palmitoyltransferase I, muscle 1.07 0.03 Up Trifunctional enzyme beta À1.08 0.17 Down

Fatty acid beta oxidation Fatty acid CoA Ligase 5 À1.09 0.23 Down

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 938 Table 3 Continued.

Pathway Significant genes Fold change P value Direction

Fatty acid CoA Ligase 6 À1.18 0.05 Down Carnitine O-palmitoyltransferase I—muscle 1.07 0.03 Up Carnitine O-palmitoyltransferase I—liver 1.05 0.18 Up 2,4- Dienoyl—CoA reductase À1.05 0.18 Down

Apoptosis I-kappa B 1.06 0.15 Up Caspase-2 1.08 0.09 Up Bcl-X À1.06 0.14 Down

Proteasome degradation 26S subunit, TBP-1 À1.15 0.08 Down 20S subunit, component c8 À1.19 0.04 Down 20S subunit, component c9 À1.25 0.09 Down Lmp7 1.07 0.17 Up

Cholesterol biosynthesis Mevalonate kinase 1.18 0.07 Up 7-dehydrocholesterol reductase À1.07 0.15 Down Isopentenyl diphosphate isomerase À1.11 0.25 Down Squalene monooxygenase À1.11 0.15 Down Squalene synthetase À1.06 0.23 Down

Eicosanoid biosynthesis Phospholipase A2 1.14 0.01 Up 5-Lipoxygenase-activating protein 1.05 0.13 Up Arachidonate 12-lipoxygenase 1.07 0.19 Up Leukotriene A4 hydrolase 1.08 0.06 Up

TGF-beta signaling pathway Betaglycan 1.10 0.03 Up BMP 1.09 0.10 Up Smad1 À1.07 0.16 Down Smad3 1.05 0.22 Up Smad7 À1.10 0.11 Down

Wnt signaling pathway Frizzled 2 receptor 1.04 0.15 Up PKC delta À1.11 0.14 Down PKC epsilon À1.23 0.04 Down G1/S-specific cyclin D2 À1.11 0.15 Down G1/S-specific cyclin D3 À1.11 0.11 Up Fos-related antigen 1 1.06 0.24 Up

The data shown are organized according to several different biopathways/clusters appropriate to studies in rat brain available from GenMapp (www.genmapp.org). The individual genes represented for each pathway are listed according to fold changes, P-values for significance and direction of change. All the genes shown satisfied either a high (P ¼ 0.05) or low (P ¼ 0.25) stringency criterion for inclusion in the post hoc analysis of bio-pathways and clusters.

pathways and/or clusters (Table 3), both low and high clase and phosphodiesterase) and proteins (e.g., kRAS stringency criteria (P ¼ 0. 25 and 0.05, respectively) b and the epsilon isoform of protein kinase C) that met for entry of a gene into the analysis were compared either the high or low stringency criteria. Other maps

alone and in combination. For the composite Pc, the a that showed clusters of genes meeting criteria for level was set at 1.0 Â 10À4. Generally speaking, the inclusion in the post hoc analysis included the genes that met the high stringency criterion tended to electron transport chain (i.e., subunits of Complex I discriminate the same GenMapp pathways and/or and IV, as well as Complex V (ATP synthase), clusters as the genes satisfying the low stringency mitochondrial fatty acid beta oxidation and fatty acid criterion (Figures 1–3). These included the mono- degradation (i.e., lipoprotein lipase, long-chain fatty amine (ie m1, m2, m3, 5HT5b, 5HT6, alpha 1b, alpha acid CoA ligases 5 and 6, and carnitine-O-palmitoyl-

2a, beta2, and D4) and peptide (ie angiotensin AT1A-R transferase I) pathways, translation factors and the and ATR, CCKA, CCKB, neuropeptide Y, the kappa TGFb signaling pathway. As shown in Table 4, the KOR-1, and mu, MOR-1 opioid receptors) G protein- post hoc statistical test demonstrated that the path- coupled pathways (Figures 1 and 2, respectively). As ways showing the most robust changes were the shown in Figure 3, the G protein clusters in GenMapp monoamine and peptide G protein coupled receptor also showed several subunits and/or isoforms of G- pathways and the G protein signaling pathway. Other proteins or associated enzymes (e.g., adenylate cy- metabolic and signaling pathways, such as glycolysis,

