Molecular Vision 2005; 11:971-6
A new congenital nuclear cataract caused by a missense mutation in the γD-crystallin gene (CRYGD) in a Chinese family
Jingzhi Gu,1 Yanhua Qi,1 Li Wang,1 Jin Wang,1 Lisong Shi,2 Hui Lin,1 Xiang Li,1 Hong Su,1 Shangzhi Huang2
1Department of Ophthalmology, the Second Affiliated Hospital of Harbin Medicine University, Harbin, China; 2Department of Medical Genetics, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Peking, China
Purpose: To identify genetic defects associated with nuclear golden crystal autosomal dominant congenital cataract (ADCC) in a Chinese pedigree in the north of China. Methods: Clinical data were collected and the phenotype of the affected members in this family was recorded by slit lamp photography. Genomic DNA was isolated from peripheral blood. Linkage analyses excluded all known loci except that in 2q33-q35. Mutation analysis of CRYGs was carried by direct sequencing of the PCR products. Results: Sequencing of the coding regions of CRYGA, CRYGB, CRYGC, and CRYGD showed the presence of a heterozy- gous C>A transversion at nt109 of the coding sequence (R36S) in exon 2 of CRYGD, which co-segregated with the affected members. Conclusions: The R36S mutation in CRYGD identified in this Chinese family caused a nuclear golden crystal cataract phenotype not described before. This finding is an additional indication that there may be phenotypic heterogeneity of cataract, especially in different races.
Congenital cataracts are a significant cause of visual im- intrinsic protein (MIP), and one gene coding for beaded fila- pairment in childhood. They have a high incidence and are a ment structural protein 2 (BFSP2). Also, a mutation in CRYGS significant cause of vision loss world wide causing approxi- with autosomal dominant cataract in humans was recently re- mately one tenth of childhood blindness [1]. Roughly 50% of ported [26]. congenital cataracts are hereditary and family studies have re- In our study, we performed linkage analysis on a four vealed that approximately 30% of children with bilateral iso- generation Chinese family with nuclear golden crystal cata- lated congenital cataract had a genetic basis [2]. racts by using STRs markers on 12 ADCC loci and haplotype Congenital cataract is phenotypically and genetically het- analysis with makers on 2q33-q35. A missense mutation in erogeneous. To date, congenital cataracts, isolated or exon 2 of the CRYGD gene was identified, which is respon- syndromic forms, have been mapped to 27 genetic loci, and sible for the disease in this pedigree. the disease-associated mutations have been identified in 18 genes, including those coding for αA-crystallin [3,4], αB-crys- METHODS tallin [5], βA1-crystallin [6,7], βB1-crystallin [8], βB2-crys- Clinical evaluation: The family was ascertained by the De- tallin [9], γC-crystallin [10], γD-crystallin [11-13], beaded fila- partment of Ophthalmology, the Second Affiliated Hospital ment structural protein 2 [14], heat shock transcription factor of Harbin Medicine University, Heilongjiang province, China. 4 [15], gap junction protein alpha-3 [16], gap junction protein Informed consent in accordance with the Declaration of alpha-8 [17], paired-like homeodomain transcription factor-3 Helsinki and the Heilongjiang Institutional Review Board ap- [18,19], ferritin [20], galactokinase 1 [21], glucosaminyl(N- proval was obtained from all participants. The pedigree was a acetyl)transferase 2 [22], major intrinsic protein of lens fiber four generation family with 7 members affected (Figure 1). (MIP) [23], lens intrinsic membrane protein 2 (LIM2) [24], ADCC diagnosis was established by the presence of affected and