MAIMUUN MUNTANTUS009855303B2 UN AN TO THEMAN UNITI (12 ) United States Patent ( 10 ) Patent No. : US 9 , 855 ,303 B2 McKenzie et al. (45 ) Date of Patent: * Jan . 2 , 2018 (54 ) COMPOSITIONS AND METHODS (58 ) Field of Classification Search ??? . A61K 35 /742 (71 ) Applicant : SERES THERAPEUTICS , INC ., See application file for complete search history . Cambridge, MA (US ) (72 ) Inventors : Gregory McKenzie , Arlington , MA ( 56 ) References Cited (US ) ; Mary - Jane Lombardo McKenzie , Arlington , MA (US ) ; David U . S . PATENT DOCUMENTS N . Cook , Brooklyn , NY (US ) ; Marin 3 ,009 , 864 A 11 / 1961 Gordon - Aldterton et al. Vulic , Boston , MA (US ) ; Geoffrey von 3 ,228 , 838 A 1 / 1966 Rinfret Maltzahn , Boston , MA (US ); Brian 3 ,608 , 030 A 9 / 1971 Tint Goodman , Boston , MA (US ) ; John 4 ,077 , 227 A 3 / 1978 Larson Grant Aunins , Doylestown , PA (US ) ; 4 , 205 , 132 A 5 / 1980 Sandine Matthew R . Henn , Somerville , MA 4 ,655 ,047 A 4 /1987 Temple (US ); David Arthur Berry , Brookline , 4 ,689 , 226 A 8 / 1987 Nurmi MA (US ) ; Jonathan Winkler , Boston , 4 ,839 , 281 A 6 / 1989 Gorbach et al . 5 , 196 , 205 A 3 / 1993 Borody MA (US ) 5 , 425 , 951 A 6 / 1995 Goodrich 5 ,436 ,002 A 7 / 1995 Payne (73 ) Assignee : Seres Therapeutics, Inc ., Cambridge , 5 ,443 ,826 A 8 / 1995 Borody MA (US ) 5 , 599 , 795 A 2 / 1997 McCann 5 ,648 ,206 A 7 / 1997 Goodrich ( * ) Notice : Subject to any disclaimer , the term of this 5 , 951 , 977 A 9 / 1999 Nisbet et al. patent is extended or adjusted under 35 5 , 965 , 128 A 10 / 1999 Doyle et al . U . S .C . 154 (b ) by 0 days . 6 ,589 ,771 B1 7 / 2003 Marshall 6 ,645 , 530 B1 11/ 2003 Borody This patent is subject to a terminal dis 7 , 427, 398 B2 9 /2008 Baillon et al. claimer . 7 ,628 , 982 B2 12 / 2009 Klaviniskis 7 , 632 , 520 B2 12 / 2009 Khandelwal 7 ,708 , 988 B2 5 / 2010 Farmer (21 ) Appl . No. : 15 /415 , 745 7 , 731 , 976 B2 6 / 2010 Cobb 7 ,763 , 420 B2 7 / 2010 Stritzker et al . (22 ) Filed : Jan . 25 , 2017 7 , 981 , 411 B2 7 / 2011 Nadeau et al . 7 , 998 , 473 B2 8 / 2011 Boileau et al . (65 ) Prior Publication Data 8 ,021 ,654 B2 9 / 2011 Rehberger et al. US 2017 /0196914 A1 Jul. 13 , 2017 (Continued ) Related U . S . Application Data FOREIGN PATENT DOCUMENTS (60 ) Continuation of application No. 14 /884 ,655 , filed on CN 102131928 A 7 /2011 Oct. 15 , 2015 , now Pat . No . 9 , 585 , 921 , which is a EA | 006847 B1 4 /2006 continuation of application No. 14 / 313 , 828 , filed on (Continued ) Jun . 24 , 2014 , now Pat. No . 9 ,180 ,147 , which is a division of application No. 14 / 197 ,044 , filed on Mar . 4 , 2014 , now Pat. No . 9 ,011 , 834 , which is a OTHER PUBLICATIONS continuation of application No . AAS , J. , Gessert , C . E ., and Bakken , J. S . ( 2003) . Recurrent PCT/ US2014 /014745 , filed on Feb . 4 , 2014 . Clostridium difficile colitis : case series involving 18 patients treated (60 ) Provisional application No. 61/ 926 ,918 , filed on Jan . with donor stool administered via a nasogastric tube. Clinical 13 , 2014 , provisional application No. 61 / 760 ,585 , Infectious Diseases 36 (5 ), 580 -585 . filed on Feb . 4 , 2013 , provisional application No . ( Continued ) 61/ 760 ,584 , filed on Feb . 4 , 2013 , provisional application No. 61/ 760, 574 , filed on Feb . 4 , 2013 , provisional application No. 61/ 760 ,606 , filed on Feb . Primary Examiner — Albert M Navarro 4 , 2013 . ( 74 ) Attorney, Agent, or Firm — Fenwick & West LLP (51 ) Int. Ci. C12N 3 /00 ( 2006 . 01 ) ( 57 ) ABSTRACT A61K 35 /742 ( 2015 . 01 ) A61K 9 /48 ( 2006 .01 ) Disclosed herein are therapeutic compositions containing A61K 35 /37 ( 2015 . 01 ) non - pathogenic , germination - competent bacterial spores , A61K 9 /00 ( 2006 .01 ) for the prevention , control, and treatment of gastrointestinal A61K 45 /06 ( 2006 .01 ) diseases , disorders and conditions and for general nutritional (52 ) U . S . CI. health . CPC ...... A61K 35 / 742 ( 2013 .01 ) ; A61K 9 /0053 (2013 .01 ) ; A61K 9 /48 (2013 .01 ); A61K 35/ 37 ( 2013 .01 ) ; A61K 45 / 06 ( 2013 .01 ) 26 Claims, 21 Drawing Sheets US 9, 855 ,303 B2 Page 2
(56 ) References Cited EP 2750682 B1 . 5 / 2016 JP 5 019563 B2 9 / 2012 U . S . PATENT DOCUMENTS RU 2035186 C1 5 / 1995 RU 2439145 C2 1 / 2012 8 , 034 ,601 B2 10 / 2011 Boileau WO WO 90 /01335 A1 2 / 1990 8 ,039 , 006 B2 10 / 2011 Prato WO WO 1997 /009886 Al 3 / 1997 8 ,147 , 482 B2 4 / 2012 Shimizu WO WO 98 / 26787 Al 6 / 1998 8, 187 ,590 B2 5 /2012 Farmer WO WO 2000 /010582 A2 3 / 2000 8 , 236 , 508 B2 8 / 2012 Mutharasan wo WO 01 / 93904 Al 12 / 2001 8 , 388, 996 B2 3 / 2013 Gehling WO WO 2002 /007741 A1 1/ 2002 8 , 460 , 648 B2 6 /2013 Borody WO WO 02 /43649 A2 6 / 2002 8 ,906 , 668 B2 12 / 2014 Henn et al. WO WO 2005 /017095 A2 2 /2005 9 , 011 , 834 B1 4 /2015 McKenzie et al. WO WO 2005 / 110445 A2 11/ 2005 9 , 028 , 841 B2 5 / 2015 Henn et al . WO WO 2006 / 012586 A2 2 / 2006 9 ,180 ,147 B2 11/ 2015 McKenzie et al. WO WO 2007 /036230 Al 4 /2007 9 ,408 , 872 B2 8 / 2016 Borody WO WO 2007 / 136553 A2 11/ 2007 9 , 446, 080 B2 9 /2016 McKenzie et al . WO WO 2008 /076696 A2 6 / 2008 2001/ 0036453 A1 11 / 2001 Reid WO WO 2008 /083157 A2 7 / 2008 2004 / 0028689 AL 2 / 2004 Borody WO WO 2010 /030997 A1 3 / 2010 2004 /0170617 A1 9 / 2004 Finegold WO WO 2010 / 062369 A2 6 / 2010 2005 / 0048515 Al 3 / 2005 Garner WO WO 2010 / 124387 Al 11/ 2010 2005 / 0180962 AL 8 / 2005 Raz WO WO 2010 / 151842 A2 12 / 2010 2006 / 0046246 AL 3 / 2006 Zeng et al. WO WO 2011 / 005756 A1 1 / 2011 2006 /0188523 Al 8 / 2006 Pei WO WO 2011 /022542 A2 2 / 2011 2006 / 0233830 Al 10 / 2006 Wong WO WO 2011022660 A1 2 / 2011 2007 /0141139 A1 6 / 2007 Vandenberg WO WO 2011 /033310 Al 3 / 2011 2008 /0213752 Al 9 / 2008 Stave et al. WO WO 2011 /043654 Al 4 / 2011 2009 /0197249 A1 8 / 2009 Gillevet WO WO 2011 /046616 A3 4 /2011 2010 / 0074872 A1 3 / 2010 Blaser et al. WO WO 2011 /094027 A1 8 / 2011 2010 /0215745 A1 8 / 2010 Lazzari et al. WO WO 2011 / 103123 A2 8 / 2011 2011/ 0081320 A1 4 /2011 Westall et al. WO WO 2011 / 107482 A2 9 / 2011 2011 /0113863 Al 5 /2011 Fuhrmann et al. WO WO 2011/ 113801 A1 9 / 2011 2011/ 0189132 A1 8 / 2011 Garner et al. WO WO 2011107481 A2 9 / 2011 2011/ 0280840 A1 11 / 2011 Blaser WO WO 2011 / 152566 A2 12/ 2011 2012 / 0020950 A 1 / 2012 Davis et al. WO WO 2012 /009712 A2 1 / 2012 2012 /0021429 AL 1 / 2012 Rublee WO WO 2012 /016287 A2 2 / 2012 2012 /0021921 A1 1 / 2012 Scott WO WO 2012 / 033814 A2 3 / 2012 2012 / 0058094 Al 3 / 2012 Blaser WO WO 2012 /045150 A1 4 / 2012 2012 / 0064592 Al 3 / 2012 O 'Mullan et al. WO WO 2012 /064981 A2 5 / 2012 2012 /0128633 A1 5 / 2012 Veiga et al. WO WO 2012 / 108830 A1 8 / 2012 2012 /0128634 A1 5 /2012 Veiga WO WO 2012 / 116289 A2 8 / 2012 2012 /0148629 A1 6 / 2012 Holvoet et al. WO WO 2012 / 122478 AL 9 /2012 2012 /0149584 Al 6 / 2012 Olle wo WO 2012 / 122522 A2 9 / 2012 2012 /0165215 Al 6 / 2012 Andersen WO WO 2012 / 142605 Al 10 / 2012 2012 /0177650 Al 7 / 2012 Borody wo WO 2012 / 148991 A111/ 2012 2012 / 0207726 A1 8 / 2012 Lipkin WO WO 2012 / 159023 A2 11/ 2012 2012 /0238468 AL 9 / 2012 Tuk WO WO 2013 /019896 A1 2 / 2013 2012 / 0264637 A1 10 / 2012 Brodie wo WO 2013 /032328 Al 3 / 2013 2012 /0276149 AL 11/ 2012 Littman WO WO 2013 / 037067 Al 3 / 2013 2012 / 0276201 AL 11/ 2012 Trachtman WO WO 2013 /037068 3 / 2013 2012 / 0315249 Al 12 / 2012 Olmstead WO WO 2013 /053836 A1 4 / 2013 2013 /0017999 Al 1/ 2013 Fremont WO WO 2013 /080561 Al 6 / 2013 2013 / 0022575 AL 1 / 2013 Cassity WO WO 2013 / 166031 AL 11 / 2013 2013 /0045274 A1 2 / 2013 Hlavka WO WO 2013 / 171515 AL 11 / 2013 2013 /0045874 A1 2 / 2013 Ehrlich WO WO 2013 / 176774 A1 11 / 2013 2013 /0121968 A1 5 / 2013 Quay WO WO 2014 / 082050 AL 5 /2014 2013 /0149339 Al 6 / 2013 Honda WO WO 2015 /095241 A2 6 / 2014 2013 / 0149375 Al 6 / 2013 Geall WO WO 2014 / 121298 A2 8 / 2014 2013 / 0266539 A1 10 / 2013 Borody WO WO 2014 / 121301 A1 8 / 2014 2014 /0045744 AL 2 / 2014 Gordon WO WO 2014 / 121302 A2 8 / 2014 2014 / 0147417 Al 5 / 2014 Sadowsky et al. WO WO 2014 / 121304 Al 8 / 2014 2014 / 0199281 Al 7 / 2014 Henn et al . WO WO 2014 / 145958 A2 9 / 2014 2015 /0190435 A1 7 / 2015 Henn et al. WO WO 2014 / 153194 A2 9 /2014 2016 /0271188 A19 /2016 Berry et al. WO WO 2015 / 077794 A1 5 / 2015 FOREIGN PATENT DOCUMENTS OTHER PUBLICATIONS EP 0033584 A3 1 / 1981 Abrams, R . S ., “ Open -Label , Uncontrolled Trial of Bowel Steriliza EP 0446069 Al 9 / 1991 tion and Repopulation with Normal Bowel Flora for Treatment of EP 0456418 A2 11 / 1991 Inflammatory Bowel Disease , " Current Therapeutic Research , Dec . EP 0433299 A4 4 / 1992 EP 1107772 B1 4 / 2006 1997 , pp . 1001 - 1012 , vol. 58 , No. 12 . EP 1631312 B1 9 / 2008 Achtman , M ., and Wagner , M . ( 2008 ). Microbial diversity and the EP 2337569 A2 6 / 2011 genetic nature of microbial species. Nat. Rev. Microbiol. 6 (6 ), EP 2338989 Al 6 / 2011 431 -440 . EP 2519108 Al 11 /2012 Accoceberry , I . et al ., “ One - Step Purification of Enterocytozoon EP 2684469 A1 1 / 2014 Bieneusi Spores from Human Stools by Immunoaffinity Expanded EP 0479820 B1 7 / 2014 Bed Adsorption , ” Journal of Clinical Microbiology, May 2001 , pp . EP 2626076 AL 8 / 2014 1974 - 1951 , vol. 39 , No . 5 . US 9 , 855 , 303 B2 Page 3
( 56 ) References Cited filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat Methods 10 ( 1 ) , 57 - 59 . OTHER PUBLICATIONS Bolivar, I. et al ., “ Bacterial Diversity in Oral Samples of Children in Niger with Acute Noma, Acute Necrotizing Gingivitis and Allen - Vercoe, E ., Reid , G ., Viner, N ., Gloor, G . B ., Hota , S ., Kim , P. , Healthy Controls , ” PLOS Neglected Tropical Diseases , Mar. 2012 , Lee , C ., O 'Doherty , K . , Vanner , S . J ., Weese , J. S . , et al . ( 2012 ) . A pp . 1 - 11, vol. 6 , No . 3 , E1556 ; Uncultured Catonella sp . partial 16S Canadian Working Group report on fecal microbial therapy : micro rRNA Gene , Clone 402A04 ( oral) : Nucleotide : NCBI: GenBank : bial ecosystems therapeutics . Can . J . Gastroenterol. 26 ( 7 ) , 457 - 462 . AM420133 . 1 , last accessed Mar. 12 , 2014 , pp . 12 - 13 Allen - Vercoe, E ., Strauss, J. , and Chadee , K . ( 2011 ). Fusobacterium Borody, T. J . et al . (2011 ). Fecal microbiota transplantation (FMT ) in nucleatum : an emerging gut pathogen ? Gut Microbes 2 (5 ), 294 -298 . multiple sclerosis . Poster abstract at American College of Gastro Anderson , K . F ., Lonsway, D . R . , Rasheed , J . K ., Biddle, J . , Jensen , enterology Annual Scientific Meeting and Postgraduate Course Oct. B ., McDougal, L . K . , Carey, R . B ., Thompson , A . , Stocker, S . , 28 , 2011. Limbago , B . , et al. ( 2007 ) . Evaluation of Methods to Identify the Borody, T. J . , and Khoruts, A . ( 2012 ). Fecal microbiota transplan Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae . J . tation and emerging applications. Nat Rev Gastroenterol Hepatol Clin . Microbiol . 45 ( 8 ) , 2723 - 2725 . 9 ( 2 ) , 88 - 96 . Arumugam , M ., Raes , J. , Pelletier , E ., Paslier, D . L ., Yamada, T. , Borriello , S . P . ( 1990 ) . The influence of the normal flora on Mende, D . R ., Fernandes, G . R ., Tap , J . , Bruls , T . , Batto , J . - M . , et al. Clostridium difficile colonisation of the gut. Ann . Med . 22 ( 1) , (2011 ) . Enterotypes of the human gut microbiome. Nature 61 -67 . 473 ( 7346 ), 174 - 180 . Borriello , S . P ., and Barclay, F . E . ( 1985 ) . Protection of hamsters Atarashi, K ., Tanoue, T ., Oshima, K ., Suda , W . , Nagano , Y. , against Clostridium difficile ileocaecitis by prior colonisation with Nishikawa , H ., Fukuda, S ., Saito , T ., Narushima, S . , Hase , K . , et al . non -pathogenic strains. J Med Microbiol 19 (3 ), 339 - 350 . (2013 ) . Treg induction by a rationally selected mixture of Clostridia Borriello , S . P ., and Barclay , F . E . (1986 ) . An in - vitro model of strains from the human microbiota . Nature 500 (7461 ) , 232 -236 . colonisation resistance to Clostridium difficile infection . Journal of Atarashi, K ., Tanoue , T . , Shima, T . , Imaoka , A . , Kuwahara , T . , Medical Microbiology 21 ( 4 ) , 299 - 309 . Momose , Y ., Cheng , G ., Yamasaki, S ., Saito , T ., Ohba , Y . , et al . Borriello , S . P . , and Honour, P . ( 1981) . Simplified procedure for the ( 2011 ) . Induction of colonic regulatory T cells by indigenous routine isolation of Clostridium difficile from faeces . J Clin Pathol Clostridium species . Science 331 (6015 ) , 337 - 341 . Australian First Examination Report , Australian Application No . 34 ( 10 ) , 1124 - 1127 . 2013347805, Apr. 13 , 2017 , 3 pages . Boyles , W .A ., and Lincoln , R . E . (1958 ). Separation and concentra Backhed , F . et al. , (2004 ) . The gut microbiota as an environmental tion of bacterial spores and vegetative cells by foam flotation . Appl factor that regulates fat storage , PNAS, Nov . 2 , 2014 , pp . 15718 Microbiol 6 ( 5 ) , 327 - 334 . 15723 , vol. 101, No . 44 . Brandt, L . J . ( 2012 ) . Fecal Transplantation for the Treatment of Bader, J ., Albin , A . , and Stahl, U . ( 2012 ) . Spore -forming bacteria Clostridium difficile Infection . Gastroenterol Hepatol ( N Y ) 8 ( 3 ) , and their utilisation as probiotics . Benef Microbes 3 ( 1) , 67 -75 . 191 - 194 . Bakken , J . S . (2009 ) . Fecal bacteriotherapy for recurrent Clostridium Brandt , L .J ., Aroniadis, O .C ., Mellow , M ., Kanatzar, A ., Kelly , C ., difficile infection . Anaerobe 15 ( 6 ) , 285 - 289 . Park , T. , Stollman , N ., Rohlke , F. , and Surawicz , C . (2012 ) . Long Bakken , J. S . , Borody, T . , Brandt , L . J ., Brill, J. V ., Demarco , D . C . , Term Follow -Up of Colonoscopic Fecal Microbiota Transplant for Franzos, M . A ., Kelly , C ., Khoruts , A ., Louie , T ., Martinelli, L . P ., et Recurrent Clostridium difficile Infection . The American Journal of al. (2011 ) . Treating Clostridium difficile infection with fecal Gastroenterology 107 ( 7 ) , 1079 - 1087 . microbiota transplantation . Clin . Gastroenterol. Hepatol. 9 ( 12 ), Bräauniger, S ., Peters , J . , Borchers, U . , and Kao , M . (2000 ) . Further 1044 - 1049 . studies on thermal resistance ofbovine parvovirus against moist and Barreau , M . , Pagnier, I ., and La Scola , B . ( 2013 ) . Improving the dry heat . International Journal of Hygiene and Environmental identification of anaerobes in the clinical microbiology laboratory Health 203 ( 1 ) , 71 - 75 . through MALDI- TOF mass spectrometry . Anaerobe 22 , 123 - 125 . Broda , D . M . , De Lacy, K . M . , and Bell , R .G . ( 1998 ) . Efficacy of heat Bauer, T . M . et al. , “ Derivation and Validation of Guidelines for and ethanol spore treatments for the isolation of psychrotrophic Stool Cultures for Enteropathogenic Bacteria Other Than Clostridium spp . associated with the spoilage of chilled vacuum Clostridium difficile in Hospitalized Adults ,” The Journal of the packed meats . International Journal of Food Microbiology 39 ( 1 - 2 ) , American Medical Association , Jan . 17 , 2001, pp . 313 - 319 , vol . 61- 68 . 285 . Brosius , J . et al ., “ Complete Nucleotide Sequence of a 16S Ribo Ben - Amor, K ., Heilig, H ., Smidt, H ., Vaughan , E .E ., Abee, T. , and somal RNA Gene from Eschericia coli ,” Proc . Natl . Acad . Sci ., Oct. De Vos, W . M . (2005 ) . Genetic diversity of viable , injured , and dead 1978 , pp . 4801 -4805 , vol. 75 , No . 10 . fecal bacteria assessed by fluorescence -activated cell sorting and Bueche , M . , Wunderlin , T ., Roussel -Delif , L ., Junier , T . , Sauvain , 16S rRNA gene analysis . Applied and Environmental Microbiology L ., Jeanneret , N ., and Junier, P . (2013 ) . Quantification of 71 ( 8 ) , 4679 -4689 . Endospore - Forming Firmicutes by Quantitative PCR with the Func Berstad , A . et al. , “ Fecal Fat Determination with a Modified tional Gene spo0A . Applied and Environmental Microbiology Titration Method ,” Scandinavian Journal of Gastroenterology , 79 ( 17 ) , 5302 -5312 . 2010 , pp . 603 -607 , vol. 45 . Buffie , C . G . , and Pamer, E . G . (2013 ) . Microbiota -mediated colo Bhatia, A . et al ., “ Proionibacterium Acnes and Chronic Diseases, " nization resistance against intestinal pathogens. Nature Reviews The Infectious Etiology of Chronic Diseases: Defining the Rela Immunology 13 ( 11) , 790 - 801. tionship , Enhancing the Research , and Mitigating the Effects: Burke , C . J . , Hsu , T . A ., and Volkin , D . B . ( 1999 ) . Formulation , Workshop Summary ., Knobler, S . L . et al. ( eds. ) , 2004 , pp . 74 - 80 , stability, and delivery of live attenuated vaccines for human use . may be downloaded at < URL :http :/ /www .nap . edu /catalog / 11026 . Crit Rev Ther Drug Carrier Syst 16 ( 1 ) , 1 - 83 . html> Cani, P . D . , Possemiers , S ., Wiele , T . V . De, Guiot, Y ., Everard , A . , Bidawid , S ., Farber , J . M ., Sattar , S . A . , and Hayward , S . (2000 ) . Rottier, O . , Geurts, L ., Naslain , D . , Neyrinck , A ., Lambert , D . M . , et Heat inactivation of hepatitis A virus in dairy foods. J. Food Prot. al. (2009 ). Changes in gut microbiota control inflammation in obese 63 ( 4 ) , 522 -528 . mice through a mechanism involving GLP - 2 - driven improvement Bloedt, K . , Riecker, M . , Poppert, S ., and Wellinghausen , N . ( 2009 ) . of gut permeability . Gut 58 (8 ) , 1091 - 1103 . Evaluation of new selective culture media and a rapid fluorescence Carvalho , A . S . , Silva , J . , Ho , P . , Teixeira , P . , Malcata , F . X . , and in situ hybridization assay for identification of Clostridium difficile Gibbs , P . ( 2008 ) . Effects of Various Sugars Added to Growth and from stool samples. J Med Microbiol 58 ( 7 ) , 874 - 877 . Drying Media upon Thermotolerance and Survival throughout Bokulich , N . A ., Subramanian , S ., Faith , J. J . , Gevers, D ., Gordon , Storage of Freeze -Dried Lactobacillus delbrueckii ssp . Bulgaricus . J . I . , Knight, R . , Mills , D . A ., and Caporaso , J. G . (2013 ) . Quality Biotechnology Progress 20 ( 1) , 248 -254 . US 9, 855 ,303 B2 Page 4
( 56 ) References Cited Detmer, A . , and Glenting, J . ( 2006 ) . Live bacterial vaccines - a review and identification of potential hazards. Microb Cell Fact 5 , OTHER PUBLICATIONS 23. Dharmani, P . , De Simone , C . , and Chadee , K . (2013 ) . The Probiotic Champagne, C . P ., Mondou , F ., Raymond , Y ., and Roy, D . ( 1996 ) . Mixture VSL # 3 Accelerates Gastric Ulcer Healing by Stimulating Effect of polymers and storage temperature on the stability of Vascular Endothelial Growth Factor. PLoS ONE 8 ( 3 ) , e58671 . freeze- dried lactic acid bacteria . Food Research International 29 ( 5 Dietrich , G . , Collioud , A . , and Rothen , S . A . ( 2008 ) . Developing and 6 ), 555 - 562. Manufacturing Attenuated Live Bacterial Vaccines.
( 56 ) References Cited Gough , E . et al ., " Systematic Review of Intestinal Microbiota Transplantation ( Fecal Bacteriotherapy) for Recurrent Clostridium OTHER PUBLICATIONS Dfficile Infection ,” Clin . Infect. Dis ., Nov. 15 , 2011, pp . 994 - 1002 , vol . 53 , No . 10 . N .M ., et al . (2013 ) . Cross -talk between Akkermansia muciniphila Gould , G . W ., and Sale , A . J . ( 1970 ) . Initiation of germination of and intestinal epithelium controls diet- induced obesity . Proceedings bacterial spores by hydrostatic pressure . J . Gen . Microbiol. 60 ( 3 ) , of the National Academy of Sciences 110 ( 22 ) , 9066 - 9071 . 335 - 346 . Fairhead , H . , Setlow , B ., Waites , W . M ., and Setlow , P . ( 1994 ) . Grabow , W . O ., Clay, C . G . , Dhaliwal , W . , Vrey , M . A ., and Müller, Small , acid - soluble proteins bound to DNA protect Bacillus subtilis E .E . ( 1999 ). Elimination of viruses, phages, bacteria and spores from being killed by freeze -drying . Applied and Environ Cryptosporidium by a new generation Aquaguard point- of - use mental Microbiology 60 ( 7 ), 2647 - 2649 . water treatment unit . Zentralbl Hyg Umweltmed 202 ( 5 ) , 399 - 410 . Faith , J . J . , Ahern , P . P . , Ridaura , V . K . , Cheng, J ., and Gordon , J . I . Greenway , F ., Wang , S ., and Heiman , M . ( 2014 ) . A novel cobiotic ( 2014 ) . Identifying Gut Microbe — Host Phenotype Relationships containing a prebiotic and an antioxidant augments the glucose Using Combinatorial Communities in Gnotobiotic Mice . Sci Transl control and gastrointestinal tolerability of metformin : a case report . Med 6 ( 220 ) , 220ra11 - 220rall . Beneficial Microbes 5 ( 1 ), 29 - 32 . Fakhry , S . , Sorrentini , I ., Ricca, E ., De Felice , M ., and Baccigalupi, Grehan , M . J ., Borody, T . J ., Leis , S . M . , Campbell , J ., Mitchell, H ., L . (2008 ) . Characterization of spore forming Bacilli isolated from and Wettstein , A . ( 2010 ) . Durable alteration of the colonic the human gastrointestinal tract. Journal of Applied Microbiology microbiota by the administration of donor fecal flora . J . Clin . 105 ( 6 ) , 2178 - 2186 . Gastroenterol. 44 ( 8 ) , 551 - 561 . Faust, et al. , “ Microbial Co -occurrence Relationships in the Human Grimoud , J. et al. , “ In Vitro Screening of Probiotic Lactic Acid Microbiome, ” PLoS Computational Biology, Jul. 2012 , e1002606 , Bacteria and Prebiotic Glucooligosaccharides to Select Effective 17 pages, vol. 8, No . 7 . Synbiotics ,” Anaerobe , Clinical Microbiology , Oct. 2010 , pp . 493 Fell JR ., N . F ., Pellegrino , P . M . , and Gillespie , J . B . ( 2001) . Mitigat 500 , vol . 16 , No . 5 . ing phosphate interference in bacterial endospore detection by Tb Gupta , R . K . et al. , “ Differentiation Between Heat Resistance and dipicolinate photoluminescence. Analytica Chimica Acta 426 ( 1 ) , Octyl Alcohol Resistance of the Cells of Bacillus Cereus T ., " 43 - 50 . Biochemical and Biophysical Research Communications, 1970 , pp . Fichtel, J ., Köster, J ., Rullkötter , J . , and Sass, H . (2007 ) . Spore 23 - 30 , vol. 38 , No . 1 . dipicolinic acid contents used for estimating the number of Halmann , M . et al. , “ Stages in Germination of Spores of Bacillus endospores in sediments . FEMS Microbiology Ecology 61( 3 ) , 522 Lichenformis, ” J. Bacteriol. , 1962 , pp . 1187 - 1193 , vol . 84 . 532 Hamilton , M .J . , Weingarden , A .R ., Sadowsky, M .J . , and Khoruts , A . Fischbach , M . A . , Bluestone , J . A ., and Lim , W . A . ( 2013 ) . Cell ( 2012 ) . Standardized frozen preparation for transplantation of fecal Based Therapeutics : The Next Pillar of Medicine. Sci Transl Med microbiota for recurrent Clostridium difficile infection . Am . J. 5 ( 179 ) , 179ps7 . Gastroenterol. 107 ( 5 ), 761 - 767. Fonseca , F. , Béal, C ., and Corrieu , G . ( 2001) . Operating Conditions Hamilton , M .J . , Weingarden , A .R . , Unno , T. , Khoruts , A ., and That Affect the Resistance of Lactic Acid Bacteria to Freezing and Sadowsky , M .J . ( 2013 ). High - throughput DNA sequence analysis Frozen Storage . Cryobiology 43 ( 3 ) , 189 - 198 . reveals stable engraftment of gut microbiota following transplan Franz , C . M . A . P ., Huch , M . , Abriouel , H ., Holzapfel, W ., and tation of previously frozen fecal bacteria . Gut Microbes 4 ( 2 ) , Gálvez, A . (2011 ) . Enterococci as probiotics and their implications 125 - 135 . in food safety . International Journal of Food Microbiology 151 ( 2 ), Harmsen , H . J . M . , Gibson , G . R . , Elfferich , P ., Raangs , G . C ., 125 - 140 . Wildeboer- Veloo , A . C . M ., Argaiz, A ., Roberfroid , M . B ., and Friedman -Moraco , R . J ., Mehta , A . K ., Lyon , G . M . , and Kraft , C . S . Welling , G . W . ( 2000 ) . Comparison of viable cell counts and ( 2014 ). Fecal Microbiota Transplantation for Refractory fluorescence in situ hybridization using specific rRNA - based probes Clostridium difficile Colitis in Solid Organ Transplant Recipients : for the quantification of human fecal bacteria . FEMS Microbiology Fecal Microbiota Transplantation in Solid Organ Transplant Recipi Letters 183 ( 1 ) , 125 - 129 . ents . American Journal of Transplantation 14 (2 ), 477 -480 . Harrison , F ., “ Bacterial Cooperation in the Wild and in the Clinic : Fuentes, S ., Van Nood , E ., Tims, S . , Heikamp - De Jong, I. , Ter Are Pathogen Social Behaviours Relevant Outside the Laboratory ? " Braak , C . J . , Keller, J. J. , Zoetendal , E . G ., and De Vos , W . M . ( 2014 ) . Bioessays, Dec . 27 , 2012 , pp . 108 - 112 , vol. 35 , No . 2 . Reset of a critically disturbed microbial ecosystem : faecal transplant Hasan , J . A . , Japal, K . M ., Christensen , E . R . , and Samalot- Freire , L .C . (2011 ) . In vitro production of Clostridium difficile spores for in recurrent Clostridium difficile infection . The ISME Journal . use in the efficacy evaluation of disinfectants : a precollaborative GenBank HQ819637 , “ Uncultured Organism Clone ELU0180 - T56 investigation . J AOAC Int 94 ( 1 ) , 259 - 272 . S -NIPCRAMGANa _ 000311 Small Subunit Ribosomal RNA Gene , Hayashi, Y . et al. , “ Western Blot ( Immunoblot ) Assay of Small Partial Sequence , " Jul. 30 , 2012 , 1 page, [ Online ] [ Retrieved on Round - Structured Virus Associated with an Acute Gastroenteritis Aug . 21 , 2014 ] Retrieved from the Internet < URL :http : // www .ncbi . Outbreak in Tokyo , ” Journal of Clinical Microbiology, Aug . 1989 , nlm .nih .gov /nuccore / HQ819637 > . pp . 1728 -1733 , vol . 27 . Gevers , D ., Kugathasan , S ., Denson , L . A ., Vázquez - Baeza , Y . , Van Hell , M ., Bernhofer, C . , Stalzer , P ., Kern , J . M . , and Claassen , E . Treuren , W ., Ren , B . , Schwager , E . , Knights , D . , Song , S . J . , Yassour, ( 2013 ) . Probiotics in Clostridium difficile infection : reviewing the M ., et al. ( 2014 ) . The Treatment- Naive Microbiome in New - Onset need for a multistrain probiotic . Beneficial Microbes 4 ( 1 ) , 39 - 51 . Crohn ' s Disease. Cell Host & Microbe 15 ( 3 ) , 382 - 392. Hemmerling , A ., Harrison , W . , Schroeder, A ., Park , J ., Korn , A ., Gilligan , P . H . (2013 ). Identification of Pathogens by Classical Shiboski , S . , Foster -Rosales , A . , and Cohen , C . R . (2010 ) . Phase 2a Clinical Tests . In the Prokaryotes, E . Rosenberg , E . F. DeLong, S . Study Assessing Colonization Efficiency, Safety , and Acceptability Lory , E . Stackebrandt, and F . Thompson , eds. (Springer Berlin of Lactobacillus crispatus CTV -05 in Women With Bacterial Heidelberg ), pp . 57 - 89 . Vaginosis : Sexually Transmitted Diseases 37 ( 12 ), 745 - 750 . Goodman , A . L ., Kallstrom , G ., Faith , J. J . , Reyes, A ., Moore , A ., Herron , P . R ., and Wellington , E . M . H . ( 1990 ) . New Method for Dantas, G . , and Gordon , J . I . (2011 ) . From the Cover : Extensive Extraction of Streptomycete Spores from Soil and Application to the personal human gut microbiota culture collections characterized and Study of Lysogeny in Sterile Amended and Nonsterile Soil . Appl manipulated in gnotobiotic mice . Proceedings of the National Environ Microbiol 56 ( 5 ) , 1406 - 1412 . Academy of Sciences 108 ( 15 ) , 6252 -6257 . Hewitt , J . , Rivera -Aban , M . , and Greening, G . E . ( 2009 ) . Evaluation Goodman , N . S . , Gottfried , R . J ., and Rogoff , M . H . (1967 ) . Biphasic of murine norovirus as a surrogate for human norovirus and system for separation of spores and crystals of Bacillus hepatitis A virus in heat inactivation studies. Journal of Applied thuringiensis . Journal of Bacteriology 94 ( 2 ), 485. Microbiology 107 ( 1 ) , 65 - 71 . US 9, 855 ,303 B2 Page 6
( 56 ) References Cited Jones, M . L ., Martoni, C . J ., Parent , M . , and Prakash , S . ( 2012b ) . Cholesterol- lowering efficacy of a microencapsulated bile salt OTHER PUBLICATIONS hydrolase -active Lactobacillus reuteri NCIMB 30242 yoghurt for mulation in hypercholesterolaemic adults . British Journal of Nutri Hindle , A . A ., and Hall, E . A . H . ( 1999 ). Dipicolinic acid (DPA ) assay tion 107 ( 10 ) , 1505 - 1513 . revisited and appraised for spore detection . The Analyst 124 ( 11) , Joosten , H . et al. , “ Salmonelle Detection in Probiotic Products ," 1599 - 1604 . International Journal of Food Microbiology , Jul. 2006 , pp . 104 - 107 , Hirsch , E . B ., and Tam , V. H . (2010 ). Detection and treatment options vol. 110 , No. 1 . for Klebsiella pneumoniae carbapenemases (KPCs ) : an emerging Jorgensen , J. H ., and Ferraro, M .J . ( 2009 ). Antimicrobial Suscepti cause of multidrug - resistant infection . J. Antimicrob . Chemother. bility Testing: A Review of General Principles and Contemporary 65 ( 6 ), 1119 - 1125 . Practices. Clin Infect Dis. , Medical Microbiology, 49 ( 11) , 1749 Hofsten , B . V . ( 1966 ) . Partition of Escherichia coli in an aqueous 1755 . polymer two -phase system . Experimental Cell Research 41 ( 1 ) , Jorup -Rönström , C ., Håkanson , S . , Sandell, S . , Edvinsson , O . , Midtvedt, T ., Persson , A .- K ., and Norin , E . ( 2012 ) . Fecal transplant 117 - 123 . against relapsing Clostridium difficile -associated diarrhea in 32 Holmes, E . , Kinross , J . , Gibson , G . R . , Burcelin , R . , Jia , W . , Pet patients . Scand . J . Gastroenterol. 47 ( 5 ) , 548 - 552 . tersson , S ., and Nicholson , J. K . ( 2012 ). Therapeutic Modulation of Jousimies -Somer , H ., Summanen , P ., Citron , D .M ., Baron , E .J . , Microbiota -Host Metabolic Interactions. Science Translational Wexler , H . M . , and Finegold , S . M . ( 2002 ) . Wadsworth — KLT Medicine 4 ( 137 ) , 137rv6 - 137rv6 . Anaerobic Bacteriology Manual, 6th edition (California : Star) , pp . Hoppe, B . , Groothoff , J . W . , Hulton , S . - A ., Cochat, P . , Niaudet , P . , 55- 74 , 81- 132 , 165 - 185 . Kemper , M . J. , Deschênes, G ., Unwin , R . , and Milliner, D . ( 2011) . Kailasapathy, K . ( 2002 ) . Microencapsulation of probiotic bacteria : Efficacy and safety of Oxalobacter formigenes to reduce urinary technology and potential applications. Curr Issues Intest Microbiol oxalate in primary hyperoxaluria . Nephrol. Dial. Transplant. 26 ( 11) , 3 ( 2 ) , 39 - 48 . 3609 - 3615 . Kamiya , S ., Yamakawa, K ., Ogura, H ., and Nakamura , S . (1989 ). Hoyles , L ., Honda, H ., Logan , N . A ., Halket, G ., La Ragione , R . M . , Recovery of spores of Clostridium difficile altered by heat or alkali. and McCartney , A . L . (2012 ). Recognition of greater diversity of J Med Microbiol 28 ( 3 ) , 217 - 221 . Bacillus species and related bacteria in human faeces . Res . Kanamoto , T . et al . , “ Genetic Heterogeneities and Phenotypic Microbiol. 163( 1 ) , 3 - 13 . Characteristics of Strains of the Genus Abiotrophia and Proposal of Hurst , C . J . , and Gerba , C . P . ( 1989 ) . Fate of viruses during waste Abiotrophia para - adiacens sp . nov ., ” Journal of Clinical Microbi water sludge treatment processes. Critical Reviews in Environmen ology , Feb . 2000 , pp . 492 -498 , vol . 38 , No . 2 ; Abiotropia para tal Control 18 (4 ) , 317 - 343 . adjacens gene for 16S rRNA , partial sequence , strain : Nucleotide : Iizuka , M . et al . , “ Elemental Diet Modulates the Growth of NCBI: GenBank : AB022027 . 1 , last accessed Mar. 12 , 2014 , p . 8 . Clostridium difficile in the Gut Flora, ” Aliment Pharmacol. Ther . , Kanehisa Laboratories . KEGG : Kyoto encyclopedia of genes and Jul. 2004 , pp . 151 - 157 , vol. 20 , Suppl. 1 . genomes . < http :/ / www .genome . jp /kegg /> Accessed Mar . 27 , 2014 . Israel Office Action , Israel Application No . 238973 , dated Apr. 20 , Karasawa, T . et al ., “ A Defined Growth Medium for Clostridium 2017 , 4 pages ( with concise explanation of relevance ) . difficile ,” Microbiology , Feb . 1995 , pp . 371 - 375 , vol. 151 , No. 2 . Itoh , K . , and Mitsuoka , T . ( 1985 ) . Characterization of clostridia Kazamias, M . et al. , “ Enhanced Fermentation of Mannitol and isolated from faeces of limited flora mice and their effect on caecal Release of Cytotoxin by Clostridium difficile in Alkaline Culture size when associated with germ - free mice. Laboratory Animals Media , ” Applied and Environmental Microbiology , Jun . 1995 , pp . 19 ( 2 ) , 111 - 118 . 2425 - 2427 , vol. 61 , No . 6 . Itoh , K . , Lee , W . K . , Kawamura , H ., Mitsuoka , T . , and Magaribuchi, Kelly , D . , Campbell , J. I ., King, T. P ., Grant , G ., Jansson , E . A ., T . ( 1987 ) . Intestinal bacteria antagonistic to Clostridium difficile in Coutts , A . G . P ., Pettersson , S . , and Conway, S . (2003 ) . Commensal mice . Lab Anim 21 ( 1 ) , 20 - 25 . anaerobic gut bacteria attenuate inflammation by regulating nuclear Itoh , K ., Urano , T. , and Mitsuoka , T. ( 1986 ). Colonization resistance cytoplasmic shuttling of PPAR - y and RelA . Nature Immunology against Pseudomonas aeruginosa in gnotobiotic mice . Lab Anim 5 ( 1 ) , 104 - 112 . 20 ( 3 ) , 197 - 201. Khoruts, A . ( 2013 ) . How Does Fecal Microbiota Transplantation Jalanka - Tuovinen , J. , Salojarvi, J ., Salonen , A . , Immonen , O . , Treat Clostridium difficile Infection ?
(56 ) References Cited Liu , K . , Linder, C . R ., and Warnow , T . ( 2011 ) . RAXML and FastTree: Comparing Two Methods for Large - Scale Maximum Likelihood OTHER PUBLICATIONS Phylogeny Estimation . PLoS ONE 6 ( 11 ), e27731. Livingston , S .J . , Kominos, S . D ., and Yee , R .B . (1978 ). New complete genomes. < http :/ /www .ncbi . nlm .nih .gov /books / medium for selection and presumptive identification of the NBK21090 /pdf / ch22 .pdf > Accessed Mar. 27 , 2014 Bacteroides fragilis group . J . Clin . Microbiol . 7 ( 5 ) , 448 -453 . Koransky, J . R ., Allen , S . D . , and Dowell, V . R ., JR ( 1978 ) . Use of Logan , N . A ., “ Bacillus and Relatives in Foodborne Illness, ” Journal ethanol for selective isolation of sporeforming microorganisms. of Applied Microbiology , Mar . 20 , 2012 , pp . 417 - 429 , vol. 112 , No. Appl. Environ . Microbiol. 35 ( 4 ) , 762 - 765 . 3 . Kort , R . , O ' Brien , A . C . , Stokkum , I . H . M . Van , Oomes, S . J . C . M . , Lopetuso , L . R . , Scaldaferri, F. , Petito , V ., and Gasbarrini, A . ( 2013 ). Crielaard , W ., Hellingwerf, K . J ., and Brul, S . (2005 ) . Assessment of Commensal Clostridia : leading players in the maintenance of gut Heat Resistance of Bacterial Spores from Food Product Isolates by homeostasis . Gut Pathogens 5 ( 1 ) , 23 . Lodish , H . et al. , “ Viruses: Structure , Function , and Uses ,” Molecu Fluorescence Monitoring of Dipicolinic Acid Release . Appl. lar Cell Biology, 4 Edition , 2000 , pp . 1- 12 . Environ . Microbiol. 71( 7 ) , 3556 - 3564 . Lozupone , C ., Faust, K ., Raes , J. , Faith , J. J. , Frank , D . N ., Zaneveld , Kucerova, Z ., Moura, H . , Leitch , G .J ., Sriram , R . , Bern , C ., Kawai , J . , Gordon , J . I. , and Knight, R . ( 2012 ) . Identifying genomic and V ., Vargas , D ., Gilman , R . H ., Ticona , E ., and Vivar, A . (2004 ) . metabolic features that can underlie early successional and oppor Purification of Enterocytozoon bieneusi spores from stool speci tunistic lifestyles of human gut symbionts . Genome Res 22 ( 10 ) , mens by gradient and cell sorting techniques. Journal of Clinical 1974 - 1984 . Microbiology 42 (7 ), 3256 - 3261. Malik , K . A . ( 1988 ) . A new freeze - drying method for the preserva Kumar , M . et al. , “ Cholesterol- Lowering Probiotics as Potential tion of nitrogen - fixing and other fragile bacteria . Journal of Micro Biotherapeutics for Metabolic Diseases ,” Experimental Diabetes biological Methods 8 ( 5 ) , 259 -271 . Research , 2012 , Article ID 902917 , 14 pages, vol . 2012 . Manichanh , C . ( 2006 ). Reduced diversity of faecal microbiota in Kump, P. K ., Gröchenig , H .- P. , Lackner , S ., Trajanoski, S ., Reicht, Crohn ' s disease revealed by a metagenomic approach . Gut 55 ( 2 ) , G ., Hoffmann , K .M ., Deutschmann , A ., Wenzl, H .H ., Petritsch , W ., 205 -211 . Krejs , G .J . , et al. (2013 ) . Alteration of intestinal dysbiosis by fecal Matsuda, K . et al. , “ Sensitive Quantitative Detection of Commensal microbiota transplantation does not induce remission in patients Bacteria by rRNA - Targeted Reverse Transcription - PCR , ” Applied with chronic active ulcerative colitis . Inflamm . Bowel Dis . 19 ( 10 ) , and Environmental Microbiology , Jan . 2007 , pp . 32 - 39 , vol. 73 , No . 2155 - 2165 . 1 . Kunde, S ., Pham , A ., Bonczyk , S ., Crumb, T. , Duba , M ., Conrad , H ., Mbithi, J. N ., Springthorpe, V .S ., and Sattar, S . A . ( 1990 ) . Chemical JR , Cloney , D . , and Kugathasan , S . ( 2013 ) . Safety , tolerability , and disinfection of hepatitis A virus on environmental surfaces. Applied clinical response after fecal transplantation in children and young and Environmental Microbiology 56 ( 11) , 3601 -3604 . adults with ulcerative colitis . J. Pediatr. Gastroenterol. Nutr . 56 (6 ), McFarland , L . V ., “ Use of Probiotics to Correct Dysbiosis of Normal 597 -601 . Microbiota Following Disease or Disruptive Events : A Systematic Landy , J ., Al -Hassi , H . O . , McLaughlin , S . D ., Walker, A . W ., Review , " BMJ Open , 2014 , pp . 1 - 18 , vol. 4 . Ciclitira , P . J ., Nicholls, R . J ., Clark , S . K ., and Hart , A . L . (2011 ) . McFarland , L . V . et al . , “ Pharmaceutical Probiotics for the Treatment Review article : faecal transplantation therapy for gastrointestinal of Anaerobic and Other Infections, ” Anaerobe , Jan . 1997 , pp . 73 - 78 , disease . Alimentary Pharmacology & Therapeutics 34 ( 4 ), 409 -415 . vol. 3 , No. 2 - 3 Lawley , T . D ., Clare, S . , Walker, A . W . , Stares, M . D . , Connor, T . R . , McGuire, G ., Denham , M .C ., and Balding , D . J. (2001 ). Models of Raisen , C . , Goulding , D ., Rad , R . , Schreiber, F . , Brandt, C ., et al . Sequence Evolution for DNA Sequences Containing Gaps. Mol ( 2012 ) . Targeted Restoration of the Intestinal Microbiota with a Biol Evol 18 ( 4 ) , 481 -490 . Simple, Defined Bacteriotherapy Resolves Relapsing Clostridium McNulty , N . P . , Yatsunenko , T . , Hsiao , A ., Faith , J . J ., Muegge , B . D . , difficile Disease in Mice . PLoS Pathog 8 ( 10 ) , e1002995 . Goodman , A . L . , Henrissat, B ., Oozeer , R . , Cools -Portier , S ., Gobert, Lawson , P. A ., Song, Y. , Liu , C ., Molitoris, D .R ., Vaisanen , M .- L ., G ., et al. (2011 ) . The impact of a consortium of fermented milk Collins, M . D ., and Finegold , S . M . ( 2004 ) . Anaerotruncus strains on the gut microbiome of gnotobiotic mice and monozygotic colihominis gen . nov. , sp . nov ., from human faeces . Int J Syst Evol twins. Sci Transl Med 3 ( 106 ) , 106ra106 . Microbiol 54 ( 2 ) , 413 - 417 . Mevissen - Verhage, E . A . , Marcelis , J . H ., Vos , M . N . De, Amerongen , Lee, I . - K ., and Liu , J . - W . ( 2006 ) . Clinical characteristics and risk W . C . H ., and Verhoef, J . ( 1987 ) . Bifidobacterium , Bacteroides , and factors for mortality in Morganella morganii bacteremia . J Clostridium spp . in fecal samples from breast - fed and bottle - fed Microbiol Immunol Infect 39 ( 4 ), 328 -334 . infants with and without iron supplement. J. Clin .Microbiol . 25 ( 2 ), Lee , J . S ., Cha, D . S . , and Park , H . J . ( 2004 ) . Survival of Freeze -Dried 285 - 289 . Lactobacillus bulgaricus KFRI 673 in Chitosan - Coated Calcium Miller, R . S . , and Hoskins, L . C . ( 1981) . Mucin degradation in human Alginate Microparticles . J . Agric . Food Chem . 52 ( 24 ) , 7300 - 7305 . colon ecosystems. Fecal population densities of mucin -degrading Lee , M . , Hesek , D . , Shah , I. M . , Oliver, A .G ., Dworkin , J . , and bacteria estimated by a " most probable number” method . Gastro Mobashery , S . (2010 ) . Synthetic peptidoglycan motifs for germi enterology 81 (4 ) , 759 -765 . nation of bacterial spores. Chembiochem 11 (18 ), 2525 -2529 . Mireau , I . et al. , “ Industrial -Scale Production and Purification of a Lehar, J . (2007 ) . Chemical combination effects predict connectivity Heterologous Protein in Lactococcus Lactis Using the Nisin - Con in biological systems, Molecular Systems Biology , pp . 1- 14 , vol. 3 , trolled Gene Expression System NICE: The Case of Lysostaphin , " Article No. 80 . Microbial Cell Factories , May 27 , 2005 , pp . 1 - 9 , vol. 4 , No . 15 . Lemon , K .P ., Armitage, G . C ., Relman , D . A ., and Fischbach , M . A . Miyamoto -Shinohara , Y. , Sukenobe , J. , Imaizumi, T. , Nakahara , T. , ( 2012 ) . Microbiota - Targeted Therapies: An Ecological Perspective . and Others (2008 ) . Survival of freeze -dried bacteria . The Journal of Science Translational Medicine 4 ( 137 ) , 137rv5 - 137rv5 . General and Applied Microbiology 54 ( 1 ) , 9 . Leslie , S .B ., Israeli, E ., Lighthart, B . , Crowe, J. H ., and Crowe, L .M . Momose , Y . et al. , “ 16S rRNA Gene Sequence - Based Analysis of ( 1995 ) . Trehalose and sucrose protect both membranes and proteins Clostridia Related to Conversion of Germfree Mice to the Normal in intact bacteria during drying . Applied and Environmental Micro State , ” Journal of Applied Microbiology , 2009 , pp . 2088 - 2097 , vol. biology 61 ( 10 ) , 3592 -3597 . 107 . Liggins, M . , Ramirez , N . , Magnuson , N ., and Abel- Santos, E . Morgan , C .A ., Herman , N ., White, P. A ., and Vesey, G . (2006 ). (2011 ) . Progesterone analogs influence germination of Clostridium Preservation of micro - organisms by drying ; A review . Journal of sordellii and Clostridium difficile spores in vitro . J. Bacteriol. Microbiological Methods 66 ( 2 ) , 183 - 193 . 193 ( 11) , 2776 - 2783 . Murri , M . , Leiva , I. , Gomez - Zumaquero , J . M ., Tinahones, F . J . , Lindsay, J . A . , Beaman , T . C . , and Gerhardt, P . ( 1985 ) . Protoplast Cardona , F ., Soriguer, F ., and Queipo -Ortuño , M . I . ( 2013 ) . Gut water content of bacterial spores determined by buoyant density microbiota in children with type 1 diabetes differs from that in sedimentation . J . Bacteriol . 163( 2 ) , 735 - 737 . healthy children : a case -control study . BMC Med 11 ( 1 ) , 1 - 12 . US 9 , 855 , 303 B2 Page 8
( 56 ) References Cited www .path .org /publications / files/ TS _ vaccine _ stability _ table _ in vest .pdf > Accessed Mar. 21, 2014 . OTHER PUBLICATIONS PCT International Search Report and Written Opinion , PCT Appli cation No . PCT/ US14 / 14744 , dated May 21, 2014 , 36 pages. Myllyluoma, E . et al. , “ Effects of Multispecies Probiotic Combi PCT International Search Report and Written Opinion , PCT Appli nation on Helicobacter pylori Infection in Vitro , Clinical and cation No . PCT/US14 / 14747 , dated Jun . 13 , 2014 , 27 pages. Vaccine Immunology, Sep . 2008 , pp . 1472 - 1482 , vol. 15 , No . 9 . PCT International Search Report and Written Opinion , PCT Appli Naaber P et al “ Inhibition of Clostridium difficile strains by intes tinal Lactobacillus species ” Journal of Medical Microbiology , 2004 , cation No . PCT/ US14 / 14738 , dated Jul. 30 , 2014 , 32 pages . pp . 551 - 554 , vol . 53 . PCT International Search Report and Written Opinion , PCT Appli New Zealand First Examination Report, New Zealand Application cation No. PCT/ US14 / 14745 , dated Jul. 30 , 2014 , 31 pages . No . 709392 , dated Oct . 5, 2015 , 7 pages . PCT Invitation to Pay Additional Fees, PCT Application No. New Zealand First Examination Report, New Zealand Application PCT/ US14 / 14745 , dated May 16 , 2014 , 2 pages . No. 711771, dated Nov . 23 , 2015 , 6 pages . PCT International Search Report and Written Opinion , PCT Appli New Zealand First Examination Report , New Zealand Application cation No . PCT/ US13 / 71758 , dated May 5 , 2014 , 45 pages . No . 711773 , dated Nov. 24 , 2015 , 6 pages. PCT Invitation to Pay Additional Fees, PCT Application No . New Zealand Second Examination Report , New Zealand Applica PCT/ US14 /70684 , dated Mar. 24 , 2015 , 2 pages. tion No . 709392 , dated Jun . 9 , 2016 , 7 pages . PCT International Search Report and Written Opinon , PCT Appli New Zealand Third Examination Report, New Zealand Application cation No. PCT/ US2014 /067491 , dated Apr. 2 , 2015 , 14 pages. No . 711771 , dated Nov. 4 , 2016 , 4 pages . PCT International Search Report and Written Opinion , PCT Appli Nicholson , W . L ., and Law , J . F . ( 1999 ) . Method for purification of cation No . PCT/ US14 /70684 , dated Jun . 10 , 2015 , 24 pages . bacterial endospores from soils : UV resistance of natural Sonoran PCT Invitation to Pay Additional Fees , PCT Application No. desert soil populations of< i> Bacillus< /i > spp . with reference to < PCT/ US13 / 71758 , dated Feb . 25 , 2014 , 4 pages . i > B . subtilis < / i > strain 168 . Journal of Microbiological Methods PCT Invitation to Pay Additional Fees , PCT Application No . 35 ( 1) , 13 -21 . PCT/ US2014 /014738 , May 16 , 2014 , 2 pages . NIH human microbiome project .
