J. Microbiol. Biotechnol. (2017), 27(0), 1–3 https://doi.org/10.4014/jmb.1712.12054 Research Article Review jmb
Table S1. Operational parameters of the three tannery wastewater treatment plants. Flow rate COD (mg/l) NH + (mg/l) Sample Process HRT (h) pH 4 (m3d-1) Influent Effluent Influent Effluent AS-A A/O+SBR 2,000 72 8.0 1500 200 150 ≤2.0 AS-B OD+SBR 1,000 144 7.5 1300 190 150 ≤2.0 AS-C A/O+O 1,200 96 7.5 2500 150 550 ≤1.0
Table S2. Primers used for q-PCR amplification of total bacteria, AOA and AOB. Specific Primers Sequence (5’-3’) Reference Bacterial 16S rRNA 341F CCTACGGGAGGCAGCAG Koike et al. (2007) 534R TTACCGCGGCTGCTGGCAC AOA Arch-amoAF STAATGGTCTGGCTTAGACG Peng et al. (2014) Arch-amoAR GCGGCCATCCATCTGTATGT AOB Bacteria-AmoaF GGGGTTTCTACTGGTGGT Peng et al. (2014) Bacteria-AmoaR CCCCTCKGSAAAGCCTTCTTC
References
Koike S, Krapa I, Oliver H, Yannarell A, et al. 2007. Monitoring and source tracking of tetracycline resistance genes in lagoons and groundwater adjacent to swine production facilities over a 3-year period. Appl. Environ. Microbiol. 73: 4813-4823. Peng X, Guo Feng, Ju F, et al. 2014. Shifts in the microbial community, nitrifiers and denitrifiers in the biofilm in a full-scale rotating biological contactor. Environ. Sci. Technol. 48: 8044-8052.
A 2017 ⎪ Vol. 27⎪ No. 0 2Name et al.
Table S3. Percentages of the shared genera for activated sludge samples. Percentage (%) Phylum Class Genus AS-A AS-B AS-C Eubacteria Proteobacteria β-proteobacteria Thauera 4.74 1.43 3.08 Proteobacteria β-proteobacteria Nitrosospira 2.08 0.50 1.29 Proteobacteria β-proteobacteria Nitrosomonas 0.63 3.94 2.28 Proteobacteria β-Proteobacteria Azoarcus 1.97 0.61 1.29 Proteobacteria β-Proteobacteria Comamonas 0.57 0.13 0.35 Proteobacteria γ-proteobacteria Arenimonas 0.51 6.31 3.41 Proteobacteria γ-Proteobacteria Steroidobacter 2.03 1.01 1.52 Proteobacteria γ-Proteobacteria Luteimonas 0.01 3.10 1.55 Proteobacteria γ-Proteobacteria Thioprofundum 0.14 0.33 0.24 Proteobacteria γ-Proteobacteria Thioalkalispira 0.03 0.00 0.02 Proteobacteria γ-Proteobacteria Lysobacter 0.20 0.00 0.10 Proteobacteria δ-proteobacteria Phaselicystis 0.53 0.48 0.50 Planctomycetes Phycisphaerae Phycisphaera 1.05 15.63 8.34 Planctomycetes Planctomycetia Blastopirellula 0.49 0.72 0.61 Chloroflexi Anaerolineae Bellilinea 2.36 1.07 1.72 Chloroflexi Anaerolineae Levilinea 1.67 0.63 1.15 Chloroflexi Anaerolineae Longilinea 1.44 0.08 0.76 Chloroflexi Caldilineae Litorilinea 0.37 0.17 0.27 Acidobacteria Acidobacteria_Gp4 Gp4 3.38 3.65 3.52 Acidobacteria Acidobacteria_Gp16 Gp16 0.13 1.83 0.98 Ignavibacteriae Ignavibacteria Ignavibacterium 5.17 0.17 2.67 Nitrospirae Nitrospira Nitrospira 4.44 0.86 2.65 Bacteroidetes Sphingobacteriia Haliscomenobacter 1.77 1.47 1.62 Bacteroidetes Sphingobacteriia Lewinella 2.00 0.04 1.02 Bacteroidetes Cytophagia Fulvivirga 1.24 0.23 0.73 Bacteroidetes Bacteroidetes_incertae_sedis Ohtaekwangia 0.06 0.01 0.03 Deinococcus-Thermus Deinococci Truepera 0.29 3.46 1.88 Chloroflexi Anaerolineae Levilinea 1.67 0.63 1.15 Verrucomicrobia Verrucomicrobiae Roseibacillus 0.15 1.89 1.02 Candidatus Saccharibacteria Saccharibacteria_genera_incertae_sedis 0.40 1.75 1.08 Gemmatimonadetes Gemmatimonadetes Gemmatimonas 1.28 0.69 0.99 candidate division WPS-1 WPS-1_genera_incertae_sedis 0.61 0.06 0.34 Archaea Euryarchaeota Methanomicrobia Methanosaeta 12.09 10.08 27.23 Euryarchaeota Methanomicrobia Methanocalculus 1.95 5.14 26.56 Euryarchaeota Methanomicrobia Methanospirillum 2.58 3.05 7.78 Euryarchaeota Methanomicrobia Methanogenium 0.57 0.00 8.42 Euryarchaeota Methanomicrobia Methanoregula 9.87 0.00 1.12 Euryarchaeota Methanomicrobia Methanolinea 7.41 1.50 2.90 Euryarchaeota Methanomicrobia Methanofollis 2.18 0.00 2.91 Euryarchaeota Thermoplasmata Thermogymnomonas 3.92 0.05 3.05 Euryarchaeota Methanomicrobia Methanolobus 0.36 0.00 2.94 Euryarchaeota Methanomicrobia Methanosarcina 0.71 0.02 0.94 Euryarchaeota Methanomicrobia Methanomethylovorans 1.61 0.00 0.63 Euryarchaeota Methanobacteria Methanosphaera 2.47 0.00 0.14 Euryarchaeota Methanomicrobia Methanosphaerula 0.45 0.05 1.22 Crenarchaeota Thermoprotei Thermofilum 1.87 0.02 0.04
J. Microbiol. Biotechnol. Title 3
Fig. S1. Rarefaction curves of the sequencing results for each sample. (A) Eubacteria; (B) Archaea.
Fig. S2. Shared OTUs of eubacterial (A) and archaeal (B) communities for activated sludge samples. A, B, and C in the figure represent samples AS-A, AS-B, and AS-C, respectively.
A 2017 ⎪ Vol. 27⎪ No. 0