Taxonomy, biogeography and population genetic structure of the southern Australian intertidal barnacle fauna
Katherine L York
Subtnittcd in total fulfihncnt of the requirements of the degree of Doctor of Philosophy
Decetnber, 2008
Departrnent of Genetics 'T'hc University of Melbourne
Produced on archival quality paper Declaration
This is to certify that:
(i) this thesis comprises only my original work towards the PhD except where
indicated in the Preface;
(ii) due acknowledgement has been made in the text to all other material used;
(iii) this thesis is less than I 00,000 words in Ient::,rth, exclusive of table, figures,
bibliographies and appendices
Parts of the work have been published in the following paper:
York, K.L., l3lacket, M.J., and Appleton, B.R. (2008) The Bassian Isthmus and the major ocean currents of southeast Australia influence the phytogeography and population structure of a southern Australian intertidal barnacle Calomerus polymerus (Darwin).
Molecular Ecology 17: 1948-1961
Katherine York Abstract
Barnacles are a unique organism in that they have both a planktonic larval stage followed
by an irreversibly sessile adult stage. Widely distributed throughout the world, they have
been studied by tnany prominent scientists, with much of the work undertaken focusing on ecology and taxonomy. However, most of the taxonomic work had been undertaken based on morphological characteristics, with phylogenetic studies only undertaken more recently. Many of these studies have failed to include Australian species, most of which are endemic to the continent.
Newly produced and Genbank records of mitochondrial DNA sequence were used to confirm the taxonomic status of Australian species. The status of most species was confirmed, with a few notable exceptions. In particular, data analysis suggested the existence of cryptic species within Elminius modestus. In addition, the divergence between these three species and Elminius kingii was great enough to warrant the introduction of a new genus, Austrominius. This genus now contains three species, A. modestus, A. adelaidae and A. covertus.
The two-phase life history of barnacles also made them the ideal organism for the study of the dynamics of the southern Australian marine environment. Three marine biogeographic provinces are recognised in the region, with both historical and contemporary ecological factors predicted to be responsible. In order to investigate the biogeography and hydrography of the region, both tnitochondrial sequence data and n1icrosatellite data were used to investigate the phylogeography and population genetic
ii structure of Catomerus polymerus. The mitochondrial data showed a deep
phylogeographical split, dividing the species into eastern and western lineages. Dating
this split using a molecular clock indicated that the repeated emergence of the Bassian
Isthmus during glacial periods was most likely responsible, having provided a barrier to
gene flow between the two lineages. However, subsequent geneflow during interglacial periods prevented the lineages from diverging into two separate species. Analysis of the microsatellite data indicated that the species comprised four groups or subregions; one in
South Australia, one in New South Wales and eastern Victoria, one in central Victoria, and one in western Victoria and Tasmania. Further analysis of the data indicated that these subregions could be due to the influence of the major ocean currents (Leeuwin, East
Australian and Zeehan currents), and the reduction in gene 'flow across two biogeographic breaks (Ninety Mile Beach, The Coorong). This correlates reasonably well with the previously recognised biogeographic provinces.
Finally, mitochondrial data were used to examine the phytogeography of two species of barnacle, Chthamalus antennatus and Chamaesipho tasmanica. In contrast with the study of C.polymerus, these species did not show any significant structure across their entire distribution. There are a number of possible explanations for this, with most relating to the longevity and durability of the larvae. However, it is also possible that these species could colonise southern Tasmania during the glacial periods, thereby being unaffected by the present of the Bassian Isthmus, and maintaining a single pamnictic population.
iii Preface
The following work was carried out by, or in conjunction with others
Chapter 4: Microsatellite isolation in Catomerus polymerus was carried out with the supervision of M. Blacket
iv Acknowledgments
There are many people without whom my PhD would not have been possible. Firstly, my
supervisor Belinda Appleton, who provided the perfect balance of supervision and
friendship. Without Belinda, this project would not have existed, but I am grateful also for being able to take the project in my own direction. Thank you for all the advice and guidance, all the chats and the fun times too! I have enjoyed and appreciated having a supervisor that I can really talk to, about both work and anything else.
Thank you also to Joanne Srnissen, who provided the original idea which started the project. Without you I would never have even thought about working on barnacles, let alone had any idea about all the different species. Thank you also for providing all the vital literature and background information that got this project up and running.
I am also grateful to Mark Blacket, who guided me through the process of creating a microsatellite library from start to finish. Without you I would have been lost. Thank you also for spending ti1ne showing me the many different ways to analyse mitochondrial data.
Many thanks also to the Genetics Department, and the Appleton Lab in particular. There are many people who have been there, day-to-day, throughout my PhD who have been
1nore help than they realise. Not just for help in the lab with different techniques, but also for the distraction when I've needed a break.
v There are also many people and organisations which I must thank for their help with field
work. Permits were provided by New South Wales Fisheries, Victorian Department of
Sustainability and Environment, South Australia Primary Industries and Resources SA,
and Tasmania Department of Primary Industries and Water. There have been numerous
people who have come along on field trips, including Melanie Norgate, Fallon Mody,
Kate Ryan, Dale Appleton, Cadel Appleton, Elissa York, Melissa Stahle and Suzanne
York.
Thank you also to Parks Victoria, who provided funding for much of this research.
Last, but most importantly, are the family and friends who have supported me over the
last 3 ~ years. Without you, I would not have been able to be this dedicated. My friends
have been there to cheer me up and distract me when I needed a break. My family have
also provided countless support and encouragement. However, my acknowledgements
would not be complete without specifically thanking my mum, Suzanne. For the
encouragement and support throughout my entire education, and for believing that I can
achieve whatever I want. For continuing to support me through another 3 ~ years of study. For cooking me dinner when I get home late. For travelling around half of
Australia with me collecting barnacles. For being interested i.n what I do, and trying to understand when I'm talking science. And most of all, for loving Ine. Without you, I would not be where I am today.
vi Table of Contents
Declaration ...... i
Abstract ...... ii
Preface ...... iv
Ack.nowledgements ...... v
Contents ...... vii
Figures ...... xiii
'"fables ...... ; ...... xiv
Chapter 1 Introduction ..•...•...... 1
1.1 General Description ...... 2
1.2 Reproduction ...... 3
1.3 Taxonomy and Phylogenetics of the Cirripedia ...... 5
I .4 Biogeography ...... 7
1.5 Markers for Use in Phytogeographic and Biogeographic Studies ...... 13
1.5.1 Mitochondrial DNA (mtDNA) Structure ...... 14
1.5.2 Use ofmtDNA in Phylogenetics ...... 15
1.5.3 Microsatellite Evolution ...... 17
1.5.4 Use of Microsatellites in Studies of Population Genetic Structure ...... 19
1.6 Overall Aims ...... 20
Chapter 2 General Materials and Methods ...... 22
2.1 Sample Collection ...... 23
vii 2.1.1 Whole Individuals ...... 23
2.1.2 Partial Samples of Catomerus Polymerus ...... 23
2.1.3 Sampling Criteria ...... 23
2.2 DNA Extraction ...... 32
2.3 DNA Polymerase Chain Reaction (PCR) ...... 33
2.3.1 Primer Sequences: ...... 33
2.3.2 PCR Protocol ...... 34
2.4 Sequencing ...... 35
2.4.1 Sequencing Protocol...... 35
2.5 Analysis of Sequence Data ...... 35
2.5.1 Sequence Analysis ...... 35
2.5.2 Phylogenetic Analysis ...... 36
Chapter 3 Phylogeny of the Southern Australian Intertidal Barnacle Fauna ...... 37
3.1 Introduction ...... : ...... 38
3.2 Materials and Methods ...... 40
3 .2.1 Sample Collection ...... 40
3 .2.2 DNA Extraction and Sequencing ...... 40
3.2.3 Phylogenetic Analysis ...... 45
3.3 Results ...... ·...... 46
3.3. I Within Australia ...... 46
3 .3.2 Global Phylogeny ...... 52
3.3.3 'fhe Eln1inius genus ...... 55
viii 3.4 Discussion ...... 60
3.4.1 Sequence Divergence Between and Within Species ...... 60
3.4.2 Within Australia ...... 60
3.4.3 Global Phylogeny ...... 61
3.4.4 The Chamaesipho Genus ...... 61
3.4.5 The Chthamalus Genus ...... 62
3.4.6 The Elminius Genus ...... 63
3.5 Conclusions ...... 67
Chapter 4 Mitochondrial and Microsatellitc Population Structure and
Biogeography of Catomerus polymerus ...... 68
4.1 Introduction ...... 69
4.1.1 General Description of Catomerus polymerus ...... 69
4.1.2 Marine Biogeography of Southern Australia ...... 70
4.1.3 Aims of the Study ...... 76
4.1 Materials and Methods ...... 76
4.2.1 Sample Collection and DNA Extraction ...... 76
4.2.2 Mitochondrial Amplification and Sequencing ...... 79
4.2.3 Mitochondrial DNA Sequence Analysis ...... 80
4.2.4 Isolation and Characterisation of Microsatellites ...... 82
4.2.5 Genotypi11g ...... 83
4.2.6 Microsatellite Analysis ...... 83
4.3 Results ...... 87
ix 4.3.1 Mitochondrial Analysis ...... 87
4.3.2 Microsatellite Analysis ...... 90
4.4 Discussion ...... 105
4.4.1 Phylogeography and Origin of Populations ...... I 05
4.4.2 Contemporary Population Structure ...... 107
4.4.3 One Species or Two? ...... III
4.4.4 Management Recom1nendations ...... 112
4.5 Conclusions ...... 112
Chapter 5 Mitochondrial Population Structure of Chtllamalus antennatus and
Cltamaesiplto tasmanica ...... 114
5. I Introduction ...... 115
5.2 Materials and Methods ...... 120
5.2.1 Sample Collection ...... I 20
5 .2.2 DNA Extraction and Sequencing ...... 120
5 .2.3 Phylogenetic Analysis ...... 120
5 .2.4 I solation and Characterisation of Microsatellites ...... 125
5 .2.5 Genotypir1g ...... I 26
5.2.6 Microsatellite Analysis ...... 129
5.3 Results ...... 130
5.3.1 Chthamalus antennatus ...... 130
5.3.2 Chantaesipho tasmanica ...... 131
5.4 Discussio11 ...... 150
X 5.5 Conclusion ...... l53
Chapter 6 Summation and Further Work...... 154
6.1 Summary of Experimental Chapters ...... 155
6.2 Future Research ...... 156
Bib liograp lty ...... 158
Appendices ...... 171
I. Solutions and Buffers ...... 172
2. Sequence Alignments ...... 173
2.1 Australian COl ...... 173
2.2 Australian 16S rRNA ...... 178
2.3 Global 16S rRNA ...... I 81
2.4 Elminius 16S rRNA ...... 187
2.5 Catomerus polymerus COl ...... 194
2.6 Catomerus polymerus Control Region ...... 20 l
2. 7 Chthanwlus antennatus 16S rRNA ...... 208
2. 8 Chthmnalus antennatus CO I...... 212
2.9 Chamaesipho tasmanica 16S rRNA ...... 222
2.10 Chamaesipho tastnanica COl...... 225
3. Microsatellite Data ...... 230
3.1 C. polymerus Microsatellite Genotype Data ...... 230
3.2 C. polymerus Hardy-Weinberg Equilibrimn ...... 238
xi 3.3 C. polymerus Migration Estimates ...... 240
3.4 C. tasmanica Microsatellite Genotype Data ...... 241
3.5 C. tasmanica Hardy-Weinberg Equilibrium ...... 245
4. Published Paper ...... 247
xii List of Figures
Figure 1.1 Extent of emergent land during the glacial periods ...... 11
Figure 2.1 Sample sites in New South Wales ...... 25
Figure 2.2 Sample sites in Victoria ...... 27
Figure 2.3 Sample sites in South Australia ...... 29
Figure 2.4 Sample sites in Tasmania ...... 31
Figure 3.1 Australian CO I phylogenetic tree ...... 49
Figure 3.2 Australian 16S rRNA phylogenetic tree ...... 51
Figure 3.3 Worldwide 16S rRNA phylogenetic tree ...... 54
Figure 3.4 Photos of Elminius ...... 57
Figure 3.5 16S rRNA phylogenetic tree for Elminius ...... 59
Figure 4.1 Marine biogeographical provinces ...... 73
Figure 4.2 Location of Bassi an Landbridge ...... 75
Figure 4.3 Collection localities of Catomerus polymerus ...... 78
Figure 4.4 Catomerus polymerus n1tDNA phylogenetic tree ...... 89
Figure 4.5 Spatial autocorrelation for I OOkm distance classes ...... 93
Figure 4.6 UPGMA disttmce phylogram and PCA plot ...... 95
l;igurc 4. 7 Geneflow estirnates ...... I 04
Figure 5. I Photos of Chthamalus antenna/us and Chamaesipho tasmanica ...... 118
Figure 5.2 Collection localities of samples ...... 122
Figure 5.3 CO 1 tree for Chthanzalus antenna/us ...... 133
Figure 5.4 16S rRNA tree for Chthamalus antenna/us ...... I 35
Figure 5.5 COl tree for Chamaesipho tasmanica ...... 138
Figure 5.6 16S rRNA tree for Chamaesipho tasmanica ...... 140
Figure 5.7 UPGMA distance phylogram and PCA plot...... 143
xiii List of Tables
Table 3.1 Collection locations for barnacles used in phylogenetic study ...... 42
Table 3.2 Collection locations for samples of Elminius ...... 44
Table 4.1 Microsatellite primer details ...... 85
Table 4.2 Range and average pairwise Fsr and Nm values ...... 97
Table 4.3 Analysis of molecular variance (AMOVA) ...... 99
Table 4.4 Population pairwise FsT values ...... 102
Table 5.1 Collection locations and numbers of samples ...... I 24
Table 5.2 Microsatcllites primer details fbr C. tasmanica ...... 128
Table 5.3 Range and average pairwise FsT and Nrn values ...... 145
Table 5.4 Analysis of molecular variance (AM OVA) for C. tasmanica ...... 147
Table 5.5 Population pairwise FsT values for C. tasmanica ...... 149
xiv Chapter 1
General Introduction
1 1.1 General Description
Barnacles (Crustacea: Cirripedia: Thoracica) were once viewed as the eggs of barnacle
geese (Moray, 1678). Later they were classified as molluscs (Linnaeus, 1758) before
finally being identified as crustaceans (Thompson, 1830). This confusion appears to
have arisen due to the drastic adaptations barnacles have that tnake them unique relative
to all other crustaceans. The most obvious difference in this common marine crustacean
is that they possess an irreversibly sessile adult form. Because of this, they do not
possess an exoskeleton like all other crustaceans, but rather are clad in a protective shell
comprised of mineralised shell plates. As the Cirripedia are maxillopodan crustaceans,
their organisation is based on six head segments, six thoracic segments, and five abdominal segments (Anderson, 1994).
There are two major morphological variants within the Cirripedia: the acorn or sessile barnacle (Order Sessilia) and the stalked or pedunculate barnacle (Order Pedunculata).
Focusing on the Sessilia, the most notable feature of the barnacle is its shell, which comprises four to eight prin1ary plates (Ncwn1an, 1987). This shell acts as the protective armour of the anitnal, preventing both predation and desiccation during low tide.
~ However, the feeding n1ethod of the barnacle is in contrast with its requiren1ent of protection, as cirripedes feed with their feet (cirri), and these must be extended fron1 within the shell in order to facilitate filter feeding. The animal has an opercular valve, con1prised of the scuta and terga, which is able to open during feeding, allowing the cirri to protrude slightly and unfurl as a cirral fan.
2 1.2 Reproduction
The majority of barnacle species are cross-fertilising hermaphrodites (Barnes, 1980) and
so each animal possesses both male and female reproductive organs in a system that is
uniform across pedunculate and sessile thoracicans. I-Iowever, their sessile nature is a
complicating factor, and so the reproductive system is enlarged relative to the ancestral
condition. The female gonads consist of a pair of sac-like ovaries from which extend
paired oviducts to the female openings near the base of the first pair of cirri, and are
capable of producing large numbers of eggs. The male organs consist of seminal
vesicles, testes, and a penis which exists as an outgrowth from the cirripede abdomen
(Anderson, 1994). Despite a preference for cross-fertilisation, incidences of self
fertilisation have also been reported in a number of species (Barnes and Crisp, 1956;
Landau, 1976). In the case of the latter study, both isolated and clustered individuals
were collected and examined for the presence of embryos. Barnacles were considered
isolated when they were 7cm (the maximum penis extension) fron1 their nearest
neighbour. The presence of embryos in isolated individuals is interpreted as being due
to self fertilisation.
In order for cross-fertilisation to occur, each animal n1ust act as a "functional male" or
"functional female" as copulation is not usually reciprocal (Barnes and Barnes, 1956).
Because of their sessile nature, mating n1ust be with a close-by neighbour, and to facilitate this, the barnacle features an extensible penis which can reach up to 10 ti1nes the length of the body of the animal, rnaking it the largest relative to body size of any animal. Once extended, the penis undergoes a very deliberate searching pattern; in
Semibalanus balanoides a search sequence is performed, with the penis first searching the area carinal (front) to the animal, followed by the rostral area (rear). Even the
3 presence of a functional female within this area does not modify the search behaviour.
That is, the male completes his searching pattern before returning to the female he has
previously located. However, if a female is not located, the penis is furled and
withdrawn. A receptive functional female is usually indicated by passivity, with the
partial opening of the opercular valves and reduced cirral activity, and remains open
when contacted by a penis (Foster and Nott, 1969).
Copulation in barnacles is also striking in that multiple matings occur; that is, an animal
behaving as the female is capable of accepting penes from several males
simultaneously, and will receive seminal f1uid from each (Barnes and Barnes, 1956;
Barnes et al., 1977). However, a functional female only behaves as such during
copulation. Furthermore, copulation is repeated a number of times, with each event
marked by the withdrawal, contraction and furling of the penis and resumption of cirral
beating by the male. On each subsequent mating, the search behaviour is not repeated,
and a total of six to eight mating events are usually undertaken, as noted in S. balanoides (Barnes et a!., 1977). Oviposition in the fen1ale usually occurs after the deposition of scn1inal fluid by the n1ale into the mantle cavity (Anderson, 1994). During subsequent tnatings, previously functional n1ales are able to act as functional females, and vice versa. In Tetraclita japonica, it was found that a change in sex could take place within several hours of acting as a female (Murata et al., 2001 ).
Following fertilisation and etnbryonic developtnent, juvenile barnacles undergo a nun1ber of larval stages before post-settlement metamorphosis into the sessile adult.
During larval development, the animals undergo a sequence of several naupliar stages, followed by a single cyprid stage (Anderson, 1994 ). There is little variation an1ong
4 species in terms of this pattern, and development is strictly constrained through six
naupliar stages (West and Costlow, 1988). As the nauplius proceeds through each of the
six stages, intervening moults are undertaken. Following the final nauplius stage, the
larvae undergo a single moult to the cyprid stage. The final stage of development is
settlement, which appears to be restricted to a specific environment (substrate)
recognised by the cyprid (Lewis, 1978), and therefore involves complex larval
behaviour. Most commonly this is thought to be affected by the presence of adults of the
same or closely related species (Crisp, 1974). During settlement, the cyprid comes into
contact with a solid substrate, and undergoes a process of attachment. Subsequently, the
animal undergoes a post-settlement moult which transforms the cyprid into a
pedunculate or sessile juvenile with the general layout of the adult it will become.
Subsequent growth and further n1oults allow for complete functional differentiation
(Anderson, 1994 ).
1.3 Taxonomy and Phylogenetics of the Cirripedia
Modern taxonon1y classes barnacles as belonging to the subclass Cirripedia (Phylum
Crustacea, Subphylum Maxillopoda). The superorder Thoracica are then divided into
the orders Sessilia (acorn) and Pedunculata (stalked) (Doyle et al., 1996). The Scssilia
con1prise the majority of species of southern Australia, and those exarnined belong to
the superfmnilies Balanoidea, Tetraclitoidea and Chthamaloidea. The Pedunculata
contains a number of superfan1ilies also, nan1ely the Scalpellomorpha, Lepadon1orpha,
Heteralepadon1orpha, and the lblotnorpha (Martin and Davis, 2001). However, species fron1 the pedunculae superfamilies are not usually located on rocky shores (Foster,
1987), and are therefore not examined in detail in this study. The families of the Sessilia that are of most interest in southern Australia are the Balanidae, Catophragmidae,
5 Chthamalidae and the Tetraclitidae. The allocation of each species to the appropriate
family is well established morphologically; however the generic and specific status of
some species is still under some debate and validity of these species divisions is
examined in this study.
Barnacles, being both unique and numerous members of the intertidal community, have
been studied by a number of prominent scientists. The most notable of these was
Charles Darwin, whose monographs (1851-1855) contain a large body of information
on the biology, palaeontology and systematics of barnacles. Despite the large body of
work on the cirripedes, there has been a distinct lack of phylogenetic information,
particularly for the Australian species.
The first study to apply phylogenetic approaches to the determination of
interrelationships between members of the cirripedia (Glenner et a!., 1995) was
undertaken purely on a range of 32 morphological characters from both fossils and
extant taxa (n=26). Two subsequent phylogenetic morphological studies were
undertaken, the first limited to 10 stalked barnacles and 17 morphological characters
(H0eg et a!., 1999) and the second to a wider range of both genera and larval features
(Newn1an and Ross, 2001). A more recent and comprehensive study (Perez-Losada et a!., 2004) used a con1bination of three nuclear genes, two tnitochondrial genes, 3 7 adult characters and 53 larval characters to explore thoracican evolutionary relationships.
This study had a nun1ber of findings. First, both molecular and Inorphological data placed the lblotnorpha as the base of the Thoracican tree, which agreed with previous molecular (I-Iarris et a!., 2000) and morphological (H0eg et a!., 1999) phylogenetic analyses. More significantly, this study was the first to provide well-supported
6 phylogenetic evidence for the monophyly of the Sessilia, which had been highly
debated for more than a century (Perez-Losada et al., 2004). Other findings of the study
relate to the evolution of barnacle characteristics such as filter-feeding, which evolved
in the cirri pede stem line, and biomineralisation of the exoskeleton, which potentially
evolved independently more than once. The use of phylogenetic and phylogeographic
analyses can also play a valuable role in other areas of research including biogeography,
which is discussed in further detail below.
1.4 Biogeography
The study of biogeography aims to establish why animals live where they do. More
precisely, biogeography studies the principles, processes and parameters which
influence the distribution of living organisms in both space and time (Ball, 1975).
Because the current distribution of extant taxa can be influenced by both conten1porary
and historical processes, the study of biogeography can attempt to reconstruct past
events based on present distributions (McDowall, 1978). The patterns of biogeography
can be divided into two n1ain fields: historical biogeography and ecological
biogeography (Wiley, 1981 ).
Historical biogeography is concerned with evolutionary processes over n1illions of years
(Crisci, 2001 ), and focuses heavily on the association between taxonomic groups and
historical biogeographic events (Crisci eta!., 2006). Studies of vicariance biogeography
suggest that disjunct distribution patterns can be attributed to the division of a species by disruptive geologic, climatic or geographic events (Rosen, 1978). However, disjunct biogeographic patterns n1ay also be attributed to dispersal, whereby taxa from a central origin disperse by c.hance and undergo natural selection, evolving into new species
7 (Morrone and Crisci, 1995). Phylogenetic biogeography is an extension of historical
biogeography, and was the first approach to consider a phylogenetic hypothesis to infer
the biogeographic history of a given group of organisms (Morrone and Crisci, 1995).
In contrast, ecological biogeography seeks causal explanations of the distributional
patterns of organisms in short temporal and small spatial scales (Myers and Giller,
1988). In other words, ecological biogeography is more concerned with physical causes
operating currently, as opposed to historical causes that have ceased to operate. Also in
contrast with historical biogeography, ecological biogeography is based on functional
groups of species and environmental constraints rather than taxonomic groups and
historical events (Crisci, 2001 ).
Marine biogeography examines a different range of environmental influences compared
with those of terrestrial biogeography. However, as with terrestrial biogeography, both
historical and contemporary processes must be taken into account (Dawson, 2001 ). In
southern Australia, historical patterns are often interpreted in terms of allopatric
divergences associated with the clin1atic history of the late Pliocene and Pleistocene
(Dartnall, 1974; Knox, 1980; Hutchins, 1987; Burridge, 2000a). In particular, the glacial cycles that marked this period were responsible for dramatic changes in sea levels (up to
II 0 n1 below current sea level), and cooling of ocean te1nperaturcs (Wells and Okada,
1996). The rnost notable feature of glacial n1axin1a in southern Australia was the
Bassian landbridge, whereby reduced sea levels exposed the land between Victoria and
Tasrnania and closed ofT Bass Strait (Figure 1.1 ). During the height of glaciation, the landbridge featured a large depression in the centre which was connected to the southern ocean via a low, broad valley. During the subsequent interglacial period, the
8 ocean entered the depression from the west, with the eastern land connection being
broken several thousand years later (Lam beck and Chappell, 2001 ).
