DOCSLIB.ORG

Research Article Review Jmb

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Research Article Review Jmb J. Microbiol. Biotechnol. (2017), 27(0), 1–3 https://doi.org/10.4014/jmb.1712.12054 Research Article Review jmb Table S1. Operational parameters of the three tannery wastewater treatment plants. Flow rate COD (mg/l) NH + (mg/l) Sample Process HRT (h) pH 4 (m3d-1) Influent Effluent Influent Effluent AS-A A/O+SBR 2,000 72 8.0 1500 200 150 ≤2.0 AS-B OD+SBR 1,000 144 7.5 1300 190 150 ≤2.0 AS-C A/O+O 1,200 96 7.5 2500 150 550 ≤1.0 Table S2. Primers used for q-PCR amplification of total bacteria, AOA and AOB. Specific Primers Sequence (5’-3’) Reference Bacterial 16S rRNA 341F CCTACGGGAGGCAGCAG Koike et al. (2007) 534R TTACCGCGGCTGCTGGCAC AOA Arch-amoAF STAATGGTCTGGCTTAGACG Peng et al. (2014) Arch-amoAR GCGGCCATCCATCTGTATGT AOB Bacteria-AmoaF GGGGTTTCTACTGGTGGT Peng et al. (2014) Bacteria-AmoaR CCCCTCKGSAAAGCCTTCTTC References Koike S, Krapa I, Oliver H, Yannarell A, et al. 2007. Monitoring and source tracking of tetracycline resistance genes in lagoons and groundwater adjacent to swine production facilities over a 3-year period. Appl. Environ. Microbiol. 73: 4813-4823. Peng X, Guo Feng, Ju F, et al. 2014. Shifts in the microbial community, nitrifiers and denitrifiers in the biofilm in a full-scale rotating biological contactor. Environ. Sci. Technol. 48: 8044-8052. A 2017 ⎪ Vol. 27⎪ No. 0 2Name et al. Table S3. Percentages of the shared genera for activated sludge samples. Percentage (%) Phylum Class Genus AS-A AS-B AS-C Eubacteria Proteobacteria β-proteobacteria Thauera 4.74 1.43 3.08 Proteobacteria β-proteobacteria Nitrosospira 2.08 0.50 1.29 Proteobacteria β-proteobacteria Nitrosomonas 0.63 3.94 2.28 Proteobacteria β-Proteobacteria Azoarcus 1.97 0.61 1.29 Proteobacteria β-Proteobacteria Comamonas 0.57 0.13 0.35 Proteobacteria γ-proteobacteria Arenimonas 0.51 6.31 3.41 Proteobacteria γ-Proteobacteria Steroidobacter 2.03 1.01 1.52 Proteobacteria γ-Proteobacteria Luteimonas 0.01 3.10 1.55 Proteobacteria γ-Proteobacteria Thioprofundum 0.14 0.33 0.24 Proteobacteria γ-Proteobacteria Thioalkalispira 0.03 0.00 0.02 Proteobacteria γ-Proteobacteria Lysobacter 0.20 0.00 0.10 Proteobacteria δ-proteobacteria Phaselicystis 0.53 0.48 0.50 Planctomycetes Phycisphaerae Phycisphaera 1.05 15.63 8.34 Planctomycetes Planctomycetia Blastopirellula 0.49 0.72 0.61 Chloroflexi Anaerolineae Bellilinea 2.36 1.07 1.72 Chloroflexi Anaerolineae Levilinea 1.67 0.63 1.15 Chloroflexi Anaerolineae Longilinea 1.44 0.08 0.76 Chloroflexi Caldilineae Litorilinea 0.37 0.17 0.27 Acidobacteria Acidobacteria_Gp4 Gp4 3.38 3.65 3.52 Acidobacteria Acidobacteria_Gp16 Gp16 0.13 1.83 0.98 Ignavibacteriae Ignavibacteria Ignavibacterium 5.17 0.17 2.67 Nitrospirae Nitrospira Nitrospira 4.44 0.86 2.65 Bacteroidetes Sphingobacteriia Haliscomenobacter 1.77 1.47 1.62 Bacteroidetes Sphingobacteriia Lewinella 2.00 0.04 1.02 Bacteroidetes Cytophagia Fulvivirga 1.24 0.23 0.73 Bacteroidetes Bacteroidetes_incertae_sedis Ohtaekwangia 0.06 0.01 0.03 Deinococcus-Thermus Deinococci Truepera 0.29 3.46 1.88 Chloroflexi Anaerolineae Levilinea 1.67 0.63 1.15 Verrucomicrobia Verrucomicrobiae Roseibacillus 0.15 1.89 1.02 Candidatus Saccharibacteria