( 56 ) References Cited buffers for use with a new live oral cholera vaccine , Peru - 15 , in outpatient volunteers. Infect . Immun . 65 ( 6 ) , 2107 -2111 . OTHER PUBLICATIONS Sacks, L . E . , and Alderton , G . ( 1961) . Behavior of bacterial spores in aqueous polymer two- phase systems. J . Bacteriol. 82 , 331 - 341. Pinn , D . et al . ( 2013 ) . Follow -up Study of Fecal Microbiota Trans Sahlström , L ., Bagge , E ., Emmoth , E . , Holmqvist, A . , Danielsson plantation (FMT ) for the Treatment of Refractory Irritable Bowel Tham , M . - L . , and Albihn , A . ( 2008 ) . A laboratory study of survival Syndrome (IBS ). Abstract ACG 2013 . of selected microorganisms after heat treatment of biowaste used in Postgate , J . R ., and Hunter , J . R . ( 1961) . On the Survival of Frozen biogas plants. Bioresour. Technol. 99 ( 16 ), 7859 - 7865 . Bacteria . J Gen Microbiol 26 ( 3 ) , 367- 378 . Santivarangkna, C ., Kulozik , U ., and Foerst, P. (2007 ). Alternative “ Potentials of Probiotics in Pig Nutrition , " AllAboutFeed News , Drying Processes for the Industrial Preservation of Lactic Acid Jan . 31 , 2007 , 6 pages. Starter Cultures . Biotechnology Progress 23 ( 2 ) , 302 - 315 . Prilassnig , M . et al. , “ Are Probiotics Detectable in Human Feces Sattar , S . A ., Jason , T. , Bidawid , S ., and Farber, J. (2000 ). Foodborne After Oral Uptake by Healthy Volunteers ? ” The Middle European spread of hepatitis A : recent studies on virus survival , transfer and Journal ofMedicine , Aug . 2007, pp . 456 -462 , vol. 119 , Nos. 15 - 16 . inactivation . The Canadian Journal of Infectious Diseases 11( 3 ), Pultz , N . J ., Hoyen , C . K . , and Donskey , C . J . ( 2004 ) . Inhibition of 159 . methicillin -resistant Staphylococcus aureus by an in vitro continu Savaiano , D . A ., Ritter, A .J . , Klaenhammer, T. , Walker, M .R ., ous - flow culture containing human stool microflora . FEMS Micro Carlson , H . L . F. , and Ruckle , J. ( 2012 ). A Novel High Purity biology Letters 241 ( 2 ) , 201 - 205 . Short - Chain Galacto -Oligosaccharide ( RP -G28 ) Improves Lactose Queenan , A . M ., and Bush , K . ( 2007 ) . Carbapenemases : the Versa Digestion and Symptoms of Lactose Intolerance . Gastroenterology tile B -Lactamases . Clin . Microbiol. Rev. 20 ( 3 ) , 440 -458 . 142 ( 5 ) , S - 182 . Quigley , E . M . M . et al. , " Small Intestinal Bacterial Overgrowth : Savaiano , D . A . , Ritter, A . J. , Klaenhammer, T . R . , Walker, W . A . , Roles of Antibiotics, Prebiotics and Probiotics, ” Gastroenterology, James , G . M ., Longcore , A . T ., Chandler, J. R ., and Foyt, H . L . ( 2013 ) . Feb . 2006 , pp . 78 -90 , vol. 130 . Improving lactose digestion and symptoms of lactose intolerance Raibaud , P. , Ducluzeau , R ., Dubos, F. , Hudault , S ., Bewa , H ., and with a novel galacto - oligosaccharide (RP -G28 ): a randomized , Muller, M . C . ( 1980 ). Implantation of bacteria from the digestive double- blind clinical trial. Nutrition Journal 12 ( 1 ), 160 . tract of man and various animals into gnotobiotic mice. Am J Clin Seale , R . B . , Flint, S . H ., McQuillan , A . J . , and Bremer, P . J . (2008 ) . Nutr 33 ( 11 ) , 2440 - 2447 . Recovery of Spores from Thermophilic Dairy Bacilli and Effects of Ramirez , N . , and Abel- Santos , E . ( 2010 ) . Requirements for germi Their Surface Characteristics on Attachment to Different Surfaces. nation of Clostridium sordellii spores in vitro . J . Bacteriol. 192 ( 2 ), Appl Environ Microbiol 74 (3 ) , 731- 737. 418 - 425 . Seo , M ., Inoue, I. , Tanaka , M ., Matsuda, N ., Nakano , T. , Awata , T. , Rao , A . V ., Shiwnarain , N . , and Maharaj, I. (1989 ) . Survival of Katayama, S. , Alpers , D .H ., and Komoda , T. ( 2013 ). Clostridium Microencapsulated Bifidobacterium pseudolongum in Simulated butyricum MIYAIRI 588 improves high - fat diet- induced non -alco Gastric and Intestinal Juices. Canadian Institute of Food Science holic fatty liver disease in rats . Dig . Dis . Sci . 58 ( 12 ) , 3534 - 3544 . and Technology Journal 22 ( 4 ), 345 - 349 . Setlow , B ., Cowan , A . E ., and Setlow , P . ( 2003 ) . Germination of Reeves , A . E ., Koenigsknecht, M . J ., Bergin , I. L ., and Young, V . B . spores of Bacillus subtilis with dodecylamine. Joumal of Applied ( 2012 ) . Suppression of Clostridium difficile in the Gastrointestinal Microbiology 95 ( 3 ), 637 -648 . Tracts of Germfree Mice Inoculated with a Murine Isolate from the Setlow , B ., Yu , J ., Li, Y . - Q ., and Setlow , P . ( 2013 ) . Analysis of the Family Lachnospiraceae. Infection and Immunity 80 ( 11) , 3786 germination kinetics of individual Bacillus subtilis spores treated 3794 . with hydrogen peroxide or sodium hypochlorite . Letters in Applied Rexroad , J ., Wiethoff , C .M ., Jones, L . S ., and Middaugh , C .R . Microbiology 57 ( 4 ) , 259 - 265 ( 2002 ) . Lyophilization and the thermostability of vaccines. Cell Setlow , B . et al ., “ Mechanisms of Killing Spores of Bacillus Subtilis Preservation Technology 1 ( 2 ) , 91 - 104 . by Acid , Alkali and Ethanol, ” Journal of Applied Microbiology , Ridaura , V . K ., Faith , J .J . , Rey , F . E ., Cheng , J ., Duncan , A . E . , Kau , 2002 , pp . 362 - 375 , vol. 92 . A .L ., Griffin , N . W ., Lombard , V. , Henrissat, B ., Bain , J. R ., et al. Shafaat, H . S ., and Ponce , A . (2006 ) . Applications of a Rapid ( 2013 ) . Gut Microbiota from Twins Discordant for Obesity Modu Endospore Viability Assay for Monitoring UV Inactivation and late Metabolism in Mice . Science 341( 6150 ) , 1241214 - 1241214 . Characterizing Arctic Ice Cores . Appl Environ Microbiol 72 ( 10 ), Robinson , I. M . et al ., “ Emendation of Acetivibrio and Description 6808 -6814 . of Acetivibrio ethanolgignens, a New Species from the Colons of Shah , I . M ., Laaberki, M . - H . , Popham , D . L ., and Dworkin , J . (2008 ) . Pigs with Dysentery , ” International Journal of Systematic Bacteri A eukaryotic - like Ser / Thr kinase signals bacteria to exit dormancy ology , Jul. 1981, pp . 333 - 338 , vol. 31, No . 3 . in response to peptidoglycan fragments . Cell 135 ( 3 ) , 486 -496 . Rode , L . J . , and Foster , J . W . ( 1961 ) . Germination of bacterial spores Shah , N . P . , “ Symposium : Probiotic Bacteria : Probiotic Bacteria : with alkyl primary aminesl . J Bacteriol 81 ( 5 ) , 768 -779 . Selective Enumeration and Survival in Dairy Foods, ” Oct. 7 , 1999 , Roffe , C . ( 1996 ) . Biotherapy for antibiotic -associated and other 14 pages. diarrhoeas . J. Infect. 32 ( 1) , 1- 10 . Shah , N . P . et al. , “ Microencapsulation of Probiotic Bacteria and Rohlke , F. , Surawicz , C . M . , and Stollman , N . (2010 ) . Fecal flora Their Survival in Frozen Fermented Dairy Desserts, ” The Australian reconstitution for recurrent Clostridium difficile infection : results Joumal of Dairy Technology , Oct. 2000 , pp . 139 -144 , vol. 55, No. and methodology . J . Clin . Gastroenterol. 44 ( 8 ) , 567 - 570 . Rosen , D .L ., Sharpless, C ., and McGown , L . B . ( 1997) . Bacterial Shah , S . (2012 ). Clostridium difficile in inflammatory Bowel Dis Spore Detection and Determination by Use of Terbium Dipicolinate ease : a dangerous mix ( Clostridium difficile Symposium , Miriam Photoluminescence. Anal. Chem . 69 (6 ), 1082 -1085 . Hospital, Providence , RI) . Russell, A .D ., “ The Destruction of Bacterial Spores, ” 1982, pp . Shahinas, D . , Silverman , M ., Sittler, T ., Chiu , C . , Kim , P ., Allen 191 - 193 . Vercoe , E . , Weese , S . , Wong , A ., Low , D . E . , and Pillai, D . R . ( 2012 ) . Russian Office Action , Russian Application No . 2015137399 , dated Toward an Understanding of Changes in Diversity Associated with Mar. 22, 2016 , 8 pages. Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep Russian Office Action , Russian Application No. 201537399 , dated Sequencing. mBio 3 ( 5 ), e00338 - 12 -e00338 - 12 . Aug . 15 , 2016 , 8 pages . Sharpe , E .S ., Nickerson , K . W ., Bulla JR , L . A ., and Aronson , J. N . Russian First Office Action , Russian Patent Application No. ( 1975 ) . Separation of spores and parasporal crystals of Bacillus 2015124366 , dated Dec . 13 , 2016 , 12 pages. thuringiensis in gradients of certain x - ray contrasting agents. Russian Second Office Action , Russian Patent Application No . Applied Microbiology 30 ( 6 ), 1052 . 2015137399 , dated Mar. 14 , 2017 , 8 pages. Sheu , T . - Y ., Marshall , R . T ., and Heymann , H . ( 1993 ) . Improving Sack , D .A . , Shimko , J. , Sack , R .B ., Gomes, J. G ., Macleod , K ., Survival of Culture Bacteria in Frozen Desserts by Microentrap O ' Sullivan , D ., and Spriggs, D . ( 1997 ) . Comparison of alternative ment. Journal of Dairy Science 76 ( 7 ), 1902 - 1907. US 9 ,855 , 303 B2 Page 10
( 56 ) References Cited Tvede , M ., and Rask -Madsen , J. ( 1989 ) . Bacteriotherapy for chronic relapsing Clostridium difficile diarrhoea in six patients . OTHER PUBLICATIONS Lancet 1 ( 8648 ), 1156 - 1160 . Ubeda , C ., Bucci, V . , Caballero , S . , Djukovic , A . , Toussaint, N . C . , Siaterlis , A ., Deepika, G . , and Charalampopoulos, D . ( 2009) . Effect Equinda , M ., Lipuma, L . , Ling , L ., Gobourne, A ., No , D . , et al. of culture medium and cryoprotectants on the growth and survival ( 2013 ) . Intestinal Microbiota Containing Barnesiella Species Cures of probiotic lactobacilli during freeze drying . Letters in Applied Vancomycin -Resistant Enterococcus faecium Colonization . Infect. Microbiology 48( 3 ), 295 - 301 . Immun . 81 (3 ), 965 -973 . Sigma- Tau . VSL # 3 . < http :/ / www .vs13 .com / > Accessed Mar. 21, Ubeda , C . , Taur, Y ., Jenq , R . R ., Equinda , M . J ., Son , T ., Samstein , 2014 . M . , Viale , A . , Socci, N . D . , Van Den Brink , M . R . M ., Kamboj, M . , et Skaar, E ., “ The Battle for Iron Between Bacterial Pathogens and al. ( 2010 ) . Vancomycin - resistant Enterococcus domination of intes Their Vertebrate Hosts ,” PLoS Pathog. , Aug . 12 , 2010 , pp . 1 - 4 , vol. tinal microbiota is enabled by antibiotic treatment in mice and 6 , No. 8 . precedes bloodstream invasion in humans . Journal of Clinical Sleator, R . D . et al. , " Designer Probiotics: A Potential Therapeutic for Investigation 120 ( 12 ), 4332 -4341 . Clostridium difficile ? ” Journal ofMedical Microbiology , Jun . 2008 , U . S . Office Action , U . S . Appl. No . 14 /313 ,828 , dated Aug . 13 , 2014 , pp . 793 - 794 , vol. 57 , No. 6 . 5 pages . Snitkin , E .S ., Zelazny, A . M ., Thomas, P. J . , Stock , F. , Henderson , U . S . Office Action , U . S . Appl. No . 14 /313 , 828 , dated Dec . 10 , 2014 , D .K ., Palmore, T. N ., and Segre , J. A . (2012 ) . Tracking a Hospital 7 papges . Outbreak of Carbapenem -Resistant Klebsiella pneumoniae with U . S . Office Action , U . S . Appl. No. 14/ 313, 828 , dated May 15 , 2015 , Whole -Genome Sequencing . Sci Transl Med 4 ( 148) , 148ral 16 11 pages . 148ra116 . U . S . Office Action , U . S . Appl. No. 14 /221 , 190 , dated Jul. 22, 2014 , Solanki, H . K . , Pawar , D . D ., Shah , D . A ., Prajapati, V . D ., Jani, G . K . , 19 pages. Mulla , A . M ., and Thakar , P . M . ( 2013 ) . Development of Microen U . S . Office Action , U . S . Appl. No. 14 /091 , 201, dated Mar. 25 , 2014 , capsulation Delivery System for Long - Term Preservation of 19 pages. Probiotics as Biotherapeutics Agent. BioMed Research Interna U . S . Office Action , U . S . Appl. No . 14 / 197 ,044 , dated Aug. 13, 2014 , tional 2013 , 1 - 21. 5 pages . SOP No . MB - 28 - 00 . < http : // www . epa .gov /pesticides / methods / MB U . S . Office Action , U . S . Appl. No. 14 / 592 ,481 , dated Dec . 22, 2015, 28 -00 .pdf > Accessed Mar . 27 , 2014 . 21 pages . Sorg , J. A . , and Sonenshein , A . L . ( 2008 ). Bile Salts and Glycine as U . S . Office Action , U . S . Appl. No . 15/ 068, 438 , dated Apr . 28 , 2016 , Cogerminants for Clostridium difficile Spores . J Bacteriol 190 ( 7 ) , 9 pages. 2505 - 2512 . U . S . Office Action , U . S . Appl. No. 14 /884 ,655 , dated May 5 , 2016 , Sow , H ., Desbiens, M . ,Morales - Rayas , R ., Ngazoa, S .E ., and Jean , 10 pages . J . ( 2011 ) . Heat Inactivation of Hepatitis A Virus and a Norovirus U . S . Office Action , U . S . Appl . No. 14 / 884, 655, dated Aug. 17 , 2016 , Surrogate in Soft - Shell Clams (Mya arenaria ). Foodborne Patho 9 pages . gens and Disease 8 ( 3 ) , 387 - 393 . U . S . Office Action , U . S . Appl. No. 14 / 765 , 812 , dated Aug. 25, 2016 , Stams, A . J . M . , Van Dijk , J . B . , Dijkema , C . , and Plugge , C . M . 10 pages . ( 1993 ) . Growth of Syntrophic Propionate - Oxidizing Bacteria with U . S . Office Action , U .S . Appl. No . 14 / 592 ,481 , dated Aug. 19, 2016 , Fumarate in the Absence of Methanogenic Bacteria. Appl Environ 6 pages . Microbiol 59 ( 4 ) , 1114 - 1119 . U . S . Office Action , U . S . Appl. No. 14 / 777, 252, dated Nov. 3 , 2016 , Stefka , A . T . et al ., “ Commensal Bacteria Protect Against Food 16 pages . Allergen Sensitization ,” PNAS, Sep . 9 , 2014 , pp . 13145 - 13150 , vol . U . S . Office Action , U . S . Appl . No . 14 / 765, 810 , dated Jan. 23 , 2017, 111, No. 36 . 20 pages . Stevens, K . A . , and Jaykus, L . - A . (2004 ). Bacterial Separation and U . S . Office Action , U . S . Appl. No . 14 /776 ,676 , dated Mar. 23 , 2017 , Concentration from Complex Sample Matrices: A Review . Critical 9 pages . Reviews in Microbiology 30 ( 1 ) , 7 - 24 . U . S . Office Action , U . S . Appl. No . 14 /777 ,252 , May 11, 2017 , 9 Su , W . J ., Waechter, M . J ., Bourlioux , P ., Dolegeal, M ., Fourniat, J ., pages. and Mahuzier , G . ( 1987 ) . Role of volatile fatty acids in colonization Van Der Woude , M . W ., and Baumler, A . J. ( 2004 ). Phase and resistance to Clostridium difficile in gnotobiotic mice . Infect. Antigenic Variation in Bacteria . Clin Microbiol Rev 17 (3 ), 581 -611 . Immun . 55 ( 7 ) , 1686 - 1691 . Van Immerseel , F . et al. , “ Butyric Acid -Producing Anaerobic Bac Talwalkar, A ., and Kailasapathy , K . (2003 ) . Effect of microencap teria as a Novel Probiotic Treatment Approach for Inflammatory sulation on oxygen toxicity in probiotic bacteria . Australian Journal Bowel Disease, ” Journal of Medical Microbiology, JMM Editorial, of Dairy Technology 58 ( 1 ), 36 - 39 . 2010 , pp . 141- 143 . Tamir , H ., and Gilvarg , C . ( 1966 ) . Density Gradient Centrifugation Van Kregten , E ., Westerdaal, N . A . , and Willers, J . M . ( 1984 ) . New , for the Separation of Sporulating Forms of Bacteria . J . Biol. Chem . simple medium for selective recovery of Klebsiella pneumoniae and 241 ( 5 ), 1085 - 1090 . Klebsiella oxytoca from human feces . J Clin Microbiol 20 ( 5 ) , Tanaka , M . et al. , “ Increased Fasting Plasma Ghrelin Levels in 936 -941 . Patients with Bulimia Nervosa , ” European Journal of Endocrinol Van Nood , E . , Vrieze , A ., Nieuwdorp , M ., Fuentes , S ., Zoetendal, ogy , Jun . 2002 , pp . 1- 3 , vol. 146 . E . G ., De Vos, W .M . , Visser, C . E ., Kuijper, E . J . , Bartelsman , J . F . W . Taur, Y. , and Pamer, E .G . ( 2014 ) . Harnessing Microbiota to Kill a M . , Tijssen , J . G . P. , et al . ( 2013 ) . Duodenal Infusion of Donor Feces Pathogen : Fixing the microbiota to treat Clostridium difficile infec for Recurrent Clostridium difficile . New England Journal of Medi tions . Nature Medicine 20 (3 ), 246 -247 . cine 368( 5 ) , 407 -415 . Taur , Y ., Xavier , J . B ., Lipuma , L ., Ubeda , C . , Goldberg , J ., Vandenplas, Y . , Veereman , G . , Van Der Werff Ten Bosch , J . , Gobourne , A ., Lee, Y . J . , Dubin , K . A ., Socci , N . D ., Viale , A ., et al. Goossens, A ., Pierard , D ., Samsom , J. N ., and Escher , J. C . (2014 ). ( 2012 ) . Intestinal Domination and the Risk of Bacteremia in Fecal Microbial Transplantation in a One - Year- Old Girl with Early Patients Undergoing Allogeneic Hematopoietic Stem Cell Trans Onset Colitis Caution Advised : Journal of Pediatric Gastroenter plantation . Clin Infect Dis 55 ( 7 ) , 905 - 914 . ology and Nutrition 1 . The Human Microbiome Project Consortium ( 2012 ) . Structure , Vidal, M . , Forestier , C ., Charbonnel , N . , Henard , S . , Rabaud , C . , function and diversity of the healthy human microbiome. Nature and Lesens, O . ( 2010 ) . Probiotics and Intestinal Colonization by 486 (7402 ) , 207 - 214 . Vancomycin -Resistant Enterococci in Mice and Humans . J Clin Tisa , L . S . , Koshikawa, T . , and Gerhardt, P. ( 1982 ) . Wet and dry Microbiol 48 ( 7 ) , 2595 - 2598 . bacterial spore densities determined by buoyant sedimentation . Villano , S . A ., Seiberling, M ., Tatarowicz , W . , Monnot - Chase , E . , Applied and Environmental Microbiology 43 ( 6 ) , 1307 - 1310 . and Gerding , D . N . (2012 ) . Evaluation of an Oral Suspension of US 9 ,855 , 303 B2 Page 11
( 56 ) References Cited Wróbel, B . ( 2008 ) . Statistical measures of uncertainty for branches in phylogenetic trees inferred from molecular sequences by using OTHER PUBLICATIONS model -based methods. J . Appl. Genet . 49 ( 1 ) , 49 -67 . Wroblewski, D . , Hannett , G . E ., Bopp , D .J ., Dumyati , G . K . , Halse , VP20621, Spores of Nontoxigenic Clostridium difficile Strain M3, in Healthy Subjects . Antimicrobial Agents and Chemotherapy T . A . , Dumas, N . B ., and Musser , K . A . ( 2009 ) . Rapid Molecular 56 ( 10 ) , 5224 - 5229 . Characterization of Clostridium difficile and Assessment of Popu Wagman , J . , and Weneck , E . J . ( 1963) . Preservation of bacteria by lations of C . difficile in Stool Specimens. Journal of Clinical circulating - gas freeze drying . Applied Microbiology 11 ( 3 ) , 244 Microbiology 47 ( 7 ) , 2142 - 2148 . 248 . Yamakawa , K . et al. , “ Enhancement of Clostridium difficile Toxin Waites , W . M . , and Wyatt , L . R . ( 1971 ) . Germination of spores of Production in Biotin -Limited Conditions ," J . Med . Microbiol. , Feb . Clostridium bifermentans by certain amino acids , lactate and 1996 , pp . 111 - 114 , vol . 44 , No . 2 . pyruvate in the presence of sodium or potassium ions. J . Gen . Yamamura, H ., Hayakawa , M ., and limura, Y. (2003 ). Application Microbiol . 67 ( 2 ) , 215 - 222 . of sucrose - gradient centrifugation for selective isolation of Waites , W .M ., and Wyatt, L .R . ( 1974 ). The effect of pH , germinants Nocardia spp . from soil . Journal of Applied Microbiology 95 ( 4 ) , and temperature on the germination of spores of Clostridium 677 -685 bifermentans. J. Gen . Microbiol. 80 (1 ), 253 -258 . Yang , W .- W ., and Ponce, A . ( 2009 ). Rapid endospore viability assay Walker, A . W . , and Lawley , T . D . (2012 ) . Therapeutic modulation of of Clostridium sporogenes spores . International Journal of Food intestinal dysbiosis . Pharmacological Research 69( 1 ) , 75 - 86 . Microbiology 133 ( 3 ) , 213 -216 . Wang , M . et al. , “ Comparison of Bacterial Diversity Along the Yang , W .- W ., and Ponce , A . ( 2011) . Validation of a Clostridium Human Intestinal Tract by Direct Cloning and Sequencing of 16S Endospore Viability Assay and Analysis of Greenland Ices and rRNA Genes, ” FEMS Microbiology Ecology, 2005 , pp . 219 - 231, Atacama Desert Soils . Appl. Environ . Microbiol. 77 ( 7 ) , 2352 -2358 . vol. 54 . Yang , W .- W ., Crow -Willard , E .N ., and Ponce , A . (2009 ). Production Wang , S ., and Curtiss III , R . ( 2014 ). Development of Streptococcus and characterization of pure Clostridium spore suspensions. J. Appl. pneumoniae Vaccines Using Live Vectors . Vaccines 2 ( 1) , 49 -88 . Microbiol. 106 ( 1 ) , 27 - 33 . Weingarden , A . R ., Chen , C . , Bobr, A . , Yao , D ., Lu , Y . , Nelson , V . M ., Yang , W . W . (2010 ) . Fast Viability Assessment of Clostridium Sadowsky , M . J. , and Khoruts, A . (2013 ) .Microbiota transplantation Spores Survival in Extreme Environments . PhD thesis California restores normal fecal bile acid composition in recurrent Clostridium Institute of Technology . difficile infection . AJP : Gastrointestinal and Liver Physiology Yi, X ., and Setlow , P . (2010 ) . Studies of the Commitment Step in the 306 ( 4 ) , G310 -G319 . Germination of Spores of Bacillus Species. J . Bacteriol. 192 ( 13 ) , Wiencek , K . M . et al. , “ Hydrophobicity of Bacillus and Clostridium 3424 - 3433 . Spores ,” Applied and Environmental Microbiology, Sep . 1990 , pp . Yung, P . T . , and Ponce, A . ( 2008 ) . Fast Sterility Assessment by 2600 - 2605 , vol. 56 , No . 9 . Germinable -Endospore Biodosimetry . Appl . Environ . Microbiol . Wilson , K . H . , and Sheagren , J . N . ( 1983 ) . Antagonism of toxigenic 74 ( 24 ) , 7669 -7674 . Clostridium difficile by nontoxigenic C . difficile . Journal of Infec Yunoki, M . , Tsujikawa, M . , Urayama, T ., Sasaki, Y . , Morita , M . , tious Diseases 147 (4 ), 733 . Tanaka , H ., Hattori, S . , Takechi, K ., and Ikuta , K . (2003 ) . Heat Wilson , K .H ., Silva, J. , and Fekety , F . R . ( 1981) . Suppression of sensitivity of human parvovirus B19 . Vox Sanguinis 84 ( 3 ) , 164 - 169 . Clostridium difficile by Normal Hamster Cecal Flora and Preven Zeng , Y. , Fan , H ., Chiueh , G ., Pham , B ., Martin , R ., Lechuga tion of Antibiotic -Associated Cecitis . Infect Immun 34 ( 2 ) , 626 -628 . Ballesteros, D ., Truong , V .L ., Joshi, S .B ., and Middaugh , C .R . Wilson , K . et al. , “ Role of Competition for Nutrients in Suppression ( 2009 ) . Towards development of stable formulations of a live of Clostridium difficile by the Colonic Microflora . ” Infection and attenuated bacterial vaccine : a preformulation study facilitated by a Immunity , Oct. 1988 , pp . 2610 - 2614 , vol. 56 , No. 10 . biophysical approach . Hum Vaccin 5 ( 5 ) , 322 - 331 . Woo , T . D . H . , Oka , K . , Takahashi, M . , Hojo , F . , Osaki, T . , Hanawa , Zhao , J ., Krishna , V ., Moudgil, B ., and Koopman , B . (2008 ) . T . , Kurata , S . , Yonezawa, H . , and Kamiya , S . ( 2011 ) . Inhibition of Evaluation of endospore purification methods applied to Bacillus the cytotoxic effect of Clostridium difficile in vitro by Clostridium cereus. Separation and Purification Technology 61( 3 ), 341 -347 . butyricum MIYAIRI 588 strain . J . Med . Microbiol. 60 (Pt 11) , New Zealand First Examination Report, New Zealand Application 1617 - 1625 . No. 713298 , dated Feb . 28 , 2017 , 6 pages . U . S . Patent Jan . 2 , 2018 Sheet 1 of 21 US 9 ,855 , 303 B2
19 - wwwwww9 - 9 - 994 to sto sto sto too doo doo FIG . 1A 1 AAATIGAAGAGTIGATCATGGCICAGATTGAACGCTGGCGGCAGGOCIA AAVAGGAAGAA 101 GIGGOGGAOGGGTGAGTAATGTCTGGGAAACIGOCIGATGGAGGGGGATA 151 ACTACIGGAAACGGTAGCTAATACCGCATAACGICGCAAGACCAAAGAGG TCGGATOT CCAGAT 251 TAGGIGGGGTAACGGCTCACCIAGGOGAOGAICOCTAGCTGGICIGAGAG
401 GCGTGTAIGAAGAAGGCCTTCGGGTTGTA4AGTACTTTCAGCGGGGAGGA TTACCCGCAGAAGAAGC 501 4000GCTAACICG1GOCCAGOCA7GCGCAOGAATAOGGAGGIOCAAGCOT 551 TAATCOGHATTACIGGGCGTAAAGCGCACGCAGGCGGITIGITAAGICAG 601 ATGIGAAATCCCCGGGCICAACCIGGGAACTGCATCTGATACIGGCAAGC 651 TTGAGICICGTAGAGGGGGGTAGAATICCAGGIOTAGCGGIGAAATGOGT 701 AGAGATCIGGAGGAATACOGGIGGOGAAGGOGGOCOCCIGGACGAAGACT 751 0400CIGAOGTOOGADAGOGIGGGGAGCAAACAGGATTAGATAOCCYGGT 801 AGIOCACGOCCIAAACGATGICGACHIGGAGGIGIGOCCIGAGGCGIG 881 GCTICCGGAGCTAACGCGTTAAGIOGACCGOCIGGGGAGIAOGGOCGCAA 901 GGIAAAACICAAAIGAATIGACGGGGGCOCGCACAAGOGGIGGAGCATO 951 TGGTTAADICGATGCAACGCGAAGAA0CTTACCIGGTCTTGACATCCAC 1001 GGAAGTICAGAGATGAGAAIGIGCCTICGGGAACCGTGAGACAGGIGO 1051 IGCAIGGCIGIOGICAGOTCGTOUGIGAAAIGTIGGGUTAAGICOCGCA 110 AOGAGOGCAACOCTAICCUIGTIGCCAGCGGICOGGCCGGGAACICAA 1151 AGGAGACIGCCAGIGATAAACTGGAGGAAGGTGGGGATGACOTCAAGICA 1201 ICAIGGCOCUACGACCAGGGCTACACACGIGCTACAATGGOGCATACAA 1251 AGAGAAGCGACCTCGCGAGAGCAAGCGGACCICATAAAGIGCGICGIAGI 1301 CCGGADGGAGTCTGCAACICGACICCATGAAGICGGAATCGCTAGTAAT 1351 CGIGGATCAGAAIGOCACGGTGAATACGTICCOGGGCCUGTACACACCG 1 :01 . CCCGMCACACCATGGGAGTGGGTIGCAAAAGAAGTAGGTAGCITAACCU 1451 CGGGAGGGCGCUTACCACTIOGATICATGACIGGGGTGAAGICGTAAC 3501 AAGOTAACCGIAGGGGAACCIGOGGTIGGAICACCICQUA U . S . Patent Jan . 2 , 2018 Sheet 2 of 21 US 9 ,855 , 303 B2
FIG . 2 U . S . Patent Jan . 2 , 2018 Sheet 3 of 21 US 9 ,855 , 303 B2
FIG.3 U . S . Patent Jan . 2 , 2018 Sheet 4 of 21 US 9 ,855 , 303 B2
oueuspoleen-Sosods* juopelopoleon-oueue uxwoouenSajodspagund VOXWoouen jonuodoplewho
'. :w
.
* www .
*
wwwwww.walimwambini VZ&ZZOC6181219199181210L68290% 591
* wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww kea
wwwwwwwwwwww*
*
.wwwno
0%* YYYYYYYYYYYYYYYYYYYYYYYYYY * * ** * * * * * * * * 8 e pasne @ Alains % U . S . Patent Jan . 2 , 2018 Sheet 5 of 21 US 9 ,855 , 303 B2
SalaxisDarwan-OUEUES BIDEIDPSILOX-Polegg UKUJULAsuadspayund JONOOD
.: UDÁWOODEN aswe
Va www
.
*
. wwwwwwwwwwwwwwwwwwwwww * ????????? VEZUZ170261812191SIFICIUIIOL6X . wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww 9OB
* kea
??
* 9$7
*
*
wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww *wwwwwwwwww wwwwwwwwww
1076 ?? * wwwwwwwwwwwwwwww 5
:
: PEALAMS % U . S . Patent Jan . 2 , 2018 Sheet 6 of 21 US 9 ,855 , 303 B2
' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' '
3xos VWotbapOLD 90deg10min YIBap06 H043%OSYTO H019%osydo H013%OSYSZO D80deg10min VWOTSapoorO ?IBapOLO uIBapooro Vorsuadsns%OID IBap08p
*
:
*
*
*
* WWW
* . FIG.6
.
.
.
.
.
*
.*
*
80*300T 80*300 6043001 1.00E+07 1.00E+06 1.00E+05 1.00E+04 20*3001 10+300-T 004300T du?mi BBA Anaerobi cron ' U . S . Patent Jan . 2 , 2018 Sheet 7 of 21 US 9 ,855 , 303 B2
'-
- PUASA - VZASU SUASH 6ZASU
1111111111
*
-
*
-
- 209
* - (20-)unosaalla
* OUWSJeayaid
- * TXXXXXXXWWWWWWWWWWWWWWW
-
* : : : : :: : : :: : : : : : :: : : : : : ..
*
'-. US "T"* III. L93 (20+)V88 * Juaweal * Payad
w
* WWW1
- * OUWS 009 (20+)K?xuoopew
*
- * eaqald
* vvvvv wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
- WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW. ?0+3? 2031 90+31 S0+3*1 €0*341 20+31 10*31 hiteltet 80431 ) ml/ cfu ( survival Cell 00431 ...... * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * U . S . Patent Jan . 2 , 2018 Sheet 8 of 21 US 9 ,855 , 303 B2
???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ogoraeueVand
.:wiwiwii * 0001 *
.w OOSE .",*'· 000€
* :wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww .:9414414424444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444 * wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww 891
*WWWWWWWWWWWWW (spuodas)suu wwmmmmmmmmmmmmmmmmmm. WOST000000$!
W*
MMMMMMMMMM* WOOL
*
*MAMAMA wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww OOS
W
0
80* $0*31 20*31 90*31 10-31 00*37 2 iiniiwiminimiviminiwminiwminiwminiwminiwminiwminiwminiwmiwiwiwiwminiwmiwiwwiiwiwiwiiwin 031 20431 )ml / cfu ( survival Cell U . S . Patent Jan . 2 , 2018 Sheet 9 of 21 US 9 ,855 , 303 B2
????????????????????????????????????????????????????????????????????????????????????????????? 1006 * 10 ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' 1 ,006 09 * 2. 006408 en
:
:
h t . 098: : . : . :* : * SporeCFU/gram * mannin mahinnainmaniningIII." 7474YY.ir 1006406 *XXXSXXSKSEXSXXXXXXXXXXXXXXXXXXX +
WWWWY739789813394W: * *
1.LA 1 00EXOS w * www
...... inin 100E +OX RUTIAISESTISEUS?UTIQESUESHTKIUSAUSISXXIS?NEMASIESINIMESIMI * VYYYYYyyyyyyyV * XXXXXXXXXXXXXXXXXXXXXXXX m WWWWWWWWWWW * WW ma
wwwwwwwwwwwwwwwwwwwwwwwwately * . . 1. . . . 00E...... + . 03. . . . . Donations133333333333333333333333333333333333333333 ( Colored by Donor) wwwwwwwwwwwwwwwwwwwwwww SEXXX * * * * * * * * * * * * * * * ' * ' * ' * ' * ' ' ' wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww" " " " " " " " " " " " " " " " " 1 . 00E 00€ + 10 ...... 1* 300 *60 1. 00€ + 08 1. 00E + 02 wwwwwwwwwww www
SporeEquivalents/gram * WNLOADS www WWWWWWWWWWWW 100E + 06 W
*#777777777777777777777777 * WWW. 1. . . 00E...... +. 05. . . winnin'ininaniniwannan. Wiki 1. 00E +04 XXXXXXXXXXX erewewewwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww *
1 . 00503 w >wwwWw Donations3333333333333333333333333333333333333333 X WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW (Colored by Donor) VYAWWWWWWWWWXWXWWVYXYTKYONEX 3XXXXXXXXXXW8393823833 wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwYAMAHALAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww WWWWWWWWWWWWWWWWWWWWWWWWWWWWW wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww ??????????????????????????????????????????????? FIG . 9 U . S . Patent Jan . 2 , 2018 Sheet 10 of 21 US 9 ,855 , 303 B2
*." suezuawaj?q unorkingo sauešojodson *.
Y* FIG.10 L9$ (w/sappedwiods)2o1
*.
No????????????????????????????????????????????????????????????????????????????????????????????? ) Fluorescence ( Log U . S . Patent Jan . 2 , 2018 Sheet 11 of 21 US 9 ,855 , 303 B2
finisiminimi * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
*.
w * 0 .8 * * * * * * * * * * * * ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? ? ?? ? ? ? ?? ? ? inini OBHIS OX COPA QRF 16 : 05 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? * * * * * * * * * * * * * * * * * * * * * * SGF w MUC FBS 1 .6 0 .4 wwwwwwww 1 . 6 $ 0 . 3 . www . SOA
wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwLLLL 16 +0 . 67
1. 6405 & BMIS OK # Ca - DRA RE SGF Muc 1 . 6 * 0 . FBS thi
+
+ ?????????? wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwiiiiiiiiiiiiiiiiiiwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww 1 *03 ** * wwwwwwwwwwwwwwwwwwwwwwwwwww BBA SW SWBLys MXGSC M2GSCLYS FIG . 11 U . S . Patent Jan . 2 , 2018 Sheet 12 of 21 US 9 ,855 , 303 B2
1019 EtOHoxgall plated on GAMmannitol& GAMFOS Inulin n83
Blauda Wexlande Rukococas sp Sing www Butyrivitxo COSUUS *Clostridiales sp SS : 4 Clostridiales sp $ 834 Rumococcusom R ococcus atas Clestrom smutkettii Lacrospira o Clostridium wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww actinoschino disponicum Clostridium lavalense Clostridium sordni Becleantem Bulbranchorien rectal DSM Ucien rectale $ 2 $ 52
1019 BOH plated on PEA sheepbloodn- 262 Ruinococcus albus NCBI Rurinococcus sp K1 wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww Ruminococos 7 Clostridam ' spcem
FIG . 12 U . S . Patent Jan . 2 , 2018 Sheet 13 of 21 US 9, 855 ,303 B2
55C 75C ORT 0650 850O DonorC
*.
DonorB SampleDonor FIG.13
ut DonorA
* * * * * * * . . *. * . . * . . *. * * * . 90*3001 00E071. 06+00E.1+061.00E +041.00E +031.00E mL/ CFU Spore U . S . Patent Jan . 2 , 2018 Sheet 14 of 21 US 9 ,855 , 303 B2
* * * * * * * * * * * * * * * * * * * * * * * * * * *' ' ' ' " " *' * ' ' * ' * ' * Donor 4 on Sweet S Plate 2* 300 * 90 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * ** * * * ** * * * * * * * * * * * * * * * * * * * * * * * * * * * **
* 1. 00E +05
CFU/ml * awkzosA7 1 . 00E400
*
3001 * €0 RT 55C 65C 75C 85C
uoneappy...... asnjejadwal * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * ** * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * ** * * * * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * jouod y to 97W $ # 9043001 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * **
2 .00E + 05 SYY CFU/mL BuizosA1 3001 + 90 * * ) .QWAZOSA ...... ?;
1. 00€ * 03 RT 55C 65C 75C 85C
Activation. . . . . ! ! ! ! ! ! ! ! ! ! ! ! Temperature FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FIG . 14 n: S' f?rd uer' 7 107 8 jaayS SI JO I7 sn 6' EOE?SS8 &
CFU/ml VdO.
:: : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :: : :: : : : : : : : : : : : : : : : : : : : : :: . : . : . : . . . : . . . : . : . : . . : . : . . : ...... : . : . : . : . : . . . . . : . . : . . : . : . . . : . : . . : . : . . : . . . . : . . : . : . : . . : . : . : . : . : . : . : 33: : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : 33333 : 33 : 37 : :12 :: : : : : : : : : : : : : : : : : : : : : : : :: : : : :: : : : : :: : : : : : : : : : : : :: : : : : : : : : : : : :: : : : : : :: : :: : :: : :: : : : : :: : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : W21:35 2: : : : : : : : : : : : : : : : : :: : : : :: : : : : : : : : : : : :: : : : : : : : : : : : : : : : : : : : :: : : : : : : : :: : : : : : : : : : : :: : : : : : : 8128MS W FOS/Inulin
Syyyy TT T TTTTTT ...... iii : : : : : : : : : : : : : : : : : : : : : : : : : :: : : : : : : :: : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :: : : : : : : : : : : : : : : : : : : : : : : :: : : : : : : : :: : : : : : : : : : : : :: : : : : : : : : : :: : :: : : : : :: : :: : :: :: : : : : : :: " " " " " " " " " " " " " " " * * * * * * * * * * * * * * * * * * W33 M2GSC FIG.15
: : : : : : : : : : : : : : : : : : : : :: : : : : : : : : : : : : : : : : : : : : : : : :: : : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : : : : : : . : . : . : : . : . : . : . : : . : . : . : . : . : . : . : . : . : . : . : . : . : . : : : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : : : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : . : .. .: .: ...... GAMFOS/Inulin
*.
Winni : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :: : : : :: : : : : : : : : : : : : : : : : : : : : 3293333333 :: : : : :: : : :: : :: : :: : : :: : : : : : :: : : : : : : : : : : : : : : : : : : : :: : . : . : . : : : :: : : : : : : : : : : : : :: : ...... : BBA
WW
100E+07 LO0E+06 1.00€05 1.00E+09 1.00€408 mL/ CFU U . S . Patent Jan . 2 , 2018 Sheet 16 of 21 US 9 ,855 , 303 B2
2 Day Plate Scrape - EIOH 100E + 09
: : : : * . . . 11":1
1 . 006 - 08 " . . . . : : :
: 333333333333333EEEEEE333333333333*
1 ...... : 3 .4 .4 .4 . 4 $ 1. 00E +07 : : :
: : : : : : * CFU mL.
:. I2922932:5539929939931 1. 00E + 05 . ' ' ......
:
:
: 1 . 00€ * 04 *. . .* GAM W2GSQ Sweet 8 FOs nuin 803/ Wimui w wwwwwwwwwwwwwwwwwwwwwwwwwwwwwww 7 Day Plate Scrape * EXOH Oxgalt 1. 00E + 00 * * * * * * * * * * * * * * * * * * ** * * * * * ** * * * * ** * * ** * * * ** * * * * ** * * ** * * * ** * * * ** * * * ** *
1, 006 08
: 33333333333333333 CFUml XOFUM 77777777777733333333333333333333333333 * OPA VO0E 00 1
:
100E + 05 : 334 GAM 2GSC Sweet . Wurso 33333333333333333333333333333333333333333333 WOULSOX3333555555555555XE9X3991537777777777777777 FIG . 16 U . S . Patent Jan . 2 , 2018 Sheet 17 of 21 US 9, 855 , 303 B2
.0sporulatablespores gradient-purified .O-37425*NaivaSE sucap treated-3746BIOHS6 deaths Day
{" Aeo 01 anne on juben 1 - Day to Relative Weight
Omsajodsaqeeuwla FIG.17 -1deaths treated,374.5=E1OM-SE perund-uspelo Aeo Suspension374.3*FecalSE- deaths
. 8 L - ?g ?i sang A H?NG 1 - Day to Relative Weight
10-Vehiclew 0gradient-purifiedspores. sweep kedtreated,374.*E10H-SE deaths 374.SE-
* 1600 ameo Uom * * ABQ 0 Omee yoon U . S . Patent Jan . 2 , 2018 Sheet 18 of 21 US 9 ,855 , 303 B2
40000 35000
15000200002500030000 chaol:Samplelowinterminationminigaminimoministrimi SequencesPerSample FIG.18 rinnan niet imin10000 niinoinnimin5000
500m 400 chaol Measure Rarefaction U . S . Patent Jan . 2 , 2018 Sheet 19 of 21 US 9 ,855 , 303 B2
PATI.dont SERIESER-109 PC1(43%) PAT1.patidm1
FIG.19 SAT1.patid14 PAT1.pat1d25 D14D14 pamp25|PC2(31%)D25 PA11patids D5 PC3(24%) U . S . Patent Jan . 2 , 2018 Sheet 20 of 21 US 9 ,855 , 303 B2
·www wwwww WW
: : : : : : Wk4 wwwwwwwwww wwwwwwwwww Pt02 w * ed
wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww* Wwwwwwwwwww FIG.20 Bacteroidesfragilisgroupspecies PM wwwwwwwwwww ww Pt01 LLLLLLLLLLLLLLLLLLLLLLLLLLLL 910
WWW
08+E.1 16+04 1.6+02 1.6*00 01+31 60631 1.6407 16406 1.E+053 1.E103 1.6401 U . S . Patent Jan . 2 , 2018 Sheet 21 of 21 US 9 ,855 , 303 B2
- 30 - oc
-
.
. . 25 . 9€
.
. 20
.
. MI . wwwwww . 15 . 02910X Day
.
. . wwwwwwwwwwwwwww . 10
.
.
.
. wwwwwwwwwwwwww
. . $ 5 .
. . wwww w . . wwww 88 8 8 8 quepungy angoo Abundance Relative wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * FIG.21 30 30
25 25 VW 20 20 15 15
*
10 10
5 5 wwwwwwwwwwwwwwwwwwwwwwwwww WWW 0 888 SO Abundance Relative Abundance Relative WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW US 9 , 855 , 303 B2 COMPOSITIONS AND METHODS diseases and disorders are chronic conditions that signifi cantly decrease a subject' s quality of life and can be ulti RELATED APPLICATIONS mately fatal . Manufacturers of probiotics have asserted that their This application is a continuation of U . S . application Ser. 5 preparations of bacteria promote mammalian health by No. 14 / 884 ,655 filed Oct . 15 , 2015 , ( allowed ), which is a preserving the natural microflora in the GI tract and rein continuation of U . S . application Ser. No . 14 /313 , 828 filed forcing the normal controls on aberrant immune responses . Jun . 24 , 2014 , now U . S . Pat . No . 9 , 180 ,147 , issued Nov . 10 , See , e. g ., U . S . Pat . No. 8 , 034 ,601 . Probiotics, however, have 2015 , which is a divisional of U . S . application Ser. No. been limited to a very narrow group of genera and a 14 / 197 ,044 , filed Mar. 4 , 2014 , now U . S . Pat . No. 9 , 011 , 834 , " correspondingly limited number of species ; as such , they do issued Apr. 21 , 2015 , which is a continuation of International not adequately replace the missing natural microflora of the Application No . PCT/ US2014 /014745 , filed Feb . 4 , 2014 , GI tract in many situations . which claims priority to U . S . Provisional Application No . Thus practitioners have a need for a method of populating 61/ 760 , 584 , filed Feb . 4 , 2013 , and U . S . Provisional Appli - 15 a subject ' s gastrointestinal tract with a diverse and useful cation No . 61/ 760 , 585 , filed Feb . 4 , 2013 , and U . S . Provi - selection of microbiota in order to alter a dysbiosis . sional Application No . 61 /760 ,574 , filed Feb . 4 , 2013 , and Therefore , in response to the need for durable , efficient, U . S . Provisional Application No . 61/ 760 ,606 , filed Feb . 4 , and effective compositions and methods for treatment of GI 2013 , and U . S . Provisional Application No. 61/ 926 , 918 , diseases by way of restoring or enhancing microbiota func filed Jan . 13, 2014 . These applications are all incorporated 20 tions, we address these and other shortcomings of the prior by reference in their entirety for all purposes. art by providing compositions and methods for treating subjects. REFERENCE TO A SEQUENCE LISTING SUMMARY OF THE INVENTION This application includes a Sequence Listing with 2043 25 sequences submitted electronically as a text file named Disclosed herein are therapeutic compositions containing 36011_ US _ Sequence _ Listing. txt, created on Jan . 12 , 2017 , non -pathogenic , germination - competent bacterial spores, with a size of 4 ,324 ,673 bytes . The sequence listing is for the prevention , control, and treatment of gastrointestinal incorporated by reference . diseases, disorders and conditions and for general nutritional 30 health . These compositions are advantageous in being suit BACKGROUND able for safe administration to humans and othermammalian subjects and are efficacious in numerous gastrointestinal Mammals are colonized by microbes in the gastrointes diseases, disorders and conditions and in general nutritional tinal (GI ) tract , on the skin , and in other epithelial and tissue health . niches such as the oral cavity , eye surface and vagina . The 35 gastrointestinal tract harbors an abundant and diverse micro BRIEF DESCRIPTION OF THE DRAWINGS bial community . It is a complex system , providing an environment or niche for a community of many different FIG . 1A provides a schematic of 16S rRNA gene and species or organisms, including diverse strains of bacteria . denotes the coordinates of hypervariable regions 1 - 9 (V1 Hundreds of different species may form a commensal com - 40 V9 ). Coordinates of V1- V9 are 69 - 99 , 137 - 242 , 433 - 497 , munity in the GI tract in a healthy person , and this comple - 576 -682 , 822 -879 , 986 - 1043 , 1117 - 1173 , 1243 -1294 , and ment of organisms evolves from the time of birth to ulti - 1435 - 1465 respectively, based on numbering using E . coli mately form a functionally mature microbial population by system of nomenclature defined by Brosius et al. , Complete about 3 years of age . Interactions between microbial strains nucleotide sequence of a 16S ribosomal RNA gene ( 16S in these populations and between microbes and the host , e . g . 45 rRNA ) from Escherichia coli, PNAS 75 ( 10 ) : 4801 - 4805 the host immune system , shape the community structure , ( 1978 ) . FIG . 1B highlights in bold the nucleotide sequences with availability of and competition for resources affecting for each hypervariable region in the exemplary reference E . the distribution of microbes . Such resources may be food , coli 16S sequence described by Brosius et al. FIG . 1B location and the availability of space to grow or a physical discloses SEQ ID NO : 2043 . structure to which the microbe may attach . For example , 50 FIG . 2 shows a photograph of a CsC1 gradient demon host diet is involved in shaping the GI tract flora . strating the spore separation from other residual habitat A healthy microbiota provides the host with multiple material. benefits , including colonization resistance to a broad spec - FIG . 3 shows three phase contrast image demonstrating trum of pathogens, essential nutrient biosynthesis and the progressive enrichment of spores from a fecal suspen absorption , and immune stimulation thatmaintains a healthy 55 sion ; ethanol treated , CsCl purified spore preparation ; and an gut epithelium and an appropriately controlled systemic ethanol treated , CsClpurified , sucrose purified spore prepa immunity . In settings of tlysbiosis ' or disrupted symbiosis , ration . microbiota functions can be lost or deranged , resulting in FIG . 4 shows a set of survival curves demonstrating increased susceptibility to pathogens, altered metabolic pro - efficacy of the spore population in a mouse prophylaxis files, or induction of proinflammatory signals that can result 60 model of C . difficile . in local or systemic inflammation or autoimmunity . Thus , FIG . 5 provides a set of survival curves demonstrating the intestinal microbiota plays a significant role in the efficacy of the spore population in a hamster relapse pre pathogenesis of many diseases and disorders , including a vention model of C . difficile . variety of pathogenic infections of the gut. For instance , FIG . 6 demonstrates the cell viability under a variety of subjects become more susceptible to pathogenic infections 65 ethanol and heat treatments for varying lengths of time. when the normal intestinal microbiota has been disturbed FIG . 7 demonstrates cell survivability from four donor due to use of broad -spectrum antibiotics. Many of these fecal samples after heat treatment at 60 C for 5 minutes. US 9 ,855 ,303 B2 FIG . 8 demonstrates that ethanol reduces both anaerobic agar which is highly selective for the B . fragilis group . and aerobic bacterial species by several orders ofmagnitude Species were determined by 16S full- length sequence iden in seconds. tification . FIG . 9 demonstrates the spore concentration of fecal FIG . 21 demonstrates the increase in number of species donations from multiple donors over time. 5 engrafting and species augmenting in patient' s microbiomes FIG . 10 shows the strong correlation and linear corre after treatment with an ethanol- treated spore population . spondence between the measurement of DPA concentration by a coupled fluorescence assay and the viable spore colony Relative abundance of species that engrafted or augmented forming units as described were determined based on the number of 16S FIG . 11 demonstrates the effect on various germination 10 sequence reads. Each plot is from a different patient treated treatments on the ability to cultivate vegetative bacteria from with the ethanol- treated spore population for recurrent C . a spore population . difficile . FIG . 12 demonstrates the increase in bacterial diversity The figures depict various embodiments of the present from using a germinant treatment to grow vegetative bac invention for purposes of illustration only . One skilled in the teria from spore populations . 15 art will readily recognize from the following discussion that FIG . 13 demonstrates the role of heat activation at various alternative embodiments of the structures and methods illus temperatures on spores from three different donor fecal trated herein may be employed without departing from the samples . principles of the invention described herein . FIG . 14 demonstrates a lysozyme treatment with heat activation improves germination at most temperatures . 20 DESCRIPTION OF THE TABLES FIG . 15 demonstrates spore concentrations present in a fecal sample grown on various medias . Table 1 . List of Operational Taxonomic Units (OTU ) with FIG . 16 demonstrates similar spore production from incu - taxonomic assignments made to Genus, Species , and Phy bating plates for 2 and 7 days after a spore population was logenetic Clade . Clade membership of bacterial OTUs is germinated on plates with various medias . 25 based on 16S sequence data . Clades are defined based on the FIG . 17 demonstrates the protective efficacy of the spore topology of a phylogenetic tree that is constructed from population in mice challenged with C . difficile as measured full - length 16S sequences using maximum likelihood meth by the change in weight of mice over the course of the ods familiar to individuals with ordinary skill in the art of experiment. Each plot tracks the change in the individual phylogenetics . Clades are constructed to ensure that all mouse ' s weight relative to day - 1 over the course of the 30 OTUs in a given clade are : ( i ) within a specified number of experiment. The number of deaths over the course of the bootstrap supported nodes from one another , and ( ii ) within experiment is indicated at the top of the chart and demon - 5 %% genetic similarity . OTUs that are within the same clade strated by a line termination prior to day 6 . The top panels can be distinguished as genetically and phylogenetically ( from left to right) are the vehicle control arm , the fecal suspension arm , and the untreated naive control arm , while 35 distinct from OTUs in a different clade based on 16S -V4 the bottom panels are the ethanol treated , gradient purified sequence data , while OTUs falling within the same clade are spore preparation ; the ethanol treated , gradient purified , closely related . OTUs falling within the same clade are “ germinable ” spore preparation , and ethanol treated , gradi evolutionarily closely related and may or may not be dis ent purified , “ sporulatable ” preparation . tinguishable from one another using 16S - V4 sequence data . FIG . 18 demonstrates the microbial diversity measured in 40 . Members of the same clade , due to their evolutionary the ethanol treated spore treatment sample and patient pre - relatedness, play similar functional roles in a microbial and post - treatment samples . Total microbial diversity is ecology such as that found in the human gut. Compositions defined using the Chaol Alpha -Diversity Index and is mea - substituting one species with another from the same clade sured at the same genomic sampling depths to confirm are likely to have conserved ecological function and there adequate sequence coverage to assay the microbiome in the 45 fore are useful in the present invention . All OTUs are target samples . The patient pretreatment (purple ) harbored a denoted as to their putative capacity to form spores and microbiome that was significantly reduced in total diversity whether they are a Pathogen or Pathobiont ( see Definitions as compared to the ethanol treated spore treatment ( red ) and for description of " Pathobiont” ) . NIAID Priority Pathogens patient post treatment at days 5 (blue ) , 14 (orange ) , and 25 are denoted as ' Category - A ' , 'Category - B ’ , or ‘ Category -C° , ( green ) . 50 and Opportunistic Pathogens are denoted as 'OP ' . OTUS FIG . 19 demonstrates how the patient microbial ecology that are not pathogenic or for which their ability to exist as is shifted by treatment with an ethanol treated spore treat- a pathogen is unknown are denoted as 'N ' . The ' SEQ ID ment from a dysbiotic state to a state of health . Principle Number ' denotes the identifier of the OTU in the Sequence coordinates analysis based on the total diversity and struc - Listing File and ‘Public DB Accession ' denotes the identifier ture of the microbiome (Bray Curtis Beta Diversity ) of the 55 of the OTU in a public sequence repository . patient pre - and post -treatment delineates that the combina Table 2 contains bacterial OTUs identified from the 16s tion of engraftment of the OTUs from the spore treatment analysis of the ethanol treated spore population before and and the augmentation of the patientmicrobial ecology leads after a CsCl gradient purification . to a microbial ecology that is distinct from both the pre Table 3 contains the mortality and weight change ofmice treatmentmicrobiome and the ecology of the ethanol treated 60 treated with a donor fecal suspension and an ethanol and / or spore treatment. heat- treated spore preparation at various dilutions, FIG . 20 demonstrates the augmentation of bacteroides Table 4 contains OTUs identified from spore forming species in patients treated with the spore population . Com species generated by picking colonies from a spore prepa paring the number of Bacteroides colonies from fecal sus ration involving various heat treatments pensions pre - treatment and in week 4 post treatment reveals 65 Table 5 contains OTUs not identified in untreated fecal an increase of 4 logs or greater. Colonies were enumerated slurries, but identified in ethanol treated or heat treated spore by serial dilution and plating on Bacteroides Bile Esculin populations. US 9 ,855 ,303 B2 Table 6 contains OTUs identified from an ethanol treated subjects and are efficacious in numerous gastrointestinal spore population isolated from a microbiome sample from diseases , disorders and conditions and in general nutritional donor A . health . While spore -based compositions are known , these Table 7 contains OTUs identified from an ethanol treated are generally prepared according to various techniques such spore population isolated from a microbiome sample from 5 as lyophilization or spray - drying of liquid bacterial cultures , donor B . resulting in poor efficacy , instability , substantial variability Table 8 contains OTUs identified from an ethanol treated and lack of adequate safety and efficacy . spore population isolated from a microbiome sample from It has now been found that populations of bacterial spores donor C . can be obtained from biological materials obtained from Table 9 contains OTUs identified from an ethanol treated 10 mammalian subjects , including humans. These populations spore population isolated from a microbiome sample from are formulated into compositions as provided herein , and donor D . Table 10 contains OTUs identified from an ethanol treated administered to mammalian subjects using the methods as spore population isolated from a microbiome sample from provided herein . donor E . 15 Table 11 contains OTUs identified from an ethanol treated Definitions spore population isolated from a microbiome sample from donor F . “ Microbiota ” refers to the community of microorganisms Table 12 contains OTUs identified from growing ethanol that occur ( sustainably or transiently ) in and on an animal treated spore populations on various media types . 20 subject, typically a mammal such as a human , including Table 13 . Species identified as “ germinable ” and “ sporu - eukaryotes, archaea , bacteria , and viruses ( including bacte latable ” by colony picking approach rial viruses i .e . , phage ) . Table YYY . Species identified as “ germinable " using “ Microbiome” refers to the genetic content of the com 16S - V4 NGS approach . munities of microbes that live in and on the human body, Table Zzz . Species identified as “ sporulatable ” using 25 both sustainably and transiently , including eukaryotes, 16s - V4 NGS approach . archaea , bacteria , and viruses (including bacterial viruses Table AC shows spore content data from 3 different (i . e ., phage )) , wherein " genetic content" includes genomic ethanol treated spore preparations used to successfully treat DNA, RNA such as ribosomal RNA , the epigenome, plas 3 patients suffering from recurrent C . difficile infection . mids , and all other types of genetic information . Table AD . DPA doses in Table AC when normalized to 30 “Microbial Carriage ” or simply “ Carriage” refers to the 4x105 SCFU per dose population of microbes inhabiting a niche within or on Table GB . OTUs detected by a minimum of ten 16S - V4 humans. Carriage is often defined in terms of relative sequence reads in at least a one ethanol treated spore abundance . For example , OTU1 comprises 60 % of the total preparation (pan -microbiome ) . OTUS that engraft in a microbial carriage , meaning that OTU1 has a relative abun treated patients and the percentage of patients in which they 35 dance of 60 % compared to the other OTUs in the sample engraft are denoted , as are the clades , spore forming status, from which the measurement was made . Carriage is most and Keystone OTU status . Starred OTUs occur in > 80 % of often based on genomic sequencing data where the relative the ethanol preps and engraft in 250 % of the treated patients . abundance or carriage of a single OTU or group ofOTUs is Table GC ranks the top 20 OTUs by CES with the further defined by the number of sequencing reads that are assigned requirement that an OTU must be shown to engraft to be a 40 to that OTU /s relative to the total number of sequencing considered an element of a core ecology . reads for the sample . Table GD : Subsets of the Core Ecology tested in the C . “ Microbial Augmentation ” or simply “ augmentation ” difficile mouse model refers to the establishment or significant increase of a Table GE : Results of bacterial compositions tested in a C . population ofmicrobes that are ( i ) absent or undetectable (as difficile mouse model . 45 determined by the use of standard genomic and microbio Table GF. OTUs and their clade assignments tested in logical techniques ) from the administered therapeutic micro ternary combinations with results in the in vitro inhibition bial composition , (ii ) absent, undetectable , or present at low assay frequencies in the host niche (as example : gastrointestinal Table ZA . Microbial compositions administered via oral tract , skin , anterior- nares, or vagina ) before the delivery of gavage on Day - 1 50 the microbial composition , and ( iii ) are found after the Table TAB . Population of OTUs on Days 2 , 3 and 4 administration of the microbial composition or significantly following dosing with Microbial Compositions increase , for instance 2 - fold , 5 - fold , 1x102 , 1x103, 1x104, Table TAC . Population of Clades on Days 2 , 3 and 4 1x10°, 1x10°, 1x10 ' , or greater than 1x108 , in cases where following dosing with Microbial Compositions they were present at low frequencies . The microbes that Table TAD . Mortality by experimental group in mice 55 comprise an augmented ecology can be derived from exog challenged with 104 . 5 C . difficile spores on Day 0 enous sources such as food and the environment, or grow out from micro -niches within the host where they reside at low DETAILED DESCRIPTION frequency. The administration of the therapeutic microbial compo Overview 60 sition induces an environmental shift in the target niche that promotes favorable conditions for the growth of these com Disclosed herein are therapeutic compositions containing mensal microbes. In the absence of treatment with a thera non - pathogenic , germination - competent bacterial spores , peutic microbial composition , the host can be constantly for the prevention , control, and treatment of gastrointestinal exposed to these microbes ; however, sustained growth and diseases, disorders and conditions and for general nutritional 65 the positive health effects associated with the stable popu health . These compositions are advantageous in being suit - lation of increased levels of the microbes comprising the able for safe administration to humans and other mammalian augmented ecology are not observed . US 9 , 855 , 303 B2 “ Microbial Engraftment” or simply “ engraftment” refers Acids Res 38 : e200 . Konstantinidis K T , Ramette A , and to the establishment of OTUs comprising a therapeutic Tiedje J M . 2006 . The bacterial species definition in the microbial composition in a target niche that are absent in the genomic era . Philos Trans R Soc Lond B Blot Sci 361: treated host prior to treatment. The microbes that comprise 1929 - 1940 . ). In embodiments involving the complete the engrafted ecology are found in the therapeutic microbial 5 genome, MLSTs, specific genes , or sets of genes OTUS that composition and establish as constituents of the host micro share > 95 % average nucleotide identity are considered the bial ecology upon treatment . Engrafted OTUs can establish same OTU (see e . g . Achtman M , and Wagner M . 2008 . for a transient period of time , or demonstrate long - term stability in the microbial ecology that populates the host post Microbial diversity and the genetic nature of microbial treatment with a therapeutic microbial composition . The 10 species . Nat . Rev .Microbiol . 6 : 431 -440 . Konstantinidis KT, engrafted ecology can induce an environmental shift in the Ramette A , and Tiedje J M . 2006 . The bacterial species target niche that promotes favorable conditions for the definition in the genomic era . Philos Trans R Soc Lond B growth of commensal microbes capable of catalyzing a shift Biol Sci 361: 1929 - 1940 . ). OTUs are frequently defined by from a dysbiotic ecology to one representative of a health comparing sequences between organisms. Generally , state . sequences with less than 95 % sequence identity are not " Ecological Niche” or simply “ Niche ” refers to the eco considered to form part of the same OTU . OTUs may also logical space in which a an organism or group of organisms be characterized by any combination of nucleotide markers occupies . Niche describes how an organism or population or or genes , in particular highly conserved genes ( e .g . , " house organisms responds to the distribution of resources , physical keeping “ genes ) , or a combination thereof. Such character parameters ( e . g . , host tissue space ) and competitors (e . g ., by 20 ization employs , e. g . , WGS data or a whole genome growing when resources are abundant, and when predators , sequence . parasites and pathogens are scarce ) and how it in turn alters “ Residual habitat products ” refers to material derived those same factors ( e . g ., limiting access to resources by from the habitat for microbiota within or on a human or other organisms, acting as a food source for predators and a animal. For example , microbiota live in feces in the gastro consumer of prey ) . 25 intestinal tract, on the skin itself , in saliva , mucus of the “ Dysbiosis ” refers to a state of the microbiota of the gut respiratory tract, or secretions of the genitourinary tract ( i. e ., or other body area in a subject, including mucosal or skin biologicalmatter associated with the microbial community ) . surfaces in which the normal diversity and /or function of the Substantially free of residual habitat products means that the ecological network is disrupted . This unhealthy state can be bacterial composition no longer contains the biological due to a decrease in diversity, the overgrowth of one or more 30 pathogens or pathobionts , symbiotic organisms able to cause matter associated with the microbial environment on or in disease only when certain genetic and / or environmental the human or animal subject and is 100 % free , 99 % free , conditions are present in a subject , or the shift to an 98 % free , 97 % free , 96 % free , or 95 % free of any contami ecological microbial network that no longer provides an nating biological matter associated with the microbial com essential function to the host subject, and therefore no longer 35 munity". . Residual habitat products can include abiotic mate promotes health . rials ( including undigested food ) or it can include unwanted “ Pathobionts "” or "“ Opportunistic . Pathogens ” refers to microorganisms. Substantially free of residual habitat prod symbiotic organisms able to cause disease only when certain ucts may also mean that the bacterial composition contains genetic and /or environmental conditions are present in a no detectable cells from a human or animal and that only subject. 40 microbial cells are detectable . In one embodiment , substan " Phylogenetic tree ” refers to a graphical representation of tially free of residual habitat products may also mean that the the evolutionary relationships of one genetic sequence to bacterial composition contains no detectable viral ( including another that is generated using a defined set of phylogenetic bacterial viruses ( i . e . , phage ) ) , fungal, mycoplasmal con reconstruction algorithms ( e . g . parsimony , maximum like taminants . In another embodiment, it means that fewer than lihood , or Bayesian ). Nodes in the tree represent distinct 45 1x10 - 2 % , 1x10 - 3 % , 1x10 - 4 % , 1x10 - 6 % , 1x106 % , ancestral sequences and the confidence of any node is 1x10 - 7 % , 1x10 - 8 of the viable cells in the bacterial com provided by a bootstrap or Bayesian posterior probability , position are human or animal, as compared to microbial which measures branch uncertainty . cells. There are multiple ways to accomplish this degree of " Operational taxonomic units ,” “ OTU ” (or plural , purity , none of which are limiting . Thus , contamination may " OTUs” ) refer to a terminal leaf in a phylogenetic tree and 50 be reduced by isolating desired constituents through mul is defined by a nucleic acid sequence , e . g ., the entire tiple steps of streaking to single colonies on solid media until genome, or a specific genetic sequence , and all sequences replicate ( such as, but not limited to , two ) streaks from serial that share sequence identity to this nucleic acid sequence at single colonies have shown only a single colony morphol the level of species. In some embodiments the specific ogy . Alternatively, reduction of contamination can be genetic sequence may be the 16S sequence or a portion of 55 accomplished by multiple rounds of serial dilutions to single the 16S sequence . In other embodiments , the entire genomes desired cells ( e . g . , a dilution of 10 - 8 or 10 - 9 ) , such as of two entities are sequenced and compared . In another through multiple 10 - fold serial dilutions. This can further be embodiment, select regions such as multilocus sequence confirmed by showing that multiple isolated colonies have tags (MLST ), specific genes , or sets of genes may be similar cell shapes and Gram staining behavior. Other meth genetically compared . In 16S embodiments , OTUs that 60 ods for confirming adequate purity include genetic analysis share 297 % average nucleotide identity across the entire 16S ( e . g . PCR , DNA sequencing ) , serology and antigen analysis , or some variable region of the 16S are considered the same enzymatic and metabolic analysis , and methods using instru OTU ( see e . g . Claesson M J , Wang Q , O 'Sullivan 0 , mentation such as flow cytometry with reagents that distin Greene - Diniz R , Cole JR , Ros RP, and O ' Toole P W . 