On the other hand, contemporary marine biogeographic influences can include major
ocean current systems, latitudinal temperature gradients, and geographic breaks
whereby large sandy regions devoid of shallow rocky reefs or regions of open-water
may interrupt an otherwise continuous marine distribution, depending on specific
species requirements. In southern Australia, the dominant ocean currents are the
Leeuwin, Zeehan, and East Australian Currents. The Leeuwin current is a warm, low
salinity ocean current which flows southward along the Western Australian coast, then turns east along the South Australian coast (Ridgway and Condie, 2004 ). In the region of the Great Australian Bight, the Leeuwin current is replaced by the Great Australian
Bight Current (Rochford, 1986), then the weaker Zeehan Current which runs as far east as the west coast of Tasmania (Baines et a!., 1983). However, the Great Australian
Bight Current is usually referred to as part of the Leeuwin current. There is also some debate as to whether the Zeehan Current is a continuation of the Leeuwin Current or a separate current (Ridgway and Condie, 2004). Regardless, this current is relatively warm, and spreads beyond the southern tip of Tasmania before reaching the southern portion of the cast coast of Tasn1ania (Cresswell, 2000; Bruce et al., 2001 ). The East
Australian current (EAC) flows southwards along the east coast of Australia, and generates ocean
9 Figure 1.1. Map of the south-east corner of Australia, showing the approximate extent of emergent land during the last glacial period. The present day coastline of Australia is shaded grey, while the historical coastline is shown in black. Figure adapted from Burridge et al. (2004).
10 11 eddies, most of which rotate anti-clockwise. The EAC reaches its peak in summer,
reaching furthest south, while it is at its weakest in winter (Til burg et al., 200 I). The
direction and timing of these currents is important as it is likely that they are responsible
for the movement of barnacle larvae between populations.
Marine phylogeographic breaks are also major influences of the biogeography of marine
species. In particular, Ninety Mile Beach in eastern Victoria, and the Coorong in South
Australia are extensive sandy regions devoid of shallow rocky reef habitat. Because of
the size of these regions, species with shorter planktonic larval phases may find that
these regions act as contemporary barriers to dispersal. Alternatively, small patches of
suitable habitat within these regions may facilitate stepping-stone dispersal across the region (Hidas et al., 2007), which is supported by data that show that poor-dispersing species successfully cross barriers such as Ninety Mile Beach (Wares et al., 2001).
Other regions which may cause divisions are those with very high or very low wave irnpact compared with the tolerance level of the species; that is, each species may have a preference for a certain level of wave impact, and n1ay not survive in regions of differing wave intensity. One such example is Catomerus polymerus which is found only on exposed shores with pounding surf.
Lastly, temperature gradients, whereby ten1peratures decrease with decreasing latitude, arc also suggested to play a role in the establishn1ent and maintenance of biogeographic patterns (Bennett and Pope, 1953; O'Hara and Poore, 2000). The effect of these environn1ental factors on barnacles is discussed in Chapter 4.
12 . 1.5 Markers for Use Ill Phylogenetic and
Biogeographic Studies
There are numerous genetic markers available for studying the phylogenetics and
biogeography of a species. The most widely used is variation in the mitochondrial DNA
(mtDNA) sequence (Hurst and Jiggins, 2005). mtDNA has many advantages and is
therefore commonly used in many population, biogeographic and phylogenetic studies.
However, this marker is not without its limitations. It generally reflects only the female
history of a species (Zhang and Hewitt, 2003) and it has also been argued that the
evolution of mtDNA is non-neutral frequently enough to question its utility as a marker
for genomic history (Ballard and Whitlock, 2004). Additionally, the presence of
mitochondrial pseudogenes in the nuclear genomes of many species can affect the
results of population studies (Zhang and Hewitt, I 996).
In order to overcome some of the limitations of mtDNA sequence data, n1any studies
usc n1icrosatellite n1arkers which are currently the most revealing DNA n1arker
available for studying population genetic structure (Zhang and Hewitt, 2003). These
n1arkers have n1any benefits, including the ability to detect population structure, test
parentage and relatedness, and assess genetic diversity.
Both n1tDNA sequence data and microsatellite n1arkers were en1ployed in this study in order to investigate phylogenetic relationships, phylogeography, and population genetic structure of the southern Australian intertidal fauna. Both these markers are discussed below in further detail.
13 1.5.1 Mitochondrial DNA (mtDNA) Structure
The mitochondrial genome is a covalently closed circular molecule of DNA located in
the mitochondria of animal cells. The molecule is double-stranded, and approximately
16.5kb in length (Griffiths and Tavare, 1994), with the size being relatively uniform
across vertebrate and invertebrate animals (Brown et al., 1979). Gene content is also
conserved, and the molecule encodes 2 ribosomal RNA (rRNA) genes, 22 transfer RNA
(tRNA) genes, and 13 messenger RNA (mRNA) genes. The mitochondrial genomes of
animals also show no interruptions within transcribed genes, no introns between genes,
and, n1ost often, no classes of repetitive DNA (Avise, 1986). Gene content and
arrangement are also well conserved (Brown et al., 1979).
MtDNA undergoes a very rapid rate of substitution, with a rate of evolution 5-l 0 times
higher than that of typical single copy nuclear DNA (Brown et al., 1979). Possible
explanations for this high rate of evolution are a high rate of n1utation, a high rate of
fixation, or a combination of both (Brown et a!., 1979). The mitochondrial genon1e is
widely known to lack recombination, and as such the molecule acts as a single linkage
group. A nun1ber of papers claim to have found evidence for mitochondrial
recombination (Awadalla et al., 1999; Eyre-Walker et al., 1999; Hagel berg et al., 1999),
however this has been highly disputed in a subsequent paper (MeV can, 2001 ). The n1olccule is also uniparentally inherited, thereby reducing the effective population size of mitochondrial genes (Curole and Kocher, 1999), which results in data that is (more) indicative of genetic drift or bottlenecks. (Birky Jr. et al., 1983).
14 1.5.2 Use of mtDNA in Phylogenetics
MtDNA sequence data are commonly used in phylogenetics and population genetics in
order to study the history of species. In particular, the comparison of homologous
regions of DNA between species enables us to infer the ancestral relationships of
species particularly if these species have diverged rather recently (e.g. 5-l 0 my a)
(Brown et al., 1979). On the other hand, the comparison of the same sequence
information within species enables us to infer aspects of the evolutionary history of the
species of interest (Griffiths and Tavare, 1994). Because of these features, mtDNA is
widely used in phylogenetic studies ( eg Astrin et al., 2006; Baldwin et al., 1998; Harris
ct al., 2000), particularly amongst closely related taxa. Analysis of sequence data is a
common form of phylogenetic analysis, primarily due to the ease of use and the cost
effectiveness of the technique. The method is also advantageous as PCR (Polymerase
Chain Reaction) is highly sensitive, requiring only small mnounts of tissue for
amplification. As such, DNA can be obtained from partial samples such as blood, fur or
feathers, negating the need for whole-animal sacrifice in most cases. Because 1ntDNA
has a maternal inheritance pattern and relatively rapid evolution, it is widely used as a
n1arkcr for studies of female-mediated gene flow, the history of species, and the
dynan1ics of hybrid zones (Moritz et al., 1987). It is also useful for dating historical
events in a species, such as allopatric divergence (eg Roberts, 2006).
Both Cytochron1e Oxidase I and 16s rRNA are frequently used in phylogenetic studies
of both marine and terrestrial organisms, and in particular of marine invertebrates, and are currently the most widely applied mitochondrial markers in n1olecular taxonon1y
(Astrin et a!., 2006). Both n1arkers have distinct advantages and disadvantages, and in particular, both genes contain a large number of infonnative sites which are useful for
15 inferring phylogenetic relationships. While many studies have used COl as a single
genetic marker for molecular taxonomic studies (eg Saunders, 2005; Ward et al., 2005;
Smith et al., 2006)), a number of studies have suggested that 16S is in fact superior over
CO I in this context, including in crustaceans (in Astrin et al., 2006). In certain taxa 168
has been shown to achieve better taxon separation (e.g. pholcid spiders, (Astrin et al.,
2006)). 16S has also widely been used on barnacle taxa for the purpose of phylogenetic
studies (Perez-Losada et al., 2004; Fisher et al., 2004; Perez-Losada et al., 2008), and is
therefore comparative with this study.
The control region, or displacement loop (D-loop), is a region of approximately 1100
base pairs and contains promoters for transcription and the origin of replication for one
of the strands of the. mitochondrial genon1e (Griffiths and Tavare, 1994). However, the
region lacks structural genes, and is the most rapidly evolving region of the n1itochondrial genome (Moritz et a/., 1987). In invertebrates, the region is often called the "A + T rich region" due to high levels of adenine and thymine nucleotides. In all vertebrates except avians, the control region is located between the tRNApro and tRNAphc genes, but in invertebrates its location appears to show great diversity (Zhang and Hewitt, 1997). Sequencing of the Initochondrial genon1e in Tetraclita japonica
1 shows that it is positioned between tRNA cu and tRNA vni (Accession no. AB 126701 ).
However, in this study (Chapter 4) the control region is found to be between 12S rRNA and tRNA0111 in Catomerus polymerus. The control region is valued as a n1arker in phylogenetic studies due to its non-coding nature which results in relatively high substitution rates and levels of variability, and is therefore useful for providing fine scale resolution both among closely related species and within species (Firestone,
2000).
16 1.5.3 Microsatellite Evolution
Microsatellites, or Simple Sequence Repeats (SSRs), are highly polymorphic molecular
markers and are widely used for the study of spatial and temporal population structure.
One of the fastest evolving molecular markers, rnicrosatellites are nuclear DNA markers
which are widely distributed throughout the genome (Zhu et a!., 2000), and are
dispersed loci comprising regions of repetitive DNA. Microsatellites are usually tandem
repeats of one to six nucleotides, typically neutral, co-dominant, are inherited
biparentally and are easily scored (Bruford and Wayne, 1993; Jarne and Lagoda, 1996).
The three types of microsatellite are the perfect (uninterrupted), imperfect (interrupted),
and compound repeat sequences (Reece et al., 2004 ). Compound microsatellites occur
when several repeat types are separated by up to three base pairs (Weber, 1990).
Microsatellites demonstrate a relatively high n1utation rate compared with other
molecular markers, and while the exact cause of these mutations is not yet known, there arc a nurnber of n1odels available to explain the generation of microsatellitc mutations.
However, changes in repeat number are likely to occur as a result of replication slippage, also referred to as slip-strand mis-pairing (SSM) or polymerase slippage.
During replication of the DNA, a transient dissociation of the two DNA strands occurs due to an error caused by the DNA polyn1erase (Canceill et a!., 1999), followed by a misaligned reassociation which results in the looping out of one of the strands. When the DNA strands rctnain out of alignment, renewed replication results in either an expansion or contraction of the repeat sequence (Zhu et al., 2000), depending on which strand has forn1ed the loop (Bennett, 2000). These errors are usually repaired by the mismatch repair systetn; however, the few that are not repaired become m.icrosatellite
17 mutation events (Ellegren, 2004). While the formation of a microsatellite is a rare event,
they evolve quickly once formed due to slippage during replication.
There are five primary models that have been proposed to explain the generation of
microsatellite mutations. However, the two most extreme models are most often
associated with microsatellites in the literature: the step-wise mutation model (SMM)
and the infinite alleles model (IAM) (Estoup et al., 2002). Under the SMM, there is the
loss or gain of a single tande1n repeat, with an equal probability of mutating in either direction. Therefore, alleles of different sizes are 1nore distantly related than alleles of a similar size (Balloux and Lugon-Moulin, 2002). As such, this model allows for size homoplasy, whereby alleles may 1nutate to a state already present in the population, resulting in alleles that may be identical by state, but not identical-by-descent (IBD)
(Estoup et al., 2002). However, n1icrosatellites tend to show an upper size limit (Jarne and Lagoda, 1996), a feature incompatible with the SMM (Ellegren, 2004 ), which was first used to describe the frequencies of alleles as distinguished by protein electrophoresis (Valdes et al., 1993 ). Extensions of the SMM now exist which allow for an upper size li1nit, as there is general agreement over the existence of allele size constraints (Pollock et al., 1998). On the other hand, the lAM states that novel alleles arc created at a given rate (~), and that these n1utations may involve any nun1ber of tandctn repeats (Estoup et a/., 2002). As a result, this model does not allow for homoplasy, and identical alleles are assun1ed to be identical-by-descent (Balloux and
Lugon-Moulin, 2002).
18 1.5.4 Use of Microsatellites in Studies of Population Genetic Structure
Microsatellites are widely used to investigate the population structure of a broad range
of organisms, and are particularly useful for estimating genetic differentiation and
migration rates (Slatkin, 1995). This is particularly true for geographically isolated species, or closely related subpopulations of a single species. Once characterised, microsatellites are relatively cheap and easy to score, with large amounts of data accumulated in a short period of time. Labelling primers with different coloured fluorphores and multiplexing loci can further reduce the cost. The advantages of microsatellites extend beyond time and cost; the results obtained from nuclear DNA such as microsatellite markers can reveal different aspects of population structure compared with mitochondrial DNA. In particular, the rapid rate of evolution of microsatellites allows the examination of the conten1porary population structure of a species (Andersen et a!., 1998), whereas mtDNA is used to detect historical population structure.
Prior to this study, microsatellites have been used to examine only two other species of barnacle, Sernibalanus balanoides (Dufresne et a!., 2002) and Chthamalus montagui
(Pannacciulli et a!., 2005). However, their use in the study of other marine invertebrate systerns, such as sponges (Duran et a!., 2004 ), prawns (Brooker et a!., 2000) and abalone (Huang et a!., 2000), has been steadily increasing. Most frequently, these markers are used to infer population structure of the species of interest. This has been crucial in den1onstrating that n1arine species, while lacking obvious barriers to gene flow, often show high levels of population differentiation despite their apparent potential for long distance dispersal (Duran et a!., 2004 ). In such species, mitochondrial data often lacks resolution at the intraspecific level, whereas n1icrosatellites are found to
19 be highly informative, particularly in detecting reduced gene flow and subtle population
structure.
To date, there has been little use of microsatellite markers to examine the population
structure of southern Australian marine invertebrate systems. A majority of studies have
been undertaken using only mtDNA sequence data (Waters and Roy, 2003; Waters et
al., 2004; Dawson, 2005), the exception being a single study on cuttlefish (Kassahn et
a!., 2003) While these studies have been instrumental in examining the historical
processes responsible for the distributions of these organisms, they fail to examine any
contemporary ecological processes which may be responsible. These contemporary
conditions are more easily detected using microsatellite markers, as demonstrated in this
thesis.
Microsatellite markers have also been used to study kin aggregation in the barnacle
L)'emibalanus balanoides (Veliz eta/., 2006). In this study, microsatellite genotype data
was used to investigate any connection between relatedness and settlement of
S balanoides, and to test whether patches of highly related individuals catne fron1 a
common parental site. Studies of this nature detnonstrate the application of
n1icrosatcllites rnarkers to a variety of research questions.
1.6 Overall Aims
This study had two tnajor ain1s. The first was to confirm the taxonoxnic status of the barnacle taxa of southern Australia. By con1bining the newly created data with data available on public databases (Genbank) for other species found outside of Australia, it was expected that any potential cryptic speciation would be detected. The second major
20 aim was to investigate the phylogeography and population genetic structure of a number of species, with particular focus on Catomerus polymerus. An attempt was also made to elucidate the ecological factors responsible for the biogeographical patterns observed.
21 Chapter 2 General Materials and Methods
22 The solutions and buffers used in this study are referred to in abbreviated form
throughout the text (e.g. TB, TAE etc). The components of all solutions and buffers
referred to throughout the thesis can be found in Appendix I.
2.1 Sample Collection
2.1.1 Whole individuals
Samples were collected in two different manners. Due to the structure of a barnacle,
whereby the soft interior is enclosed in a hard calcareous shell, removal of whole
individuals from the shore was required. This was done using a paint scraper or scalpel
blade, which was gently pushed under the edge of the individual, and wriggled gently in
order to prise the barnacle from the substrate. These whole individuals were then
transferred to vials of 70% ethanol.
2.1.2 Partial samples of Catomerus polynterus
In the case of Catomerus polymerus, the presence of a layer of small plates outside the
eight principle plates allowed a portion of the individual to be sampled. This was done
using a scalpel, whose blade was gently pushed down between the layers of plates,
allowing a small section to fall away. These pieces were collected with tweezers, and
transferred to small vials containing 70o/o ethanol.
2.1.3 Sampling Criteria
Samples were collected fron1 nutnerous shores across the tetnperate region of Australia, encompassing South Australia, Victoria, New South Wales, and Tasmania. See Figures
2.1-2.4 for sampling locations.
23 Figure 2.1 Sampling locations for New South Wales. SH Scotts Head, CH Charlottes Head, HP Hermit Point, CB Cape Banks, TH Tura Head.
24 25 Figure 2.2 Sampling locations for Victoria. BP Bastion Point, CC Cape Conran, MJ Marlo, GP Griffith Point, SR San Remo, PI Phillip Island, BB Berrys Beach, SB Sorrento, LB Portsea, BR Black Rock, AI Aireys Inlet, SBP Portland.
26 27 Figure 2.3 Sampling locations in South Australia. Gl Glenelg, PB Pennington Bay, PJ Penneshaw, Cl Cowell, CpC Cape Carnot, PS Point Sinclair.
28 d \ PB
29 Figure 2.4 Sampling locations in Tasmania. WH West Head, WP Waterhouse point, StH St Helens, Fm Falmouth, Bi Bicheno, CIB Coles Bay, PrB Pirates Bay, Bby Blackmans Bay.
30 31 Sampling was generally undertaken only during a low tide of 0.2m or less, which
enabled access to the surf-loving barnacles such as Catomerus polymerus, Tesseropora rosea and Austromegabalanus nigrescens. Sampling for most species was fairly random, with up to 10 individuals of each species collected from numerous positions across each shore. At some locations C. polymerus was collected in a transect along the shore, approximately evenly spaced, while at other sites several individuals were collected from each of a number of positions across the shore. This was done in order to minimise the number of related individuals collected due to the potential for clmnping of related individuals, which has been shown to occur in Semi balanus balanoides (Veliz et al., 2006). Tidal conditions including wave impact also determined if non-destructive samples were taken, and how many they comprised of the total collected. If swell was high, it was not considered safe to spend time carefully removing plates from individual barnacles. Sampling generally aimed to collect 30 C. polymerus, however at some shores there were less than this present.
2.2 DNA Extraction
Genomic DNA was extracted from cirral tissue, or in the case of C. polymerus, from a number of small surrounding plates lined with basal membrane, using a protocol tnodified frorn the lithiun1 chloride protocol described by Gemmel and Akiyan1a (1996).
Cirral tissue was added to 300~tL of extraction buffer with 20~L 0.01 mg/n1L Proteinase
K and incubated at 50°C for two hours, then at 3 7°C oven1ight. Protein was removed with the addition of 1OO~L 1OM LiCI and 440~L 24:1 chlorofonn: isomnyl alcohol and
1nixed at roon1 temperature for 3 0-60 minutes. The solution was centrifuged at 13,200 rpm for 15 minutes. The upper aqueous phase was transferred to a clean tube, and
1OOO~L ice cold 100% ethanol added. This was mixed by inversion and cooled to -70°C
32 for 10 minutes. The precipitated DNA was centrifuged again for 15 minutes at 13,200
rpm, the ethanol removed, and the pellet air-dried. The DNA was then resuspended in
1OOJ.tL TE and left resuspend at 4°C overnight.
2.3 Polymerase Chain Reaction (PCR)
2.3.1 Primer Sequences A 658bp region of the mitochondrial Cytochrome Oxidase I (COl) gene was initially
amplified and sequenced using universal primer sequences HCOI2198 and LCOI1490
(Folmer et al., 1994) For san1ples that could not be amplified, LCOI1490 was used in
conjunction with COIN-R (Schram and H0eg, 1995). An annealing temperature of 44°C
was used for all CO I primers.
A region of the 16S rRNA gene was amplified using primers 16SAR and 16SBR
(Palumbi, 1996a), resulting in a product of approximately 600bp. Sequencing of the
product was difficult, in particular with the reverse primer, with the resulting sequence approximately 330bp in length, depending on the species.
Lastly, a portion of the mitochondrial control region was amplified using novel primers
(Barnacle 12S-F: 5' -CTGGCACGCCATTWTCCAC-3' and Barnacle Ilc-R: - -
5'-CTGGCCTTACATGATTTACTCTATC-3') designed from Initochondrial sequences available on GenBank (Megabalanus volcano, Pollicipes polymerus and Tetraclita japonica,· Ace. # NC_006293, NC_005936, NC_008974). A number of individuals were sequenced, and more specific pnmers were designed (CR-F: 5'-
TTTCYAAWATTTTCTACTGAG-3' and CR-R:
33 5'-CAAAGTAAYCCTTTTWTCAGGC-3'). The annealing temperature used for these primers
was 47°C. These primers were used to amplify approximately 590bp in most species for
use in population structure analysis.
2.3.2 PCR Protocol
Template DNA was amplified by PCR in 12.5~L reaction volume containing the
following: 5X PCR buffer, 0.2mM each dNTP, 2.5mM MgCh, 0.3pmol each of each primer, 0.5U GoTaq Flexi Taq DNA polymerase (Promega) and 6.25~L template DNA
(approximately 50-1 OOng). The PCR cycles were as follows, with annealing temperatures changing according to the primer set used:
Initial denaturation 96°C
Denaturation 96°C
Annealing 44°C 30 cycles
Extension 72°C
Final extension 72°C
A negative control was included in each PCR to identify any contamination. All initial
12.5 ~L PCRs were run on 1.4% agarose gel to check for amplification of the expected product. DNA grade agarose was dissolved in lX TAE buffer. PCR products were mixed with 2!J.L of blue/orange loading dye (6X, Pron1ega). The gels were covered with
1X T AE buffer, the san1ples loaded and then electrophoresed at 280V for 15-20 minutes. The gel was stained with ethidiutn br01nide (1 Omg/ml) and visualised using a
UV transilluminator. Once optimised, the PCR was repeated in a larger volume (50J..LL) and 2-SJ..LL was used to test that the product was again obtained. The remaining 45-48~L was then purified prior to sequencing using the QIAGEN PCR Purification kit
34 according to the manufacturer's instructions. The last step was altered, so that the DNA
was eluted from the column using 30~1 of di-hO.
2.4 Sequencing
2.4.1 Sequencing Protocol
PCR sequencing reactions (total20J-Ll containing 2)..ll Big Dye v3.1, 3~1 of the associated
buffer, I J.Ll of primer, and I4J-Ll combined purified DNA and dH20) were carried out.
The sequencing protocol consisted of an initial denaturing step at 96°C for 3min,
followed by 30 cycles of I Os at 96°C, 5s at 50°C, and 4min at 60°C. The resulting
product was combined with 6J.!l dH20, 4J.Ll 2.4M Sodiun1 Acetate (pH 5.2) and 60)..ll
I 00% ethanol, and allowed to cool on ice for I Omin. The product was centrifuged for
20-30min, after which the liquid was removed and a further 60~1 of 70% ethanol added.
The product was centrifuged for I Omin, the ethanol removed, and the DNA pellet
allowed to air dry. Capillary separation was carried out at the Australian Genome
Research Facility (AGRF). Alternatively, PCR products were purified as above, and
sent to Macrogen Inc (Korea) for sequencing and capillary separation.
2.5 Analysis of Sequence Data
2.5.1 Sequence Analysis Once sequenced by AGRF or Macrogen, the files were downloaded and imported into
Sequencher 4. 7. Each sequence was checked n1anually to ensure all bases were read
correctly. This was done by aligning forward and reverse sequences to cross-check the base calls.
35 2.5.2 Phylogenetic Analysis
Genetic distances were calculated using Kimura's (1980) two-parameter method in
Phylip (Felsenstein, 1996). Neighbour-joining trees were constructed in Mega 3.1
(Kumar et al., 2004). Maximum likelihood and maximum-parsimony analyses were
also conducted using the heuristic search option in PAUP* (Swofford, 2001 ). Model test
V3. 7 (Posada and Crandall, 1998) was used to select the most appropriate model of
molecular evolution used for the ML analyses. The robustness of the branching patterns
was assessed using bootstrapping (Felsenstein, 1985), with 1000 replicates for neighbour-joining and MP, and 100 replicates for ML analyses. Bayesian analysis was conducted using the program MrBayes version 3.1.2 (Ronquist and Huelsenbeck, 2003).
The appropriate model previously indicated by Modeltest was specified, and starting trees were randon1. The analysis was run with 4 chains (3 hot, 1 cold) for 1,000,000 generations sampling every 100 generations. It was ensured that the Bayesian runs achieved sufficient convergence by ascertaining that the average standard deviation of split frequencies between chains had reached below 0.01 at the end of the run, and that the potential scale reduction factor (PSRF) of each parameter remained at 1.000. The first 25,000 generations were excluded from the calculation of posterior probabilities.