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 939

Figure 1 A GenMapp diagram depicting changes in the regulation of various subtypes of monoamine receptors using low stringency criteria. The serotonin receptors 5HT5b and 5HT6, the adrenergic receptors alpha 1b, alpha 2a, and beta 2, and the cholinergic muscarinic receptors M1, M2 and M3 all showed an upregulation. Although the dopamine D1 and D2 receptors did not show a change in regulation in the picrotoxin-treated rats, the D4 receptor gene was upregulated. Although these receptors only satisfied low stringency criteria, the post hoc test of significance demonstrated P ¼ 4.9 Â 10À6.

Figure 2 A GenMapp diagram depicting clusters of peptide G protein-coupled receptors including ones associated with angiotensin, chemokines, cholecystokinin (CCK), endothelin, galanin, glycoprotein hormones, melanocortins, neuropeptide Y, opioids, and releasing hormones. The post hoc test demonstrated that P ¼ 7.2 Â 10À14. eicosanoid biosynthesis, Wnt signaling and apoptosis In order to validate the microarray analyses, showed some genes satisfying low or high criteria, but quantitative PCR using a highly sensitive and repro- these pathways/clusters did not attain significance as ducible fluorescence resonance energy transfer designated for this post hoc analysis. (FRET)-based approach was applied to a subset of

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 940

Figure 3 A schematic diagram from the GenMapp website showing the aggregation of genes representing subunits and/or isoforms associated with various G proteins. Significant changes in expression were observed for G alpha o 1 subunit of Gi, the AC4 isoform of adenylate cyclase and the PDE 4D isoform of phosphodiesterase, all associated with the regulation of cyclic AMP-mediated activities. An upregulation of the G alpha 15 subunit isoform of Gq occurred in association with a downregulation of kRAS B and the epsilon isoform of protein kinase C, an intracellular signal associated with inhibition of apoptosis.

Table 4 Post hoc biopathway and cluster analysis using each of the target gene assays (Figure 5). A bivariate GenMapp analysis of log concentrations vs threshold cycle for dopamine D4 mRNA showed a striking degree of GenMapp pathway Post hoc P value linearity (Figure 4, inset) and the FRET-based QRT- PCR assay showed good separation of the data for the Monoamine GPCRs 4.9 Â 10À6 À14 picrotoxin vs vehicle-treated animals (Figure 4). A Peptide GPCRs 7.2 Â 10 similar degree of linearity was seen for the other target G-protein signaling 3.5 Â 10À6 Glycolysis 7.6 Â 10À3 NS genes. The target genes examined included the Electron transport chain 3.3 Â 10À4 GAD65, GAD67, the dopamine D4, adrenergic alpha Fatty acid degradation 1.2 Â 10À5 1B, and CCK-B receptors because these met criteria Mitochondrial fatty acid b-oxidation 8.0 Â 10À8 for inclusion in the post hoc analysis. As shown in Apoptosis 7.6 Â 10À3 NS Figure 5, increases in mRNA encoding the dopamine Translation factors 3.7 Â 10À4 D4 and adrenergic alpha 1b receptors (fold Eicosanoid biosynthesis 4.2 Â 10À3 NS changes ¼ 2.7 and 2.3, respectively) were found to TGF b-Signaling 4.9 Â 10À4 be quite significant using the REST analysis. À3 Wnt signaling pathway 1.1 Â 10 NS Although the direction of change in the mRNA levels of these genes are consistent with the microarray data, ? The composite probability, Pc ¼ [(P1 Â P2 Â Pi)/ the magnitude of the upregulation is much higher, (ni/nt)] Â Np. probably reflecting the increased sensitivity of FRET- P ¼ P value of each gene below alpha (Po ¼ 0.25) in pathway. based QRT-PCR when compared to microarray-based gene expression profiling. Additionally, the mRNA ni ¼ number of genes less than the alpha value.

nt ¼ total number of genes in each pathway. encoding the CCKR-B gene was also found to be

Np ¼ total number of pathways (ad hoc Bonferroni correc- upregulated by a factor of 1.9 in the picrotoxin-treated tion). animals, but the REST analysis indicated that this The alpha value is 5 Â 10À4. change was not significant.