2010 . guish desired constituents from contaminants . Comparison of two next- generation sequencing technolo - 65 " Clade” refers to the OTUs or members of a phylogenetic gies for resolving highly complex microbiota composition tree that are downstream of a statistically valid node in a using tandem variable 16S rRNA gene regions. Nucleic phylogenetic tree . The clade comprises a set of terminal US 9 , 855 , 303 B2 10 leaves in the phylogenetic tree that is a distinct monophy The terms “Network Class” , “ Core Network ” and “ Core letic evolutionary unit and that share some extent of Network Ecology ” refer to a group of network ecologies that sequence similarity . in general are computationally determined to comprise In microbiology , “ 16S sequencing ” or “ 16S -rRNA ” or ecologies with similar phylogenetic and /or functional char “ 16S ” refers to sequence derived by characterizing the 5 acteristics . A Core Network therefore contains important nucleotides that comprise the 16S ribosomal RNA gene (s ). biological features , defined either phylogenetically or func The bacterial 16S rDNA is approximately 1500 nucleotides tionally , of a group ( i .e . , a cluster ) of related network in length and is used in reconstructing the evolutionary ecologies . One representation of a Core Network Ecology is relationships and sequence similarity of one bacterial isolate a designed consortium of microbes, typically non -patho to another using phylogenetic approaches . 16S sequences 10 genic bacteria , that represents core features of a set of are used for phylogenetic reconstruction as they are in phylogenetically or functionally related network ecologies general highly conserved , but contain specific hypervariable seen in many different subjects . In many occurrences , a Core regions that harbor sufficient nucleotide diversity to differ - Network , while designed as described herein , exists as a entiate genera and species of most bacteria . Network Ecology observed in one or more subjects . Core The “ V1 - V9 regions” of the 16S rRNA refers to the first 15 Network ecologies are useful for reversing or reducing a through ninth hypervariable regions of the 16S rRNA gene dysbiosis in subjects where the underlying, related Network that are used for genetic typing of bacterial samples . These Ecology has been disrupted . regions in bacteria are defined by nucleotides 69 - 99 , 137 - The term “ Keystone OTU ” refers to one or more OTUS 242 , 433 -497 , 576 -682 , 822 -879 , 986 - 1043 , 1117 -1173 , that are common to many network ecologies and are mem 1243 - 1294 and 1435 - 1465 respectively using numbering 20 bers of networks ecologies that occur in many subjects ( i. e . based on the E . coli system of nomenclature . Brosius et al. , are pervasive ) ( FIG . 1 ) . Due to the ubiquitous nature of Complete nucleotide sequence of a 16S ribosomal RNA Keystone OTUs, they are central to the function of network gene from Escherichia coli , PNAS 75 ( 10 ): 4801 - 4805 ecologies in healthy subjects and are often missing or at ( 1978 ) . In some embodiments , at least one of the V1 , V2 , reduced levels in subjects with disease . Keystone OTUSmay V3, V4 , V5 , V6 , 17 , 18, and V9 regions are used to 25 exist in low , moderate , or high abundance in subjects . characterize an OTU . In one embodiment, the V1, V2 , and The term “ non -Keystone OTU ” refers to an OTU that is V3 regions are used to characterize an OTU . In another observed in a Network Ecology and is not a keystone OTU . embodiment, the V3 , V4 , and V5 regions are used to The term “ Phylogenetic Diversity ” refers to the biodiver characterize an OTU . In another embodiment, the V4 region sity present in a given Network Ecology or Core Network is used to characterize an OTU . A person of ordinary skill in 30 Ecology based on the OTUs that comprise the network . the art can identify the specific hypervariable regions of a Phylogenetic diversity is a relative term , meaning that a candidate 16S rRNA by comparing the candidate sequence Network Ecology or Core Network that is comparatively in question to a reference sequence and identifying the more phylogenetically diverse than another network con hypervariable regions based on similarity to the reference tains a greater number of unique species , genera, and hypervariable regions, or alternatively , one can employ 35 taxonomic families . Uniqueness of a species , genera , or Whole Genome Shotgun (WGS ) sequence characterization taxonomic family is generally defined using a phylogenetic of microbes or a microbial community . tree that represents the genetic diversity all species, genera , The term “ subject” refers to any animal subject including or taxonomic families relative to one another . In another humans , laboratory animals ( e . g ., primates, rats , mice ) , embodiment phylogenetic diversity may be measured using livestock ( e . g . , cows, sheep , goats , pigs, turkeys , and chick - 40 the total branch length or average branch length of a ens ) , and household pets ( e . g . , dogs , cats, and rodents ). The phylogenetic tree . subjectmay be suffering from a dysbiosis , including, but not “ Spore " or " endospore ” refers to an entity , particularly a limited to , an infection due to a gastrointestinal pathogen or bacterial entity , which is in a dormant, non - vegetative and may be at risk of developing or transmitting to others an non - reproductive stage. Spores are generally resistant to infection due to a gastrointestinal pathogen . 45 environmental stress such as radiation , desiccation , enzy The term “ phenotype ” refers to a set of observable matic treatment, temperature variation , nutrient deprivation , characteristics of an individual entity . As example an india and chemical disinfectants . vidual subject may have a phenotype of “ health ” or “ dis - A “ spore population ” refers to a plurality of spores present ease ” . Phenotypes describe the state of an entity and all in a composition . Synonymous terms used herein include entities within a phenotype share the same set of character - 50 spore composition , spore preparation , ethanol treated spore istics that describe the phenotype . The phenotype of an fraction and spore ecology . A spore population may be individual results in part, or in whole , from the interaction of purified from a fecal donation , e. g . via ethanol or heat the entities genome and / or microbiome with the environ - treatment, or a density gradient separation or any combina ment . tion of methods described herein to increase the purity , The term " Network Ecology ” refers to a consortium of 55 potency and/ or concentration of spores in a sample . Alter OTUs that co - occur in some number of subjects . As used natively , a spore population may be derived through culture herein , a “ network ” is defined mathematically by a graph methods starting from isolated spore former species or spore delineating how specific nodes (i . e . OTUS ) and edges ( con - former OTUs or from a mixture of such species, either in nections between specific OTUS) relate to one another to vegetative or spore form . define the structural ecology of a consortium of OTUs. Any 60 In one embodiment, the spore preparation comprises given Network Ecology will possess inherent phylogenetic spore forming species wherein residual non - spore forming diversity and functional properties. A Network Ecology can species have been inactivated by chemical or physical also be defined in terms of function where for example the treatments including ethanol , detergent, heat , sonication , nodes would be comprised of elements such as , but not and the like ; or wherein the non - spore forming species have limited to , enzymes , clusters of orthologous groups (COGS ; 65 been removed from the spore preparation by various sepa http : // www .ncbi . nlm . nih . gov /books / NBK21090 / ) , or KEGG rations steps including density gradients, centrifugation , pathways (www . genome. jp /kegg ) . filtration and /or chromatography ; or wherein inactivation US 9 ,855 ,303 B2 12 and separation methods are combined to make the spore pyridoxine hydrochloride ), Vitamin B7 ( biotin ), Vitamin B9 preparation . In yet another embodiment , the spore prepara ( folic acid ) , and Vitamin B12 ( various cobalamins; com tion comprises spore forming species that are enriched over m only cyanocobalamin in vitamin supplements ) , vitamin C , viable non -spore formers or vegetative forms of spore vitamin D , vitamin E , vitamin K , K1 and K2 ( i . e . MK - 4 , formers . In this embodiment, spores are enriched by 2 - fold , 5 MK - 7 ) , folic acid and biotin ) essential in minute amounts for 5 - fold , 10 - fold , 50 - fold , 100 - fold , 1000 - fold , 10 , 000 - fold or normal growth and activity of the body and obtained natu greater than 10 , 000 - fold compared to all vegetative forms of rally from plant and animal foods or synthetically made , bacteria . In yet another embodiment, the spores in the spore pro - vitamins, derivatives, analogs. preparation undergo partial germination during processing As used herein , the term " minerals ” is understood to and formulation such that the final composition comprises 10 include boron , calcium , chromium , copper , iodine, iron , spores and vegetative bacteria derived from spore forming magnesium , manganese , molybdenum , nickel , phosphorus, species . potassium , selenium , silicon , tin , vanadium , zinc , or com A “ germinant” is a material or composition or physical binations thereof. chemical process capable of inducing vegetative growth of As used herein , the term “ antioxidant” is understood to a bacterium that is in a dormant spore form , or group of 15 include any one or more of various substances such as bacteria in the spore form , either directly or indirectly in a beta - carotene (a vitamin A precursor ) , vitamin C , vitamin E , host organism and /or in vitro . and selenium ) that inhibit oxidation or reactions promoted A “ sporulation induction agent” is a material or physical- by Reactive Oxygen Species ( “ ROS ” ) and other radical and chemical process that is capable of inducing sporulation in non -radical species . Additionally , antioxidants are mol a bacterium , either directly or indirectly , in a host organism 20 ecules capable of slowing or preventing the oxidation of and / or in vitro . other molecules . Non - limiting examples of antioxidants To “ increase production of bacterial spores ” includes an include astaxanthin , carotenoids, coenzyme Q10 activity or a sporulation induction agent. “ Production ” (“ CoQ10 ” ) , flavonoids, glutathione , Goji (wolfberry ) , hes includes conversion of vegetative bacterial cells into spores peridin , lactowolfberry , lignan , lutein , lycopene , polyphe and augmentation of the rate of such conversion , as well as 25 nols , selenium , vitamin A , vitamin C , vitamin E , zeaxanthin , decreasing the germination of bacteria in spore form , or combinations thereof. decreasing the rate of spore decay in vivo , or ex vivo , or to Compositions of the Invention increasing the total output of spores ( e .g . via an increase in Disclosed herein are therapeutic compositions containing volumetric output of fecal material ) . non - pathogenic , germination - competent bacterial spores , The " colonization ” of a host organism includes the non - 30 for the prevention , control, and treatment of gastrointestinal transitory residence of a bacterium or other microscopic diseases , disorders and conditions and for general nutritional organism . As used herein , " reducing colonization of a host health . These compositions are advantageous in being suit subject' s gastrointestinal tract ( or any other microbiotal able for safe administration to humans and other mammalian niche) by a pathogenic bacterium includes a reduction in the subjects and are efficacious in numerous gastrointestinal residence time of the pathogen in the gastrointestinal tract as 35 diseases , disorders and conditions and in general nutritional well as a reduction in the number (or concentration ) of the health . While spore -based compositions are known , these pathogen in the gastrointestinal tract or adhered to the are generally prepared according to various techniques such luminal surface of the gastrointestinal tract . Measuring as lyophilization or spray -drying of liquid bacterial cultures , reductions of adherent pathogens may be demonstrated , e . g ., resulting in poor efficacy , instability , substantial variability by a biopsy sample , or reductions may be measured indi- 40 and lack of adequate safety and efficacy . rectly , e . g. , by measuring the pathogenic burden in the stool It has now been found that populations of bacterial spores of a mammalian host . can be obtained from biological materials obtained from A “ combination ” of two or more bacteria includes the mammalian subjects , including humans . These populations physical co - existence of the two bacteria , either in the same are formulated into compositions as provided herein , and material or product or in physically connected products , as 45 administered to mammalian subjects using the methods as well as the temporal co -administration or co - localization of provided herein . the two bacteria . Provided herein are therapeutic compositions containing a A " cytotoxic ” activity or bacterium includes the ability to purified population of bacterial spores . As used herein , the kill a bacterial cell, such as a pathogenic bacterial cell . A terms " purify " , " purified ” and “ purifying " refer to the state " cytostatic ” activity or bacterium includes the ability to 50 of a population ( e . g . , a plurality of known or unknown inhibit , partially or fully , growth , metabolism , and /or pro - amount and /or concentration ) of desired bacterial spores , liferation of a bacterial cell , such as a pathogenic bacterial that have undergone one or more processes of purification , cell. e . g ., a selection or an enrichment of the desired bacterial To be free of “ non -comestible products” means that a spore , or alternatively a removal or reduction of residual bacterial composition or other material provided herein does 55 habitat products as described herein . In some embodiments , not have a substantial amount of a non -comestible product , a purified population has no detectable undesired activity or, e . g ., a product or material that is inedible , harmful or alternatively , the level or amount of the undesired activity is otherwise undesired in a product suitable for administration , at or below an acceptable level or amount. In other embodi e . g ., oral administration , to a human subject . Non - comes - ments , a purified population has an amount and / or concen tible products are often found in preparations of bacteria 60 tration of desired bacterial spores at or above an acceptable from the prior art. amount and /or concentration . In other embodiments, the As used herein the term “ vitamin ” is understood to ratio of desired -to -undesired activity ( e . g . spores compared include any of various fat -soluble or water- soluble organic to vegetative bacteria ) , has changed by 2 - , 5 - , 10 - , 30 - , 100 - , substances (non - limiting examples include vitamin A , Vita 300 -, 1x104 , 1x10 % , 1x10®, 1x107, 1x108 , or greater than min B1 (thiamine ) , Vitamin B2 ( riboflavin ) , Vitamin B3 65 1x10 % . In other embodiments , the purified population of (niacin or niacinamide ) , Vitamin B5 (pantothenic acid ), bacterial spores is enriched as compared to the starting Vitamin B6 (pyridoxine , pyridoxal, or pyridoxamine , or material ( e. g ., a fecal material ) from which the population is US 9 ,855 ,303 B2 13 14 obtained . This enrichmentmay be by 10 % , 20 % , 30 % , 40 % , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 75 , 100 , 200 , 300 , 400 , 500 , 50 % , 60 % , 70 % , 80 % , 90 % , 95 % , 96 % , 97 % , 98 % , 99 % , 750 , 1000 or from greater than 1000 donors , where such 99. 9 % , 99. 99 % , 99. 999 % , 99 . 9999 % , 99. 9999 % , or greater materials are then pooled prior to purification of the desired than 99 .999999 % as compared to the starting material . bacterial spores. In another embodiment, fecalmaterials can In certain embodiments , the purified populations of bac - 5 be obtained from a single donor subject over multiple times terial spores have reduced or undetectable levels of one or and pooled from multiple samples e . g . 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , more pathogenic activities, such as toxicity , an ability to 9 , 10 , 15, 20, 25 , 30 , 32, 35 , 40 , 45 , 48 , 50 , 100 samples from cause infection of the mammalian recipient subject, an a single donor. undesired immunomodulatory activity , an autoimmune I n alternative embodiments , the desired bacterial spores response , a metabolic response , or an inflammatory response 10 are purified from a single fecal material sample obtained or a neurological response . Such a reduction in a pathogenic from a single donor, and after such purification are combined activity may be by 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , 70 % , with purified spore populations from other purifications , 80 % , 90 % , 95 % , 96 % , 97 % , 98 % , 99 % , 99 . 9 % , 99 . 99 % , either from the same donor at a different time, or from one 99 . 999 % , 99 . 9999 % , or greater than 99 . 9999 % as compared or more different donors , or both . to the starting material . In other embodiments , the purified 15 Mammalian donor subjects are generally of good health populations of bacterial spores have reduced sensory com - and have microbiota consistent with such good health . ponents as compared to fecalmaterial , such as reduced odor, Often , the donor subjects have not been administered anti taste , appearance , and umami. biotic compounds within a certain period prior to the col Provided are purified populations of bacterial spores that lection of the fecal material. In certain embodiments , the are substantially free of residual habitat products . In certain 20 donor subjects are not obese or overweight, and may have embodiments , this means that the bacterial spore composi - body mass index (BMI ) scores of below 25 , such as between tion no longer contains a substantial amount of the biologi - 18 . 5 and 24 . 9 . In other embodiments , the donor subjects are cal matter associated with the microbial community while not mentally ill or have no history or familial history of living on or in the human or animal subject, and the purified mental illness , such as anxiety disorder, depression , bipolar population of spores may be 100 % free , 99 % free , 98 % free , 25 disorder , autism spectrum disorders, schizophrenia , panic 97 % free, 96 % free , or 95 % free of any contamination of the disorders, attention deficit ( hyperactivity ) disorders , eating biological matter associated with the microbial community disorders or mood disorders. In other embodiments , the Substantially free of residual habitat products may also donor subjects do not have irritable bowel disease ( e . g . , mean that the bacterial spore composition contains no crohn ' s disease , ulcerative colitis ) , irritable bowel syn detectable cells from a human or animal, and that only 30 drome, celiac disease , colorectal cancer or a family history microbial cells are detectable , in particular, only desired of these diseases . In other embodiments , donors have been microbial cells are detectable . In another embodiment, it screened for blood borne pathogens and fecal transmissible means that fewer than 1x10 - 2 % , 1x10 - % % , 1x10 - 4 % , pathogens using standard techniques known to one in the art 1x10 - % % , 1x10 - " % , 1x10 - ' % , 1x10 % of the cells in the ( e . g . nucleic acid testing , serological testing, antigen testing , bacterial composition are human or animal, as compared to 35 culturing techniques , enzymatic assays , assays of cell free microbial cells . In another embodiment, the residual habitat fecal filtrates looking for toxins on susceptible cell culture product present in the purified population is reduced at least substrates ) . a certain level from the fecal material obtained from the In some embodiments , donors are also selected for the mammalian donor subject , e . g ., reduced by at least about presence of certain genera and / or species that provide 10 % , 20 % , 30 % , 40 % , 50 % , 50 % , 70 % , 80 % , 90 % , 95 % , 40 increased efficacy of therapeutic compositions containing 96 % , 97 % , 98 % , 99 % , 99 . 9 % , 99 . 99 % , 99 . 999 % , these genera or species . In other embodiments , donors are 99 . 9999 % , or greater than 99 . 9999 % . preferred that produce relatively higher concentrations of In one embodiment, substantially free of residual habitat spores in fecalmaterial than other donors. In further embodi products or substantially free of a detectable level of a ments , donors are preferred that provide fecal material from pathogenic material means that the bacterial composition 45 which spores having increased efficacy are purified ; this contains no detectable viral ( including bacterial viruses ( i .e ., increased efficacy is measured using in vitro or in animal phage ) ) , fungal , or mycoplasmal or toxoplasmal contami studies as described below . In some embodiments , the donor nants , or a eukaryotic parasite such as a helminth . Alterna - may be subjected to one or more pre - donation treatments in tively, the purified spore populations are substantially free of order to reduce undesired material in the fecal material, an acellular material, e . g . , DNA , viral coat material, or 50 and / or increase desired spore populations . non - viable bacterial material . Alternatively , the purified It is advantageous to screen the health of the donor subject spore population may processed by a method that kills , prior to and optionally , one or more times after, the collec inactivates , or removes one or more specific undesirable t ion of the fecal material. Such screening identifies donors viruses , such as an enteric virus, including norovirus , polio - carrying pathogenic materials such as viruses (HIV , hepati virus or hepatitis A virus . 55 tis , polio ) and pathogenic bacteria . Post- collection , donors As described herein , purified spore populations can be are screened about one week , two weeks, three weeks , one demonstrated by genetic analysis ( e . g . , PCR , DNA sequenc - month , two months, three months, six months, one year or ing ) , serology and antigen analysis , microscopic analysis , more than one year, and the frequency of such screening microbial analysis including germination and culturing , and may be daily , weekly , bi- weekly , monthly , bi- monthly , semi methods using instrumentation such as flow cytometry with 60 yearly or yearly . Donors that are screened and do not test reagents that distinguish desired bacterial spores from non - positive, either before or after donation or both , are consid desired , contaminating materials . ered “ validated " donors . Exemplary biological materials include fecal materials Solvent Treatments . such as feces or materials isolated from the various segments To purify the bacterial spores, the fecal material is sub of the small and large intestines. Fecal materials are obtained 65 jected to one ormore solvent treatments . A solvent treatment from a mammalian donor subject, or can be obtained from is a miscible solvent treatment ( either partially miscible or more than one donor subject, e . g . , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , fully miscible ) or an immiscible solvent treatment. Misci US 9 ,855 ,303 B2 15 16 bility is the ability of two liquids to mix with each to form components to pass through , and the spore fraction is then a homogeneous solution . Water and ethanol, for example , recovered from the filter medium . Alternatively , undesirable are fully miscible such that a mixture containing water and particulates and eukaryotic cells may be retained on a filter ethanol in any ratio will show only one phase . Miscibility is while bacterial cells including spores pass through . In some provided as a wt/ wt/ o , or weight of one solvent in 100 g of 5 embodiments the spore fraction retained on the filter final solution . If two solvents are fully miscible in all medium is subjected to a diafiltration step , wherein the proportions, their miscibility is 100 % . Provided as fully retained spores are contacted with a wash liquid , typically a miscible solutions with water are alcohols , e . g . , methanol, sterile saline - containing solution or other diluent such as a ethanol, isopropanol, butanol, propanediol, butanediol, etc . water compatible polymer including a low -molecular poly The alcohols can be provided already combined with water ; 10 ethylene glycol (PEG ) solution , in order to further reduce or e . g . , a solution containing 10 % , 20 % , 25 % , 30 % , 35 % , 40 % , remove the undesirable fecal components . 45 % , 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 89 % , 85 % , 90 % , Thermal Treatments . 95 % or greater than 95 % . Other solvents are only partially Provided herein is the thermal disruption of the fecal miscible , meaning that only some portion will dissolve in material. Generally, the fecal material is mixed in a saline water . Diethyl ether, for example , is partially miscible with 15 containing solution such as phosphate - buffered saline (PBS ) water. Up to 7 grams of diethyl ether will dissolve in 93 g and subjected to a heated environment, such as a warm of water to give a 7 % ( wt/ wt % ) solution . If more diethyl room , incubator, water -bath , or the like, such that efficient ether is added , a two - phase solution will result with a heat transfer occurs between the heated environment and the distinct diethyl ether layer above the water . Other partially fecal material. Preferably the fecal material solution is miscible materials include ethers , propanoate , butanoate , 20 mixed during the incubation to enhance thermal conductiv chloroform , dimethoxyethane , or tetrahydrofuran . In con ity and disrupt particulate aggregates . Thermal treatments trast , an oil such as an alkane and water are immiscible and can be modulated by the temperature of the environment form two phases . Further , immiscible treatments are option and / or the duration of the thermal treatment. For example , ally combined with a detergent, either an ionic detergent or the fecalmaterial or a liquid comprising the fecal material is a non - ionic detergent. Exemplary detergents include Triton 25 subjected to a heated environment, e . g ., a hot water bath of X - 100 , Tween 20 , Tween 80 , Nonidet P40 , a pluronic , or a at least about 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , polyol. The solvent treatment steps reduces the viability of 80 , 85 , 90 , 95 , 100 or greater than 100 degrees Celsius , for non - spore forming bacterial species by 10 % , 20 % , 30 % , at least about 1 , 5 , 10 , 15 , 20 , 30 , 45 seconds, or 1 , 2 , 3 , 4 , 40 % , 50 % , 60 % , 70 % , 80 % , 85 % , 90 % , 95 % , 99 % , 99 . 9 % , 5 , 6 , 7 , 8 , 9 , 10 , 15 , 20 , 25 , 30 , 40 , or 50 minutes , or 1 , 2 , 99. 99 % , 99 . 999 % , or 99. 9999 % , and it may optionally 30 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 or more than 10 hours . In certain reduce the viability of contaminating protists , parasites embodiments the thermal treatment occurs at two different and / or viruses . temperatures, such as 30 seconds in a 100 degree Celsius Chromatography Treatments . environment followed by 10 minutes in a 50 degree Celsius To purify spore populations , the fecal materials are sub environment. In preferred embodiments the temperature and jected to one or more chromatographic treatments, either 35 duration of the thermal treatment are sufficient to kill or sequentially or in parallel . In a chromatographic treatment, remove pathogenic materials while not substantially dam a solution containing the fecal material is contacted with a aging or reducing the germination - competency of the solid medium containing a hydrophobic interaction chro - spores . In other preferred embodiments , the temperature and matographic ( HIC ) medium or an affinity chromatographic duration of the thermal treatment is short enough to reduce medium . In an alternative embodiment, a solid medium 40 the germination of the spore population . capable of absorbing a residual habitat product present in the Irradiation Treatments. fecal material is contacted with a solid medium that adsorbs Provided are methods of treating the fecal material or a residual habitat product . In certain embodiments , the HIC separated contents of the fecal material with ionizing radia medium contains sepharose or a derivatized sepharose such tion , typically gamma irradiation , ultraviolet irradiation or as butyl sepharose , octyl sepharose, phenyl sepharose , or 45 electron beam irradiation provided at an energy level suffi butyl- s sepharose . In other embodiments , the affinity chro - cient to kill pathogenic materials while not substantially matographic medium contains material derivatized with damaging the desired spore populations . For example , ultra mucin type I , II , III , IV , V , or VI , or oligosaccharides derived violet radiation at 254 nm provided at an energy level below from or similar to those of mucins type I , II , III , IV , V , or VI. about 22 ,000 microwatt seconds per cm2 will not generally Alternatively, the affinity chromatographic medium contains 50 destroy desired spores . material derivatized with antibodies that recognize spore - Centrifugation and Density Separation Treatments . forming bacteria . Provided are methods of separating desired spore popu Mechanical Treatments . lations from the other components of the fecal material by Provided herein is the physical disruption of the fecal centrifugation . A solution containing the fecal material is material, particularly by one or more mechanical treatment 55 subjected to one or more centrifugation treatments , e . g . , at such as blending , mixing , shaking , vortexing , impact pul about 200xg , 1000xg, 2000xg , 3000xg , 4000xg, 5000xg , verization , and sonication . As provided herein , the mechani- 6000xg , 7000xg , 8000xg or greater than 8000xg . Differen cal disrupting treatment substantially disrupts a non - spore tial centrifugation separates desired spores from undesired material present in the fecal material and does not substan - non - spore material; at low forces the spores are retained in tially disrupt a spore present in the fecal material, or it may 60 solution , while at higher forces the spores are pelleted while disrupt the spore material less than the non - spore material, smaller impurities ( e . g ., virus particles, phage , microscopic e . g . 2 - fold less , 5 - , 10 - , 30 - , 100 -, 300 - , 1000 - or greater than fibers , biological macromolecules such as free protein , 1000 - fold less . Furthermore ,mechanical treatment homog - nucleic acids and lipids ) are retained in solution . For enizes the material for subsequent sampling , testing , and example , a first low force centrifugation pellets fibrous processing . Mechanical treatments optionally include filtra - 65 materials ; a second , higher force centrifugation pellets unde tion treatments , where the desired spore populations are sired eukaryotic cells, and a third , still higher force centrifu retained on a filter while the undesirable ( non - spore ) fecal gation pellets the desired spores while smaller contaminants US 9 ,855 ,303 B2 17 18 remain in suspension . In some embodiments density or species are provided , one of skill in the art will recognize mobility gradients or cushions ( e . g . , step cushions ) , such as that other strains of the species can be substituted for the CsCl, Percoll, Ficoll, Nycodenz , Histodenz or sucrose gra named strain . dients , are used to separate desired spore populations from In some embodiments , spore - forming bacteria are iden other materials in the fecal material. 5 tified by the presence of nucleic acid sequences that modu Also provided herein are methods of producing spore late sporulation . In particular , signature sporulation genes are highly conserved across members of distantly related populations that combine two or more of the treatments genera including Clostridium and Bacillus. Traditional described herein in order to synergistically purify the desired approaches of forward genetics have identified many , if not spores while killing or removing undesired materials and 1/ or 10 all , genes that are essential for sporulation ( spo ). The devel activities from the spore population . It is generally desirable opmental program of sporulation is governed in part by the to retain the spore populations under non - germinating and successive action of four compartment - specific sigma fac non - growth promoting conditions and media , in order to tors (appearing in the order of , oE , OG and oK ) , whose minimize the growth of pathogenic bacteria present in the activities are confined to the forespore ( of and oG ) or the spore populations and to minimizeninimize the germination of spores 1510 mother cell ( oE and oK ). In other embodiments , spore into vegetative bacterial cells . forming bacteria are identified by the biochemical activity of Purified Spore Populations . DPA producing enzymes or by analyzing DPA content of As described herein , purified spore populations contain cultures . As part of the bacterial sporulation , large amounts combinations of commensal bacteria of the human gut of DPA are produced , and comprise 5 - 15 % of the mass of a microbiota with the capacity to meaningfully provide func - 20 spore . Because not all viable spores germinate and grow tions of a healthy microbiota when administered to a mam Ununder known media conditions, it is difficult to assess a total malian subject . Without being limited to a specific mecha spore count in a population of bacteria . As such , a measure nism , it is thought that such compositions inhibit the growth ment of DPA content highly correlates with spore content of a pathogen such as C . difficile , Salmonella spp ., entero - and is an appropriate measure for characterizing total spore pathogenic E . coli, Fusobacterium spp ., Klebsiella spp . and 25 content in a bacterial population . vancomycin - resistant Enterococcus spp . , so that a healthy, [Provided are spore populations containing more than one diverse and protective microbiota can be maintained or, in type of bacterium . As used herein , a “ type” or more than one " types ” of bacteria may be differentiated at the genus level , the case of pathogenic bacterial infections such as C . difficile the species, level, the sub - species level, the strain level or by infection , repopulate the intestinal lumen to reestablishdi 30 any other taxonomic method , as described herein and oth ecological control over potential pathogens . In one embodi- 30 anerwise known in the art . ment, the purified spore populations can engraft in the host In some embodiments all or essentially all of the bacterial and remain present for 1 day, 2 days, 3 days , 4 days, 5 days , spores present in a purified population are obtained from a 6 days , 7 days , 10 days , 14 days , 21 days, 25 days , 30 days , fecal material treated as described herein or otherwise 60 days , 90 days , or longer than 90 days . Additionally, the 35 known in the art . In alternative embodiments , one or more purified spore populations can induce other healthy com than one bacterial spores or types of bacterial spores are mensal bacteria found in a healthy gut to engraft in the host generated in culture and combined to form a purified spore that are not present in the purified spore populations or population . In other alternative embodiments , one or more present at lesser levels and therefore these species are of these culture - generated spore populations are combined considered to " augment” the delivered spore populations . In 40 with a fecal material- derived spore population to generate a this manner, commensal species augmentation of the puri- hybrid spore population . Bacterial compositions may con fied spore population in the recipient' s gut leads to a more tain at least two types of these preferred bacteria , including diverse population of gut microbiota then present initially . strains of the same species . For instance , a bacterial com Preferred bacterial genera include Acetanaerobacterium , position may comprise at least 2 , at least 3 , at least 4 , at least Acetivibrio , Alicyclobacillus, Alkaliphilus , Anaerofustis , 45 5 , at least 6 , at least 7 , at least 8 , at least 9 , at least 10 , at least Anaerosporobacter, Anaerostipes , Anaerotruncus, Anoxyba - 11, at least 12 , at least 13 , at least 14 , at least 15 , at least 16 , cillus , Bacillus, Bacteroides, Blautia , Brachyspira , Breviba - at least 17 , at least 18 , at least 19 , or at least 20 or more than cillus, Bryantella , Bulleidia , Butyricicoccus, Butyrivibrio , 20 types of bacteria , as defined by species or operational Catenibacterium , Chlamydiales, Clostridiaceae , Clostridi- taxonomic unit (OTU ) encompassing such species . ales, Clostridium , Collinsella , Coprobacillus, Coprococcus, 50 Thus, provided herein are methods for production of a Coxiella , Deferribacteres, Desulfitobacterium , Desulfoto - composition containing a population of bacterial spores maculum , Dorea , Eggerthella , Erysipelothrix , Erysipelo - suitable for therapeutic administration to a mammalian trichaceae, Ethanoligenens, Eubacterium , Faecalibacte subject in need thereof. And the composition is produced by rium , Filifactor, Flavonifractor, Flexistipes, Fulvimonas, generally following the steps of: ( a ) providing a fecal Fusobacterium , Gemmiger, Geobacillus, Gloeobacter, 55 material obtained from a mammalian donor subject ; and ( b ) Holdemania , Hydrogenoanaerobacterium , Kocuria , Lach subjecting the fecal material to at least one purification nobacterium , Lachnospira , Lachnospiraceae, Lactobacil- treatment or step under conditions such that a population of lus, Lactonifactor, Leptospira , Lutispora , Lysinibacillus, bacterial spores is produced from the fecal material. The Mollicutes, Moorella , Nocardia , Oscillibacter, Oscillospira , composition is formulated such that a single oral dose Paenibacillus, Papillibacter, Pseudoflavonifractor, Robin - 60 contains at least about 1x104 colony forming units of the soniella , Roseburia , Ruminococcaceae , Ruminococcus, Sac bacterial spores, and a single oral dose will typically contain charomonospora , Sarcina , Solobacterium , Sporobacter, about 1x104, 1x109 , 1x10 " , 1x107, 1x108 , 1x10°, 1x1010 , Sporolactobacillus, Streptomyces, Subdoligranulum , Sutte - 1x1011 , 1x1012 , 1x1013, 1x1014 , 1x1015 , or greater than rella , Syntrophococcus , Thermoanaerobacter, Thermobifida , 1x1015 CFUs of the bacterial spores . The presence and /or Turicibacter 65 concentration of a given type of bacterial spore may be Preferred bacterial species are provided at Table 1 and known or unknown in a given purified spore population . If demarcated as spore formers . Where specific strains of a known , for example the concentration of spores of a given US 9 ,855 ,303 B2 19 20 strain , or the aggregate of all strains , is e .g ., 1x104 , 1x10915, composition may comprise at least 2 , at least 3 , at least 4 , at 1x10 " , 1x107, 1x108, 1x109, 1x1010 , 1x1011 , 1x1012 , least 5 , at least 6 , at least 7 , at least 8 , at least 9 , at least 10 , 1x1013 , 1x1014 , 1x1015, or greater than 1x1015 viable bac at least 11 , at least 12 , at least 13 , at least 14 , at least 15 , at terial spores per gram of composition or per administered least 16 , at least 17 , at least 18 , at least 19, at least 20 , or at dose . 5 least 21, 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 30 , 31 , 32 , 33 , 34 , 35 , In some formulations, the composition contains at least 36 , 37 , 38 , 39 , or at least 40 , at least 50 or greater than 50 about 0 . 5 % , 1 % , 2 % , 5 % , 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , types of bacteria , as defined by species or operational 70 % , 80 % , 90 % or greater than 90 % spores on a mass basis . taxonomic unit (OTU ) , or otherwise as provided herein . In some formulations, the administered dose does not in another embodiment, the number of types of bacteria exceed 200 , 300 , 400 , 500 , 600 , 700 , 800 , 900 milligrams or 10 present in a bacterial composition is at or below a known 1 , 1 . 1, 1. 2 , 1 .3 , 1 . 4 , 1. 5 , 1 .6 , 1 . 7 , 1. 8 , or 1. 9 grams in mass . value . For example , in such embodiments the bacterial The bacterial spore compositions are generally formu - composition comprises 50 or fewer types of bacteria , such as lated for oral or gastric administration , typically to a mam - 49 , 48 , 47 , 46 , 45 , 44 , 43 , 42 , 41, 40 , 39 , 38 , 37 , 36 , 35 , 34 . malian subject. In particular embodiments , the composition 33 , 32 , 31 , 30 , 29 , 28 , 27 , 26 , 25 , 24 , 23 , 22 , 21, 20 , 19 , 18 , is formulated for oral administration as a solid , semi- solid , 15 17 , 16 , 15 , 14 , 13 , 12 , 11, or 10 or fewer, or 9 or fewer types gel, or liquid form , such as in the form of a pill , tablet , of bacteria , 8 or fewer types of bacteria , 7 or fewer types of capsule , or lozenge . In some embodiments, such formula bacteria , 6 or fewer types of bacteria , 5 or fewer types of tions contain or are coated by an enteric coating to protect bacteria , 4 or fewer types of bacteria , or 3 or fewer types of the bacteria through the stomach and small intestine , bacteria . In another embodiment, a bacterial composition although spores are generally resistant to the stomach and 20 comprises from 2 to no more than 40 , from 2 to no more than small intestines . In other embodiments, the bacterial spore 30 , from 2 to no more than 20 , from 2 to no more than 15 , compositions may be formulated with a germinant to from 2 to no more than 10 , or from 2 to no more than 5 types enhance engraftment, or efficacy . In yet other embodiments , of bacteria . the bacterial spore compositions may be co - formulated or Bacterial Compositions Described by Species co - administered with prebiotic substances , to enhance 25 Bacterial compositions may be prepared comprising at engraftment or efficacy . least two types of isolated bacteria , chosen from the species The bacterial spore compositions may be formulated to be in Table 1 . effective in a given mammalian subject in a single admin - In one embodiment, the bacterial composition comprises istration or over multiple administrations . For example , a at least one and preferably more than one of the following : single administration is substantially effective to reduce Cl. 30 Enterococcus faecalis (previously known as Streptococcus difficile and / or Cl. difficile toxin content in a mammalian faecalis ) , Clostridium innocuum , Clostridium ramosum , subject to whom the composition is administered . Substan - Bacteroides ovatus, Bacteroides vulgatus, Bacteroides tially effective means that Cl. difficile and / or Cl. difficile thetaoiotaomicron , Escherichia coli ( 1109 and 1108 - 1 ) , toxin content in the subject is reduced by at least 10 % , 20 % , Clostridium bifermentans, and Blautia producta ( previously 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , 95 % , 98 % , 99 % or 35 known as Peptostreptococcus productus) . In an alternative greater than 99 % following administration of the composi- embodiment, at least one of the preceding species is not tion . Alternatively , efficacy may be measured by the absence substantially present in the bacterial composition . of diarrheal symptoms or the absence of carriage of C . In one embodiment, the bacterial composition comprises difficile or C . difficile toxin after 2 day, 4 days , 1 week , 2 at least one and preferably more than one of the following : weeks , 4 weeks, 8 weeks or longer than 8 weeks . 40 Enterococcus faecalis ( previously known as Streptococcus Bacterial Compositions faecalis ), Clostridium innocuum , Clostridium ramosum , Provided are bacteria and combinations of bacteria of the Bacteroides ovatus, Bacteroides vulgatus, Bacteroides human gut microbiota with the capacity to meaningfully thetaoiotaomicron , Escherichia coli (1109 and 1108 - 1 ), provide functions of a healthy microbiota when adminis Clostridium bifermentans, and Blautia producta (previously tered to mammalian hosts . Without being limited to a 45 known as Peptostreptococcus productus ) . In an alternative specific mechanism , it is thought that such compositions embodiment, at least one of the preceding species is not inhibit the growth , proliferation , and /or colonization of one substantially present in the bacterial composition . or a plurality of pathogenic bacteria in the dysbiotic micro - In another embodiment, the bacterial composition com biotal niche, so that a healthy , diverse and protective micro - prises at least one and preferably more than one of the biota colonizes and populates the intestinal lumen to estab - 50 following: Acidaminococcus intestinalis , Bacteroides ova lish or reestablish ecological control over pathogens or t us , two strains of Bifidobacterium adolescentis , two strains potential pathogens ( e . g ., some bacteria are pathogenic of Bifidobacterium longum , Blautia producta , Clostridium bacteria only when present in a dysbiotic environment ) . cocleatum , Collinsella aerofaciens , two strains of Dorea Inhibition of pathogens includes those pathogens such as C . longicatena , Escherichia coli , Eubacterium desmolans, difficile , Salmonella spp . , enteropathogenic E coli, multi - 55 Eubacterium eligens, Eubacterium limosum , four strains of drug resistant bacteria such as Klebsiella , and E . coli, Eubacterium rectale , Eubacterium ventriosumi, Faecalibac Carbapenem - resistent Enterobacteriaceae (CRE ) , extended terium prausnitzii, Lachnospira pectinoshiza , Lactobacillus spectrum beta - lactam resistant Enterococci (ESBL ) , and casei, Lactobacillus casei/ paracasei , Paracateroides dista vancomycin -resistant Enterococci ( VRE ) . sonis , Raoultella sp . , one strain of Roseburia ( chosen from As used herein , a " type ” or more than one " types" of 60 Roseburia faecalis or Roseburia faecis ) , Roseburia intesti bacteria may be differentiated at the genus level, the species, nalis , two strains of Ruminococcus torques, two strains of level, the sub -species level, the strain level or by any other Ruminococcus obeum , and Streptococcusmitis . In an alter taxonomic method , as described herein and otherwise native embodiment, at least one of the preceding species is known in the art . not substantially present in the bacterial composition . Bacterial compositions may comprise two types of bac - 65 In yet another embodiment, the bacterial composition teria ( termed “ binary combinations” or “ binary pairs ” ) or comprises at least one and preferably more than one of the greater than two types of bacteria . For instance , a bacterial following : Barnesiella intestinihominis ; Lactobacillus reu US 9 ,855 ,303 B2 21 22 teri; a species characterized as one of Enterococcus hirae , gilis - ryhm , Bacteroides gracilis , Bacteroides levii, Bacte Enterococus faecium , or Enterococcus durans; a species roides macacae, Bacteroides merdae, Bacteroides ovatus , characterized as one of Anaerostipes caccae or Clostridium Bacteroides pneumosintes, Bacteroides putredinis , Bacte indolis ; a species characterized as one of Staphylococcus roides pyogenes , Bacteroides splanchnicus, Bacteroides warneri or Staphylococcus pasteuri ; and Adlercreutzia 5 stercoris . Bacteroides tectum . Bacteroides thetaiotaomi equolifaciens . In an alternative embodiment, at least one of cron , Bacteroides uniformis , Bacteroides ureolyticus, and the preceding species is not substantially present in the Bacteroides vulgatus. In an alternative embodiment , at least bacterial compositionion . one of the preceding species is not substantially present in In other embodiments, the bacterial composition com prises at least one and preferably more than one of the 10 the bacterial composition . following : Clostridium absonum , Clostridium argentinense , In one embodiment, the bacterial composition comprises Clostridium baratii , Clostridium bartlettii , Clostridium at least one and preferably more than one of the following : bifermentans, Clostridium botulinum , Clostridium butyri Bacteroides, Eubacteria , Fusobacteria , Propionibacteria , cum , Clostridium cadaveris , Clostridium camis , Clostridium Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia celatum . Clostridium chauvoei. Clostridium clostridio - 15 coli, Gemmiger, Desulfomonas , and Peptostreptococcus . In forme. Clostridium cochlearium . Clostridium difficile . an alternative embodiment, at least one of the preceding Clostridium fallax. Clostridium felsineum . Clostridium species is not substantially present in the bacterial compo ghonii, Clostridium glycolicum , Clostridium haemolyticum , sition . Clostridium hastiforme, Clostridium histolyticum , In one embodiment, the bacterial composition comprises Clostridium indolis, Clostridium innocuum , Clostridium 20 at least one and preferably more than one of the following : irregulare , Clostridium limosum , Clostridium malenomina - Bacteroides fragilis ss . Vulgatus, Eubacterium aerofaciens , tum , Clostridium novyi, Clostridium oroticum , Clostridium Bacteroides fragilis ss. Thetaiotaomicron , Blautia producta paraputrificum , Clostridium perfringens, Clostridium pili - (previously known as Peptostreptococcus productus II) , forme, Clostridium putrefaciens, Clostridium putrificum , Bacteroides fragilis ss. Distasonis , Fusobacterium praus Clostridium ramosum , Clostridium sardiniense , Clostridium 25 nitzii , Coprococcus eutactus, Eubacterium aerofaciens III , sartagoforme, Clostridium scindens , Clostridium septicum , Blautia producta (previously known as Peptostreptococcus Clostridium sordellii , Clostridium sphenoides , Clostridium productus I) , Ruminococcus bronii , Bifidobacterium adoles spiroforme, Clostridium sporogenes, Clostridium subtermi centis, Gemmiger formicilis , Bifidobacterium longum , nale , Clostridium symbiosum , Clostridium tertium , Eubacterium siraeum , Ruminococcus torques, Eubacterium Clostridium tetani, Clostridium welchii , and Clostridium 30 rectale Eubacterium rectale IV , Eubacterium eligens, Bacte villosum . In an alternative embodiment , at least one of the roides eggerthii, Clostridium leptum , Bacteroides fragilis ss . preceding species is not substantially present in the bacterial A , Eubacterium biforme, Bifidobacterium infantis , Eubac composition . terium rectale III - F , Coprococcus comes , Bacteroides cap In one embodiment, the bacterial composition comprises illosus, Ruminococcus albus, Eubacterium formicigenerans, at least one and preferably more than one of the following: 35 Eubacterium hallii , Eubacterium ventriosum I, Fusobacte Clostridium innocuum , Clostridium bifermentans, rium russii , Ruminococcus obeum , Eubacterium rectale II, Clostridium butyricum , Bacteroides fragilis , Bacteroides Clostridium ramosum I , Lactobacillus leichmanii , Rumi thetaiotaomicron , Bacteroides uniformis , three strains of nococcus cailidus , Butyrivibrio crossotus, Acidaminococcus Escherichia coli , and Lactobacillus sp . In an alternative fermentans, Eubacterium ventriosum , Bacteroides fragilis embodiment, at least one of the preceding species is not 40 ss . fragilis , Bacteroides AR , Coprococcus catus , Eubacte substantially present in the bacterial composition . rium hadrum , Eubacterium cylindroides, Eubacterium rumi In one embodiment, the bacterial composition comprises nantium , Eubacterium CH - 1 , Staphylococcus epidermidis , at least one and preferably more than one of the following : Peptostreptococcus BL , Eubacterium limosum , Bacteroides Clostridium bifermentans, Clostridium innocuum , praeacutus, Bacteroides L , Fusobacterium mortiferum I , Clostridium butyricum , three strains of Escherichia coli, 45 Fusobacterium naviforme, Clostridium innocuum , three strains of Bacteroides, and Blautia producta . In an Clostridium ramosum , Propionibacterium acnes, Rumi alternative embodiment , at least one of the preceding species nococcus flavefaciens, Ruminococcus AT, Peptococcus is not substantially present in the bacterial composition . AU - 1 , Eubacterium AG , - AK , - AL , - AL - 1 , - AN ; Bacte In one embodiment, the bacterial composition comprises roides fragilis ss . ovatus , -ss . d , - ss . f; Bacteroides L - 1 , L - 5 ; at least one and preferably more than one of the following: 50 Fusobacterium nucleatum , Fusobacterium mortiferum , Bacteroides sp ., Escherichia coli, and non pathogenic Escherichia coli, Streptococcus morbiliorum , Peptococcus Clostridia , including Clostridium innocuum , Clostridium magnus, Peptococcus G , AU - 2 ; Streptococcus intermedius, bifermentans and Clostridium ramosum . In an alternative Ruminococcus lactaris, Ruminococcus CO Gemmiger X , embodiment, at least one of the preceding species is not Coprococcus BH , -CC ; Eubacterium tenue , Eubacterium substantially present in the bacterial composition . 55 ramulus, Eubacterium AE , - AG - H , - AG - M , -AJ , -BN - 1 ; In one embodiment, the bacterial composition comprises Bacteroides clostridiiformis ss. clostridliformis , Bacteroides at least one and preferably more than one of the following: coagulans, Bacteroides orails , Bacteroides ruminicola ss . Bacteroides species , Escherichia coli and non -pathogenic brevis , - ss . ruminicola , Bacteroides splanchnicus, Desui Clostridia , such as Clostridium butyricum , Clostridium fomonas pigra , Bacteroides L - 4 , - N - i ; Fusobacterium H , bifermentans and Clostridium innocuum . In an alternative 60 Lactobacillus G , and Succinivibrio A . In an alternative embodiment, at least one of the preceding species is not embodiment, at least one of the preceding species is not substantially present in the bacterial composition . substantially present in the bacterial composition . In one embodiment, the bacterial composition comprises Bacterial Compositions Described by Operational Taxo at least one and preferably more than one of the following : nomic Unit (OTUS ) Bacteroides caccae , Bacteroides capillosus, Bacteroides 65 Bacterial compositions may be prepared comprising at coagulans, Bacteroides distasonis , Bacteroides eggerthii, least two types of isolated bacteria , chosen from the species Bacteroides forsythus, Bacteroides fragilis, Bacteroides fra - in Table 1 . US 9 , 855 , 303 B2 23 24 In one embodiment, the OTUs can be characterized by In another embodiment, the bacterial composition does one or more of the variable regions of the 16S sequence not comprise at least one of Clostridium innocuum , ( V1 - V9 ) . These regions in bacteria are defined by nucleo Clostridium bifermentans, Clostridium butyricum , Bacte tides 69 - 99 , 137 -242 , 433 - 497 , 576 -682 , 822 -879 , 986 roides fragilis , Bacteroides thetaiotaomicron , Bacteroides 1043, 1117 - 1173 , 1243 - 1294 and 1435 - 1465 respectively 5 uniformis , three strains of Escherichia coli , and Lactobacil using numbering based on the E . coli system of nomencla - lus sp . ture . (See , e . g . , Brosius et al ., Complete nucleotide sequence In another embodiment, the bacterial composition does of a 16S ribosomal RNA gene from Escherichia coli, PNAS not comprise at least one of Clostridium bifermentans , 75 ( 10 ) : 4801 - 4805 ( 1978 ) ). In some embodiments , at least Clostridium innocuum , Clostridium butyricum , three strains one of the V1, V2 , V3 , V4 , V5 , V6 , V7 , V8, and V9 regions 10 of Escherichia coli , three strains of Bacteroides, and Blautia are used to characterize an OTU . In one embodiment, the producta ( previously known as Peptostreptococcus produc V1, V2 , and V3 regions are used to characterize an OTU . In tus ) . another embodiment, the V3 , V4 , and V5 regions are used In another embodiment , the bacterial composition does to characterize an OTU . In another embodiment, the V4 not comprise at least one of Bacteroides sp . , Escherichia region is used to characterize an OTU . 15 coli , and non pathogenic Clostridia , including Clostridium Bacterial Compositions Exclusive of Certain Bacterial innocuum , Clostridium bifermentans and Clostridium ramo Species or Strains sum . In one embodiment, the bacterial composition does not in another embodiment, the bacterial composition does comprise at least one of Enterococcus faecalis (previously not comprise at least one of more than one Bacteroides known as Streptococcus faecalis ) , Clostridium innocuum , 20 species , Escherichia coli and non - pathogenic Clostridia , Clostridium ramosum , Bacteroides ovatus, Bacteroides such as Clostridium butyricum , Clostridium bifermentans vulgatus, Bacteroides thetaoiotaomicron , Escherichia coli and Clostridium innocuum . ( 1109 and 1108 - 1 ) , Clostridium bifermentans, and Blautia In another embodiment, the bacterial composition does producta (previously known as Peptostreptococcus produc - not comprise at least one of Bacteroides caccae , Bacteroides tus ) . 25 capillosus, Bacteroides coagulans, Bacteroides distasonis , In another embodiment, the bacterial composition does Bacteroides eggerthii, Bacteroides forsythus, Bacteroides not comprise at least one of Acidaminococcus intestinalis , fragilis , Bacteroides fragilis - ryhm , Bacteroides gracilis, Bacteroides ovatus, two species of Bifidobacterium adoles- Bacteroides levii, Bacteroides macacae , Bacteroides mer centis , two species of Bifidobacterium longum , Collinsella dae , Bacteroides ovatus, Bacteroides pneumosintes , Bacte aerofaciens, two species of Dorea longicatena , Escherichia 30 roides putredinis , Bacteroides pyogenes, Bacteroides coli , Eubacterium eligens, Eubacterium limosum , four spe - splanchnicus, Bacteroides stercoris , Bacteroides tectum , cies of Eubacterium rectale , Eubacterium ventriosumi, Fae - Bacteroides thetaiotaomicron , Bacteroides uniformis , calibacterium prausnitzii , Lactobacillus casei, Lactobacil- Bacteroides ureolyticus , and Bacteroides vulgatus . lus paracasei, Paracateroides distasonis, Raoultella sp ., one In another embodiment, the bacterial composition does species of Roseburia ( chosen from Roseburia faecalis or 35 not comprise at least one of Bacteroides, Eubacteria , Fuso Roseburia faecis ) , Roseburia intestinalis , two species of bacteria , Propionibacteria , Lactobacilli , anaerobic cocci , Ruminococcus torques , and Streptococcus mitis . Ruminococcus, Escherichia coli, Gemmiger , Desulfomonas , In yet another embodiment, the bacterial composition and Peptostreptococcus. does not comprise at least one of Bamesiella intestinihomi- In another embodiment, the bacterial composition does nis ; Lactobacillus reuteri ; a species characterized as one of 40 not comprise at least one of Bacteroides fragilis ss . Vulgatus, Enterococcus hirae, Enterococus faecium , or Enterococcus Eubacterium aerofaciens, Bacteroides fragilis ss . Thetaio durans; a species characterized as one of Anaerostipes taomicron , Blautia producta (previously known as Pepto caccae or Clostridium indolis ; a species characterized as one streptococcus productus II ) , Bacteroides fragilis ss . Dista of Staphylococcus warneri or Staphylococcus pasteuri; and sonis, Fusobacterium prausnitzii , Coprococcus eutactus, Adlercreutzia equolifaciens. 