36 Chapter 3
Phylogeny of southern Australian intertidal barnacle fauna
37 3.1 Introduction
The taxonomy of southern Australian barnacle species is under constant revision, but
until now that work has been carried out using mostly morphological data (Glenner et
al., 1995, H0eg et al., 1999, Newman and Ross, 2001). Molecular taxonomic studies
have primarily been undertaken only on species found outside Australia (Spears et al.,
1994; Harris et al., 2000; Fisher et al., 2004; Perez-Losada et al., 2004; Perez-Losada et
al., 2008). While these studies have increased our understanding of the relationships
within the Thoracica, very few of these studies have included Australian species, many
of which are endemic to the continent. Those that have included Australian species have
included only one or two species. As a result, the status of many Australian species have
not been confirmed genetically, nor has there been any study of potential cryptic
speciation in Australia.
Of particular interest is the specific status of Elminius modestu.s in South Australia. E.
modestus is a small barnacle, usually 5-1 On1n1 in dia1neter, and is commonly located on
piers, wharves and jetties in estuarine conditions. It was originally classed as an
Australian and New Zealand species, which was spread to the United Kingdo1n (Crisp,
1958) from either or both of the two countries. However, a subsequent study suggested
that E. modestus was a New Zealand species which was introduced to Australia by
shipping in the nineteenth century (Foster, 1982). The morphology of this species was
exa1nined in detail in South Australia by Bayliss (Bayliss, 1988; Bayliss, 1994). He first
separated out speciinens from the Adelaide region as Elminius adelaidae (Bayliss,
1988) based on slight morphological differences, in particular a n1ild colouration
difference of the external shell plates and variation in the shape of the opercular plates.
• This species is suggested to be located in the high intertidal zone, rather than the mean
38 tide level preferred by E. modestus, and uses a variety of substrates including rocks,
artificial structures, and various parts of Avicennia marina. Later work split the
remainder of his specimens into a further three species: Elminius jlindersi, Elminius
erubescens and Elminius placidus (Bayliss, 1994). Again, this separation was based on
differences in colouration of the external shell and the internal body, as well as more
complex characteristics such as size and number of cirri and the morphology of other
internal body parts. E. jlindersi is proposed to be the largest member of the genus in
Australia, but cannot be differentiated from E. modestus based on external shell
appearance. The species is suggested to settle on a wide variety of substrates, but avoids
the mangroves where water flow is gentle. E. erubescens is natned in reference to the
redness of the external shell which makes it easy to distinguish from the other species of the genus. It is suggested that this species is found only in the Adelaide region, and is the highest barnacle in the intertidal zone. Lastly, E. placidus is described as having a thin, translucent shell with narrow dark bands, preferring sheltered habitats such as the n1angroves in the Spencer Gulf in South Australia. However, environn1ental factors such as substrate and salinity arc known to cause morphological variation in a species, and so the status of the genus Elminius required further investigation.
The aim was to exan1ine a nun1bcr of southern Australian intertidal barnacle species in an effort to see if there were monophyletic assemblages associated with each specific name. Previously published sequences available on GcnBank were also included to check that each Australian species associates with the rest of its genus. In doing so, it was expected that any potential cryptic speciation of Australian species might be identified, as this had so far been unexamined. This is accomplished using two regions ofthe mitochondrial genome, Cytochrome Oxidase I (COl) and 16S rRNA.
39 3.2 Materials and Methods
3.2.1 Sample Collection
Thoracican species were collected from rocky intertidal zones at a number of sites in
southern Australia. Up to I 0 individuals of each species were collected, and collections
were made from March 2005 to December 2006. Samples were preserved in 70%
ethanol. Samples from New Zealand were provided by a colleague (Andrew Hosie,
National Institute of Water and Atmospheric Research). In combination with these
samples, 22 thoracican 16S rRNA sequences from GenBank were included in the
analyses (Table 3.1 ). lbla quadrivalvis was used as the outgroup taxon as the
Iblomorpha are known to be at the base of the thoracican tree (Perez-Losada et a!.,
2004).
Specimens of Elminius spp. were identified ustng the key established by Bayliss
(Bayliss, 1988; Bayliss, 1994). In many cases specimens demonstrated characteristics
that were particular to more than one of the species listed, con1plicating diagnosis.
Details of specimens used are listed in Table 3.2.
3.2.2 DNA Extraction and Sequencing
Genomic DNA extractions were conducted as described in Chapter 2. Extraction and
an1plification were carried out on I 0 species; Catomerus polymerus, Chthamalus
antennatus, Chamaesipho tasmanica, C. brunnea, C. columna, Tesseropora rosea,
Austromegabalanus nigrescens, Austrobalanus imperator, Lepas anatifera and Ebninius
spp.
40 Table 3.1 Collection locations and ID codes for the Thoracica cirripedes included in this study. GenBank accession numbers are given for samples from the literature.
41 Taxon Location ID Code or GenBank Accession No.
Balanomorpha Balanoidea Austromegabalanus nigrescens Lamarck Scotts Head, NSW, SH8 Australia A. psittacus Molina New Zealand Balanus glandula Darwin Monterey Bay, CA, EF545111 USA B. crenatus Bruguicre Menai Straits, Wales, AY520726 UK B. perforatus Bruguicre Vigo Bay, Galicia, AY520731 Spain Megabalanus tintinnabulum (Linnaeus) Monterey Bay, CA, AY520733 USA M. californicus (Pilshry) Montcn:y Bay, CA, AY520734 USA M Jpinosus (Gmclin) Annob6n, Equatorial AY520735 Guinea Menesiniella aquila (Pilsbry) Monterey Bay, CA, AY520732 USA Semibalanus balanoides (Linnaeus) Iscijord, Derunark AM497883 S. cariosus (Pallas) Monterey Bay, CA, AY520729 USA Elminius kingii Gray Molinos Beach, AY520738 Valdivia, Chile E. modestus Datwin Victoria, Australia MJI, MJ2, HP9, SRI E. modestus Darwin New Zealand NZ4 E. modestus Darwin Menai Straits, Wales, AY520737 UK Chthamaloidea Catomerus polymerus (Darwin) Australia SBP3 (EU423216), GPI 0 (EU423218), SB5 (EU423226), Al2 (EU423214), BR2 (EU423216) AY428045 Chamaesipho tasmanica Foster and Anderson Australia BR3, SBP2, CC3, SB3, BBII C. brunnea Evans Bay, NZ6 Wellington, New Zealand "C. brunnea" Auckland, New AY428046 Zealand C. columna Evans Bay, NZl, NZ2 Wellington, New Zealand Chthama/us antenna/us Australia AI6, SB2, SBP I, GP2, CC8 C. stellatus (Poli) Vigo Bay, Galicia, Ll.Y_428039 Spain C. bisinuatus Pilsbry Tramandai Beach, AY520745 RGS, Brazil C. chal/engeri lloek Japan A-~_20744 Telraclitodca Tetraclitel!a purpurascens (Wood) Eaglchawk Neck, AY520739 T AS, Australia Tesseropera rosea Krauss New South Wales HP5, HP6 (EU423233), CHN5 Tetraclita japonica Pilsbry Japan AY52073~ T squamosa (Bruguicre) Cooktown, Australia AY520740 A ustrobalanus imperator Darwin llermit Point, NSW, HP7 (EU423232), HP8 Australia Lcpadomorpha Lepas anatifera Linnaeus Sorrento, VIC, LB9, LBIO Australia Pedunculata Scalpellomorpha Pollicipes polymerus Sowerby Monterey Bay, CA, AY520751 USA Iblomorpha lbla quadrivalvis Cuvier Kirigston Beach, AY520755 TAS, Australia
42 Table 3.2 Collection locality and putative species identification of samples of the Elminius genus. The substrate from which the sample was collected, and its field collection identification is also given.
43 r'ollection I .ali tude!I ,ongitude ,\'uhstrate Presumed ,\'ample II) Locality ,)'pecies New ~outh I Icrmit Point -.11.R571151.26R Hock F. modestus I IP
44 Partial sequence of the mitochondrial COl gene was obtained using universal pritners
LCOI1490 and HCOI2198 (Folmer eta!., 1994) or LCOI1490 and COI-N R (Schram
and I-I0eg, 1995). Partial sequence for 168 rRNA was obtained using primers 16SAR
and 16SBR (Palumbi, 1996a). Sequencing was undertaken as described in Chapter 2.
3.2.3 Phylogenetic Analysis
Sequences were aligned with the previously published sequences using the Clustal W algorithtn (Thompson et a!., 1994) in MEGA 3.1 (Kumar et a!., 2004) using default settings. They were then imported into PAUP"' 4.0 (Swofford, 2001) for phylogenetic analyses.
The newly produced COl and 168 sequences were analysed separately. Analysis was also undertaken on a larger 16S data set, incorporating global sequences downloaded from GenBank.
For each data set, maxirnum parsirnony (MP) and maximum likelihood (ML) trees were generated using the heuristic search option in PAUP*. Model test V3.7 (Posada and
Crandall, 1998) was used to select the tnost appropriate model of n1olecular evolution.
The ML analyses were itnplen1entcd using heuristic searches in PAUP*. Confidence in resulting nodes for all trees was assessed using bootstrapping (I 000 replicates for MP;
100 replicates for ML). Bayesian analysis was conducted using the progratn MrBayes version 3.1.2 CRonquist and I-Iuelsenbeck, 2003). The appropriate model previously indicated by Modeltest was specified, and starting trees were random. The analysis was run with 4 chains (3 hot, 1 cold) for 1,000,000 generations sampling every 100 generations. It was ensured that the Bayesian runs achieved sufficient convergence by
45 ascertaining that the average standard deviation of split frequencies between chains had
reached below 0.01 at the end of the run, and that the potential scale reduction factor
(PSRF) of each parameter remained at 1.000. The first 25,000 generations were
excluded from the calculation of posterior probabilities. Global 16S data was analysed
in the same manner.
16S sequence data for E. modestus, including samples from South Australia, were also
aligned and analysed separately. As for the previous analyses, the data was subjected to
MP, ML and Bayesian analyses, and the robustness of the trees was assessed using
bootstrapping as above, with the appropriate rnodel for ML analyses selected using
Modeltest. Two species were used as outgroup taxa, representing the Tetraclitoidea;
Tesseropora rosea Krauss and Au.s·trobalanus imperator Darwin.
CO 1 sequence data was also used to confirn1 the relationship amongst Australian E.
modestus in the manner described above. This analysis could not include the single E.
modestus sample frorn the UK or E. kingii as COl sequence for these individuals was
not available on GenBank.
3.3 Results
3.3.1 Within Australia
21 new sequences for each of COl and 168 representing eight species of Australian barnacles were obtained (Table 3.1). Modeltest V 3.7 for ML trees selected the TVM+G model for Australian 168, TVM+I+G for COl, and GTR+I+G for the total 16S data.
46 Cytochrome oxidase I sequences of 658bp were gathered from 12 populations around
Australia. The fragment used showed no insertions or deletions across taxa, and
contained 256 variable sites and 227 parsimony informative sites. No stop codons were
found and the COl and 16S trees are congruent, which indicates that it is unlikely that
these DNA sequences are nuclear pseudogenes.
Phylogenetic analysis of these sequences revealed distinct clades corresponding to each
of the species examined (Figure 3.1 ). Sequence divergences among clades were high,
ranging from 18.6% to 28.6% (mean 24.5%). The COl phylogeny reinforces the
traditional, morphology-based taxonomy in that each of the currently recognised species
is monophyletic. Analysis indicates strong bootstrap support (1 00%) for the monophyly
of each of Chthamalus antenna/us, Chamaesipho tasmanica, Catomerus polymerus and
Elminius modestus, and moderate to high support (59-94%) for the sister relationship of
C. antenna/us and C. tasmanica. However, little phylogenetic resolution is evident
within clades.
16S rRNA sequence of 326bp was analysed for the smne individuals used for the COl
analysis. The fragment used showed five INDELs, and contained 139 variable sites and
99 parsimony inforn1ative sites. Gaps were treated as pairwise deletions in order to
include them in the analysis.
As with the COl data, phylogenetic analysis of the 16S data revealed distinct clades
(Figure 3 .2), corresponding to previously described species and bootstrap support of the basal nodes was low. Sequence divergences among clades were high, ranging from
47 Figure 3.1 Bayesian tree based on 658 base pairs of Cytochrome Oxidase I mtDNA sequence, for Australia intertidal barnacle species. Bootstrap support is indicated at each node (ML/MP/Bayes).
48 .------LB10 Lepas anatlfera 1 00/9911 oo I MJ2 } Elmlnlus modestus SR1 SB2 { A16
...... ------1_00_1_99_1_100__ --t- SBP1 Chthamalus anrennatus -cca
CC1 -/59/93 r-SB3
BB11
-/-/73 SBP2 Chamaeslpho tasmanlca r--- 100/991100 CC3
BR3
'------SH8 Austromegabalanus nlgrescens
-1-199 GP10
t-AJ2
.------1_00_/_99_/_100_--1 BR 1 Catomerus polymerus
lfSBP3 Lsas
81180/100 1 HP6 Tesseropora rosea !.______HP7 Austrobalanus lmperator ------0.1
49 Figure 3.2 Bayesian tree based on 335 base pairs of 16S rRNA sequence for Australian intertidal barnacle species. Bootstrap support is indicated at each node (ML/MP/Bayes).
50 ~------LB10 Lepasanatife~
.....______HP7 Austroba/anus /mperator
100/99/100 MJ2} Elmlnlus modestus SR1
r-BR3 100/99/100 J------+ CC3 Chamaeslpho tasmanlca SB3 SBP2 .
_rAI6 I lss2
100/-/100 Chthamalus antennatus r--GP2
SBP1 .~
rAI1 ' t-BR1 100/99/100 I------+-GP9 Catomerus po/ymerus
SBS SBP3
-/-/92 ,..-----HP6 Tesseropora rosea
l SH8 Austromegaba/anus nlgrescens -----0.1
51 16.7% to 47.9% (mean 27.6%). The monophyly of each of C. antennatus, C. tasmanica,
C. polymerus and E. modestus was again highly supported by bootstrap analysis (99%).
3.3.2 Global Phylogeny
Phylogenetic analysis of 16S rRNA sequences was undertaken for all available
Australian (n=29) and New Zealand (n=4) samples, and 22 Genbank samples. A 330bp
fragment was used, of which 165 sites were variable and 143 sites were parsimony
informative. 18 INDELs were present across all taxa, and 17 within the ingroup taxa
only. Gaps were treated as pairwise deletions in order to include them in the analysis.
Analysis revealed distinct separation of species and confirmation of the existing taxonomy to a high degree in that a majority of Australian species group with the appropriate family (Figure 3.3). Bootstrap support for basal nodes was low, but tern1inal nodes were more strongly supported. Sequence divergences between genera were 5.8% to 24.2% (mean 14.1 o/o) while divergences within genera were lower, between 0.2o/o and
8.8% (mean 3.4%). These calculations do not include genera for which a single smnplc is available. Divergences within species were 0% to 1.2% (n1ean 0.52%). Again, these calculations do not include species for which only a single sample is available. These data do not reveal anything about the evolutionary relationships of species, but suggest that some generic associations are not supported by the molecular data, in particular those between species within the Elminius genus. For example, Elminius kingii appears to be n1ore closely associated with Lepas anat(fera rather than E. n1odestus.
52 Figure 3.3 Bayesian tree based on 328 base pairs of 16S rRNA sequence. Taxa labels refer to those listed in Table 3 .1. Samples without an ID code are from GenBank (Table 3.1 ). The bootstrap support, based on 1000 replicates for maximum parsimony and 100 for maximum likelihood, and posterior probabilities for bayesian analysis, is indicated at each node (ML/MP/Bayes).
53 ..------l.quadrlvaJvls p .polymerus L----- ~~olymerus }
1 00/10011 00 ::~ Catomerus po/ymerus GP9 SB5 NZ4 55198A)6 Dun 1 E.modestus 60,92Ja9 Dll12 HP10 Elmlnlus modestus MJ1 100199/1 00 MJ2 HP9
SR1 } 100/100/100 Chthamalus anrennatJJs ~------~~---t ~~P2SB2 -/-/61 SBP1 c.challengerl C.blslnuatus L----c.stellatus
~~1 } 70199195 CCJBR3 Chamaeslpha tasmanlca -/53fi5 SBP2 C.brmnea ~} Chamaeslpho columna u::l..WJ~.L>o<.W.. NZ6 Chamaesipho brunnea 1 00/10011 00 HP7 }Austrobalanus Jmperatar HP8 1 001991100 B.crenatus 65/-182 B.glandula 70/611100 s.carlosus -/61156 S.balanoldes 50/64 B.perforatus M.aqulla SH8 A.pslttacus M.tintinnabulum M.callfornlcus M.splnosus 1 00/10011 00 LB9 J- Lepas anatlfera ~------~~--~ LB1
L______E.klngll ___ T .squamosa .____ T.japonlca HP5 J HP6 Tesseropora rosea -157191 CHN .______T .purpurascens ---0.1
54 3.3.3 The Elminius genus
Specimens of Elminius from South Australia were allocated to the species described by
Bayliss (1988, 1994) where possible, however many identifications were uncertain due to an overlap in characteristics. In particular, external colour of the specimens was varied, and for some specimens the colouration of the body did not fall into any of the five described Elminius species. The range of morphologies of these specimens is shown in Figure 3.4. Modeltest V 3.7 for ML trees selected the TIM+I model for 16S data. The subsequent analysis of the 16S data for these samples indicates the presence of three distinct clades. Clade A (Figure 3.5) contains supposed individuals of E. modestus from New South Wales, Victoria and Tasmania, as well as all individuals identified as E. cover/us. Clade B contains all but a single individual from South
Australia, representing all of Bayliss' suggested species. Clade C contains individuals from New Zealand, the United Kingdom, Tasmania and a single locality in South
Australia.
Average divergences within these clades are low, between 0.6 and 1.3%, while divergence between the three clades is 5.8-7.4%. Clades A-C show a relatively high level of divergence when con1parcd with E. kingii, between 15.3% and 16.1 o/o. This is sitnilar to the level of divergence when compared with the two outgroup taxa (15.3-
18.1 %). Analysis of 658bp of Cytochrome Oxidase I (COI) data for the Australia and
New Zealand samples (not shown) confirmed these divisions. This analysis of the COI data is not shown as not all samples could be included, patiicularly E. kingii and E. modestus as COl sequence was not available on GenBank.
55 Figure 3.4 Photographs showing the rage of morphological variation of samples of Elminius collected from a number of sites in Australia. Each individual represents a different putative species of Elminius; a-E. placidus, b-E. modestus, c- E. adelaidae, d-· E. jlindersi, e-E. erubescens and f-E. covertus. However, samples a, d and e all fall into Clade B, samples b and f fall into clade A, while sample c falls into Clade C
56 57 Figure 3.5 Bayesian tree based on 325 base pairs of 16S rRNA sequence for Elminius. Taxa labels refer localities listed in Table 3 .2. The bootstrap support, based on 1000 replicates for maximum parsimony and 100 for maximum likelihood, and posterior probabilities for bayesian analysis, is indicated at each node (ML/MP/Bayes)
58 .------T.rosea L------A.imperator r-PI3 f-PI5 ~PI9.2 r-PI9.4 r-1--MJ1
f- L--MJ 99/99/100 1- Dun2 A ~-HP9 Pl1 ~-PI4
~-PI? {PI9.1 Pl9.3 "--SR1 99/91/95 -GJ1.2 -PA2.1 -1-CSA L-KI4.1 -,_--C6.1 t-KI1.2 I rKI4.2 B ~KI6.1 99/97/100 L--KI1.4 f-PA1.1 ~-PA1.2 PA2.2 C2A
L- Kl5.1 99/99/96 r-GB1.2 NZ4 99/98199 Dun1 >- c ~--Hb1 ~..- E.modestus .,) E.ki ngii 0.1
59 3.4 Discussion
3.4.1 Sequence divergence between and within species
Average sequence divergences between and within known morphologically defined
'good' species give us an indication of what level of divergence we might expect in order to identify cryptic species. There are marked differences in the percentage of sequence divergence within currently recognised barnacle species, between species within genera, and between species across genera. Within species divergence is in the range of 0-1.2% (mean 0.52o/o), while divergence between species within genera is on average 0.2-8.8%. However, the Chthamalus genus appears to be the exception where divergence between species within the genus is 9.5-25.9% (mean 19.1 %). Meanwhile, sequence divergence between species across all genera varies between 0.4-25.3o/o (mean
13.12%).
3.4.2 Within Australia
The specific status of eight of the II known southern Australian intertidal barnacle species was examined. The remaining three species were not included as they were either not collected, or could not be PCR-amplified for the genes of interest. Analysis of
COl and 16S phylogenies show that the branching order of species are consistent across genes. While low bootstrap support causes branches to collapse back to the basal node, all species are clearly distinct. The only notable feature is the inclusion of
A ustrobalanus imperator, forn1erly Balanus imperator, in the Tetraclitidae. A. in1perator was recognised as a coronuloid by NeWinan and Ross (NeWinan and Ross,
1976; Newman and Ross, 1977), and is the only n1en1ber of the Tetraclitidae to feature six principle plates. The other members of the Tetraclitidae have four principle plates
60 while a key feature of the Balanidae is six principle plates, although this is not the only
defining feature of the family. This analysis shows that the decision to include this
species in the Tetraclitidae based on its morphology was made correctly.
3.4.3 Global phylogeny
When data for Australian samples is cmnbined with samples from around the world,
each species groups into the expected family. That is, Tesseropora rosea,
Austrobalanus imperator and Tetraclitella purpurascens sit clearly amongst other
representatives of the Tetraclitidae, Austromegabalanus nigrescens associates with the
other members of the Balanidae, and Chthamalus antennatus and Chamaesipho tasmanica cluster with other members of the Chthamalidae. The basal nodes for these clades are highly supported. While the relationships presented by the trees are generally as expected based on previous morphological characterisation, there are a number of results which require further discussion.
3.4.4 The Chamaesipho Genus
Chamaesipho columna was previously reported to be distributed in both New Zealand and Australia. However, this species was later split into two separate species, C. columna in New Zealand, and Chamaesipho tasmanica in Australia (Foster and
Anderson, 1986). This analysis supports the split, with 6.6±0.21% sequence divergence between the two. This level of sequence divergence is similar to the divergence between
C. columna and Chamaesipho brunnea (12.0%).
A previously published sequence from a putative individual of Chamaesipho brunnea from Auckland, New Zealand was also included from Genbank (Fisher et al., 2004).
61 However, this sample clearly aligns with C. tasmanica from Australia (sequence
divergence 0.12±0.16%). This is conflicting, as C. tasmanica is not previously reported in New Zealand. However, it is possible that C. tasmanica is recently introduced to
New Zealand, either by shipping or natural dispersal. Numerous marine species are known to have undertaken trans-Tasman dispersal (Chiswell et al., 2003; Waters et al.,
2005b) and it is possible that this is the case for C. tasmanica. Misidentification of the sample is potentially due to the unfamiliarity of the collector to C. tasmanica given that it is not previously known to be present in New Zealand. The collection locality of the sample was confirmed with the collector.
3.5.5 The Chthamalus Genus
The reasonably high inter-generic sequence divergence within Chthamalus is also worth noting. In particular, C. antennatus is approximately 18-20o/o divergent compared with each of C. bisinuatus, C. challengeri and C. stellatus. However, the latter three species show pairwise sequence divergences of 9.5-15.4%. While this level of divergence n1ight suggest that C. antennatus belongs to a second genus, morphological studies show that of all members of the Chthamalus genus share their larval features (Egan and Anderson,
1989). Similarly, other studies of the Chthamalidae have shown high levels of divergence between n1embers of the satne species ( Chthamalus malayensis, CO I:
12.3%) which are not supported by morphological variation (John Zardus, pers. comm.).
High levels of divergence within species of this genus suggest that there may be something about the biology or ecology of Chthamalus larvae which limits their dispersal.
62 3.4.6 The Elminius Genus
The most interesting finding of this study is the division of Elminius modestus indicated
by the phylogenetic analyses undertaken. Previous literature based on morphological
analysis has suggested a single species, which originates in both Australia and New
Zealand, with introduction to the United Kingdom on ships hulls or as larvae in ballast
water (Crisp, 1958). The species was first reported in the United Kingdom in 1946
(Bishop, 1947). A subsequent study suggested that E. modestus was a New Zealand
species which was introduced to Australia by shipping in the nineteenth century (Foster,
1982).
However, the phylogenetic analysis undertaken here clearly indicates three separate
clades; one in Australia (NSW, VIC, TAS) (Clade A), one in New Zealand~ the United
Kingdom and Australia (T AS, SA) (Clade C), and a third only in South Australia (Clade
B). Average sequence divergence within each group is 0.6 to 1.3%, but 5.8-7.4% between groups. This level of sequence divergence is not unlike that seen between two species belonging to the san1e genus, for example Chamaesipho tasmanica and c·. columna. It is therefore suggested that the two Australian groups be raised to species status. However, these data also suggest that the division of South Australian Elminius is not appropriate, in that smnples falling into each of the four species described by
Bayliss (Bayliss, 1988; Bayliss, 1994) show little to no genetic variation. Therefore it is possible that any n1orphological differences are due to environmental conditions.