Saccharibacteria_genera_incertae_sedis 0.40 1.75 1.08 Gemmatimonadetes Gemmatimonadetes Gemmatimonas 1.28 0.69 0.99 candidate division WPS-1 WPS-1_genera_incertae_sedis 0.61 0.06 0.34 Archaea Euryarchaeota Methanomicrobia Methanosaeta 12.09 10.08 27.23 Euryarchaeota Methanomicrobia Methanocalculus 1.95 5.14 26.56 Euryarchaeota Methanomicrobia Methanospirillum 2.58 3.05 7.78 Euryarchaeota Methanomicrobia Methanogenium 0.57 0.00 8.42 Euryarchaeota Methanomicrobia Methanoregula 9.87 0.00 1.12 Euryarchaeota Methanomicrobia Methanolinea 7.41 1.50 2.90 Euryarchaeota Methanomicrobia Methanofollis 2.18 0.00 2.91 Euryarchaeota Thermoplasmata Thermogymnomonas 3.92 0.05 3.05 Euryarchaeota Methanomicrobia Methanolobus 0.36 0.00 2.94 Euryarchaeota Methanomicrobia Methanosarcina 0.71 0.02 0.94 Euryarchaeota Methanomicrobia Methanomethylovorans 1.61 0.00 0.63 Euryarchaeota Methanobacteria Methanosphaera 2.47 0.00 0.14 Euryarchaeota Methanomicrobia Methanosphaerula 0.45 0.05 1.22 Crenarchaeota Thermoprotei Thermofilum 1.87 0.02 0.04 J. Microbiol. Biotechnol. Title 3 Fig. S1. Rarefaction curves of the sequencing results for each sample. (A) Eubacteria; (B) Archaea. Fig. S2. Shared OTUs of eubacterial (A) and archaeal (B) communities for activated sludge samples. A, B, and C in the figure represent samples AS-A, AS-B, and AS-C, respectively. A 2017 ⎪ Vol. 27⎪ No. 0.
Load more

Recommended publications
  • Soil Biology & Biochemistry
    Soil Biology & Biochemistry 111 (2017) 66e77 Contents lists available at ScienceDirect Soil Biology & Biochemistry journal homepage: www.elsevier.com/locate/soilbio In-depth analysis of core methanogenic communities from high elevation permafrost-affected wetlands Sizhong Yang a, b, 1, Susanne Liebner a, 1, Matthias Winkel a, Mashal Alawi a, Fabian Horn a, Corina Dorfer€ c, Julien Ollivier d, Jin-sheng He e, f, Huijun Jin b, Peter Kühn c, * Michael Schloter d, Thomas Scholten c, Dirk Wagner a, a GFZ German Research Centre for Geosciences, Section 5.3 Geomicrobiology, Telegrafenberg, 14473 Potsdam, Germany b State Key Laboratory of Frozen Soils Engineering, Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, 730000, Lanzhou, China c University of Tübingen, Department of Geosciences, 72074 Tübingen, Germany d Helmholtz Zentrum München, Research Unit Comparative Microbiome Analysis, 85764 Neuherberg, Germany e Key Laboratory of Adaptation and Evolution of Plateau Biota, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, 810008, Xi'ning, China f Peking University, Department of Ecology, College of Urban and Environmental Sciences, 100871, Beijing, China article info abstract Article history: The organic carbon of permafrost affected soils is receiving particular attention with respect to its fate Received 21 December 2016 and potential feedback to global warming. The structural and activity changes of methanogenic com- Accepted 15 March 2017 munities in the degrading permafrost-affected wetlands on the Tibetan Plateau can serve as fundamental elements for modelling feedback interaction of ecosystems to climate change. Hence, we aimed at anticipating if and how the rapid environmental changes occurring especially on the high altitude Ti- Keywords: betan platform will affect methanogenic communities.