45 Eubacterium aerofaciens III, Blautia producta (previously In other embodiments , the bacterial composition does not known as Peptostreptococcus productus I ) , Ruminococcus comprise at least one of Clostridium absonum , Clostridium bromii , Bifidobacterium adolescentis , Gemmiger formicilis , argentinense , Clostridium baratii, Clostridium bifermen Bifidobacterium longum , Eubacterium siraeum , Ruminococ tans, Clostridium botulinum , Clostridium butyricum , cus torques , Eubacterium rectale Eubacterium rectale IV , Clostridium cadaveris , Clostridium camis , Clostridium 50 Eubacterium eligens, Bacteroides eggerthii , Clostridium celatum , Clostridium chauvoei, Clostridium clostridio leptum , Bacteroides fragilis ss. A , Eubacterium biforme, forme, Clostridium cochlearium , Clostridium difficile , Bifidobacterium infantis, Eubacterium rectale Coprococcus Clostridium fallax , Clostridium felsineum , Clostridium comes , Bacteroides capillosus , Ruminococcus albus, Eubac ghonii, Clostridium glycolicum , Clostridium haemolyticum , terium formicigenerans, Eubacterium hallii , Eubacterium Clostridium hastiforme, Clostridium histolyticum , 55 ventriosum I , Fusobacterium russii , Ruminococcus obeum , Clostridium indolis , Clostridium innocuum , Clostridium Eubacterium rectale II , Clostridium ramosum I , Lactoba irregulare, Clostridium limosum , Clostridium malenomina - cillus leichmanii , Ruminococcus cailidus, Butyrivibrio cros tum , Clostridium novyi, Clostridium oroticum , Clostridium sotus , Acidaminococcus fermentans, Eubacterium ventrio paraputrificum , Clostridium perfringens, Clostridium pili - sum , Bacteroides fragilis ss . fragilis , Bacteroides AR , forme, Clostridium putrefaciens, Clostridium putrificum , 60 Coprococcus catus , Eubacterium hadrum , Eubacterium Clostridium ramosum , Clostridium sardiniense , Clostridium cylindroides, Eubacterium ruminantium , Eubacterium sartagoforme, Clostridium scindens, Clostridium septicum , CH - 1 , Staphylococcus epidermidis , Peptostreptococcus BL , Clostridium sordellii, Clostridium sphenoides, Clostridium Eubacterium limosum , Bacteroides praeacutus, Bacteroides spiroforme, Clostridium sporogenes, Clostridium subtermi- L , Fusobacterium mortiferum I, Fusobacterium naviforme, nale , Clostridium symbiosum , Clostridium tertium , 65 Clostridium innocuum , Clostridium ramosum , Propionibac Clostridium tetani, Clostridium welchii , and Clostridium terium acnes , Ruminococcus flavefaciens , Ruminococcus villosum . AT , Peptococcus AU - 1 , Eubacterium AG , - AK , - AL , - AL - 1 , US 9 ,855 ,303 B2 25 26 - AN ; Bacteroides fragilis ss . ovatus, - ss . d , -ss . f; Bacte - Disclosed herein are therapeutic compositions containing roides L - 1 , L - 5 ; Fusobacterium nucleatum , Fusobacterium non - pathogenic , germination - competent bacterial spores , mortiferum , Escherichia coli , Streptococcus morbiliorum , for the prevention , control, and treatment of gastrointestinal Peptococcus magnus, Peptococcus G , AU - 2 ; Streptococcus diseases, disorders and conditions and for general nutritional intermedius , Ruminococcus lactaris, Ruminococcus CO 5 health . These compositions are advantageous in being suit Gemmiger X , Coprococcus BH , -CC ; Eubacterium tenue , able for safe administration to humans and other mammalian Eubacterium ramulus , Eubacterium AE , - AG - H , - AG - M , subjects and are efficacious in numerous gastrointestinal - AJ, -BN - 1 ; Bacteroides clostridiiformis ss . clostridliformis , diseases , disorders and conditions and in general nutritional Bacteroides coagulans , Bacteroides orails , Bacteroides health . While spore -based compositions are known , these ruminicola ss . brevis , -Ss . ruminicola , Bacteroides splanch - 10 are generally prepared according to various techniques such nicus, Desuifomonas pigra , Bacteroides L - 4 , - N - i ; Fusobac - as lyophilization or spray -drying of liquid bacterial cultures , terium H , Lactobacillus G , and Succinivibrio A . resulting in poor efficacy , instability , substantial variability Inhibition of Bacterial Pathogens and lack of adequate safety . In some embodiments, the bacterial composition provides It has now been found that populations of bacterial spores a protective or therapeutic effect against infection by one or 15 can be obtained from biological materials obtained from more GI pathogens of interest . mammalian subjects , including humans. These populations A list of exemplary bacterial pathogens is provided in are formulated into compositions as provided herein , and Table 1 as indicated by pathogen status. administered to mammalian subjects using the methods as In some embodiments , the pathogenic bacterium is provided herein . selected from the group consisting of Yersinia , Vibrio , 20 Provided herein are therapeutic compositions containing a Treponema , Streptococcus , Staphylococcus , Shigella , Sal - purified population of bacterial spores . As used herein , the monella , Rickettsia , Orientia , Pseudomonas, Neisseria , termaterms “ purify ” , “ purified ” and “ purifying” refer to the state Mycoplasma, Mycobacterium , Listeria , Leptospira , Legio of a population ( e . g . , a plurality of known or unknown nella , Klebsiella , Helicobacter, Haemophilus , Francisella , amount and /or concentration ) of desired bacterial spores, Escherichia , Ehrlichia , Enterococcus, Coxiella , Corynebac - 25 that have undergone one or more processes of purification , terium , Clostridium , Chlamydia , Chlamydophila , Campy e . g ., a selection or an enrichment of the desired bacterial lobacter, Burkholderia , Brucella , Borrelia , Bordetella , Bifi spore , or alternatively a removal or reduction of residual dobacterium , Bacillus, multi -drug resistant bacteria , habitat products as described herein . In some embodiments , extended spectrum beta - lactam resistant Enterococci a purified population has no detectable undesired activity or, ( ESBL ) , Carbapenem - resistent Enterobacteriaceae ( CRE ) , 30 alternatively , the level or amount of the undesired activity is and vancomycin - resistant Enterococci ( VRE ) . at or below an acceptable level or amount. In other embodi In some embodiments , these pathogens include, but are ments , a purified population has an amount and/ or concen not limited to , Aeromonas hydrophila , Campylobacter fetus , tration of desired bacterial spores at or above an acceptable Plesiomonas shigelloides, Bacillus cereus, Campylobacter amount and / or concentration . In other embodiments, the jejuni, Clostridium botulinum , Clostridium difficile , 35 purified population of bacterial spores is enriched as com Clostridium perfringens, enteroaggregative Escherichia pared to the starting material ( e . g ., a fecal material ) from coli , enterohemorrhagic Escherichia coli , enteroinvasive which the population is obtained . This enrichment may be Escherichia coli , enterotoxigenic Escherichia coli ( such as, by 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , 95 % , but not limited to , LT and /or ST ) , Escherichia coli 0157 :H7 , 96 % 97 % 98 % , 99 % , 99 . 9 % , 99 . 99 % , 99 . 999 % , Helicobacter pylori , Klebsiellia pneumonia , Lysteria mono - 40 99 .9999 % , or greater than 99 . 9999 % as compared to the cytogenes, Plesiomonas shigelloides, Salmonella spp ., Sal- starting material. monella typhi, Salmonella paratyphi, Shigella spp . , Staphy In certain embodiments , the purified populations of bac lococcus spp ., Staphylococcus aureus, vancomycin -resistant terial spores have reduced or undetectable levels of one or enterococcus spp ., Vibrio spp ., Vibrio cholerae, Vibrio para more pathogenic activities, such as toxicity , an infection of haemolyticus , Vibrio vulnificus , and Yersinia enterocolitica . 45 the mammalian recipient subject, an immunomodulatory In one embodiment, the pathogen of interest is at least one activity , an autoimmune response , a metabolic response , or pathogen chosen from Clostridium difficile , Salmonella spp . , an inflammatory response or a neurological response . Such pathogenic Escherichia coli, vancomycin -resistant Entero a reduction in a pathogenic activity may be by 10 % , 20 % , coccus spp ., and extended spectrum beta - lactam resistant 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , 95 % , 96 % , 97 % , Enterococci (ESBL ) . 50 98 % , 99 % , 99. 9 % , 99. 99 % , 99. 999 % , 99 .9999 % , or greater Purified Spore Populations than 99 . 9999 % as compared to the starting material. In other In some embodiments , the bacterial compositions com - embodiments , the purified populations of bacterial spores prise purified spore populations . Purified spore populations have reduced sensory components as compared to fecal contain combinations of commensal bacteria of the human material , such as reduced odor , taste , appearance , and gut microbiota with the capacity to meaningfully provide 55 umami. functions of a healthy microbiota when administered to a Provided are purified populations of bacterial spores that mammalian subject. Without being limited to a specific a re substantially free of residual habitat products . In certain mechanism , it is thought that such compositions inhibit the embodiments , this means that the bacterial spore composi growth of a pathogen such as C . difficile , Salmonella spp ., tion no longer contains a substantial amount of the biologi enteropathogenic E . coli, and vancomycin - resistant Entero - 60 cal matter associated with the microbial community while coccus spp . , so that a healthy , diverse and protective micro - living on or in the human or animal subject, and the purified biota can be maintained or, in the case of pathogenic population of spores may be 100 % free , 99 % free , 98 % free , bacterial infections such as C . difficile infection , repopulate 97 % free , 96 % free , or 95 % free of any contamination of the the intestinal lumen to reestablish ecological control over biological matter associated with the microbial community . potential pathogens . In some embodiments , yeast spores and 65 Substantially free of residual habitat products may also other fungal spores are also purified and selected for thera - mean that the bacterial spore composition contains no peutic use . detectable cells from a human or animal, and that only US 9 ,855 ,303 B2 27 28 microbial cells are detectable , in particular, only desired are highly conserved across members of distantly related microbial cells are detectable . In another embodiment, it genera including Clostridium and Bacillus . Traditional means that fewer than 1x10 - 2 % , 1x10 - 3 % , 1x10 - 4 % approaches of forward genetics have identified many, if not 1x10 - 5 % , 1x10 - 6 % , 1x10 - 7 % , 1x10 - 8 % of the cells in the all, genes that are essential for sporulation ( spo ) . The devel bacterial composition are human or animal, as compared to 5 opmental program of sporulation is governed in part by the microbial cells . In another embodiment, the residual habitat successive action of four compartment - specific sigma fac product present in the purified population is reduced at least tors ( appearing in the order of , oE , OG and oK ) , whose a certain level from the fecal material obtained from the activities are confined to the forespore ( of and oG ) or the mammalian donor subject, e . g . , reduced by at least about mother cell ( oE and oK ) . 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , 95 % , 10 Provided are spore populations containing more than one 96 % 97 % , 98 % , 99 % , 99 . 9 % , 99. 99 % , 99. 999 % , type of bacterium . As used herein , a " type” or more than one 99 . 9999 % , or greater than 99. 9999 % . " types ” of bacteria may be differentiated at the genus level , In one embodiment, substantially free of residual habitat the species , level , the sub -species level , the strain level or by products or substantially free of a detectable level of a any other taxonomic method , as described herein and oth pathogenic material means that the bacterial composition 15 erwise known in the art . contains no detectable viral ( including bacterial viruses (i . e . In some embodiments , all or essentially all of the bacterial phage) ) , fungal , or mycoplasmal or toxoplasmal contami- spores present in a purified population are obtained from a nants, or a eukaryotic parasite such as a helminth . Alterna - fecal material treated as described herein or otherwise tively , the purified spore populations are substantially free of known in the art . In alternative embodiments , one or more an acellular material, e. g ., DNA , viral coat material, or 20 than one bacterial spores or types of bacterial spores are non - viable bacterial material. generated in culture and combined to form a purified spore As described herein , purified spore populations can be population . In other alternative embodiments , one or more demonstrated by genetic analysis ( e . g ., PCR , DNA sequenc - of these culture - generated spore populations are combined ing ), serology and antigen analysis , and methods using with a fecal material- derived spore population to generate a instrumentation such as flow cytometry with reagents that 25 hybrid spore population . Bacterial compositions may con distinguish desired bacterial spores from non - desired , con - tain at least two types of these preferred bacteria , including taminating materials . strains of the same species . For instance , a bacterial com Exemplary biological materials include fecal materials position may comprise at least 2 , at least 3 , at least 4 , at least such as feces or materials isolated from the various segments 5 , at least 6 , at least 7 , at least 8 , at least 9 , at least 10 , at least of the small and large intestines. Fecal materials are obtained 30 11 , at least 12 , at least 13 , at least 14 , at least 15 , at least 16 , from a mammalian donor subject, or can be obtained from at least 17 , at least 18 , at least 19 , or at least 20 or more than more than one donor subject, e . g . , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 20 types of bacteria , as defined by species or operational 15 , 20, 25 , 30 , 35 , 40 , 45 , 50 , 75, 100 , 200 , 300 , 400 , 500 , taxonomic unit (OTU ) encompassing such species . 750 , 1000 or from greater than 1000 donors , where such Thus , provided herein are methods for production of a materials are then pooled prior to purification of the desired 35 composition containing a population of bacterial spores bacterial spores. suitable for therapeutic administration to a mammalian In alternative embodiments , the desired bacterial spores subject in need thereof. And the composition is produced by are purified from a single fecal material sample obtained generally following the steps of : ( a ) providing a fecal from a single donor, and after such purification are combined material obtained from a mammalian donor subject; and ( b ) with purified spore populations from other purifications , 40 subjecting the fecal material to at least one purification either from the same donor at a different time, or from one treatment or step under conditions such that a population of or more different donors , or both . bacterial spores is produced from the fecal material. The Preferred bacterial genera include Acetonema, Alkaliphi composition is formulated such that a single oral dose lus, Alicyclobacillus, Amphibacillus, Ammonifex , Anaero contains at least about 1x10 + colony forming units of the bacter, Anaerofustis , Anaerostipes , Anaerotruncus, Anoxy - 45 bacterial spores , and a single oral dose will typically contain bacillus, Bacillus, Blautia , Brevibacillus, Bryantella , about 1x104, 1x109, 1x10 “, 1x107, 1x10°, 1x10° , 1x1010 , Caldicellulosiruptor, Caloramator, Candidatus, Carboxy - 1x1011, 1x1012, 1x1013, 1x1014, 1x1015, or greater than dibrachium , Carboxydothermus, Clostridium , Cohnella , 1x1015 CFUs of the bacterial spores. The presence and /or Coprococcus, Dendrosporobacter Desulfitobacterium , Des concentration of a given type of bacteria spore may be ulfosporosinus, Desulfotomaculum , Dorea , Eubacterium , 50 known or unknown in a given purified spore population . If Faecalibacterium , Filifactor , Geobacillus , Halobacteroides, known , for example the concentration of spores of a given Heliobacillus, Heliobacterium , Heliophilum , Heliorestis , strain , or the aggregate of all strains, is e . g ., 1x104, 1x10° , Lachnoanaerobaculum , Lysinibacillus, Moorella , Oceano - 1x10 " , 1x107, 1x108 , 1x10°, 1x1010 , 1x1011, 1x1012 , bacillus, Orenia ( S . ), Oxalophagus, Oxobacter, Paenibacil 1x1013 , 1x1014 , 1x1015 , or greater than 1x1015 viable bac lus, Pelospora , Pelotomaculum , Propionispora , Roseburia , 55 terial spores per gram of composition or per administered Ruminococcus, Sarcina , Sporobacterium , Sporohalobacter, dose . Sporolactobacillus , Sporomusa, Sporosarcina , Sporoto In some formulations, the composition contains at least maculum , Subdoligranulum , Symbiobacterium , Syntropho about 10 % , 20 % , 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % or botulus, Syntrophospora , Terribacillus, Thermoanaero - greater than 90 % spores on a mass basis . In some formula bacter , and Thermosinus. 60 tions , the administered dose does not exceed 200 , 300 , 400 , Preferred bacterial species are provided at Table X4 . 500 , 600 , 700 , 800 , 900 milligrams or 1, 1 .1 , 1 .2 , 1. 3 , 1 .4 , Where specific strains of a species are provided , one of skill 1 . 5 , 1. 6 , 1 . 7 , 1 . 8 , or 1 . 9 grams in mass . in the art will recognize that other strains of the species can T he bacterial spore compositions are generally formu be substituted for the named strain . lated for oral or gastric administration , typically to a mam In some embodiments , spore - forming bacteria are iden - 65 malian subject . In particular embodiments , the composition tified by the presence of nucleic acid sequences that modu - is formulated for oral administration as a solid , semi- solid , late sporulation . In particular , signature sporulation genes gel , or liquid form , such as in the form of a pill, tablet , US 9 , 855 , 303 B2 29 30 capsule , or lozenge . In some embodiments , such formula For banking, the strains included in the bacterial compo tions contain or are coated by an enteric coating to protect sition may be ( 1 ) isolated directly from a specimen or taken the bacteria through the stomach and small intestine , from a banked stock , ( 2 ) optionally cultured on a nutrient although spores are generally resistant to the stomach and agar or broth that supports growth to generate viable bio small intestines . 5 mass , and ( 3 ) the biomass optionally preserved in multiple The bacterial spore compositions may be formulated to be aliquots in long- term storage . effective in a given mammalian subject in a single admin In embodiments that use a culturing step , the agar or broth can contain nutrients that provide essential elements and istration or over multiple administrations. For example , a specific factors that enable growth . An example would be a single administration is substantially effective to reduce Cl. 10 medium composed of 20 g / L glucose , 10 g / L yeast extract, difficile and / or Cl. difficile toxin content in a mammalian 10 g / L soy peptone , 2 g / L citric acid , 1 . 5 g / L sodium subject to whom the composition is administered . Substan phosphate monobasic , 100 mg/ L ferric ammonium citrate , tially effective means that Cl. difficile and / or Cl. difficile 80 mg/ L magnesium sulfate , 10 mg/ L hemin chloride, 2 toxin content in the subject is reduced by at least 10 % , 20 % , mg/ L calcium chloride , 1 mg / L menadione . A variety of 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , 90 % , 95 % , 98 % , 99 %% orof 15 microbiological media and variations are well known in the greater than 99 % following administration of the composi art ( e . g . R . M . Atlas, Handbook of Microbiological Media tion . ( 2010 ) CRC Press ) . Medium can be added to the culture at Methods of the Invention the start , may be added during the culture , or may be Methods for Determining 16S Sequences intermittently / continuously flowed through the culture . The OTUs can be defined either by full 16S sequencing of the 20 strains in the bacterial composition may be cultivated alone, rRNA gene , by sequencing of a specific hypervariable as a subset of the bacterial composition , or as an entire region of this gene ( i. e . V1 , V2 , V3 , V4 , V5 , V6 , V7 , V8 , or collection comprising the bacterial composition . As an V9 ) , or by sequencing of any combination of hypervariable example , a first strain may be cultivated together with a regions from this gene ( e . g . V1 - 3 or V3 - 5 ) . The bacterial second strain in a mixed continuous culture , at a dilution rate 16S rDNA is approximately 1500 nucleotides in length and 25 lower than the maximum growth rate of either cell to prevent is used in reconstructing the evolutionary relationships and the culture from washing out of the cultivation . sequence similarity of one bacterial isolate to another using The inoculated culture is incubated under favorable con phylogenetic approaches . 16S sequences are used for phy ditions for a time sufficient to build biomass . For bacterial logenetic reconstruction as they are in general highly con - compositions for human use , this is often at 37° C . tem served , but contain specific hypervariable regions that har - 30 perature , pH , and other parameter with values similar to the bor sufficient nucleotide diversity to differentiate genera and normal human niche . The environment can be actively species ofmost microbes . controlled , passively controlled (e . g ., via buffers) , or Using well known techniques , in order to determine the allowed to drift . For example , for anaerobic bacterial com full 16S sequence or the sequence of any hypervariable positions ( e .g ., gut microbiota ), an anoxic / reducing environ region of the 16S sequence , genomic DNA is extracted from 35 ment can be employed . This can be accomplished by addi a bacterial sample , the 16S rDNA ( full region or specific tion of reducing agents such as cysteine to the broth , and / or hypervariable regions ) amplified using polymerase chain stripping it of oxygen . As an example , a culture of a bacterial reaction (PCR ) , the PCR products cleaned , and nucleotide composition can be grown at 37° C ., pH 7 , in the medium sequences delineated to determine the genetic composition above , pre - reduced with 1 g / L cysteine HCl. of 16S gene or subdomain of the gene . If full 16S sequencing 40 When the culture has generated sufficient biomass , it can is performed , the sequencing method used may be , but is not be preserved for banking . The organisms can be placed into limited to , Sanger sequencing . If one or more hypervariable a chemicalmilieu that protects from freezing ( adding ‘ cryo regions are used , such as the V4 region , the sequencing can protectants ' ) , drying ( ?lyoprotectants ' ) , and /or osmotic be, but is not limited to being , performed using the Sanger shock (' osmoprotectants ') , dispensing into multiple (option method or using a next- generation sequencing method , such 45 ally identical) containers to create a uniform bank , and then as an Illumina (sequencing by synthesis ) method using treating the culture for preservation . Containers are gener barcoded primers allowing for multiplex reactions . ally impermeable and have closures that assure isolation OTUS can be defined by a combination of nucleotide from the environment. Cryopreservation treatment is accom markers or genes, in particular highly conserved genes ( e . g ., plished by freezing a liquid at ultra - low temperatures ( e . g . , " house -keeping ” genes ), or a combination thereof, full - 50 at or below - 80° C . ) . Dried preservation removes water genome sequence, or partial genome sequence generated from the culture by evaporation ( in the case of spray drying using amplified genetic products , or whole genome or ' cool drying ') or by sublimation (e . g. , for freeze drying , sequence (WGS ) . Using well defined methods DNA spray freeze drying) . Removal of water improves long -term extracted from a bacterial sample will have specific genomic bacterial composition storage stability at temperatures regions amplified using PCR and sequenced to determine the 55 elevated above cryogenic . If the bacterial composition com nucleotide sequence of the amplified products . In the whole prises spore forming species and results in the production of genome shotgun (WGS ) method , extracted DNA will be spores , the final composition can be purified by additional directly sequenced without amplification . Sequence data can means, such as density gradient centrifugation preserved be generated using any sequencing technology including , using the techniques described above . Bacterial composition but not limited to Sanger , Illumina , 454 Life Sciences, Ion 60 banking can be done by culturing and preserving the strains Torrent , ABI, Pacific Biosciences, and /or Oxford Nanopore . individually , or by mixing the strains together to create a Methods for Preparing a Bacterial Composition for combined bank . As an example of cryopreservation, a bac Administration to a Subject terial composition culture can be harvested by centrifugation Methods for producing bacterial compositions can to pellet the cells from the culture medium , the supernate include three main processing steps, combined with one or 65 decanted and replaced with fresh culture broth containing more mixing steps . The steps include organism banking , 15 % glycerol. The culture can then be aliquoted into 1 mL organism production , and preservation . cryotubes , sealed , and placed at - 80° C . for long - term US 9 ,855 ,303 B2 31 32 viability retention . This procedure achieves acceptable mittently according to a set schedule , e . g . , once a day , once viability upon recovery from frozen storage . weekly , or once monthly , or when the subject relapses from Organism production can be conducted using similar the primary illness . In another embodiment , the preparation culture steps to banking , including medium composition and may be administered on a long - term basis to individuals who culture conditions . It can be conducted at larger scales of 5 are at risk for infection with or who may be carriers of these operation , especially for clinical development or commer- pathogens, including individuals who will have an invasive cial production . At larger scales , there can be several sub medical procedure (such as surgery ) , who will be hospital cultivations of the bacterial composition prior to the final i zed , who live in a long -term care or rehabilitation facility , cultivation . At the end of cultivation , the culture is harvested who are exposed to pathogens by virtue of their profession to enable further formulation into a dosage form for admin - 10 (livestock and animal processing workers ) , or who could be istration . This can involve concentration , removal of unde - carriers of pathogens ( including hospital workers such as sirable medium components , and / or introduction into a physicians, nurses , and other healthcare professionals ) . chemical milieu that preserves thebacterial composition and Also provided are methods of treating or preventing a renders it acceptable for administration via the chosen route . mammalian subject suffering from or at risk of developing For example , a bacterial composition can be cultivated to a 15 a metabolic disease , and disorder or condition selected from concentration of 1010 CFU /mL , then concentrated 20 - fold the group consisting of diabetes, metabolic syndrome, obe by tangential flow microfiltration ; the spent medium can be sity , heart disease , autoimmune disease , liver disease , and exchanged by diafiltering with a preservative medium con - autism using the therapeutic compositions provided herein . sisting of 2 % gelatin , 100 mM trehalose , and 10 mM sodium In embodiments , the bacterial spore composition is phosphate buffer . The suspension can then be freeze -dried to 20 administered enterically . This preferentially includes oral a powder and titrated . administration , or by an oral or nasal tube ( including naso After drying , the powder can be blended to an appropriate gastric , nasojejunal, oral gastric , or oral jejunal) . In other potency , and mixed with other cultures and /or a filler such embodiments , administration includes rectal administration as microcrystalline cellulose for consistency and ease of ( including enema, suppository , or colonoscopy ) . The bacte handling , and the bacterial composition formulated as pro - 25 rial composition may be administered to at least one region vided herein . of the gastrointestinal tract, including the mouth , esophagus, Administration of Bacterial Compositions. stomach , small intestine, large intestine , and rectum . In The bacterial compositions of the invention are suitable some embodiments , it is administered to all regions of the for administration to mammals and non -mammalian animals gastrointestinal tract. The bacterial compositions may be in need thereof . In certain embodiments, the mammalian 30 administered orally in the form of medicaments such as subject is a human subject who has one or more symptoms powders , capsules , tablets , gels or liquids . The bacterial of a dysbiosis , including but not limited to overgrowth of an compositions may also be administered in gel or liquid form undesired pathobiont or pathogen , reduced representation of by the oral route or through a nasogastric tube , or by the key bacterial taxa such as the Bacteroidetes or Firmicutes or rectal route in a gel or liquid form , by enema or instillation genera or species thereof, or reduced diversity of microbial 35 through a colonoscope or by a suppository . species compared to a healthy individual, or reduced overall If the composition is administered colonoscopically and , abundance of anaerobic bacteria . optionally, if the bacterial composition is administered by When the mammalian subject is suffering from a disease , other rectal routes (such as an enema or suppository ) or even disorder or condition characterized by an aberrant micro - if the subject has an oral administration , the subject may biota , the bacterial compositions described herein are suit- 40 have a colonic - cleansing preparation . The colon - cleansing able for treatment thereof. In some embodiments , the mam preparation can facilitate proper use of the colonoscope or malian subject has not received antibiotics in advance of other administration devices, but even when it does not serve treatment with the bacterial compositions . For example , the a mechanical purpose it can also maximize the proportion of mammalian subject has not been administered at least two the bacterial composition relative to the other organisms doses of vancomycin , metronidazole and / or or similar anti - 45 previously residing in the gastrointestinal tract of the sub biotic compound within one week prior to administration of ject. Any ordinarily acceptable colonic - cleansing prepara the therapeutic composition . In other embodiments , the tion may be used such as those typically provided when a mammalian subject has not previously received an antibiotic subject undergoes a colonoscopy . compound in the one month prior to administration of the To evaluate the subject, symptoms of dysbiosis are evalu therapeutic composition . In other embodiments , the mam - 50 ated post treatment ranging from 1 day to 6 months after malian subject has received one or more treatments with one administration of the purified spore population . Fecal mate or more different antibiotic compounds and such rial is collected during this period and the microbes present treatment( s ) resulted in no improvement or a worsening of in the gastrointestinal tract can be assessed by 16S rDNA or symptoms. In some embodiments, the spore composition is metagenomic sequencing analysis or other analyses com administered following a successful course of antibiotics to 55 monly used by the skilled artisan . Repopulation by species prevent dysbiosis and enhance recovery of a diverse ,healthy provided by the spore population as well as Augmentation microbiota . by commensal microbes not present in the spore population In some embodiments , the gastrointestinal disease , disor- will occur in this time as the spore population catalyzes a der or condition is diarrhea caused by C . difficile including reshaping of the gut ecology to a state of healthy biosis . The recurrent C . difficile infection , ulcerative colitis , colitis , 60 specification is most thoroughly understood in light of the Crohn 's disease , or irritable bowel disease . Beneficially , the teachings of the references cited within the specification . therapeutic composition is administered only once prior to The embodiments within the specification provide an illus improvement of the disease , disorder or condition . In some tration of embodiments and should not be construed to limit embodiments the therapeutic composition is administered at the scope . The skilled artisan readily recognizes that many intervals greater than two days , such as once every three , 65 other embodiments are encompassed . four , five or six days , or every week or less frequently than All publications and patents cited in this disclosure are every week . Or the preparation may be administered inter - incorporated by reference in their entirety . To the extent the US 9 ,855 ,303 B2 33 34 material incorporated by reference contradicts or is incon recur. In these instances, the pretreatment protocol can sistent with this specification , the specification will super enhance the ability of the bacterial composition to affect the sede any such material. The citation of any references herein patient' s microbiome . is not an admission that such references are prior art. As one way of preparing the patient for administration of Methods of Treating a Subject 5 the microbial ecosystem , at least one antibiotic can be In some embodiments , the compositions disclosed herein administered to alter the bacteria in the patient. As another are administered to a patient or a user ( sometimes collec - way of preparing the patient for administration of the tively referred to as a “ subject ” ). As used herein " adminis - microbial ecosystem , a standard colon -cleansing preparation ter" and " administration " encompasses embodiments in can be administered to the patient to substantially empty the which one person directs another to consume a bacterial 10 contents of the colon , such as used to prepare a patient for composition in a certain manner and /or for a certain purpose , a colonscopy. By “ substantially emptying the contents of the and also situations in which a user uses a bacteria compo - colon , ” this application means removing at least 75 % , at sition in a certain manner and / or for a certain purpose least 80 % , at least 90 % , at least 95 % , or about 100 % of the independently of or in variance to any instructions received contents of the ordinary volume of colon contents . Antibi from a second person . Non -limiting examples of embodi- 15 otic treatment can precede the colon - cleansing protocol. ments in which one person directs another to consume a If a patient has received an antibiotic for treatment of an bacterial composition in a certain manner and / or for a infection , or if a patient has received an antibiotic as part of certain purpose include when a physician prescribes a course a specific pretreatment protocol, in one embodiment, the of conduct and / or treatment to a patient, when a parent antibiotic can be stopped in sufficient time to allow the commands a minor user ( such as a child ) to consume a 20 antibiotic to be substantially reduced in concentration in the bacterial composition , when a trainer advises a user ( such as gut before the bacterial composition is administered . In one an athlete ) to follow a particular course of conduct and /or embodiment, the antibiotic can be discontinued 1 , 2 , or 3 treatment, and when a manufacturer, distributor, or marketer days before the administration of the bacterial composition . recommends conditions of use to an end user , for example In another embodiment, the antibiotic can be discontinued 3 , through advertisements or labeling on packaging or on other 25 4 , 5 , 6 , or 7 antibiotic half - lives before administration of the materials provided in association with the sale or marketing bacterial composition . In another embodiment, the antibiotic of a product. can be chosen so the constituents in the bacterial composi The bacterial compositions offer a protective and /or thera - tion have an MIC50 that is higher than the concentration of peutic effect against infection by one or more GI pathogens the antibiotic in the gut. of interest and can be administered after an acute case of 30 MIC50 of a bacterial composition or the elements in the infection has been resolved in order to prevent relapse , composition can be determined by methods well known in during an acute case of infection as a complement to the art. Reller et al. , Antimicrobial Susceptibility Testing: A antibiotic therapy if the bacterial composition is not sensi- Review of General Principles and Contemporary Practices , tive to the same antibiotics as the GI pathogen , or to prevent Clinical Infectious Diseases 49 ( 11 ) : 1749 - 1755 (2009 ) . In infection or reduce transmission from disease carriers . 35 such an embodiment, the additional time between antibiotic The present bacterial compositions can be useful in a administration and administration of the bacterial composi variety of clinical situations. For example , the bacterial tion is not necessary. If the pretreatment protocol is part of compositions can be administered as a complementary treat- treatment of an acute infection , the antibiotic can be chosen ment to antibiotics when a patient is suffering from an acute so that the infection is sensitive to the antibiotic , but the infection , to reduce the risk of recurrence after an acute 40 constituents in the bacterial composition are not sensitive to infection has subsided , or when a patient will be in close the antibiotic . proximity to others with or at risk of serious gastrointestinal Routes of Administration infections (physicians , nurses, hospital workers , family The bacterial compositions of the invention are suitable members of those who are ill or hospitalized ) . for administration to mammals and non -mammalian animals The present bacterial compositions can be administered to 45 in need thereof. In certain embodiments , the mammalian animals , including humans , laboratory animals ( e . g ., pri - subject is a human subject who has one or more symptoms mates , rats , mice ) , livestock ( e . g . , cows, sheep , goats , pigs , of a dysbiosis . turkeys , chickens) , and household pets ( e . g . , dogs , cats , When a mammalian subject is suffering from a disease , rodents ) . disorder or condition characterized by an aberrant micro In the present method , the bacterial composition can be 50 biota , the bacterial compositions described herein are suit administered enterically , in other words, by a route of access able for treatment thereof. In some embodiments, the mam to the gastrointestinal tract. This includes oral administra malian subject has not received antibiotics in advance of tion , rectal administration ( including enema , suppository , or treatment with the bacterial compositions . For example , the colonoscopy ) , by an oral or nasal tube (nasogastric , naso mammalian subject has not been administered at least two jejunal, oral gastric , or oral jejunal ), as detailed more fully 55 doses of vancomycin , metronidazole and / or or similar anti herein . biotic compound within one week prior to administration of Pretreatment Protocols the therapeutic composition . In other embodiments , the Prior to administration of the bacterial composition , the mammalian subject has not previously received an antibiotic patient can optionally have a pretreatment protocol to pre - compound in the one month prior to administration of the pare the gastrointestinal tract to receive the bacterial com - 60 therapeutic composition . In other embodiments, the mam position . In certain embodiments , the pretreatment protocol m alian subject has received one or more treatments with one is advisable , such as when a patient has an acute infection or more different antibiotic compounds and such with a highly resilient pathogen . In other embodiments , the treatment( s ) resulted in no improvement or a worsening of pretreatment protocol is entirely optional, such as when the symptoms. pathogen causing the infection is not resilient, or the patient 65 In some embodiments , the gastrointestinal disease , disor has had an acute infection that has been successfully treated der or condition is diarrhea caused by C . difficile including but where the physician is concerned that the infection may recurrent C . difficile infection , ulcerative colitis , colitis , US 9 ,855 ,303 B2 35 36 Crohn ' s disease , or irritable bowel disease . Beneficially , the months, at least 6 months, or at least 1 year. In some therapeutic composition is administered only once prior to embodiments the treatment period is from 1 day to 1 week , improvement of the disease, disorder or condition . In some from 1 week to 4 weeks, from 1 month , to 3 months, from embodiments , the therapeutic composition is administered at 3 months to 6 months, from 6 months to 1 year, or for over intervals greater than two days , such as once every three , 5 a year. four, five or six days, or every week or less frequently than In one embodiment, 105 and 1012 microorganisms total every week . In other embodiments , the preparation can be can be administered to the patient in a given dosage form . In administered intermittently according to a set schedule , e . g . , another embodiment, an effective amount can be provided in once a day , once weekly , or once monthly , or when the from 1 to 500 ml or from 1 to 500 grams of the bacterial subject relapses from the primary illness . In another embodi- 10 composition having from 107 to 1011 bacteria per ml or per ment, the preparation may be administered on a long -term gram , or a capsule , tablet or suppository having from 1 mg basis to subjects who are at risk for infection with or who to 1000 mg lyophilized powder having from 107 to 1011 may be carriers of these pathogens , including subjects who bacteria . Those receiving acute treatment can receive higher will have an invasive medical procedure (such as surgery ) , doses than those who are receiving chronic administration who will be hospitalized , who live in a long -term care or 15 ( such as hospital workers or those admitted into long - term rehabilitation facility , who are exposed to pathogens by care facilities ) . virtue of their profession ( livestock and animal processing Any of the preparations described herein can be admin workers ), or who could be carriers of pathogens ( including istered once on a single occasion or on multiple occasions , hospital workers such as physicians , nurses, and other health such as once a day for several days or more than once a day care professionals ). 20 on the day of administration ( including twice daily , three In certain embodiments, the bacterial composition is times daily , or up to five times daily ) . In another embodi administered enterically. This preferentially includes oral m ent, the preparation can be administered intermittently administration , or by an oral or nasal tube ( including naso according to a set schedule , e. g ., once weekly , once monthly , gastric , nasojejunal , oral gastric , or oral jejunal) . In other or when the patient relapses from the primary illness. In one embodiments , administration includes rectal administration 25 embodiment, the preparation can be administered on a ( including enema, suppository , or colonoscopy ) . The bacte - long - term basis to individuals who are at risk for infection rial composition can be administered to at least one region with or who may be carriers of these pathogens , including of the gastrointestinal tract, including the mouth , esophagus, individuals who will have an invasive medical procedure stomach , small intestine , large intestine, and rectum . In (such as surgery ) , who will be hospitalized , who live in a some embodiments , it is administered to all regions of the 30 long - term care or rehabilitation facility, who are exposed to gastrointestinal tract. The bacterial compositions can be pathogens by virtue of their profession ( livestock and animal administered orally in the form of medicaments such as processing workers ) , or who could be carriers of pathogens powders , capsules , tablets , gels or liquids. The bacterial (including hospital workers such as physicians, nurses , and compositions can also be administered in gel or liquid form other health care professionals ) . by the oral route or through a nasogastric tube , or by the 35 Patient Selection rectal route in a gel or liquid form , by enema or instillation Particular bacterial compositions can be selected for indi through a colonoscope or by a suppository . vidual patients or for patients with particular profiles. For If the composition is administered colonoscopically and , example , 16S sequencing can be performed for a given optionally , if the bacterial composition is administered by patient to identify the bacteria present in his or her micro other rectal routes ( such as an enema or suppository ) or even 40 biota . The sequencing can either profile the patient' s entire if the subject has an oral administration , the subject can have microbiome using 16S sequencing ( to the family , genera , or a colon - cleansing preparation . The colon - cleansing prepa - species level) , a portion of the patient ' s microbiome using ration can facilitate proper use of the colonoscope or other 16S sequencing , or it can be used to detect the presence or administration devices, but even when it does not serve a absence of specific candidate bacteria that are biomarkers mechanical purpose , it can also maximize the proportion of 45 for health or a particular disease state , such as markers of the bacterial composition relative to the other organisms multi - drug resistant organisms or specific genera of concern previously residing in the gastrointestinal tract of the sub - such as Escherichia . Based on the biomarker data , a par ject. Any ordinarily acceptable colon - cleansing preparation ticular composition can be selected for administration to a may be used such as those typically provided when a subject patient to supplement or complement a patient' s microbiota undergoes a colonoscopy. 50 in order to restore health or treat or prevent disease . In Dosages and Schedule for Administration another embodiment, patients can be screened to determine In some embodiments , the bacteria and bacterial compo the composition of their microbiota to determine the likeli sitions are provided in a dosage form . In certain embodi- hood of successful treatment. ments , the dosage form is designed for administration of at Combination Therapy least one OTU or combination thereof disclosed herein , 55 The bacterial compositions can be administered with wherein the total amount of bacterial composition adminis - other agents in a combination therapy mode , including tered is selected from 0 . 1 ng to 10 g , 10 ng to 1 g , 100 ng anti -microbial agents and prebiotics . Administration can be to 0 . 1 g , 0 . 1 mg to 500 mg, 1 mg to 100 mg, or from 10 - 15 sequential, over a period of hours or days , or simultaneous . mg. In other embodiments , the bacterial composition is in one embodiment, the bacterial compositions are consumed at a rate of from 0 . 1 ng to 10 g a day, 10 ng to 1 60 included in combination therapy with one or more anti g a day , 100 ng to 0 . 1 g a day, 0 . 1 mg to 500 mg a day , 1 mg microbial agents , which include anti - bacterial agents, anti to 100 mg a day , or from 10 - 15 mg a day , or more . fungal agents , anti - viral agents and anti -parasitic agents . In certain embodiments , the treatment period is at least 1 Anti -bacterial agents can include cephalosporin antibiot day , at least 2 days, at least 3 days , at least 4 days , at least ics ( cephalexin , cefuroxime, cefadroxil , cefazolin , cepha 5 days , at least 6 days , at least 1 week , at least 2 weeks, at 65 lothin , cefaclor, cefamandole , cefoxitin , cefprozil, and cefto least 3 weeks, at least 4 weeks , at least 1 month , at least 2 biprole ) ; fluoroquinolone antibiotics ( cipro , Levaquin , months , at least 3 months, at least 4 months, at least 5 floxin , tequin , avelox , and norflox ) ; tetracycline antibiotics US 9 ,855 , 303 B2 37 38 ( tetracycline , minocycline, oxytetracycline, and doxycy using quantitative PCR (qPCR ) , described below , or by cline ) ; penicillin antibiotics ( amoxicillin , ampicillin , peni using traditional microbiological techniques and counting cillin V , dicloxacillin , carbenicillin , vancomycin , and methi colony formation . cillin ); and carbapenem antibiotics ( ertapenem , doripenem , Optionally , the mice can receive an antibiotic treatment to imipenem / cilastatin , and meropenem ) . 5 mimic the condition of dysbiosis . Antibiotic treatment can Anti- viral agents can include Abacavir, Acyclovir, Adefo decrease the taxonomic richness , diversity , and evenness of vir , Amprenavir , Atazanavir, Cidofovir , Darunavir , Delavir the community , including a reduction of abundance of a dine, Didanosine, Docosanol, Efavirenz , Elvitegravir , Emtricitabine, Enfuvirtide, Etravirine, Famciclovir, Foscar significant number of bacterial taxa . Dethlefsen et al ., The net , Fomivirsen , Ganciclovir , Indinavir, Idoxuridine , Lami- 10 pervasive effects of an antibiotic on the human gut micro vudine, Lopinavir Maraviroc , MK - 2048 , Nelfinavir , Nevi biota , as revealed by deep 16S rRNA sequencing , PLoS rapine , Penciclovir, Raltegravir, Rilpivirine , Ritonavir , Biology 6 ( 11 ) :3280 ( 2008 ) . At least one antibiotic can be Saquinavir , Stavudine , Tenofovir Trifluridine, Valaciclovir, used , and antibiotics are well known . Antibiotics can include Valganciclovir , Vidarabine , Ibacitabine , Amantadine , Osel aminoglycoside antibiotic ( amikacin , arbekacin , gentamicin , tamivir , Rimantidine, Tipranavir , Zalcitabine, Zanamivir 15 kanamycin , neomycin , netilmicin , paromomycin , rho and Zidovudine . dostreptomycin , streptomycin , tobramycin , and apramycin ) , Examples of antifungal compounds include, but are not amoxicillin , ampicillin , Augmentin (an amoxicillin / clavu limited to polyene antifungals such as natamycin , rimocidin , lanate potassium combination ) , cephalosporin ( cefaclor, filipin , nystatin , amphotericin B , candicin , and hamycin ; defadroxil , cefazolin , cefixime, fefoxitin , cefprozil , ceftaz imidazole antifungals such as miconazole , ketoconazole , 20 imdime, cefuroxime, cephalexin ), clavulanate potassium , clotrimazole , econazole , omoconazole , bifonazole, butocon clindamycin , colistin , gentamycin , kanamycin , metronida azole , fenticonazole , isoconazole , oxiconazole , sertacon - zole , or vancomycin . As an individual, nonlimiting specific azole , sulconazole , and tioconazole ; triazole antifungals example , the mice can be provided with drinking water such as fluconazole , itraconazole , isavuconazole, ravucon containing a mixture of the antibiotics kanamycin , colistin , azole , posaconazole , voriconazole , terconazole , and alba - 25 gentamycin , metronidazole and vancomycin at 40 mg /kg , conazole ; thiazole antifungals such as abafungin ; allylamine 4 . 2 mg/ kg , 3 . 5 mg/ kg , 21. 5 mg/ kg , and 4 . 5 mg/ kg (mg per antifungals such as terbinafine , naftifine, and butenafine ; and average mouse body weight) , respectively , for 7 days . Alter echinocandin antifungals such as anidulafungin , caspo fungin , and micafungin . Other compounds that have anti natively ,mice can be administered ciprofloxacin at a dose of fungal properties include, but are not limited to polygodial, 30 15 - 20 mg/ kg (mg per average mouse body weight) , for 7 benzoic acid , ciclopirox , tolnaftate , undecylenic acid , flu days. If the mice are provided with an antibiotic , a wash out cytosine or 5 - fluorocytosine , griseofulvin , and haloprogin . period of from one day to three days may be provided with In one embodiment, the bacterial compositions are no antibiotic treatment and no bacterial composition treat included in combination therapy with one ormore corticos ment . teroids , mesalazine , mesalamine, sulfasalazine , sulfasala - 35 Subsequently , the test bacterial composition is adminis zine derivatives , immunosuppressive drugs, cyclosporin A , tered to the mice by oral gavage . The test bacterial compo mercaptopurine , azathiopurine , prednisone, methotrexate , sition may be administered in a volume of 0 . 2 ml containing antihistamines, glucocorticoids , epinephrine , theophylline , 104 CFUs of each type of bacteria in the bacterial compo cromolyn sodium , anti- leukotrienes , anti - cholinergic drugs sition . Dose -response may be assessed by using a range of for rhinitis , anti -cholinergic decongestants , mast- cell stabi- 40 doses , including , but not limited to 10 ", 10 " , 104, 10 " , 10° , lizers, monoclonal anti- IgE antibodies, vaccines , and com - 10 % , 108, 109, and /or 1010 . binations thereof. The mice can be evaluated using 16S sequencing , full A prebiotic is a selectively fermented ingredient that genome sequencing , whole genome shotgun sequencing allows specific changes, both in the composition and /or (WGS ) , or traditional microbiological techniques to deter activity in the gastrointestinal microbiota that confers ben - 45 mine whether the test bacterial composition has populated efits upon host well -being and health . Prebiotics can include the gastrointestinal tract of the mice . For example only , one complex carbohydrates, amino acids, peptides, or other day, three days , one week , two weeks , and one month after essential nutritional components for the survival of the administration of the bacterial composition to the mice , 16S bacterial composition . Prebiotics include, but are not limited to , amino acids, biotin , fructooligosaccharide , galactooli - 50 profiling is conducted to determine whether the test bacterial gosaccharides, inulin , lactulose, mannan oligosaccharides, composition has populated the gastrointestinal tract of the oligofructose - enriched inulin , oligofructose , oligodextrose , mice . Quantitative assessments , including qPCR and tradi tagatose , trans - galactooligosaccharide , and xylooligosac tional microbiological techniques such as colony counting , charides . can additionally or alternatively be performed , at the same Methods for Testing Bacterial Compositions for Populat - 55 time intervals . ing Effect Furthermore , the number of sequence counts that corre In Vivo Assay for Determining Whether a Bacterial spond exactly to those in the bacterial composition over time Composition Populates a Subiect' s Gastrointestinal Tract can be assessed to determine specifically which components In order to determine that the bacterial composition of the bacterial composition reside in the gastrointestinal populates the gastrointestinal tract of a subject, an animal 60 tract over a particular period of time. In one embodiment, the model, such as a mouse model, can be used . The model can strains of the bacterial composition persist for a desired begin by evaluating the microbiota of the mice . Qualitative period of time. In another embodiment, the components of assessments can be accomplished using 16S profiling of the the bacterial composition persist for a desired period of time, microbial community in the feces of normal mice . It can also while also increasing the ability of other microbes ( such as be accomplished by full genome sequencing , whole genome 65 those present in the environment, food , etc . ) to populate the shotgun sequencing (WGS ) , or traditional microbiological gastrointestinal tract, further increasing overall diversity , as techniques . Quantitative assessments can be conducted discussed below . US 9 , 855 , 303 B2 39 40 Ability of Bacterial Compositions to Populate Different tiple bacterial constituents (collectively referred to in this Regions of the Gastrointestinal Tract section as bacterial composition ) . The present bacterial compositions can also be assessed pH Sensitivity Testing for their ability to populate different regions on the gastro If a bacterial composition will be administered other than intestinal tract. In one embodiment, a bacterial composition 5 to the colon or rectum (i . e ., for example , an oral route ), can be chosen for its ability to populate one or more than one optionally testing for pH resistance enhances the selection of region of the gastrointestinal tract , including , but not limited bacterial compositions that will survive at the highest yield possible through the varying pH environments of the distinct to the stomach , the small intestine (duodenum , jejunum , and regions of the GI tract. Understanding how the bacterial ileum ), the large intestine ( the cecum , the colon ( the ascend 10 compositions react to the pH of the GI tract also assists in ing , transverse, descending, and sigmoid colon ) , and the formulation , so that the number of bacteria in a dosage form rectum ) . can be increased if beneficial and / or so that the composition An in vivo study can be conducted to determine which may be administered in an enteric - coated capsule or tablet or regions of the gastrointestinal tract a given bacterial com with a buffering or protective composition . As the pH of the position will populate . A mouse model similarar to the one 15 stomach can drop to a pH of 1 to 2 after a high - protein meal described above can be conducted , except instead of assess for a short time before physiological mechanisms adjust it to ing the feces produced by the mice, particular regions of the a pH of 3 to 4 and often resides at a resting pH of 4 to 5 , and gastrointestinal tract can be removed and studied individu - as the pH of the small intestine can range from a pH of 6 to ally. For example , at least one particular region of the 7 . 4 , bacterial compositions can be prepared that survive gastrointestinal tract can be removed and a qualitative or 20 these varying pH ranges ( specifically wherein at least 1 % , quantitative determination can be performed on the contents 5 % , 10 % , 15 % , 20 % , 25 % , 30 % , 40 % , 50 % , 60 % , 70 % , of that region of the gastrointestinal tract. In another 80 % , 90 % , or as much as 100 % of the bacteria can survive embodiment, the contents can optionally be removed and the gut transit times through various pH ranges ). This can be qualitative or quantitative determination may be conducted tested by exposing the bacterial composition to varying pH on the tissue removed from the mouse . 25 ranges for the expected gut transit times through those pH qPCR ranges. Therefore, as a nonlimiting example only , 18 - hour As one quantitative method for determining whether a cultures of bacterial compositions can be grown in standard bacterial composition populates the gastrointestinal tract, media , such as gut microbiota medium (“ GMM ” , see Good quantitative PCR (qPCR ) can be performed . Standard tech man et al. , Extensive personal human gut microbiota culture niques can be followed to generate a standard curve for the 30 collections characterized and manipulated in gnotobiotic bacterial composition of interest, either for all of the com mice, PNAS 108 ( 15 ) :6252 -6257 ( 2011 ) ) or another animal ponents of the bacterial composition collectively , individu - products - free medium , with the addition of pH adjusting ally , or in subsets ( if applicable ) . Genomic DNA can be agents for a pH of 1 to 2 for 30 minutes, a pH of 3 to 4 for extracted from samples using commercially -available kits, 1 hour, a pH of 4 to 5 for 1 to 2 hours , and a pH of 6 to 7 . 4 such as the Mo Bio Powersoil® -htp 96 Well Soil DNA 35 for 2 .5 to 3 hours. An alternative method for testing stability Isolation Kit (Mo Bio Laboratories, Carlsbad , Calif .) , the to acid is described in U . S . Pat. No . 4 ,839 , 281. Survival of Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laborato - bacteria may be determined by culturing the bacteria and ries , Carlsbad , Calif. ), or the QIAamp DNA Stool Mini Kit counting colonies on appropriate selective or non - selective (QIAGEN , Valencia , Calif. ) according to the manufacturer ' s media . instructions. 40 Bile Acid Sensitivity Testing In some embodiments , qPCR can be conducted using Additionally , in some embodiments, testing for bile -acid HotMasterMix (5PRIME , Gaithersburg , Md. ) and primers resistance enhances the selection of bacterial compositions specific for the bacterial composition of interest , and may be that will survive exposures to bile acid during transit through conducted on a Micro Amp® Fast Optical 96 -well Reaction the GI tract . Bile acids are secreted into the small intestine Plate with Barcode ( 0 .1 mL ) ( Life Technologies, Grand 45 and can , like pH , affect the survival of bacterial composi Island , N . Y . ) and performed on a BioRad C1000TM Thermal tions . This can be tested by exposing the bacterial compo Cycler equipped with a CFX96TM Real- Time System (Bio sitions to bile acids for the expected gut exposure time to Rad , Hercules , Calif. ) , with fluorescent readings of the FAM bile acids. For example , bile acid solutions can be prepared and ROX channels . The Ca value for each well on the FAM at desired concentrations using 0 .05 mM Tris at pH 9 as the channel is determined by the CFX ManagerTM software 50 solvent. After the bile acid is dissolved , the pH of the version 2 . 1 . The logio ( cfu /ml ) of each experimental sample solution may be adjusted to 7 . 2 with 10 % HC1. Bacterial is calculated by inputting a given sample ' s Cq value into compositions can be cultured in 2 . 2 ml of a bile acid linear regression model generated from the standard curve composition mimicking the concentration and type of bile comparing the Cq values of the standard curve wells to the acids in the patient, 1 . 0 ml of 10 % sterile -filtered feces known log10 ( cfu /ml ) of those samples. The skilled artisan 55 media and 0 . 