However, it is unlikely that substrate alone is responsible, as samples of different morphology were found to be adjacent on the same substrate (Table 3.2). It is also noted that some recent publications ( eg Perez-Losada et al., 2008) refer to E. modest us as
Austrominius modestus. However, Austrominius was originally suggested as a novel
63 subgenus for both E. modestus and E. covertus (Buckeridge, 1982), not a genus as these
recent publications might suggest.
Interestingly, Elminius kingii shows between 14.8% and 17.3% sequence divergence to
the other E. modestus localities, which is a level of sequence divergence more similar to
that seen between two species belonging to different genera. This division may be due
to geographical distance; E. kingii is most commonly found in Chile and separation over
such a distance for long periods of time could result in a divergence of this magnitude.
I-Iowever, it is most likely that E. kingii belongs to a genus separate to that containing
"E. modestus"; while E. kingii may appear to be monophyletic to the E. modestus clades
(Figure 3.5), the larger phylogenetic analysis undertaken (Figure 3.2) shows that this is not the case, and that they are in fact not sister taxa. Therefore, it is suggested that
Austrominius (Buckeridge, 1982) be raised to generic status. The precedent for this type of taxonomic change was set when Newman and Ross ( 197 6) changed the status of the subgenus Catomerus to a genus in its own right, without comment, and this change has been retained in the literature.
Therefore, it is proposed that the species that is found in Australia, New Zealand and the
United Kingdom becomes A ustrominius modest us, while the clade containing specimens from Victoria, New South Wales and Tasmania, as well as samples identified as E. covertus, becomes Austrominius covertus. Lastly, the South Australian clade should be known as Austrontinius adelaidae as this was the first novel species described by Bayliss.
64 It is difficult to determine from the data presented here whether Elminius originated in
New Zealand or Australia. Based on the hypothesis of Foster (1982), a New Zealand
origin seems likely, as it was found that Darwin's descriptions of specimens of E.
modestus matched those of E. modestus from New Zealand and Europe, and many of his
samples could not be located by Foster. Therefore it was concluded that if E. modestus
in Australia was initially restricted to shipping ports, then the species most likely
underwent ship-aided dispersal to Australia, beginning prior to 1836 when Darwin's
specimens were collected. However, the work by Buckeridge (Buckeridge, 1982) lends
more to an Australian origin, given the number of species found in Australia, both
extant and extinct. The data presented here appear to support an Australian origin, but
further samples from New Zealand and the United Kingdom would be required to fully
investigate this.
This study into Elminius has been particularly interesting, as there has been a distinct
lack of concordance between the n1orphological and molecular data. Samples which appear morphologically sin1ilar have shown relatively large genetic differences, while morphologically distinct samples have been found to be genetically similar. This lack of molecular support for morphological variation is well documented in a number of marine species (e.g. (Foltz et al., 1996; Knowlton and Weigt, 1997), as is the alternative where taxonon1ically accepted species have been shown to be genetically indistinguishable (e.g. (Schwaninger, 1999; Williams, 2000)).
A recent study in Asia showed that barnacles can exhibit phenotypic plasticity in response to local selection pressures. This study examined two "species", Tetraclita japonica and T. formosana, which were originally separated due to colouration
65 differences of the shell. Recent work (Tsang et a!., 2007) has shown that there is an
average cor sequence divergence of only 1.2% between these two taxa which is within
the range of intra-specific divergence for barnacle species (Sotka et a/., 2004). The
authors therefore suggest that T japonica and T formosana most likely represent two
colour morphotypes of the same species, and that any colour differences are most likely
due to variations in the local environment. Similarly, samples of Chthamalus antenna/us
collected during the duration of the current study were found to vary drastically in appearance depending on the substrate on which they were found. Subsequent molecular analysis showed no genetic basis for this variation, suggesting that it is due purely to environmental conditions.
Another explanation for these conflicting patterns of genetic and morphological variation is recent or incomplete speciation (Flowers and Foltz, 2001), resulting fro1n hybridisation (Marko, 1998), incomplete lineage sorting (Palun1bi, 1996b) or limited morphological divergence between genetically distinct species (Knowlton, 2000).
The issue of species concepts is particularly relevant here, where morphology and genetics give conflicting results. The biological species concept (Mayr, 1942) defines species as groups of individuals with the potential to interbreed, with boundaries between these species being a barrier to geneflow that has a genetic basis. However, the increasing use of systematics has widened the appeal of the phylogenetic species concept. This concept implies that any type of diagnostic genetic difference can be used to define a species, as long as interbreeding does not occur. Knowlton and Weigt
(Knowlton and Weigt, 1997) suggest that if individuals exist in sympatry, then the biological and phylogenetic species concepts are equivalent, as fixed genetic differences
66 imply barriers to gene exchange, and subsequently, genetic difference. As the
individuals analysed in this study are sympatric, it is reasonable to conclude that they
are in fact three distinct species.
3.5 Conclusions
In summary, the molecular analyses undertaken here provide a high level of support for
morphology-based taxonomic descriptions of Australian barnacle species. In particular,
there is very strong support for the assignment of each species into the existing genera.
However, the molecular data have highlighted a number of inconsistencies, most
notably the assignment of the name Elminius modestus to what appears to be three separate species. As a result, the recommendation from this study is that E. modestus be listed as three species with the genus name Austrominius; A. modestus, A. covertus and
A. adelaidae.
67 Chapter 4
Mitochondrial and Microsatellite Population Structure and Biogeography of Catomerus polymerus
68 4.1 Introduction
4.1.1 General description of Catomerus polymerus
Catomerus polymerus (Darwin) is a highly distinctive species of intertidal barnacle endemic to the temperate coastal waters of southern Australia. A chthamaloid barnacle of the family Catophragmidae, it was separated from the northern hemisphere Catophragmus by Pilsbury (Pilsbury, 1916), and raised to full generic status by Newman and Ross
(Newman and Ross, 1976). More recently it was suggested that there may be two species of
Catomerus on mainland Australia and Tasmania (Ross and Newman, 2001), based on the configuration of the opercular plates, particularly in their manner of articulation. However, this difference could be attributed to growth differences due to substrate, as well as the very small sample size used in the study.
Catomerus polymerus occurs on exposed rocky shores from southern Queensland, south along the New South Wales coast to the southern tip of Tasmania. Its distribution also extends westward along the Victorian and South Australian coasts towards the Great
Australian Bight. The two n1ost notable breaks in the distribution of C. polymerus are along the southern coast of mainland Australia: the region fron1 Cape Otway in Victoria to Robe in South Australia shows a marked reduction in individuals, while the species is completely absent in the Ninety Mile Beach region, in eastern Victoria, due to lack of suitable rocky substrate.
Catomerus polyn1erus is easily distinguished from other species on the shore due to its distinctive shell. Surrounding the eight principal wall plates of the animal is a prominent band of marginal plates, which comprises up to eight whorls of small, overlapping
69 sublateral plates. These plates are potentially an adaptation to the high energy environment
that the species prefers (Ross and Newman, 2001 ). These whorls are considered a primitive
trait, and led Darwin (Darwin, 1854) to hypothesise that C. polymerus was the evolutionary
link between the sessile and stalked barnacles. However, more recent studies suggest that
this is not the case, as C. polymerus in fact posses a combination of plesiomorphic and apomorphic characters (Anderson, 1983; Anderson, 1994).
Barnacles undergo a two-phase life cycle of planktonic larval form and sessile adult form, whereby gene flow is facilitated by the larval phase. Most literature assumes that species with a long-lived planktonic larval phase have vast geographic distributions, and minimised genetic structure (Booth and Ovenden, 2000; Burridge, 2000b ), while the opposite is usually true for species with short-lived planktonic larvae (Planes et al., 2001; Riginos and
Victor, 2001). The length of the cyprid stage of C. polymerus is not known precisely, however studies of other barnacle species suggest that the larvae may survive in the plankton for several weeks (Crisp, 1974; Walker et al., 1987). Studies of the breeding patterns of C. polyn1erus in New South Wales suggest that reproductive activity peaks during autun1n/winter, with the 1nain spawning of larvae occurring during late winter/spring
(Wisely and Blick, 1964, Mackiewicz, 1975, Egan and Anderson, 1989). The atmual breeding pattern in southern populations has not been determined, but reproductively active individuals have been collected fron1 Tasmania during winter and autumn (Fleming, 1986).
4.1.2 Marine Biogeography of Southern Australia
Previous studies of southern Australian marine species (Bennett and Pope, 1953, Bennett and Pope, 1960, Knox, 1963, Rowe and Vail, 1982) have led to the recognition of three distinct marine biogeographical provinces: the Peronian province (south-east Australia), the
70 Flindersian province (south-west) and the Maugean province (Tasmania and southern
Victoria) (Figure 4.1) While the causes of these biogeographical patterns are not entirely
certain, researchers have suggested a number of factors. These include contemporary
factors such as coastal regions which lack shallow rocky reef habitats (Edgar, 1986), the
prevailing ocean currents in the region and temperature gradients (Bennett and Pope, 1953;
Bennett and Pope, 1960; O'Hara and Poore, 2000)
Historical factors include the Bassian landbridge (Figure 4.2) which was present during glacial maxima and would have most certainly blocked gene flow between eastern and western marine populations (Burridge eta!., 2004).
The movement of C. polymerus larvae is aided by major currents in the southern Australian marine region; primarily the Leeuwin current, the East Australian current and the Zeehan current (Baines et al., 1983) (Figure 4.1). The Leeuwin current, a warm ocean current, flows southward along the Western Australian coast, then turns east along the South
Australian coast. In the region of the Great Australian Bight, the Leeuwin current is replaced by the Great Australian Bight Current (Rochford, 1986), then the weaker Zeehan
Current which runs as far east as the west coast of Tasmania (Baines et a!., 1983).
However, the Great Australian Bight Current is usually referred to as part of the Leeuwin current. The East Australian current (EAC) flows south along the east coast of Australia, and generates ocean eddies, most of which rotate anti-clockwise. The EAC reaches its peak in summer, while it is at its weakest in winter (Tilburg eta!., 2001). It is hypothesised that the action of these currents will be a major contributing factor in the contemporary structuring of C. polymerus populations.
71 Figure 4.1 Shaded regions indicate the marine biogeographic provinces of southern Australia as proposed by Bennet and Pope (1953). Extensive sandy regions (Coorong in South Australia, Ninety-Mile Beach in Victoria) are indicated by "X". The Leeuwin current partially reverses during summer, while the East Australian Current extends further south. Figure modified from Waters et al. (2004)
72 Peron ian Leeuwin current ' Flindersian East e Maugean Australian ll current 1 \··. South Australia Western Australia \ Great Australian Bight \
73 Figure 4.2 Illustration showing the location of the Bassian Land bridge and the altered coastline as it would have been during glacial maxima. The present-day coastline is shown in grey, while the glacial coastline is shown in black. Figure adapted from Burridge et al. (2004).
74 75 4.1.3 Aims of the Study
In this study both mtDNA sequence data and microsatellite analyses have been utilised to
examine both the historic and contemporary processes which have shaped the biogeography
of C. polymerus populations in Australia. These data allow the formulation of hypotheses
as to the causes of this structuring with regards to environmental and ecological factors at
work in the southern Australian intertidal marine environment. Ecological hypotheses
predict that genetic diversity is correlated with geographic barriers such as 90 Mile Beach
or the Coorong (Hypothesis 1; Figure 4.1 ), while contemporary gene flow might be
correlated with major ocean currents (Hypothesis 2; Figure 4.1 ). On the other hand, an
historical vicariant hypothesis predicts that genetic diversity might be correlated with the
Bassian Isthmus (Hypothesis 3; Figure 4.2). MtDNA is well established as a marker for the
examination of historical patterns, while the rapid rate of mutation of microsatellite loci
make them ideal for the study of contemporary population structure and the ecological
factors responsible. As C. polymerus is hermaphroditic, mtDNA is expected to be a better
reflector of patterns of population structure than in bisexual organis1ns where sex-biased
genetic patterns may be observed.
4.2 Materials and Methods
4.2.1 Sample Collection and DNA Extraction
Samples of Catomerus polymerus were collected by hand from rocky intertidal zones throughout the species range (Figure 4.3). Up to 30 individuals were collected frorn each population, where a population is defined as a geographic collection locality. Collections were made from March 2005 to December 2006, and preserved in 70o/o ethanol. Samples were collected in the form of whole individuals, or as partial samples, in that a few of the small imbricating plates of C. polymerus were carefully removed with a scalpel.
76 Figure 4.3 Map of Catomerus polymerus collection sites from rocky shores in south eastern Australia. PS Point Sinclair, CpC Cape Carnot, PB Pennington Bay, SBP Portland, LB Portsea, SB Sorrento, GP Griffith Point, CC Cape Conran (includes SG, WC), BP Bastion Point, TH Tura Head, CB Cape Banks, CHS Charlotte Head, StH St Helens Point, Fm Falmouth, Bi Bicheno, ClB Coles Bay, PrB Pirates Bay, BBy Blackmans Bay.
77 U) I 0 I/~
78 To test the viability of non-lethal sampling, the positions of a number of individuals was
marked on a Perspex sheet, before samples were taken from five of these individuals.
Return visits were made to the site over a period of eight months. It was found that these sampled individuals survived for this period of time following the removal of their imbricating plates.
Genomic DNA extractions from both whole and partial samples were conducted as described in Chapter 2
4.2.2 Mitochondrial Amplification and Sequencing
Partial mtDNA Cytochrome Oxidase I (COl), and Control Region (CR) fragments were amplified from one to two individuals randomly selected from each of the populations of C. polymerus. These fragments were also amplified from samples of Tesseropora rosea and
Austrobalanus imperator for use as outgroup taxa. Chthamalus antennatus was the first choice for the outgroup, however no product could be amplified for the control region. The topology of the tree was the same regardless of the outgroup taxa used.
Partial sequences of the mitochondrial COl gene were obtained using universal primers
LCOI1490 and HCOI2198 (Fohner et al., 1994) or LCOI1490 and COI-N R (Buckeridge,
1995). Novel primers were used to amplify the 1nitochondrial control region: CR-F (5'
TTfCYAAWATTTTCTACTGAG-3') and CR-R (5'-CAAAGTAAYCCTTTTWTCAGGC-3'). These primers were designed from full mitochondrial genon1es of Megabalanus volcano,
Pollicipes polymerus and Tetraclita japonica on GenBank (Ace. #NC_006293,
NC_005936, NC_008974).
79 Polymerase chain reaction (PCR) amplifications were performed on a Mastercycler
gradient thennocycler (Eppendorf). DNA amplification was performed in a 50J.LL
volume containing approximately 50-100 ng DNA template, 0.3 pm each of each
primer, 0.2 mm each dNTP, 2.5 mm MgC12, Sx PCR buffer, and 2.0 U GoTaq Flexi
Taq DNA polymerase (Promega). Amplification consisted of an initial denaturation at
96°C for 3min, followed by 30 cycles of 96°C for 30sec, the appropriate annealing
temperature for 30sec, and 72°C for 30sec, with a final extension step at 72°C for 4min.
The annealing temperature used for COl was 44°C while 47°C was used for the control region. PCR products were purified using a QIAGEN PCR purification kit.
Initially some of the samples were sequenced in both directions using the BigDye version
3.1 sequencing kit (Applied Biosystems Inc.) as per the manufacturer's instructions.
Capillary separation of samples was performed by the Australian Genome Research
Facility (AGRF). The remaining samples were sent to Macrogen Inc (Korea) for sequencing and capillary separation. All samples were sequenced in both directions. The nucleotide sequence data determined for these samples were deposited on GenBank
(accession numbers: EU423198-EU423267).
4.2.3 Mitochondrial DNA sequence analysis
All sequences were aligned using the ClustalW algorithn1 (Thompson et al., 1994) in Mega
3.1 (Kumar et a!., 2004) with default settings. Pairwise distances were calculated using
Kitnura's 2-parameter model, and neighbour-joining trees constructed using Tesseropora rosea and Austrobalanus imperator sequences as the outgroup taxa. Maximum likelihood
(ML) and maximum-parsimony (MP) analyses were also conducted using the heuristic search option in PAUP* (Swofford, 2001). Modeltest V3.7 (Posada and Crandall, 1998) was
80 used to select the most appropriate model of molecular evolution used for the ML analyses.
COl data was analysed under a TVM+G model, while control region data was analysed
under a TrN+G model. The robustness of the branching patterns were assessed using
bootstrapping (Felsenstein, 1985), with 1000 replicates for neighbour-joining and MP, and
100 replicates for ML analyses.
The COl sequences were tested for background selection using Tajima's D (Tajima, 1989)
and Fu and Li's F and D (Fu and Li, 1993) calculated in the program DNASP version 4.10.9
(Rozas et al., 2003)), and Fu's Fs (Fu, 1997) calculated in ARLEQUIN version 3.11
(Excoffier et a!., 2005). These tests are based on the observed level and pattern of allelic variation which can be inf1uenced by both selection and demographic processes. These include selective sweeps and population expansion (Ballard and Whitlock, 2004). The
McDonald-Kreitman (M-K) test compares the ratio of synonymous and non-synonymous differences within species compared to those between species (McDonald and Kreitman,
1991 ), and is not as sensitive to demographic changes compared with the tests above which detect departures from neutrality caused by selection (Ballard and Whitlock, 2004). The eastern samples were used as the outgroup for the western samples, and vice versa, in the tests for selection.
The demographic history of populations of C. polymerus was also examined through Fu's
Fs (Fu, 1997), performed in ARLEQUIN and DNASP. Fu's Fs is a stringent statistical test, where negative values are indicative of population growth and/or genetic hitchhiking.
Mitochondrial FsT estimates were also calculated using ARLEQUIN. A coalescent-based test was used to detect past population growth, and was executed in FLUCTUATE (Kuhner et a!.,
1998). FLUCTUATE employed 10 short chains, with increments of 20 for 4000 steps, then 5
81 long chains with increments of 40 for 40000 steps to calculate the value of e (a composite
measure of effective population size and the per-site neutral mutation rate, 2Ne~ in the case
of mtDNA), with no population growth. This was repeated five times, and the mean and
standard deviation of these replicates calculated. A further five replicates were undertaken, allowing for population growth. The mean and standard deviation of (} and g (exponential growth rate) obtained from the replicates was subsequently calculated.
4.2.4 Isolation and Characterisation of Microsatellites
DNA was extracted from cirral tissue or plate membrane following a modified lithium chloride/chloroform protocol described by Gemme! and Akiyama (1996), as described in
Chapter 2.
Genomic DNA fron1 four individuals of C. polymerus was combined and digested with
Msel, resulting in 200-1 OOObp fragments. Microsatellite loci were then isolated using the
FIASCO (fast isolation by AFLP of sequences containing repeats) protocol (Zane et a!.,
2002). The resulting poly-GA and poly-CA enriched genomic library was cloned into pGEM (T-easy vector system) (Protnega) and used to transforn1 Escherichia coli competent cells.
53 clones with inserted plasmids were randon1ly selected from LB plates and incubated at
95°C for 3min in 50J-Ll TE buffer [I 001nM Tris-HCI (ph 7.6), lmM EDTA]. Resulting DNA was amplified by polymerase chain reaction (PCR) with M13 forward and reverse prin1ers, and sequenced by Macrogen Inc (Korea) using universal primers T7 and SP6.
82 Fifteen primer pairs flanking microsatellite regions were designed using PRIMER3 (Rozen
and Skaletsky, 2000), and optimised on a Mastercycler gradient thermocycler (Eppendorf).
Ten microsatellites were successfully optimised, however due to monomorphism and high
levels of stuttering (PCR slippage), five were employed in sample genotyping.
4.2.5 Genotyping
One member of each primer pair was end-labelled with a fluorophore (either FAM or TET).
DNA amplification was performed in a 12.5JlL volume containing approximately 50-1 OOng
DNA template, 0.3pmol each of each primer, 0.2mM each dNTP, 2.5mM MgCh, 5X PCR
buffer, and 0.5U GoTaq Flexi Taq DNA polymerase (Promega). Amplification consisted of
an initial denaturation at 94°C for 3min, 30 cycles of denaturation at 94°C for 30s,
annealing for 30s at a locus-specific temperature, and extension at 72°C for 30, followed by
a final step of 72°C for 4min. Details of all primer pairs including annealing temperatures
are listed in Table 4.1.
4.2.6 Microsatellite Analysis
PCR products from multiple primer sets for each individual were pooled then purified with
a Sodium Acetate precipitation, and analysed on a MegaBACEIOOO capillary DNA
sequencer by the Genetic Analysis Facility (James Cook University, Townsville). The output was loaded into Fragn1ent Profiler Vl.2 (An1ersham Biosciences) to enable scoring of genotypes.
GENALEX version 6 (Peakall and Smouse, 2006) was used to calculate the average nu1nber of alleles per locus. Observed and expected heterozygosities were estimated and deviations from Hardy-Weinberg equilibrium were determined by exact tests and permutation in
83 Table 4.1 Polymorphic microsatellites characterised for Catomerus polymerus. Repeat structure is based on sequence of cloned allele. Ta is the annealing temperature used in the standard polymerase chain reactions (PCRs). The number of alleles, product size ranges, proportion of observed heterozygotes (Ho) and expected heterozygotes (HE) all based on the genotyping of 399 individuals of C. polymerus
84 Locus I Primer sequences 5' to 3' Repeat structure Ta [MgCh] No. of Product Ho HE GenBank (oC) alleles SIZe accession range No. (bE) Catomerusl I F:TIAAATGCGA.ACCAACAGTIC (CA)6/ I (T}? 54 25 33 286-335 0.767 0.863 EU423268 R:GCAGCTGGCATCACTCTA TG Catomerus2 I F:GCCCGGCTGTAGT ACCT ATG (AC)2(C)4(AC)6 54 25 10 224-235 0.733 0.591 EU423269 R:ITAAACGAGCAGCGTCTCAG
Catomerus3 I F:AGCAAGCTTGAGTCGGACAG (A)3(G)4(A)J(GA)g(GGGA)2(GA)4 54 25 30 272-318 0.862 0.800 EU423270 R:AATA.AGAGAAA TAGGGCAACAG Catomerus4 I F:TTITGCCACATCCITGTITG (T)sll (CA)6 54 25 19 176-225 0.867 0.832 EU423271 R:CTAACGTCTGGCGACA.ACAG
Catomerus5 I F: ITGTGGTACAAGAAGGGAAGG (CA)4(TA)(CA)J(TA)(CA)(T A) 48 25 4 184-192 0.433 0.473 EU423272 R:CTGGTCTGCCATCCAAATG GENEPOP 3.1 b (Raymond and Rousset, 1995). All pairs of loci were tested for linkage
disequilibrium under the assumption of Hardy-Weinberg equilibrium in GENEPOP with
exact tests and significance determined through permutation.
In order to investigate possible population structure and geographic differentiation,
population pairwise measures of FsT were calculated using ARLEQUIN version 3.11
(Excoffier et al., 2005). To test for isolation-by-distance, a Mantel test (Mantel, 1967)
(10,000 permutations) was conducted using ARLEQUIN. A linearised Fsr (Fsrll-Fsr) matrix was compared with a geographical distance matrix (in km) in order to test for a relationship between genetic and geographic distance. Geographical distances were calculated from latitude and longitude values. Spatial patterns of variation were also examined using spatial autocorrelation in GENA LEX, employing multiple distance classes (50, 100, 200, 400km).
A principle components analysis (PCA) was also implemented in GENALEX in order to summarise the patterns of genetic differentiation between the sampled populations. This was achieved by plotting the first two underlying factors that explain the n1ajority of variation in multilocus genotypes. A UPGMA distance tree was constructed in GOA
(Lewis and Zaykin, 2001) to confirm the results of the PCA. Genetic population structure was investigated using an analysis of molecular variance (AMOV A) (Excoffier et al., 1992), and partitioning the variation among regions and subregions (eastern, western, central
Victorian, and Tasmanian marine regions, see Results), among populations within subregions, and within populations. The AMOV A was performed in ARLEQUIN with pairwise
FsT as the distance measure.
86 To determine if there was asymmetrical gene flow between populations, the software
package MIGRATE version 2.1.3 (Beerli, 2002) was used to estimate the effective number of
migrants ( 4Nm, where N is the effective population size and m is the migration rate)
entering and leaving each population per generation. The analysis was run using the
microsatellite model (ladder model; stepwise mutation) with heated chains (1 0 short chains,
3 long chains). The analysis was run three times to verify the consistency of the results. The reported results are the consensus from all three runs. Additionally, populations were also combined into four genetically defined subregions, and the analyses were run again to examine migration between subregions. Values of Nm were also calculated in GENALEX.