    [Show full text]
  • The 2014 Golden Gate National Parks Bioblitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event
    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 ON THIS PAGE Photograph of BioBlitz participants conducting data entry into iNaturalist. Photograph courtesy of the National Park Service. ON THE COVER Photograph of BioBlitz participants collecting aquatic species data in the Presidio of San Francisco. Photograph courtesy of National Park Service. The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 Elizabeth Edson1, Michelle O’Herron1, Alison Forrestel2, Daniel George3 1Golden Gate Parks Conservancy Building 201 Fort Mason San Francisco, CA 94129 2National Park Service. Golden Gate National Recreation Area Fort Cronkhite, Bldg. 1061 Sausalito, CA 94965 3National Park Service. San Francisco Bay Area Network Inventory & Monitoring Program Manager Fort Cronkhite, Bldg. 1063 Sausalito, CA 94965 March 2016 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate comprehensive information and analysis about natural resources and related topics concerning lands managed by the National Park Service.
    [Show full text]
  • Methanospirillum Hungatei GP1 As an S Layer MAX FIRTEL,1 GORDON SOUTHAM,1 GEORGE HARAUZ,2 and TERRY J
    JOURNAL OF BACTERIOLOGY, Dec. 1993, p. 7550-7560 Vol. 175, No. 23 0021-9193/93/237550-11$02.00/0 Copyright © 1993, American Society for Microbiology Characterization of the Cell Wall of the Sheathed Methanogen Methanospirillum hungatei GP1 as an S Layer MAX FIRTEL,1 GORDON SOUTHAM,1 GEORGE HARAUZ,2 AND TERRY J. BEVERIDGE'* Department ofMicrobiology' and Department ofMolecular Biology and Genetics, 2 College of Biological Sciences, University of Guelph, Guelph, Ontario, Canada N1G 2W1 Received 16 June 1993/Accepted 27 September 1993 The cell wall of MethanospiriUum hungatei GP1 is a labile structure that has been difficult to isolate and Downloaded from characterize because the cells which it encases are contained within a sheath. Cell-sized fragments, 560 nm wide by several micrometers long, of cell wall were extracted by a novel method involving the gradual drying of the filaments in 2% (wtlvol) sodium dodecyl sulfate and 10%0 (wt/vol) sucrose in 50 mM N-2-hydroxyeth- ylpiperazine-N'-2-ethanesulfonic acid (HEPES) buffer containing 10 mM EDTA. The surface was a hexagonal array (a = b = 15.1 nm) possessing a helical superstructure with a ca. 2.50 pitch angle. In shadowed relief, the smooth outer face was punctuated with deep pits, whereas the inner face was relatively featureless. Computer-based two-dimensional reconstructed views of the negatively stained layer demonstrated 4.0- and 2.0-nm-wide electron-dense regions on opposite sides of the layer likely corresponding to the openings of funnel-shaped channels. The face featuring the larger openings best corresponds to the outer face of the layer.
    [Show full text]
  • Genome-Resolved Meta-Analysis of the Microbiome in Oil Reservoirs Worldwide
    microorganisms Article Genome-Resolved Meta-Analysis of the Microbiome in Oil Reservoirs Worldwide Kelly J. Hidalgo 1,2,* , Isabel N. Sierra-Garcia 3 , German Zafra 4 and Valéria M. de Oliveira 1 1 Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas–UNICAMP, Av. Alexandre Cazellato 999, 13148-218 Paulínia, Brazil; [email protected] 2 Graduate Program in Genetics and Molecular Biology, Institute of Biology, University of Campinas (UNICAMP), Rua Monteiro Lobato 255, Cidade Universitária, 13083-862 Campinas, Brazil 3 Biology Department & CESAM, University of Aveiro, Aveiro, Portugal, Campus de Santiago, Avenida João Jacinto de Magalhães, 3810-193 Aveiro, Portugal; [email protected] 4 Grupo de Investigación en Bioquímica y Microbiología (GIBIM), Escuela de Microbiología, Universidad Industrial de Santander, Cra 27 calle 9, 680002 Bucaramanga, Colombia; [email protected] * Correspondence: [email protected]; Tel.: +55-19981721510 Abstract: Microorganisms inhabiting subsurface petroleum reservoirs are key players in biochemical transformations. The interactions of microbial communities in these environments are highly complex and still poorly understood. This work aimed to assess publicly available metagenomes from oil reservoirs and implement a robust pipeline of genome-resolved metagenomics to decipher metabolic and taxonomic profiles of petroleum reservoirs worldwide. Analysis of 301.2 Gb of metagenomic information derived from heavily flooded petroleum reservoirs in China and Alaska to non-flooded petroleum reservoirs in Brazil enabled us to reconstruct 148 metagenome-assembled genomes (MAGs) of high and medium quality. At the phylum level, 74% of MAGs belonged to bacteria and 26% to archaea. The profiles of these MAGs were related to the physicochemical parameters and recovery management applied.