1 ml of an 18 - hour culture of the given strain may employ alternative qPCR modes. of bacteria . Incubations may be conducted for from 2 . 5 to 3 Methods for Characterization of Bacterial Compositions hours or longer. An alternative method for testing stability to In certain embodiments , provided are methods for testing bile acid is described in U . S . Pat . No. 4 ,839 , 281. Survival of certain characteristics of bacterial compositions . For bacteria may be determined by culturing the bacteria and example , the sensitivity of bacterial compositions to certain 60 counting colonies on appropriate selective or non - selective environmental variables is determined , e . g ., in order to media . select for particular desirable characteristics in a given Antibiotic Sensitivity Testing composition , formulation and / or use . For example , the con As a further optional sensitivity test , bacterial composi stituents in the bacterial composition can be tested for pH tions can be tested for sensitivity to antibiotics. In one resistance , bile acid resistance , and / or antibiotic sensitivity, 65 embodiment, bacterial compositions can be chosen so that either individually on a constituent -by -constituent basis or the bacterial constituents are sensitive to antibiotics such collectively as a bacterial composition comprised of mul that if necessary they can be eliminated or substantially US 9 ,855 , 303 B2 41 42 reduced from the patient ' s gastrointestinal tract by at least the desired spore populations are retained on a filter while one antibiotic targeting the bacterial composition . the undesirable (non - spore) fecal components to pass Adherence to Gastrointestinal Cells through , and the spore fraction is then recovered from the The bacterial compositions may optionally be tested for filter medium . Alternatively , undesirable particulates and the ability to adhere to gastrointestinal cells . A method for 5 eukaryotic cells may be retained on a filter while bacterial testing adherence to gastrointestinal cells is described in cells including spores pass through . In some embodiments U . S . Pat. No . 4 , 839 ,281 . Methods for Purifying Spores the spore fraction retained on the filter medium is subjected Solvent Treatments to a diafiltration step , wherein the retained spores are con To purify the bacterial spores, the fecal material is sub - 10 tacted with a wash liquid , typically a sterile saline- contain jected to one or more solvent treatments . A solvent treatment ing solution or other diluent, in order to further reduce or is a miscible solvent treatment ( either partially miscible or remove the undesirable fecal components . fully miscible ) or an immiscible solvent treatment. Misci Thermal Treatments bility is the ability of two liquids to mix with each to form Provided herein is the thermal disruption of the fecal a homogeneous solution . Water and ethanol, for example . 15 material. Generally , the fecal material is mixed in a saline are fully miscible such that a mixture containing water and containing solution such as phosphate -buffered saline (PBS ) ethanol in any ratio will show only one phase . Miscibility is and subjected to a heated environment, such as a warm provided as a wt/ wt % , or weight of one solvent in 100 g of room , incubator, water -bath , or the like , such that efficient final solution . If two solvents are fully miscible in all heat transfer occurs between the heated environment and the proportions , their miscibility is 100 % . Provided as fully 20 fecal material . Preferably the fecal material solution is miscible solutions with water are alcohols , e . g ., methanol, mixed during the incubation to enhance thermal conductiv ethanol, isopropanol, butanol, etc . The alcohols can be ity and disrupt particulate aggregates. Thermal treatments provided already combined with water; e .g . , a solution can be modulated by the temperature of the environment containing 10 % , 20 % , 25 % , 30 % , 35 % , 40 % , 45 % , 50 % , and /or the duration of the thermal treatment. For example , 55 % , 60 % , 65 % , 70 % , 75 % , 89 % , 85 % , 90 % , 95 % or 25 the fecalmaterial or a liquid comprising the fecal material is greater than 95 % Other solvents are only partially miscible , subjected to a heated environment, e . g ., a hot water bath of meaning that only some portion will dissolve in water . at least about 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , Diethyl ether, for example , is partially miscible with water . 80 , 85 , 90 , 95 , 100 or greater than 100 degrees Celsius , for Up to 7 grams of diethyl ether will dissolve in 93 g of water at least about 1 , 5 , 10 , 15 , 20 , 30 , 45 seconds, or 1 , 2 , 3 , 4 , to give a 7 % (wt / wt % ) solution . If more diethyl ether is 30 5 , 6 , 7 , 8 , 9 , 10 , 15 , 20 , 25 , 30 , 40 , or 50 minutes, or 1 , 2 , added , a two phase solution will result with a distinct diethyl 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 or more than 10 hours . In certain ether layer above the water . Other miscible materials include embodiments the thermal treatment occurs at two different ethers , dimethoxyethane , or tetrahydrofuran In contrast , an temperatures, such as 30 seconds in a 100 degree Celsius oil such as an alkane and water are immiscible and form two environment followed by 10 minutes in a 50 degree Celsius phases . Further, immiscible treatments are optionally com - 35 environment. In preferred embodiments the temperature and bined with a detergent, either an ionic detergent or a non - duration of the thermal treatment are sufficient to kill or ionic detergent. Exemplary detergents include Triton X - 100 , remove pathogenic materials while not substantially dam Tween 20 , Tween 80 , Nonidet P40 , a pluronic , or a polyol . aging or reducing the germination - competency of the Chromatography Treatments spores . To purify spore populations , the fecal materials are sub - 40 Irradiation Treatments jected to one or more chromatographic treatments , either Provided are methods of treating the fecal material or sequentially or in parallel. In a chromatographic treatment, separated contents of the fecal material with ionizing radia a solution containing the fecal material is contacted with a tion , typically gamma irradiation , ultraviolet irradiation or solid medium containing a hydrophobic interaction chro - electron beam irradiation provided at an energy level suffi matographic (HIC ) medium or an affinity chromatographic 45 cient to kill pathogenic materials while not substantially medium . In an alternative embodiment, a solid medium damaging the desired spore populations . For example , ultra capable of absorbing a residual habitat product present in the violet radiation at 254 nm provided at an energy level below fecal material is contacted with a solid medium that adsorbs about 22 , 000 microwatt seconds per cm² will not generally a residual habitat product. In certain embodiments , the HIC destroy desired spores . medium contains sepharose or a derivatized sepharose such 50 Centrifugation and Density Separation Treatments as butyl sepharose , octyl sepharose, phenyl sepharose , or Provided are methods of separating desired spore popu butyl- s sepharose . In other embodiments , the affinity chro - lations from the other components of the fecal material by matographic medium contains material derivatized with centrifugation . A solution containing the fecal material is mucin type I, II , III , IV , V , or VI, or oligosaccharides derived subjected to one or more centrifugation treatments , e . g . , at from or similar to those ofmucins type I , II , III , IV , V , or VI. 55 about 1000xg , 2000xg, 3000xg , 4000xg , 5000xg , 6000xg , Alternatively , the affinity chromatographic medium contains 7000xg , 8000xg or greater than 8000xg . Differential cen material derivatized with antibodies that recognize spore - trifugation separates desired spores from undesired non forming bacteria . spore material; at low forces the spores are retained in Mechanical Treatments solution , while at higher forces the spores are pelleted while Provided herein is the physical disruption of the fecal 60 smaller impurities (e . g. , virus particles, phage ) are retained material , particularly by one or more mechanical treatment in solution . For example , a first low force centrifugation such as blending , mixing , shaking, vortexing , impact pul- pellets fibrous materials ; a second , higher force centrifuga verization , and sonication . As provided herein , the mechani - tion pellets undesired eukaryotic cells , and a third , still cal disrupting treatment substantially disrupts a non - spore higher force centrifugation pellets the desired spores while material present in the fecal material and does not substan - 65 small contaminants remain in suspension . In some embodi tially disrupt a spore present in the fecal material. Mechani- ments density or mobility gradients or cushions ( e . g ., step cal treatments optionally include filtration treatments , where cushions ), such as Percoll, Ficoll, Nycodenz , Histodenz or US 9 ,855 ,303 B2 43 44 sucrose gradients , are used to separate desired spore popu - minerals include, without limitation : chloride, sodium , cal lations from other materials in the fecal material. cium , iron , chromium , copper , iodine , zinc, magnesium , Also provided herein are methods of producing spore manganese, molybdenum , phosphorus, potassium , and sele populations that combine two or more of the treatments nium . Suitable forms of any of the foregoing minerals described herein in order to synergistically purify the desired 5 include soluble mineral salts , slightly soluble mineral salts , spores while killing or removing undesired materials and /or insoluble mineral salts, chelated minerals , mineral com activities from the spore population . It is generally desirable plexes , non - reactive minerals such as carbonylminerals , and to retain the spore populations under non - germinating and non - growth promoting conditions and media , in order to reduced minerals , and combinations thereof. minimize the growth of pathogenic bacteria present in the 101 In certain embodiments , the composition comprises at spore populations and to minimize the germination of spores least one supplemental vitamin . The at least one vitamin can into vegetative bacterial cells . be fat - soluble or water soluble vitamins . Suitable vitamins Pharmaceutical Compositions and Formulations of the include but are not limited to vitamin C , vitamin A , vitamin Invention E , vitamin B12 , vitamin K , riboflavin , niacin , vitamin D , Formulations vitamin B6 , folic acid , pyridoxine , thiamine , pantothenic acid , and biotin . Suitable forms of any of the foregoing are andProvided other subjects are formulations in need thereof for administration Generally the to bacterialhumans salts of the vitamin , derivatives of the vitamin , compounds compositions are combined with additional active and /or having the same or similar activity of the vitamin , and inactive materials in order to produce a final product, which metabolites of the vitamin . may be in single dosage unit or in a multi- dose format. 20 In other embodiments , the composition comprises an In some embodiments , the composition comprises at least excipient. Non - limiting examples of suitable excipients one carbohydrate . A " carbohydrate ” refers to a sugar or include a buffering agent, a preservative , a stabilizer, a polymer of sugars . The terms " saccharide , " " polysaccha - binder, a compaction agent, a lubricant, a dispersion ride ," " carbohydrate ,” and “ oligosaccharide ” may be used enhancer, a disintegration agent, a flavoring agent, a sweet interchangeably. Most carbohydrates are aldehydes or 25 ener , and a coloring agent. ketones with many hydroxyl groups , usually one on each In another embodiment, the excipient is a buffering agent. carbon atom of the molecule . Carbohydrates generally have Non - limiting examples of suitable buffering agents include the molecular formula C , H , O , . A carbohydrate can be a sodium citrate , magnesium carbonate , magnesium bicarbon monosaccharide , a disaccharide , trisaccharide , oligosaccha - ate , calcium carbonate , and calcium bicarbonate . ride, or polysaccharide . The most basic carbohydrate is a 30 In some embodiments , the excipient comprises a preser monosaccharide , such as glucose, sucrose , galactose , man - vative. Non - limiting examples of suitable preservatives nose , ribose, arabinose , xylose , and fructose . Disaccharides include antioxidants , such as alpha - tocopherol and ascor are two joined monosaccharides . Exemplary disaccharides bate , and antimicrobials , such as parabens, chlorobutanol, include sucrose, maltose , cellobiose , and lactose . Typically , and phenol. an oligosaccharide includes between three and six mono - 35 In other embodiments , the composition comprises a saccharide units ( e. g ., raffinose , stachyose ), and polysaccha - binder as an excipient. Non - limiting examples of suitable rides include six or more monosaccharide units . Exemplary binders include starches , pregelatinized starches , gelatin , polysaccharides include starch , glycogen , and cellulose . polyvinylpyrolidone , cellulose , methylcellulose , sodium Carbohydrates can contain modified saccharide units , such carboxymethylcellulose , ethylcellulose , polyacrylamides , as 2' - deoxyribose wherein a hydroxyl group is removed , 40 polyvinyloxoazolidone, polyvinylalcohols , C12 -018 fatty 2 '- fluororibose wherein a hydroxyl group is replace with a acid alcohol, polyethylene glycol, polyols, saccharides , oli fluorine , or N - acetylglucosamine , a nitrogen - containing gosaccharides, and combinations thereof. form of glucose ( e . g . , 2 ' - fluororibose , deoxyribose , and In another embodiment, the composition comprises a hexose ). Carbohydrates can exist in many different forms, lubricant as an excipient. Non - limiting examples of suitable for example , conformers , cyclic forms, acyclic forms, ste - 45 lubricants include magnesium stearate , calcium stearate , reoisomers , tautomers , anomers, and isomers . zinc stearate , hydrogenated vegetable oils , sterotex , poly In some embodiments , the composition comprises at least oxyethylene monostearate , talc , polyethyleneglycol, sodium one lipid . As used herein , a “ lipid ” includes fats , oils , benzoate , sodium lauryl sulfate , magnesium lauryl sulfate , triglycerides, cholesterol, phospholipids , fatty acids in any and light mineral oil . form including free fatty acids . Fats , oils and fatty acids can 50 In other embodiments , the composition comprises a dis be saturated , unsaturated ( cis or trans ) or partially unsatu - persion enhancer as an excipient. Non - limiting examples of rated ( cis or trans ) . In some embodiments , the lipid com - suitable dispersants include starch , alginic acid , polyvi prises at least one fatty acid selected from lauric acid ( 12 : 0 ) , nylpyrrolidones , guar gum , kaolin , bentonite , purified wood myristic acid ( 14 : 0 ) , palmitic acid ( 16 : 0 ) , palmitoleic acid cellulose , sodium starch glycolate , isoamorphous silicate , ( 16 : 1 ) , margaric acid ( 17: 0 ), heptadecenoic acid ( 17 : 1 ), 55 and microcrystalline cellulose as high HLB emulsifier sur stearic acid ( 18 : 0 ), oleic acid ( 18 : 1 ) , linoleic acid ( 18 : 2 ) , factants . linolenic acid ( 18 : 3 ), octadecatetraenoic acid ( 18 : 4 ) , In some embodiments , the composition comprises a dis arachidic acid (20 :0 ) , eicosenoic acid (20 : 1 ), eicosadienoic integrant as an excipient. In other embodiments , the disin acid (20 : 2 ) , eicosatetraenoic acid (20 :4 ) , eicosapentaenoic tegrant is a non -effervescent disintegrant. Non - limiting acid (20 : 5 ) ( EPA ) , docosanoic acid ( 22 : 0 ) , docosenoic acid 60 examples of suitable non - effervescent disintegrants include ( 22 : 1 ) , docosapentaenoic acid (22 : 5 ) , docosahexaenoic acid starches such as corn starch , potato starch , pregelatinized ( 22 :6 ) (DHA ) , and tetracosanoic acid ( 24 : 0 ) . In other and modified starches thereof, sweeteners , clays, such as embodiments , the composition comprises at least one modi bentonite , micro -crystalline cellulose , alginates, sodium fied lipid , for example , a lipid that has been modified by starch glycolate , gums such as agar, guar , locust bean , cooking . 65 karaya , pecitin , and tragacanth . In another embodiment, the In some embodiments , the composition comprises at least disintegrant is an effervescent disintegrant. Non - limiting one supplemental mineral or mineral source . Examples of examples of suitable effervescent disintegrants include US 9 , 855 , 303 B2 45 46 sodium bicarbonate in combination with citric acid , and those formed from acrylic acid , methacrylic acid , methyl sodium bicarbonate in combination with tartaric acid . acrylate , ammonio methylacrylate , ethyl acrylate , methyl In another embodiment, the excipient comprises a flavor - methacrylate and /or ethyl methacrylate ( e . g ., those copoly ing agent. Flavoring agents can be chosen from synthetic mers sold under the trade name “ Eudragit " ) ; vinyl polymers flavor oils and flavoring aromatics ; natural oils ; extracts 5 and copolymers such as polyvinyl pyrrolidone , polyvinyl from plants , leaves, flowers , and fruits ; and combinations acetate , polyvinylacetate phthalate , vinylacetate crotonic thereof. In some embodiments the flavoring agent is selected acid copolymer, and ethylene- vinyl acetate copolymers ; and from cinnamon oils ; oil of wintergreen ; peppermint oils ; shellac ( purified lac ) . In yet other embodiments , at least one clover oil ; hay oil ; anise oil ; eucalyptus ; vanilla ; citrus oil polymer functions as taste -masking agents . such as lemon oil , orange oil , grape and grapefruit oil ; and 10 Tablets , pills , and the like can be compressed , multiply fruit essences including apple , peach , pear, strawberry , rasp - compressed , multiply layered , and / or coated . The coating berry , cherry , plum , pineapple , and apricot. can be single or multiple . In one embodiment , the coating In other embodiments , the excipient comprises a sweet - material comprises at least one of a saccharide , a polysac ener. Non - limiting examples of suitable sweeteners include charide , and glycoproteins extracted from at least one of a glucose ( corn syrup ) , dextrose , invert sugar, fructose , and 15 plant , a fungus , and a microbe . Non -limiting examples mixtures thereof (when not used as a carrier ) ; saccharin and include corn starch , wheat starch , potato starch , tapioca its various salts such as the sodium salt ; dipeptide sweeten - starch , cellulose , hemicellulose , dextrans , maltodextrin , ers such as aspartame ; dihydrochalcone compounds , glycyr - cyclodextrins, inulins , pectin , mannans , gum arabic , locust rhizin ; Stevia Rebaudiana ( Stevioside ) ; chloro derivatives of bean gum , mesquite gum , guar gum , gum karaya , gum sucrose such as sucralose ; and sugar alcohols such as 20 ghatti, tragacanth gum , funori, carrageenans , agar , alginates , sorbitol , mannitol, sylitol, and the like . Also contemplated chitosans , or gellan gum . In some embodiments the coating are hydrogenated starch hydrolysates and the synthetic material comprises a protein . In another embodiment, the sweetener 3 ,6 - dihydro - 6 -methyl - 1 , 2 , 3 -oxathiazin - 4 -one - 2 , coating material comprises at least one of a fat and an oil. In 2 - dioxide , particularly the potassium salt ( acesulfame- K ) , other embodiments , the at least one of a fat and an oil is high and sodium and calcium salts thereof. 25 temperature melting . In yet another embodiment, the at least In yet other embodiments , the composition comprises a one of a fat and an oil is hydrogenated or partially hydro coloring agent. Non - limiting examples of suitable color genated . In one embodiment, the at least one of a fat and an agents include food , drug and cosmetic colors (FD & C ) , drug oil is derived from a plant. In other embodiments , the at least and cosmetic colors ( D & C ) , and external drug and cosmetic one of a fat and an oil comprises at least one of glycerides , colors ( Ext. D & C ) . The coloring agents can be used as dyes 30 free fatty acids , and fatty acid esters . In some embodiments , or their corresponding lakes. the coating material comprises at least one edible wax . The The weight fraction of the excipient or combination of edible wax can be derived from animals , insects, or plants . excipients in the formulation is usually about 99 % or less , Non -limiting examples include beeswax , lanolin , bayberry such as about 95 % or less, about 90 % or less, about 85 % or wax , carnauba wax , and rice bran wax . Tablets and pills can less , about 80 % or less , about 75 % or less , about 70 % or 35 additionally be prepared with enteric coatings . less, about 65 % or less , about 60 % or less , about 55 % or Alternatively , powders or granules embodying the bacte less , 50 % or less , about 45 % or less, about 40 % or less , rial compositions disclosed herein can be incorporated into about 35 % or less , about 30 % or less , about 25 % or less , a food product. In some embodiments , the food product is a about 20 % or less, about 15 % or less , about 10 % or less, drink for oral administration . Non - limiting examples of a about 5 % or less, about 2 % or less, or about 1 % or less of 40 suitable drink include fruit juice , a fruit drink , an artificially the total weight of the composition . flavored drink , an artificially sweetened drink , a carbonated The bacterial compositions disclosed herein can be for - beverage , a sports drink , a liquid diary product, a shake, an mulated into a variety of forms and administered by a alcoholic beverage , a caffeinated beverage , infant formula number of different means. The compositions can be admin - and so forth . Other suitable means for oral administration istered orally , rectally , or parenterally , in formulations con - 45 include aqueous and nonaqueous solutions, emulsions, sus taining conventionally acceptable carriers , adjuvants , and pensions and solutions and / or suspensions reconstituted vehicles as desired . The term " parenteral ” as used herein from non - effervescent granules, containing at least one of includes subcutaneous, intravenous , intramuscular, or suitable solvents , preservatives , emulsifying agents , sus intrastemal injection and infusion techniques. In an exem pending agents , diluents , sweeteners , coloring agents, and plary embodiment, the bacterial composition is administered 50 flavoring agents . orally . In some embodiments , the food product can be a solid Solid dosage forms for oral administration include cap - foodstuff . Suitable examples of a solid foodstuff include sules , tablets , caplets , pills , troches , lozenges , powders , and without limitation a food bar, a snack bar, a cookie , a granules . A capsule typically comprises a core material brownie , a muffin , a cracker , an ice cream bar, a frozen comprising a bacterial composition and a shell wall that 55 yogurt bar , and the like . encapsulates the core material. In some embodiments , the In other embodiments, the compositions disclosed herein core material comprises at least one of a solid , a liquid , and are incorporated into a therapeutic food . In some embodi an emulsion . In other embodiments , the shell wall material ments, the therapeutic food is a ready - to -use food that comprises at least one of a soft gelatin , a hard gelatin , and optionally contains some or all essential macronutrients and a polymer. Suitable polymers include , but are not limited to : 60 micronutrients . In another embodiment, the compositions cellulosic polymers such as hydroxypropyl cellulose , disclosed herein are incorporated into a supplementary food hydroxyethyl cellulose , hydroxypropyl methyl cellulose that is designed to be blended into an existing meal . In one ( HPMC ) , methyl cellulose, ethyl cellulose , cellulose acetate , embodiment, the supplemental food contains some or all cellulose acetate phthalate , cellulose acetate trimellitate , essential macronutrients and micronutrients . In another hydroxypropylmethyl cellulose phthalate , hydroxypropylm - 65 embodiment, the bacterial compositions disclosed herein are ethyl cellulose succinate and carboxymethylcellulose blended with or added to an existing food to fortify the sodium ; acrylic acid polymers and copolymers , such as food 's protein nutrition . Examples include food staples US 9 , 855 , 303 B2 47 48 ( grain , salt , sugar , cooking oil, margarine ), beverages ( cof- g aliquots were weighed and placed into tubes and flash fee , tea , soda , beer, liquor , sports drinks ), snacks , sweets and frozen in a dry ice/ ethanol bath . Aliquots are frozen at - 80 other foods . degrees Celsius until use . In one embodiment, the formulations are filled into gela Optionally , the fecalmaterial was suspended in a solution , tin capsules for oral administration . An example of an 5 and /or fibrous and /or particulate materials were removed . A appropriate capsule is a 250 mg gelatin capsule containing frozen aliquot containing a known weight of feces was from 10 (up to 100 mg) of lyophilized powder ( 108 to 1011 removed from storage at - 80 degrees Celsius and allowed to bacteria ), 160 mg microcrystalline cellulose, 77 . 5 mg gela thaw at room temperature . Sterile 1xPBS was added to tin , and 2. 5 mg magnesium stearate . In an alternative create a 10 % w / v suspension , and vigorous vortexing was embodiment, from 10 % to 1012 bacteria may be used , 10 % to 10 performed to suspend the fecal material until the material 107, 10 to 10 % , or 108 to 1010 , with attendant adjustments of appeared homogeneous . The material was then left to sit for the excipients if necessary . In an alternative embodiment, an 10 minutes at room temperature to sediment fibrous and enteric - coated capsule or tablet or with a buffering or particulate matter . The suspension above the sediment was protective composition can be used . then carefully removed into a new tube and contains a 15 purified spore population . Optionally , the suspension was EXAMPLES then centrifuged at a low speed , e . g . , 1000xg, for 5 minutes to pellet particulate matter including fibers . The pellet was Below are examples of specific embodiments for carrying discarded and the supernatant , which contained vegetative out the present invention . The examples are offered for organisms and spores, was removed into a new tube . The illustrative purposes only , and are not intended to limit the zu20 supernatantS was then centrifuged at 6000xg for 10 minutes scope of the present invention in any way . Efforts have been to pellet the vegetative organisms and spores . The pellet was made to ensure accuracy with respect to numbers used ( e . g . , then resuspended in 1xPBS with vigorous vortexing until amounts , temperatures, etc . ) , but some experimental error the material appears homogenous. and deviation should , of course, be allowed for. The practice of the present invention will employ, unless 25 Example 2 . Spore Purification from Alcohol otherwise indicated , conventional methods of protein chem Treatment of Fecal Material istry , biochemistry , recombinant DNA techniques and phar macology , within the skill of the art . Such techniques are A 10 % w / v suspension of human fecal material in PBS explained fully in the literature . See , e . g . , T . E . Creighton , was mixed with absolute ethanol in a 1 : 1 ratio and vortexed Proteins: Structures and Molecular Properties (W . H . Free - 30 to mix for 1 minute . The suspension was incubated at 37 man and Company , 1993 ) ; A . L . Lehninger , Biochemistry degrees Celsius for 1 hour. After incubation the suspension (Worth Publishers , Inc. , current addition ); Sambrook , et al. , was centrifuged at 13 ,000 rpm for 5 minutes to pellet spores. Molecular Cloning : A Laboratory Manual (2nd Edition , The supernatant was discarded and the pellet was resus 1989 ) ; Methods In Enzymology ( S . Colowick and N . Kaplan pended in an equal volume of PBS . Glycerol was added to eds. , Academic Press , Inc. ); Remington 's Pharmaceutical 35 a final concentration of 15 % and then the purified spore Sciences , 18th Edition1on ((Easton ,, PaPa . : Mack Publishing Com - fraction is stored at - 80 degrees Celsius . pany, 1990 ) ; Carey and Sundberg Advanced Organic Chem istry 3ra Ed . ( Plenum Press ) Vols A and B ( 1992 ) . Example 2A . Generation of a Spore Preparation from Alcohol Treatment of Fecal Material Example 1 . Provision of Fecal Material 40 A 10 % w / v suspension of human fecal material in PBS Fresh fecal samples were obtained from healthy human was mixed with absolute ethanol in a 1 : 1 ratio and vortexed donors who have been screened for general good health and to mix for 1 minute . The suspension was incubated at 37 for the absence of infectious diseases , and meet inclusion degrees Celsius for 1 hour. After incubation the suspension and exclusion criteria , inclusion criteria include being in 45 is centrifuged at 13 ,000 rpm for 5 minutes to concentrate good general health , without significant medical history, spores into a pellet containing a purified sprore -containing physical examination findings , or clinical laboratory abnor preparation . The supernatant was discarded and the pellet malities , regular bowel movements with stool appearance resuspended in an equal volume ofPBS . Glycerolwas added typically Type 2 , 3 , 4 , 5 or 6 on the Bristol Stool Scale , and to a final concentration of 15 % and then the purified spore having a BMI 18 kg / m “ and 25 kg / m “ . Exclusion criteria 50 preparation was stored at - 80 degrees Celsius. generally included significant chronic or acute medical conditions including renal, hepatic , pulmonary , gastrointes Example 3 . Spore Purification from Thermal tinal, cardiovascular , genitourinary , endocrine, immuno Treatment of Fecal Material logic , metabolic , neurologic or hematological disease , a family history of, inflammatory bowel disease including 55 A 10 % w / v suspension of human fecal material in PBS Crohn ' s disease and ulcerative colitis , Irritable bowel syn was incubated in a water bath at 80 degrees Celsius for 30 drome, colon , stomach or other gastrointestinal malignan - minutes. Glycerol was added to a final concentration of 15 % cies , or gastrointestinal polyposis syndromes , or recent use and then the enriched spore containing material was stored of yogurt or commercial probiotic materials in which an at - 80 degrees Celsius . organism ( s ) is a primary component. Samples were col- 60 lected directly using a commode specimen collection sys Example 4 . Spore Purification from Alcohol tem , which contains a plastic support placed on the toilet Treatment and Thermal Treatment of Fecal Material seat and a collection container that rests on the support . Feces were deposited into the container , and the lid was then A 10 % w / v suspension of human feces in PBS was mixed placed on the container and sealed tightly . The sample was 65 with absolute ethanol in a 1 : 1 ratio and vortexed to mix for then delivered on ice within 1 - 4 hours for processing . 1 minute . The suspension was incubated in a water bath Samples were mixed with a sterile disposable tool , and 2 - 4 under aerobic conditions at 37 degrees Celsius for 1 hour. US 9 ,855 ,303 B2 49 50 After incubation the suspension was centrifuged at 13 ,000 lation . The ability to germinate into vegetative bacteria is rpm for 5 minutes to pellet spores. The supernatant was also demonstrated . Visual counts are determined by phase discarded and the pellet was resuspended in equal volume contrast microscopy. A spore preparation is either diluted in PBS. The ethanol treated spore population was then incu PBS or concentrated by centrifugation , and a 5 microliter bated in a water bath at 80 degrees Celsius for 30 minutes. 5 aliquot is placed into a Petroff Hauser counting chamber for Glycerol was added to a final concentration of 15 % and the visualization at 400x magnification . Spores are counted purified spore fraction was stored at - 80 C . within ten 0 .05 mmx0 .05 mm grids and an average spore count per grid is determined and used to calculate a spore Example 5 . Spore Purification from Detergent count per ml of preparation . Lipopolysaccharide (LPS ) 10 reduction in purified spore populations is measured using a Treatment of Fecal Material Limulus amebocyte lysate (LAL ) assay such as the com A 10 % w / v suspension ofhuman feces in PBS is prepared mercially available ToxinSensorTM Chromogenic LAL to contain a final concentration of 0 . 5 to 2 % Triton X - 100 . Endotoxin Assay Kit (GenScript , Piscataway , N . J . ) or other After shaking incubation for 30 minutes at 25 to 37 degrees standard methods known to those skilled in the art . Celsius , the sample is centrifuged at 1000 g for 5 - 10 minutes 15 to pellet particulate matter and large cells . The bacterial Example 9 . Determination of Bacterial Pathogens spores are recovered in the supernatant fraction , where the in Purified Spore Populations purified spore population is optionally further treated , such as in Example 4 . Without being bound by theory , detergent Bacterial pathogens present in a purified spore population addition to the fecal mixture produces better spore popula - 2020 are determined by qPCR using specific oligonucleotide tions, at least in part by enhancing separation of the spores primers as follows. from particulates thereby resulting in higher yields of Standard Curve Preparation . The standard curve is gen spores . erated from wells containing the pathogen of interest at a known concentration or simultaneously quantified by selec Example 6 . Spore Purification by Chromatographic 25 tive spot plating . Serial dilutions of duplicate cultures are Separation of Fecal Material performed in sterile phosphate -buffered saline . Genomic DNA is then extracted from the standard curve samples A spore - enriched population such as obtained from along with the other samples . Examples 1 - 5 above , is mixed with NaCl to a final concen - Genomic DNA Extraction . tration of 4M total salt and contacted with octyl Sepharose 30 Genomic DNA may be extracted from 100 ul of fecal 4 Fast Flow to bind the hydrophobic spore fraction . The samples, fecal- derived samples , or purified spore prepara resin is washed with 4M NaCl to remove less hydrophobic tions using the Mo Bio Powersoil® - htp 96 Well Soil DNA components , and the spores are eluted with distilled water , Isolation Kit (Mo Bio Laboratories, Carlsbad , Calif. ) and the desired enriched spore fraction is collected via UV according to the manufacturer' s instructions with two excep absorbance . 35 tions: the beadbeating is performed for 2x4 :40 minutes using a BioSpec Mini- Beadbeater- 96 (BioSpec Products , Example 7 . Spore Purification by Filtration of Bartlesville , Okla . ) and the DNA is eluted in 50 ul of Fecal Material Solution C6 . Alternatively the genomic DNA could be isolated using the Mo Bio Powersoil® DNA Isolation Kit A spore -enriched population such as obtained from 40 (Mo Bio Laboratories , Carlsbad , Calif .) , the Sigma- Aldrich Examples 1 - 6 above is diluted 1 : 10 with PBS , and placed in Extract - N - AmpTM Plant PCR Kit, the QIAamp DNA Stool the reservoir vessel of a tangential flow microfiltration Mini Kit (QIAGEN , Valencia , Calif . ) according to the system . A 0 . 2 urn pore size mixed cellulose ester hydrophilic manufacturer ' s instructions . tangential flow filter is connected to the reservoir such as by [ qPCR Composition and Conditions. a tubing loop . The diluted spore preparation is recirculated 45 The qPCR reaction to detect C . difficile contains 1x through the loop by pumping, and the pressure gradient HotMasterMix (5PRIME , Gaithersburg , Md. ) , 900 nM of across the walls of the microfilter forces the supernatant Wr- tcdB - F ( AGCAGTTGAATATAGTGGTTTAGTTA liquid through the filter pores . By appropriate selection of GAGTTG , (SEQ ID NO : 2040 ) IDT, Coralville , Iowa ) , 900 the filter pore size the desired bacterial spores are retained , nM of Wr- tcdB - R (CATGCTTTTTTAGTTTCTGGATT while smaller contaminants such as cellular debris , and other 50 GAA , (SEQ ID NO : 2041 ) IDT, Coralville, Iowa ) , 250 nM contaminants in feces such as bacteriophage pass through of We- tcdB - P (6FAM -CATCCAGTCTCAATTGTATAT the filter . Fresh PBS buffer is added to the reservoir peri - GTTTCTCCA -MGB (SEQ ID NO : 2042 ) , Life Technolo odically to enhance the washout of the contaminants . At the gies, Grand Island , N . Y . ) , and PCR Water (Mo Bio Labo end of the diafiltration , the spores are concentrated approxi ratories, Carlsbad , Calif. ) to 18 ul ( Primers adapted from : mately ten - fold to the original concentration . The purified 55 Wroblewski , D . et al. Rapid Molecular Characterization of spores are collected from the reservoir and stored as pro Clostridium difficile and Assessment of Populations of C . vided herein . difficile in Stool Specimens . Journal of Clinical Microbiol ogy 47: 2142 -2148 (2009 )) . This reaction mixture is ali Example 8 . Characterization of Purified Spore quoted to wells of a MicroAmp® Fast Optical 96 -well Populations 60 Reaction Plate with Barcode ( 0 . 1 mL ) (Life Technologies , Grand Island , N . Y . ) . To this reaction mixture, 2 ul of Counts of viable spores are determined by performing 10 extracted genomic DNA is added . The qPCR is performed fold serial dilutions in PBS and plating to Brucella Blood on a BioRad C1000TM Thermal Cycler equipped with a Agar Petri plates or applicable solid media . Plates are CFX96TM Real- Time System (BioRad , Hercules , Calif. ) . incubated at 37 degrees Celsius for 2 days . Colonies are 65 The thermocycling conditions are 95° C . for 2 minutes counted from a dilution plate with 50 -400 colonies and used followed by 45 cycles of 95° C . for 3 seconds, 60° C . for 30 to back - calculate the number of viable spores in the popu seconds, and fluorescent readings of the FAM and ROX US 9 ,855 ,303 B2 51 channels . Other bacterial pathogens can be detected by using region of the 16S sequence, genomic DNA is extracted from primers and a probe specific for the pathogen of interest . a bacterial sample , the 16S rDNA ( full region or specific Data Analysis . hypervariable regions ) amplified using polymerase chain The Cg value for each well on the FAM channel is reaction ( PCR ) , the PCR products cleaned , and nucleotide determined by the CFX ManagerTM Software Version 2 . 1 . 5 sequences delineated to determine the genetic composition The log 10 ( cfu /ml ) of each experimental sample is calcu - of 16S gene or subdomain of the gene . If full 16S sequencing lated by inputting a given sample ' s Cq value into linear is performed , the sequencing method used may be, but is not regression model generated from the standard curve com - limited to , Sanger sequencing . If one or more hypervariable paring the Cq values of the standard curve wells to the regions are used , such as the V4 region , the sequencing may known log 10 (cfu /ml ) of those samples. 10 be, but is not limited to being, performed using the Sanger Viral pathogens present in a purified spore population are method or using a next - generation sequencing method , such determined by qPCR as described herein and otherwise as an Illumina (sequencing by synthesis ) method using barcoded primers allowing for multiplex reactions. known in the art . In addition to the 16S rRNA gene , one may define an OTU Example 10 : Species Identification 15 by sequencing a selected set of genes that are known to be marker genes for a given species or taxonomic group of The identity of the spore - forming species which grew up OTUs. These genes may alternatively be assayed using a from a complex fraction can be determined in multiple ways. PCR -based screening strategy . As example , various strains First, individual colonies can be picked into liquid media in of pathogenic Escherichia coli can be distinguished using a 96 well format, grown up and saved as 15 % glycerol stocks 20 DNAs from the genes that encode heat- labile ( LTI, LTIIa , at - 80 C . Aliquots of the cultures can be placed into cell lysis and LTIIb ) and heat -stable (STI and STII ) toxins, verotoxin buffer and colony PCR methods can be used to amplify and types 1 , 2 , and 2e (VT1 , VT2 , and VT2e , respectively ) , sequence the 16S rDNA gene (Example 2 ). Alternatively , cytotoxic necrotizing factors ( CNF1 and CNF2 ), attaching colonies may be streaked to purity in several passages on and effacing mechanisms (eaeA ) , enteroaggregative mecha solid media . Well separated colonies are streaked onto the 25 nisms (Eagg ) , and enteroinvasive mechanisms ( Einv ) . The fresh plates of the same kind and incubated for 48 -72 hours optimal genes to utilize for taxonomic assignment of OTUS at 37 C . The process is repeated multiple times in order to by use of marker genes will be familiar to one with ordinary ensure purity . Pure cultures can be analyzed by phenotypic skill of the art of sequence based taxonomic identification . or sequence -based methods, including 16S rDNA amplifi - Genomic DNA Extraction cation and sequencing as described in Examples 11 & 12 . 30 Genomic DNA is extracted from pure microbial cultures Sequence characterization of pure isolates or mixed com - using a hot alkaline lysis method . 1 ul of microbial culture munities e . g . plate scrapes and spore fractions can also is added to 9 ul of Lysis Buffer (25 mM NaOH , 0 . 2 mm include whole genome shotgun sequencing . The latter is EDTA ) and the mixture is incubated at 95° C . for 30 valuable to determine the presence of genes associated with minutes. Subsequently , the samples are cooled to 4° C . and sporulation , antibiotic resistance , pathogenicity , and viru - 35 neutralized by the addition of 10 ul of Neutralization Buffer lence . Colonies can also be scraped from plates en masse (40 mM Tris -HCl ) and then diluted 10 - fold in Elution Buffer and sequenced using a massively parallel sequencing ( 10 mM Tris -HCl ) . Alternatively , genomic DNA is extracted method as described in Examples 11 & 12 such that indi- from pure microbial cultures using commercially available vidual 16S signatures can be identified in a complex mix - kits such as the Mo Bio Ultraclean® Microbial DNA Iso ture . Optionally , the sample can be sequenced prior to 40 lation Kit (Mo Bio Laboratories , Carlsbad , Calif. ) or by germination (if appropriate DNA isolation procedures are standard methods known to those skilled in the art . used to Isye and release the DNA from spores ) in order to Amplification of 16S Sequences for Downstream Sanger compare the diversity of germinable species with the total Sequencing number of species in a spore sample . As an alternative or To amplify bacterial 16S rDNA (FIG . 1A ) , 2 ul of complementary approach to 16S analysis , MALDI- TOF - 45 extracted gDNA is added to a 20 ul final volume PCR mass spec can also be used for species identification ( as reaction . For full - length 16 sequencing the PCR reaction reviewed in Anaerobe 22 : 123 ). also contains 1x HotMasterMix (5PRIME , Gaithersburg . Md. ) , 250 nM of 27f ( AGRGTTTGATCMTGGCTCAG Example 11: 16s Sequencing to Determine (SEQ ID NO : 2033 ) , IDT, Coralville , Iowa) , and 250 nM of Operational Taxonomic Unit (OTU ) 50 1492r ( TACGGYTACCTTGTTAYGACTT (SEQ ID NO : 2034 ) , IDT, Coralville , Iowa) , with PCR Water (Mo Bio Method for Determining 16S Sequence Laboratories, Carlsbad , Calif . ) for the balance of the vol OTUs may be defined either by full 16S sequencing of the ume. Alternatively , other universal bacterial primers or rRNA gene , by sequencing of a specific hypervariable thermostable polymerases known to those skilled in the art region of this gene ( i. e . V1, V2 , V3 , V4 , V5 , V6 , V7 , V8 , or 55 are used . For example primers are available to those skilled V9 ) , or by sequencing of any combination of hypervariable in the art for the sequencing of the the “ V1 -V9 regions” of regions from this gene ( e . g . V1 - 3 or V3 - 5 ) . The bacterial the 16S rRNA ( FIG . 1A ) . These regions refer to the first 16S rDNA is approximately 1500 nucleotides in length and through ninth hypervariable regions of the 16S rRNA gene is used in reconstructing the evolutionary relationships and that are used for genetic typing of bacterial samples . These sequence similarity of one bacterial isolate to another using 60 regions in bacteria are defined by nucleotides 69 - 99 , 137 phylogenetic approaches . 16S sequences are used for phy - 242 , 433 - 497 , 576 -682 , 822 - 879, 986 - 1043 , 1117 - 1173 , logenetic reconstruction as they are in general highly con - 1243 - 1294 and 1435 - 1465 respectively using numbering served , but contain specific hypervariable regions that har based on the E . coli system of nomenclature . Brosius et al. , bor sufficient nucleotide diversity to differentiate genera and Complete nucleotide sequence of a 16S ribosomal RNA species of most microbes . 65 gene from Escherichia coli , PNAS 75 ( 10 ) : 4801 - 4805 Using well known techniques , in order to determine the ( 1978 ) . In some embodiments , at least one of the V1, V2 , full 16S sequence or the sequence of any hypervariable V3 , V4 , V5 , V6 , V7 , V8 , and V9 regions are used to US 9 , 855 , 303 B2 53 54 characterize an OTU . In one embodiment, the V1 , V2 , and products are mixed with 25 pmol of sequencing primer and V3 regions are used to characterize an OTU . In another Mo Bio Molecular Biology Grade Water (Mo Bio Labora embodiment, the V3 , V4 , and V5 regions are used to tories, Carlsbad , Calif .) to 15 ul total volume. This reaction characterize an OTU . In another embodiment, the V4 region is submitted to a commercial sequencing organization such is used to characterize an OTU . A person of ordinary skill in 5 as Genewiz (South Plainfield , N . J. ) for Sanger sequencing . the art can identify the specific hypervariable regions of a Massively Parallel Sequencing of Target Amplicons from candidate 16S rRNA ( in FIG . 1A ) by comparing the candi- Heterogeneous Samples date sequence in question to the reference sequence ( FIG . DNA Quantification & Library Construction . 1B ) and identifying the hypervariable regions based on The cleaned PCR amplification products are quantified similarity to the reference hypervariable regions. 10 using the Quant- iTTM PicoGreen® dsDNA Assay Kit ( Life The PCR is performed on commercially available ther - Technologies , Grand Island , N . Y . ) according to the manu mocyclers such as a BioRad MyCyclerTM Thermal Cycler facturer ' s instructions . Following quantification , the bar (BioRad , Hercules, Calif. ) . The reactions are run at 94° C . coded cleaned PCR products are combined such that each for 2 minutes followed by 30 cycles of 94° C . for 30 distinct PCR product is at an equimolar ratio to create a seconds , 51° C . for 30 seconds, and 68° C . for 1 minute 30 15 prepared Illumina library . seconds, followed by a 7 minute extension at 72° C . and an Nucleic Acid Detection . indefinite hold at 4° C . Following PCR , gel electrophoresis The prepared library is sequenced on Illumina HiSeq or of a portion of the reaction products is used to confirm MiSeq sequencers ( Illumina , San Diego , Calif. ) with cluster successful amplification of a - 1 . 5 kb product. generation , template hybridization , iso - thermal amplifica To remove nucleotides and oligonucleotides from the 20 tion , linearization , blocking and denaturization and hybrid PCR products , 2 ul of HT ExoSap - IT (Affymetrix , Santa ization of the sequencing primers performed according to Clara , Calif . ) is added to 5 ul of PCR product followed by the manufacturer ' s instructions . 16SV4SeqFw ( TATGG a 15 minute incubation at 37° C . and then a 15 minute TAATTGTGTGCCAGCMGCCGCGGTAA ( SEQ ID NO : inactivation at 80° C . 2038 ) ), 16SV4SeqRev ( AGTCAGTCAGCCGGAC Amplification of 16S Sequences for Downstream Char - 25 TACHVGGGTWTCTAAT (SEQ ID NO : 2037 ) ) , and acterization by Massively Parallel Sequencing Technologies 16SV4Index (ATTAGAWACCCBDGTAGTCCGGCT Amplification performed for downstream sequencing by GACTGACT (SEQ ID NO : 2039 ) ) ( IDT, Coralville , Iowa ) short read technologies such as Illumina require amplifica - are used for sequencing . Other sequencing technologies can tion using primers known to those skilled in the art that be used such as but not limited to 454 , Pacific Biosciences , additionally include a sequence -based barcoded tag. As 30 Helicos, Ion Torrent, and Nanopore using protocols that are example, to amplify the 16s hypervariable region V4 region standard to someone skilled in the art of genomic sequenc of bacterial 16S rDNA , 2 ul of extracted gDNA is added to ing. a 20 ul final volume PCR reaction . The PCR reaction also contains 1x HotMasterMix (5PRIME , Gaithersburg , Md. ), Example 12 : Sequence Read Annotation 200 nM of V4 _ 515f_ adapt (AATGATACGGCGACCAC - 35 CGAGATCTACACTATGGTAATTGTGTGCCAGC Primary Read Annotation MGCC GCGGTAA (SEQ ID NO : 2035 ) , IDT, Coralville , Nucleic acid sequences are analyzed and annotations are Iowa) , and 200 nM of barcoded 806rbc (CAAGCA to define taxonomic assignments using sequence similarity GAAGACGGCATACGAGAT (SEQ ID NO : and phylogenetic placement methods or a combination of 2036 ) 12bpGolayBarcode AGTCAGTCAGCCGGAC - 40 the two strategies . A similar approach can be used to TACHVGGGTWTCTAAT ( SEQ ID NO : 2037 ) , IDT, Cor- annotate protein names, transcription factor names, and any alville , Iowa) , with PCR Water (Mo Bio Laboratories , other classification schema for nucleic acid sequences . Carlsbad , Calif. ) for the balance of the volume. These Sequence similarity based methods include those familiar to primers incorporate barcoded adapters for Illumina sequenc - individuals skilled in the art including , but not limited to ing by synthesis . Optionally , identical replicate , triplicate , or 45 BLAST, BLASTX , BLASTn , tBLASTX , RDP - classifier, quadruplicate reactions may be performed . Alternatively DNAclust , and various implementations of these algorithms other universal bacterial primers or thermostable poly such as Qiime or Mothur. These methods rely on mapping a merases known to those skilled in the art are used to obtain sequence read to a reference database and selecting the different amplification and sequencing error rates as well as match with the best score and e - value . Common databases results on alternative sequencing technologies . 50 include , but are not limited to the Human Microbiome The PCR amplification is performed on commercially Project, NCBI non - redundant database , Greengenes , RDP, available thermocyclers such as a BioRad MyCyclerTM and Silva . Phylogenetic methods can be used in combination Thermal Cycler (BioRad , Hercules , Calif. ) . The reactions with sequence similarity methods to improve the calling are run at 94° C . for 3 minutes followed by 25 cycles of 94° accuracy of an annotation or taxonomic assignment . Here C . for 45 seconds, 50° C . for 1 minute , and 72° C . for 1 55 tree topologies and nodal structure are used to refine the minute 30 seconds , followed by a 10 minute extension at 72° resolution of the analysis . In this approach we analyze C . and a indefinite hold at 4° C . Following PCR , gel nucleic acid sequences using one of numerous sequence electrophoresis of a portion of the reaction products is used similarity approaches and leverage phylogenetic methods to confirm successful amplification of a ~ 1 . 5 kb product that are well known to those skilled in the art, including but PCR cleanup is performed as specified in the previous 60 not limited to maximum likelihood phylogenetic reconstruc example . tion ( see e . g . Liu K , Linder C R , and Warnow T . 2011 . Sanger Sequencing of Target Amplicons from Pure RAXML and FastTree : Comparing Two Methods for Large Homogeneous Samples Scale Maximum Likelihood Phylogeny Estimation . PLoS To detect nucleic acids for each sample , two sequencing ONE 6 : e27731. McGuire G , Denham MC, and Balding D reactions are performed to generate a forward and reverse 65 J . 2001. Models of sequence evolution for DNA sequences sequencing read . For full -length 16s sequencing primers 27f containing gaps. Mol. Biol. Evol 18 : 481- 490 . Wróbel B . and 1492r are used . 40 ng of ExoSap - IT -cleaned PCR 2008 . Statistical measures of uncertainty for branches in US 9 ,855 ,303 B2 55 56 phylogenetic trees inferred from molecular sequences by (e .g ., cholate and taurocholate ), metal cations ( e. g ., Mg2 + , using model- based methods . J. Appl. Genet . 49 : 49 -67 .) Ca2 + ), fatty acids, and long -chain alkyl amines ( e . g ., Sequence reads are placed into a reference phylogeny com - dodecylamine , Germination of bacterial spores with alkyl prised of appropriate reference sequences. Annotations are primary amines” J. Bacteriology , 1961. ) . Mixtures of these made based on the placement of the read in the phylogenetic 5 or more complex natural mixtures , such as rumen fluid or tree . The certainty or significance of the OTU annotation is Oxgall , can be used to induce germination . Oxgall is dehy defined based on the OTU ' s sequence similarity to a refer - drated bovine bile composed of fatty acids , bile acids , ence nucleic acid sequence and the proximity of the OTU inorganic salts, sulfates, bile pigments , cholesterol, mucin , sequence relative to one or more reference sequences in the lecithin , glycuronic acids, porphyrins, and urea . The germi phylogeny . As an example, the specificity of a taxonomic 10 nation can also be performed in a growth medium like assignment is defined with confidence at the the level of prereduced BHIS / oxgall germination medium , in which Family , Genus, Species, or Strain with the confidence deter- BHIS (Brain heart infusion powder (37 g / L ) , yeast extract ( 5 mined based on the position of bootstrap supported branches g / L ) , L -cysteine HCl ( 1 g / L ) ) provides peptides, amino in the reference phylogenetic tree relative to the placement acids, inorganic ions and sugars in the complex BHI and of the OTU sequence being interrogated . 15 yeast extract mixtures and Oxgall provides additional bile Clade Assignments acid germinants . The ability of 16S - V4 OTU identification to assign an In addition , pressure may be used to germinate spores . OTU as a specific species depends in part on the resolving The selection of germinants can vary with the microbe being power of the 16S -V4 region of the 16S gene for a particular sought. Different species require different germinants and species or group of species . Both the density of available 20 different isolates of the same species can require different reference 16S sequences for different regions of the tree as germinants for optimal germination . Finally , it is important well as the inherent variability in the 16S gene between to dilute the mixture prior to plating because some germi different species will determine the definitiveness of a nants are inhibitory to growth of the vegetative -state micro taxonomic annotation . Given the topological nature of a organisms. For instance , it has been shown that alkyl amines phylogenetic tree and the fact that tree represents hierarchi - 25 must be neutralized with anionic lipophiles in order to cal relationships of OTUS to one another based on their promote optimal growth . Bile acids can also inhibit growth sequence similarity and an underlying evolutionary model, of some organisms despite promoting their germination , and taxonomic annotations of a read can be rolled up to a higher must be diluted away prior to plating for viable cells . level using a clade -based assignment procedure ( Table 1 ) . For example, BHIS / oxgall solution is used as a germinant Using this approach , clades are defined based on the topol- 30 and contains 0 .5xBHIS medium with 0 . 25 % oxgall ( dehy ogy of a phylogenetic tree that is constructed from full - drated bovine bile ) where 1xBHIS medium contains the length 16S sequences using maximum likelihood or other following per L of solution : 6 g Brain Heart Infusion from phylogenetic models familiar to individuals with ordinary solids, 7 g peptic digest of animal tissue, 14 .5 g of pancreatic skill in the art of phylogenetics . Clades are constructed to digest of casein , 5 g of yeast extract, 5 g sodium chloride, 2 ensure that all OTUs in a given clade are : ( i ) within a 35 g glucose , 2 . 5 g disodium phosphate , and 1 g cysteine . specified number of bootstrap supported nodes from one Additionally , Ca -DPA is a germinant and contains 40 mM another ( generally , 1 - 5 bootstraps ) , and ( ii ) within a 5 % CaC12 , and 40 mM dipicolinic acid (DPA ) . Rumen fluid (Bar genetic similarity . OTUs that are within the same clade can Diamond , Inc . ) is also a germinant. Simulated gastric fluid be distinguished as genetically and phylogenetically distinct ( Ricca Chemical) is a germinant and is 0 . 2 % ( w / v ) Sodium from OTUs in a different clade based on 16S - V4 sequence 40 Chloride in 0 . 7 % ( v / v ) Hydrochloric Acid . Mucin medium is data . OTUs falling within the same clade are evolutionarily a germinant and prepared by adding the following items to closely related and may or may not be distinguishable from 1 L of distilled sterile water: 0 . 4 g KH2PO4, 0 .53 g one another using 16S -V4 sequence data . The power of Na2HPO4, 0 . 3 g NH _ C1, 0 . 3 g NaC1, 0 . 1 g MgCl, x6H , O , clade based analysis is that members of the same clade , due 0 . 11 g CaCl2, 1 ml alkaline trace element solution , 1 ml acid to their evolutionary relatedness , are likely to play similar 45 trace element solution , 1 ml vitamin solution , 0 . 5 mg resa functional roles in a microbial ecology such as that found in Zurin , 4 g NaHCO3, 0 . 25 g Na, Sx9 H , O . The trace element the human gut. Compositions substituting one species with and vitamin solutions prepared as described previously another from the same clade are likely to have conserved (Stams et al. , 1993 ) . All compounds were autoclaved , except ecological function and therefore are useful in the present the vitamins, which were filter -sterilized . The basal medium invention . 50 was supplemented with 0 . 7 % ( v / v ) clarified , sterile rumen Notably , 16S sequences of isolates of a given OTU are fluid and 0 .25 % ( v / v ) commercial hog gastric mucin ( Type phylogenetically placed within their respective clades , III; Sigma ), purified by ethanol precipitation as described sometimes in conflict with the microbiological- based previously (Miller & Hoskins , 1981 ) . This medium is assignment of species and genus that may have preceded referred herein as mucin medium . 16S - based assignment. Discrepancies between taxonomic 55 Fetal Bovine Serum (Gibco ) can be used as a germinant assignment based on microbiological characteristics versus and contains 5 % FBS heat inactivated , in Phosphate Buff genetic sequencing are known to exist from the literature . ered Saline (PBS , Fisher Scientific ) containing 0 . 137M Sodium Chloride , 0 .0027M Potassium Chloride , 0 .0119M Example 13 : Germinating Spores Phosphate Buffer . Thioglycollate is a germinant as described 60 previously (Kamiya et al Journal of Medical Microbiology Germinating a spore fraction increases the number of 1989 ) and contains 0 .25M (PH10 ) sodium thioglycollate . viable spores that will grow on various media types . To Dodecylamine solution containing 1 mM dodecylamine in germinate a population of spores , the sample is moved to the PBS is a germinant. A sugar solution can be used as a anaerobic chamber , resuspended in prereduced PBS , mixed germinant and contains 0 . 2 % fructose , 0 . 2 % glucose , and and incubated for 1 hour at 37 C to allow for germination . 65 0 . 2 % mannitol. Amino acid solution can also be used as a Germinants can include amino -acids ( e .g . , alanine , glycine ) , germinant and contains 5 mM alanine, 1 mM arginine , 1 mM sugars ( e . g . , fructose ), nucleosides ( e . g ., inosine ), bile salts histidine , 1 mM lysine, 1 mM proline , 1 mM asparagine, 1 US 9 , 855 ,303 B2 57 58 mM aspartic acid , 1 mM phenylalanine. A germinant mix Infusion powder (Remel ) , 5 g yeast extract, 2 .2 g meat ture referred to herein as Germix 3 can be a germinant and extract , 1 . 2 g liver extract, 1 g cystein HC1, 0 . 3 g contains 5 mM alanine , 1 mM arginine , 1 mM histidine , 1 sodium thioglycolate , 10 mg hemin , 2 g soluble starch , mM lysine, 1 mM proline , 1 mM asparagine , 1 mM aspartic 2 g FOS / Inulin , 1 g cellobiose, 1 g L -arabinose , 1 g acid , 1 mM phenylalanine, 0 . 2 % taurocholate , 0 . 2 % fruc - 5 mannitol, 1 Na- lactate , 1 mL Tween 80 , 0 . 6 g MgSO4x tose , 0 . 2 % mannitol, 0 . 2 % glucose , 1 mM inosine , 2 . 5 mm 7H20 , 0 .6 g CaC12 , 6 g ( NH4) 2SO4 , 3 g KH2PO4 , 0 .5 Ca -DPA , and 5 mM KC1. BHIS medium + DPA is a germi g K2HPO4 , 33 mM Acetic acid , 9 mM propionic acid , nant mixture and contains BHIS medium and 2 mM Ca 1 mM Isobutyric acid , 1 mM isovaleric acid , 15 g agar, DPA . Escherichia coli spent medium supernatant referred to and after autoclaving add 50 mL of 8 % NaHCO , herein as EcSN is a germinant and is prepared by growing 10 solution and 50 mL 1M MOPS -KOH (pH 7 ) . E . coli MG1655 in SweetB /Fos inulin medium anaerobically Noack - Blaut Eubacterium agar ( See Noack et al . J . Nutr . for 48 hr, spinning down cells at 20 , 000 rcf for 20 minutes, ( 1998 ) 128 : 1385 - 1391 ) collecting the supernatant and heating to 60 C for 40 min . BHIS azl/ ge2 — BHIS az/ ge agar (Reeves et . al. Infect . Finally , the solution is filter sterilized and used as a germi Immun . 