4.3 Results
4.3.1 Mitochondrial Analysis
The COl aiignment was 658bp in length, with 205 variable sites and 88 parsimony inforn1ative sites. The control region alignment was 579bp in length, with I 09 variable sites and 55 parsimony inforn1ative sites.
Phylogenetic analysis of the mtDNA sequence data revealed two strongly supported clades
(Figure 4.4) for each gene: one corresponding to eastern Victoria and New South Wales, the other to western Victoria, South Australia and Tasmania. Divergence among the two clades was high, ranging from 2.5% to 5.5% (mean 3.6%) for COl and from 5.5% to 9.2%
(1nean 6.8%) for the control region. A strong biogeographic pattern was detected in what would have been a case of reciprocal monophyly except for a single san1ple found in the
"wrong" genetic clade (SG2). This sample was collected in the east of Victoria, but associates with samples from the west.
87 Figure 4.4 Neighbour-joining trees for Cytochrome Oxidase I (left) and Control Region (right), displaying bootstrap values for MP/NJ/ML. East and West refer to the geographic location of the lineages. The individual marked with a star is the sample in the wrong genetic clade.
88 CIB8LB7~ SBP3 Bi9 PS BB4
CHS1 CB2 TH2 L------i------A.lmperator A.lmperaror------~------~ L------T.rosea T.rosea ------'
f---1 0.05 0.01
89 The conservative Fu's Fs was negative for both east (-4.2; P<0.05) and west (-19.6;
P<0.001) supporting population growth or selection. Additionally, values of g obtained in
FLUCTUATE were significantly (Lessa et a!., 2003) larger than zero for the east, g = 528 ±
67 SD, indicating substantial population growth. Values of B were larger (0.266 ± 0.093) assuming population growth compared with no growth (0.030 ± 0.001). For the west, values ofg were even larger (g=l919 ± 503), as were values of Bassuming growth (25.421
± 28.423) compared with no growth (0.048 ± 0.001). The McDonald-Kreitman test indicated that there were no significant departures from neutrality (P>O.OS). However, all other tests for selection were significant (P 6.14% amino acid divergence within the east and west clades). 4.3.2 Microsatellite Analysis A total of five microsatellite loci were analysed in 18 populations (399 individuals). The nun1ber of alleles at a locus ranged from 4 to 33, with a total of 96 detected over all loci. Average observed and expected heterozygosities were high in all populations (H0 , 0.392- 0.730; HE, 0.443-0.71) (Appendix 3.2). The GENEPOP program revealed that four of the five loci were in HWE, with Catomerus 1 showing a significant deviation from HWE in three populations (Cape Conran, Griffith Point, and Pirates Bay) due to heterozygote deficiency in these populations. This was not surprising as two of these populations were at distribution li1nits of subregions (Figure 4.3). Linkage disequilibrium was possibly indicated between only one pair of loci (Catomerus 1 90 and Catomerus3), but occurred only within three of the eighteen populations (Cape Conran, Falmouth, Bicheno ). There was a significant correlation between genetic distance and geographic distance when the data are taken as a whole, with a Mantel test showing a positive correlation (r = 0.4331, P = 0.0013). When the two regions are analysed separately, the western lineage again shows a positive correlation between genetic and geographic distance (r = 0.3912, P = 0.0083). However, no significant correlation is indicated in the eastern lineage (r = 0.3187, P = 0.2014). Spatial patterns were also summarised using spatial autocorrelation. Spatial autocorrelation coefficients for the 100-km distance classes (Figure 4.5) are significantly positive at 300 and 700km. The same result is present at all distance classes up to 200-km. The relationships between individuals from the different populations are clearly shown by the two-dimensional principle components analysis of the microsatellite variation and the UPGMA distance phylograrn (Figure 4.6). When the two factors that explain the majority of the variation are plotted against each other, the populations clearly separate into four subregions. The UPGMA distance phylogram confirms the presence of four distinct subregions. Pairwise FsT and Nm values between each of these four subregions are sumn1arised in Table 4.2. The AMOVA analysis indicated significant variation among the four subregions, with 10% of the variation in microsatellites explained by difference between the four subregions (Table 4.3 ). 91 Figure 4.5 Spatial autocorrelation analysis of microsatellite variation, with 1OOkm distance classes. Correlation is significant at 300 and 700km. 92 ggggggggCb.( 00 (() ~ "! ~ "! ~ 93 Figure 4.6 Two-dimensional plot (top) showing the relationship among populations of Catomerus polymerus based on a principle components analysis of 5 microsatellite genotypes for 18 populations collected from the southern Australian coastal region and (bottom) a UPGMA distance phylogram confirming the boundaries of the four subregions indicated. 94 c Coordln.t • 1 (61 ..-li"'Q Cap• Bmks 'Cape Conran Bastion Point A TuraH.ad Ch:a.rlotw Head B Blackman's Bay Pirate's Bay Cape Carnot Pt Sinclair c Pennington Bay Griffith Point I London Bridge D Sor,..nto 0.1 95 Table 4.2 Range and average pairwise F sr values between each of the four subregions indicated by the principle components analysis. Average gene flow estimates (Nm) between each of these subregions is also indicated. All Fsr values were significant. 96 Subregions Compared Range of Pairwise FsT Average FsT AverageNm AandB 0.063-0.159 0.142 2.46 AandC 0.064-0.142 0.129 2.69 AandD 0.038-0.097 0.072 4.95 B andC 0.033-0.055 0.057 7.70 B andD 0.006-0.156 0.067 6.65 CandD 0.032-0.055 0.051 8.33 Table 4.3 AMOV A comparing genetic variation in microsatellite data among four subregions, among populations within subregions and within populations of Catomerus polymerus 98 Source of d.f. Sum of squares Variance Fixation indices P value Percentage of variation comQonents variation Among 3 87.893 0.151 0.107 < 0.001 10.18 subregions Among 14 22.953 0.007 0.005 < 0.001 0.49 populations within subregions Within 778 1032.656 1.327 0.102 < 0.001 89.33 populations Total 795 1143.503 1.486 There was also significant variation in microsatellites explained by populations within subregions (0.5%), however the majority of the variation is explained by the within population component (89%). The pairwise FsT estimates indicated significant differentiation between populations throughout the distribution of C.polymerus (Table 4.4). Estimates of gene flow calculated with the MIGRATE computer program indicated there were moderate to high levels of gene flow between populations within subregions. The results were consistent between all three runs. Unidirectional estimates of 4Nm ranged from 0.00 to 308.92 (Appendix 3.3). Of the 18 pairwise comparisons between populations within subregions, 8 (44%) had asymmetrical gene flow as indicated by non-overlapping 95% confidence intervals around the estimate of 4Nm into each population. The direction of gene flow between populations within subregions, across subregions (assessed as gene flow between the outermost, edge populations), and between subregions across biogeographic breaks is summarised in Figure 4.7. 100 Table 4.4 Genetic differentiation for the microsatellite data as measured by Wright's Fsr are shown below the diagonal. Nonsignificant differences in pairwise FsTS are indicated in bold. Geographical distances in kilometres are shown above the diagonal. 101 Cape Portlamj London Sorrento Basuon Pomt Pennington Cape Cape Tura Charlotte Griffith St Falmouth Bicheno Blackman's Coles Pirate's Conran Bridge Point Sinclatr Bay Carnot Banks Head Head Point Helen's Bay Bay Bay South Point Cape Conran 641.7 358.7 357 8 93.7 1567.8 1001.6 1210.9 479.2 149.6 699.4 305.2 388.0 413.6 454.0 590.4 482.7 583.3 Portland 0.117 283.9 285.3 734 6 1036 8 430.2 640.2 1004.0 767.1 1208.4 343.2 673.0 679.1 701.7 715.6 716.1 752.4 London 0.039 0.015 17 452 I 12688 674 9 888.4 759.4 490.3 974.5 63.7 452.7 466.6 499.3 565.0 5211 587.8 Bri~ge Sorrento I 0.034 0 057 -0.005 450.9 1270.5 676 6 890.1 758.9 489.3 974.2 62.0 451.0 464.9 497.6 563.5 519.5 586.2 Bastion Point I -0.003 0127 0049 0044 1645 6 1087 4 1295 I 419.1 81.1 635.0 398.9 429.7 455 5 494.1 638.0 522.1 624.4 Point 0.095 0.076 0.056 0 050 0.097 606.6 402.4 1713.1 1639.9 18384 1331.9 1705.1 1713.1 1737.7 1748.0 1752.7 1787.0 Sinclair Pennington 0.089 0.047 0.031 0044 0091 -0.007 213.6 12468 1097.2 1416.4 738.6 1100.5 1107.7 1131.5 1142.7 1146.2 1181.0 Bay Cape Camot I o.I 02 0.047 0.043 006:! 0.097 -0.004 -0.008 1428.7 1301.0 1585.5 952.0 1312.4 1319.0 1341.8 1347.0 1355.8 1386 7 Cape Banks I 0.043 0.198 0.114 0.164 0.015 0188 0.180 0 185 338.9 2211 728.8 848.5 8782 912.4 1057.1 940.1 1042.5 TuraHead 0.007 0.154 0073 0.069 -0.002 0.128 0.119 0128 0.001 556_2 443_2 510.6 536.4 575.1 71&.6 603.2 7055 Charlotte 0.013 0.146 0.063 0.072 -0.002 0.148 0.143 0.141 0.005 0.002 946.9 1061.9 1087.5 1124.6 1271.1 1151.9 1254.1 Head South Griffith Point I 0.030 0080 0.009 0.006 0.048 0.056 0.044 0.074 0.139 0.066 0.084 396.4 411.8 446.2 522.7 469.4 541.8 StHelen's I 0.082 0.007 0.026 0.035 0077 0041 0.032 0.021 0.135 0101 0.091 0.078 25.8 66.0 209.3 94.7 195.7 Point Falmouth 0.108 -0.003 0.023 0.052 0.115 0.068 0.047 0.042 0.180 0142 0.133 0.068 -0.004 40.9 183.8 69.5 170 Bicheno 0.129 0.012 0044 0102 0131 0.091 0.074 0.062 0.194 0.151 0.152 0100 0.002 -0.006 149.0 28.7 1304 Blackman's 0.140 0.0002 0.032 0.091 0131 0.056 0.042 0.026 0.214 0.163 0.158 0.118 -0.008 0.005 0.015 124.9 490 Bay Coles Bay 0.078 0.012 0.006 0.046 0.068 0.054 0.038 0.024 0.150 0.091 0.089 0.071 -0.010 0.015 0.028 0.004 102.4 Pimte's Bay 0.184 0.017 0.076 0.136 0180 0.115 0.102 0.087 0.245 0.208 0.197 0.156 0.01.7 0.021 0.015 -0.005 0.043 Figure 4. 7 Estimates of gene flow between 18 populations of Catomerus polymerus are used to indicate direction of gene flow. Single-headed arrows indicate asymmetrical gene flow, while double-headed arrows indicate bidirectional gene flow. Dashed arrows show overall migration in defined subregions (between outermost, edge, populations within the subregion). Shaded arrows indicate direction of gene flow across biogeographic breaks (Coorong, Ninety-Mile Beach). Letters A-D refer to the subregions. 103 104 4.4 Discussion 4.4.1 Phylogeography and Origin of Populations The phytogeographic structure from the mitochondrial data provides information regarding the history and origin of the current populations of Catomerus polymerus. It is apparent that C. polymerus has a relatively high dispersal ability, as neither the eastern nor western mtDNA clade shows evidence of population sub-division across reasonably large geographic scales (up to 300km). However, the mtDNA sequence data does indicate a deep phylogeographical split within southern Australia, strongly correlated with a phylogeographical barrier in the Bass Strait region. While various molecular clocks exist for COl, there is no calibrated clock for C. polymerus. Therefore, we can roughly date this phylogenetic event using molecular calibrations for Chthamalus COl (3.1 o/o per MY) (Wares, 2001). Based on this, the mtDNA divergence between the two clades (up to 5.9%, mean 3 .5o/o) may correspond to isolation during the Pliocene, up to 2 million years ago. Similarly, the molecular clock for Shrimp COl (2.2-2.6% per MY) (Knowlton et al., 1993) and echinoderm COl (3.1-3.5°/o per MY, Kimura 2-parameter distance; (Lessios et al., 1999; McCartney et al., 2003) also place the divergence during the Pliocene. These late Pliocene divergences roughly correlate with the onset of glaciation. The etnergence of the Bassian Isthmus during glacial periods has been long thought to have promoted allopatric speciation southern Australian marine environment. Similarly, a number of other transient marine geographic barriers are recognised globally, including the isthmus of Panama (Knowlton and Weigt, 1998), the Sunda and Sahul shelves (Benzie, 1999; Chenoweth 105 et al., 1998), and the Benguela upwelling (Lessios et a!., 2001; Bowen et a!., 2001). It is hypothesised that the disjunction indicated by the data correlates with the (now inundated) Bassian Isthmus which was repeatedly exposed for extensive periods over a number of glacial cycles. The glacial periods during the Pleistocene were marked by significantly lower sea levels (to 11 0 m below current level), and cooler ocean temperatures (Wells and Okada, 1996). During these periods, the Bassian landbridge would have been exposed, and would have posed a significant barrier to the dispersal of C. polymerus larvae. This is consistent with studies in other species, in particular a number of starfish species (Waters eta!., 2004). However, during the interglacial cycles when Bass Strait was present, gene flow between the two lineages would have been reinstated, preventing C. polymerus from completely diverging into two species. It is also possible that Tasmania was beyond the southern limit of the species during the glacial periods, and was colonised during post-glacial expansion of the species' range. Following the most recent inundation of the Bassian Isthmus approximately 10-12,000 years ago, the newly formed coastline would have provided substrate for post-glacial colonisation, resulting in the distribution we sec today. The mitochondrial data indicate that populations in western and central Victoria, and Tasmania are of western origin, and this colonisation is supported by analyses that suggest this western clade has undergone significant population growth. The eastern clade has undergone far less population growth, as there is significantly less new rocky shoreline habitat for C. polymerus to colonise. The distinct phylogenetic break seen in C. polymerus is consistent with studies of mtDNA diversity in other species, in particular the starfish Coscinasterias muricata (Waters et al., 106 2004) and the littoral gastropod Nerita atramentosa (Waters et al., 2005b). However, the exact position of the phytogeographic break on the Victorian coastline appears to be influenced strongly by the mode of development of the species being studied, as well as habitat requirements. Species such as C. polymerus are capable of long distance dispersal due to the presence of a planktonic larval phase, potentially resulting in low levels of genetic structure (Booth and Ovenden, 2000; Burridge, 2000b). On the other hand, those species which undergo direct development are more prone to local settlement. As a result, direct developers display lower levels of variation within regions than larval dispersers, and often show marked phytogeographic structure (Planes et al., 2001; Riginos and Victor, 2001). However, C. polymerus also requires rocky shore habitat with fairly rigorous wave impact, rendering Ninety Mile Beach uninhabitable. As such, this expansive sandy region is the location of the disjunction in C. polymerus. This is in comparison with a species such as N. atramentosa which is able to colonise sites between Ninety Mile Beach and Wilsons Promontory, and therefore demonstrates its disjunction at Wilsons Promontory itself. In addition, the same east west division is also seen in the jellyfish Catostylus mosaicus, and is attributed to reproductive isolation caused by the presence of the Bassian Isthmus (Dawson, 2005). 4.4.2 Contemporary Population Structure The microsatellite data indicate significant genetic divergence among the eastern and western lineages of Catomerus polymerus, and also indicate variation within these regions. The principle components analysis clearly indicates that the western region is divided into a further three subregions (Figure 4.6). The three western subregions have clear geographic divisions; populations from South Australia form one subregion, those frotn central Victoria another, and the third subregion comprises all populations from Tasmania and a single population from 107 western Victoria. The geographic separation of these populations is supported by significant spatial autocorrelation results at 300 and 700km, which suggests that interbreeding subregion populations occur approximately within a 300km section of coastline. The significant result at 700km is probably due to regional (east-west) differentiation. In addition to the role of vicariance in the shaping of the population genetic structure of C. polymerus, it is apparent that a number of contemporary environmental factors have helped to shape the biogeography of the species. In particular, the East Australian and Leeuwin currents appear to promote gene flow across broad geographic scales; the former promotes gene flow between populations on the east coast of Australia, while the latter is likely responsible for gene flow from South Australia into Victoria. The Zeehan current also appears to play a role, promoting migration between mainland Australia and Tasmania. Estimates of migration between populations on the east coast suggest movement of larvae up and down the coast. While seemingly in contrast with the southward moving EAC, it is possible that the eddies that form from the current carry some larvae north of their release site. The predominant period of larval release is during winter, when the EAC shortens significantly. This suggests a decrease in migration to southern New South Wales. However, \Vhile winter is the main period for larvae to be released, studies also suggest that reproductively active C. polymerus are found at all times of year (Wisely and Blick, 1964), including when the EAC is at its most powerful, extending past the southern liinit of mainland Australia. Despite indication of movement of larvae up and down the coast, the overall majority of migration is southward, in keeping with the direction of the EAC. 108 Based on predictive studies of particle movement (National Oceans Office 2000), it is most probably the Zeehan current which is responsible for the gene flow between western Victorian populations and Tasmania. The movement of the Zeehan current during the winter months coincides with predominant period of larval release of C. polymerus and studies have shown that particles as small as larvae, when released from Portland, would be collected by the current and carried south before being transported around the south of Tasmania and northwards onto the east coast. Values of migration estimated using MIGRATE confinn this, indicating that the majority of gene flow occurs in the northward direction on the east coast of Tasmania. The major current system influencing the population structure in South Australia is the Leeuwin Current, also known as the Great Australian Bight. Current at its eastern end. Migration values obtained suggest that there is bidirectional movement of larvae between the three populations in South Australia (Region C, Figure 4.6). However, a larger proportion of larval migration is from west to east, which coincides with the eastward flow of the Leeuwin current, particularly during winter when the current is at its strongest, and the peak larval release period is underway. Migration values also suggest reduced migration into Victoria compared with levels of migration within South Australia, aiding the separation of these subregions. In addition to the influence of the current systems, the data suggests that phylogeographic breaks coincide with sandy regions devoid of rocky reef habitat. Group A in Figure 4.6 109 comprises all populations in eastern Victoria and New South Wales, and is clearly a separate region compared to all other populations (FsT 0.072-0.142; Table 4.2). This break appears to coincide with Ninety-Mile Beach. There is no rocky, high-impact surf habitat in this region for C.polymerus to settle on, and it would appear that contemporary ocean currents do not regularly successfully carry migrants across this barrier. The direction of the EAC is also such that larvae would be carried southward, then eastwards and away from Australia's east coast. There is no indication of significant currents travelling westward into Bass Strait which would aid their dispersal into central Victoria. Geneflow estimates in C. polymerus support this, indicating an average of 5 migrants (Nm) per generation across this disjunction. Rare dispersal events across this junction have also been noted in Tesseropora rosea; however this species does not survive for prolonged periods west of Bastion Point (J .Smissen, personal communication). These rare dispersal events are also supported in the mitochondrial data, as one individual of western origin was sampled to the east of Ninety-Mile Beach. Estimates of migration between the NSW and central Victorian subregions suggest asymmetrical geneflow from NS W to Victoria, which is in contrast with the finding of a western individual of C.polymerus in the east. However, migration between the two populations which border Ninety Mile Beach (Griffith Point, Cape Conran) suggests bidirectional geneflow. This appears to indicate complexity in the patterns of currents in Bass Strait. The populations in South Australia (Group C, Figure 4.6) belong to the western clade, and are likely the source of geneflow for founder populations in Victoria and Tasmania. The three subregions indicated by microsatellite data (Groups B, C and D, Figure 4.6) are separate contemporary populations but low levels of geneflow are tnaintained, and isolation-by-distance 110 is strongly supported. A reduction in geneflow between South Australia and Victorian and Tasmanian subregions is potentially due to the large sandy region at the Coorong (see Figure 4.1) which, like Ninety Mile Beach, is devoid of rocky habitat suitable for this species. This is again supported by geneflow estimates, which indicate that between 6-8 migrants (Nm) per generation disperses across this region. Meanwhile, geneflow estimates between populations within these subregions are significantly higher. MIGRATE indicates that the small level of gene flow that does occur across this region occurs in an easterly direction (Figure 4. 7), in keeping with the direction of movement of the Leeuwin Current. 4.4.3 One Species or Two? The data presented here also allows us to make conclusions regarding the taxonomic status of C. polymerus. While it has previously been suggested that C. polymerus is in fact two species, the data does not support that conclusion. The mitochondrial sequence divergence is within the normal range for population variation within other species of barnacles (Chapter 3), and there is an equivalent level of variation both within and between the two mtDNA clades. The single individual of western origin, which was sampled in eastern Victoria, also suggests that complete reciprocal monophyly is not present in this species. Microsatellite analysis also appears to support this, with estimates of migration suggesting low levels of gene flow between these eastern and western lineages. As such, it is suggested that C. polymerus remain as a single species. 111 4.4.4 Management Recommendations As the eastern and western clades indicated by the mtDNA data are highly distinct, and show very low levels of gene flow, it appears that these regions have been evolving independently for a long period of time. Therefore it is suggested that these two regions represent evolutionary significant units (ESUs) for management purposes. This is particularly relevant to Victoria, as both mitochondrial lineages, and therefore both ESUs, are present in the one state. As such, rocky shores in each of these regions require equal investment of resources. While C. polymerus is itself not an endangered species, it is endemic to the cool temperate waters of southern Australia and is an important member of the rocky intertidal community. These results may prove useful as a guide to possible population structuring within other intertidal species with a similar planktonic larval phase, thereby supporting conservation of biodiversity on our shores. ln particular, these results may be applicable to commercially important species such as abalone and crayfish, which also have a planktonic larval phase. Furthermore, these results may also be applicable to the prediction and prevention of spread of invasive pest species with a similar dispersal phase, such as starfish. 