Discussion genes. Quantitative estimates of mRNA expression in hippocampus isolated from saline- and picrotoxin- The results of this study demonstrate that picrotoxin treated rats (Figure 4) were normalized with respect to infusion in the basolateral nucleus of the amygdala is GAPDH mRNA that served as an internal standard for capable of inducing significant changes in gene

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 941

Figure 4 Quantitative RT-PCR data for dopamine D4 in hippocampus of saline- and picrotoxin-treated rats. A standard curve (inset) shows a tight linear relationship between the log concentration of dopamine D4 mRNA and threshold cycle (Ct). With the threshold set at 30, a set of curves representing the RT-PCR amplifications over time for the individual rats in each group. There is a relatively clear separation between the curves for the saline vs the picrotoxin-treated groups, with dopamine D4 mRNA showing higher expression in the drug-treated group.

Figure 5 A set of bar graphs showing the data for mRNA for several different target genes, including GAD65, GAD67, the adrenergic alpha 1b, the dopamine D4 receptor and the CCKb receptor. The data were normalized with respect to the ‘housekeeping’ gene, glyceraldehydes-3-phosphate dehydrogenase (GAPDH) that did not show any difference in regulation in the picrotoxin-treated rats as compared to the saline-treated controls, suggesting that is constitutively expressed under the conditions employed in these experiments. The threshold cycle (Ct) values for GAPDH are shown separately for the saline- and picrotoxin-treated groups for each of the target genes.

expression in the hippocampus. Although immuno- in this region22 and the amount of mRNA expressed cytochemical studies have demonstrated increased by GABAergic cells could fall below the level of amounts of GAD65 and GAD67-containing terminals in detection needed for the microarray technique em- the hippocampus of picrotoxin-treated rats,14 very ployed here. RT-PCR, on the other hand, with its high pronounced increases of GAD65 and GAD67 were degree of sensitivity, was able to detect increases of also noted when FRET-based qRT-PCR was used and GAD67 and GAD65 mRNA, despite the fact that GABA these results correspond well with those described cells account for only 10% of the total number of above.14 GABAergic cells in the hippocampus ac- hippocampal neurons.22 Since there were approxi- count for only 10% of the total neuronal population mately 8000 genes represented on the Affymetrix RG-

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 942 U34A chip, there may have been many genes showing may perhaps represent changes in different cell no apparent changes in expression when conven- populations or hippocampal sectors. Either way, a tional statistical approaches are employed. Indeed, decrease of CCK mRNA25 and binding sites26 have when a novel approach in which Gen Mapp pathways been reported in postmortem studies of schizophrenia and a post hoc statistic that takes into account these and this peptide is believed to play a role in both pathways were employed, meaningful changes in the pathophysiology27,28 to generate ATP and po- biologically relevant clusters of genes have been ssibly even its treatment.29 Interestingly, CCK-immu- detected. Accordingly, the data obtained in this study noreactive terminals were found to be increased have provided some novel insights into how the in the hippocampus following picrotoxin infusion basolateral amygdala may influence the regulation of in the amygdala.14 Mu opioid receptors were complex signaling and metabolic pathways in the also upregulated in the picrotoxin-treated rats and hippocampus. this too is potentially an important finding because this peptide is thought to disinhibit pyramidal G protein-coupled pathways neurons in the hippocampus, possibly via neuropep- An important general area where changes in gene tide Y-containing interneurons.30 Interestingly, expression met criteria for inclusion in the post hoc we have also observed an upregulation of neuro- analysis of GenMapp biopathways/clusters was re- peptide Y receptors in the picrotoxin-treated rats lated to monoamine and peptide G protein-coupled and these latter binding sites may play a neuro- receptors. Overall, there were 14 peptides that met protective role against excitotoxicity in the hippo- criteria set for the post hoc analysis. The CCK campus.31 receptors are particularly interesting because they In Figure 6, there are nine upregulated monoamine have been associated with increases of GABA re- receptors associated with three different G proteins lease.23,24 This latter mechanism may be mediated pathways. These pathways include: by protein kinase C25 for which a significant decrease (a) m1, m3,32,33 a1 and a234 receptors possibly in mRNA expression was detected in the current associated with Gq and protein kinase C;35 34,36 study. Given that the two markers showed changes (b) m2, 5HT5b, 5HT6 and b2 receptors potentially in the opposite direction, it is unclear as to whether linked with Gs-mediated processing; 37 these two findings are linked with one another or (c) D4 receptor associated with Gi.