paired box gene 6 [25]. Among them, 12 distinct genes individuals in each generation and male to male transmission. have been identified to cause nonsyndromic autosomal domi- Affected status was determined by the surgical records of cata- nant cataracts, including seven genes coding for crystallin ract extraction for the patients or ophthalmologic examina- (CRYAA, CRYAB, CRYBA1/A3, CRYBB1, CRYBB2, CRYGC, tion, included slit lamp examination with dilated pupils, vi- CRYGD) and two genes coding for gap junctional channel sual acuity testing, intraocular pressure measurement, fundus protein (GJA3, GJA8), one gene coding for heat-shock tran- examination, and ultrasonic examination. Peripheral blood (5 scription factor 4 gene (HSF4), one gene coding for major ml) was collected from each of 5 available affected and 5 un- affected individuals in the family, and genomic DNA was ex- Correspondence to: Jingzhi Gu, Affiliated Second Hospital of Harbin tracted using standard protocol. Medicine, University Heilongjiang Province, 246 Baojian Road, Genotyping and linkage analysis: Twenty-one Harbin 150086, China; Phone: 0086-0451-86605851; FAX: 0086- microsatellite markers close linked to 12 known ADCC loci 0451-86605116; email: [email protected] were used to perform allele-sharing among patients in the fam- 971 Molecular Vision 2005; 11:971-6
D13S1236, D13S175, D16S3034, D16S421, D17S1294, Fragment D17S1288, D21S212, D22S1174, D22S315, TOP1P2, Gene Exon Strand Sequence (5'-3') size (bp) ------CRYBB2 and three additional markers, D2S2318, D2S1384, CRYGA 1 Forward GTCAGCTGGAAGGAACATCC 291 and D2S1385, linked to the CRYGs. The oligonucleotide Reverse TGAGGACAACTCGAAAATGC 2 Forward GGGTCAGGCCTTGCTATTCT 450 primer sequences were selected from The GDB Human Ge- Reverse CCATGTCTATTGGGGGTCTG nome Database. The order and genetic distances of the mark- 3 Forward GGATTGATTGAACCTGGGAG 659 Reverse GGTGAAAGTTGCAGTGAGCA ers were derived from the Marshfield database. Microsatellites CRYGB 1,2 Forward GGTGGTGCATGCCTGTAA 679 were amplified by polymerase chain reaction (PCR) follow- Reverse GCCCTTTTGTGTGATTTCCT 3 Forward AAACTTGGCCTGGGAGAACT 553 ing standard methods. The genotypes were obtained by silver Reverse GCTTCCCATCATGAAAACAT stain and manual inspection. The pedigree and haplotype was CRYGC 1 Forward CATTTCCAGTGAATGCAGGA 442 Reverse CGCAGCAAGTATTGTTGACC constructed by Cyrillic version 2.1 (MathStat Software 2 Forward GGAAGGTGAGCAGAACACAA 476 ;Victoria, Australia). Reverse TGGCTTATTCAGGTCTCTGATG 3 Forward AATGACAATTCCATGCCACA 534 Mutation analysis: DNA samples from all available af- Reverse CCCACCCCATTCACTTCTTA fected and unaffected family members of the family were CRYGD 1,2 Forward CTTATGTGGGGAGCAAACT 620 Reverse CAGCAGCCCTCCTGCTAT screened for mutations in CRYGA, CRYGB, CRYGC, and 3 Forward GAAACAGCTATGACCATGCACA CRYGD by direct cycle sequencing of the PCR products. The CTTGCTTTTCTTCTCTTT 435 Reverse ATACGACTCACTATAGGGCAAG genomic sequence of CRYGs was obtained from the Ensemble ACACAAGCAAATCAGTGCC genome data resources. Gene specific PCR primers were used to amplify the three exons and flanking introns sequences of Gene specific PCR primer sequences for all exons and flanking in- CRYGA, CRYGB (sequences available upon request), CRYGC, trons sequences of CRYGA, CRYGB, CRYGC, and CRYGD and the size of each PCR product.
Figure 1. Pedigree and haplotype of the autosomal dominant congenital cataract. Black and white symbols denote affected and unaffected individuals, respectively. The affected haplotype is indicated by a black vertical bar. The sequence of mark- ers is from centromere to telomere. The pedigree and haplotype was constructed by Cyrillic version 2.1.