4.5 Conclusions From these analyses, it can be concluded that both historical and ecological factors have interacted to shape the extant distribution of C. polymerus. While the distribution of this species may have once been continuous, it appears that the cyclic emergence of the Bassian Landbridge promoted allopatric divergence and resulted in the two highly divergent clades illustrated in the mtDNA data. Analysis of microsatellite data provided the opportunity to examine the species' contemporary structure, and suggested the presence of four subregions. It 112 is apparent that Australia's distinct East Australian, Leeuwin, and Zeehan currents facilitate gene flow while the two large geographic breaks (Ninety Mile Beach and the Coorong) prevent gene flow between these regions. 113 Chapter 5 Mitochondrial Population Structure of Chthamalus antennatus and Chamaesipho tasmanica 114 5.1 Introduction It was established in Chapter 4 that the distribution and population genetic structure of Catomerus polymerus had been affected by the presence of the Bassian Isthmus during glacial maxima, while its present population structure is dependent on both biogeographic breaks in South Australia and Victoria, and the direction of the major ocean currents of southern Australia. Similarly, a clear east-west phytogeographical break has been detected between jellyfish populations (Catostylus mosaicus) (Dawson, 2005) and within the intertidal gastropod genus Nerita (Waters et al., 2005a). 1-fowever, it is apparent that the presence and position of any biogeographic break is dependent on a number of factors, including the presence and duration of a larval life phase (Hunt, 1993; Dawson, 2001 ). In order to gain further understanding of the biogeography of the southern Australian marine environment, and to compare life history and its effects on the population structure of intertidal barnacles, further study was undertaken on other species of barnacle with an overlapping distribution to that of C. polymerus. Chthamalus antennatus Darwin ( 1854) and Chamaesipho tasmanica Foster and Anderson ( 1986) are two of the more highly abundant shore barnacles found in southern Australia, and belong to the family Chthamalidae. Along with Catomerus polymerus, they cotnprise the superfamily Chthan1aloidea. Both C. antenatus and C. tasmanica have approximately the same distribution, being located on rocky shores throughout South Australia, Victoria, New South Wales, Tasmania and southern Queensland. 115 Chthamalus antennatus is a medium-sized barnacle, usually growing up to 1 em in diameter. This species has six principle shell plates, and is somewhat tooth-like in appearance (Figure 5.1 ). C. antennatus tends towards higher levels on the shore, often such that it can only feed during high spring tides. In terms of its reproductive capacity, it has been found that C. antennatus shows little evidence of seasonality, and individuals are found to be brooding continuously throughout the year, with only a slight decline in winter (Egan and Anderson, 1989). On the other hand, C. tasmanica is a fairly small species, and features only four principle shell plates. However, the sutures between the plates are often difficult to distinguish, as individuals of the species usually cluster together at high densities (Figure 5.1 ). This aggregating behaviour has given rise to the common name "honeycomb barnacle" (Anderson, 1994). Previously classified as Chamaesipho columna (Spengler), C .tasmanica was later identified as being separate from its New Zealand sister species C. columna (Foster and Anderson, 1986). This division has since been shown to be correct based on genetic data (Chapter 3). In contrast with C. antennatus, this species has a more seasonal breeding pattern, as demonstrated in NSW, whereby peak productivity occurs during late autumn, winter and early spring (April to November) (Egan and Anderson, 1989). It shows only small levels of brooding in the sumtner months, pritnarily in December. In contrast, breeding in C. polymerus ceases during the sun1mer (Decetnber to February). 116 Figure 5.1 Top photo shows the classic appearance of Chthamalus antennatus, bottom photo shows a cluster of Chan1aesipho tasmanica. 117 118 In New South Wales, the larvae of these two species, along with that of Catomerus polymerus, occur together in the plankton. However, detailed studies of the larvae of all three species (Egan and Anderson, 1989) allow each species to be identified in plankton samples. Furthermore, the larval features of C. antennatus are shared by the nauplii of other species of the genus Chthamalus, while morphological differences clearly separate the three Australasian species of Chamaesipho. That is, there is little morphological variation in Chthamalus larvae, while the larvae of the three Chamaesipho species are morphologically distinct. These two species, C. antennatus and C. ta.~·manica, share their distribution and aspects of their larval development (e.g. duration of larval stages) with C. polymerus. Laboratory studies estimate a nauplier duration of 21 days for C. polymerus, and approximately 38 days for C. antennatus and C. tasmanica (Egan and Anderson, 1989). Therefore, at a superficial level it might be expected that they could show a similar pattern (two distinct lineages) as seen in the former species. However, the latter species do differ slightly from C. polyrnerus in their use of habitat, in that they arc able to settle in areas with lower levels of \Vavc impact. Therefore, it is possible that C. antennatus and C. tasmanica may be able to utilise isolated patches of habitat, which may act as stepping-stones to facilitate dispersal bcl\veen geographically isolated populations. If this were the case, then it would be expected that the data would show no indication of any phylogeographic division. Therefore, the airn of this study was to examine the biogeography of the two species over their distribution to compare the results with that of Catomerus polymerus (Chapter 4), their closest Australian relative, and to establish the potential causes of these differences. 119 5.2 Materials and Methods 5.2.1 Sample Collection and DNA Extraction Samples of Chthamalus antennatus and Chamaesipho tasmanica were collected from sites throughout their distribution, as illustrated in Figure 5 .2. Up to 10 individuals of each species were collected per site, and animals were removed by carefully prising them from rocks with a paint scraper. The collection localities and sample sizes are also summarised in Table 5.1. Genomic DNA extractions were conducted as described in Chapter 2. Cirral tissue was used for C. antennatus while the whole animal was used for C. tasmanica due to its small size. 5.2.2 Mitochondrial Amplification and Sequencing Up to two individuals per site of each species were amplified where possible using mitochondrial genes Cytochrome Oxidase 1 and 16S rRNA using the methods described in Chapter 2. Sequencing and capillary separation was undertaken by Macrogen Inc (Korea), while additional samples underwent capillary separation at AGRF as described in Chapter 5.2.3 Phylogenetic Analysis Sequence files were imported into Sequencher 4. 7 (Gene Codes) and atnbiguous bases checked and corrected if necessary. This was done by aligning forward and reverse 120 Figure 5.2 Sample site map showing collection localities for Chthamalus antennatus and Chamaesipho tasmanica in south-eastern Australia. PS Point Sinclair, CpC Cape Carnot, PB Pennington Bay, PJ Penneshaw Jetty, SBP Portland, AI Aireys Inlet, BR Black Rock, LB Portsea, SB Sorrento, BB Berrys Beach, GP GritTith Point, CC Cape Conr~n, BP Bastion Point, TH Tura Head, CB Cape Banks, HP Hermit Point, CHN Charlotte Head, SH Scott's Head, WH West Head, WP Waterhouse Point, StH St Helens, Fm Falmouth, Bi Bicheno, ClB Coles Bay, PrB Pirates Bay, BBy Blackmans Bay. 121 .:f ·~ ./ ..,...,._,.. ~- -·- ~-~ . '' Table 5.1. Summary of collection localities and number of individuals of Chthamalus antennatus and Chamaesipho tasmanica sequenced for COl and 16S. Number shown is a total number for that site regardless of gene used; an individual sequenced for both genes is only counted once. 123 Collection Locality # Chthamalus antcnnatus # Chamaesipho tasmanica Scotts Head 2 Charlotte Head North 2 2 Hermit Point 2 Cape Banks 2 2 Tura Head Bastion Point 2 Cape Conran 7 3 Griffith Point 4 2 Berry's Beach 4 2 Sorrento 2 2 Portsea 2 2 Black Rock Aireys Inlet 2 Portland 2 Penneshaw Pennington Bay Cape Carnot 2 Point Sinclair 2 2 West Head Waterhouse Point St Helens Point Falmouth 2 Bicheno 2 2 Coles Bay Pirates Bay Blackmans Bay 2 124 sequences. All sequences were then imported into MEGA 3.1 (Kumar et a!., 2004) for alignment. Neighbour-joining trees were constructed in MEGA 3.1 (Kumar et al., 2004). Maximum likelihood (ML) and maximum-parsimony (MP) analyses were conducted using the heuristic search option in PAUP* (Swofford, 2001). Modeltest V3.7 (Posada and Crandall, 1998) was used to select the most appropriate model of molecular evolution used for the ML analyses. The robustness of the branching patterns was assessed using bootstrapping (Felsenstein, 1985), with 1000 replicates for neighbour-joining and MP, and 1 00 replicates for ML analyses. 5.2.4 Isolation and Characterisation of Microsatellites Genomic DNA from four individuals of C. tasmanica was combined and digested with Msel, resulting in 200-1 OOObp fragments. Microsatellite loci were then isolated using the FIASCO protocol (Zane et al., 2002). The resulting poly-GA and poly-CA enriched genomic libraries were cloned into pGEM (T-easy vector system) (Promega) and used to transfonn Escherichia coli competent cells. 57 clones with inserted plasmids were randomly selected from LB plates and incubated at 95°C for 3min in 50J.tl TE buffer [lOOmM Tris-HCI (ph 7.6), lmM EDTA]. Resulting DNA was amplified by polymerase chain reaction (PCR) with Ml3 forward and reverse primers, and sequenced by Macrogen Inc (Korea) using universal primers T7 and SP6. 125 Primer pairs flanking the microsatellite regions were designed using primer3 (Rozen and Skaletsky, 2000), and optimised on a Mastercycler gradient thermocycler (Eppendorf). Twelve microsatellites were successfully optimised, however due to monomorphism and high levels of stuttering (PCR slippage), five markers were employed in sample genotyping. 5.2.5 Genotyping The forward primer of each prirner pair was end-labelled with an M 13 tag to enable incorporation of a fluorophore during PCR (either FAM, PET, VIC or NED). DNA amplification was performed in a 12.5 ~L volume containing approximately 50-1 OOng DNA template, 0.3pmol each of each primer, 0.2mM each dNTP, 2.5mM MgC}z, 5X PCR buffer, and 0.5U GoTaq Flexi Taq DNA polymerase (Promega). Two types of amplification protocols were used; the first consisted of an initial denaturation at 94°C for 3min, 30 cycles of denaturation at 94°C for 30s, annealing for 30s at a locus-specific tetnperature, and extension at 72°C for 30s. The second protocol used was a "touch-down" PCR, whereby the annealing temperature was decreased by 1°C per cycle for the first 10 cycles. All protocols included an additional 8 cycles to incorporate the appropriate dye; denaturation at 94°C for 30sec, annealing at 53°C for 30sec and extension at 72°C for 30sec, followed by a final extension of 72°C for 1 Omin. Details of all primer pairs including annealing temperatures are listed in Table 5.2. PCR products from multiple primer sets for each individual were pooled and analysed on an AB3730 DNA Analyser capillary DNA sequencer by the Australian Genome Research Facility 126 Locus I Primer sequences 5' to 3' Repeat structure Ta [MgCh] No. of Product Ho HE C0C) alleles size range (b ) CTAClO I F:AGTGCATGCAGGTACAGTCC (ATC)3 55 25 11 162-196 0.409 0.539 R:GCGTTGCAGTCTCCAT AAAC TAGA42 I F:TGGTCTCAACAAGTGCCAAC (ATA)/ /(ATA)3 60-50 25 9 300-364 0.079 0.230 R:GTATCCGTGTCCGTTCCTG CTAC16 IF:GCTGGTAGGACAATTTGAGGAC (GA)3//(CT)3 55 25 16 150-220 0.821 0.742 R:TGCITACTTGGCCA TGAGTG CATC13 I F:AGTCAAGATGGGTGGCAAAC (CA)5 60-50 25 5 177-185 0.063 0.058 ~CGTCTTTGATCAGACCCAAC CTAC23 IF:ATTTACATCGCGTGGGATTG (CA)3 60-50 25 3 236-244 0.985 0.517 R:GGGCTTCTTGTTCAGTGTCG Locus I Primer sequences 5' to 3' Repeat structure Ta [MgCb] No. of Product Ho HE C0C) alleles SlZe range (bE) CTAC10 I F:AGTGCATGCAGGTACAGTCC (ATC)3 55 25 11 162-196 0.409 0.539 R:GCGTTGCAGTCTCCAT AAAC TAGA42 I F:TGGTCTCAACAAGTGCCAAC (ATA)//(ATA)3 60-50 25 9 300-364 0.079 0.230 R:GTATCCGTGTCCGTTCCTG CTAC16 I F:GCTGGTAGGACAATITGAGGAC (GA)3//(CT)3 55 25 16 150-220 0.821 0.742 R:TGCTTACTTGGCCATGAGTG CATC13 IF:AGTCAAGATGGGTGGCAAAC (CA)5 60-50 25 5 177-185 0.063 0.058 ~CGTCTTTGATCAGACCCAAC CTAC23 I F:ATTTACATCGCGTGGGATTG (CA)3 60-50 25 3 236-244 0.985 0.517 ~GGGCTTCTTGTTCAGTGTCG (AGRF). The output was loaded into GeneMapper v4.0 (Applied Biosystems) to enable scoring of genotypes. 5.2.6 Microsatellite Analysis GENALEX version 6 (Peakall and Smouse, 2006) was used to calculate the average number of alleles per locus. Observed and expected heterozygosities were estimated in GENALEX and deviations from Hardy-Weinberg equilibrium were determined by exact tests and permutation in GENEPOP 3.1 b (Raymond and Rousset, 1995). All pairs of loci were tested for linkage disequilibrium under the assumption of Hardy-Weinberg equilibrium in GENEPOP with exact tests and significance determined through permutation. In order to investigate possible population structure and geographic differentiation, population pairwise measures of FsT were calculated using Arlequin version 3.11 (Excoffier et al.!l 2005). To test for isolation-by-distance, a Mantel test (Mantel, 1967) (1 0,000 permutations) was conducted using Arlequin. A linearised FsT (FsT/1-FsT) matrix was compared with a geographical distance matrix (in km) in order to test for a relationship between genetic and geographic distance. Geographical distances were calculated from latitude and longitude values. A principle components analysis (PCA) was also implemented in GENALEX in order to summarise the patterns of genetic differentiation between the sampled populations. This was achieved by plotting the first two underlying factors that· explain the majority of variation in multilocus genotypes. Genetic population structure was investigated using an 129 analysis of molecular variance (AMOVA) (Excoffier et al., 1992), and partitioning the variation among regions and within populations. The AMOV A was performed in Arlequin with pairwise FsT as the distance measure. 5.3 Results 5.3.1 Clttltamalus antennatus 48 CO 1 and 32 16S sequences from Chthamalus antennatus were obtained, and Modeltest V 3.7 for ML trees selected the GTR+G model and HKY+G model for C. antennatus COl and 16S respectively. Cytochrome oxidase I sequences of 658bp were gathered from 48 individuals. The fragment used showed no insertions or deletions across taxa, and contained 176 variable sites, of which 138 are parsimony informative. No stop codons were found to be present and the COl and 16S trees were congruent, which indicates that it is unlikely that these DNA sequences are nuclear pseudo genes. 16S sequences were 316bp in length, of which 68 are variable and 51 are parsimony informative. The fragment contained 8 INDELS within the ingroup taxa. The sequence data for C. antennatus shows sequence divergences between individuals of 0% to 3.8% (average 1.5%) for COl, and an average of 20% sequence divergence to the outgroup taxa (C. tasmanica). For 16S, the sequence divergence between individuals of the 130 species ranges from 0% to 1.2% (average 0.4o/o), and an average of 10.0% sequence divergence to the outgroup taxa used (C. tasmanica). The phylogenetic trees for C. antennatus (Figure 5.3, Figure 5.4) indicate that there is no significant biogeographic pattern present. Some individuals appear to associate more closely than others, however bootstrap support for these clades are low, and there is no geographic significance to these associations. 5.3.2 Chamaesipho tasmanica 20 COl and 25 16S sequences from Chamaesipho tasmanica were obtained, and Modeltest V 3. 7 selected the TVM+G and TVM models for C. tasmanica CO I and 16S respectively. This species was difficult to both amplify and sequence, and as such Cytochrome oxidase I sequences of 658bp were gathered from 20 individuals. The fragrnent used showed no insertions or deletions across taxa, and contained 157 variable sites, of which 120 were parsimony infonnative. No stop codons were found to be present and again the COl and 16S trees are congruent. 16S sequences were 315bp in length, and contained 60 variable sites, of which 48 were parsimony informative. There were no INDELS within the ingroup taxa. 131 Figure 5.3 Neighbour-joining trees for a 658bp frag1nent of Cytochrome Oxidase I for samples of Chthamalus antennatus across the species' distribution. Values displayed on nodes are bootstrap values for MP/NJ/ML 132 90/93190 86/92/83 100/100/100 CC5 C. tasman/ca 0.02 133 Figure 5.4 Neighbour-joining trees for a 316bp fragment of 16S for samples of Chthamalus antennatus across the species' distribution. Values displayed on nodes are bootstrap values for MP!NJ/ML 134 53/56/- Fm2 CHN1 SB2 100/100/100 Fm1 LB1 HP1 BB14 LB3 a-----BP4 PS1 BB13 SB1 BBy2 SBP1 Bi1 CpC2 CIB1 C. tasmanlca C. tasmanlca 0.02 135 The sequence data for C. tasmanica shows sequence divergences between individuals of 0.2% to 2.7% (average 1.1 %) for CO 1, and an average of 24.3% sequence divergence to the outgroup taxa (C. antennatus). For 16S, the sequence divergence between individuals of the species ranges from 0% to 1.6% (average 0.5%), and an average of 19.5%> sequence divergence to the outgroup taxa used (C. antennatus). As with C. antennatus, phylogenetic trees for C. tasmanica (Figure 5.5, Figure 5.6) do not indicate a significant biogeographic relationship. The most notable feature of the data is the small clade in the 16S tree which contains several individuals from central Victoria, but with low bootstrap support. A further individual from this region (LB5) is separated from the remaining individuals of this species with fairly high bootstrap support (90-96). The bootstrapping of the COl tree indicates a number of small clades, however the support is low and there appears to be no geographic significance. A total of five microsatellite loci were analysed in 19 populations (182 individuals). The number of alleles at a locus ranged from 3 to 16, with a total of 44 detected over all loci. Average observed and expected heterozygosities were varied across all populations (Ho, 0.00- 1.00; l-IE, 0.00-0.858) (Appendix 3.5) The GENEPOP program revealed that four of the five loci showed minor deviations from HWE. This was due to a combination of heterozygote deficiency and excess at these loci. CATC 10 and T AGA42 demonstrated heterozygote deficiency in four populations, white CA TC 13 demonstrated heterozygote excess in 12 populations. CATC 16 demonstrated neither excess nor 136 Figure 5.5 Neighbour-joining trees for a 658bp fragment of Cytochrome Oxidase I for samples of Chamaesipho tasmanica across the species' distribution. Values displayed on nodes are bootstrap values for MP/NJ/ML 137 65/68/54 TH5 .,..._. __ HP3 CHN3 CC9 BR3 BB12 CPC3 CB6 99/100/100 rr---CC10 BBy4 Bi4 SB3 ------_f ____ c.anrenna~ . antennat.us 0.02 138 Figure 5.6 Neighbour-joining trees for a 315bp fragment of 16S for samples of Chamaesipho tasmanica across the species' distribution. Values displayed on nodes are bootstrap values for MP/NJ/ML 139 r-GP6 Fm4 BBy4 Bi4 CHN4 CHN3 SBP2 HP3 Bi3 PS3 PJ1 BP6 - GP5 -TH5 CpC3 . r- BB11 SB3 901-196 LB5 CIB3 LB6 100/100/100 - PS4 StH4 BBy3 SB4 WP3 C. antennatus J C. antennatus 0.01 140 deficiency of heterozygotes. Linkage disequilibrium was not indicated between any pairs of loci. There was no significant correlation between genetic distance and geographic distance, with a Mantel test showing no correlation (r = 0.0015, P = 0.340). The relationships between individuals from the different populations is clearly shown by the two-dimensional principle components analysis of the microsatellite variation and the UPGMA distance phylogram (Figure 5. 7). When the two factors that explain the majority of the variation are plotted against each other, the populations are scattered randomly, with no geographic association. The UPGMA distance phylogratn confirms the lack of geographic structure, as all three clades on the tree are comprised of populations scattered across the species' distribution. Pairwise FsT and Nm values between each of these four clusters are summarised in Table 5.2. The average FsT values suggest little structure between the clusters, while the Nm values show reasonable levels of migration. The AMOVA analysis indicated significant variation among the 19 populations, with 3.57°/o of the variation in microsatellites explained by differences between the populations (Table 5 .3). However, the majority of the variation is explained by the within population component (96.43%). The pairwise FsT estimates indicated significant differentiation between some pairs of populations throughout the distribution of C. tasmanica (Table 5.4); however, as with the PCA and UPGMA analysis, there appears to be no significant geographic pattern to these results. 141 Figure 5.7 Two-dimensional plot (top) showing the relationship among populations of Chamaesipho tasmanica based on a principle components analysis of 5 microsatellite genotypes for 19 populations collected from the southern Australian coastal region and (bottom) a UPGMA distance phylogram confirming the results of the PCA. 142 GP •sf;• •ps •cpc •TH M M • stH ('I •sH v 1ii PJ .. LB 1: .... cc ~ 0 •cHN ·w u0 • •BI •WP •cs • BP •WH •HP Coordinate 1 44.26% 8 errys B eac h Blcheno Cape Banks Cape Conran Charlotte Head Penneshaw 1 Portland - Waterhouse Point West Head - Scotts Head -Portsea Bastion Point I St Helens Hennlt Po lnt 1 I 2 ITura Head _IBia ck Rock IGrlfflth Point 3 lea pe Carnot I Point Sinclair ------0.01 143 Table 5.2 Range and average pairwise FsT values between each of the three clusters indicated by the UPGMA distance tree (Figure 5.7). Average gene flow estimates (Nm) between each of these clusters is also indicated. All average FsT values were low but significant. 144 Subregions Compared Range of Pairwise FsT Average FsT AverageNm 1 and 2 -0.0056- 0.1465 0.037 6.517 1 and 3 0.0003 - 0.1948 0.022 10.864 2 and 3 -0.0480-0.1915 0.033 7.378 145 Table 5.3 AMOV A comparing genetic variation in microsatellite data among four subregions, among populations within subregions and within populations of Chamaesipho tasmanica 146 Source of d.f. Sum of squares Variance Fixation indices P value Percentage of variation com2onents variation Among 19 31.345 0.0380 < 0.001 3.57 populations within regions Within 348 354.224 1.0267 < 0.001 96.43 populations Total 367 385.569 1.0647 0.03569 Table 5.4 Genetic differentiation for the microsatellite data as measured by Wright's FsT are shown below the diagonal. Significant differences in pairwise FsTs are indicated in bold. Geographical distances in kilometres are shown above the diagonal. 148 BB Bi BP BR CB CC CHN CpC GP HP LB PJ PS SBP SH StH m WH WP BB 456.4 413.1 66.3 738.4 319::!. 955 9 9373 15.1 751.2 49.0 714.8 1317.7 328.2 1119.6 407.7 456.0 3116 332.0 Bi -0.036 493.8 512.9 912.1 453.8 1124 3 1341.8 446.1 927.9 499.2 1127.5 1737.6 701.7 1306.1 65.7 574.8 159.5 1279 .BP 0.010 0.020 468.6 4190 93.9 634 9 1295.4 399 I 434.8 452.4 1074.0 1645.9 734.9 815.3 429.7 81.1 468.5 404.0 .BR -0.043 -0.062 0.039 770.5 375.1 984 8 871 0 811 782.5 17.6 648.5 1251.9 267.1 1143.6 467.4 505.3 362.4 391.2 CB -0.047 -0.021 0.029 -0.059 4792 2:!11 1428 7 718.8 160 759.4 1227.5 1713.1 1004.0 397 7 848.5 338.9 880.9 821.6 cc -0.038 -0.048 0.029 -0.060 -0.017 699.4 1210.9 305.2 494.3 358.7 988.6 1567.8 641.7 876.7 388.0 149.6 402.2 348.3 CHN -0.016 -0.013 0.102 -0003 -0009 -0040 1585.5 946.9 2068 974.5 \395.8 1838.4 1208.4 182.3 1061.9 556.2 1100.3 1038.8 CpC -0.048 -0.026 0.018 -0.037 -0009 ..() 018 -0018 952.0 1433.4 88&.4 223.3 402.4 640.2 1680.4 1312.4 1301.0 1182.5 1138.1 GP -0.021 -0.043 0.013 -0.038 -0.039 -0062 -0 0"'..2 -0073 741.7 63.7 729.4 1331.9 343.2 1!11.6 396.4 443.2 303.6 310.9 HP -0.014 -0.016 0.029 -0.075 0.001 -0002 -0011 -0027 -0041 171.6 1233.3 17149 1014.3 382.4 864.3 3546 896.2 837.1 LB -0.005 0.010 0.005 0.026 0.038 -0002 0.031 0.017 -0.018 0.070 665.!1 1268.8 283.9 li34.S 452.7 490.3 350.2 376.6 PJ -0.040 0.006 0.045 -0.004 -0.029 -0.019 0.029 -0.019 0.016 -0.012 0.055 610.2 427.4 1503.4 1095.3 1082.2 9680 1020.3 PS -0.044 -0.011 0.095 -0.037 -0.051 -0025 -0014 -0.034 -0.014 -0.041 0.062 -0.007 1036 8 1902.6 1705.1 1639.9 1578.2 1629.9 S.BP 0.030 0.003 0.003 0.015 0.000 -0.003 0.068 0.052 0.015 0.006 0055 -0.006 0.039 1353.8 673.0 767.1 542.4 599.6 SH 0.063 0.059 0.121 0.040 0.046 0.055 0.079 0.063 0.066 0.015 0.147 0.059 0.052 0.053 1243.3 735.9 1278.6 1218.8 StH 0.045 0.664 0.