80 :3786 - 3794 (2012 ) ) [Brain Heart Infusion nant solution . 15 agar ( Atlas, Handbook of Microbiological Media , 4th ed , ASM Press , 2010 ) supplemented with yeast extract Example 14: Selection of Media for Growth 0 . 5 % , cysteine 0 . 1 % , 0 . 1 % cellobiose, 0 . 1 % inulin , 0 . 1 % maltose , aztreonam 1 mg/ L , gentamycin 2 mg/ L ] It is important to select appropriate media to support BHIS CINM azl / ge2 — BHIS CINM [Brain Heart Infusion growth , including preferred carbon sources . For example , 20 agar (Atlas , Handbook of Microbiological Media , 4th some organisms prefer complex sugars such as cellobiose ed , ASM Press , 2010 ) supplemented with yeast extract over simple sugars . Examples of media used in the isolation 0 . 5 % , cysteine 0 . 1 % , 0 . 1 % cellobiose , 0 . 1 % inulin , of sporulating organisms include EYA , BHI, BHIS , and 0 . 1 % maltose , aztreonam 1 mg/ L , gentamycin 2 mg/ L ] GAM ( see below for complete names and references ) . Multiple dilutions are plated out to ensure that some plates 25 Example 15 : The Purification and Isolation of a will have well isolated colonies on them for analysis , or Spore Forming Fraction from Feces alternatively plates with dense colonies may scraped and suspended in PBS to generate a mixed diverse community . To purify and selectively isolate efficacious spores from Plates are incubated anaerobically or aerobically at 37 C fecal material a donation is first blended with saline using a for 48 -72 or more hours, targeting anaerobic or aerobic 30 homogenization device ( e . g . , laboratory blender ) to produce spore formers , respectively. a 20 % slurry ( w / v ) . 100 % ethanol is added for an inactiva Solid plate media include: tion treatment that lasts 10 seconds to 1 hour. The final Gifu Anaerobic Medium (GAM , Nissui) without dextrose alcohol concentration can range from 30 - 90 % , preferably supplemented with fructooligosaccharides/ inulin 50 - 70 % . High speed centrifugation (3200 rcf for 10 min ) is (0 .4 % ), mannitol ( 0 .4 % ), inulin (0 .4 % ), or fructose 35 performed to remove solvent and the pellet is retained and ( 0 .4 % ) , or a combination thereof. washed . Subsequently , once the washed pellet is resus Sweet GAM [Gifu Anaerobic Medium (GAM , Nissui) ] pended , a low speed centrifugation step ( 200 rcf for 4 min ) modified , supplemented with glucose , cellobiose , malt - is performed to remove large particulate vegetative matter ose , L - arabinose , fructose , fructooligosaccharides / inu - and the supernatant containing the spores is retained . High lin , mannitol and sodium lactate ) 40 speed centrifugation (3200 ref for 10 min ) is performed on Brucella Blood Agar (BBA , Atlas, Handbook of Micro - the supernatant to concentrate the spore material . The pellet biological Media , 4th ed , ASM Press , 2010 ) is then washed and resuspended to generate a 20 % slurry. PEA sheep blood (Anaerobe Systems; 5 % Sheep Blood This is the ethanol treated spore preparation . The concen Agar with Phenylethyl Alcohol ) trated slurry is then separated with a density based gradient Egg Yolk Agar (EYA ) ( Atlas , Handbook of Microbiologi - 45 e .g . a CsCl gradient, sucrose gradient or combination of the cal Media , 4th ed , ASM Press , 2010 ) two generating a ethanol treated , gradient- purified spore Sulfite polymyxin milk agar (Mevissen - Verhage et al. , J . preparation . For example , a CsCl gradient is performed by Clin . Microbiol. 25 :285 - 289 (1987 ) ) loading a 20 % volume of spore suspension on top a 80 % Mucin agar (Derrien et al. , IJSEM 54 : 1469 - 1476 ( 2004 ) ) volume of a stepwise CsCl gradient ( w / v ) containing the Polygalacturonate agar (Jensen & Canale -Parola , Appl. 50 steps of 64 % , 50 % , 40 % CsCl (w / v ) and centrifuging for 20 Environ . Microbiol. 52 :880 - 997 ( 1986 ) ) min at 3200 rcf. The spore fraction is then run on a sucrose M2GSC ( Atlas, Handbook of Microbiological Media , 4th step gradient with steps of 67 % , 50 % , 40 % , and 30 % ( w / v ) . ed , ASM Press , 2010 ) When centrifuged in a swinging bucket rotor for 10 min at M2 agar ( Atlas, Handbook of Microbiological Media , 4th 3200 rcf. The spores run roughly in the 30 % and 40 % ed , ASM Press , 2010 ) supplemented with starch ( 1 % ) , 55 sucrose fractions . The lower spore fraction (FIG . 2 ) is then mannitol ( 0 . 4 % ) , lactate ( 1 . 5 g / L ) or lactose ( 0 . 4 % ) removed and washed to produce a concentrated ethanol Sweet B - Brain Heart Infusion agar (Atlas , Handbook of treated , gradient- purified spore preparation . Taking advan Microbiological tage of the refractive properties of spores observed by phase Media , 4th ed , ASM Press , 2010 ) supplemented with contrast microscopy (spores are bright and refractive while yeast extract ( 0 . 5 % ) , hemin , cysteine ( 0 . 1 % ) , maltose 60 germinated spores and vegetative cells are dark ) one can see ( 0 . 1 % ), cellobiose ( 0 . 1 % ) , soluble starch ( sigma , 1 % ), an enrichment of the spore fraction from a fecal bacterial cell MOPS (50 mM , PH 7 ) . suspension ( FIG . 3 , left ) compared to an ethanol treated , PY - salicin (peptone -yeast extract agar supplemented with CsCl gradient purified , spore preparation (FIG . 3, center) , salicin ) ( Atlas , Handbook of Microbiological Media , and to an ethanol treated , CsCl gradient purified , sucrose 4th ed , ASM Press , 2010 ). 65 gradient purified , spore preparation ( FIG . 3 , right) . Modified Brain Heart Infusion ( M - BHI) [ [ sweet and Furthermore, growth of spores after treatment with a sour ]] contains the following per L : 37. 5 g Brain Heart germinant can also be used to quantify a viable spore US 9 ,855 , 303 B2 59 60 population . Briefly , samples were incubated with a germi prevents mortality and weight loss at three dilutions, while nant (Oxgall , 0 . 25 % for up to 1 hour ), diluted and plated the heat -treated fraction was protective at the only dose anaerobically on BBA (Brucella Blood Agar) or similar tested . These data indicate that the spore fraction is effica media ( e . g . see Examples 4 and 5 ) . Individual colonies were cious in preventing C . difficile infection in the mouse . picked and DNA isolated for full - length 16S sequencing to 5 identify the species composition ( e . g . see examples 2 and 3 ) . Example 17 : The Prophylactic and Relapse Analysis revealed that 22 species were observed in total Prevention Hamster Models ( Table 2 ) with a vast majority present in both the material purified with the gradient and without the gradient, indicat - Previous studies with hamsters using toxigenic and non ing no or inconsequential shift in the ecology as a result of 10 toxigenic strains of C . difficile demonstrated the utility of the gradient purification . Spore yield calculations demonstrate hamster model in examining relapse post antibiotic treat an efficient recovery of 38 % of the spores from the initial ment and the effects of prophylaxis treatments with cecal fecal material as measured by germination and plating of flora in C . difficile infection (Wilson et al. 1981 , Wilson et spores on BBA or measuring DPA count in the sample . al. 1983 , Borriello et al. 1985 ) and more broadly gastroin 15 testinal infectious disease . To demonstrate prophylactic use Example 16 : Bacterial Compositions Prevent C . of a test article to ameliorate C . difficile infection , the difficile Infection in a Mouse Model following hamster model is used . In a prophylactic model, Clindamycin ( 10 mg/ kg s . c . ) is given on day - 5 , the test To test the therapeutic potential of the bacterial compo article or control is administered on day - 3 , and C . difficile sitions a prophylactic mouse model of C . difficile infection 20 challenge occurs on day 0 . In the positive control arm , (model based on Chen , et al. , A mouse model of Clostridium vancomycin is then administered on day 1 - 5 (and vehicle difficile associated disease , Gastroenterology 135 ( 6 ) : 1984 - control is delivered on day - 3 ) . Feces are collected on day 1992 ) was used . Two cages of five mice each were tested for - 5 , - 4 , - 1, 1 , 3 , 5, 7, 9 and fecal samples are assessed for each arm of the experiment. All mice received an antibiotic pathogen carriage and reduction by microbiological meth cocktail consisting of 10 % glucose, kanamycin (0 .5 mg/ ml ) , 25 ods, 16S sequencing approaches or other methods utilized gentamicin ( 0 .044 mg/ ml ) , colistin ( 1062. 5 U /ml ) , metron - by one skilled in the art . Mortality is assessed throughout the idazole ( 0 .269 mg/ ml ) , ciprofloxacin ( 0 . 156 mg/ ml ) , ampi experiment through 21 days post C . difficile challenge . The cillin ( 0 . 1 mg/ ml ) and Vancomycin (0 .056 mg/ml ) in their percentage survival curves show that ethanol treated spores drinking water on days - 14 through - 5 and a dose of 10 and ethanol treated , gradient- purified spores better protect mg/ kg Clindamycin by oral gavage on day - 3 . On day - 1 , 30 the hamsters compared to the Vancomycin control, and they received either the test article or vehicle control via oral vehicle control. gavage. On day Othey were challenged by administration of See FIG . 4 : Prophylaxis model with the ethanol treated approximately 4 . 5 log 10 cfu of C . difficile (ATCC 43255 ) spore preparation and the ethanol treated , gradient- purified via oral gavage . Optionally a positive control group received spore preparation . vancomycin from day - 1 through day 3 in addition to the 35 In the relapse prevention model, hamsters are challenged antibiotic protocol and C . difficile challenge specified above . with toxigenic C . difficile strains on day 0 , and treated with Feces were collected from the cages for analysis of bacterial clindamycin by oral gavage on day 1 , and vancomycin carriage , mortality was assessed every day from day 0 to day dosing day 2 - 6 . Test or control treatment was then admin 6 and the weight and subsequent weight change of the istered on day 7 , 8 , and 9 . The groups of hamsters for each animal was assessed with weight loss being associated with 40 arm consist of 8 hamsters per group . Fecal material is C . difficile infection . Mortality and reduced weight loss of collected on day - 1 , 1 , 3 , 5 , 7 , 10 and 13 and hamster the test article compared to the vehicle were used to assess mortality is assessed throughout. Survival curves are used to the success of the test article . Additionally, a C . difficile assess the success of the test article e .g . ethanol treated or symptom scoring was performed each day from day - 1 ethanol treated , gradient purified spores versus the control through day 6 . Clinical Score was based on a 0 - 4 scale by 45 treatment in preventing hamster death . The survival curves combining scores for Appearance ( 0 - 2 pts based on normal, demonstrate maximum efficacy for the ethanol treated , gra hunched , piloerection , or lethargic ), and Clinical Signs (0 -2 dient -purified spores followed by the ethanol treated spores. points based on normal, wet tail , cold - to -the - touch , or iso Both treatments improved survival percentage over vanco lation from other animals ) . mycin treatment alone . In a naive control arm , animals were challenged with C . 50 See FIG . 5 : Relapse prevention model with ethanol difficile . In the vancomycin positive control arm animals treated spores and ethanol treated , gradient purified spores were dosed with C . difficile and treated with vancomycin from day – 1 through day 3 . The negative control was Example 18 : Clinical Treatment of Recurrent C . gavaged with PBS alone and no bacteria . The test arms of difficile in Patients the experiment tested 1x , 0 . 1x , 0 .01x dilutions derived from 55 a single donor preparation of ethanol treated spores ( e . g . see To assess the efficacy of a test article ( e . g . , ethanol treated example 6 ) or the heat treated feces prepared by treating a spore preparations, see Example 15 ) to treat recurrent C . 20 % slurry for 30 min at 80 C . Dosing for CFU counts was difficile in human patients, the following procedure was determined from the final ethanol treated spores and dilu - performed to take feces from a healthy donor, inactivate via tions of total spores were administered at 1x , 0 . 1x , 0 .01x of 60 the ethanol treated spore preparation protocol described the spore mixture for the ethanol treated fraction and a 1x below , and treat recurrent C . difficile in patients presenting dose for the heat treated fraction . with this indication . Non - related donors were screened for Weight loss and mortality were assessed on day 3 . The general health history for absence of chronic medical con negative control, treated with C . difficile only , exhibits 20 % ditions ( including inflammatory bowel disease ; irritable mortality and weight loss on Day 3 , while the positive 65 bowel syndrome; Celiac disease ; or any history of gastro control of 10 % human fecal suspension displays no mortal- intestinal malignancy or polyposis ), absence of risk factors ity or weight loss on Day 3 ( Table 3 ) . EtOH - treated feces for transmissible infections, antibiotic non -use in the previ US 9 ,855 ,303 B2 62 ous 6 months, and negative results in laboratory assays for 16S sequencing and spore count with methods explained blood -borne pathogens (HIV , HTLV, HCV , HBV , CMV, previously ( e .g . see Examples 11 and 12 ) . Through 4 weeks HAV and Treponema pallidum ) and fecal bacterial patho - post treatment, each patient has gradually improved with no gens ( Salmonella , Shigella , Yersinia , Campylobacter, E . coli evidence of C . difficile recurrence . 0157 ) , ova and parasites , and other infectious agents (Giar - 5 Six other patients with recurrent C . difficile -associated dia , Cryptosporidium Cyclospora , Isospora ) prior to stool diarrhea were treated in a similar fashion , with no CDI donation . recurrence and no requirement for resumption of antibiotics Donor stool was frozen shortly after donation and ( total of 8 patients ) . Additionally , there were no treatment sampled for testing . At the time of use , approximately 75 g related serious adverse events . of donor stool was thawed and resuspended in 500 mL of 10 non - bacteriostatic normal saline and mixed in a single use Example 19 : Treatment of Fecal Suspensions with glass or plastic blender. The resulting slurry was sequentially Ethanol or Heat Drastically Reduces Vegetative passed through sterile , disposable mesh screens that remove Cell Numbers and Results in an Enrichment of particles of size 600 , 300 and 200 microns . The slurry was Spore Forming Species then centrifuged briefly (200 rcf for 4 min ) to separate 15 fibrous and particulate materials, and the supernatant ( con Treatment of a sample , preferably a human fecal sample , taining bacterial cells and spores ) was transferred to a fresh in a manner to inactivate or kill substantially all of the container. Ethanol was added to a final concentration of 50 % vegetative forms of bacteria present in the sample results in and the resulting - 1500 ml slurry was incubated at room selection and enrichment of the spore fraction . Methods for temperature for 1 hr with continuous mixing to inactivate 20 inactivation can include heating , sonication , detergent lysis , vegetative bacterial cells . Midway through inactivation the enzymatic digestion (such as lysozyme and / or proteinase K ) , slurry was transferred to a new bottle to ensure complete ethanol or acid treatment, exposure to solvents ( Tetrahydro contact with the ethanol. The solid matter was pelleted in a furan , 1 -butanol , 2 -butanol , 1 , 2 propanediol, 1 , 3 propane centrifuge and washed 3 times with normal saline to remove diol, butanoate , propanoate , chloroform , dimethyl ether and residual ethanol. The final pellet was resuspended in 100 % 25 a detergent like triton X - 100 , diethyl ether ) , or a combina sterile , USP glycerol at a minimum volume, and filled into tion of these methods. To demonstrate the efficacy of ethanol approximately 30 size 0 delayed release capsules (hypromel - induced inactivation of vegetative cells , a 10 % fecal sus lose DRcaps , Capsugel, Inc . ) at 0 .65 mL suspension each . pension was mixed with absolute ethanol in a 1 : 1 ratio and The capsules were immediately capped and placed onto an vortexed to mix for 1 min . The suspension was incubated at aluminum freezing block held at - 80° C . via dry ice to 30 room temperature for 30 min , 1 h , 4 h or 24 h . After freeze . The frozen capsules were in turn over - capsulated incubation the suspension was centrifuged at 13 , 000 rpm for with size 00 DRcaps to enhance capsule stability , labeled , 5 min to pellet spores . The supernatant is discarded and the and placed into < - 65° C . storage immediately . The final pellet is resuspended in equal volume of PBS . Viable cells productwas stored at < - 65° C . until the day and time of use . were measured as described below . Encapsulated product may be stored for indefinitely 35 To demonstrate the efficacy of heat treatment on vegeta at < - 65° C . On the day of dosing capsules were warmed on tive cell inactivation a 10 - 20 % fecal suspension was incu wet ice for 1 to 2 hours to improve tolerability , and were then bated at 70 C , 80 C , 90 C or 100 C for 10 min or 1 h . dosed with water ad libitium . After ethanol or heat treatment, remaining viable cells Patient 1 is a 45 -year old woman with a history of C . were measured after 24 h incubation on plates by determin difficile infection and diarrhea for at least 1 year prior to 40 ing the bacterial titer on Brucella blood agar (BBA ) as a treatment. She has been previously treated with multiple function of treatment and time ( See FIG . 6 ) . Ethanol treat courses of antibiotics followed each time by recurrence of C . ment for 1 h and 25 h have similar effects , reducing the difficile -associated diarrhea. number of viable cells by approximately 4 logs , while Patient 2 is an 81 - year old female who has experienced increasing temperature and time at high temperature leads to recurrent C . difficile infection for 6 months prior to treatment 45 higher losses in viable cell number , with no colonies detect despite adequate antibiotic therapy following each recur - able at 100° C . at either 10 min or 1 h . In this experiment no rence . germinants were used . After several days of additional 24 hours prior to starting oral treatment, CDAD antibiotic growth on plates , a number of colonies were picked from therapy was discontinued . Each patient received a colon these treated samples and identified by 16S rDNA analysis preparation procedure intended to reduce the competing 50 ( e . g . see Examples 11 and 12 ) . These included known spore microbial burden in the gastrointestinal tract and to facilitate forming Clostridium spp . as well as species not previously repopulation by the spore forming organisms in the inves - reported to be spore formers including Ruminococcus bro tigational product. mii, and Anaerotruncus colihominis ( Lawson , et al 2004 ) , On the morning of the first treatment day , the patients and a Eubacterium sp . ( Table 4 ) . See FIG . 6 : Heat and received a dose of delayed release capsules containing the 55 ethanol treatments reduce cell viability investigational product with water ad libitum . Patients were To demonstrate that vegetative cells are greatly reduced requested to avoid food for 1 hour thereafter. The next day, by ethanol treatment, known non - spore forming bacteria are the patient returned to the clinic to receive an additional ethanol treated as described previously ( e . g . see Example dose . Patients were asked to avoid food for 4 hours prior to 15 ) and viability was determined by plating on BBA in receiving their second dose and for 1 hour following dosing . 60 anaerobic conditions ( e . g . see Example 14 ). Fecal material Both patients were followed closely for evidence of from four independent donors was exposed to 60 C for 5 min relapse or adverse symptoms following treatment . Patients and subsequently plated on three types of selective media were contacted by phone on Day 2 , Day 4 , and Weeks 1 , 2 under either aerobic ( + 02) or anaerobic conditions ( -02 ) and 4 and each was queried about her general status and the (BBA + aerobic , MacConkey lactose + aerobic , Bacteroides condition of her CDAD and related symptoms. Stool 65 Bile esculin + anaerobic ) to identify known nonsporeforming samples were collected at baseline and Weeks 1 , 2 , 4 and 8 Enterobacteria ( survivors on MacConkey agar ) and Bacte post- treatment to assess changes in the gut microbiota via roides fragilis group species ( survivors on Bacteroides Bile US 9 ,855 , 303 B2 63 64 Esculin plates ). The detectable limit for these assays was in an individual donor over time and can be up to three logs roughly 20 cfu /mL . Germinants were not used in this difference between donors . One possible reason for the experiment (FIG . 7 ) . Both ethanol and heat inactivation difference in spore contentmeasures is that nonviable spores greatly reduces the cell viability from fecal material to the and non - germinable spores will not be observed by plating limit of detection under using MacConkey lactose agar and 5 but will have measurable DPA content. Another possibility BBE agar. The remaining cells identified on BBA media is the variability between species of DPA content in spores grown in anaerobic conditions comprise the non - germinant making some complex mixtures containing high DPA spores dependent spore forming species . See FIG . 7 : Reduction in while other mixtures contain low DPA content spores . non - spore forming vegetative cells by treatment at 60° C . for Selecting donors with high spore counts is important in 5 min 10 determining productivity of isolating spores from fecal Additionally, the ethanol treatment was shown to rapidly donations by identifying preferred donors . kill both aerobic and non -spore forming anaerobic colony See FIG . 9 : Donation Spore concentrations from clinical forming units in 10 % fecal suspensions as determined by donors plating on rich (BBA ) media . The reduction of plated CFUS A fresh fecal sample from donor F was treated as decreases four orders of magnitude in seconds as shown in 15 described in Example 15 to generate an ethanol treated spore FIG . 8 . fraction , germinated with BHIS /Oxgall for 1 h as a described See FIG . 8 : Time course demonstrates ethanol reduces ( e . g . see Example 13 ) , then plated to a variety ofmedia ( e . g . both anaerobic and aerobic bacterial CFUS See example 14 ) . Colonies were picked with a focus on picking several of each type of morphologically distinct Example 20 : Species Identified and Isolated as 20 colony on each plate to capture as much diversity as pos Spore Formers by Ethanol Treatment sible . Colonies are counted on a plate of each media type with well isolated colonies such that the number of colony To demonstrate that spore - forming species are enriched forming units per mlcan be calculated ( Table 12 ) . Colonies by heat or ethanol treatment methods, a comparison of were picked into one of several liquid media and the 16S > 7000 colony isolates was performed to identify species in 25 rDNA sequences ( e . g . see Examples 11 and 12 ) were deter a repeatable fashion ( e . g ., identified independently in mul- mined and analyzed as described above . The number of tiple preparations, see examples 1 , 2 , and 3 ) only isolated unique OTUs for each media type is shown below with the from fecal suspensions treated with 50 % ethanol or heat media with the most unique OTUs at the top ( Table 12 ) . treatment and not from untreated fecal suspensions ( Table Combinations of 3 to 5 of the top 5 media types capture 5 ) . These data demonstrate the ability to select for spore 30 diversity , and some other can be chosen to target specific forming species from fecalmaterial , and identify organisms species of interest . Colony forming units can be calculated as spore formers not previously described as such in the for a given species using the 16S data , and could be used to literature . In each case , organismswere picked as an isolated determine whether a sufficient level of a given organism is colony, grown anaerobically , and then subjected to full - present. The spore complement from Donor F as determined length 16S sequencing in order to assign species identity . 35 in this experiment includes these 52 species as determined To further identify spore formers, ethanol treated fecal by 16S sequencing ( Table 12 ). samples from donors A , B , C , D , E and F were plated to a To screen human donors for the presence of a diversity of variety of solid media types, single colonies were picked and spore forming bacteria and / or for specific spore - forming grown up in broth in a 96 well format ( Table 6 - 11) . The 16S bacteria , fecal samples were prepared using germinants and rRNA gene was then amplified by PCR and direct cycle 40 selective plating conditions and colonies were picked ( e . g . sequencing was performed (See examples 11 and 12 ) . The see Examples 13 and 14 ) and analyzed for 16S diversity as ID is based on the forward read from direct cycle sequencing described previously ( see Examples 11 and 12 ) . An assess of the 16S rRNA gene . ment of donor diversity could include the cfu /ml of ethanol There is surprising heterogeneity in the microbiome from resistant cells on a given media type , or cfu /ml of a given one individual to another ( Clemente et al. , 2012 ) and this has 45 species using the 16S analysis of colonies picked from that consequences for determining the potential efficacy of vari media to determine the level of spores of a given species of ous donors to generate useful spore compositions. The interest . This type of culture -based analysis could be method described below is useful for screening donors complemented by culture - independent methods such as when , for instance , a particular quantity or diversity of spore qPCR with probes specific to species or genera of interest or forming organisms is useful or desired for repopulating the 50 metagenomic sequencing of spore preparations, or 16S microbiome following antibiotic treatment or treating a profiling of spore preparations using Illumina 16S variable particular disease or condition . Further, such screening is region sequencing approaches ( e . g . see Examples 11 and useful when there is a need to screen donors for the purpose 12 ) . of isolating microorganisms capable of spore formation , or when a purified preparation of spore forming organisms is 55 Example 21 : Quantification of Spore desired from a particular donor. Concentrations Using DPA Assay Total spore count is also a measure of potency of a particular donation or purified spore preparation and is vital Methods to assess spore concentration in complex mix to determine the quantity of material required to achieve a tures typically require the separation and selection of spores desired dose level. To understand the variability in total 60 and subsequent growth of individual species to determine spore counts , donor samples were collected and processed as the colony forming units . The art does not teach how to described in prior examples . Donor spore counts in CFU / g quantitatively germinate all the spores in a complex mixture were then determined by growth on media plates at various as there are many species for which appropriate germinants titrations to determine the spore content of the donation have not been identified . Furthermore , sporulation is thought Furthermore , DPA assays were used to assess spore content 65 to be a stochastic process as a result of evolutionary selec ( expressed as spore equivalents ) as described in Example tion , meaning that not all spores from a single species 21. As seen in FIG . 9 , there is as much as two logs difference germinate with same response to germinant concentration , US 9 ,855 ,303 B2 65 66 time and other environmental conditions. Alternatively , a or less using the SCFU assay ( e . g . Preparation 1 , Table AC ) . key metabolite of bacterial spores, dipicolinic acid (DPA ) If that SCFU dose was used to normalize dosing in a clinical has been developed to quantify spores particles in a sample setting, however, then the actual spore doses given to and avoid interference from fecal contaminants . The assay patients would be much lower for other ethanol treated spore utilizes the fact that DPA chelates Terbium 3 + to form a 5 preparations as measured as by the DPA assay ( Table AD ) . luminescent complex (Fichtel et al, FEMS Microbiology Ecology, 2007 ; Kort et al, Applied and Environmental TABLE AD Microbiology, 2005 ; Shafaat and Ponce , Applied and Envi DPA doses in Table AC when normalized to 4 x 105 ronmental Microbiology , 2006 ; Yang and Ponce , Interna SCFU per dose tional Journal of Food Microbiology , 2009 ; Hindle and Hall, 10 Analyst, 1999 ) . A time- resolved fluorescence assay detects SCFU / DPA SEq/ 30 Fraction of Preparation 1 terbium luminescence in the presence of DPA giving a Preparation 30 capsules capsules Dose 1 . 0 quantitative measurement of DPA concentration in a solu Preparation 1 4 .0 x 10< 5 6 . 8 x 10°7 tion . Preparation 2 4 . 0 x 10 5 1 . 8 x 10 7 0 . 26 To perform the assay 1 mL of the spore standard to bem 15 Preparation 3 4 .0 x 10 ^5 5 .6 x 1095 0 . 0082 measured was transferred to a 2 mL microcentrifuge tube . The samples were centrifuged at 13000 RCF for 10 min and It becomes clear from the variability of SCFU and DPA the sample is washed in 1 mL sterile deionized H2O . Wash counts across various donations that using SCFU as the an additional time by repeating the centrifugation . Transfer 20 measure of potency would lead to significant underdosing in the 1 mL solution to hungate tubes and autoclave samples on certain cases . For instance , setting a dose specification of a steam cycle for 30 min at 250 C . Add 100 uL of 30 uM 4x10 SCFU ( the apparent effective dose from donor Prepa TbC1z solution (400 mM sodium acetate , pH 5 . 0 , 30 uM ration 1 ) for product Preparation 3 would lead to a potential TbC1z ) to the sample . Make serial dilutions of of the autoclaved material and measure the fluorescence of each underdosing of more than 100 - fold . This can be rectified sample by exciting with 275 nm light and measuring the 25 only by setting potency specifications based on the DPA emission wavelength of 543 nm for an integration time of assay , which better reflects total spore counts in an ethanol 1 .25 ms and a 0 . 1 ms delay . treated spore preparation . The unexpected finding of this Purified spores are produced as described previously ( e . g . work is that the DPA assay is uniquely suited to set potency see www . epa. gov /pesticides /methods / MB - 28 - 00 . pdf ) . and determine dosing for an ethanol treated spore prepara Serial dilutions of purified spores from C . bifermentans, C .· 30 tion . sporogenes, and C . butyricum cultures were prepared and measured by plating on BBA media and incubating over Example 22 : Demonstration of Enhanced Growth night at 37 C to determine CFU /ml . FIG . 10 shows the linear with a Germinant correspondence across different spore producing bacteria 35 To enhance the ethanol treated spores germination capa across several logs demonstrating the DPA assay as means bility and demonstrate spore viability , spores from three to assess spore content. different donors were germinated by various treatments and See FIG . 10 : Linear range of DPA assay compared to CFU plated on various media . Germination with BHIS / oxgall counts /ml (BHIS Ox ), Ca -DPA , rumen fluid (RF ) , simulated gastric The discrepancy for complex spore populations betweenen 40an duidfluid ( SGF) , mucin medium (Muc ) , fetal bovine serum spore counts measured by germinable spore CFU and by ( FBS ) , or thioglycollate ( Thi) for 1 hour at 37 C in anaerobic DPA has important implications for determining the potency conditions was performed as described previously ( e . g . see of an ethanoltreated spore preparation for clinical use . Table Examples 13 and 14 ) with samples derived from two inde AC shows spore content data from 3 different ethanol treated pendent donors ( FIG . 11 ) . The spore - germinantmixture was spore preparations used to successfully treat 3 patients 45 serially diluted and plated on different plate media including suffering from recurrent C . difficile infection . The spore BBA , Sweet B , Sweet B + lysozyme ( 2 ug /ml ), M2GSC and content of each spore preparation is characterized using the M2GSC + lysozyme ( 2 ug /ml ) as previously described ( e . g . two described methods. see Examples 13 and 14 ) to determine spore germination . Colony forming units were tallied and titers were deter TABLE AC 50 mined using standard techniques by one skilled in the art. As Spore quantitation for ethanol treated spore FIG . 11 shows, maximum colony forming units are derived preparations using spore CFU ( SCFU ) assay and DPA assay from BHI- oxgall treatment. This germination treatment also greatly increases the diversity as measured by the number of DPA SEq /30 OTUS identified when samples were submitted for 16S Preparation SCFU /30 capsules capsules Ratio SCFU /DPA 55 sequencing ( e . g . see Examples 11 and 12 ) compared to Preparation 1 4 . 0 0 x 105 6 .8 x 10 7 5 . 9 x 10 - 3 plating without a germination step (FIG . 12 ) . As shown in Preparation 2 2 . 1 x 10 9 .2 x 108 0 .023 FIG . 11 : Different germinant treatments have variable Preparation 3 9 .6 x 109 0 .72 effects on CFU counts from donor A (upper left ) and donor B ( lower right ). The Y - Axes are spore CFU per ml. As What is immediately apparent is that spore content varies 60 shown in FIG . 12 : Germinates greatly increase the diversity greatly per 30 capsules . Asmeasured by germinable SCFU , of cultured spore forming OTUS. spore content varies by greater than 10 , 000 - fold . As mea - To test the effect of heat activation to promote germina sured by DPA , spore content varies by greater than 100 - fold . tion , ethanol treated fecal samples were treated for 15 min In the absence of the DPA assay, it would be difficult to set at room temperature , 55 C , 65 C , 75 C or 85 C from three a minimum dose for administration to a patient. For 65 different donors and germinated subsequently with BHIS + instance , without data from the DPA assay , one would Oxgall for 1 hr at 37 C then plated on BBA media ( FIG . 13 ) conclude that a minimum effective dose of spores is 4x105 as previously described ( e . g . see Examples 13 and 14 ) . US 9 ,855 ,303 B2 67 68 Pretreatment at room temperature produced equal if not also administered to mice to model fecal microbiota trans more spores than the elevated temperatures in all three plant (FMT ) . Weight loss and mortality of the various test donors . The temperature of germinating was also examined and control arms of the study are plotted in FIG . 17 and by incubating samples at room temperature or 37 C for 1 hr summarized in Table 15 which also contains the dosing in anaerobic conditions before plating on BBA . No differ - 5 information . The data clearly shows both the " germinable ” ence in the number of CFUS was observed between the two and " sporulatable ” fractions are efficacious in providing conditions . Lysozyme addition to the plates ( 2 ug/ ml ) was protection against C . difficile challenge in a prophylaxis also tested on a single donor sample by the testing of various mouse model ( e . g . see Example 16 ) . The efficacy of these activation temperature followed by an incubation in the fractions further demonstrates that the species present are presence or absence of lysozyme. The addition of lysozyme 10 responsible for the efficacy of the spore fraction , as the had a small effectwhen plated on Sweet B or M2GSC media fractionation further dilutes any potential contaminant from but less so than treatment with BHIS Oxgall without the original spore preparation . lysozyme for 1 hr ( FIG . 14 ). See FIG . 16 : Titer of " germinable ” fraction after 2 days As shown in FIG . 13 : Heat Activation as a germination (left ) and Sporulatable fraction ( right ) by DPA and CFU /ml . treatment with BHIS +oxgall . As shown in FIG . 14 : Effect of 15 The “ sporulatable ” fraction made following 7 days of lysozyme slightly enhances germination . growth was measured as previously described using germi Germination time was also tested by treating a 10 % nation and growth assays or DPA content as previously suspension of a single donor ethanol treated feces ( e . g . see described (see Example 21) . Example 15 ) incubated in either BHIS , taurocholate , oxgall, The species present in the " germinable ” and “ sporulat or germix for 0 , 15 , 30 , or 60 minutes and subsequently 20 able” fractions were determined by full length 16S sequenc plated on BHIS , EYA , or BBA media ( e . g . see Examples 13 ing of colony picks and by 16S NGS sequencing of the and 14 ) . 60 minutes resulted in the most CFU units across fractions themselves. The colony pick data indicate all various combinations germinates and plate media tested . Clostridium species are very abundant in both fractions , while the NGS data reveal other spore forming organisms Example 23 : Demonstrating Efficacy of Germinable 25 that are typically found in ethanol treated spore preparations and Sporulatable Fractions of Ethanol Treated are present. Spores Results are shown in the following : See Table 13 . Species identified as " germinable " and " sporulatable ” by colony To define methods for characterization and purification , picking approach . See Table YYY . Species identified as and to improve ( e . g ., such as by modulating the diversity of 30 “ germinable ” using 16S - V4 NGS approach . See Table ZZZ . the compositions , the active spore forming ecology derived Species identified as “ sporulatable ” using 16s - V4 NGS from fecal donations, the ethanol treated spore population approach . See FIG . 17 : Mouse prophylaxis model demon (as described in Example 15 ) was further fractionated . A strates " germinable ” and “ sporulatable ” preparations are “ germinable fraction ” was derived by treating the ethanol- protective against C . difficile challenge . Each plot tracks the treated spore preparation with oxgall , plating to various 35 change in the individual mouse ' s weight relative to day - 1 solid media , and then , after 2 days or 7 days of growth , over the course of the experiment. The number of deaths scraping all the bacterial growth from the plates into 5 mL over the course of the experiment is indicated at the top of of PBS per plate to generate a bacterial suspension . A the chart and demonstrated by a line termination prior to day “ sporulatable fraction ” was derived as above except that the 6 . The top panels ( from left to right ) are the vehicle control cells were allowed to grow on solid media for 2 days or 7 40 arm , the fecal suspension arm , and the untreated naive days ( the time was extended to allow sporulation , as is control arm , while the bottom panels are the ethanol treated , typical in sporulation protocols ), and the resulting bacterial gradient purified spore preparation ; the ethanol treated , suspension was treated with 50 % ethanol to derive a popu - gradient purified , " germinable ” preparation , and ethanol lation of “ sporulatable ” spores, or species that were capable treated , gradient purified , “ sporulatable ” preparation . See of forming spores. In preparing these fractions, fecal mate - 45 Table 15 : Results of the prophylaxis mouse model and rial from donor A was used to generate an ethanol treated dosing information spore preparation as previously described in Example 15 ; then spore content was determined by DPA assay and Example 24 : Donor Pooling Efficacy in Prophylaxis CFU / ml grown on various media (FIG . 15 ) as previously Mouse described ( see Example 21) . See FIG . 15 : Spores initially 50 present in ethanol treated spore preparation as measured by To test the efficacy and dosing of pooled donor samples DPA and CFU /ml grown on specified media . the C . difficile prophylaxis mouse model ( e . g ., see Example To characterize the fraction that is sporulatable , the 2 day 16 ) is used with donations mixed from two or more donor and 7 day “ germinable ” fractions were assessed for CFU and samples as previously described . Weight loss and mortality DPA content before and after ethanol treatment to generate 55 with the mixed spore product versus the spore product a spore fraction . Bacterial suspensions were treated with derived from a single donor at the various dosing is deter ethanol, germinated with Oxgall, and plated on the same mine whether the two treatment schemes are equivalent or types ofmedia that the “ germinable ” fraction was grown on . one is significantly better than the other. DPA data showed that growth on plates for 2 and 7 days Dosing of the spore product derived from a single or produced the same amount of total spores . Colonies on the 60 multiple donors is between 1E4 to 1E10 CFU /ml . The spore several types of media were picked for 16S sequence product is mixed from product derived from any number of analysis to identify the spore forming bacteria present ( Table donors ranging from 1 - 10 at either equal concentrations or 13 ). different known concentrations . A 2 day “ germinable ” fraction and a 7 day “ sporulatable ” Additionally , this method can be used to expand the spore fraction were used as a treatment in the mouse prophylaxis 65 fraction for production purposes. For production purposes , assay as described ( e . g . see Example 16 ) . As a control, a an enriched spore fraction ( e . g . - a purified and EtOH 10 % fecal suspension prepared from a donor (Donor B ) was treated fraction of a fecal sample ) is preserved in multiple US 9 ,855 ,303 B2 69 70 aliquots to form a bank of viable spore - forming organisms. represent OTUs that do not form spores while the latter An aliquot of this bank is then recovered by germinant taxonomic groups represent OTUs that are believed to form treatment followed by cultivation in a medium , and under spores . conditions , that are broadly permissive for spore- forming Patient treatment with the ethanol treated spore prepara organisms and encourage sporulation . After a suitable 5 tion leads to the establishment of a microbial ecology that amplification time, the amplified bacteria including spores has greater diversity than prior to treatment ( FIG . 18 ) . are harvested , and this preparation is solvent or heat- treated Genomic - based microbiome characterization confirmed to isolate the spore fraction . This fraction may be further engraftment of a range of OTUs that were absent in the purified away from non - spore forms and culture constitu - patient pretreatment ( Table 16 ) . These OTUS comprised ents . The process of amplification , spore isolation and 10 both bacterial species that were capable and not capable of optional purification may be repeated at increasing scales to forming spores , and OTUs that represent multiple phyloge generate large quantities for further use . When enough netic clades. Organisms absent in Patient 1 pre -treatment germinable / sporulatable material has been accumulated by either engraft directly from the ethanol treated spore fraction amplification , it may be further purified , concentrated or or are augmented by the creation of a gut environment diluted , and / or preserved to a state suitable for further use , 15 favoring a healthy , diverse microbiota . Furthermore , Bacte e . g . - clinical dosing . roides fragilis group species were increased by 4 and 6 logs Features may be incorporated into the above process to in patients 1 and 2 (FIG . 20 ) . make it suitable for further utility , especially for product OTUs that comprise an augmented ecology are not pres applications such as clinical use . The production of the ent in the patient prior to treatment and /or exist at extremely initial spore fraction may be conducted under controlled 20 low frequencies such that they do not comprise a significant conditions (cGMP ' s ) and validated to remove non - spore fraction of the total microbial carriage and are not detectable organisms to a high degree . The germination may be con by genomic and / or microbiological assay methods . OTUS ducted using reagents that are more standardizable than that are members of the engrafting and augmented ecologies natural products such as oxgall, e .g . - synthetic mixtures of were identified by characterizing the OTUs that increase in bile salts . Amplification may be done using media with 25 their relative abundance post treatment and that respectively components that are preferred for clinical safety, e . g . - are : (i ) present in the ethanol treated spore preparation and sourced from qualified animals , or non - animal sourced . absent in the patient pretreatment, or (ii ) absent in the Conditions may be arranged so as to ensure consistent ethanol treated spore preparation , but increase in their rela compositions of sporulated organisms, are less prone to tive abundance through time post treatment with the prepa contamination , and are more amenable to scale - up , e . g . - 30 ration due to the formation of favorable growth conditions closed stirred fermenters with feedback control loops . Spo - by the treatment. Notably , the latter OTUs can grow from rulated organisms from the process may be isolated using low frequency reservoirs in the patient, or be introduced procedures that alone or combined stringently eliminate from exogenous sources such as diet . OTUs that comprise a non - spores and other process residuals , e . g . - solvent treat “ core” augmented or engrafted ecology can be defined by ment, aqueous two - phase extraction , and / or 60° C . long - 35 the percentage of total patients in which they are observed time heat treatment. Preservation may involve addition of to engraft and / or augment; the greater this percentage the excipients and /or adjustment of conditions to enable con more likely they are to be part of a core ecology responsible version to a preferred dosage form amenable to long - term for catalyzing a shift away from a dysbiotic ecology . The shelf storage , e. g . — addition of trehalose , followed by dominant OTUs in an ecology can be identified using lyophilization or spray drying , further blending of the pow - 40 several methods including but not limited to defining the der with microcrystalline cellulose, and encapsulation in a OTUs that have the greatest relative abundance in either the gelatin capsule to form an orally dosable product . augmented or engrafted ecologies and defining a total rela tive abundance threshold . As example, the dominant OTUS Example 25 : Engraftment, Augmentation and in the augmented ecology of Patient- 1 were identified by Reduction of Pathogen Carriage in Patients Treated 45 defining the OTUs with the greatest relative abundance , with Spore Compositions which together comprise 60 % of the microbial carriage in this patient' s augmented ecology . Complementary genomic and microbiological methods See FIG . 18 : Microbial diversity measured in the ethanol were used to characterize the composition of the microbiota treated spore treatment sample and patient pre - and post from Patient 1 , 2 , 3 , 4 , and 5 , 6 , 7 , 8 , 9 , and 10 at 50 treatment samples . Total microbial diversity is defined using pretreatment (pretreatment ) and on up to 4 weeks post- the Chaol Alpha -Diversity Index and is measured at differ treatment. ent genomic sampling depths to confirm adequate sequence To determine the OTUs that engraft from treatment with coverage to assay the microbiome in the target samples. The an ethanol treated spore preparation in the patients and how patient pretreatment (purple ) harbored a microbiome that their microbiome changed in response , the microbiome was 55 was significantly reduced in total diversity as compared to characterized by 16S - V4 sequencing prior to treatment the ethanol treated spore treatment ( red ) and patient post (pretreatment ) with an ethanol treated spore preparation and treatment at days 5 (blue ) , 14 ( orange ) , and 25 ( green ). up to 25 days after receiving treatment. As example , the See FIG . 19 : Patient microbial ecology is shifted by treatment of patient 1 with an ethanol treated spore prepa - treatment with an ethanol treated spore treatment from a ration led to the engraftment of OTUs from the spore 60 dysbiotic state to a state of health . Principle Coordinates treatment and augmentation in the microbiome of the patient Analysis based on the total diversity and structure of the ( FIG . 18 and FIG . 19 ) . By day 25 following treatment, the microbiome (Bray - Curtis Beta -Diversity ) of the patient pre total microbial carriage was dominated by species of the and post - treatment delineates that the engraftment ofOTUS following taxonomic groups : Bacteroides , Sutterella , Rumi- from the spore treatment and the augmentation of the patient nococcus, Blautia , Eubacterium , Gemmiger / Faecalibacte - 65 microbial ecology leads to a microbial ecology that is rium , and the non - sporeforming Lactobacillus ( see Table 16 distinct from both the pretreatment microbiome and the and Table 2 for specific OTUs) . The first two genera ecology of the ethanol treated spore treatment (Table 16 ) . US 9 ,855 ,303 B2 71 See FIG . 20 : Augmentation of Bacteroides species in is a resident of the human microbiome in only about 2 % of patients . Comparing the number of Bacteroides fragilis subjects based on an analysis of HMP database ( www .hmp groups species per cfu / g of feces pre - treatment and in week dacc. org ) , and the mean relative abundance of Klebsiella is 4 post treatment reveals an increase of 4 logs or greater. The only about 0 .09 % in the stool of these people. It ' s surprising ability of 16S - V4 OTU identification to assign an OTU as a 5 presence at 20 % relative abundance in Patient 1 before specific species depends in part on the resolution of the treatment is an indicator of a proinflammatory gut environ 16S - V4 region of the 16S gene for a particular species or ment enabling a " pathobiont” to overgrow and outcompete group of species . Both the density of available reference 16S the commensal organisms normally found in the gut . Simi sequences for different regions of the tree as well as the larly , the dramatic overgrowth of Fusobacterium indicates a inherent variability in the 16S gene between different spe - 10 profoundly dysbiotic gut microbiota . One species of Fuso cies will determine the definitiveness of a taxonomic anno - bacterium , F . nucleatum (an OTU phylogenetically indis tation to a given sequence read . Given the topological nature tinguishable from Fusobacterium sp . 3 _ 1 _ 33 based on 16S of a phylogenetic tree and that the tree represents hierarchi- V4 ) , has been termed " an emerging gut pathogen ” based on cal relationships of OTUS to one another based on their its association with IBD , Crohn ' s disease , and colorectal sequence similarity and an underlying evolutionary model, 15 cancer in humans and its demonstrated causative role in the taxonomic annotations of a read can be rolled up to a higher development of colorectal cancer in animal models [ Allen level using a clade -based assignment procedure ( Table 1 ) . Vercoe , Gut Microbes ( 2011 ) 2 : 294 - 8 ). Importantly , neither Using this approach , clades are defined based on the topol- Klebsiella nor Fusobacterium was detected in the 16S -V4 ogy of a phylogenetic tree that is constructed from full - reads by Day 25 ( Table 18 ) . length 16S sequences using maximum likelihood or other 20 To further characterize the colonization of the gut by phylogenetic models familiar to individuals with ordinary Klebsiella and other Enterobacteriaceae and to speciate skill in the art of phylogenetics. Clades are constructed to these organisms, pretreatment and Day 25 fecal samples ensure that all OTUs in a given clade are : ( i ) within a stored at - 80 C as PBS - glycerol suspensions were plated on specified number of bootstrap supported nodes from one a variety of selective media including MacConkey lactose another ( generally , 1 - 5 bootstraps ) , and ( ii ) within a 5 % 25 media ( selective for gram negative enterobacteria ) and Sim genetic similarity . OTUs that are within the same clade can mons Citrate Inositol media ( selective for Klebsiella spp ) be distinguished as genetically and phylogenetically distinct Van Cregten et al, J . Clin . Microbiol. ( 1984 ) 20 : 936 - 41 ) . from OTUs in a different clade based on 16S - V4 sequence Enterobacteria identified in the patient samples included K . data . OTUs falling within the same clade are evolutionarily pneumoniae , Klebsiella sp . Co _ 9935 and E . coli . Strikingly , closely related and may or may not be distinguishable from 30 each Klebsiella species was reduced by 2 - 4 logs whereas E . one another using 16S- V4 sequence data . The power of coli, a normal commensal organism present in a healthy clade based analysis is that members of the same clade , due microbiota , was reduced by less than 1 log ( Table 19 ) . This to their evolutionary relatedness , play similar functional decrease in Klebsiella spp . carriage is consistent across roles in a microbial ecology such as that found in the human multiple patients (Table 19 ) . Four separate patients were gut. Compositions substituting one species with another 35 evaluated for the presence of Klebsiella spp . pre treatment from the same clade are likely to have conserved ecological and 4 weeks post treatment. Klebsiella spp . were detected by function and therefore are useful in the present invention . growth on selective Simmons Citrate Inositol media as Stool samples were aliquoted and resuspended 10xvol/ wt previously described . Serial dilution and plating, followed in either 100 % ethanol ( for genomic characterization ) or by determining cfu /mL titers of morphologically distinct PBS containing 15 % glycerol ( for isolation of microbes ) and 40 species and 16S full length sequence identification of rep then stored at - 80° C . until needed for use . For genomic 16S resentatives of those distinct morphological classes , allowed sequence analysis colonies picked from plate isolates had calculation of titers of specific species. their full -length 16S sequence characterized as described in The genus Bacteroides is an important member of the Examples 11 and 12 , and primary stool samples were gastrointestinal microbiota ; 100 % of stool samples from the prepared targeting the 16S - V4 region using the method for 45 Human Microbiome Project contain at least one species of heterogeneous samples in Example 10 . Bacteroides with total relative abundance in these samples Notably , 16S sequences of isolates of a given OTU are ranging from 0 . 96 % to 93 . 92 % with a median relative phylogenetically placed within their respective clades abundance of 52 .67 % (www .hmpdacc . com reference data despite that the actual taxonomic assignment of species and set HMSMCP ) . Bacteroides in the gut has been associated genus may suggest they are taxonomically distinct from 50 with amino acid fermentation and degradation of complex other members of the clades in which they fall. Discrepan - polysaccharides . Its presence in the gut is enhanced by diets cies between taxonomic names given to an OTU is based on rich in animal- derived products as found in the typical microbiological characteristics versus genetic sequencing western diet [David , L . A . et al, Nature ( 2013 ) doi: 10 . 1038 / are known to exist from the literature . The OTUs footnoted nature12820 ] . Strikingly , prior to treatment, fewer than in this table are known to be discrepant between the different 55 0 . 008 % of the 16S - V4 reads from Patient 1 mapped to the methods for assigning a taxonomic name. genus Bacteroides strongly suggesting that Bacteroides spe Engraftment of OTUs from the ethanol treated spore c ies were absent or that viable Bacteroides were reduced to preparation treatment into the patient as well as the resulting an extremely minor component of the patient ' s gut micro augmentation of the resident microbiome led to a significant biome. Post treatment, 242 % of the 16S - V4 reads could be decrease in and elimination of the carriage of pathogenic 60 assigned to the genus Bacteroides within 5 days of treatment species other than C . difficile in the patient. 16S - V4 sequenc - and by Day 25 post treatment 59 .48 % of the patients gut ing of primary stool samples demonstrated that at pretreat - microbiome was comprised of Bacteroides. These results ment, 20 % of reads were from the genus Klebsiella and an were confirmed microbiologically by the absence of detect additional 19 % were assigned to the genus Fusobacterium . able Bacteroides in the pretreatment sample plated on two These striking data are evidence of a profoundly dysbiotic 65 different Bacteroides selective media : Bacteroides Bile microbiota associated with recurrent C . difficile infection Esculin (BBE ) agar which is selective for Bacteroides and chronic antibiotic use. In healthy individuals , Klebsiella fragilis group species [Livingston , S . J. et al J. Clin . Micro US 9 ,855 ,303 B2 73 74 biol ( 1978 ) . 7: 448 -453 ] and Polyamine Free Arabinose of 5 cases of Enterobacteriaceae carriage with multiple (PFA ) agar [Noack et al . J. Nutr . (1998 ) 128 : 1385 - 1391 ; imipenem resistant organisms ( Table 22 ). modified by replacing glucose with arabinose ] . The highly In addition to speciation and enumeration , multiple iso selective BBE agar had a limit of detection of < 2x103 cfu / g , lates of each organism from Patient 4 were grown overnight while the limit of detection for Bacteroides on PFA agar was 5 in 96 -well trays containing a 2 - fold dilution series of imi approximately 2x10 ' cfu /g due to the growth of multiple penem in order to quantitatively determine the minimum non - Bacteroides species in the pretreatment sample on that inhibitory concentration (MIC ) of antibiotic . Growth of medium . Colony counts of Bacteroides species on Day 25 organisms was detected by light scattering at 600 nm on a were up to 2x1010 cfu / g , consistent with the 16S - V4 SpectraMax M5e plate reader . In the clinical setting , these sequencing , demonstrating a profound reconstitution of the 10 species are considered resistant to imipenem if they have an gut microbiota in Patient 1 ( Table 20 ). MIC of 1 ug /mL or greater. M . morganii isolates from The significant abundance of Bacteroides in Patient 1 on pretreatment samples from Patient D had MICs of 2 -4 Day 25 ( and as early as Day 5 as shown by 16S -V4 ug/ mL and P . pennerii isolates had MICs of 4 -8 ug /mL . Thus sequencing ) is remarkable . Viable Bacteroides fragilis group 15 the ethanol treated spore population administered to Patient species were not present in the ethanol treated spore popu 15 4 caused the clearance of 2 imipenem resistant organisms lation based on microbiological plating ( limit of detection of ( Table 16 ). 10 cfu /ml ) . Thus, administration of the ethanol treated spore Example 26 . Enrichment and Purification of population to Patient 1 resulted not only in the engraftment Bacteria of spore - forming species , but also the restoration of high 20 levels of non -spore forming species commonly found in To purify individual bacterial strains , dilution plates were healthy individuals through the creation of a niche that selected in which the density enables distinct separation of allowed for the repopulation of Bacteroides species . These single colonies . Colonies were picked with a sterile imple organisms were most likely either present at extremely low ment (either a sterile loop or toothpick ) and re - streaked to abundance in the GI tract of Patient 1 , or present in a 25 BBA or other solid media . Plates were incubated at 37° C . reservoir in the GI tract from which they could rebound to for 3 - 7 days. One or more well - isolated single colonies of high titer. Those species may also be reinoculated via oral the major morphology type were re - streaked . This process uptake from food following treatment. We term this healthy was repeated at least three times until a single , stable colony repopulation of the gut with OTUs that are not present in the morphology is observed . The isolated microbe was then ethanol treated spore population “ Augmentation . ” Augmen - 30 cultured anaerobically in liquid media for 24 hours or longer tation is an important phenomenon in that it shows the to obtain a pure culture of 106 - 1010 cfu /ml . Liquid growth ability to use an ethanol treated spore ecology to restore a medium might include Brain Heart Infusion -based medium healthy microbiota by seeding a diverse array or commensal (Atlas , Handbook of Microbiological Media , 4th ed , ASM organisms beyond the actual component organisms in the Press , 2010 ) supplemented with yeast extract, hemin , cys ethanol treated spore population itself ; specifically the spore 35 teine , and carbohydrates ( for example , maltose , cellobiose , treatment itself and the engraftmentof OTUs from the spore soluble starch ) or other media described previously ( e . g . see composition create a niche that enables the outgrowth of example 14 ) . The culture was centrifuged at 10 ,000xg for 5 OTUs required to shift a dysbiotic microbiome to a micro - min to pellet the bacteria , the spent culture media was bial ecology that is associated with health . The diversity of removed , and the bacteria were resuspended in sterile PBS . Bacteroides species and their approximate relative abun - 40 Sterile 75 % glycerol was added to a final concentration of dance in the gut of Patient 1 is shown in Table 21 , com - 20 % . An aliquot of glycerol stock was titered by serial prising at least 8 different species . dilution and plating . The remainder of the stock was frozen See FIG . 