972 Molecular Vision 2005; 11:971-6
RESULTS DISCUSSION Clinical findings: All affected members showed nuclear cata- In this report, after excluding all known loci corresponding ract, presented at birth or developed during infancy, progress- to ADCC in a Chinese family except on 2q33-35, we have ing slowly with age. One of them has had cataract extraction. identified a locus on 2q33.3-q34 associated with the nuclear In the other four patients without cataract extraction, the cata- golden crystal cataract and found that a C>A transversion in ract was bilateral and consisted of a central pulverulent opac- exon 2 of CRYGD in all affected members of the family. This ity affecting the embryonal, fetal, and infantile nucleus of the mutation co-segregated with the cataract in the family and no lens, characterized by golden crystal punctuate, with metal- mutation was identified in the 100 independent control allele. like refractivity in the opaque nucleus (Figure 2, Figure 3). It is known that only CRYGC and CRYGD encode abun- From the hospital records, the best corrected visual acuity of dant lens γ-crystallins in humans [27,28] and almost 90% of the affected eyes varied from 20/200 to 40/200 before cata- the γ-crystallins synthesized in human lens are the products of ract extraction. There was no family history of any other ocu- these two genes [29]. CRYGD is one of only two γ-crystallins lar or systemic abnormalities. Autosomal dominant inherit- to be expressed at high concentrations in the fiber cells of the ance of the phenotype was supported by the presence of af- human embryonic lens and these cells subsequently form the fected individuals in each of the four generations and with a lens nucleus fibers. Many identified mutations in CRYGD have male to male transmission. been and have proven to be cataractogenic. We think that the Mutation detection: Allele-sharing analysis among the heterozygous mutation was responsible for the congenital cata- affected members in the family excluded linkage with the 11 ract in this family. This is because first, Kmoch et al. [30] has ADCC loci other than those on 2q33-35. Haplotype analysis identified this mutation in a Czech 5-year-old boy who suf- on chromosome 2q33-35 showed that a block of 5 markers fered from photophobia and decreased visual acuity due to (black bar in Figure 1) was co-segregated with the disease in symmetrical crystal deposition and grayish opacities in both this family. Direct sequencing was performed to cover exons lenses, and then proved that cataract was caused by deposi- and flanking intron-exon boundary sequences. A heterozygous tion of defined crystallized protein, γD crystallin. Second, we C>A transversion (Figure 4, Figure 5) was identified at nucle- sequenced 100 alleles of 50 unrelated control individuals and exclude the possibility of a rare polymorphism. Third, the single transversion in the heterozygous state (cDNA 109C>A)
Figure 2. Frontal view photograph of the eye of the proband. Photo- graph of the anterior segment of the eye of the proband using a TOPCON Retinal camera TRC-NW6S. Opacities were located in Figure 3. Slit lamp photographs of the eye of the proband. There the embryonal, fetal, and infantile nucleus of the lens while the cor- were many crystal dots in the grey-white opaque nucleus, with golden tex was transparent. metal-like refractivity. 973 Molecular Vision 2005; 11:971-6
Figure 4. Forward sequence analysis of CRYGD at exon 2. A: Sequence of unaf- fected individual (individual III:1 in Fig- ure 1). B: Sequence of affected (indi- vidual III:4 in Figure 1). A single trans- version is observed at position 109 (C>A).
Figure 5. Reverse sequence analysis of CRYGD at exon 2. A: Sequence of unaf- fected individual (individual III:1 in Fig- ure 1). B: Sequence of affected (indi- vidual III:4 in Figure 1). A single trans- version is observed at position 109 (G>T).