Figure 6 A schematic diagram depicting the monoamine (green) and peptide (aqua) G-coupled protein pathways showing changes in hippocampus of rats receiving picrotoxin in the basolateral nucleus of the amygdala. There was a notable upregulation of nine different monoamine receptors (green) that form three different clusters based on the different G proteins (blue) to mediate their activity, Gq, Gs and Gi (blue). The second and third pathways both involve the formation of cyclic AMP as a signaling molecule, while adenylate cyclase and phosphodiesterase serve as synthetic and degradative proteins, respectively that regulate its accumulation. Eight out of the nine monoamine receptors showing an increased expression also show moderate to high affinity for the atypical antipsychotic, clozapine and this suggests the possibility that the unique therapeutic efficacy of this drug may be related in part to the blockade of multiple monoaminergic receptors on hippocampal neurons.

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 943 The second and third pathways are both cyclic associated with G-coupled protein pathways and AMP dependent and ultimately utilize protein kinase involve pivotal components to intracellular signaling. A as an intermediate signal in mechanisms that The latter include adenylate cyclase,58,59 protein regulate the occurrence of long-term potentiation kinase C60,39 and RAS61,62 that can theoretically (LTP).38 In the current study, both adenylate cyclase influence the occurrence of LTP63,64 and/or apopto- (AC4) and phosphodiesterase (PDE4) were upregu- sis.65,59 In adipose tissue, both PKC66 and PKA67 have lated, making it possible that the synthesis and been implicated in the regulation of lipoprotein lipase breakdown of cyc-AMP could potentially have via beta-adrenergic receptors.68 In addition to a attained a steady-state condition. It is not clear, downregulation of lipoprotein lipase (LPL), several however, whether these changes occurred in the same other genes associated with fatty acid oxidation and cell types and/or hippocampal subregions or in the electron transport chain met criteria for inclusion separate tissue compartments. The upregulation of in the post hoc analysis and both of these latter multiple monoamine receptors could theoretically pathways showed significant differences in the increase the overall activity of this pathway with the picrotoxin-treated group (see Table 4). Stimulation potential for a facilitation of long-term potentiation of beta-adrenergic receptors in adipose tissue69 or (LTP) in the rats receiving picrotoxin. The PKA and liver70 is associated with a decreased transcription of PKC pathways have both been found to have anti- LPL. In the context of the current report, the apoptotic potential, particularly when the epsilon upregulation of the beta receptor is compatible with isoform of PKC is expressed.39 This is noteworthy the downregulation of LPL. Thus, it is theoretically because a recent study has presented evidence for a possible that the changes in the monoamine GPCRs reduction of apoptotic potential in schizophrenia.40 detected in this study may interplay with other alterations found in the fatty acid oxidation path- Functional implications ways. The latter could, in turn, bear some relationship The influence of the amygdala on the hippocampal to the