21: Species Engrafting versus Species Augment on dry ice for 10 -15 min and then placed at - 80 C for long ing in patients microbiomes after treatment with an ethanol- term storage . treated spore population . Relative abundance of species that 45 engrafted or augmented as described were determined based Example 27 . Cell Bank Preparation on the number of 16S sequence reads. Each plot is from a different patient treated with the ethanol- treated spore popu Cell banks (RCBs ) of bacterial strains were prepared as lation for recurrent C . difficile . follows. Bacterial strains were struck from - 80° C . frozen The impact of ethanol treated spore population treatment 50 glycerol stocks to Brucella blood agar with Hemin or on carriage of imipenem resistant Enterobacteriaceae was Vitamin K ( Atlas , Handbook of Microbiological Media , 4th assessed by plating pretreatment and Day 28 clinical ed , ASM Press , 2010 ) , M2GSC (Atlas , Handbook of Micro samples from Patients 2 , 4 and 5 on MacConkey lactose plus biological Media , 4th ed , ASM Press, 2010 ) or other solid 1 ug /mL of imipenem . Resistant organisms were scored by growth media and incubated for 24 to 48 h at 37° C . in an morphology , enumerated and DNA was submitted for full 55 anaerobic chamber with a gas mixture of H2: C02 : N , of length 16S rDNA sequencing as described above . Isolates 10 : 10 :80 . Single colonies were then picked and used to were identified as Morganella morganii, Providencia rett - inoculate 250 ml to 1 L of Wilkins - Chalgren broth , Brain geri and Proteus pennerii. Each of these are gut commensal Heart Infusion broth , M2GSC broth or other growth media , organisms; overgrowth can lead to bacteremia and / or uri - and grown to mid to late exponential phase or into the nary tract infections requiring aggressive antibiotic treat- 60 stationary phase of growth . Alternatively , the single colonies ment and , in some cases , hospitalization (Kim , B - N , et al may be used to inoculate a pilot culture of 10 ml, which were Scan J . Inf Dis (2003 ) 35 : 98 - 103 ; Lee , IK and Liu , J - W then used to inoculate a large volume culture . The growth J . Microbiol Immunol Infect (2006 ) 39 : 328 - 334 ; O 'Hara et media and the growth phase at harvest were selected to al, Clin Microbiol Rev ( 2000 ) 13 : 534 ]. The titer of organ enhance cell titer , sporulation (if desired ) and phenotypes isms at pretreatment and Day 28 by patient is shown in Table 65 that might be associated desired in vitro or in vivo . Option 22 . Importantly , administration of the ethanol treated spore a lly , Cultures were grown static or shaking , depending preparation resulted in greater than 100 - fold reduction in 4 which yielded maximal cell titer. The cultures were then US 9 ,855 ,303 B2 75 76 concentrated 10 fold or more by centrifugation at 5000 rpm Paine coined the concept “ Keystone Species ” in 1969 ( see for 20 min , and resuspended in sterile phosphate buffered Paine R T . 1969. A note on trophic complexity and com saline (PBS ) plus 15 % glycerol . 1 ml aliquots were trans- munity stability . The American Naturalist 103 : 91 - 93 . ) to ferred into 1 . 8 ml cryovials which were then frozen on dry describe the existence of such lynchpin species that are ice and stored at - 80 C . The identity of a given cell bank was 5 integral to a given ecosystem regardless of their abundance confirmed by PCR amplification of the 16S rDNA gene, in the ecological community . Paine originally describe the followed by Sanger direct cycle sequencing , and comparison role of the starfish Pisaster ochraceus in marine systems and to a curated rDNA database to determine a taxonomic ID . since the concept has been experimentally validated in Each bank was confirmed to yield colonies of a single numerous ecosystems. morphology upon streaking to Brucella blood agar or 10 Keystone OTUs and /or Functions are computationally M2GSC agar . When more than one morphology was derived by analysis of network ecologies elucidated from a observed , colonies were confirmed to be the expected spe - defined set of samples that share a specific phenotype. cies by PCR and sequencing analysis of the 16S rDNA gene . Variant colony morphologies can be observed within pure Keystone OTUs and /or Functions are defined as all Nodes cultures, and in a variety of bacteria the mechanisms of 15 within a defined set of networks thatmeet two or more of the varying colony morphologies have been well described ( van following criteria . Using Criterion 1 , the node is frequently der Woude , Clinical Microbiology Reviews, 17 :518 , 2004 ) , observed in networks, and the networks in which the node including in Clostridium species (Wadsworth -KTL Anaero is observed are found in a large number of individual bic Bacteriology Manual, 6th Ed , Jousimie -Somer , et al subjects ; the frequency of occurrence of these Nodes in 2002 ). For obligate anaerobes. RCBs were confirmed to lack 20 networks and the pervasiveness of the networks in individu aerobic colony forming units at a limit of detection of 10 als indicates these Nodes perform an important biological cfu /ml . function in many individuals . Using Criterion 2 , the node is frequently observed in networks, and each the networks in Example 28 . Titer Determination which the node is observed contain a large number of 25 Nodes — these Nodes are thus “ super - connectors ” , meaning The number of viable cells per ml was determined on the that they form a nucleus of a majority of networks and as freshly harvested , washed and concentrated culture by plat - such have high biological significance with respect to their ing serial dilutions of the RCB to Brucella blood agar or functional contributions to a given ecology . Using Criterion other solid media , and varied from 106 to 1010 cfu /ml . The 3 , the node is found in networks containing a large number impact of freezing on viability was determined by tittering 30 of Nodes (i . e. they are large networks ), and the networks in the banks after one or two freeze - thaw cycles on dry ice or which the node is found occur in a large number of subjects ; at - 80° C ., followed by thawing in an anaerobic chamber at these networks are potentially of high interest as it is room temperature . Some strains displayed a 1 - 3 log drop in unlikely that large networks occurring in many individuals viable cfu /ml after the 1st and /or 2nd freeze thaw , while the would occur by chance alone strongly suggesting biological viability of others were unaffected . 35 relevance . Optionally , the required thresholds for the fre quency at which a node is observed in network ecologies , Example 29 . Preparation of Bacterial Compositions the frequency at which a given network is observed across subject samples , and the size of a given network to be Individual strains were typically thawed on ice and com - considered a Keystone node are defined by the 50th , 70th , bined in an anaerobic chamber to create mixtures, followed 40 80th , or 90th percentiles of the distribution of these vari by a second freeze at - 80° C . to preserve the mixed samples. ables. Optionally, the required thresholds are defined by the When making combinations of strains for in vitro or in vivo value for a given variable that is significantly different from assays , the cfu in the final mixture was estimated based on themean or median value for a given variable using standard the second freeze - thaw titer of the individual strains . For parametric or non -parametric measures of statistical signifi experiments in rodents , strains may be combined at equal 45 cance . In another embodiment a Keystone node is defined as counts in order to deliver between 1e4 and le10 per strain . one that occurs in a sample phenotype of interest such as but Additionally , some bacteria may not grow to sufficient titer not limited to " health ” and simultaneously does not occur in to yield cell banks that allowed the production of composi- a sample phenotype that is not of interest such as but not tions where all bacteria were present at le10 . limited to “ disease . ” Optionally , a Keystone Node is defined 50 as one that is shown to be significantly different from what Example 30 . Identification of Keystone OTUs and is observed using permuted test datasets to measure signifi Functions cance . The human body is an ecosystem in which the microbiota , Example 31 . Identifying the Core Ecology from the and the microbiome, play a significant role in the basic 55 Ethanol Treated Spore Preparation healthy function of human systems ( e . g . metabolic , immu nological, and neurological) . The microbiota and resulting Ten different ethanol treated spore preparations were microbiome comprise an ecology of microorganisms that made from 6 different donors ( as described in Example 15 ) . co -exist within single subjects interacting with one another The spore preparations were used to treat 10 patients , each and their host ( i . e . , the mammalian subject ) to form a 60 suffering from recurrent C . difficile infection . Patients were dynamic unit with inherent biodiversity and functional char - identified using the inclusion / exclusion criteria described in acteristics . Within these networks of interacting microbes Example 18 , and donors were identified using the criteria ( i . e . ecologies ) , particular members can contribute more described in Example 1 . None of the patients experienced a significantly than others ; as such these members are also relapse of C . difficile in the 4 weeks of follow up after found in many different ecologies , and the loss of these 65 treatment, whereas the literature would predict that 70 - 80 % microbes from the ecology can have a significant impact on of subjects would experience a relapse following cessation the functional capabilities of the specific ecology . Robert of antibiotic [ Van Nood , et al, NEJM (2013 ) ]. Thus, the US 9 ,855 ,303 B2 77 78 ethanol treated spore preparations derived from multiple Bokulich , A . et al . 2013 . Quality - filtering vastly improves different donors and donations showed remarkable clinical diversity estimates from Illumina amplicon sequencing . efficacy . Nature Methods 10 : 57 -59 ) , which would equate to 2 . 2 reads To define the Core Ecology underlying the remarkable given the sequencing depth obtained for the samples ana clinical efficacy of the ethanol treated spore preparation , the 5 lyzed in this example , as cut- off which is substantially lower following analysis was carried out. The OTU composition of the spore preparation was determined by 16S - V4 rDNA than the 210 reads used in this analysis . All taxonomic and sequencing and computational assignment of OTUs per clade assignments were made for each OTU as described in Example 12 . A requirement to detect at least ten sequence Examples 12. The resulting list of OTUs, clade assignments , reads in the ethanol treated spore preparation was set as a 10 and frequency of detection in the spore preparations are conservative threshold to define only OTUs that were highly shown in Table GB . OTUs that engraft in a treated patients unlikely to arise from errors during amplification or and the percentage of patients in which they engraft are sequencing . Methods routinely employed by those familiar denoted , as are the clades , spore forming status , and Key to the art of genomic - based microbiome characterization use stone OTU status . Starred OTUs occur in 80 % of the a read relative abundance threshold of 0 .005 % (see e . g . ethanol preps and engraft in 250 % of the treated patients . TABLE GB OTUs detected by a minimum of ten 16S - V4 sequence reads in at least a one ethanol treated spore preparation ( pan - microbiome ) . % of % of Spore Patients Preps with OTU Spore Keystone OTU Clade OTU Engrafts Former OTU Prevotella _ maculosa clade _ 104 10 % 0 % N Prevotella _ copri clade _ 168 20 % 0 % Bacteroides _ caccae clade _ 170 30 % 0 % Bifidobacterium _ sp _ TM _ 7 * clade _ 172 90 % 60 % Bifidobacterium _ gallicum clade 172 70 % 20 % Bifidobacterium _ dentium clade _ 172 50 % 0 % Lactobacillus _ casei clade _ 198 20 % 10 % Actinomyces_ odontolyticus clade _ 212 20 % 30 % Clostridium _ colicanis clade _ 223 10 % 10 % Clostridiales _ sp _ SS3 _ 4 * clade _ 246 100 % 70 % Clostridium _ sporogenes clade _ 252 40 % 40 % Clostridium _ butyricum clade _ 252 20 % 20 % Clostridium _ disporicum clade _ 253 40 % 30 % Clostridium _ hylemonae * clade _ 260 100 % 50 % Clostridium _ scindens clade _ 260 10 % 60 % Coprococcus _ comes * clade _ 262 90 % 80 % Lachnospiraceae _ bacterium _ 1 _ 4 _ 56FAA * clade _ 262 90 % 80 % Ruminococcus _ torques clade _ 262 30 % 70 % Parabacteroides _ merdae clade _ 286 30 % 20 % Bifidobacterium _ bifidum clade _ 293 10 % 0 % Johnsonella _ ignava clade _ 298 10 % 10 % Blautia _ glucerasea * clade _ 309 100 % 80 % Blautia _ sp _ M25 * clade _ 309 100 % 70 % Lachnospiraceae _ bacterium _ 6 _ 1 _ 63FAA * clade _ 309 100 % 60 % Eubacterium _ cellulosolvens clade _ 309 10 % 30 % Lactobacillus fermentum clade _ 313 10 % 0 % Sarcina _ ventriculi clade _ 353 10 % 10 % Clostridium _ bartlettii * clade _ 354 90 % 70 % Clostridium _ bifermentans clade _ 354 70 % 70 % Clostridium _ mayombei clade 354 50 % 50 % Dorea _ longicatena * clade _ 360 100 % 60 % Lachnospiraceae _ bacterium _ 9 _ 1 _ 43BFAA clade _ 360 100 % 30 % Lachnospiraceae _ bacterium _ 2 _ 1 _ 58FAA * clade _ 360 80 % 80 % Lachnospiraceae _ bacterium _ 2 _ 1 _ 46FAA clade _ 360 50 % 50 % Lactobacillus _ perolens clade _ 373 10 % 0 % Bacteroides _ dorei clade _ 378 60 % 50 % Eubacterium _ biforme clade _ 385 10 % 0 % Peptoniphilus_ sp _ gpac077 clade _ 389 10 % 20 % Coprococcus _ catus * clade _ 393 100 % 70 % Eubacterium _ hallii * clade _ 396 90 % 60 % Anaerosporobacter _mobilis clade _ 396 40 % 60 % Bacteroides pectinophilus clade _ 396 10 % 60 % Lactobacillus _ hominis clade 398 10 % 0 % Lactococcus _ lactis clade _ 401 40 % 40 % Ruminococcus _ champanellensis * clade _ 406 80 % 50 % Ruminococcus _ callidus clade _ 406 10 % 10 % Clostridium _ clostridioforme * clade _ 408 100 % 60 % Eubacterium _ hadrum * clade _ 408 100 % 90 % Clostridium _ symbiosum clade _ 408 30 % 50 % Anaerostipes _ caccae clade _ 408 10 % 50 % Parasutterella _ excrementihominis clade _ 432 10 % 0 % Sutterella _ stercoricanis clade _ 432 10 % 0 % Eubacterium _ rectale * clade _ 444 100 % 80 % US 9 ,855 ,303 B2 79 80 TABLE GB -continued OTUs detected by a minimum of ten 16S - V4 sequence reads in at least a one ethanol treated spore preparation (pan -microbiome ) . % of % of Spore Patients Preps with OTU Spore Keystone OTU Clade OTU Engrafts Former OTU Lachnobacterium _ bovis * clade _ 444 100 % 80 % Desulfovibrio _ desulfuricans clade _ 445 10 % 0 % Eubacterium _ sp _ oral_ clone _ JS001 * clade _ 476 80 % 70 % Faecalibacterium _ prausnitzii * clade _ 478 100 % 60 % Subdoligranulum _ variabile * clade _ 478 100 % 80 % Coprobacillus_ sp _ D7 * clade _ 481 90 % 60 % Clostridium _ cocleatum clade _ 481 60 % 20 % Clostridium _ spiroforme clade _ 481 40 % 50 % Eubacterium _ ramulus * clade _ 482 80 % 60 % Flavonifractor _ plautii clade _ 494 70 % 60 % Pseudoflavonifractor _ capillosus clade _ 494 60 % 60 % Ruminococcaceae _bacterium _ D16 clade _ 494 30 % 50 % Acetivibrio _ cellulolyticus * clade _ 495 70 % 80 % Clostridium _ stercorarium clade _ 495 40 % 50 % Enterococcus _ durans clade _ 497 10 % 10 % Enterococcus faecium clade _ 497 10 % 10 % Dialister invisus clade _ 506 50 % 10 % Eubacterium _ limosum clade _ 512 20 % 0 % Ruminococcus flavefaciens clade _ 516 60 % 60 % Eubacterium _ ventriosum clade _ 519 30 % 60 % Bilophila _ wadsworthia clade _ 521 90 % 0 % Lachnospira _ pectinoschiza clade _ 522 40 % 60 % Eubacterium _ eligens clade _ 522 30 % 50 % Catonella _ morbi clade _ 534 20 % 0 % Clostridium _ sporosphaeroides * clade _ 537 100 % 80 % Ruminococcus _ bromii clade _ 537 60 % 30 % Clostridium _ leptum clade _ 537 40 % 70 % Clostridium _ sp _ YIT _ 12069 clade 537 40 % 60 % Clostridium _ viride clade _ 540 10 % 10 % Megamonas _ funiformis clade 542 50 % 0 % Eubacterium _ ruminantium * clade _ 543 80 % 90 % Coprococcus _ eutactus clade _ 543 20 % 20 % Collinsella _ aerofaciens clade _ 553 50 % 10 % Alkaliphilus _ metalliredigenes clade _ 554 40 % 10 % Turicibacter _ sanguinis clade _ 555 80 % 40 % Phascolarctobacterium _ faecium clade _ 556 20 % 0 % Clostridiales _ bacterium _ oral_ clone _ P4PA * clade _ 558 80 % 50 % Lutispora _ thermophila clade _ 564 100 % 0 % Coriobacteriaceae _ bacterium _ JC110 clade _ 566 70 % 0 % Eggerthella _ sp _ 1 _ 3 _ 56FAA clade _ 566 70 % 30 % Adlercreutzia _ equolifaciens clade _ 566 40 % 0 % Gordonibacter _ pamelaeae clade _ 566 30 % 0 % Slackia _ isoflavoniconvertens clade _ 566 10 % 0 % Eubacterium _ desmolans * clade _ 572 90 % 70 % Papillibacter _ cinnamivorans* clade _ 572 90 % 80 % Clostridium _ colinum clade _ 576 30 % 30 % Akkermansia _ muciniphila clade _ 583 60 % 10 % Clostridiales _ bacterium _ oral_ taxon _ F32 clade _ 584 60 % 30 % Prochlorococcus _ marinus clade _ 592 30 % 0 % Methanobrevibacter _ wolinii clade _ 595 30 % 0 % Bacteroides _ fragilis clade _ 65 20 % 30 % Lactobacillus _ delbrueckii clade _ 72 10 % 0 % Escherichia coli clade _ 92 50 % 0 % Clostridium _ sp _ D5 clade _ 96 80 % 60 % Streptococcus _ thermophilus clade _ 98 90 % 20 % Streptococcus_ sp _ CM6 clade _ 98 20 % 10 % Streptococcus _ sp _ oral_ clone _ ASCE05 clade _ 98 10 % 0 %
Next, it was reasoned that for an OTU to be considered a that an OTU must be shown to engraft in the patient member of the Core Ecology of the spore preparation , that eliminates OTUs that represent non - viable spores or con OTU must be shown to engraft in a patient . Engraftment is taminating sequences. Table GB also identifies all OTUS important for two reasons. First, engraftment is a sine qua 60 non of the mechanism to reshape the microbiome and detected in the spore preparation that also were shown to eliminate C . difficile colonization . OTUs that engraft with engraft in at least one patient post - treatment. OTUs that are higher frequency are highly likely to be a component of the present in a large percentage of the ethanol spore prepara Core Ecology of the spore preparation . Second . OTUS tions analyzed and that engraft in a large number of patients detected by sequencing the spore preparation (as in Table 65 represent a subset of the Core Ecology that are highly likely GB ) may include non - viable spores or other contaminant to catalyze the shift from a dysbiotic disease ecology to a DNA molecules not associated with spores . The requirement healthy microbiome. US 9 ,855 , 303 B2 82 A third lens was applied to further refine insights into the TABLE GC Core Ecology of the spore preparation . Computational based , network analysis has enabled the description of Top 20 OTUs ranked by CES microbial ecologies that are present in the microbiota of a Spore Keystone broad population of healthy individuals . These network 5 OTU Clade CES Former OTU ecologies are comprised of multiple OTUs, some of which Eubacterium _ hadrum clade _ 408 4 . 2 are defined as Keystone OTUs. Keystone OTUs are com Eubacterium _ rectale clade _ 444 putationally defined as described in Example 30 . Keystone Subdoligranulum _ variabile clade_ 478 4 .2 Blautia _ sp _M25 clade _ 309 4. 2 OTUs form a foundation to the microbially ecologies in that Coprococcus _ catus clade _ 393 4 . 2 they are found and as such are central to the function of Lachnospiraceae _ bac clade 262 4 . 2 network ecologies in healthy subjects . Keystone OTUS terium _ 1 _ 4 _ 56FAA associated with microbial ecologies associated with healthy Coprococcus _ comes clade _ 262 4 . 2 Blautia _ glucerasea clade _ 309 subjects are often are missing or exist at reduced levels in Lachnobacterium _ bovis clade _ 444 subjects with disease . Keystone OTUs may exist in low , 15 Clostridium _ sporosphaeroides clade _ 537 4 .0 moderate , or high abundance in subjects . Table GB further Clostridiales _ sp _ SS3 _ 4 clade _ 246 4 .0 notes which of the OTUs in the spore preparation are Papillibacter _ cinnamivorans clade _ 572 4. 0 Clostridium _ bartlettii clade _ 354 4. 0 Keystone OTUs exclusively associated with individuals that Eubacterium _ desmolans clade _ 572 4. 0 are healthy and do not harbor disease . Clostridium _ clostridioforme clade_ 408 3 . 2 There are several important findings from this data . A 30 Dorea _ longicatena clade _ 360 3 .2 Faecalibacterium _ prausnitzii clade _ 478 3 . 2 relatively small number of species , 16 in total, are detected Eubacterium _ hallii clade 396 3 . 2 in all of the spore preparations from 6 donors and 10 Clostridium _ leptum clade _ 537 3 . 2 donations. This is surprising because the HMP database Lachnospiraceae _ bac clade _ 309 3 .0 (www .hmpdacc .org ) describes the enormous variability of terium _ 6 _ 1 _ 63FAA commensal species across healthy individuals. The presence of a small number of consistent OTUs lends support to the concept of a Core Ecology . The engraftment data further supports this conclusion . A regression analysis shows a Example 32 . Defining Efficacious Subsets of the significant correlation between frequency of detection in a Core Ecology spore preparation and frequency of engraftment in a donoror : 2030 The number of organisms in the human gastrointestinal R = 0 . 43 ( p < 0 .001 ) . There is no a priori requirement that an tract, as well as the diversity between healthy individuals , is OTU detected frequently in the spore preparation will or indicative of the functional redundancy of a healthy gut should engraft. For instance , Lutispora thermophila , a spore microbiome ecology ( see The Human Microbiome Consor former found in all ten spore preparations, did not engraft in tia . 2012 . Structure , function and diversity of the healthy any of the patients . Bilophila wadsworthia , a gram negative 35, human microbiome. Nature 486 : 207 - 214 ) . This redundancy anaerobe , is present in 9 of 10 donations, yet it does not makes it highly likely that subsets of the Core Ecology engraft in any patient, indicating that it is likely a non - viable describe therapeutically beneficial components of the etha contaminant in the ethanol treated spore preparation . Finally , nol treated spore preparation and that such subsets may it is worth noting the high preponderance of previously themselves be useful compositions for the treatment of C . defined Keystone OTUs among the most frequent OTUs in 40 difficile infection given the ecologies functional character the spore preparations . istics . Using the CES, individual OTUscan be prioritized for These three factors prevalence in the spore preparation , evaluation as an efficacious subset of the Core Ecology. frequency of engraftment, and designation as a Keystone Another aspect of functional redundancy is that evolu OTUS - enabled the creation of a “ Core Ecology Score " tionarily related organisms ( i. e . those close to one another on ( CES ) to rank individual OTUS. CES was defined as fol 45 the phylogenetic tree , e . g. those grouped into a single clade ) lows: will also be effective substitutes in the Core Ecology or a 40 % weighting for presence of OTU in spore preparation subset thereof for treating C . difficile . multiplier of 1 for presence in 1 - 3 spore preparations To one skilled in the art , the selection of appropriate OTU multiplier of 2 . 5 for presence in 4 - 8 spore preparations subsets for testing in vitro (e .g . see Example 33 below ) or in multiplier of 5 for presences in 9 spore preparations 50 vivo (e . g . see Examples 16 or 17 ) is straightforward . Subsets 40 % weighting for engraftment in a patient may be selected by picking any 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , or multiplier of 1 for engraftment in 1 - 4 patients more than 10 OTUs from Table GB , with a particular multiplier of 2 .5 for engraftment in 5 - 6 patients emphasis on those with higher CES , such as the OTUS multiplier of 5 for engraftment in 27 patients described in Table GC . In addition , using the clade relation 20 % weighting to Keystone OTUS 55 ships defined in Example 12 and Table 1 above , related multiplier of 1 for a Keystone OTU OTUS can be selected as substitutes for OTUs with accept multiplier of 0 for a non -Keystone OTU able CES values . These organisms can be cultured anaero Using this guide, the CES has a maximum possible score bically in vitro using the appropriate media ( selected from of 5 and a minimum possible score of 0 . 8 . As an example , those described in Example 14 above ) , and then combined an OTU found in 8 of the 10 spore preparations that 60 in a desired ratio . A typical experiment in the mouse C . engrafted in 3 patients and was a Keystone OTU would be difficile model utilizes at least 10 + and preferably at least 105, assigned the follow CES: 106, 107, 108 , 109 or more than 10° colony forming units of a each microbe in the composition . Variations in the culture CES = ( 0 .4x2 . 5 ) + ( 0 .4x1 ) + ( 0 . 2x1) = 1 . 6 yields may sometimes mean that organisms are combined in Table GC ranks the top 20 OTUs by CES with the further 65 unequal ratios, e .g . 1: 10 , 1: 100 , 1: 1, 000 , 1: 10 ,000 , 1 : 100 , requirement that an OTU must be shown to engraft to be a 000 , or greater than 1 : 100 , 000 . What is important in these considered an element of a core ecology. compositions is that each strain be provided in a minimum US 9 ,855 ,303 B2 83 84 amount so that the strain ' s contribution to the efficacy of the the animal was assessed with weight loss being associated Core Ecology subset can be measured . Using the principles with C . difficile infection . Mortality and reduced weight loss and instructions described here , it is straightforward for one of the test article compared to the empty vehicle was used to of skill in the art to make clade -based substitutions to test the assess the success of the test article . Additionally, a C . efficacy of subsets of the Core Ecology. Table GB describes 5 difficile symptom scoring was performed each day from day the clades for each OTU detected in a spore preparation and - 1 through day 6 . Symptom scoring was based on Appear Table 1 describes the OTUs that can be used for substitutions ance ( 0 - 2 pts based on normal , hunched , piloerection , or based on clade relationships . lethargic ) , Respiration ( 0 - 2 pts based on normal, rapid or shallow , with abdominal breathing) , Clinical Signs ( 0 - 2 Example 33 . Testing Subsets of the Core Ecology points based on normal, wet tail , cold - to - the- touch , or iso in the Mouse Model lation from other animals ). In addition to compiling the cumulative mortality for each Several subsets of the Core Ecology were tested in the C . arm , the average minimum relative weight is calculated as difficile mouse model. The negative control was phosphate the mean of each mouse 's minimum weight relative to Day buffered saline and the positive control was a 10 % human 15 - 1 and the average maximum clinical score is calculated as fecal suspension . The subsets are described in Table GD . the mean of each mouse ' s maximum combined clinical score with a score of 4 assigned in the case of death . The TABLE GD results are reported in Table GE . Subsets of the Core Ecology tested in the C . difficile mouse model 20 TABLE GE Substitute For Subset OTU OTU in Table 1 (Clade ) Results of bacterial compositions tested in a C . difficile mouse model. Subset 1 Collinsella aerofaciens none (Clade _ 553 ) Avg. Avg . Clostridium tertium C . sporogenes (Clade _ 252 ) Cumulative Minimum Maximum Clostridium disporicum none (Clade _ 253 ) 2525 Mortality Relative Clinical Score Clostridium innocuum Clostridium _ sp _ HGF2 Group DoseDose ( % ) Weight (Death = 4 ) (Clade _ 351) 1 Clostridium mayombei none ( Clade _ 354 ) Vehicle 40 0 . 87 2 . 8 Clostridium butyricum none ( Clade _ 252 ) Control Coprococcus comes none (Clade _ 262 ) Feces 5 . 8e8 cfu total 0 . 99 Clostridium hylemonae none (Clade _ 260 ) 30 Control Clostridium bolteae E . hadrum (Clade _ 408 ) Subset 1 1e8 cfu /OTU 0 . 98 o Clostridium symbiosum C . clostridioforme (Clade _ 408 ) Subset 2 1e8 cfu OTU o09908go10 0 . 84 2 . 1 Clostridium orbiscindens R . _ bacterium _ D16 ( Clade _ 494 ) Subset 3 1e8 cfu / OTU 10 0 . 84 Lachnospiraceae C . scindens ( Clade _ 260 ) Subset 4 1e8 cfu /OTU 0 0 .87 NEN bacterium _ 5 _ 1 _ 57FAA Subset 5 1e8 cfu /OTU 20 0 . 91 1 . 7 Blautia producta Blautia _ sp _ M25 (Clade _ 309 ) 35 Subset 6 le8 cfu /OTU 40 0 . 82 2 . 8 Ruminococcus gnavus D . longi catena ( Clade _ 360 ) Subset 7 1e8 cfu /OTU 0 .90 1 Ruminococcus bromii none ( Clade _ 537 ) Subset 2 Collinsella aerofaciens none ( Clade _ 553 ) Clostridium butyricum none ( Clade _ 252 ) Clostridium hylemonae none ( Clade _ 260 ) Example 34 . Defining Subsets of the Core Ecology Blautia producta Blautia _ sp _ M25 ( Clade _ 309 ) 40 Subset 3 Collinsella aerofaciens none (Clade _ 553 ) in the In Vitro C . difficile Inhibition Assay Clostridium innocuum Clostridium _ sp _ HGF2 ( Clade _ 351) Vials of - 80° C . glycerol stock banks were thawed and Coprococcus comes none (Clade _ 262 ) diluted to le8 CFU /mL . Selected strains and their clade Ruminococcus bromii none ( Clade _ 537 ) assignment are given in Table GF. Each strain was then Subset 4 Clostridium butyricum none ( Clade _ 252 ) Clostridium hylemonae none (Clade _ 260 ) 45 diluted 10x ( to a final concentration of 1e7 CFU /mL of each Blautia producta Blautia _ sp _M25 ( Clade _ 309 ) strain ) into 200 uL of PBS + 15 % glycerol in the wells of a Subset 5 Clostridium butyricum none (Clade _ 252 ) 96 -well plate . Plates were then frozen at - 80° C . When Clostridium hylemonae none ( Clade _ 260 ) needed for the assay, plates were removed from - 80° C . and Subset 6 Blautia producta Blautia _ sp _ M25 (Clade _ 309 ) Clostridium butyricum none ( Clade _ 252 ) thawed at room temperature under anaerobic conditions Subset 7 Clostridium orbiscindens R . bacterium D16 (Clade 494 ) 50 when testing in a in vitro C . difficile inhibition assay Lachnospiraceae C . scindens ( Clade _ 260 ) (CivSim ) . bacterium _ 5 _ 1 _ 57FAA An overnight culture of Clostridium difficile is grown iiiiii Eubacterium rectale none ( Clade _ 444 ) under anaerobic conditions in Sweet B - Fosin or other suit able media for the growth of C . difficile . SweetB -Fosln is a Two cages of five mice each were tested for each arm of 55 complex media composed of brain heart infusion , yeast the experiment. All mice received an antibiotic cocktail extract , cysteine , cellobiose , maltose , soluble starch , and consisting of 10 % glucose, kanamycin ( 0 .5 mg/ ml ) , gen - fructooligosaccharides / inulin , and hemin , and is buffered tamicin ( 0 .044 mg/ ml ) , colistin ( 1062 . 5 U /ml ) , metronida with MOPs. After 24 hr of growth the culture is diluted zole ( 0 .269 mg/ml ) , ciprofloxacin ( 0 . 156 mg/ ml ) , ampicillin 100 , 000 fold into a complex media such as SweetB - Fosin (0 . 1 mg/ ml ) and Vancomycin ( 0 .056 mg /ml ) in their drink - 60 which is suitable for the growth of a wide variety of ing water on days – 14 through - 5 and a dose of 10 mg/ kg anaerobic bacterial species . The diluted C . difficile mixture Clindamycin by oral gavage on day - 3. On day - 1, they is then aliquoted to wells of a 96 -well plate ( 180 uL to each received either the test articles or control articles via oral well ). 20 uL of a subset Core Ecology is then added to each gavage . On day Othey were challenged by administration of well at a final concentration of 1e6 CFU /mL of each species . approximately 4 . 5 log 10 cfu of C . difficile ( ATCC 43255 ) 65 Alternatively the assay can be tested each species at different via oral gavage . Mortality was assessed every day from day initial concentrations ( 1e9 CFU /mL , le8 CFU /mL , le7 O to day 6 and the weight and subsequent weight change of CFU /mL , 1e5 CFU /mL , 1e4 CFU /mL , 1e3 CFU /mL , 1e2 US 9 ,855 ,303 B2 85 86 CFU /mL ). Control wells only inoculated with C . difficile are cules, Calif .) . The qPCR is performed on a BioRad C1000TM included for a comparison to the growth of C . difficile Thermal Cycler equipped with a CFX96TM Real- Time Sys without inhibition . Additional wells are used for controls tem (BioRad , Hercules , Calif. ). The thermocycling condi tions are 95° C . for 15 minutes followed by 45 cycles of 95° that either inhibit or do not inhibit the growth of C . difficile . 5 C . for 5 seconds, 60° C . for 30 seconds , and fluorescent One example of a positive control that inhibits growth is a 5 readings of the FAM channel. Alternatively , the qPCR is combination of Blautia producta , Clostridium bifermentans performed with other standard methods known to those and Escherichia coli . One example of a control that shows skilled in the art. reduced inhibition of C . difficile growth is a combination of The Cq value for each well on the FAM channel is Bacteroides thetaiotaomicron , Bacteroides ovatus and determined by the CFX ManagerTM 3 . 0 software . The logio Bacteroides vulgatus . Plates are wrapped with parafilm and " (cfu /mL ) of C . difficile each experimental sample is calcu incubated for 24 hr at 37° C . under anaerobic conditions . lated by inputting a given sample 's Cq value into a linear After 24 hr the wells containing C . difficile alone are serially regression model generated from the standard curve com diluted and plated to determine titer. The 96 - well plate is paring the Cq values of the standard curve wells to the then frozen at - 80 C before quantifying C . difficile by qPCR known log10 ( cfu /mL ) of those samples. The log inhibition assay . is calculated for each sample by subtracting the log10 A standard curve is generated from a well on each assay ( cfu /mL ) of C . difficile in the sample from the logo ( cfu /mL ) plate containing only pathogenic C . difficile grown in of C . difficile in the sample on each assay plate used for the SweetB + Fosin media and quantified by selective spot plat generation of the standard curve that has no additional ing . Serial dilutions of the culture are performed in sterilen bacteria added . The mean log inhibition is calculated for all phosphate -buffered saline. Genomic DNA is extracted from - replicates for each composition . the standard curve samples along with the other wells . A histogram of the range and standard deviation of each Genomic DNA is extracted from 5 ulof each sample using composition is plotted . Ranges or standard deviations of the a dilution , freeze / thaw , and heat lysis protocol. 5 uL of log inhibitions that are distinct from the overall distribution thawed samples is added to 45 uL of UltraPure water (Life are examined as possible outliers. If the removal of a single Technologies , Carlsbad , Calif. ) and mixed by pipetting . The log inhibition datum from one of the binary pairs that is plates with diluted samples are frozen at - 20° C . until use for identified in the histograms would bring the range or stan qPCR which includes a heated lysis step prior to amplifi dard deviation in line with those from the majority of the cation . Alternatively the genomic DNA is isolated using the samples , that datum is removed as an outlier, and the mean Mo Bio Powersoil® -htp 96 Well Soil DNA Isolation Kit - log inhibition is recalculated . (Mo Bio Laboratories, Carlsbad , Calif . ) , Mo Bio Power - > The pooled variance of all samples evaluated in the assay soil® DNA Isolation Kit (Mo Bio Laboratories , Carlsbad , is estimated as the average of the sample variances weighted Calif . ) , or the QIAamp DNA Stool Mini Kit ( QIAGENJEN ,, by the sample ' s degrees of freedom . The pooled standard Valencia , Calif . ) according to the manufacturer ' s instruc error is then calculated as the square root of the pooled tions. variance divided by the square root of the number of The qPCR reaction mixture contains 1x SsoAdvanced samples. Confidence intervals for the null hypothesis are Universal Probes Supermix , 900 nM of Wr- tedB - F primer determined by multiplying the pooled standard error to the (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG ( SEQZ score corresponding to a given percentage threshold . Mean ID NO : 2040 ) , IDT, Coralville , Iowa) , 900 nM of Wr- tcdB - R log inhibitions outside the confidence interval are considered primer (CATGCTTTTTTAGTTTCTGGATTGAA (SEQ ID to be inhibitory if positive or stimulatory if negative with the NO : 2041 ) , IDT, Coralville , Iowa) , 250 nM of Wr- tedB - P to percent confidence corresponding to the interval used. Ter probe (6FAM -CATCCAGTCTCAATTGTATAT nary combinations with mean log inhibition greater than GTTTCTCCA -MGB ( SEO ID NO : 2042 ) , Life Technolo - 0 . 312 are reported as + + + + ( 299 % confidence interval ( C . I. ) gies , Grand Island , N . Y . ) , and Molecular Biology Grade of the null hypothesis ) , those with mean log inhibition Water (Mo Bio Laboratories , Carlsbad , Calif . ) to 18 ul between 0 .221 and 0 . 312 as + + + ( 95 % < C . I . < 99 % ), those ( Primers adapted from : Wroblewski, D . et al. , Rapido with mean log inhibition between 0 . 171 and 0 .221 as Molecular Characterization of Clostridium difficile and + + ( 90 % < C . 1 . < 95 % ) , those with mean log inhibition Assessment of Populations of C . difficile in Stool Speci- between 0 . 113 and 0 . 171 as + (80 % < C . I . < 90 % ) , those with mens, Journal of Clinical Microbiology 47 : 2142 - 2148 mean log inhibition between - 0 . 113 and - 0 . 171 as - ( 2009 ) ) . This reaction mixture is aliquoted to wells of a (80 % < C . I. < 90 % ) , those with mean log inhibition between Hard - shell Low - Profile Thin Wall 96 -well Skirted PCR Plate » - 0 . 171 and - 0 . 221 as - - ( 90 % < C . I. < 95 % ), those with mean ( BioRad , Hercules , Calif. ) . To this reaction mixture , 2 ul of log inhibition between - 0 .221 and - 0 .312 as - - - diluted , frozen , and thawed samples are added and the plate ( 95 % < C . I . < 99 % ) , and those with mean log inhibition less sealed with a Microseal ' B ' Adhesive Seal (BioRad , Her - than - 0 .312 as - - - - ( 99 % < C . I. ) . TABLE GF OTUs and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay OTU1 Cladel OTU2 Clade2 OTU3 Clade3 Results Clostridium _ bolteae clade_ 408 Blautia _ producta clade _ 309 Eubacterium _ rectale clade _ 444 + + + + Clostridium _ bolteae clade _ 408 Clostridium _ symbiosum clade _ 408 Blautia _ producta clade _ 309 + + + + Clostridium _ bolteae clade _ 408 Clostridium _ symbiosum clade _ 408 Eubacterium _ rectale clade _ 444 - Clostridium _ bolteae clade _ 408 Clostridium _ symbiosum clade _ 408 Faecalibacterium _ clade_ 478 - prausnitzii Clostridium _ bolteae clade _ 408 Clostridium _ symbiosum clade _ 408 Lachnospiraceae _ clade _ 260 bacterium _ 5 _ 1 _ 57FAA US 9 ,855 ,303 B2 87 88 TABLE GF -continued OTUS and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay OTU1 Cladel OTU2 Clade2 OTU3 Clade3 Results Clostridium _ bolteae clade _ 408 Faecalibacterium _ clade_ 478 Blautia _ producta clade _ 309 + + + + prausnitzii Clostridium _ boltede clade _ 408 Faecalibacterium clade _ 478 Eubacterium _ rectale clade _ 444 prausnitzii Clostridium _ bolteae clade _ 408 Faecalibacterium clade _ 478 Lachnospiraceae _ clade _ 260 + + + + prausnitzii bacterium _ 5 _ 1 _ 57FAA Clostridium _ bolteae clade _ 408 Lachnospiraceae _ clade _ 260 Blautia _ producta clade _ 309 + + + + bacterium _ 5 _ 1 _ 57FAA Clostridium _ boltede clade _ 408 Lachnospiraceae _ clade _ 260 Eubacterium _ rectale clade _ 444 *+ bacterium _ 5 _ 1 _ 57FAA Clostridium _ symbiosum clade _ 408 Blautia _ producta clade _ 309 Eubacterium _ rectale clade _ 444 + + + + Clostridium _ symbiosum clade _ 408 Faecalibacterium clade _ 478 Blautia _ producta clade _ 309 + + + + prausnitzii Clostridium _ symbiosum clade _ 408 Faecalibacterium _ clade _ 478 Eubacterium _ rectale clade _444 prausnitzii Clostridium _ symbiosum clade _ 408 Faecalibacterium _ clade _ 478 Lachnospiraceae _ clade _ 260 + prausnitzii bacterium _ 5 _ 1 _ 57FAA Clostridium _ symbiosum clade _ 408 Lachnospiraceae clade _ 260 Blautia _ producta clade _ 309 + + + + bacterium _ 5 _ 1 _ 57FAA Clostridium _ symbiosum clade _ 408 Lachnospiraceae clade _ 260 Eubacterium _ rectale clade _ 444 bacterium _ 5 _ 1 _ 57FAA Collinsella _ aerofaciens clade _ 553 Blautia _ producta clade _ 309 Eubacterium _ rectale clade _ 444 + + + + Collinsella _ aerofaciens clade _ 553 Clostridium _ bolteae clade _ 408 Blautia _ producta clade _ 309 + + + + Collinsella _ aerofaciens clade _ 553 Clostridium _ bolteae clade _ 408 Clostridium _ symbiosum clade _ 408 + + + + Collinsella _ aerofaciens clade _ 553 Clostridium _ bolteae c lade _ 408 Eubacterium _ rectale clade _ 444 + + + + Collinsella _ aerofaciens clade _ 553 Clostridium _ bolteae clade _ 408 Faecalibacterium _ clade _ 478 + + + + prausnitzii Collinsella _ aerofaciens clade _ 553 Clostridium _ bolteae clade _ 408 Lachnospiraceae clade _ 260 + + + + bacterium _ 5 _ 1 _ 57FAA Collinsella _aerofaciens clade _ 553 Clostridium _ symbiosum clade _ 408 Blautia _ producta clade _ 309 + + + + Collinsella _ aerofaciens clade _ 553 Clostridium _ symbiosum clade _ 408 Eubacterium _ rectale clade _ 444 Collinsella _ aerofaciens clade _ 553 Clostridium _ symbiosum clade_ 408 Faecalibacterium _ clade 478 prausnitzii Collinsella _ aerofaciens clade _ 553 Clostridium _ symbiosum clade_ 408 Lachnospiraceae _ clade _ 260 + bacterium _ 5 _ 1 _ 57FAA Collinsella _ aerofaciens clade _ 553 Coprococcus_ comes clade _ 262 Blautia _ producta clade _ 309 + + + + Collinsella _ aerofaciens clade _ 553 Coprococcus_ comes clade _ 262 Clostridium _ boltede clade _ 408 + + + + Collinsella _ aerofaciens clade _ 553 Coprococcus_ comes clade _ 262 Clostridium _ symbiosum clade _ 408 + + + Collinsella _ aerofaciens clade _ 553 Coprococcus_ comes clade _ 262 Eubacterium _ rectale clade _ 444 + + + Collinsella _aerofaciens clade _ 553 Coprococcus _ comes clade _ 262 Faecalibacterium _ clade 478 + + + + prausnitzii Collinsella _ aerofaciens clade_ 553 Coprococcus_ comes clade_ 262 Lachnospiraceae clade _ 260 + + + bacterium _ 5 _ 1 _ 57FAA Collinsella _ aerofaciens clade _ 553 Faecalibacterium _ clade _ 478 Blautia _ producta clade_ 309 + + + + prausnitzii Collinsella _ aerofaciens clade _ 553 Faecalibacterium _ clade_ 478 Eubacterium _ rectale clade _ 444 + + + prausnitzii Collinsella _ aerofaciens clade_ 553 Faecalibacterium _ clade _ 478 Lachnospiraceae _ clade_ 260 + + + prausnitzii bacterium _ 5 _ 1 _ 57FAA Collinsella _ aerofaciens clade _ 553 Lachnospiraceae _ clade _ 260 Blautia _ producta clade _ 309 + + + + bacterium _ 5 _ 1 _ 57FAA Collinsella _ aerofaciens clade _553 Lachnospiraceae _ clade _ 260 Eubacterium _ rectale clade_ 444 + + + + bacterium _ 5 _ 1 _ 57FAA Coprococcus _ comes clade _ 262 Blautia _ producta clade _ 309 Eubacterium _ rectale clade _ 444 + + + + Coprococcus _ comes clade _ 262 Clostridium _ bolteae clade _ 408 Blautia _ producta clade _ 309 + + + + Coprococcus _ comes clade _ 262 Clostridium _ bolteae clade _ 408 Clostridium _ symbiosum clade_ 408 Coprococcus _ comes clade _ 262 Clostridium _ bolteae clade 408 Eubacterium rectale clade 444 - - Coprococcus _ comes clade _ 262 Clostridium _ bolteae clade _ 408 Faecalibacterium _ clade _ 478 + + + prausnitzii Coprococcus _ comes clade _ 262 Clostridium _ bolteae clade _ 408 Lachnospiraceae _ clade _ 260 + + + bacterium _ 5 _ 1 _ 57FAA Coprococcus _ comes clade _ 262 Clostridium _ symbiosum clade _ 408 Blautia _ producta clade _ 309 + + + + Coprococcus _ comes clade _ 262 Clostridium _ symbiosum clade _ 408 Eubacterium _ rectale clade _ 444 - - - Coprococcus _ comes clade _ 262 Clostridium _ symbiosum clade _ 408 Faecalibacterium _ clade _ 478 prausnitzii Coprococcus_ comes clade _ 262 Clostridium _ symbiosum clade _ 408 Lachnospiraceae _ clade _ 260 bacterium _ 5 _ 1 _ 57FAA Coprococcus _ comes clade _ 262 Faecalibacterium _ clade _ 478 Blautia _ producta clade _ 309 + + + + prausnitzii 'll Coprococcus _ comes clade_ 262 Faecalibacterium clade _ 478 Eubacterium _ rectale clade _ 444 - prausnitzii Coprococcus _ comes clade_ 262 Faecalibacterium _ clade _ 478 Lachnospiraceae _ clade _ 260 prausnitzii bacterium _ 5 _ 1 _ 57FAA Coprococcus _ comes clade _ 262 Lachnospiraceae _ clade_ 260 Blautia _ producta clade _ 309 + + + + bacterium _ 5 _ 1 _ 57FAA US 9 ,855 ,303 B2 89 90 TABLE GF - continued OTUS and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay OTU1 Cladel OTU2 Clade2 OTU3 Clade3 Results Coprococcus _ comes clade _ 262 Lachnospiraceae _ clade _ 260 Eubacterium _ rectale clade _ 444 bacterium _ 5 _ 1 _ 57FAA Faecalibacterium _ clade _478 Blautia _ producta clade _ 309 Eubacterium _ rectale clade_ 444 + + + + prausnitzii Faecalibacterium clade _ 478 Lachnospiraceae _ clade _ 260 Blautia _ producta clade _ 309 + + + + prausnitzii bacterium _ 5 _ 1 _ 57FAA Faecalibacterium clade _ 478 Lachnospiraceae _ clade _ 260 Eubacterium _ rectale clade _ 444 prausnitzii bacterium _ 5 _ 1 _ 57FAA Lachnospiraceae clade_ 260 Blautia _ producta clade _ 309 Eubacterium _ rectale clade _ 444 + + + + bacterium _ 5 _ 1 _ 57FAA
The CivSim shows that many ternary combinations with approximately 104. 5 spores of Clostridium difficile inhibit C . difficile . 39 of 56 combinations show inhibition (ATCC 43255 ) via oral gavage . Mortality for C . difficile with a confidence interval > 80 % ; 36 of 56 with a C . I. > 90 % ; challenged animals was assessed every day from Day O to 36 of 56 with a C .I . > 95 % ; 29 of 56 with a C . I . of > 99 % . 20 Day 6 and the weight and subsequent weight change of the Non - limiting but exemplary ternary combinations include animal was assessed with weight loss being associated with those with mean log reduction greater than 0 . 171, e . g . any C . difficile infection . Mortality and reduced weight loss of combination shown in Table 6 with a score of + + + + , such as the test article compared to the empty vehicle was used to Colinsella aerofaciens , Coprococcus comes, and Blautia assess the success of the test article . producta . Equally important, the CivSim assay describes ternary combinations that do not effectively inhibit C . dif TABLE ZA ficile . 5 of 56 combinations promote growth with > 80 % confidence; 2 of 56 promote growth with > 90 % confidence ; Microbial compositions administered via oral gavage on Day - 1 1 of 56 , Coprococcus comes, Clostridium symbiosum and 30 Eubacterium rectale , promote growth with > 95 % confi OTU Clade dence . 12 of 56 combinations are neutral in the assay, MicrobialMicrobial Clostridium _ butyricum clade _ 252 meaning they neither promote nor inhibit C . difficile growth Composition 1 Clostridium _ disporicum clade _ 253 Clostridium _ hylemonae clade _ 260 to the limit of measurement. Clostridium _ orbiscindens clade _ 494 It is straightforward for one of skill in the art to use the 35 Clostridium _ symbiosum clade _ 408 CivSim method to determine efficacious subsets of the Core Collinsella _ aerofaciens clade _ 553 Ecology derived from the ethanol treated spore fraction Coprococcus _ comes clade _ 262 shown to be efficacious in treating C . difficile in humans. Lachnospiraceae _ bacterium _ 5 _ 1 _ 57FAA clade _ 260 Example AAZA : Bacterial Compositions Populating the Ruminococcus_ bromii clade _ 537 Gut in a Mouse Model 40 Blautia _ producta clade _ 309 Two bacterial compositions were evaluated in a mouse Clostridium _ bolteae clade _ 408 model to demonstrate the ability to populate the gastroin Clostridium _ innocuum clade _ 351 testinal tract . Bacteria were grown as described in Clostridium _mayombei clade _ 354 Clostridium _ tertium clade _ 252 * * * Example 14 . Compositions were pre -made under Ruminococcus _ gnavus clade _ 360 anaerobic conditions and suspended in PBS + 15 % glycerol 45 Microbial Clostridium _ disporicum clade _ 253 and stored at 2 - 70° C . prior to Groups of mice ( 10 females / Composition 2 Clostridium _ orbiscindens clade _ 494 group ; 5 per cage ) were pre - treated on Days - 14 to - 5 with Clostridium _ symbiosum clade _ 408 an antibiotic cocktail consisting of 10 % glucose , kanamycin Collinsella _ aerofaciens clade _ 553 ( 0 . 5 mg/ ml ) , gentamicin ( 0 . 044 mg/ml ) , colistin ( 1062. 5 Eubacterium _ rectale clade _ 444 U /ml ), metronidazole ( 0 . 269 mg/ ml ) , ciprofloxacin ( 0 . 156 50 Lachnospiraceae _ bacterium _ 5 _ 1 _ 57FAA clade _ 260 mg/ ml ) , ampicillin ( 0 . 1 mg/ml ) and vancomycin ( 0 .056 Blautia _ producta clade _ 309 mg/ ml ) in their drinking water . On Day - 3 they received 10 Clostridium_ innoc??? clade 351 mg/ kg Clindamycin by oral gavage . On Day - 1 , they were Clostridium _mayombei clade _ 354 dosed with a microbial compositions by oral gavage in a volume of 0 . 2 mL ( Table ZA ). Microbial compositions 55 comprised approximately equal numbers of each OTU and Fecal samples were processed by isolating and sequenc were dosed at approximately 1x10° , 1x108 and 1x107 per ing DNA according to * * * Example 11 and 12 . The OTU OTU for each composition (e .g . microbial composition 1 , assignment of fecal samples from Days - 1 , 2 , 3 and 4 was comprising 15 strains , was dosed at approximately 1 . 5x1010 , determined by analyzing 16S - V4 sequence reads and assign 1 .5x109 , and 1. 5x108 total CFU ) . Fecal samples were col- 60Going OTUs as described in * * * Example 11 . Glades were lected from each cage on Day - 1 ( approximately 1 hour assigned as described in * * * Example 11 . Total read counts before dosing ) and on Days 2 , 3 and 4 post - dosing . Feces were determined for each OTU or each clade by summing were stored frozen prior to processing and sequencing the results from cages of the same experimental group . Weight gain of mice treated with either microbial compo Samples with 10 or fewer sequence reads for a given OTU sitions was similar to that of naive , control mice . 65 or clade were considered to be below background and were In parallel, groups of animals treated with the same not included in the summation process . Results are shown by microbial compositions on Day - 1 were challenged on Day OTU ( Table TAB ) and by clade ( Table TAC ) . US 9 ,855 ,303 B2 91 TABLE TAB Population of OTUs on Days 2 , 3 and 4 following dosing with Microbial Compositions 1x 10° per OTU 1x 108 per OTU 1 x 107 per OTU - 1 2 3 4 - 1 2 3 4 - 1 2 3 4 Microbial comp 1 cl_ butyricum 0 106 51 32 0 10 0 34 195 0 0 0 Cl_ disporicum 10 1746 1190 887 0 1746 769 1011 201 11175 1531 1152 Cl_ hylemonae 258 258 84 0 203 164 77 0 265 214 90 Cl_ orbiscindens 188 192 471 0 188 138 276 221 174 341 Cl symbiosum 485 482 486 444 379 447 562 2 775 Co _ aerofaciens 0 0 0 0 0 0 0 C _ comes 0 0 0 0 0 0 0 0 0 L _ bacterium _ 5 _ 1 _ 57FAA 341 336 354 0 351 182 356 256 R bromii 0 000 0 0 0 0 0 0 0 B _ producta 0 0 0 0 0 0 0 0 0 Ci_ bolteae 0 0 ci innoc??? 0 0 0 Cl_ mayombei 0 0 0 Cl_ tertium 0 0 0 R _ gnavus oooo0 0 ooooooo 0 Microbial comp 2 ooooooooooooo OOOOOOO OOOOOOO OOOOOOO OOOOOOO 000000000 oooooooooo OOOOOOO ooooooooo Cl_ disporicum 29 11810 10948 14672 0 11349 13978 39420 11995 7005 6268 Cl_ orbiscindens 0 510 408 764 0 332 545 544 310 319 432 Cl_ symbiosum 0 559 508 375 0 665 494 450 396 639 650 Co _ aerofaciens 0 0 0 0 0 0 1172 0 0 247 0 E _ rectale 0 0 0 0 0 0 0 12 0 0 261 L _ bacterium _ 5 _ 1 _ 57FAA 0 972 801 596 0 860 962 844 636 1901 1269 B _ producta 0 0 0 0 0 O0 0 0 0 0 0 Ci _ i??????? 0 0 0 0 0 O0 0 0 0 0 0 Cl _ mayombei goooooooo 0 OOOP0 0 0 O0 0 OOO0 OOOOOOOO OOO0 0 0 TABLE TAC Population of Clades on Days 2 , 3 and 4 following dosing with Microbial Compositions 1x 10° per OTU _ 1x 108 per OTU 1 107 per OTU -1 2 3 4 - 1 2 3 4 -1 2 3 4 Microbial comp 1 clade _ 252 0 444 252 87 0 198 122 125 209 394 231 88 clade _ 253 10 1746 1190 887 0 1746 769 1011 201 11175 1531 1152 clade _ 260 0 599 594 438 0 554 346 433 0 521 454 390 clade _ 262 0 14 151 51 0 0 0 0 0 12 21 57 clade _ 309 0 11093 9750 4023 0 9991 5208 5145 19 9311 6369 4951 clade 351 09064 10647 7751 0 6528 7259 8213 0 8903 10049 8701 clade _ 354 0 0 0 0 0 0 0 31 173 0 0 0 clade _ 360 0 14300 10220 11036 012553 12989 6889 0 9308 ofl.Je13483 9292 clade _ 408 13 8892 12985 12101 23 3952 7260 10652 43 4079 8581 14929 clade _ 494 0 226 227 565 0 188 184 411 0 221 200 351 clade _ 537 0 0 68 225 0 0 0 0 0 0 0 55 clade _ 553 0 0 0 0 0 0 0 0 0 0 0 0 Microbial comp 2 clade _ 253 29 11810 10948 14672 0 11349 13978 3942 011995 7005 6268 clade _ 260 0 1125 1312 854 0 1049 1295 1250 0 et792 2121 1637 clade _ 309 54 12513 13731 7849 011610 12004 126720 7407 14111 10858 clade _ 351 0 7651 9939 5936 0 8495 9724 9207 0 ce6005 9833 7655 clade 354 149 0 127 429 0 0 0 39 12 0 0 0 clade _ 408 18 2242 4989 10480 12 1688 5580 3789 0 1068 1561 6281 clade _ 444 41 0 49 202 0 18 0 12 0 14 82 1578 clade _ 494 >OA0 510 465 1054 0 332 565 596 0 310 319 476 clade _ 553 0 0 0 0 0 0 1172 0 0 0 BEST247 0 Upon examining the OTU data in Table TAB , several symbiosum , and L . bacterium _ 5 _ 1 _ 57FAA . Cl. disporicum patterns emerge. First , there are a group of OTUs with no is comparable to this group as it has sequence reads on Day sequence reads on Day - 1 that show subsequent and large 65 - 1 that are very close to background ( 10 and 29 in compo numbers of sequence reads on Days 2 , 3 , or 4 ; this group sitions 1 and 2 , respectively ) , which subsequently increase includes Cl. butyricum , Cl. hylemonae , Cl. orbiscindens, Cl. by as much as 1000 -fold on Days 2 , 3 or 4 . Second , there are US 9 ,855 , 303 B2 93 94 OTUS such as Co . aerofaciens, C . comes, R . bromii, B . TABLE TAD - continued producta , Cl. bolteae , Cl. mayombei, Cl. innocuum , Cl. tertium and R . gnavus which are not detectable at the OTU Mortality by experimental group in mice challenged level in either the Day - 1 sample or in subsequent samples. with 104. 5 C . difficile spores on Day 0 In composition 2 , Co . aerofaciens is detected transiently on 5 Group Dose (CFU per OTU ) Deaths (% mortality ) Day 2 in the 1x108 and 1x10 ' dose groups ; E . rectale in the Microbial composition 2 109 0 ( 0 % ) same experimental groups is detected on Day 3 , suggesting 108 1 (10 % ) a possible relationship between transient population by Co . 107 1 ( 10 % ) aerofaciens followed by E . rectale in these groups of mice . A striking observation is that the observed number of OTU 10 sequence reads is not highly dose dependent. Overall , the Example 36 : Prophylactic Use and Treatment in a data is consistent with a model whereby OTUs populate Mouse Model of Vancomycin Resistant rapidly following oral administration . Enterococcus (VRE ) Colonization The clade -based analysis in Table TAC was performed to 15 The emergence and spread of highly antibiotic - resistant more thoroughly evaluate the population of the GI tract . bacteria represent a major clinical challenge ( Snitkin et al Clade- based analysis obscures some of the details afforded Science Translational Medicine , 2012 ) . In recent years , the by an OTU analysis . For instance, Cl. tertium and Cl. numbers of infections caused by organisms such as methi butyricum are members of the same clade and thus a cillin -resistant Staphylococcus aureus, carbapenem - resistant clade -based analysis cannot distinguish the dynamics of 20 Enterobacteriaceae , vancomycin - resistant Enterococcus these individual OTUs. However , clade -based analysis has (VRE ) , and Clostridium difficile have increased markedly , the compensatory benefit that it is sensitive to measuring and many of these strains are acquiring resistance to the few population changes that can be missed by an OTU -based remaining active antibiotics . Most infections produced by analysis . The ability of 16S - V4 OTU identification to assign highly antibiotic - resistant bacteria are acquired during hos an OTU as a specific species depends in part on the resolving 25 pitalizations, and preventing patient- to - patient transmission power of the 16S -V4 region for a particular species or group of these pathogens is one of the major challenges confront of species . Both the density of available reference 16S ing hospitals and clinics. Most highly antibiotic -resistant sequences for different regions of the tree as well as the bacterial strains belong to genera that colonize mucosal inherent variability in the 165 gene between different spe - surfaces , usually at low densities. The highly complex cies will determine the definitiveness of a taxonomic anno - 30 microbiota that normally colonizes mucosal surfaces inhib tation . So in some cases, the population of a species can be its expansion of and domination by bacteria such as Entero followed using clade -based assignments when OTU based - bacteriaceae and Enterococcaceae . Destruction of the nor detection is insensitive in a complex population . For m al flora by antibiotic administration , however, instance , the clade - based analysis in Table 2B supports the disinhibition antibiotic -resistant members of these bacterial case that R . bromii, B . producta , Cl. innocuum , and R . 35 families, leading to their expansion to very high densities gnavus were able to populate since each OTU is a sole (Ubeda et al Journal of Clinical Investigation 2010 ). High member of a clade in the microbial compositions and density colonization by these organisms can be calamitous sequence reads went from undetectable on Day - 1 to well for the susceptible patient, resulting in bacteremia and sepsis above background on Days 2 , 3 or 4 . 16S V4 sequencing and ( Taur et al, Clinical Infectious Disease , 2012 ) . clade -based analysis could not determine whether Cl. ter - 40 To test prophylactic use and treatment of a bacterial tium or Cl. bolteae populated due to the fact that other composition test article e . g . spore population , a VRE infec members of their clades ( Cl. butyricum and Cl. symbiosum , tion mouse model is used as previously described (Ubeda et respectively ) were present and shown to populate at the al, Infectious Immunity 2013 , Ubeda et al , Journal of clinical OTU level in the mice . investigation , 2010 ) . Briefly , experiments are done with In the mice challenged in parallel with C . difficile , animals 45 7 -week - old C57BL /6J female mice purchased from Jackson were significantly protected as shown in Table TAD . Mice Laboratory , housed with irradiated food , and provided with gavaged with vehicle (phosphate buffered saline ) experi acidified water . Mice are individually housed to avoid con enced 100 % mortality while microbial compositions 1 and 2 tamination between mice due to coprophagia . For experi protected at all dose levels with between 0 and 10 % mor - mental infections with VRE , mice are treated with ampicillin tality by Day 6 , the last day of the experiment . In addition , 50 ( 0 . 5 g / liter ) in their drinking water, which is changed every weight loss in animals treated with microbial compositions 3 days . 1 and 2 was minimal compared to animals receiving the In the treatment model, on day 1 , mice are infected by vehicle gavage . These data confirm that population of the means of oral gavage with 10° CFU of the vancomycin gastrointestinal tract with microbial compositions confers a resistant Enterococcus faecium strain purchased from ATCC clinical benefit by restoring a state of dysbiosis so that 55 ( ATCC 700221 ) . One day after infection (day 1 ) , antibiotic animals can resist infection by a pathogen . treatment is stopped and VRE levels are determined at different time points by plating serial dilutions of fecal TABLE TAD pellets on Enterococcosel agar plates (Difco ) with vanco mycin ( 8 ug/ ml ; Sigma) . VRE colonies are identified by Mortality by experimental group in mice challenged 60 appearance and confirmed by Gram staining or other meth with 104 .5 C . difficile spores on Day 0 ods previously described ( e . g . see example 1 , 2 and 3 ) . In Group Dose ( CFU per OTU ) Deaths ( % mortality ) addition , as previously described (Ubeda et al Journal of Clinical Investigation 2010 ) , PCR of the vanA gene, which Vehicle control N / A 10 ( 100 % ) Microbial composition 1 109 1 (10 % ) confers resistance to vancomycin , confirms the presence of 108 1 (10 % ) 65 VRE in infected mice. The test article e. g . bacterial com 107 0 ( 0 % ) position , or ethanol treated , gradient purified spore prepa ration ( as described herein ), fecal suspension , or antibiotic US 9 ,855 ,303 B2 95 96 treatment is delivered in PBS on days 1 - 3 while the negative were interpreted as suggested by the U . S . Food and Drug control contains only PBS and is also delivered on days 1 -3 Administration (FDA ) and according to CLSI recommen by oral gavage. Fresh fecal stool pellets are obtained daily dations ( criteria for Pseudomonas ) for polymyxin E . for the duration of the experiment from days – 7 to day 10 . Mice ( 10 per group ) are assigned to either a test article The samples are immediately frozen and stored at - 80° C . 5 e . g . bacterial composition , ethanol treated , spore preparation ( e . g . see example 6 ), antibiotic clindamycin , piperacillin DNA was extracted using standard techniques and analyzed tazobactam , tigecycline, ertapenem , cefepime, ciprofloxa with 16S or comparable methods ( e . g . see example 2 and 3 ) . cin , or combination thereof or control group receiving only In the colonization model, ampicillin is administered as the vehicle . They are administered the test article daily from described above for day - 7 to day 1 , treatment with the test day - 10 to day 0 , On day 0 , 103 CFU of KPC -Kp VA - 367 article or vehicle control is administered on day 0 - 2 and the 10 diluted in 0 . 5 ml phosphate -buffered saline (PBS ) was VRE resistant bacteria at 108 CFU are administered on day administered by oral gavage using a stainless - steel feeding 14 . Fecal samples are taken throughout the experiment daily tube (Perfektum ; Popper & Sons, New Hyde Park , N . y . ) . from - 7 to day 21 and submitted for 16S sequencing as Stool samples were collected 1 , 4 , 6 , and 11 days after the administration of KPC -Kp in order to measure the concen previously described ( e . g . see examples 2 and 3 ) . tration of carbapenem -resistant K . pneumoniae . Stool In both models titers of VRE in feces are used to evaluate 15 samples ( 100 mg diluted in 800 ml of PBS ) are plated onto the success of the test article versus the negative control. MacConkey agar with and without 0 . 5 ug /ml of imipenem , Furthermore , microbiota composition is assessed for the and the number of CFU per gram of stool was determined . ability of the test article to induce a healthy microbiome. Alternatively other methods may be used to measure the levels of carbapenem - resistant K . pneumoniae e . g . per, anti Example 37 : Prophylactic Use and Treatment of a 20 gen testing, as one who ' s skilled in the art could perform . Mouse Model of Carbapenem Resistant Klebsiella Stool samples were collected after 5 days of treatment to assess the effects of the antibiotics on the stool microflora (CRKB ) Colonization and to measure antibiotic levels in stool. To assess the effects The emergence of Klebsiella pneumoniae strains with on the microflora , fresh stool samples as previously decreased susceptibility to carbapenems is a significant 25 described ( e . g . see examples 2 and 3 ) . Additional experi ments are performed to examine whether the administration threat to hospitalized patients . Resistance to carbapenems in the test article e . g . bacterial composition resulted in the these organisms is most frequently mediated by K . pneu elimination or persistence of colonization with KPC -Kp moniae carbapenemase (KPC ) , a class A beta - lactamase that VA - 367 . also confers resistance to broad -spectrum cephalosporins Mice are treated with subcutaneous clindamycin to reduce and commercially available beta - lactam /beta - lactamase 30 the normal intestinal flora 1 day before receiving 104 CFU inhibitor combinations (Queenan et al, Clinical Microbiol of KPC -Kp VA - 367 by oral gavage , and the mice continued ogy Review , 2007 ). KPC -producing K . pneumoniae (KPC to receive subcutaneous clindamycin every other day for 7 Kp ) strains often harbor resistance determinants against days . Concurrently , for 7 days after oral gavage with KPC several other classes of antimicrobials , including aminogly . Kp , mice received oral gavage of normal saline (control cosides and fluoroquinolones , resulting in truly multidrug - 35 group ) , or the bacterial composition as specified . An addi resistant (MDR ) organisms (Hirsch et al, Journal of Anti - tional dose of subcutaneous clindamycin was administered microbial Chemotherapy , 2009) . Considering the limited 20 days after the administration of KPC -Kp VA - 367 to antimicrobial options, infections caused by KPC - Kp pose a assess whether low levels of carbapenem -resistant K . pneu tremendous therapeutic challenge and are associated with moniae were present that could be augmented by the elimi poor clinical outcomes 4040 nation of the anaerobic microflora . Stool samples were A treatment protocol in a mouse model as previously collected at baseline and at 3 , 6 , 8 , 11, 16 , and 21 days after KPC -Kp VA - 367 was given by gavage . The bacterial com described ( e . g . Perez et al , Antimicrobial Agents Chemo position will be examined by the reduction of CRKB in therapy , 2011 ) is used to evaluate the test article e . g . feces. bacterial composition for treating carbapenem resistant Unless otherwise indicated , all numbers expressing quan Klebsiella and reducing carriage in the GI tract. Female CF1 45 tities of ingredients , reaction conditions, and so forth used in mice ( Harlan Sprague - Dawley , Indianapolis , Ind . ) are used the specification , including claims, are to be understood as and are individually housed and weighed between 25 and being modified in all instances by the term “ about. ” Accord 30 g . ingly , unless otherwise indicated to the contrary , the numeri The thoroughly characterized strain of K . pneumoniae , cal parameters are approximations and may vary depending VA - 367 ( 8 , 9 , 25 ) is used in this study . This clinical isolate 50 upon the desired properties sought to be obtained . At the is genetically related to the KPC -Kp strain circulating in the very least , and not as an attempt to limit the application of Eastern United States . Characterization of the resistance the doctrine of equivalents to the scope of the claims, each mechanisms in K . pneumoniae VA - 367 with PCR and DNA numerical parameter should be construed in light of the sequence analysis revealed the presence of bla PC -3 , number of significant digits and ordinary rounding blaTEM - 1, blashV- 11 , and blashv- 12 as well as qnrB19 and 55 approaches. aac (6 ') - Ib . Additionally , PCR and DNA sequencing revealed Unless otherwise indicated , the term “ at least preceding disruptions in the coding sequences of the following outer a series of elements is to be understood to refer to every membrane protein genes: ompK35 , ompK36 , and ompK37 . element in the series. Antibiotic susceptibility testing (AST ) was performed with While the invention has been particularly shown and the agar dilution method and interpreted according to current 60 described with reference to a preferred embodiment and recommendations from the Clinical and Laboratory Stan - various alternate embodiments , it will be understood by dards Institute (CLSI ) . A modified Hodge test was per persons skilled in the relevant art that various changes in formed , according to a method described previously ( e . g . form and details can be made therein without departing from see Anderson et al, Journal of Clinical Microbiology, 2007 ) the spirit and scope of the invention . with ertapenem , meropenem , and imipenem . Tigecydine and 65 All references, issued patents and patent applications polymyxin E were evaluated by Etest susceptibility assays cited within the body of the instant specification are hereby ( AB bioM ’ erieux , Solna , Sweden ) . Results for tigecycline incorporated by reference in their entirety , for all purposes . US 9 ,855 , 303 B2 97 98 ADDITIONAL TABLES