    [Show full text]
  • Anaerobic Digestion of the Microalga Spirulina at Extreme Alkaline Conditions: Biogas Production, Metagenome, and Metatranscriptome
    ORIGINAL RESEARCH published: 22 June 2015 doi: 10.3389/fmicb.2015.00597 Anaerobic digestion of the microalga Spirulina at extreme alkaline conditions: biogas production, metagenome, and metatranscriptome Vímac Nolla-Ardèvol 1*, Marc Strous 1, 2, 3 and Halina E. Tegetmeyer 1, 3, 4 1 Institute for Genome Research and Systems Biology, Center for Biotechnology, University of Bielefeld, Bielefeld, Germany, 2 Department of Geoscience, University of Calgary, Calgary, AB, Canada, 3 Microbial Fitness Group, Max Planck Institute for Marine Microbiology, Bremen, Germany, 4 HGF-MPG Group for Deep Sea Ecology and Technology, Alfred Wegener Institute, Helmholtz Centre for Polar and Marine Research, Bremerhaven, Germany A haloalkaline anaerobic microbial community obtained from soda lake sediments was Edited by: Mark Alexander Lever, used to inoculate anaerobic reactors for the production of methane rich biogas. The ETH Zürich, Switzerland microalga Spirulina was successfully digested by the haloalkaline microbial consortium + Reviewed by: at alkaline conditions (pH 10, 2.0 M Na ). Continuous biogas production was observed Aharon Oren, and the obtained biogas was rich in methane, up to 96%. Alkaline medium acted The Hebrew University of Jerusalem, Israel as a CO2 scrubber which resulted in low amounts of CO2 and no traces of H2S Ronald Oremland, in the produced biogas. A hydraulic retention time (HRT) of 15 days and 0.25 g United States Geological Survey, USA Spirulina L−1 day−1 organic loading rate (OLR) were identified as the optimal operational *Correspondence: Vímac Nolla-Ardèvol, parameters. Metagenomic and metatranscriptomic analysis showed that the hydrolysis Institute for Genome Research and of the supplied substrate was mainly carried out by Bacteroidetes of the “ML635J-40 Systems Biology, Center for aquatic group” while the hydrogenotrophic pathway was the main producer of methane Biotechnology, University of Bielefeld, Office G2-152, Universitätstraße 27, in a methanogenic community dominated by Methanocalculus.
    [Show full text]
  • Methanosaeta Pelagica" Sp
    Aceticlastic and NaCl-Requiring Methanogen "Methanosaeta pelagica" sp. nov., Isolated from Marine Tidal Flat Title Sediment Author(s) Mori, Koji; Iino, Takao; Suzuki, Ken-Ichiro; Yamaguchi, Kaoru; Kamagata, Yoichi Applied and Environmental Microbiology, 78(9), 3416-3423 Citation https://doi.org/10.1128/AEM.07484-11 Issue Date 2012-05 Doc URL http://hdl.handle.net/2115/50384 Rights © 2012 by the American Society for Microbiology Type article (author version) File Information AEM78-9_3416-3423.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP Mori et al. Title 2 Aceticlastic and NaCl-requiring methanogen “Methanosaeta pelagica” sp. nov., isolated from marine tidal flat sediment. 4 Authors 6 Koji Mori,1 Takao Iino,2 Ken-ichiro Suzuki,1 Kaoru Yamaguchi1 & Yoichi Kamagata3 1NITE Biological Resource Center (NBRC), National Institute of Technology and Evaluation (NITE), 8 2-5-8 Kazusakamatari, Kisarazu, Chiba 292-0818, Japan 2Japan Collection of Microorganisms, RIKEN BioResource Center, 2-1 Hirosawa, Wako, Saitama 10 351-0198, Japan 3Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology 12 (AIST), Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki 400-8511, Japan 14 Corresponding author Koji Mori 16 NITE Biological Resource Center (NBRC), National Institute of Technology and Evaluation (NITE), 2-5-8 Kazusakamatari, Kisarazu, Chiba 292-0818, Japan 18 Tel, +81-438-20-5763; Fax, +81-438-52-2329; E-mail, [email protected] 20 Running title Marine aceticlastic methanogen, Methanosaeta pelagica 22 1 Mori et al. 2 ABSTRACT Acetate is a key compound for anaerobic organic matter degradation, and so far, two genera, 4 Methanosaeta and Methanosarcina, are only contributors for acetate degradation among methanogens.