downregulation of the electron transport chain formation involves complex interactions, ones that and the absence of significant changes in apoptotic are believed to contribute to both associative41 and cascades that were also observed in picrotoxin-treated episodic42 memory, as well as prepulse inhibition of rats. the startle reflex.43.Some believe that the functional interconnections between the amygdala and hippocampus may actually involve a ‘double dissociation’ Conclusions between the fear conditioning that occurs in relation to explicit and contextual cues, respectively.44 The The current report provides evidence suggesting that activity of this complex circuitry and the behaviors acute stimulation of the hippocampus by the amyg- that are modulated by it appear to be regulated, at dala is capable of inducing changes in the expression least in part, by a combination of serotonergic, of genes associated with multiple intracellular and noradrenergic45,46 and, in primates and man, dopami- metabolic pathways. Taken together, the current nergic mechanisms.47 The interactions among these findings suggest that activation of G protein-coupled neuromodulatory systems may also be important. For pathways associated with the cholinergic, adrenergic, example, the cholinergic system, which is also serotonergic and dopaminergic systems71 may play a believed to play a critical role in learning and central role in the metabolic responses of hippocam- memory,48,49 may interact with the serotonergic pal neurons to amygdalar stimulation. system in the regulation of cognitive behaviors, such as spatial learning.50 An important aspect of the data reported here is the Acknowledgements fact that there was an upregulation of nine different This work was supported by grants from the National monoaminergic receptors, including the m1,m2, and 51 52 53 Institutes of Health (MH00423, MH62822 and m3 muscarinic, a1, a2 and b2 adrenergic, serotonin 54,55 56 MH60450). 5HT5b and 5HT6 and dopamine D4 receptors in the hippocampus of picrotoxin-treated rats. With the exception of the 5HT5b receptor, all have moderate to high affinity for the atypical antipsychotic drug References clozapine. It has been difficult to explain why a drug 1 Ledoux J (2000) The amygdala and emotion. In: Aggleton JP (ed). that shows such a marked degree of nonselectivity The Amygdala. Oxford University Press: Oxford, pp 289–310. would prove to be the most effective antipsychotic 2 Tamminga CA, Thaker GK, Buchanan R, Kirkpatrick B, Alphs LD, drug available for the treatment of schizophrenia.57 Chase TN et al. Limbic system abnormalities identified in schizophrenia using positron emission tomography with fluor- Based on the current results, it is tempting to odeoxyglucose and neocortical alterations with deficit syndrome. speculate that the unique efficacy of clozapine may Arch Gen Psychiatry 1992; 49: 522–530. be related to its ability to simultaneously block 3 Benes FM. Emerging principles of altered neural circuitry in multiple monoaminergic receptors that are upregu- schizophrenia. Brain Res Brain Res Rev 2000; 31: 251–269. 4 Simpson MDC, Slater P, Deakin JFW, Royston MC, Skan WJ. lated in the hippocampus in response to amygdalar Reduced GABA uptake sites in the temporal lobe in schizophrenia. stimulation. All of these receptors appear to be Neurosci Let 1989b; 107: 211–215.