TABLE 1 List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species , and Phylogenetic Clade Clade membership of bacterial OTUS is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : (i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity. OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut . Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont (see Definitions for description of “ Pathobiont" ) . NIAID Priority Pathogens are denoted as ' Category - A ' , ' Category - B ’ , or ‘ Category - C ', and Opportunistic Pathogens are denoted as ' OP '. OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’. The ' SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession ' denotes the identifier of the OTU in a public sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Eubacterium saburreum 858 AB525414 clade _ 178 Y Eubacterium sp . oral clone 866 AY349376 clade _ 178 IR009 Lachnospiraceae bacterium 1061 HQ616401 cladeclade _ 178 Y N ICM62 Lachnospiraceae bacterium 1062 HQ616384 clade _ 178 MSX33 Lachnospiraceae bacterium 1063 ADDS01000069 clade _ 178 ZZZZZZZZZZZZZZZ oral taxon 107 Alicyclobacillus acidocaldarius 122 NR 074721 clade _ 179 Clostridium baratii 555 NR 029229 clade _ 223 Clostridium colicanis 576 F1957863 clade _ 223 Clostridium paraputrificum 611 AB536771 clade _ 223 Clostridium sardiniense 621 NR 041006 clade _ 223 Eubacterium budayi 837 NR 024682 clade _ 223 Eubacterium moniliforme 851 HF558373 clade _ 223 Eubacterium multiforme 852 NR 024683 clade _ 223 Eubacterium nitritogenes 853 NR _ 024684 clade _ 223 Anoxybacillus flavithermus 173 NR _ 074667 clade _ 238 Bacillus aerophilus 196 NR _ 042339 clade _ 238 Bacillus aestuarii 197 G0980243 clade _ 238 Bacillus amyloliquefaciens 199 NR _ 075005 clade _ 238 N Bacillus anthracis 200 AAEN01000020 clade 238 Category - A Bacillus atrophaeus 201 NR 075016 clade _ 238 OP Bacillus badius 202 NR 036893 clade _ 238 OPA Bacillus cereus 203 ABDJO1000015 clade _ 238 OPA Bacillus circulans 204 AB271747 clade _ 238 A Bacillus firmus 207 NR _ 025842 clade _ 238 A Bacillus flexus 208 NR _ 024691 clade _ 238 Bacillus fordii 209 NR 025786 clade _ 238 Bacillus halmapalus 211 NR 026144 clade _ 238 Bacillus herbersteinensis 213 NR 042286 clade _ 238 Bacillus idriensis 215 NR _ 043268 clade _ 238 Bacillus lentus 216 NR 040792 clade _ 238 ?? Bacillus licheniformis 217 NC _ 006270 clade _ 238 Bacillus megaterium 218 GU252124 clade _ 238 Bacillus nealsonii 219 NR 044546 clade _ 238 - Bacillus niabensis 220 NR 043334 clade _ 238 BH Bacillus niacini 221 NR 024695 clade _ 238 1 Bacillus pocheonensis 222 NR 041377 clade _ 238 Bacillus pumilus 223 NR 074977 clade _ 238 Bacillus safensis 224 JQ624766 clade _ 238 n?hu. Bacillus simplex 225 NR 042136 clade _ 238 Bacillus sonorensis 226 NR _ 025130 clade _ 238 Bacillus sp . 10403023 227 CAET01000089 clade _ 238 MM10403188 @6869 Bacillus sp . 2 _ A _ 57 _ CT2 230 ACWD01000095 clade _ 238 Bacillus sp . 2008724126 228 GU252108 clade _ 238 Bacillus sp . 2008724139 229 GU252111 clade _ 238 Bacillus sp . 7 _ 16AIA 231 FN397518 clade _ 238 Bacillus sp . AP8 233 JX101689 clade _ 238 US 9 ,855 ,303 B2 99 100 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Bacillus sp . B27 (2008 ) 234 EU362173 clade _ 238 Y OP Bacillus sp . BT1B _ CT2 235 ACWC01000034 clade _ 238 Cu Bacillus sp . GB1. 1 236 FJ897765 clade _ 238 OO- Bacillus sp . GB9 237 FJ897766 clade _ 238 - Bacillus sp . HU19 . 1 238 FJ897769 clade _ 238 - Bacillus sp . HU29 239 FJ897771 clade _ 238 - Bacillus sp . HU33. 1 240 FJ897772 clade _ 238 - Bacillus sp . JC6 241 JF824800 clade _ 238 - Bacillus sp . oral taxon F79 248 HM099654 clade _ 238 Bacillus sp . SRC _ DSF1 243 GU797283 clade _ 238 Bacillus sp . SRC _ DSF10 242 GU797292 clade _ 238 Bacillus sp . SRC _ DSF2 244 GU797284 clade _ 238 Bacillus sp . SRC _ DSF6 245 GU797288 clade _ 238 Bacillus sp . tc09 249 HQ844242 clade _ 238 Bacillus sp . zh168 250 FJ851424 clade _ 238 nututu Bacillus sphaericus 251 DO286318 clade _ 238 Bacillus sporothermodurans 252 NR 026010 clade _ 238 Bacillus subtilis 253 EU627588 clade _ 238 Bacillus thermoamylovorans 254 NR _ 029151 clade _ 238 Bacillus thuringiensis 255 NC _ 008600 clade _ 238 Bacillus weihenstephanensis 256 NR _ 074926 clade _ 238 Geobacillus kaustophilus 933 NR _ 074989 clade _ 238 Geobacillus 936 NR _ 040794 clade _ 238 stearothermophilus Geobacillus 938 NR _ 074976 clade_ 238 thermodenitrificans ZZZ Geobacillus 939 NR _ 043022 clade _ 238 thermoglucosidasius Lysinibacillus sphaericus 1193 NR 074883 clade _ 238 Clostridiales sp . SS3 _ 4 543 AY305316 clade _ 246 Clostridium beijerinckii 557 NR 074434 clade _ 252 Clostridium botulinum 560 NC _ 010723 clade _ 252 Category - A Clostridium butyricum 561 ABDT01000017 clade _ 252 Clostridium chauvoei 568 EU106372 clade _ 252 Clostridium favososporum 582 X76749 clade _ 252 Clostridium histolyticum 592 HF558362 clade _ 252 Clostridium isatidis 597 NR _ 026347 clade _ 252 Clostridium limosum 602 FR870444 clade _ 252 Clostridium sartagoforme 622 NR 026490 clade _ 252 Clostridium septicum 624 NR _ 026020 clade _ 252 Clostridium sp . 7 _ 2 _ 43FAA 626 ACDK01000101 clade _ 252 Clostridium sporogenes 645 ABKW02000003 clade 252 Clostridium tertium 653 Y18174 clade _ 252 Clostridium carnis 564 NR 044716 clade _ 253 Clostridium celatum 565 X77844 clade _ 253 Clostridium disporicum 579 NR _ 026491 clade _ 253 Clostridium gasigenes 585 NR _ 024945 clade _ 253 Clostridium quinii 616 NR 026149 clade _ 253 Clostridium hylemonae 593 AB023973 clade _ 260 Clostridium scindens 623 AF262238 clade _ 260 Lachnospiraceae bacterium 1054 ACTR01000020 clade _ 260 5 _ 1 _ 57FAA Clostridium glycyrrhizinilyticum 588 AB233029 clade _ 262 Clostridium nexile 607 X73443 clade _ 262 ZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 101 102 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Coprococcus comes 674 ABVR01000038 clade _ 262 Lachnospiraceae bacterium 1048 ACTM01000065 clade _ 262 Y 1 _ 1 _ 57FAA Lachnospiraceae bacterium 1049 ACTN01000028 clade _ 262 1 _ 4 _ 56FAA Lachnospiraceae bacterium 1057 ACWQ01000079 clade _ 262 8 _ 1 _ 57FAA Ruminococcus lactaris 1663 ABOU02000049 clade _ 262 Ruminococcus torques 1670 AAVPO2000002 clade _ 262 Paenibacillus lautus 1397 NR _ 040882 clade _ 270 Paenibacillus polymyxa 1399 NR 037006 clade _ 270 Paenibacillus sp . HGF5 1402 AEXS01000095 clade _ 270 Paenibacillus sp . HGF7 1403 AFDHO1000147 clade _ 270 Eubacterium sp . oral clone 868 AY349379 clade _ 298 JIO12 Alicyclobacillus contaminans 124 NR 041475 clade _ 301 Alicyclobacillus herbarius 126 NR 024753 clade _ 301 Alicyclobacillus pomorum 127 NR 024801 clade 301 373 AB571656 clade _ 309 SZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Blautia coccoides Blautia glucerasea 374 AB588023 clade _ 309 Blautia glucerasei 375 AB439724 clade _ 309 Blautia hansenii 376 ABYUO2000037 clade _ 309 Blautia luti 378 AB691576 clade _ 309 Blautia producta 379 AB600998 clade _ 309 Blautia schinkii 380 NR 026312 clade _ 309 Blautia sp . M25 381 HM626178 clade _ 309 Blautia stercoris 382 HM626177 clade _ 309 Blautia wexlerae 383 EF036467 clade _ 309 Bryantella formatexigens 439 ACCLO2000018 clade 309 Clostridium coccoides 573 EF025906 clade _ 309 Eubacterium cellulosolvens 839 AY178842 clade _ 309 Lachnospiraceae bacterium 1056 ACTV01000014 clade _ 309 61 63FAA Ruminococcus hansenii 1662 M59114 clade _ 309 Ruminococcus obeum 1664 AY169419 clade _ 309 Ruminococcus sp . 1666 ACII01000172 clade _ 309 5 _ 1 _ 39BFAA Ruminococcus sp . K _ 1 1669 AB222208 clade _ 309 Syntrophococcus sucromutans 1911 NR _ 036869 clade _ 309 Bacillus alcalophilus 198 X76436 clade _ 327 Bacillus clausii 205 FN397477 clade _ 327 Bacillus gelatini 210 NR 025595 clade _ 327 A Bacillus halodurans 212 AY144582 clade _ 327 Bacillus sp . oral taxon F26 246 HM099642 clade _ 327 OP Clostridium innoc??? 595 M23732 clade _ 351 ZOO Clostridium sp . HGF2 628 AENW01000022 clade _ 351 N Clostridium perfringens 612 ABDW01000023 clade _ 353 Category - B Sarcina ventriculi 1687 NR 026146 clade _ 353 N Clostridium bartlettii 556 ABEZ02000012 clade _ 354 Clostridium bifermentans 558 X73437 clade _ 354 Clostridium ghonii 586 AB542933 clade _ 354 Clostridium glycolicum 587 FJ384385 clade _ 354 Clostridium mayombei 605 FR733682 clade _ 354 Clostridium sordellii 625 AB448946 clade _ 354 ZZZZZZ US 9 ,855 ,303 B2 103 104 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Clostridium sp . MT4 E 635 FJ159523 clade_ 354 Y Eubacterium tenue 872 M59118 clade _ 354 Clostridium argentinense 553 NR 029232 clade _ 355 Clostridium sp . JC122 630 CAEVO1000127 clade _ 355 Clostridium sp . NMBHI_ 1 636 JN093130 clade _ 355 Clostridium subterminale 650 NR 041795 clade 355 Clostridium sulfidigenes 651 NR 044161 clade _ 355 Dorea formicigenerans 773 AAXA02000006 clade _ 360 Dorea longicatena 774 AJ132842 clade _ 360 Lachnospiraceae bacterium 1050 ADLB01000035 clade _ 360 2 1 46FAA Lachnospiraceae bacterium 1051 ACTO01000052 clade_ 360 2 _ 1 _ 58FAA Lachnospiraceae bacterium 1053 ADCR01000030 clade _ 360 4 _ 1 _ 37FAA Lachnospiraceae bacterium 1058 ACTX01000023 clade _ 360 9 _ 1 _ 43BFAA Ruminococcus gnavus 1661 X94967 clade _ 360 Ruminococcus sp . ID8 1668 AY960564 clade _ 360 Blautia hydrogenotrophica 377 ACBZ01000217 clade _ 368 Lactonifactor longoviformis 1147 DQ100449 clade _ 368 Robinsoniella peoriensis 1633 AF445258 clade _ 368 Eubacterium infirmum 849 U13039 clade _ 384 Eubacterium sp . WAL 14571 864 FJ687606 clade _ 384 Erysipelotrichaceae bacterium 823 ACZW01000054 clade _ 385 5 _ 2 _ 54FAA Eubacterium biforme 835 ABYT01000002 clade _ 385 Eubacterium cylindroides 842 FP929041 clade _ 385 Eubacterium dolichum 844 L34682 clade _ 385 Eubacterium sp . 3 _ 1 _ 31 861 ACTL01000045 clade _ 385 Eubacterium tortuosum 873 NR 044648 clade _ 385 Bulleidia extructa clade _ 388 Solobacterium moorei 1739 AECQ01000039 clade _ 388 ZZZZZZZZZZZZZZZZZZZZZZ Coprococcus catus 673 EU266552 clade _ 393 Lachnospiraceae bacterium 1064 HM099641 clade _ 393 oral taxon F15 Clostridium cochlearium 574 NR 044717 clade _ 395 Clostridium malenominatum 604 FR749893 clade _ 395 Clostridium tetani 654 NC 004557 clade_ 395 Acetivibrio ethanolgignens 6 FR749897 clade _ 396 Anaerosporobacter mobilis 161 NR _ 042953 clade _ 396 Bacteroides pectinophilus 288 ABVQ01000036 clade_ 396 Clostridium aminovalericum 551 NR _ 029245 clade _ 396 Clostridium phytofermentans 613 NR _ 074652 clade _ 396 Eubacterium hallii 848 L34621 clade _ 396 Eubacterium xylanophilum 875 L34628 clade _ 396 Ruminococcus callidus 1658 NR _ 029160 clade _ 406 Ruminococcus 1659 FP929052 clade _ 406 champanellensis Ruminococcus sp . 18P13 1665 AJ515913 clade _ 406 Ruminococcus sp . 9SE51 1667 FM954974 clade _ 406 Anaerostipes caccae 162 ABAX03000023 clade _ 408 US 9 ,855 ,303 B2 105 106 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Anaerostipes sp . 3 _ 2 _ 56FAA 163 ACWB01000002 clade _ 408 Y Clostridiales bacterium 541 ABQR01000074 clade _ 408 Y 1 _ 7 _ 47FAA Clostridiales sp . SM4_ 1 542 FP929060 clade _ 408 Clostridiales sp . SSC _ 2 544 FP929061 clade _ 408 Clostridium aerotolerans 546 X76163 clade _ 408 Clostridium aldenense 547 NR _ 043680 clade _ 408 Clostridium algidixylanolyticum 550 NR 028726 clade _ 408 Clostridium amygdalinum 552 AY353957 clade _ 408 Clostridium asparagiforme 554 ACCJ01000522 clade _ 408 Clostridium bolteae 559 ABCCO2000039 clade _ 408 Clostridium celerecrescens 566 JQ246092 clade _ 408 Clostridium citroniae 569 ADLJO1000059 clade _ 408 Clostridium clostridiiformes 571 M59089 clade _ 408 Clostridium clostridioforme 572 NR 044715 clade _ 408 Clostridium hathewayi 590 AY552788 clade _ 408 Clostridium indolis 594 AF028351 clade _ 408 Clostridium lavalense 600 EF564277 clade _ 408 Clostridium saccharolyticum 620 CP002109 clade _ 408 Clostridium sp . M62 _ 1 633 ACFX02000046 clade _ 408 Clostridium sp . SS2 _ 1 638 ABGC03000041 clade _ 408 Clostridium sphenoides 643 X73449 clade _ 408 Clostridium symbiosum 652 ADLQ01000114 clade_ 408 Clostridium xylanolyticum 658 NR 037068 clade _ 408 Eubacterium hadrum 847 FR749933 clade _ 408 Lachnospiraceae bacterium 1052 ACTP01000124 clade _ 408 3 _ 1 _ 57FAA _ CT1 Lachnospiraceae bacterium 1055 ACTS01000081 clade_ 408 5 _ 1 _ 63FAA Lachnospiraceae bacterium A4 1059 D0789118 clade _ 408 Lachnospiraceae bacterium 1060 EU728771 clade _ 408 DJF VP30 Lachnospiraceae genomosp . 1065 AY278618 clade _ 408 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ C1 Clostridium difficile 578 NC _ 013315 clade _ 409 Eubacterium sp . AS15b 862 HQ616364 clade _ 428 Eubacterium sp . OBRC9 863 HQ616354 clade _ 428 Eubacterium sp . oral clone 871 AY947497 clade _ 428 ???? Eubacterium yurii 876 AEES01000073 clade _ 428 Clostridium acetobutylicum 545 NR _ 074511 clade _ 430 Clostridium algidicarnis 549 NR 041746 clade _ 430 Clostridium cadaveris 562 AB542932 clade _ 430 Clostridium carboxidivorans 563 FR733710 clade _ 430 Clostridium estertheticum 580 NR 042153 clade _ 430 Clostridium fallax 581 NR 044714 clade _ 430 Clostridium felsineum 583 AF270502 clade _ 430 Clostridium frigidicarnis 584 NR 024919 clade _ 430 Clostridium kluyveri 598 NR 074165 clade _ 430 Clostridium magnum 603 X77835 clade _ 430 Clostridium putrefaciens 615 NR _ 024995 clade _ 430 Clostridium sp . HPB _ 46 629 AY862516 clade _ 430 Clostridium tyrobutyricum 656 NR 044718 clade _ 430 Sutterella parvirubra 1899 AB300989 clade _ 432 US 9 ,855 ,303 B2 107 108 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Acetanaerobacterium 4 NR _ 042930 clade _ 439 Y elongatum Clostridium cellulosi 567 NR 044624 clade _ 439 Ethanoligenens harbinense 832 AY675965 clade _ 439 Eubacterium rectale 856 FP929042 clade _ 444 Eubacterium sp . oral clone 865 AY349374 clade _ 444 GIO38 Lachnobacterium bovis 1045 GU324407 clade _ 444 Roseburia cecicola 1634 GU233441 clade _ 444 Roseburia faecalis 1635 AY804149 clade _ 444 Roseburia faecis 1636 AY305310 clade _ 444 Roseburia hominis 1637 AJ270482 clade _ 444 Roseburia intestinalis 1638 FP929050 clade _ 444 Roseburia inulinivorans 1639 AJ270473 clade _ 444 Brevibacillus brevis 410 NR 041524 clade _ 448 Brevibacillus laterosporus 414 NR 037005 clade _ 448 Bacillus coagulans 206 DQ297928 clade _ 451 Sporolactobacillus inulinus 1752 NR _ 040962 clade _ 451 Kocuria palustris 1041 EU333884 clade _ 453 Nocardia farcinica 1353 NC _ 006361 clade _ 455 Bacillus sp . oral taxon F28 247 HM099650 clade _ 456 Catenibacterium mitsuokai 495 ABO30224 clade _ 469 Clostridium sp . TM _ 40 640 AB249652 clade _ 469 Coprobacillus cateniformis 670 AB030218 clade_ 469 Coprobacillus sp . 29 _ 1 671 ADKX01000057 clade _ 469 Clostridium rectum 618 NR _ 029271 clade _ 470 Eubacterium nodatum 854 U13041 clade _ 476 Eubacterium saphenum 859 NR _ 026031 clade _ 476 Eubacterium sp . oral clone 867 AY349373 clade 476 JH012 Eubacterium sp . oral clone 870 AY349378 clade _ 476 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ JS001 Faecalibacterium prausnitzii 880 ACOPO2000011 clade _ 478 Gemmiger formicilis 932 GU562446 clade _ 478 Subdoligranulum variabile 1896 AJ518869 clade _ 478 Clostridiaceae bacterium JC13 532 JF824807 clade 479 Clostridium sp . MLG055 634 AF304435 clade _ 479 Erysipelotrichaceae bacterium 822 ACTJO1000113 clade _ 479 3 _ 1 _ 53 Clostridium cocleatum 575 NR _ 026495 clade _ 481 Clostridium ramosum 617 M23731 clade _ 481 Clostridium saccharogumia 619 DQ100445 clade _ 481 Clostridium spiroforme 644 X73441 clade _ 481 Coprobacillus sp . D7 672 ACDT01000199 clade 481 Clostridiales bacterium 535 AB477431 clade _ 482 SY8519 Clostridium sp . SY8519 639 AP012212 clade _ 482 Eubacterium ramulus 855 JO11522 clade _ 482 Erysipelothrix inopinata 819 NR 025594 clade _ 485 Erysipelothrix rhusiopathiae 820 ACLK01000021 clade_ 485 Erysipelothrix tonsillarum 821 NR 040871 clade _ 485 Holdemania filiformis 1004 Y11466 clade _ 485 Mollicutes bacterium PACH93 1258 AY297808 clade _ 485 Coxiella burnetii 736 CP000890 clade _ 486 Category - B US 9 ,855 ,303 B2 109 110 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Clostridium hiranonis 591 ABO23970 clade_ 487 Y Clostridium irregulare 596 NR _ 029249 clade _ 487 Clostridium orbiscindens 609 Y18187 clade _ 494 Clostridium sp . NML 04A032 637 EU815224 clade _ 494 Flavonifractor plautii 886 AY724678 clade _ 494 Pseudoflavonifractor capillosus 1591 AY136666 clade _ 494 Ruminococcaceae bacterium 1655 ADDX01000083 clade _ 494 D16 Acetivibrio cellulolyticus 5 NR _ 025917 clade _ 495 Clostridium aldrichii 548 NR 026099 clade _ 495 Clostridium clariflavum 570 NR _ 041235 clade _ 495 Clostridium stercorarium 647 NR 025100 clade _ 495 Clostridium straminisolvens 649 NR _ 024829 clade _ 495 Clostridium thermocellum 655 NR _ 074629 clade _ 495 Fusobacterium nucleatum 901 ADVK01000034 clade _ 497 Eubacterium barkeri 834 NR 044661 clade _ 512 Eubacterium callanderi 838 NR 026330 clade _ 512 Eubacterium limosum 850 CP002273 clade _ 512 Anaerotruncus colihominis 164 ABGDO2000021 clade _ 516 Clostridium methylpentosum 606 ACEC01000059 clade_ 516 Clostridium sp . YIT 12070 642 AB491208 clade _ 516 Hydrogenoanaerobacterium 1005 NR _ 044425 clade _ 516 saccharovorans Ruminococcus albus 1656 AY445600 clade _ 516 Ruminococcus flavefaciens 1660 NR _ 025931 clade _ 516 Clostridium haemolyticum 589 NR _ 024749 clade _ 517 Clostridium novyi 608 NR 074343 clade _ 517 Clostridium sp . LMG 16094 632 X95274 clade _ 517 Eubacterium ventriosum 874 L34421 clade _ 519 Bacteroides galacturonicus 280 DQ497994 clade _ 522 Eubacterium eligens 845 CP001104 clade _ 522 Lachnospira multipara 1046 FR733699 clade _ 522 Lachnospira pectinoschiza 1047 L14675 clade _ 522 Lactobacillus rogosae 1114 GU269544 clade _ 522 Bacillus horti 214 NR 036860 clade _ 527
Bacillus sp . 9 _ 3AIA |232 FN397519 clade _ 527 Eubacterium brachy 836 U13038 clade _ 533 Filifactor alocis 881 CP002390 clade _ 533 Filifactor villosus 882 NR 041928 clade _ 533 Clostridium leptum 601 AJ305238 clade _ 537 Clostridium sp . YIT 12069 641 AB491207 clade _ 537 Clostridium sporosphaeroides 646 NR 044835 clade _ 537 Eubacterium 841 HM037995 clade _ 537 coprostanoligenes ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZÖÖZZZZZZZZZZZZZZZZZ Ruminococcus bromii 1657 EU266549 clade _ 537 Eubacterium siraeum 860 ABCA03000054 clade _ 538 Clostridium viride 657 NR 026204 clade _ 540 Oscillibacter sp . G2 1386 HM626173 clade _ 540 Oscillibacter valericigenes 1387 NR 074793 clade_ 540 Oscillospira guilliermondii 1388 AB040495 clade _ 540 Butyrivibrio crossotus 455 ABWN01000012 clade _ 543 Clostridium sp . L2 _ 50 631 AAYW02000018 clade _ 543 Coprococcus eutactus 675 EF031543 clade _ 543 Coprococcus sp . ART55 _ 1 676 AY350746 clade _ 543 US 9 ,855 ,303 B2 111 112 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Eubacterium ruminantium 857 NR _ 024661 clade _ 543 Y Collinsella aerofaciens 659 AAVNO2000007 clade _ 553 Alkaliphilus metalliredigenes 137 AY137848 clade _ 554 Alkaliphilus oremlandii 138 NR 043674 clade _ 554 Clostridium sticklandii 648 L04167 clade _ 554 Turicibacter sanguinis 1965 AF349724 clade _ 555 Fulvimonas sp . NML 060897 892 EF589680 clade _ 557 Desulfitobacterium frappieri 753 AJ276701 clade _ 560 Desulfitobacterium hafniense 754 NR 074996 clade _ 560 Desulfotomaculum nigrificans 756 NR _ 044832 clade _ 560 Lutispora thermophila 1191 NR _ 041236 clade _ 564 Brachyspira pilosicoli 405 NR _ 075069 clade _ 565 Eggerthella lenta 778 AF292375 clade _ 566 Streptomyces albus 1888 AJ697941 clade _ 566 Chlamydiales bacterium NS11 505 JN606074 clade _ 567 Anaerofustis stercorihominis 159 ABILO2000005 clade _ 570 Butyricicoccus pullicaecorum 453 HH793440 clade _ 572 Eubacterium desmolans 843 NR 044644 clade _ 572 Papillibacter cinnamivorans 1415 NR _ 025025 clade _ 572 Sporobacter termitidis 1751 NR 044972 clade _ 572 Deferribacteres sp . oral clone 744 AY349371 clade _ 575 JV006 Clostridium colinum 577 NR _ 026151 clade 576 Clostridium lactatifermentans 599 NR _ 025651 clade _ 576 Clostridium piliforme 614 D14639 clade _ 576 Saccharomonospora viridis 1671 X54286 clade _ 579 Thermobifida fusca 1921 NC _ 007333 clade _ 579 Leptospira licerasiae 1164 EF612284 clade _ 585 Moorella thermoacetica 1259 NR 075001 clade _ 590 Thermoanaerobacter 1920 CP000924 clade _ 590 pseudethanolicus Flexistipes sinusarabici 888 NR _ 074881 clade _ 591 Gloeobacter violaceus 942 NR 074282 clade _ 596 Eubacterium sp . oral clone 869 AY349377 clade _ 90 JN088 Clostridium oroticum 610 FR749922 clade _ 96 Clostridium sp . D5 627 ADBG01000142 clade _ 96 Eubacterium contortum 840 FR749946 clade _ 96 Eubacterium fissicatena 846 FR749935 clade _ 96 Corynebacterium coyleae 692 X96497 clade _ 100 ZZZZZZZZZZZZZZZZZZZZZZZZZZÖZZZZZZZZZZZZZZZZZZZZ Corynebacterium mucifaciens 711 NR _ 026396 clade _ 100 Corynebacterium 733 AM397636 clade _ 100 ureicelerivorans Corynebacterium appendicis 684 NR _ 028951 clade _ 102 Corynebacterium genitalium 698 ACLJO1000031 clade _ 102 Corynebacterium glaucum 699 NR _ 028971 clade _ 102 Corynebacterium imitans 703 AF537597 clade _ 102 Corynebacterium riegelii 719 EU848548 clade _ 102 Corynebacterium sp . 723 HE575405 clade 102 L _ 2012475 Corynebacterium sp . NML 724 GU238409 clade _ 102 93 _ 0481 Corynebacterium 728 Y09655 clade 102 sundsvallense US 9 ,855 ,303 B2 113 114 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Corynebacterium tuscaniae 730 AY677186 clade _ 102 Prevotella maculosa 1504 AGEK01000035 clade _ 104 Prevotella oris 1513 ADDV01000091 clade _ 104 Prevotella salivae 1517 AB108826 clade _ 104 Prevotella sp . ICM55 1521 HQ616399 clade _ 104 Prevotella sp . oral clone 1528 AY005057 clade _ 104 AA020 Prevotella sp . oral clone GIO32 1538 AY349396 clade _ 104 Prevotella sp . oral taxon G70 1558 GU432179 clade _ 104 Prevotella corporis 1491 L16465 clade _ 105 Bacteroides sp . 4 _ 1 _ 36 312 ACTC01000133 clade _ 110 Bacteroides sp . AR20 315 AF139524 clade _ 110 Bacteroides sp . D20 319 ACPT01000052 clade _ 110 Bacteroides sp . F _ 4 322 AB470322 clade _ 110 Bacteroides uniformis 329 AB050110 clade _ 110 Prevotella nanceiensis 1510 JN867228 clade _ 127 Prevotella sp . oral taxon 299 1548 ACWZ01000026 clade 127 Prevotella bergensis 1485 ACKS01000100 clade _ 128 Prevotella buccalis 1489 JN867261 clade _ 129 Prevotella timonensis 1564 ADEF01000012 clade _ 129 Prevotella oralis 1512 AEPE01000021 clade _ 130 Prevotella sp . SEQ072 1525 JN867238 clade _ 130 Leuconostoc carnosum 1177 NR 040811 clade _ 135 Leuconostoc gasicomitatum 1179 FN822744 clade _ 135 Leuconostoc inhae 1180 NR 025204 clade _ 135 Leuconostoc kimchii 1181 NR 075014 clade _ 135 Edwardsiella tarda 777 CP002154 clade _ 139 Photorhabdus asymbiotica 1466 Z76752 clade _ 139 Psychrobacter arcticus 1607 CP000082 clade _ 141 Psychrobacter cibarius 1608 HQ698586 clade _ 141 Psychrobacter cryohalolentis 1609 CP000323 clade _ 141 Psychrobacter faecalis 1610 HQ698566 clade 141 Psychrobacter nivimaris 1611 HQ698587 clade 141 Psychrobacter pulmonis 1612 HQ698582 clade _ 141 Pseudomonas aeruginosa 1592 AABQ07000001 clade _ 154 Pseudomonas sp . 2 _ 1 _ 26 1600 ACWU01000257 clade _ 154 Corynebacterium confusum 691 Y15886 clade _ 158 Corynebacterium propinquum 712 NR _ 037038 clade _ 158 Corynebacterium 713 X84258 clade _ 158 pseudodiphtheriticum Bartonella bacilliformis 338 NC _ 008783 clade _ 159 Bartonella grahamii 339 CP001562 clade _ 159 Bartonella henselae 340 NC 005956 clade _ 159 Bartonella quintana 341 BX897700 clade _ 159 Bartonella tamiae 342 EF672728 clade _ 159 Bartonella washoensis 343 FJ719017 clade _ 159 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Brucella abortus 430 ACBJO1000075 clade _ 159 Category - B Brucella canis 431 NR _ 044652 clade _ 159 Category -B Brucella ceti 432 ACJD01000006 clade _ 159 Category - B Brucella melitensis 433 AE009462 clade _ 159 Category - B Brucella microti 434 NR _ 042549 clade _ 159 Category - B Brucella ovis 435 NC _ 009504 clade _ 159 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Category - B Brucella sp . 83 _ 13 436 ACBQ01000040 clade _ 159 Category - B Brucella sp . BO1 437 EU053207 clade _ 159 Category - B US 9 ,855 ,303 B2 115 116 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Brucella suis 438 ACBK01000034 clade _ 159 Category - B Ochrobactrum anthropi 1360 NC _ 009667 clade _ 159 Ochrobactrum intermedium 1361 ACQA01000001 clade _ 159 Ochrobactrum 1362 DQ365921 clade 159 pseudintermedium Prevotella genomosp . C2 1496 Y278625 clade _ 164 Prevotella multisaccharivorax 1509 AFJE01000016 clade _ 164 Prevotella sp . oral clone 1543 AY550997 clade _ 164 IDR _ CEC _ 0055 Prevotella sp . oral taxon 292 1547 GQ422735 clade _ 164 Prevotella sp . oral taxon 300 1549 GU409549 clade 164 Prevotella marshii 1505 AEEI01000070 clade _ 166 Prevotella sp . oral clone IK053 1544 AY349401 clade _ 166 Prevotella sp . oral taxon 781 1554 GQ422744 clade _ 166 Prevotella stercorea 1562 AB244774 clade _ 166 Prevotella brevis 1487 NR 041954 clade _ 167 Prevotella ruminicola 1516 CP002006 clade _ 167 Prevotella sp . sp24 1560 AB003384 clade _ 167 Prevotella sp . sp34 1561 AB003385 clade _ 167 Prevotella albensis 1483 NR 025300 clade _ 168 Prevotella copri 1490 ACBX02000014 clade _ 168 Prevotella oulorum 1514 L16472 clade _ 168 Prevotella sp . BI_ 42 1518 AJ581354 clade 168 Prevotella sp . oral clone 1546 AY207050 clade _ 168 P4PB _ 83 P2 Prevotella sp . oral taxon G60 1557 GU432133 clade _ 168 Prevotella amnii 1484 AB547670 clade _ 169 Bacteroides caccae 268 EU136686 clade _ 170 Bacteroides finegoldii 277 AB222699 clade _ 170 Bacteroides intestinalis 283 ABJLO2000006 clade _ 171 Bacteroides sp . XB44A 326 AM230649 clade _ 171 Bifidobacteriaceae genomosp . 345 AY278612 clade _ 172 C1 Bifidobacterium adolescentis 346 AXD02000018 clade 172 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Bifidobacterium angulatum 347 ABYS02000004 clade _ 172 Bifidobacterium animalis 348 CP001606 clade 172 Bifidobacterium breve 350 CP002743 clade _ 172 Bifidobacterium catenulatum 351 ABXY01000019 clade _ 172 Bifidobacterium dentium 352 CP001750 clade _ 172 Bifidobacterium gallicum 353 ABXB03000004 clade _ 172 Bifidobacterium infantis 354 AY151398 clade _ 172 Bifidobacterium 355 AB491757 clade 172 kashiwanohense Bifidobacterium longum 356 ABQQ01000041 clade_ 172 Bifidobacterium 357 ABXX02000002 clade _ 172 pseudocatenulatum Bifidobacterium pseudolongum 358 NR _ 043442 clade _ 172 Bifidobacterium scardovii 359 AJ307005 clade _ 172 Bifidobacterium sp . HM2 360 AB425276 clade _ 172 Bifidobacterium sp . HMLN12 361 JF519685 clade _ 172 Bifidobacterium sp . M45 362 HM626176 clade _ 172 Bifidobacterium sp . MSX5B 363 HQ616382 clade _ 172 Bifidobacterium sp . TM _ 7 364 AB218972 clade _ 172 Bifidobacterium thermophilum 365 DO340557 clade _ 172 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 117 118 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Leuconostoc citreum 1178 AM157444 clade _ 175 Leuconostoc lactis 1182 NR _ 040823 clade _ 175 Alicyclobacillus acidoterrestris 123 NR 040844 clade _ 179 Alicyclobacillus 125 NR 024754 clade 179 cycloheptanicus Acinetobacter baumannii 27 ACYQ01000014 clade_ 181 Acinetobacter calcoaceticus 28 AM157426 clade _ 181 Acinetobacter genomosp . Ci 29 AY278636 clade _ 181 Acinetobacter haemolyticus 30 ADMT01000017 clade _ 181 Acinetobacter johnsonii 31 ACPLO1000162 clade _ 181 Acinetobacter junii 32 ACPM01000135 clade _ 181 Acinetobacter lwoffii 33 ACPN01000204 clade _ 181 Acinetobacter parvus 34 AIEB01000124 clade_ 181 ZZZZZZZZZZZZZZZZ Acinetobacter schindleri 36 NR _ 025412 clade _ 181 Acinetobacter sp . 56A1 37 GQ178049 clade _ 181 Acinetobacter sp . CIP 101934 38 JQ638573 clade _ 181 Acinetobacter sp . CIP 102143 39 JQ638578 clade _ 181 Acinetobacter sp . M16 _ 22 41 HM366447 clade _ 181 Acinetobacter sp . RUH2624 42 ACQF01000094 clade _ 181 Acinetobacter sp . SHO24 43 ADCH01000068 clade _ 181 Lactobacillus jensenii 1092 ACQD01000066 clade _ 182 Alcaligenes faecalis 119 AB680368 clade _ 183 Alcaligenes sp . C014 120 DQ643040 clade _ 183 Alcaligenes sp . S3 121 HQ262549 clade _ 183 Oligella ureolytica 1366 NR 041998 clade _ 183 Oligella urethralis 1367 NR 041753 clade _ 183 Eikenella corrodens 784 ACEA01000028 clade _ 185 Kingella denitrificans 1019AEWV01000047 clade 185 Kingella genomosp . P1 oral 1020 DQ003616 clade _ 185 cone MB2 _ C20 Kingella kingae 1021 AFHS01000073 clade _ 185 Kingella oralis 1022 ACJW02000005 clade _ 185 Kingella sp . oral clone ID059 1023 AY349381 clade 185 Neisseria elongata 1330 ADBF01000003 clade _ 185 Neisseria genomosp . P2 oral 1332 DQ003630 clade _ 185 clone MB5 P15 Neisseria sp . oral clone JC012 1345 AY349388 clade _ 185 Neisseria sp . SMC _ A9199 1342 FJ763637 clade _ 185 Simonsiella muelleri 1731 ADCY01000105 clade _ 185 Corynebacterium 700 ABYP01000081 clade _ 193 glucuronolyticum Corynebacterium 716 FJ185225 clade _ 193 pyruviciproducens Rothia aeria 1649 DQ673320 clade _ 194 Rothia dentocariosa 1650 ADDW01000024 clade _ 194 Rothia sp . oral taxon 188 1653 GU470892 clade _ 194 Corynebacterium accolens 681 ACGD01000048 clade _ 195 Corynebacterium macginleyi 707 AB359393 clade _ 195 Corynebacterium 714 ABYC01000237 clade _ 195 pseudogenitalium Corynebacterium 729 ACVP01000009 clade _ 195 tuberculostearicum Lactobacillus casei 1074 CP000423 clade _ 198 Lactobacillus paracasei 1106 ABOV01000067 clade 198 ZZZZZZZZZZZZZZZZZZZZZZZZZZZ ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 119 120 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Lactobacillus zeae 1143 NR _ 037122 clade_ 198 Prevotella dentalis 1492 AB547678 clade _ 205 Prevotella sp . oral clone 1529 AY923148 clade _ 206206 N N ASCG10 Prevotella sp . oral clone 1541 AY349399 clade 206 HF050 Prevotella sp . oral clone ID019 1542 AY349400 clade _ 206 Prevotella sp . oral clone IK062 1545 AY349402 clade _ 206 Prevotella genomosp . P9 oral 1499 DQ003633 clade _ 207 clone MB7 _ G16 Prevotella sp . oral clone 1531 AY005062 clade _ 207 AU069 Prevotella sp . oral clone 1532 AY005063 clade_ 207 CY006 Prevotella sp . oral clone FL019 1534 AY349392 clade _ 207 Actinomyces genomosp . C1 56 AY278610 clade _ 212 Actinomyces genomosp . C2 57 AY278611 clade _ 212 Actinomyces genomosp . P1 58 DQ003632 clade _ 212 oral clone MB6 _ C03 Actinomyces georgiae 59 GU561319 clade _ 212 Actinomyces israelii 60 AF479270 clade _ 212 Actinomyces massiliensis 61 AB545934 clade _ 212 Actinomyces meyeri 62 GU561321 clade _ 212 SZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Actinomyces odontolyticus 66 ACYT01000123 clade _ 212 Actinomyces orihominis 68 AJ575186 clade _ 212 Actinomyces sp . CCUG 37290 71 AJ234058 clade _ 212 Actinomyces sp . ICM34 75 HQ616391 clade _ 212 Actinomyces sp . ICM41 76 HQ616392 clade _ 212 Actinomyces sp . ICM47 77 HQ616395 clade _ 212 Actinomyces sp . ICM54 78 HQ616398 clade _ 212 Actinomyces sp . oral clone 87 AY349366 clade 212 IP081 Actinomyces sp . oral taxon 178 91 AEUH01000060 ?lade _ 212 Actinomyces sp . oral taxon 180 92 AEPP01000041 clade _ 212 Actinomyces sp . TeJ5 80 GU561315 clade _ 212 Haematobacter sp . BC14248 968 GU396991 clade _ 213 Paracoccus denitrificans 1424 CP000490 clade _ 213 Paracoccus marcusii 1425 NR 044922 clade _ 213 Grimontia hollisae 967 ADAQ01000013 clade _ 216 Shewanella putrefaciens 1723 CP002457 clade _ 216 Afipia genomosp . 4 111 EU117385 clade _ 217 Rhodopseudomonas palustris 1626 CP000301 clade _ 217 Methylobacterium extorquens 1223 NC 010172 clade _ 218 Methylobacterium podarium 1224 AY468363 clade _ 218 Methylobacterium 1225 GU294320 clade _ 218 radiotolerans Methylobacterium sp . 1 sub 1226 AY468371 clade _ 218 Methylobacterium sp . MM4 1227 AY468370 clade _ 218 Achromobacter denitrificans 18 NR _ 042021 clade _ 224 Achromobacter piechaudii 19 ADMS01000149 clade _ 224 Achromobacter xylosoxidans 20 ACRC01000072 clade _ 224 Bordetella bronchiseptica 384 NR _ 025949 clade _ 224 Bordetella holmesii 385 AB683187 clade _ 224 Bordetella parapertussis 386 NR _ 025950 clade _ 224 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 121 122 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Bordetella pertussis 387 BX640418 clade _ 224 Microbacterium chocolatum 1230 NR 037045 clade _ 225 Microbacterium flavescens 1231 EU714363 clade _ 225 Microbacterium lacticum 1233 EU714351 clade _ 225 Microbacterium oleivorans 1234 EU714381 clade _ 225 Microbacterium oxydans 1235 EU714348 clade 225 Microbacterium paraoxydans 1236 AJ491806 clade _ 225 Microbacterium 1237 EU714359 clade _ 225 phyllosphaerae Microbacterium schleiferi 1238 NR 044936 clade _ 225 Microbacterium sp . 768 1239 EU714378 clade _ 225 Microbacterium sp . oral strain 1240 AF287752 clade _ 225 C24KA Microbacterium testaceum 1241 EU714365 clade _ 225 Corynebacterium at??i??? 686 NR _ 025540 clade _ 229 Corynebacterium mastitidis 708 AB359395 clade _ 229 Corynebacterium sp . NML 725 GU238411 clade _ 229 97 _ 0186 Mycobacterium elephantis 1275 AF385898 clade _ 237 Mycobacterium paraterrae 1288 EU919229 clade _ 237 Mycobacterium phlei 1289 GU142920 clade _ 237 Mycobacterium sp . 1776 1293 EU703152 clade _ 237 Mycobacterium sp . 1781 1294 EU703147 clade _ 237 Mycobacterium sp . AQIGA4 1297 HM210417 clade _ 237 Mycobacterium sp . GN _ 10546 1299 FJ497243 clade _ 237 Mycobacterium sp . GN _ 10827 1300 FJ497247 clade _ 237 Mycobacterium sp . GN _ 11124 1301 FJ652846 clade _ 237 Mycobacterium sp . GN _ 9188 1302 FJ497240 clade _ 237 Mycobacterium sp . 1303 FJ555538 clade _ 237 GR _ 2007 _ 210 Anoxybacillus contaminans 172 NR _ 029006 clade _ 238 Bacillus aeolius 195 NR 025557 clade _ 238 Brevibacterium frigoritolerans 422 NR _ 042639 clade _ 238 Geobacillus sp . E263 934 DQ647387 clade _ 238 Geobacillus sp . WCH70 935 CP001638 clade _ 238 Geobacillus thermocatenulatus 937 NR _ 043020 clade _ 238 Geobacillus thermoleovorans 940 NR _ 074931 clade _ 238 ZZZSZZZZZZZZZZZZZZZZZZZZZZZZZZZ999ZZZZZZZZZZZZZZS Lysinibacillus fusiformis 1192 FN397522 clade _ 238 Planomicrobium koreense 1468 NR _ 025011 clade _ 238 Sporosarcina newyorkensis 1754 AFPZ01000142 clade _ 238 Sporosarcina sp . 2681 1755 GU994081 clade _ 238 Ureibacillus composti 1968 NR 043746 clade _ 238 Ureibacillus suwonensis 1969 NR 043232 clade _ 238 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Ureibacillus terrenus 1970 NR _ 025394 clade _ 238 Ureibacillus thermophilus 1971 NR 043747 clade _ 238 Ureibacillus thermosphaericus 1972 NR _ 040961 clade _ 238 Prevotella micans 1507 AGWK01000061 clade _ 239 Prevotella sp . oral clone 1533 AY005065 clade _ 239 DA058 Prevotella sp . SEQ053 1523 JN867222 clade _ 239 Treponema socranskii 1937 NR _ 024868 clade _ 240 Treponema sp . 6 : H :D15A _ 4 1938 AY005083 clade _ 240 Treponema sp . oral taxon 265 1953 GU408850 clade _ 240 Treponema sp . oral taxon G85 1958 GU432215 clade _ 240 ZZZZZ US 9 ,855 ,303 B2 123 124 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Porphyromonas endodontalis 1472 ACNN01000021 clade _ 241 N Porphyromonas sp . oral clone 1478 AY005068 clade _ 241 N BB134 Porphyromonas sp . oral clone 1479 AY005069 clade _ 241 F016 Porphyromonas sp . oral clone 1480 AY207054 clade _ 241 P2PB _ 52 P1 Porphyromonas sp . oral clone 1481 AY207057 clade _ 241 N P4GB _ 100 P2 Acidovorax sp . 98 _ 63833 26 AY258065 clade _ 245 Comamonadaceae bacterium 663 JN585335 clade 245 NML000135 Comamonadaceae bacterium 664 JN585331 clade _ 245 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ NML790751 Comamonadaceae bacterium 665 JN585332 clade 245 NML910035 Comamonadaceae bacterium 666 JN585333 clade_ 245 NML910036 Comamonas sp . NSP5 668 AB076850 clade _ 245 Delftia acidovorans 748 CP000884 clade _ 245 Xenophilus aerolatus 2018 JN585329 clade _ 245 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Oribacterium sp . oral taxon 078 1380 ACIQO2000009 clade _ 246 Oribacterium sp . oral taxon 102 1381 G0422713 clade _ 246 Weissella cibaria 2007 NR _ 036924 clade _ 247 Weissella confusa 2008 NR _ 040816 clade _ 247 Weissella hellenica 2009 AB680902 clade _ 247 Weissella kandleri 2010 NR _ 044659 clade _ 247 Weissella koreensis 2011 NR _ 075058 clade _ 247 Weissella para mesenteroides 2012 ACKU01000017 clade 247 Weissella sp . KLDS 7 .0701 2013 EU600924 clade _ 247 Mobiluncus curtisii 1251 AEPZ01000013 clade _ 249 Enhydrobacter aerosaccus 785 ACY101000081 clade _ 256 Moraxella osloensis 1262 JN175341 clade _ 256 Moraxella sp . GM2 1264 JF837191 clade _ 256 Brevibacterium casei 420 JF951998 clade _ 257 Brevibacterium epidermidis 421 NR _ 029262 clade _ 257 Brevibacterium sanguinis 426 NR 028016 clade _ 257 Brevibacterium sp . H15 427 AB177640 clade _ 257 Acinetobacter radioresistens 35 ACVR01000010 clade _ 261 Lactobacillus alimentarius 1068 NR _ 044701 clade _ 263 Lactobacillus farciminis 1082 NR 044707 clade _ 263 Lactobacillus kimchii 1097 NR 025045 clade _ 263 Lactobacillus nodensis 1101 NR _ 041629 clade _ 263 Lactobacillus tucceti 1138 NR 042194 clade _ 263 Pseudomonas mendocina 1595 AAUL01000021 clade _ 265 Pseudomonas 1598 NR _ 037000 clade _ 265 pseudoalcaligenes Pseudomonas sp . NP522b 1602 EU723211 clade _ 265 Pseudomonas stutzeri 1603 AM905854 clade _ 265 Paenibacillus barcinonensis 1390 NR 042272 clade _ 270 Paenibacillus barengoltzii 1391 NR _ 042756 clade _ 270 Paenibacillus chibensis 1392 NR _ 040885 clade _ 270 Paenibacillus cookii 1393 NR _ 025372 clade _ 270 Paenibacillus durus 1394 NR _ 037017 clade _ 270 US 9 ,855 ,303 B2 125 126 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Paenibacillus glucanolyticus 1395 D78470 clade _ 270 Paenibacillus lactis 1396 NR _ 025739 clade _ 270 Paenibacillus pabuli 1398 NR _ 040853 clade _ 270 Paenibacillus popilliae 1400 NR 040888 clade _ 270 Paenibacillus sp . CIP 101062 1401 HM212646 clade _ 270 Paenibacillus sp . JC66 1404 JF824808 clade _ 270 Paenibacillus sp . R _ 27413 1405 HE586333 clade _ 270 Paenibacillus sp . R _ 27422 1406 HE586338 clade _ 270 Paenibacillus timonensis 1408 NR _ 042844 clade _ 270 Rothia mucilaginosa 1651 ACVO01000020 clade _ 271 Rothia nasimurium 1652 NR 025310 clade _ 271 Prevotella sp . oral taxon 302 1550 ACZK01000043 clade _ 280 Prevotella sp . oral taxon F68 1556 HM099652 clade _ 280 Prevotella tannerae 1563 ACIJO2000018 clade _ 280 Prevotellaceae bacterium 1566 AY207061 clade _ 280 P4P _ 62 P1 Porphyromonas 1471 AENO01000048 clade _ 281 asaccharolytica Porphyromonas gingivalis 1473 AE015924 clade _ 281 Porphyromonas macacae 1475 NR 025908 clade _ 281 Porphyromonas sp . UQD 301 1477 EU012301 clade _ 281 Porphyromonas uenonis 1482 ACLR01000152 clade _ 281 Leptotrichia buccalis 1165 CP001685 clade _ 282 Leptotrichia hofstadii 1168 ACVB02000032 clade _ 282 Leptotrichia sp . oral clone 1173 AY349386 clade _ 282 HE012 Leptotrichia sp . oral taxon 223 1176 GU408547 clade _ 282 Bacteroides fluxus 278 AFBN01000029 clade _ 285 Bacteroides helcogenes 281 CP002352 clade _ 285 Parabacteroides johnsonii 1419 ABYH01000014 clade 286 Parabacteroides merdae 1420 EU136685 clade _ 286 Treponema denticola 1926 ADEC01000002 clade 288 Treponema genomosp . P5 oral 1929 DQ003624 clade _ 288 clone MB3 _ P23 Treponema putidum 1935 AJ543428 clade _ 288 Treponema sp . oral clone 1942 AY207055 clade 288 P2PB _ 53 P3 Treponema sp . oral taxon 247 1949 GU408748 clade _ 288 Treponema sp . oral taxon 250 1950 GU408776 clade _ 288 Treponema sp . oral taxon 251 1951 GU408781 clade _ 288 Anaerococcus hydrogenalis 144 ABXA01000039 clade _ 289 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZÖZZZZZZZZZZZZZZZZZ Anaerococcus sp . 8404299 148 HM587318 clade _ 289 Anaerococcus sp . gpac215 156 AM176540 clade _ 289 Anaerococcus vaginalis 158 ACXU01000016 clade _ 289 Propionibacterium 1569 NC _ 019395 clade _ 290 acidipropionici Propionibacterium avidum 1571 AJO03055 clade _ 290 Propionibacterium granulosum 1573 FJ785716 clade _ 290 Propionibacterium jensenii 1574 NR 042269 clade _ 290 Propionibacterium propionicum 1575 NR 025277 clade _ 290 Propionibacterium sp . H456 1577 AB177643 clade _ 290 Propionibacterium thoenii 1581 NR _ 042270 clade _ 290 Bifidobacterium bifidum 349 ABQP01000027 clade _ 293 Leuconostoc mesenteroides 1183 ACKV01000113 clade _ 295 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 127 128 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Leuconostoc 1184 NR _ 040814 clade _ 295 N pseudomesenteroides Johnsonella ignava 1016 X87152 clade _ 298 Propionibacterium acnes 1570 ADJM01000010 clade 299 Propionibacterium sp . 1576 AFIL01000035 clade _ 299 434 _ HC2 Propionibacterium sp . LG 1578 AY354921 clade _ 299 Propionibacterium sp . S555a 1579AB264622 clade _ 299 Alicyclobacillus sp . CCUG 128 HE613268 clade _ 301 53762 Actinomyces cardiffensis 53 GU470888 clade _ 303 Actinomyces funkei 55 HQ906497 clade _ 303 Actinomyces sp . HKU31 74 HQ335393 clade _ 303 Actinomyces sp . oral taxon 94 HM099646 clade _ 303 C55 Kerstersia gyiorum 1018 NR _ 025669 clade _ 307 Pigmentiphaga daeguensis 1467 JN585327 clade _ 307 Aeromonas allosaccharophila 104 S39232 clade 308 Aeromonas enteropelogenes 105 X71121 clade _ 308 Aeromonas hydrophila 106 NC 008570 clade _ 308 Aeromonas jandaei 107 X60413 clade _ 308 Aeromonas salmonicida 108 NC _ 009348 clade _ 308 Aeromonas trota 109 X60415 clade 308 Aeromonas veronii 110 NR 044845 clade _ 308 Marvinbryantia formatexigens 1196 AJ505973 clade _ 309 Rhodobacter sp . oral taxon 1620 HM099648 clade _ 310 C30 Rhodobacter sphaeroides 1621 CP000144 clade _ 310 Lactobacillus antri 1071 ACLL01000037 clade 313 Lactobacillus coleohominis 1076 ACOHO1000030 clade 313 Lactobacillus fermentum 1083 CP002033 clade _ 313 Lactobacillus gastricus 1085 AICN01000060 clade _ 313 Lactobacillus mucosae 1099 FR693800 clade _ 313 iZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Lactobacillus oris 1103 AEKL01000077 clade _ 313 Lactobacillus pontis 1111 HM218420 clade _ 313 Lactobacillus reuteri 1112 ACGW02000012 clade 313 Lactobacillus sp . KLDS 1 .0707 1127 EU600911 clade _ 313 Lactobacillus sp . KLDS 1 . 0709 1128 EU600913 clade _ 313 Lactobacillus sp . KLDS 1 . 0711 1129 EU600915 clade _ 313 Lactobacillus sp . KLDS 1 . 0713 1131 EU600917 clade _ 313 Lactobacillus sp . KLDS 1 .0716 1132 EU600921 clade _ 313 Lactobacillus sp . KLDS 1 .0718 1133 EU600922 clade _ 313 Lactobacillus sp . oral taxon 1137 GQ422710 clade 313 052 Lactobacillus vaginalis 1140 ACGV01000168 clade _ 313 Brevibacterium aurantiacum 419 NR 044854 clade _ 314 Brevibacterium linens 423 AJ315491 clade _ 314 Lactobacillus pentosus 1108 JN813103 clade _ 315 Lactobacillus plantarum 1110 ACGZ02000033 clade _ 315 Lactobacillus sp . KLDS 1 .0702 1123 EU600906 clade _ 315 Lactobacillus sp . KLDS 1 . 0703 1124 EU600907 clade _ 315 Lactobacillus sp . KLDS 1 .0704 1125 EU600908 clade _ 315 Lactobacillus sp . KLDS 1 . 0705 1126 EU600909 clade _ 315 Agrobacterium radiobacter 115 CP000628 clade _ 316 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 129 130 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- leng 1 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Agrobacterium tumefaciens 116 AJ389893 clade _ 316 Corynebacterium 685 EF463055 clade_ 317 argentoratense Corynebacterium diphtheriae 693 NC _ 002935 clade _ 317 Corynebacterium 715 NR _ 037070 clade _ 317 pseudotuberculosis Corynebacterium renale 717 NR _ 037069 clade _ 317 Corynebacterium ulcerans 731 NR _ 074467 clade _ 317 Aurantimonas coralicida 191 AY065627 clade _ 318 Aureimonas altamirensis 192 FN658986 clade _ 318 Lactobacillus acidipiscis 1066 NR 024718 clade _ 320 Lactobacillus salivarius 1117 AEBA01000145 clade _ 320 ZZZZZZZZZZZZZZZZZZZZZOZ Lactobacillus sp . KLDS 1 .0719 1134 EU600923 clade _ 320 Lactobacillus buchneri 1073 ACGHO1000101 clade _ 321 Lactobacillus genomosp . C1 1086 AY278619 clade _ 321 Lactobacillus genomosp . C2 1087 AY278620 clade _ 321 Lactobacillus hilgardii 1089 ACGP01000200 clade _ 321 Lactobacillus kefiri 1096 NR _ 042230 clade 321 Lactobacillus parabuchneri 1105 NR _ 041294 clade _ 321 Lactobacillus parakefiri 1107 NR _ 029039 clade _ 321 Lactobacillus curvatus 1079 NR _ 042437 clade _ 322 Lactobacillus sakei 1116 DQ989236 clade _ 322 Aneurinibacillus aneurinilyticus 167 AB101592 clade _ 323 Aneurinibacillus danicus 168 NR 028657 clade _ 323 Aneurinibacillus migulanus 169 NR 036799 clade _ 323 Aneurinibacillus terranovensis 170 NR 042271 clade _ 323 Staphylococcus aureus 1757 CP002643 clade _ 325 Category - B Staphylococcus auricularis 1758 JO624774 clade _ 325 Staphylococcus capitis 1759 ACFR01000029 clade _ 325 Staphylococcus caprae 1760 ACRH01000033 clade 325 Staphylococcus carnosus 1761 NR 075003 clade _ 325 Staphylococcus cohnii 1762 JN175375 clade _ 325 Staphylococcus condimenti 1763 NR 029345 clade _ 325 Staphylococcus epidermidis 1764 ACHE01000056 clade _ 325 Staphylococcus equorum 1765 NR _ 027520 clade _ 325 Staphylococcus haemolyticus 1767 NC _ 007168 clade 325 Staphylococcus hominis 1768 AM157418 clade _ 325 Staphylococcus lugdunensis 1769 AEQA01000024 clade _ 325 Staphylococcus pasteuri 1770 FJ189773 clade _ 325 Staphylococcus 1771 CP002439 clade _ 325 pseudintermedius Staphylococcus 1772 NR _ 029158 clade _ 325 saccharolyticus Staphylococcus saprophyticus 1773 NC _ 007350 clade_ 325 Staphylococcus sp . clone 1777 AF467424 clade _ 325 bottae7 Staphylococcus sp . H292 1775 AB177642 clade _ 325 Staphylococcus sp . H780 1776 AB177644 clade _ 325 Staphylococcus succinus 1778 NR _ 028667 clade _ 325 Staphylococcus warneri 1780 ACPZ01000009 clade _ 325 Staphylococcus xylosus 1781 AY395016 clade _ 325 Cardiobacterium hominis 490 ACKY01000036 clade _ 326 Cardiobacterium valvarum 491 NR _ 028847 clade _ 326 Pseudomonas fluorescens 1593 AY622220 clade _ 326 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ ZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 131 132 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- leng 1 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and Public DB Accession denotes the identifier of the OTU in a public sequence repository. SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Pseudomonas gessardii 1594 FJ943496 clade _ 326 Pseudomonas monteilii 1596 NR 024910 clade _ 326 Pseudomonas pode 1597 GU188951 clade _ 326 Pseudomonas putida 1599 AF094741 clade _ 326 Pseudomonas sp . G1229 1601 DQ910482 clade _ 326 Pseudomonas tolaasii 1604 AF320988 clade _ 326 Pseudomonas viridiflava 1605 NR _ 042764 clade _ 326 Listeria grayi 1185 ACCRO2000003 clade _ 328 Listeria innocua 1186 JF967625 clade _ 328 OZZZZZZZN Listeria ivanovii 1187 X56151 clade _ 328 N Listeria monocytogenes 1188 CP002003 clade _ 328 Category - B Listeria welshimeri 1189 AM263198 clade _ 328 Capnocytophaga sp . oral clone 484 AY923149 clade _ 333 ASCH05 Capnocytophaga sputigena 489 ABZV01000054 clade _ 333 Leptotrichia genomosp . Ci 1166 AY278621 clade _ 334 Leptotrichia shahii 1169 AYO29806 clade _ 334 Leptotrichia sp . neutropenic 1170 AF189244 clade _ 334 Patient Leptotrichia sp . oral clone 1171 AY349384 clade _ 334 GT018 Leptotrichia sp . oral clone 1172 AY349385 clade _ 334 GT020 Bacteroides sp . 20 _ 3 296 ACRQ01000064 clade _ 335 Bacteroides sp . 3 _ 1 _ 19 307 ADCJ01000062 clade_ 335 ZZZZZZZZZZZZZZZZZZZZZZZZ Bacteroides sp . 3 _ 2 _ 5 311 ACIB01000079 clade _ 335 Parabacteroides distasonis 1416 CP000140 clade _ 335 Parabacteroides goldsteinii 1417 AY974070 clade _ 335 Parabacteroides gordonii 1418 AB470344 clade _ 335 Parabacteroides sp . D13 1421 ACPW01000017 clade _ 335 Capnocytophaga genomosp . 477 AY278613 clade _ 336 C1 Capnocytophaga ochracea 480 AEOH01000054 clade _ 336 Capnocytophaga sp . GEJ8 481 GU561335 clade _ 336 Capnocytophaga sp . oral strain 486 AY005077 clade _ 336 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ A47ROY Capnocytophaga sp . Slb 482 U42009 clade _ 336 Paraprevotella clara 1426 AFFY01000068 clade _ 336 Bacteroides heparinolyticus 282 JN867284 clade _ 338 Prevotella heparinolytica 1500 GQ422742 clade _ 338 Treponema genomosp . P4 oral 1928 DQ003618 clade _ 339 clone MB2 _G19 Treponema genomosp . P6 oral 1930 DQ003625 clade _ 339 clone MB4 _G11 Treponema sp . oral taxon 254 1952 GU408803 clade _ 339 Treponema sp . oral taxon 508 1956 GU413616 clade _ 339 Treponema sp . oral taxon 518 1957 GU413640 clade _ 339 Chlamydia muridarum 502AE002160 clade _ 341 OP Chlamydia trachomatis 504 U68443 clade _ 341 OP Chlamydia psittaci 503 NR 036864 clade _ 342 Category - B Chlamydophila pneumoniae 509 NC 002179 clade _ 342 OP Chlamydophila psittaci 510 D85712 clade _ 342 OP Anaerococcus octavius 146 NR 026360 clade _ 343 Anaerococcus sp . 8405254 149 HM587319 clade _ 343 N US 9 ,855 ,303 B2 133 134 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Anaerococcus sp . 9401487 150 HM587322 clade _ 343 Anaerococcus sp . 9403502 151 HM587325 clade _ 343 Gardnerella vaginalis 923 CP001849 clade _ 344 Campylobacter lari 466 CP000932 clade _ 346 Anaerobiospirillum 142 NR _ 026075 clade _ 347 succiniciproducens Anaerobiospirillum thomasii 143 AJ420985 clade _ 347 Ruminobacter amylophilus 1654 NR 026450 clade _ 347 Succinatimonas hippei 1897 AEVO01000027 Actinomyces europaeus 54 NR 026363 clade _ 348 Actinomyces sp . oral clone 82 AY349361 clade _ 348 GU009 Moraxella catarrhalis 1260 CP002005 clade _ 349 Moraxella lincolnii 1261 FR822735 clade _ 349 Moraxella sp . 16285 1263 JF682466 clade _ 349 Psychrobacter sp . 13983 1613 HM212668 clade _ 349 Actinobaculum massiliae 49 AF487679 clade _ 350 Actinobaculum schaalii 50 AY957507 clade _ 350 Actinobaculum sp . BM # 101342 51 AY282578 clade _ 350 Actinobaculum sp . P2P _ 19 P1 52 AY207066 clade _ 350 Actinomyces sp . oral clone 84 AY349363 clade_ 350 10076 Actinomyces sp . oral taxon 848 93 ACUY01000072 clade_ 350 Actinomyces neuii 65 X71862 clade_ 352 Mobiluncus mulieris 1252 ACKW01000035 clade _ 352 Blastomonas natatoria 372 NR 040824 clade 356 Novosphingobium 1357 AAAV03000008 clade _ 356 aromaticivorans Sphingomonas sp . oral clone 1745 AY349411 clade _ 356 FIO12 Sphingopyxis alaskensis 1749 CP000356 clade _ 356 Oxalobacter formigenes 1389 ACDQ01000020 clade _ 357 Veillonella atypica 1974 AEDS01000059 clade _ 358 Veillonella dispar 1975 ACIKO2000021 clade _ 358 Veillonella genomosp . P1 oral 1976 DQ003631 clade _ 358 ZZZZZZZZZZZZZZZZZZZZZZZZZ clone MB5 _ P17 Veillonella parvula 1978 ADFU01000009 clade _ 358 Veillonella sp . 3 _ 1 _ 44 1979 ADCV01000019 clade _ 358 Veillonella sp . 6 _ 1 _ 27 1980 ADCW01000016 clade _ 358 Veillonella sp . ACP1 1981 HQ616359 clade _ 358 Veillonella sp . AS16 1982 HQ616365 clade _ 358 Veillonella sp . BS32b 1983 HQ616368 clade _ 358 Veillonella sp . ICM51a 1984 HQ616396 clade _ 358 Veillonella sp . MSA12 1985 HQ616381 clade _ 358 Veillonella sp . NVG 100cf 1986 EF108443 clade _ 358 Veillonella sp . OK11 1987 JN695650 clade _ 358 Veillonella sp . oral clone 1990 AY923144 clade _ 358 ASCG01 Veillonella sp . oral clone 1991 AY953257 clade_ 358 ASCGO2 Veillonella sp . oral clone OHIA 1992 AY947495 clade _ 358 Veillonella sp . oral taxon 158 1993 AENU01000007 clade _ 358 Kocuria marina 1040 GQ260086 clade _ 365 Kocuria rhizophila 1042 AYO30315 clade _ 365 ZZZZZZZZZZZZZZZZZZZ ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ US 9 ,855 ,303 B2 135 136 TABLE 1 - continued List of Operational Taxonomic Units (OTU ) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade Clade membership of bacterial OTUs is based on 16S sequence data . Clades are defined based on the topology of a phylogenetic tree that is constructed from full- length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics . Clades are constructed to ensure that all OTUs in a given clade are : ( i ) within a specified number of bootstrap supported nodes from one another, and ( ii ) within 5 % genetic similarity . OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S- V4 sequence data , while OTUs falling within the same clade are closely related . OTUs falling within the same clade are evolutionarily closely related and may ormay not be distinguishable from one another using 16S - V4 sequence data . Members of the same clade , due to their evolutionary relatedness , play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention . All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont ( see Definitions for description of “ Pathobiont” ) . NIAID Priority Pathogens are denoted as Category - A ' , ' Category - B ’ , or "Category - C ' , and Opportunistic Pathogens are denoted as 'OP ' . OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘ N ’ . The ‘ SEQ ID Number ' denotes the identifier of the OTU in the Sequence Listing File and “ Public DB Accession denotes the identifier of the OTU in a public sequence repository . SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Kocuria rosea 1043 X87756 clade _ 365 Kocuria varians 1044 AF542074 clade _ 365 Clostridiaceae bacterium 531 EF451053 clade _ 368 END 2 Micrococcus antarcticus 1242 NR _ 025285 clade _ 371 Micrococcus luteus 1243 NR 075062 clade _ 371 Micrococcus lylae 1244 NR 026200 clade _ 371 Micrococcus sp . 185 1245 EU714334 clade _ 371 Lactobacillus brevis 1072 EU194349 clade _ 372 Lactobacillus parabrevis 1104 NR 042456 clade _ 372 Pediococcus acidilactici 1436 ACXB01000026 clade _ 372 Pediococcus pentosaceus 1437 NR 075052 clade _ 372 Lactobacillus dextrinicus 1081 NR 036861 clade _ 373 Lactobacillus perolens 1109 NR 029360 clade _ 373 Lactobacillus rhamnosus 1113 ABWJO1000068 clade _ 373 Lactobacillus saniviri 1118 AB602569 clade _ 373 Lactobacillus sp . BT6 1121 HQ616370 clade _ 373 Mycobacterium mageritense 1282 FR798914 clade _ 374 Mycobacterium neoaurum 1286 AF268445 clade _ 374 Mycobacterium smegmatis 1291 CP000480 clade _ 374 Mycobacterium sp . HE5 1304 AJO12738 clade _ 374 Dysgonomonas gadei 775 ADLV01000001 clade _ 377 Dysgonomonas mossii 776 ADLW01000023 clade _ 377 Porphyromonas levii 1474 NR 025907 clade _ 377 Porphyromonas somerae 1476 AB547667 clade _ 377 Bacteroides barnesiae 267 NR 041446 clade _ 378 Bacteroides coprocola 272 ABIYO2000050 clade _ 378 Bacteroides coprophilus 273 ACBW01000012 clade _ 378 Bacteroides dorei 274 ABWZ01000093 clade _ 378 Bacteroides massiliensis 284 AB200226 clade _ 378 Bacteroides plebeius 289 AB200218 clade _ 378 Bacteroides sp . 3 _ 1 _ 33FAA 309 ACPS01000085 clade _ 378 Bacteroides sp . 3 _ 1 _ 40A 310 ACRT01000136 clade _ 378 Bacteroides sp . 4 _ 3 _ 47FAA 313 ACDR02000029 clade _ 378 Bacteroides sp . 9 _ 1 _ 42FAA 314 ACAA01000096 clade _ 378 Bacteroides sp . NB _ 8 323 AB117565 clade 378 Bacteroides vulgatus 331 CP000139 clade _ 378 Bacteroides ovatus 287 ACWH01000036 clade _ 38 Bacteroides sp . 1 _ 1 _ 30 294 ADCL01000128 clade _ 38 Bacteroides sp . 2 _ 1 _ 22 297 ACPQ01000117 clade _ 38 Bacteroides sp . 2 _ 2 _ 4 299 ABZZ01000168 clade _ 38 Bacteroides sp . 3 _ 1 _ 23 308 ACRS01000081 clade 38 Bacteroides sp . D1 318 ACAB02000030 clade 38 Bacteroides sp . D2 321 ACGA01000077 clade_ 38 Bacteroides sp . D22 320 ADCK01000151 clade _ 38 Bacteroides xylanisolvens 332 ADKP01000087 clade _ 38 Treponema lecithinolyticum 1931 NR 026247 clade _ 380 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZOO9ZZZZZZZZZZZZZZZZ Treponema parvum 1933 F302937 clade _ 380 Treponema sp . oral clone 1940 AY349417 clade _ 380 JU025 Treponema sp . oral taxon 270 1954 GQ422733 clade _ 380 Parascardovia denticolens 1428 ADEB01000020 clade _ 381 Scardovia inopinata 1688 AB029087 clade _ 381 Scardovia wiggsiae 1689 AY278626 clade _ 381 ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