    [Show full text]
  • Archaeology of Eukaryotic DNA Replication
    Downloaded from http://cshperspectives.cshlp.org/ on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Archaeology of Eukaryotic DNA Replication Kira S. Makarova and Eugene V. Koonin National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland 20894 Correspondence: [email protected] Recent advances in the characterization of the archaeal DNA replication system together with comparative genomic analysis have led to the identification of several previously un- characterized archaeal proteins involved in replication and currently reveal a nearly com- plete correspondence between the components of the archaeal and eukaryotic replication machineries. It can be inferred that the archaeal ancestor of eukaryotes and even the last common ancestor of all extant archaea possessed replication machineries that were compa- rable in complexity to the eukaryotic replication system. The eukaryotic replication system encompasses multiple paralogs of ancestral components such that heteromeric complexes in eukaryotes replace archaeal homomeric complexes, apparently along with subfunctionali- zation of the eukaryotic complex subunits. In the archaea, parallel, lineage-specific dupli- cations of many genes encoding replication machinery components are detectable as well; most of these archaeal paralogs remain to be functionally characterized. The archaeal rep- lication system shows remarkable plasticity whereby even some essential components such as DNA polymerase and single-stranded DNA-binding protein are displaced by unrelated proteins with analogous activities in some lineages. ouble-stranded DNA is the molecule that Okazaki fragments (Kornberg and Baker 2005; Dcarries genetic information in all cellular Barry and Bell 2006; Hamdan and Richardson life-forms; thus, replication of this genetic ma- 2009; Hamdan and van Oijen 2010).
    [Show full text]
  • Evidence of Active Methanogen Communities in Shallow Sediments
    Evidence of active methanogen communities in shallow sediments of the Sonora Margin cold seeps Adrien Vigneron, St´ephaneL'Haridon, Anne Godfroy, Erwan Roussel, Barry A Cragg, R. John Parkes, Laurent Toffin To cite this version: Adrien Vigneron, St´ephaneL'Haridon, Anne Godfroy, Erwan Roussel, Barry A Cragg, et al.. Evidence of active methanogen communities in shallow sediments of the Sonora Margin cold seeps. Applied and Environmental Microbiology, American Society for Microbiology, 2015, 81 (10), pp.3451-3459. <10.1128/AEM.00147-15>. <hal-01144705> HAL Id: hal-01144705 http://hal.univ-brest.fr/hal-01144705 Submitted on 23 Apr 2015 HAL is a multi-disciplinary open access L'archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destin´eeau d´ep^otet `ala diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publi´esou non, lished or not. The documents may come from ´emanant des ´etablissements d'enseignement et de teaching and research institutions in France or recherche fran¸caisou ´etrangers,des laboratoires abroad, or from public or private research centers. publics ou priv´es. Distributed under a Creative Commons Attribution - NonCommercial 4.0 International License Evidence of Active Methanogen Communities in Shallow Sediments of the Sonora Margin Cold Seeps Adrien Vigneron,a,b,c,e Stéphane L’Haridon,b,c Anne Godfroy,a,b,c Erwan G. Roussel,a,b,c,d Barry A. Cragg,d R. John Parkes,d Downloaded from Laurent Toffina,b,c Ifremer, Laboratoire de Microbiologie
    [Show full text]
  • Yu-Chen Ling and John W. Moreau