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 944 5 Reynolds, Czudek C, Andrews HB. Deficit and hemispheric 27 Feifel D, Swerdlow NR. The modulation of sensorimotor gating asymmetry of GABA uptake sites in the hippocampus in schizo- deficits by mesolimbic cholecystokinin. Neurosci Lett 1997; 229: phrenia. Biol Psychiatry 1990; 27: 1038–1044. 5–8. 6 Benes FM, Vincent SL, Alsterberg G, Bird ED, SanGiovanni JP. 28 Feifel D, Reza T, Robeck S. Antipsychotic potential of CCK-based Increased GABAA receptor binding in superficial layers of treatments: an assessment using the prepulse inhibition model of cingulate cortex in schizophrenics. J Neurosci 1992; 12: psychosis. Neuropsychopharmacology 1999; 20: 141–149. 924–929. 29 Drake CT, Milner TA. Mu opioid receptors are in discrete 7 Simpson MD, Slater P, Royston MC, Deakin JF. Regionally selective hippocampal interneuron subpopulations. Hippocampus 2002; deficits in uptake sites for glutamate and gamma-aminobutyric 12: 119–136. acid in the basal ganglia in schizophrenia. Psychiatry Res 1992; 42: 30 Silva AP, Pinheiro PS, Carvalho AP, Carvalho CM, Jakobsen B, 273–282. Zimmer J et al. Activation of neuropeptide Y receptors is 8 Guidotti A, Auta J, Davis JM, Gerevini VD, Dwivedi Y, Grayson DR neuroprotective against excitotoxicity in organotypic hippocam- et al. Decrease in reelin and glutamic acid decarboxylase67 pal slice cultures. Faseb J 2003; 17: 1118–1120. (GAD67) expression in schizophrenia and bipolar disorder: a 31 Connor M, Christie MD. Opioid receptor signalling mechanisms. postmortem brain study [In Process Citation]. Arch Gen Psychiatry Clin Exp Pharmacol Physiol 1999; 26: 493–499. 2000; 57: 1061–1069. 32 Budd DC, McDonald J, Emsley N, Cain K, Tobin AB. The 9 Heckers S, Stone D, Walsh J, Shick J, Koul P, Benes FM. C-terminal tail of the M3-muscarinic receptor possesses anti- Differential hippocampal expression of glutamic acid decarbox- apoptotic properties. J Biol Chem 2003 Accession number ylase 65 and 67 messenger RNA in bipolar disorder and 12649280. schizophrenia. Arch Gen Psychiatry 2002; 59: 521–529. 33 Dorn II GW. Adrenergic pathways and left ventricular remodeling. 10 Van Hoesen GW Morecraft RJ, Vogt BA. Connections of the J Card Fail 2002; 8: S370–S373. monkey cingulate cortex. Neurobiol Cingulate Cortex Limbic 34 Firth TA, Jones SV. GTP-binding protein Gq mediates muscarinic- Thalamus 1993, pp 249–284. receptor-induced inhibition of the inwardly rectifying potassium 11 Benes FM, Berretta S. Amygdalo-entorhinal inputs to the hippo- channel IRK1 (Kir 2.1). Neuropharmacology 2001; 40: 358–365. campal formation in relation to schizophrenia. Annals NY Acad 35 Shinozaki H, Butnev V, Tao YX, Ang KL, Conti M, Segaloff DL. Sci 2000; 911: 293–304. Desensitization of Gs-coupled receptor signaling by constitutively 12 Simpson MD, Slater P, Deakin JF, Royston MC, Skan WJ. Reduced active mutants of the human lutropin/choriogonadotropin recep- GABA uptake sites in the temporal lobe in schizophrenia. tor. J Clin Endocrinol Metab 2003; 88: 1194–1204. Neurosci Lett 1989a; 107: 211–215. 36 Jaber M, Robinson SW, Missale C, Caron MG. Dopamine receptors 13 Berretta S, Munno DW, Benes FM. Amygdalar activation alters the and brain function. Neuropharmacology 1996; 35: 1503–1519. hippocampal GABA system: ‘partial’ modelling for postmortem 37 Abel T, Nguyen PV, Barad M, Deuel TA, Kandel ER, Bourtch- changes in schizophrenia. J Comp Neurol 2001b; 431: 129–138. ouladze R. Genetic demonstration of a role for PKA in the late 14 Berretta S, Lange N, Bhattacharyya S, Sebro R, Garces J, Benes FM. phase of LTP and in hippocampus-based long-term memory. Cell Long term effects of amygdala GABA receptor blockade on specific 1997; 88: 615–626. sobpopulations of hippocampal interneurons. Hippocampus 2004, 38 Leverrier S, Vallentin A, Joubert D. Positive feedback of protein In press. kinase C proteolytic activation during apoptosis. Biochem J 2002; 15 Paxinos G, Watson C. The Rat Brain in Stereotaxic Coordinates, 368: 905–913. 