()60 0.054 0.065 0.068 0.09Q 0.067 0.051 0.065 0.079 0.080 0.076 0.078 0.010 510.6 138.4 76.3 m 0.045 0.050 0.059 0.022 0.059 0.066 0.077 0.054 0.030 0.039 0.095 0.070 0.057 0.072 -0.017 -0.014 544.6 482.9 WH 0.067 0.056 0.177 0.1)66 0.037 0.043 0.062 0.033 0.061 0000 0.141 0.100 0.050 0.145 -0.036 0.011 -0.027 84.2 WP 0.107 0.100 0.195 0.0&6 0.086 0.083 0.101 0.078 0.100 0.036 0.191 0.119 0.085 0.167 -0017 0.0-45 0.007 -0048 5.4 Discussion Chthamalus antennatus and Chamaesipho tasmanica share both their distribution across Australia, and their approximate location in the rocky intertidal marine habitat. In addition, they also have similar larval life histories. Therefore it is no surprise that the results of the sequence analysis for both species are very similar. The mitochondrial data suggests that both species have a relatively high dispersal ability as there is no indication of population subdivision over a large geographic scale (approx. 2700km). Additionally, the microsatellite data for C. tasmanica supports the mtDNA data; both the PCA and UPGMA suggest that there is no significant contemporary population structure across the distribution of this species, and the pairwise FsT values do not suggest any significant genetics structure between the populations. Therefore the data suggest that, historically, both species have had a continuous distribution over time, or have been able to recover rapidly following any geographical split. This is particularly interesting as similar sequence analysis of another species, Catomerus polymerus, indicates a significant phytogeographical split which appears to correspond with the repeated emergence of the Bassian Isth1nus until approximately 12,000 years ago (Chapter 4). The reason for the difference between the species is not clear, but there are a number of possibilities. All three species were likely affected by the presence of the land bridge joining Victoria and Tasmania. The modern-day shore line across central Victoria was not present, and colder temperatures around southern Tasmania would probably have made that region 150 uninhabitable. Therefore it is possible that C. antennatus and C. tasmanica were subject to allopatric division, as was probably the case for C. polymerus. One possible explanation for the lack of divergence in C. antennatus and C. tasmanica (as compared with C. polymerus) relate to the larval life phase of the barnacle, and include differences in the lifespan and "durability" of the larvae, as well as the species' preferences for particular substrates or environmental conditions. In terms of the Iifespan of the larvae of the different species, it is possible that larvae which are in the plankton for longer periods of time may potentially travel further from their origin, compared with species with a shorter planktonic stage. However, there is no accurate estimate of the actual time each species is present in the plankton. Estimates from laboratory-based studies suggest a period of several weeks for chthamaloid barnacles, but it is presumed that laboratory conditions cannot accurately replicate those in the natural environment, and therefore may not represent the actual larval lifespan. In particular, the type of food fed to larvae is found to influence the duration and completion of naupliar development (Egan and Anderson, 1989). If C. antennatus and C. tasmanica were to have a longer-lived planktonic phase compared with that of C. polymerus, as suggested by the study of Egan and Anderson ( 1989), migration could potentially occur over longer distances, resulting in the lack of phylogenetic division. Similar to a potentially longer-lived planktonic phase, the "durability" of the larvae may also be responsible for the difference in the results between the species. If the two species 151 studied here have larvae which are more tolerant to particular environmental conditions, such as ocean temperatures, it is possible that their dispersal capability is increased, with a similar result to that of increased larval lifespan. Another possible explanation is the differences in preference for certain substrates and environmental conditions. For C. polymerus, regions with little-to-no rocky substrate, such as Ninety Mile Beach, act as significant barriers to dispersal. Not only is their substrate of choice absent, but these regions also lack the high-impact wave action that this species prefers. As a result, C. polymerus exhibits a relatively restricted, island-like distribution. However, this is not the case for C. antenna/us or C. tasmanica. Both species are suited to regions with less active surf conditions, and may be found on smaller rocky outcrops or even on substrates such as piers and jetties. This allows them a more continuous distribution, over which gene flow may occur in a stepping-stone manner over subsequent generations, reducing the chance of any strong genetic differentiation. During the glacial periods of the Pliocene, sea levels in southern Australia were significantly lower, up to 11Om below the current level (Wells and Okada, 1996). As a rcsul t, the region of land between Victoria and Tasmania was exposed, and the coast-line of the region was changed. Because of this, and the cooler ocean temperatures around southern Tasmania (Wells and Okada, 1996), it is likely that the distribution of C. antennatus and C. tasmanica was disrupted. Given the length of disruption, and the repeated emergence of the Bassian Isthmus, it was expected that these species would have shown divergence in their tnitochondrial data. As this is not the case, it can be hypothesised 152 that the species were either able to tolerate cooler conditions around Tasmania, thereby maintaining a continuous distribution (that C. polymerus did not), or these two species have one or more physiological characteristics (discussed above) which have enabled them to quickly resume migration across their entire distribution during the interglacial periods and thereby negate the effect of any earlier division. 5.5 Conclusion From the analyses undertaken here, it can be concluded that the presence of the Bassian landbridge has not has a lasting effect on the population structure of either Chthamalus antennatus or Chamaesipho tasmanica. Neither species shows any significant divergence in the mitochondrial genes Cytochrome Oxidase I (COI) or 16S rRNA, which is in direct contrast to the strong east-west phytogeographical split seen in Catomerus polymerus. Analysis of microsatellite data for C. tasmanica supports continued gene flow between populations of the species, maintaining a single pamnictic population. The exact cause of this lack of divergence is not clear, but given nature of the larvae of these species, it is highly probable that one or more factors relating to the persistence of the larval stage are responsible for the results of the analysis, or that the cooler temperatures of the glacial periods did not prevent these species colonising southern Tasmania, resulting in an uninterrupted distribution. Additionally, the ability to utilise isolated patches of habitat has enabled both species to disperse across the two geographic breaks, allowing contetnporary gene flow to 1naintain historical signatures in the data. 153 Chapter 6 Summation and Further Work 154 6.1 Summary of Experimental Chapters In Chapter 3 of this thesis, the taxonomy of a number of southern Australian intertidal barnacle species was examined. Although their taxonomy had been established morphologically, the many phylogenetic studies that have been undertaken on barnacles failed to include the Australian species. In this chapter, their phylogenetic relationships were examined both within Australia, and globally, using sequence data from the mitochondrial genes Cytochrome Oxidase I (COl) and 16S rRNA. These data confirmed the existing taxonomy to a high degree, with the exception of the Elminius genus. Analysis of samples from Australia, New Zealand and the United Kingdom indicated that E. modestus consists of three species, and that division of South Australian specimens based on slight morphological variation had no genetic basis. The data also suggests that divergence between Elminius kingii and the remaining Elminius species is great enough to warrant the elevation of the subgenus Austrominius to genus, resulting in the species A. modestus, A. adelaidae, and A. covertus. Chapter 4 focused on one species of Australian barnacle, the so-called surf barnacle Catomerus polymerus. Due to the external morphology of this species, a non-destructive sam piing technique could be implemented, whereby a few of the imbricating plates of the shell were pried away, and DNA could be obtained from the lining membrane. Animals subjected to this technique survived for at least eight months. mtDNA (COl, control region/D-loop) was used to examine the historical population structure of this species over its entire distribution, and indicated a deep phylogeographical split consistent with allopatric divergence caused by the presence of the Bassian Landbridge. Microsatellite 155 markers were also developed in the species, in order to examine the contemporary population structure of the species. Data analysis indicated four subregions; division between these subregions was consistent with the presence of two significant biogeographic breaks, and the direction of the major ocean currents in the region. Lastly, mtDNA was used to examine the biogeography of two species, Chthamalus antennatus and Chamaesipho tasmanica, in Chapter 5. COl and 16S were used, and in contrast to C. polymerus, no apparent phylogeographic structure was indicated. A number of possibly scenarios may result in this lack of divergence, including a longer lived planktonic larval phase which would be capable of dispersal over greater distances. However, the most likely cause is a tolerance of the colder temperatures present during the glacial periods which allowed these species to colonise southern Tasmania, such that they were unaffected by the presence of the Bass ian Land bridge. If gene flow was not disrupted through this region, then there would be no phylogeographic split like that seen in C. polymerus. Furthermore, the use of isolated patches of habitat throughout both biogeographic breaks (90 Mile Beach, the Coorong) would facilitate gene flow between geographically isolated populations, thereby maintaining a single panmictic population for each species. 6.2 Future Research Further questions are raised by the work undertaken in this thesis, and potentially warrant further study. Further investigation of Elminius is required to determine the presence of 156 further cryptic species. Further study using nuclear genes or microsatellite markers may highlight the degree of separation between these species, and the potential causes. There is also the issue of self-fertilisation in Catomerus polymerus. It has been reported in the literature (Barnes and Crisp, 1956; Landau, 1976), and was noted in apparently isolated individuals during this study, but has not yet been genetically proved. This would require the collection of isolated, gravid individuals of the species towards the end of the breeding season. Embryos from these individuals can be isolated, and both the parent and embryos genotypes using the microsatellite markers developed in Chapter 4. Using this method, the occurrence of self-fertilisation could be validated. 157 Bibliography Andersen, L. W., Born, E. W., Gjertz, 1., Wiig, 0., Holm, L.-E. & Bendixen, C. (1998) Population structure and gene flow of the Atlantic walrus ( Odobenus rosmarus rosmarus) in the eastern Atlantic Arctic based on mitochondrial DNA and microsatellite variation. Molecular Ecology, 7, 1323-1336. Anderson, D. T. (1983) Catomerus polymerus and the evolution of the Balanomorph form in barnacles (Cirripedia). Memoirs ofthe Australian Museum, 18, 7-20. Anderson, D. T. (1994) Barnacles: Structure, Function, Development and Evolution., London, Chapman and Hall. Astrin, J. 1., Huber, B. A., Misof, B. & Klutsch, C. F. C. (2006) Molecular taxonomy in pholcid spiders (Pholcidae, Araneae ): evaluation of species identification methods using COl and 16S rRNA. Zoologica Scripta, 35, 441-457. A vise, J. C. (1986) Mitochondrial DNA and the Evolutionary Genetics of Higher Animals. Philosophical Transactions of the Royal Society of London Series B-biological Sciences, 3 12, 325-342. Awadalla, P., Eyre-Walker, A. & Maynard Smith, J. ( 1999) Linkage disequilibrium and recombination in hominid mitochondrial DNA. Science, 286, 2524-2525. Baines, P. G., Edwards, R. J. & Fandry, C. B. (1983) Observations of a new baroclinic current along the western continental slope of Bass Strait. Australian Journal of Marine and Freshwater Research, 34, 155-157. Baldwin, 1. D., Bass, A. L., Bowen, B. W. & Clark Jr., W. H. (1998) Molecular phylogeny and biogeography of the marine shrimp Penaeus. Molecular Phylogenetic.~' and Evolution, 10, 399-407. Ball, I. R. ( 1975) Nature and formulation of biogeographical hypotheses. Systematic Zoology, 24, 407-430. Ballard, J. W. 0. & Whitlock, M. C. (2004) The incomplete natural history of mitochondria. Molecular Ecology, 13, 729-744. Balloux, F. & Lugon-Moulin, N. (2002) The estimation of population differentiation with tnicrosatellite tnarkers. Molecular EcologyJ 11, 155-165. Barnes, H. & Barnes, M. (1956) The formation of the egg-mass inBalanus balanoides (L.). Archivum Societatis Zoologicae Botanicae Fennicae 'Vanamo', 11, 11-16. Barnes, H., Barnes, M. & Klepal, W. (1977) Studies on the reproduction of cirripedes. I. Introduction: copulation, release of oocytes and formation of the egg lamellae. Journal of Experimental Marine Biology and Ecology, 27, 195-218. 158 Barnes, H. & Crisp, D. 1. (I 956) Evidence of self-fertilisation in certain species of barnacles. Journal of the marine biological Association of the United Kingdom, 35, 631-639. Barnes, R. D. (1980) Invertebrate Zoology, Philadelphia, Saunders. Bayliss, D. E. (1988) A new intertidal barnacle of the genus Elminius (Cirripedia: Thoracica) from South Australia. Transactions of the Royal Society of South Australia, 112, 75-79. Bayliss, D. E. (1994) Description of three new barnacles of the genus Elminius (Cirripedia: Thoracica) fro1n South Australia, with a key to species of the Eliminiinae. Transactions ofthe Royal Society ofSouth Australia, 118, 115-124. Beerli, P. (2002) MIGRATE: documentation and program, part ofLAMARC. Version 2.0 Bennett, I. & Pope, E. C. (1953) Intertidal zonation of the exposed rocky shores of Victoria, together with a rearrangement of the biogeographical provinces of temperate Australian shores. Australian Journal of Marine and Freshwater Research, 4, 105- 159. Bennett, I. & Pope, E. C. (1960) Intertidal zonation of the exposed rocky shores of Tasmania and its relationship with the rest of Australia. Australian Journal of Marine and Freshwater Research, 11, 182-221. Bennett, P. (2000) Demystified ... :Microsatellites. Journal of Clinical Pathology! 53, 177- 183. Benzie, J. A. H. (1999) Major genetic difference between crown-of-thorn starfish (Acanthaster planci) populations in the Indian and Pacific oceans. Evolution, 53, 1782-1795. Birky Jr., C. W., Maruyama, T. & Fuerst, P. (1983) An approach to population and evolutionary genetic theory for genes in mitochondria and chloroplasts, and some results. Genetic..,·, 103, 513-527. Bishop, M. W. H. (1947) Establishment of an immigrant barnacle in British coastal waters. Nature, !59, 501. Booth, J. D. & Ovenden, J. R. (2000) Distribution of Jassus spp. (Decapoda: Palinuridae) phyllosomas in southern waters: implications for larval recruitment. Marine Ecology Progress Series, 200,241-255. Brooker, A. L., Benzie, J. A. H., Blair, D. & Versini, J. J. (2000) Population structure of the giant tiger prawn Penaeus monodon in Australian waters, determined using microsatellite markers. Marine Biology, 136, 149-157. 159 Brown, W. M., George Jr, M. & Wilson, A. C. (1979) Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences USA, 76, 1967-1971. Bruce, B. D., Condie, S. A. & Sutton, C. A. (200 I) Larval distribution of blue grenadier (Macruronus novaezelandiae Hector) in south-eastern Australia: Further evidence for a second spawning area. Marine and Freshwater Research, 52, 603-610. Bruford, M. W. & Wayne, R. K. ( 1993) Microsatellites and their application to population genetic studies. Current Opinion in Genetics Development, 3, 939-943. Buckeridge, J. S. ( 1982) The barnacle subfamily Elminiinae- two new subgenera and a new Miocene species from Victoria. Journal of the Royal Society of New Zealand, 12, 353-357. Buckeridge, J. S. (1995) Phylogeny and biogeography of the primitive Sessilia and a consideration of a Tethyan origin for the group. IN Schram, F. R. & H0eg, J. T. (Eds.) New Frontiers in Barnacle Evolution. Rotterdam, A.A. Balketna. Burridge, C. P. (2000a) Biogeographic history of ge1ninate cirrhitoids (Perciformes: Cirrhitoidea) with east-west allopatric distributions across southern Australia, based on molecular data. Global Ecology and Biogeography Letters, 9, 517-525. Burridge, C. P. (2000b) Molecular genetics of Cirrhitoid fishes (Perciformes: Cirrhitoidea): phylogeny, taxonomy, biogeography and stock structure. University of Tasmania, Australia. Burridge, C. P., Hurt, A. C., Farrington, L. W., Cotitin, P. C. & Austin, C. M. (2004) Stepping stone gene f1ow in an estuarine-dwelling sparid from south-east Australia. Journal ofFish Biology, 64, 805-819. Canceill, D., Viguera, E. & Ehrlich, S. D. (1999) Replication slippage of different DNA polymerases is inversely related to their strand displacement efficiency. Journal of Biological Chemistry, 274, 27481-27490. Chenoweth, S. F., Hughes, J. M., Keenan, C. P. & Lavery, S. (1998) When oceans meet: a teleost shows secondary intergradation at an Indian-Pacific interface. Proceedings of the Royal Society of London B, 265, 415-420. Chis well, S. M., Wilkin, J ., Booth, J. D. & Stanton, B. (2003) Trans-Tasman sea-larval transport: is Australia a source for New Zealand rock lobsters? Marine Ecology Progress Series, 24 7, 173-182. Cresswell, G. R. (2000) Currents of teh continental shelf and upper slope of Tas1nania. Papers and Proceedings of the Royal Society ofTasmania 133, 21-30. Crisci, J. V. (2001) The voice of historical biogeography. Journal of Biogeography, 28, 157-168. 160 Crisci, J. V., Sala, 0. E., Katinas, L. & Posadas, P. (2006) Bridging historical and ecological approaches in biogeography. Australian Systematic Botany, 19, 1-10. Crisp, D. J. (1958) The spread of Elminius modestus Darwin in north-west Europe. Journal of the Marine Biological Association of the United Kingdom, 37, 483-520. Crisp, D. J. (1974) Factors influencing the settlement of marine invertebrate larvae. IN Grant, P. T. & Mackie, A. M. (Eds.) Chemoreception in Marine Organisms. New York, Academic Press. Curole, J. P. & Kocher, T. D. (1999) Mitogenomes: digging deeper with complete mitochondrial genomes. TRENDS in Ecology and Evolution, 14, 394-398. Dartnall, A. J. (1974) Littoral biogeography. IN Williams, W. D. (Ed.) Biogeography and ecology in Tasmania. Dr W. Junk, The Hague. Darwin, C. R. (1854) A Monograph on the sub-class Cirripedia, with figures of all the species. The Balanidae; the Verrucidae, etc., London, Ray Society. Dawson, M. N. (2001) Phytogeography in coastal marine animals: a solution from California? Journal ofBiogeography, 28, 723-736. Dawson, M. N. (2005) Incipient speciation of Catostylus mosaicus (Scyphozoa, Rhizostomeae, Catostylidae), comparative phylogeography and biogeography in south-east Australia. Journal ofBiogeography, 32, 515-533. Doyle, P., Mather, A. E., Bennett, M. R. & Bussel, M. A. (1996) Miocene barnacle assemblages from southern Spain and their palaeoenvironmental significance. Lethaia, 29, 267-274. Dufresne, F., Bourget, E. & Bernatchez, L. (2002) Differential patterns of spatial divergence in microsatellite and allozyme alleles: further evidence for locus-specific selection in the acorn barnacle, Semibalanus balanoides? Molecular Ecology, 11, 113-123. Duran, S., Pascual, M., Estoup, A. & Turon, X. (2004) Strong population structure in the marine sponge Crambc crambe (Poecilosclerida) as revealed by microsatellite markers. Molecular Ecology, 13, 511-522. Edgar, G. J. (1986) Biogeographical processes in the southern hemisphere tnarine environment. IN Westermeier, R. (Ed.) Aetas del segundo congreso sobre algas marinas Chilenas. Universidad Austral de Chile, Valdivia. Egan, E. A. & Anderson, D. T. (1989) Larval development of the chthamaloid barnacles Catomerus polymerus Darwin, Chamaesipho tasmanica Foster & Anderson and Chthamalus antennatus Darwin (Crustacea: Cirripedia). Zoological Journal of the Linnean Society} 95, 1-28. 161 Ellegren, H. (2004) Microsatellites: Simple sequences with complex evolution. Nature Reviews Genetics, 5, 435-445. Estoup, A., Jarne, P. & Cornuet, J.-M. (2002) Homoplasy and mutation model at microsatellite loci and their consequences for population genetic analysis. Molecular Ecology, 11, 1591-1604. Excoffier, L., Laval, G. & Schneider, S. (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47-50. Excoffier, L., Smouse, P. E. & Quattro, J. M. (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics, 131, 479-491. Eyre-Walker, A., Smith, N. H. & Maynard Smith, J. (1999) How clonal are human mitochondria? Proceedings of the Royal Society of London B, 266, 477-483. Felsenstein, J. (1985) Confidence limits on phylogenies, an approach using the bootstrap. Evolution, 39, 783-791. Felsenstein, J. (1996) PHYLIP (Phylogeny Inference Package). Washington, University of Washington. Firestone, K. B. (2000) Phylogenetic Relationships Among Quolls Revisited: The mtDNA Control Region as a Useful Tool. Journal ofMammalian Evolution, 7, 1-22. Fisher, T., Katcoff, D. J. & Achituv, Y. (2004) A phylogenetic study of chthamaloids (Cirripedia; Thorcica; Chthamaloidae) based on 16S rDNA and COl sequence analysis. Biological Journal of the Linnean Society, 83, 39-45. Fle1ning, A. K. (1986) Aspects of the growth and reproduction of three species of intertidal barnacles in Tasmania. Univeristy of Tasmania, Hobart. Flowers, J. M. & Foltz, D. W. (2001) Reconciling molecular systematics and traditional taxonomy in a species-rich clade of sea stars (Leptasterias subgenus Hexasterias). Marine Biology, 139, 4 75-483. Folmer, 0., Black, M., Hoeh, R., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294-299. Foltz, D. W., Stickle, W. B., Campagnaro, E. L. & Hiinel, A. E. (1996) Mitochondrial DNA polymorphistns reveal additional genetic heterogeneity within the Leptasterias hexactis (Echinodermata: Asteroidea) species complex. Marine Biology, 125, 569-578. 162 Foster, B. A. (1982) Two new intertidal balanoid barnacles from eastern Austrlalia. Proceedings ofthe Linnean Society ofNew South Wales, 106,21-32. Foster, B. A. (1987) Barnacle ecology and adaptation. IN Southward, A. J. (Ed.) Barnacle Biology. Balkema, Rotterdam. Foster, B. A. & Anderson, D. T. (1986) New names for two well known shore barnacles (Cirripedia, Thoracica) from Australia and New Zealand. Journal of the Royal Society ofNew Zealand, 16, 57-69. Foster, B. A. & Nott, J. A. ( 1969) Sensory structures in the opercula of the barnacle Elminius modestus. Marine Biology, Berlin, 4, 340-344. Fu, Y.-X. (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 14 7, 915-925. Fu, Y.-X. & Li, C. P. W.-H. ( 1993) Statistical tests of neutrality of mutations. Genetics, 133. Gemme!, N. J. & Akiyama, S. ( 1996) An efficient method for the extraction of DNA from vertebrate tissues. Trends in Genetics, 12, 338-339. Glenner, H., Grygier, M. J., H0eg, J. T., Jensen, P. G. & Schram, F. R. (1995) Cladistic analysis of the Cirripedia: Thoracia (Crustacea: The costraca). Zoological Journal ofthe Linne an Society, 114, 365-404. Griffiths, R. C. & Tavare, S. (1994) Ancestral inference in population genetics. Statistical Science, 9, 307-319. Hagelberg, E., Goldman, M., LI6, P., Whelan, S., Schiefenhovel, W., Clegg, J. B. & Bowden, D. K. ( 1999) Evidence for mitochondrial DNA recombination in a human population of island Melanesia. Proceedings of the Royal Society of London B, 266, 485-492. Harris, D. 1., Maxson, L. S., Braithwaite, L. F. & Crandall, K. A. (2000) Phylogeny of the thoracican barnacles based on 18S rONA sequences. Journal of Crustacean Biology, 20, 393-398. Hidas, E. Z., Costa, T. L., Ayre, D. 1. & Minchinton, T. E. (2007) Is the species composition of rocky intertidal invertebrates across a biogeographic barrier in south-eastern Australia related to their potential for dispersal? Marine and Freshwater Research, 58, 835-842. H0eg, J. T., Whyte, M. A., Glenner, H. & Schram, F. R. (1999) New evidence on the basic phylogeny of the Cirripedia Thoracica. Crustaceans and the biodiversity crisis. Proceedings of the 4th International Crustacean Congress, 1, 10 l-114. 