974 Molecular Vision 2005; 11:971-6
REFERENCES 15. Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, 1. Gilbert CE, Canovas R, Hagan M, Rao S, Foster A. Causes of Zheng G, Qian M, Cui B, Xia Y, Liu J, Hu L, Zhao G, Hayden childhood blindness: results from west Africa, south India and MR, Kong X. Mutant DNA-binding domain of HSF4 is associ- Chile. Eye 1993; 7:184-8. ated with autosomal dominant lamellar and Marner cataract. Nat 2. Rahi JS, Dezateaux C, British Congenital Cataract Interest Group. Genet 2002; 31:276-8. Measuring and interpreting the incidence of congenital ocular 16. Mackay D, Ionides A, Kibar Z, Rouleau G, Berry V, Moore A, anomalies: lessons from a national study of congenital cataract Shiels A, Bhattacharya S. Connexin46 mutations in autosomal in the UK. Invest Ophthalmol Vis Sci 2001; 42:1444-8. dominant congenital cataract. Am J Hum Genet 1999; 64:1357- 3. Mackay DS, Andley UP, Shiels A. Cell death triggered by a novel 64. mutation in the alphaA-crystallin gene underlies autosomal 17. Berry V, Mackay D, Khaliq S, Francis PJ, Hameed A, Anwar K, dominant cataract linked to chromosome 21q. Eur J Hum Genet Mehdi SQ, Newbold RJ, Ionides A, Shiels A, Moore T, 2003; 11:784-93. Bhattacharya SS. Connexin 50 mutation in a family with con- 4. Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, genital “zonular nuclear” pulverulent cataract of Pakistani ori- Weleber RG. Autosomal dominant congenital cataract associ- gin. Hum Genet 1999; 105:168-70. ated with a missense mutation in the human alpha crystallin 18. Willoughby CE, Arab S, Gandhi R, Zeinali S, Arab S, Luk D, gene CRYAA. Hum Mol Genet 1998; 7:471-4. Billingsley G, Munier FL, Heon E. A novel GJA8 mutation in 5. Berry V, Francis P, Reddy MA, Collyer D, Vithana E, MacKay I, an Iranian family with progressive autosomal dominant con- Dawson G, Carey AH, Moore A, Bhattacharya SS, Quinlan RA. genital nuclear cataract. J Med Genet 2003; 40:e124. Alpha-B crystallin gene (CRYAB) mutation causes dominant 19. Semina EV, Ferrell RE, Mintz-Hittner HA, Bitoun P, Alward WL, congenital posterior polar cataract in humans. Am J Hum Genet Reiter RS, Funkhauser C, Daack-Hirsch S, Murray JC. A novel 2001; 69:1141-5. homeobox gene PITX3 is mutated in families with autosomal- 6. Qi Y, Jia H, Huang S, Lin H, Gu J, Su H, Zhang T, Gao Y, Qu L, Li dominant cataracts and ASMD. Nat Genet 1998; 19:167-70. D, Li Y. A deletion mutation in the betaA1/A3 crystallin gene 20. Aguilar-Martinez P, Biron C, Masmejean C, Jeanjean P, Schved (CRYBA1/A3) is associated with autosomal dominant congeni- JF. A novel mutation in the iron responsive element of ferritin tal nuclear cataract in a Chinese family. Hum Genet 2004; L-subunit gene as a cause for hereditary hyperferritinemia-cata- 114:192-7. ract syndrome. Blood 1996; 88:1895. 7. Reddy MA, Bateman OA, Chakarova C, Ferris J, Berry V, Lomas 21. Stambolian D, Ai Y, Sidjanin D, Nesburn K, Sathe G, Rosenberg E, Sarra R, Smith MA, Moore AT, Bhattacharya SS, Slingsby M, Bergsma DJ. Cloning of the galactokinase cDNA and iden- C. Characterization of the G91del CRYBA1/3-crystallin pro- tification of mutations in two families with cataracts. Nat Genet tein: a cause of human inherited cataract. Hum Mol Genet 2004; 1995; 10:307-12. 13:945-53. 22. Yu LC, Twu YC, Chang CY, Lin M. Molecular basis of the adult 8. Mackay DS, Boskovska OB, Knopf HL, Lampi KJ, Shiels A. A i phenotype and the gene responsible for the expression of the nonsense mutation in CRYBB1 associated with autosomal domi- human blood group I antigen. Blood 2001; 98:3840-5. nant cataract linked to human chromosome 22q. Am J Hum 23. Berry V, Francis P, Kaushal S, Moore A, Bhattacharya S. Mis- Genet 2002; 71:1216-21. sense mutations in MIP underlie autosomal dominant ‘polymor- 9. Vanita, Sarhadi V, Reis A, Jung M, Singh D, Sperling K, Singh JR, phic’ and lamellar cataracts linked to 12q. Nat Genet 2000; 25:15- Burger J. A unique form of autosomal dominant cataract ex- 7. plained by gene conversion between beta-crystallin B2 and its 24. Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E, Geffen- pseudogene. J Med Genet 2001; 38:392-6. Carmi N, Frydman M, Goldman B, Pras E. A missense muta- 10. Heon E, Priston M, Schorderet DF, Billingsley GD, Girard PO, tion in the LIM2 gene is associated with autosomal recessive Lubsen N, Munier FL. The gamma-crystallins and human cata- presenile cataract in an inbred Iraqi Jewish family. Am J Hum racts: a puzzle made clearer. Am J Hum Genet 1999; 65:1261- Genet 2002; 70:1363-7. 7. 25. Azuma N, Yamaguchi Y, Handa H, Hayakawa M, Kanai A, 11. Stephan DA, Gillanders E, Vanderveen D, Freas-Lutz D, Wistow Yamada M. Missense mutation in the alternative splice region G, Baxevanis AD, Robbins CM, VanAuken A, Quesenberry MI, of the PAX6 gene in eye anomalies. Am J Hum Genet 1999; Bailey-Wilson J, Juo SH, Trent JM, Smith L, Brownstein MJ. 65:656-63. Progressive juvenile-onset punctate cataracts caused by muta- 26. Sun H, Ma Z, Li Y, Liu B, Li Z, Ding X, Gao Y, Ma W, Tang X, tion of the gammaD-crystallin gene. Proc Natl Acad Sci U S A Li X, Shen Y. Gamma-S crystallin gene (CRYGS) mutation 1999; 96:1008-12. causes dominant progressive cortical cataract in humans. J Med 12. Nandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Genet 2005; 42:706-10. Benazzouz B, Hajaji Y, Boutayeb S, Gribouval O, Arbogast L, 27. Russell P, Meakin SO, Hohman TC, Tsui LC, Breitman ML. Re- Berraho A, Abitbol M, Hilal L. Gamma-D crystallin gene lationship between proteins encoded by three human gamma- (CRYGD) mutation causes autosomal dominant congenital cer- crystallin genes and distinct polypeptides in the eye lens. Mol ulean cataracts. J Med Genet 2003; 40:262-7. Cell Biol 1987; 7:3320-3. 13. Shentu X, Yao K, Xu W, Zheng S, Hu S, Gong X. Special 28. Brakenhoff RH, Aarts HJ, Reek FH, Lubsen NH, Schoenmakers fasciculiform cataract caused by a mutation in the gammaD- JG. Human gamma-crystallin genes. A gene family on its way crystallin gene. Mol Vis 2004; 10:233-9. to extinction. J Mol Biol 1990; 216:519-32. 14. Conley YP, Erturk D, Keverline A, Mah TS, Keravala A, Barnes 29. Siezen RJ, Thomson JA, Kaplan ED, Benedek GB. Human lens LR, Bruchis A, Hess JF, FitzGerald PG, Weeks DE, Ferrell RE, gamma-crystallins: isolation, identification, and characteriza- Gorin MB. A juvenile-onset, progressive cataract locus on chro- tion of the expressed gene products. Proc Natl Acad Sci U S A mosome 3q21-q22 is associated with a missense mutation in 1987; 84:6088-92. the beaded filament structural protein-2. Am J Hum Genet 2000; 30. Kmoch S, Brynda J, Asfaw B, Bezouska K, Novak P, Rezacova 66:1426-31. P, Ondrova L, Filipec M, Sedlacek J, Elleder M. Link between a 975 Molecular Vision 2005; 11:971-6
novel human gammaD-crystallin allele and a unique cataract 31. Zenteno JC, Morales ME, Moran-Barroso V, Sanchez-Navarro phenotype explained by protein crystallography. Hum Mol Genet A. CRYGD gene analysis in a family with autosomal dominant 2000; 9:1779-86. congenital cataract: evidence for molecular homogeneity and intrafamilial clinical heterogeneity in aculeiform cataract. Mol Vis 2005; 11:438-42.
The print version of this article was created on 9 Nov 2005. This reflects all typographical corrections and errata to the article through that date. Details of any changes may be found in the online version of the article. α 976