2nd Edition. Academic Press: New York, 1986. 39 Benes FM, Walsh J, Bhattacharyya S, Sheth A, Berretta S. DNA 16 Berretta S, Parthasarathy HP, Graybiel AM. Local release of fragmentation decreased in schizophrenia but not bipolar dis- GABAergic inhibition in the motor cortex induces immediate- order. Arch Gen Psychiatry 2003; 60: 359–364. early gene expression in indirect pathway neurons of the striatum. 40 Killgore WD, Casasanto DJ, Yurgelun-Todd DA, Maldjian JA, Detre J Neurosci 1997; 17: 4752–4763. JA. Functional activation of the left amygdala and hippocampus 17 Berretta S, Munno DW, Benes FM. Amygdalar activation alters the during associative encoding [In Process Citation]. Neuroreport hippocampal GABA system: ‘partial’ modelling for postmortem 2000; 11: 2259–2263. changes in schizophrenia. J Comp Neurol 2001a; 431: 129–138. 41 Rolls ET. Memory systems in the brain. Annu Rev Psychol 2000; 18 Chagnac-Amitai Y, Connors BW. Horizontal spread of synchro- 51: 599–630. nized activity in neocortex and its control by GABA-mediated 42 Wan FJ, Swerdlow NR. The basolateral amygdala regulates inhibition. J Neurophysiol 1989; 61: 747–758. sensorimotor gating of acoustic startle in the rat. Neuroscience 19 Li CX, Wong WH. Model-based analysis of ligonucleotide arrays: 1997; 76: 715–724. expression index computation and outlier detection. Proc Natl 43 Selden NR, Everitt BJ, Jarrard LE, Robbins TW. Complementary Acad Sci 2001; 98: 31–36. roles for the amygdala and hippocampus in aversive condi- 20 Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tioning to explicit and contextual cues. Neuroscience 1991; 42: tool (REST) for group-wise comparison and statistical analysis of 335–350. relative expression results in real-time PCR. Nucleic Acids Res 44 Bakshi VP, Geyer MA. Alpha-1-adrenergic receptors mediate 2002; 30:e36. sensorimotor gating deficits produced by intracerebral dizocilpine 21 Benes FM, Kwok EW, Vincent SL, Todtenkopf MS. A reduction of administration in rats. Neuroscience 1999; 92: 113–121. nonpyramidal cells in sector CA2 of schizophrenics and manic 45 Beversdorf DQ, White DM, Chever DC, Hughes JD, Bornstein RA. depressives [see comments]. Biol Psychiatry 1998; 44: 88–97. Central beta-adrenergic modulation of cognitive flexibility. Neu- 22 Miller KK, Hoffer A, Svoboda KR, Lupica CR. Cholecystokinin roreport 2002; 13: 2505–2507. increases GABA release by inhibiting a resting K þ conductance in 46 Korzan WJ, Summers TR, Summers CH. Monoaminergic activities hippocampal interneurons. J Neurosci 1997; 17: 4994–5003. of limbic regions are elevated during aggression: influence of 23 Acosta GB. A possible interaction between CCKergic and GA- sympathetic social signaling. Brain Res 2000; 870: 170–178. BAergic systems in the rat brain. Comp Biochem Physiol C Toxicol 47 Baxter MG, Frick KM, Price DL, Breckler SJ, Markowska AL, Pharmacol 2001; 128: 11–17. Gorman LK. Presynaptic markers of cholinergic function in the rat 24 Breukel AI, Wiegant VM, Lopes da Silva FH, Ghijsen WE. brain: relationship with age and cognitive status. Neuroscience Presynaptic modulation of cholecystokinin release by protein 1999; 89: 771–779. kinase C in the rat hippocampus. J Neurochem 1998; 70: 48 van der Zee EA, Luiten PG. Muscarinic acetylcholine receptors in 341–348. the hippocampus, neocortex and amygdala: a review of immuno- 25 Kerwin R, Robinson P, Stephenson J. Distribution of CCK binding cytochemical localization in relation to learning and memory. Prog sites in the human hippocampal formation and their alteration in Neurobiol 1999; 58: 409–471. schizophrenia: a post-mortem autoradiographic study. Psychol 49 Dringenberg HC, Zalan RM. Serotonin-dependent maintenance of Med 1992; 22: 37–43. spatial performance and electroencephalography activation after 26 Garver DL, Beinfeld MC, Yao JK. Cholecystokinin, dopamine and cholinergic blockade: effects of serotonergic receptor antagonists. schizophrenia. Psychopharmacol Bull 1990; 26: 377–380. Brain Res 1999; 837: 242–253.