    Microbial Distribution and Activity in a Coastal Acid Sulfate Soil System Introduction: Bioremediation in Yu-Chen Ling and John W. Moreau coastal acid sulfate soil systems Method A Coastal acid sulfate soil (CASS) systems were School of Earth Sciences, University of Melbourne, Melbourne, VIC 3010, Australia formed when people drained the coastal area Microbial distribution controlled by environmental parameters Microbial activity showed two patterns exposing the soil to the air. Drainage makes iron Microbial structures can be grouped into three zones based on the highest similarity between samples (Fig. 4). Abundant populations, such as Deltaproteobacteria, kept constant activity across tidal cycling, whereas rare sulfides oxidize and release acidity to the These three zones were consistent with their geological background (Fig. 5). Zone 1: Organic horizon, had the populations changed activity response to environmental variations. Activity = cDNA/DNA environment, low pH pore water further dissolved lowest pH value. Zone 2: surface tidal zone, was influenced the most by tidal activity. Zone 3: Sulfuric zone, Abundant populations: the heavy metals. The acidity and toxic metals then Method A Deltaproteobacteria Deltaproteobacteria this area got neutralized the most. contaminate coastal and nearby ecosystems and Method B 1.5 cause environmental problems, such as fish kills, 1.5 decreased rice yields, release of greenhouse gases, Chloroflexi and construction damage. In Australia, there is Gammaproteobacteria Gammaproteobacteria about a $10 billion “legacy” from acid sulfate soils, Chloroflexi even though Australia is only occupied by around 1.0 1.0 Cyanobacteria,@ Acidobacteria Acidobacteria Alphaproteobacteria 18% of the global acid sulfate soils. Chloroplast Zetaproteobacteria Rare populations: Alphaproteobacteria Method A log(RNA(%)+1) Zetaproteobacteria log(RNA(%)+1) Method C Method B 0.5 0.5 Cyanobacteria,@ Bacteroidetes Chloroplast Firmicutes Firmicutes Bacteroidetes Planctomycetes Planctomycetes Ac8nobacteria Fig.
    [Show full text]
  • Insights Into Archaeal Evolution and Symbiosis from the Genomes of a Nanoarchaeon and Its Inferred Crenarchaeal Host from Obsidian Pool, Yellowstone National Park
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Microbiology Publications and Other Works Microbiology 4-22-2013 Insights into archaeal evolution and symbiosis from the genomes of a nanoarchaeon and its inferred crenarchaeal host from Obsidian Pool, Yellowstone National Park Mircea Podar University of Tennessee - Knoxville, [email protected] Kira S. Makarova National Institutes of Health David E. Graham University of Tennessee - Knoxville, [email protected] Yuri I. Wolf National Institutes of Health Eugene V. Koonin National Institutes of Health See next page for additional authors Follow this and additional works at: https://trace.tennessee.edu/utk_micrpubs Part of the Microbiology Commons Recommended Citation Biology Direct 2013, 8:9 doi:10.1186/1745-6150-8-9 This Article is brought to you for free and open access by the Microbiology at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Microbiology Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Authors Mircea Podar, Kira S. Makarova, David E. Graham, Yuri I. Wolf, Eugene V. Koonin, and Anna-Louise Reysenbach This article is available at TRACE: Tennessee Research and Creative Exchange: https://trace.tennessee.edu/ utk_micrpubs/44 Podar et al. Biology Direct 2013, 8:9 http://www.biology-direct.com/content/8/1/9 RESEARCH Open Access Insights into archaeal evolution and symbiosis from the genomes of a nanoarchaeon and its inferred crenarchaeal host from Obsidian Pool, Yellowstone National Park Mircea Podar1,2*, Kira S Makarova3, David E Graham1,2, Yuri I Wolf3, Eugene V Koonin3 and Anna-Louise Reysenbach4 Abstract Background: A single cultured marine organism, Nanoarchaeum equitans, represents the Nanoarchaeota branch of symbiotic Archaea, with a highly reduced genome and unusual features such as multiple split genes.