Molecular Psychiatry Amygdalo-hipp microarray study FM Benes et al 945 50 Olianas MC, Maullu C, Onali P. Mixed agonist-antagonist proper- 60 Clark GJ, O’Bryan JP, Der CJ. Ras signaling and transformation. In: ties of clozapine at different human cloned muscarinic receptor Gutkind JS (ed). Signaling Networks and Cell Cycle Control: The subtypes expressed in Chinese hamster ovary cells. Neuropsycho- Molecular Basis of Cancer and Other Diseases. Humana Press: pharmacology 1999; 20: 263–270. Totowa, NJ, 2000. 51 Gioanni Y, Thierry AM, Glowinski J, Tassin JP. Alpha1-adrenergic, 61 Adjei AA. Ras signaling pathway proteins as therapeutic targets. D1, and D2 receptors interactions in the prefrontal cortex: Curr Pharm Des 2001; 7: 1581–1594. implications for the modality of action of different types of 62 Thomas KL, Laroche S, Errington ML, Bliss TV, Hunt SP. Spatial neuroleptics. Synapse 1998; 30: 362–370. and temporal changes in signal transduction pathways during LTP. 52 Lidow MS, Goldman-Rakic PS, Gallager DW, Geschwind DH, Neuron 1994; 13: 737–745. Rakic P. Distribution of major neurotransmitter receptors in the 63 Richter-Levin G, Thomas KL, Hunt SP, Bliss TV. Dissociation motor and somatosensory cortex of the rhesus monkey. Neu- between genes activated in long-term potentiation and in spatial roscience 1989; 32: 609–627. learning in the rat. Neurosci Lett 1998; 251: 41–44. 53 Glatt CE, Snowman AM, Sibley DR, Snyder SH. Clozapine: 64 Mielke K, Brecht S, Dorst A, Herdegen T. Activity and ex- selective labeling of sites resembling 5HT6 serotonin receptors pression of JNK1, p38 and ERK kinases, c-Jun N-terminal may reflect psychoactive profile. Mol Med 1995; 1: 398–406. phosphorylation, and c-jun promoter binding in the adult rat 54 Yu YW, Tsai SJ, Lin CH, Hsu CP, Yang KH, Hong CJ. Serotonin-6 brain following kainate-induced seizures. Neuroscience 1999; 91: receptor variant (C267T) and clinical response to clozapine. 471–483. Neuroreport 1999; 10: 1231–1233. 65 Ranganathan G, Song W, Dean N, Monia B, Barger SW, Kern PA. 55 Meltzer HY. An overview of the mechanism of action of clozapine. Regulation of lipoprotein lipase by protein kinase C alpha in 3T3- J Clin Psychiatry 1994; 55(Suppl B): 47–52. F442A adipocytes. J Biol Chem 2002; 277: 38669–38675. 56 Carpenter Jr WT, Conley RR, Buchanan RW, Breier A, Tamminga 66 Nomura S, Kawanami H, Ueda H, Kizaki T, Ohno H, Izawa T. CA. Patient response and resource management: another view of Possible mechanisms by which adipocyte lipolysis is enhanced in clozapine treatment of schizophrenia. [Review]. Am J Psychiatry exercise-trained rats. Biochem Biophys Res Commun 2002; 295: 1995; 152: 827–832. 236–242. 57 Baker LP, Nielsen MD, Impey S, Hacker BM, Poser SW, Chan MY 67 Mitchell JR, Jacobsson A, Kirchgessner TG, Schotz MC, Cannon B, et al. Regulation and immunohistochemical localization of Nedergaard J. Regulation of expression of the lipoprotein lipase betagamma-stimulated adenylyl cyclases in mouse hippocampus. gene in brown adipose tissue. Am J Physiol 1992; 263: E500–E506. J Neurosci 1999; 19: 180–192. 68 McCarty MF. Modulation of adipocyte lipoprotein lipase expres- 58 Taurin S, Ryazhsky GG, Maximova NV, Chuchalin AG, Hamet P, sion as a strategy for preventing or treating visceral obesity. Med Pshezhetsky AV et al. Suppression of programmed cell death by Hypotheses 2001; 57: 192–200. intracellular cAMP is not mediated by expression of genes 69 Schoonderwoerd K, Hulsmann WC, Jansen H. Regulation of liver encoding an inhibitor of apoptosis. Biochemistry (Mosc) 2002; lipase. II. Involvement of the alpha 1-receptor. Biochim Biophys 67: 254–259. Acta 1984; 795: 481–486. 59 Izquierdo I, Medina JH. Correlation between the pharmacology of 70 Menzaghi F, Behan DP, Chalmers DT. Constitutively activated G long-term potentiation and the pharmacology of memory. Neuro- protein-coupled receptors: a novel approach to CNS drug biol Learn Mem 1995; 63: 19–32. discovery. Curr Drug Target CNS Neurol Disord 2002; 1: 105–121.

Molecular Psychiatry