    [Show full text]
  • Evidence of Active Methanogen Communities in Shallow Sediments of the Sonora
    AEM Accepted Manuscript Posted Online 13 March 2015 Appl. Environ. Microbiol. doi:10.1128/AEM.00147-15 Copyright © 2015, American Society for Microbiology. All Rights Reserved. 1 Evidence of active methanogen communities in shallow sediments of the Sonora 2 Margin cold seeps 3 4 Adrien Vigneron#1235, Stéphane L'Haridon23, Anne Godfroy123, Erwan G. Roussel1234, Barry A. 5 Cragg4, R. John Parkes4 and Laurent Toffin123 6 1Ifremer, Laboratoire de Microbiologie des Environnements Extrêmes, UMR6197, 7 Technopôle Brest Iroise, BP70, Plouzané, France 8 2Université de Bretagne Occidentale, Laboratoire de Microbiologie des Environnements 9 Extrêmes, UMR6197, Technopôle Brest Iroise, BP70, Plouzané, France 10 3CNRS, Laboratoire de Microbiologie des Environnements Extrêmes, UMR6197, Technopôle 11 Brest Iroise, BP70, Plouzané, France 12 4School of Earth and Ocean Sciences, Cardiff University, Cardiff CF10 3AT, United Kingdom 13 5School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne 14 NE1 7RU, United Kingdom 15 Running Title: Methanogens in the Sonora Margin sediments 16 Keywords: Archaea / methanogenesis / Guaymas Basin / Methanococcoides / 17 Methanogenium 18 Contact of corresponding author: Dr. Adrien Vigneron ; [email protected] ; tel :+33 19 298 224 396 ; fax +33 298 224 557 20 Abstract 21 In the Sonora Margin cold seep ecosystems (Gulf of California), sediments underlying 22 microbial mats harbor high biogenic methane concentrations, fuelling various microbial 23 communities such as abundant lineages of Anaerobic Methanotrophs (ANME). However 1 24 biodiversity, distribution and metabolism of the microorganisms producing this methane 25 remain poorly understood. In this study, measurements of methanogenesis using 26 radiolabelled dimethylamine, bicarbonate and acetate showed that biogenic methane 27 production in these sediments was mainly dominated by methylotrophic methanogenesis, 28 while the proportion of autotrophic methanogenesis increased with depth.
    [Show full text]
  • Microbial Community Structures of an Offshore and Near-Shore Oil Production Facilities After Biocide Treatment and the Potential to Induce Souring and Corrosion
    Vol. 11(5), pp. 171-184, 7 February, 2017 DOI: 10.5897/AJMR2016.7984 Article Number: 2C2817E62589 ISSN 1996-0808 African Journal of Microbiology Research Copyright © 2017 Author(s) retain the copyright of this article http://www.academicjournals.org/AJMR Full Length Research Paper Microbial community structures of an offshore and near-shore oil production facilities after biocide treatment and the potential to induce souring and corrosion Chuma C. Okoro1*, Oluseye A. Ekun2 and Michael I. Nwume2 1Department of Biology, Microbiology and Biotechnology, Federal University, Ndufu-Alike, Ikwo, Ebonyi State, Nigeria. 2Chevron Nigeria Limited, Lagos, Nigeria. Received 27 February, 2016; Accepted 27 June, 2016 Microbial communities of six samples from Escravos and Meren oil production facility in Nigeria were examined after biocide treatment using cultural and molecular approaches. Sulfate reducing bacteria (SRB) count and activity were the highest in skimmer pit samples (1N1) which was affiliated with Euryarchchaeota (44%) and Proteobacteria (39%). Treatment of Meren injection water (1N2) with biocides significantly reduced SRB population (102 cell/ml). Sample 1N3 (produced water discharge area) and 1N5 (treated produced water) were dominated by 70.79 and 52% Euryarchaeota, respectively. 1N4 (partially treated produced water) was dominated by Euryarchaeota (51.78%) and Proteobacteria (38%), while 1N6 (produced oil) was dominated by Proteobacteria (28%) and Euryarchaeota (62.6%). Metabolic activities in 1N1, 1N4 and 1N5 were dominated by sulfate reduction and methanogenesis; however, that of 1N2 was dominated only by sulfate reduction, while 1N3 and 1N6 were dominated by methanogenesis. Anaerobic incubation of 1N1 samples gave relatively higher corrosion rates (0.065 mm/year) while 1N2, 1N3 and 1N5 gave moderate corrosion rates (0.018 to 0.037 mm/year).
    [Show full text]