163 Huang, B., Peakall, R. & Hanna, P. J. (2000) Analysis of genetic structure of blacklip abalone (Haliotis rubra) populations using RAPD, minisatetlite and microsatellite markers. Marine Biology, 16, 207-216. Hunt, A. (1993) Effects of contrasting patterns of larval dispersal on the genetic connectedness of local populations of two intertidal starfish, Patiriella calcar and P. exigua. Marine Ecology Progress Series, 92, 179-186. Hurst, G. D. D. & Jiggins, F. M. (2005) Problems with mitochondrial DNA as a marker for population, phytogeographic and phylogenetic studies: the effects of inherited symbionts. Proceedings of the Royal Society B, 272, 1525-1534. Hutchins, J. B. (1987) Description of a new plesiopid fish from south-western Australia, with a discussion of the zoogeography of Paraplesiops. Records of the Australian Museum, 13, 231-240. J arne, P. & Lagoda, P. J. L. (1996) Microsatellites, from molecules to populations and back. TRENDS in Ecology and Evolution, 11, 424-429. Kassahn, K. S., Donnellan, S. C., Fowler, A. J., Hall, K. C., Adams, M. & Shaw, P. W. (2003) Molecular and morphological analyses of the cuttlefish Sepia apama indicate a complex population structure. Marine Biology, 143, 947-962. Knowlton, N. (2000) Molecular genetic analyses of species boundaries in the sea. Hydrobiologia, 420, 73-90. Knowlton, N. & Weigt, L. A. (1997) Species of marine invertebrates: a comparison of the biological and phylogenetic species concepts. IN Claridge, M. F., Dawah, H. A. & Wilson, M. R. (Eds.) The units ofdiversity. London, Chapman and Hall. Knowlton, N. & Weigt, L. A. ( 1998) New dates and new rates for divergence across the isthmus of Panama. Proceedings of the Royal Society ofLondon B, 265,2257-2263. Knox, G. A. ( 1980) Plate tectonics and the evolution of intertidal and shallow-water benthic biotic distribution patterns of the southwest Pacific. Palaeogeographhy, Palaeoclimatology, Palaeoecology, 31, 267-297. Kuhner, M. K., Yamato, J. & Felenstein, J. (1998) Maximwn-likelihood estimation of population growth rates based on the coalescent. Genetics, 149, 429-434. Kumar, S., Tamura, K. & Nei, M. (2004) MEGA3: Integrated Software for Molecular Evolutionary Genetics Analysis and Sequence Alignment. Briefings in Bioinformatics, 5, 150-163. Lam beck, K. & Chappell, J. (200 1) Sea level change through the last glacial cycle. Science, 292, 679-686. 164 Landau, M. (1976) A comment on self-fertilisation in the barnacle Balanus eburneus Gould (Cirripedia, Thoracica). Crustaceana, 30, 105-106. Lessa, E. P., Cook, J. A. & Patton, J. L. (2003) Genetic footprints of demographic expansion in North America, but not Amazonia, during the late Quaternary. Proceedings ofthe National Academy ofSciences USA, 100, 10331-10334. Lessios, H. A., Kessing, B. D., Robertson, D. R. & Paulay, G. (I 999) Phylogeography of the pantropical sea urchin Eucidaris in relation to land barriers and ocean currents. Evolution, 53, 806-817. Lewis, C. A. (1978) A review of the substratum selection in freeliving and symbiotic cirripedes. IN Chia, F.-S. & Rice, M. E. (Eds.) Settlement and Metamorphosis of Marine Invertebrate Larvae. New York, Elsevier. Lewis, P. 0. & Zaykin, D. (200 1) Genetic Data Analysis: Computer program for the analysis of allelic data. Version 1.0 ( d 16c ). Free program distributed by the authors over the internet from http://Iewis.eeb.uconn.edu/lewishome/software.html. Linnaeus, C. (1758) Systema Naturae, Holmiae, Editio Decima, Reformata. Mantel, N. (I 967) The detection of disease clustering and generalised regression aproach. Cancer Research, 27, 209-220. Marko, P. B. ( 1998) Historical allopatry and the biogeography of speciation in the prosobranch snail genus Nucella. Evolution, 52, 757-774. Martin, J. W. & Davis, G. E. (200 1) An updated classification of the recent crustacea., Los Angeles, CA, Natural History Museum of Los Angeles County Science Series 39. Mayr, E. (1942) Systematics and the origin of species from the viewpoint of a zoologist, New York, Columbia University Press. McCartney, M. A., Keller, G. & Lessios, H. A. (2003) Dispersal barriers in tropical oceans and speciation in Atlantic and eastern Pacific sea urchins of the genus Echinometra. Molecular Ecology, 9, 1391-1400. McDonald, J. H. & Krcittnan, M. (1991) Adaptive protein evolution at the Adh locus in Drosophila. Nature, 351, 652w654. McDowall, R. M. (I 978) Generalised tracks and dispersal in biogeography. Systematic Zoology, 27, 88-104. McVean, G. A. T. (2001) What do patterns of genetic variability reveal about mitochondrial recombination? 1-Ieredity, 87, 613-620. Moray, R. (1678) A relation concerning barnacles. Philosophical Transactions of the Royal Society, 12, 175-206. 165 Moritz, C., Dowling, T. E. & Brown, W. M. (I 987) Evolution of animal mitochondrial DNA: relevance for population biology and systematics. Annual Review of Ecological Systematics, 18, 269-292. Morrone, J. J. & Crisci, J. V. (1995) Historical biogeography: introduction to methods. Annual Review ofEcological Systematics, 26, 373-401. Murata, A., Imafuku, M. & Abe, N. (2001) Copulation by the barnacle Tetraclitajaponica under natural conditions. Journal of Zoology, 253, 275-280. Myers, A. A. & Giller, P. S. (1988) Analytical biogeography: an integrated approach to the study ofanimal and plant distributions, New York, Chapman and Hall. Newman, W. A. (1987) Evolution of the cirri pedes and their major groups. IN Schram, F. R. & H0eg, J. T. (Eds.) Crustacean issues. Balkema, Rotterdam. Newman, W. A. & Ross, A. (1976) Revision of the balanomorph barnacles including a catalogue of the species. Memoirs of the San Diego Society ofNatural History, 9, 1- 108. Newman, W. A. & Ross, A. ( 1977) Superfamilies of the Balanomorpha (Cirripedia, Thoracica). Crustaceana, 32, 102. Newman, W. A. & Ross, A. (200 1) Prospectus on larval cirriped setation formulae, revisited. Journal of Crustacean Biology, 21, 56-77. O'Hara, T. D. & Poore, G. C. (2000) Patterns of distribution for southern Australian marine echinoderms and dccapods. Journal ofBiogeography, 27, 1321-1335. Palumbi, S. R. (1996a) Nucleic acids II: The polymerase chain reaction. IN Hillis, D. M., Moritz, C. M. & Mable, N. K. (Eds.) Molecular Systematics, 2nd edition. Sunderland, Massachusetts, USA, Sinauer Associates, Inc. Palumbi, S. R. (1996b) What can molecular genetics contribute to marine biogeography? An urchin's tale. Journal of Experimental Marine Biology and Ecology, 203, 75-92. Pannacciulli, F. G., Piyapattanakorn, S., Bishop, D. D., Hawkins, S. J. & Maclean, N. (2005) Isolation of highly polymorphic microsatellite markers from the intertidal barnacle Chthamalus montagui Southward. Molecular Ecology Notes, 5, 641-643. Pcakall, R. & Smouse, P. E. (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes, 6, 288-295. Perez-Losada, M., Harp, M., I-10eg, J. T., Achituv, Y., Jones, D., Watanabe, H. & Crandall, K. (2008) The tetnpo and 1node of barnacle evolution. Molecular Phylogenetics and Evolution, 46, 328-346. 166 Perez-Losada, M., H0eg, J. T. & Crandall, K. A. (2004) Unraveling the evolutionary radiation of the thoracican barnacles using molecular and morphological evidence: a comparison of several divergence time estimation approaches. Systematic Biology, 53, 244-264. Pilsbury, H. A. (1916) The sessile barnacles (Cirripedia) contained in the collections ofthe U.S. National Museum; including a monograph of the American species. U .. S. National Museum. Planes, S., Doherty, P. J. & Bernardi, G. (2001) Strong genetic divergence among populations of marine fish with limited dispersal, Acanthochromis polyacanthus, within the Great Barrier Reef and the Coral Sea. Evolution, 55, 2263-2273. Po1Iock, D. D., Bergman, A. & Feldman, M. W. G., D.B. (1998) Microsatellite behavior with range constraints: parameter estimation and improved distances to use in phylogenetic reconstruction. Theoretical Population Biology, 53, 256-271. Posada, D. & Crandall, K. A. (1998) Modeltest: testing the model of DNA substitution. Bioif!formatics, 14, 817-818. Raymond, M. & Rousset, F. ( 1995) GENEPOP (v. 1.2): a population genetics software for exact tests and ecumenicism. Journal ofHeredity, 86, 248-249. Reece, K. S., Ribeiro, W. L., Gaffney, P. M., Carnegie, R. B. & Allen, S. K. J. (2004) Microsatellite tnarker development and analysis in the Eastern Oyster (Crassostrea virginica): Continuation of null alleles and non-mendelian segregation ratios. Journal ofHeredity, 95, 346-352. Ridgway, K. R. & Condie, S. A. (2004) The 5500-km-long boundary flow off western and southern Australia. Journal of Geophysical Research, 109. Riginos, C. & Victor, B. C. (200 1) Larval spatial distributions and other early life-history characteristics predict genetic differentiation in eastern Pacific blennioid fishes. Proceedings of the Royal Society of London B, 268, 1931-1936. Roberts, T. E. (2006) Multiple levels of allopatric divergence in the endemic Philippine fruit bat 1/aplonycteris fischeri (Pteropodidae). Biological Journal of the Linnean S'ociety, 88, 329-349. Rochford, D. J. ( 1986) Seasonal changes in the distribution of Leeuwin current waters off Southern Australia. Australian Journal of Marine and Freshwater Research, 37, I I 0. Ronquist, F. & Huclsenbcck, J. P. (2003) MrBayes 3: Bayesianphylogenetic inference under mixed models. Bioinformatics, 19, 1572-1574. Rosen, D. E. (1978) Vicariant patterns and historical explanation in biogeography. Systematic Zoology, 27, 159-188. 167 Ross, A. & Newman, W. A. (2001) The Catophragmidae: members of the basal balanomorph radiation. Sessile Organisms, 18, 77-91. Rozas, J., Sanchez-De, 1., Barrio, J. C., Messeguer, X. & R., R. (2003) DNASP, DNA polymmorphism analyses by the coalescent and other methods. Bioinformatics, 19, 2496-2497. Rozen, S. & Skaletsky, H. (2000) Primer3 on the WWW for general users and for biologist programmers. IN Krawetz, S. & Misener, S. (Eds.) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ, Humana Press. Saunders, G. W. (2005) Applying DNA barcoding to red microalgae: a preliminary appraisal holds promise for future applications. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences, 360, 1879-1888. Schram, F. R. & H0eg, J. T. (1995) New frontiers in barnacle evolution. IN Schram, F. R. & H0eg, J. T. (Eds.) Crustacean issues. Balkema, Rotterdam. Schwaninger, H. R. ( 1999) Population structure of the widely dispersing marine bryozoan Membranipora membranacea (Cheilostomata): implications for population history, biogeography, and taxonomy. Marine Biology, 135,411-423. Slatkin, M. ( 1995) A measure of population subdivision based on microsatellite allele frequencies. Genetics, 139, 457-462. Smith, M.A., Woodley, N. E., Janzen, D. H., Hallwachs, W. & Hebert, P. D. (2006) DNA barcodes reveal cryptic host-specificity within the preswned polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy ofSciences USA, 103, 3657-3662. Sotka, E. E., Wares, J. P., Barth, J. A., Grosberg, R. K. & Palumbi, S. R. (2004) Strong genetic clines and geographical variation in gene flow in the rocky intertidal barnacle Balanus glandula. Molecular Ecology, 13, 2143-2156. Spears, T., Abele, L. G. & Applegate, M. A. (1994) Phylogenetic study of cirripedes and selected relatives (Thecostraca) based on 18S rONA sequence analysis. Journal of Crustacean Biology, 14, 641-656. Swofford, D. L. (2001) PAUP*. Phylogenetic Analysis Using Parsimony (* and other methods), Sunderland, Massachusetts, Sinauer Associates. Taj iina, F. (1989) Statistical 1nethod for testing the neutral tnutation hypothesis. Genetics, 123, 585-595. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive 1nultiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680. 168 Thompson, J. V. (1830) On the cirripedes or barnacles and the class of animals to which they belong. Zoological researches and illustrations or, natural history of nondescript or imperfectly known animals, 3. Tilburg, C. E., Hurlburt, H. E., O'Brien, J. J. & Shriver, J. F. (2001) The dynamics of the East Australian current system: the Tasman front, the East Auckland current, and the East Cape current. Journal of Physical Oceanography, 31, 2917-2943. Tsang, L. M., Chan, B. K. K., Ma, K. Y., Hsu, C.-H. & Chu, K. H. (2007) Lack ofmtDNA and morphological differentiation between two acorn barnacles Tetraclita japonica and T jormosana differing in parietes colours and geographic distribution. Marine Biology, 151 , 147-1 55. Valdes, A. M., Slatkin, M. & Freimer, N. B. (1993) Allele frequencies at microsatellite loci: The stepwise mutation model revisited. Genetics, 133, 737-749. Veliz, D., Duchesne, P., Bourget, E. & Bernatchez, L. (2006) Genetic evidence for kin aggregation in the intertidal acorn barnacle (Semibalanus balanoides). Molecular Ecology, 15, 4193-4202. Walker, G., Yule, A. B. & Nott, J. A. (1987) Structure and function in balanomorph larvae. IN Southwood, A. J. (Ed.) Crustacean Issues 5, Barnacle Biology. A.A. Balkema, Rotterdam. Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R. & Hebert, P. D. (2005) DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society of London Series B-biological Sciences, 360, 1847-1857. Wares, J. P. (200 1) Patterns of speciation inferred from tnitochondrial DNA in North American Chthamalus (Cirripedia: Balanomorpha: Chthamaloidea). Molecular Phylogenetic.~· and Evolution, 18, 104-116. Wares, J. P., Gaines, S. & Cunningham, C. W. (2001) A comparative study of asymmetric mirgration events across a marine biogeographic boundary. Evolution, 55, 295-306. Waters, J. M., King, T. M., O'Loughlin, P. M. & Spencer, H. G. (2005a) Phytogeographic disjunction in abundant high-dispersal littoral gastropods. Molecular Ecology, 14, 2789-2802. Waters, J. M., King, T. M., O'Loughlin, P.M. & Spencer, H. G. (2005b) Phylogeographical disjunction in abundant high-dispersal littoral gastropods. Molecular Ecology, 14, 2789-2802. Waters, J. M., O'Loughlin, P. M. & Roy, M. S. (2004) Cladogenesis in a starfish species complex from southern Australia: evidence for vicariant speciation? Molecular Phylogenetics and Evolution, 32, 236-245. 169 Waters, J. M. & Roy, M. S. (2003) Marine biogeography of southern Australia: phylogeographical structure in a temperate sea-star. Journal of Biogeography, 30, 1787-1796. Weber, J. L. ( 1990) Informativeness of humans ( dC-dA)n-( dG-dT)n polymorphisms. Genomic;, 7, 524-530. Wells, P. & Okada, H. (1996) Holocene and Pleistocene glacial palaeoceanography off southeastern Australia~ based on foraminifers and nannofossils in Vema cored hole VI8-222. Australian Journal of Earth Science, 43, 509-523. West, T. L. & Costlow, J. D. (1988) Determinants of the larval moulting pattern of the crustacean Balanus eburneus Gould (Cirripedia: Thoracica). Journal of experimental Zoology, 248, 33-44. Wiley, E. 0. ( 1981) P hylogenetics: the theory and practice of phylogenetic systematics, New York, New York, USA, John Wiley and Sons. Williams, S. T. (2000) Species boundaries in the starfish genus Linckia. Marine Biology, 136, 137-148. Wisely, B. & Blick, R. A. P. (1964) Seasonal abundance offirst stage nauplii in 10 species of barnacles at Sydney. Australian Journal ofMarine and Freshwater Research, 15, 162-171. Zane, L., Bargelloni, L. & Patarnello, T. (2002) Strategies for microsatellite isolation: a review. Molecular Ecology, I I, 1-16. Zhang, D.-X. & Hewitt, G. M. (1996) Nuclear integrations: Challenges for mitochondrial DNA markers. TRENDS in Ecology and Evolution, 11,247-251. Zhang, D.-X. & Hewitt, G. M. (1997) Insect mitochondrial control region: a review of its structure, evolution and usefullness in evolutionary studies. Biochemical 5'yslenzatics and Ecology, 25, 99-120. Zhang, D.-X. & l--lewitt, G. M. (2003) Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology, 12, 563-584. Zhu, Y., Qucller, D. C. & Strassmann, J. E. (2000) A phylogenetic perspective on sequence evolution in n1icrosatcllite loci. Journal ofMolecular Evolution, 50, 324-228. 170 Appendices 171 Appendix 1 Solutions and Buffers Appendix 1 Solutions and Buffers Solutions and buffers were prepared using molecular biology or analytical grade chemicals and distilled water (di-hO). Dilutions were made using dH20. Sodium Dodecyl Sulphate, SDS (1 0%) EDTA (250mM) pH=7 .4 NaCI (6M) Ethanol (70%) LiCI (10M) Ethanol (95-100%) Tris (1M) pH=7.4 Chloroform-isoamyl alcohol (24: 1) Ammonium Persulphatc, APS (10%) CaCh (IM) Extraction Buffer lOOmMNaCI, 50mM Tris, 1%SDS, 50mM EDTA TAE (SOX) IL 20M Tris, 57mL glacial acetic acid, 0.05M EDTA TBE (SOX) lL 27.5g boric acid, 54g Tris, 2mL 250mM EDTA TE Buffer 1OOmM Tris, 1OmM EDTA dNTPs (2mM) for PCR 0.5mM dATP, 0.5mM dTTP, 0.5mM dCTP, 0.5mM dGTP Proteinase K, ProK (1 Omg/mL) 1Omg ProK, 5 ~L 1M CaCh, 50J1L I M Tris 172 Appendix 2 Sequence Alignments Appendix 2 A2.1 Alignment of Australian Cytochrome Oxidase I Sequences Sequence alignment of partial Cytochrome oxidase I sequences for selected Australian samples of barnacle. 21 species, 658 sites Name Sequences SB2 AACTTTATAT CTAATTTTTG GTGCTTGATC CGCCATGGTG GGGACAGCTC TAAGACTTTT AI6 SBPl...... c. GPlO . . . c ...... c ... . T .. T .. A .. A .. T...... T ... A. AC . cca ..•...... •...... •...... •.. T •....•..•.•.••••. SB3 . . . GC .... C T ...... CA . A .. A...... ••... A .. A .. A .. T .. CT ....• A .• A . BR3 ... AC .... C T ...... C. . A .. A...... •.... A .. A .. A .. T .. CT ..... A. AC. CC3 ... AC .... C T ...... C .. A .. A ...... A .. A .. A .. T .. CT ..... A.AC . BEll . . . AC .... C T ...... C. . A .. A...... •.... A .. A .. A .. T .. CT ..... A. AC. SBP2 ... AC .... CT ...... C .. A .. A ...... A .. A .. A •. T .. CT ..... A.AC. SHS ... A ...... T ...... G ...... T .. G .. A .. A .. A .. T .. C ....•. A.AC. AI2 ... C...... C ...... T .. T .. A .. A .. T ...... T ... A.AC. SBP3 ... C ..... C ..... C ...... T .. T .. A .. A .. T ...... T ... A.AC. SBS ... C...... C...... T .. T .. A .. A .. T...... T ..• A. AC. BRl ... C...... C...... T .. T •. A .. A .. T...... T ... A. AC. CCl ...... A ..•...•...... •.•.•..••..•.••..••.•.•.•.•.•••• MJ2 G ...... T .. T ...•... A .. A ...... T .. A .. T .. A.AT ... T ..... A .• C. SRl G ...... C T ...... A .. A .....•.. T .. A .. T .. A .. T ... T ..... A.AC. LBlO .... C ...... T .. C ...... A ..•...•• T .. A .. C .. A .. C .. G ...... A.A .. HP6 ...... T ...... G .. A ..... A .. T ..... A ...... C .. T ... G.C .. HP7 ... C ..... C T ...... A .. A ...... T .. A .. A .. A ..... C .. T ... G •• C. SB2 AATTCGAGCA GAATTAGGTC AACCCGGAAG TTTAATTGGG GACGACCAGA TTTATAATGT AI6 SBPl GPlO ... C . . G .. T ... C ...... C . . CC . G ..... T .. T .. T .. A . . ... C ...•. cca SB3 T ...... GT .. GC . T .. A. . ... A. . . . . AC ...... A ..... T .. A. BR3 T ...... T .. GC . T .. A. . ... A. . . . . A ...... A ..... T .. A. CC3 T ...... T .. GC . T .. A . . ... A. . . . . A ...... A ..... T •. A. BBll. T ...... T .. GC . T .. A . . ... A. . . . . A •...... A ..... T .. A...... SBP2 T ...... T .. GC . T .. A. . ... A. . . . . A ...... A ..... T .. A...... SH8 ...... GT ...... A ..... A ....••.. A .. T ...•...... C .. AI2 ... C . . G .. T ... C ...... C . . CC . G ..... T .. T .. T .. A . . ... C .... . SBP3 ... C .. G .. T ... C...... C. . CC. G ..... T .. T .. T .. A. . ... C .... . SBS ... C ..... T ... C...... C. . CC. G ..... T .. T .. T .. A. . ... C .... . BRl ... C .. G .. T ... C ...... C .. CC.G ..... T .. T .. T .. A ..... C .... . CCl MJ2 T .... TT . TT ... C .... C . . ... T . . . . . CC . TT ...... G ...... C .. C ..•.. SRl T ..... T .. T ... C .... A. . ... T. . . . . CC . T ..... A ...•.... A. . C .. C .... . 1810 ...... T...... C .... G ..... A ..... GC .T ..... A .. T .. T .. A. .C .. C .... . HP6 T ...... C .... A ..... A ..... AC .T .•... A .. T ....•... C .....•.. HP7 ...... • ...... T ..... AC ...•... A .. T ..... A .. C ..... C .. S82 AATTGTAACT GCACATGCAT TTATTATAAT TTTTTTCATA GTAATGCCTA TTATAATTGG AI6 SBPl GPlO ... C .. C ..... T ....•.. ••••.••.• G .• T •. A •••. CC8 173 Appendix 2 Sequence Alignments SB3 •..... T ..... C ..... T ...... G .•... C .. T ...... A ... . BR3 ...... T .. C .. C ..... T .....•.. G ..... C .. T ...... A ..•. CC3 •..... T ..... C ..... T ..•.••.• G •••.. C •• T .•....•. A ••.. BBll ...... T... . . C ..... T .....•.. G ..... C .. T ...... A ... . SBP2 •..... T ..•.. C ..... T ..•.••.. G ..•.. C •. T ..•..••. A •..• SHB T ..•.. T ..•.. T ...... •.. T ...... •. A ... . AI2 . . . C .. C ..... T ...... G .. T .. A ... . SBP3 ... C .. C ..... T ...... •....•...... T •. A ... . SBS ... c .. c .. . . . T ...... • ..••.... G .. T •. A .. C . BRl . . . c .. c .. . . . T ...... •..•..... G .• T •. A •... CCl MJ2 T ..... T .. C .. T ..... T ..... C ...... C .. T .. G .. T .. A ...... SRl T ..... T .. C .. T ..... T ..... C ...... C .. T .. G .. T ...... •.....•.. LBlO T ..... T .. C .. T .. C .. T ...... •...... C .. T ..... T ...... HP6 C ..... T .. A .. C .. C .. T ...... C .. T ..... T .. A ...... •.. C .. HP7 ...... A .. C .. C .. T ...... •.... C .. ; .. T ...... A .. A ..•..•..... SB2 GGGTTTTGGA AATTGATTAC TACCGTTAAT ATTGGGAGCC CCTGATATGG CTTTTCCACG AI6 SEPl ...... c ..... GPlO A .....•.. G ...... C.TT .... TC.T ..... A .•..• T •• A .. C .. A .•... C .. C .. CCB .... c ..... SE3 A .. A ..... T ...... CC. . . . . C ...... A ...•.... A. . ... C .. T .. BR3 A .. A ..... T ...... • CC. . . . . C ..•.... A ..•..... A. . •.. C .. T .. CC3 A .. A ..... T ...... CC. . . . GC ...... A ...... A. . ... C .. T .. BEll A .. A ..... T ...... CC. . . . . C ...... A ...... A. . ... C .. T •. SEP2 A .. A ..... T . . . . . • ...... CC. . . . . C •...... A ...... •. A. . ... C .. T .• SHB A •.•.. C...... C. T . . C .• TC. . . . • C .•.. T . . . . . A .. C . . . . . A .. C .. T •. AI2 A ...... G ...... C. TT .... TC.T ..... A ..... T .. A .. C .. A ..... C .. C .. SEP3 A ...... G ...... C.TT .... TC.T ..... A .•... T .. A .. C .. A ...•. C .. C .. SES A ...... G ...... C.TT .... TC.T ..•.. A ..... T .. A .. C .. A ...•. C .. C .. BRl A ...... G ...... C . TT .... TC. T. . • .. A ..... T .. A .. C .. A. . ..• C .. C •• CCl .... c ..... MJ2 A .. A...... C. T ..... AC ...... A .• G ..... A ..... A ..... C •. T .. SRl A .. A...... C. T ..... AC ...... A ...... A ...•. A. . ... C •. T .. LElO A .. G ...... C . T . . ... TC . T . . G . . A .. C ...... C ...... T .. HP6 A .. G ...... C.CT .... C ...... A .....•.. A ...... • C .. C .... . HP7 T .. A...... C. TT .... AC. T. . . .. A •. G...... C. . . . . C .. C .. T .. SE2 ATTAAATAAT ATGAGCTTTT GACTACTACC TCCTGCTTTA ATATTATTAA TTAGTGGGTC AI6 SEPl .. T ...... c ..... GPl 0 . . . G ...... A ..... C .. G .. C .. T .. C .. A ... C.T .....• C.G ..... A .. A .. CCB SE3 ...... A .. A ...... TT...... C ...... C. TC ...... A •. A .. BR3 ...... A .. A ...... TT ....•..... C ...... C. TC •...•.. A •. A .. CC3 ...... A .. A...... TT...... C. . . . .• C. T C...... A .. A .• BEll ...... A .. A...... TT...... • C ...... C. T C. • . • ... A .. A .. SBP2 ...... A .. A...... TT...... C. . . . .• C. TC...... A .. A .. SHB . C . T . . C ...... T .. C . . . . • TT . G ...... C . T .•. C . . . . • . . •.• A •. A .. AI2 ... G ...... A ..... C .. G .. C .. T .. C .. A ... C.T ...... C ...... A .. A .. SEP3 .. A ..... C .. G .. C .. T .. C .. A ... C.T ...... C.G ..... A .. A .. 885 ... G ...... A ..... C .. G .. C .. T .. C .. A ... C.T ...... C.G ..... A .. A .. BRl ... G ...... A ..... C .. G .. C .. T .. C .. A ... C.T ...... C.G ..... A .. A .. CCl MJ2 ...... A . . T .. C . . ..• TT . . . . C . . C ... C . • . .. C ...... AA .... . SRl ... G ...... A .. T .. C . . ... TT . • . . C ...•.• C . T .. , C ...... A .... . LBlO . C .... C .. C ..... T...... T .. T .. C ..... CC. T ...... •. A .•... HP6 .C.T...... A .. A .. C ..... T •. C.. • .. A .•. C •...• C. T...... •. A .• A .. HP7 . C. T ..... C .. A .. A .. C . . ... TT. • . . . .. C .•. C. T •.• C. T . • • . . ... A .. A .. SE2 TCTAGTAGAA GCCGGAGCTG GGACAGGATG GACTGTCTAT CCGCCTTTAT CAAGTAATAT AI6 .....•.•.. A ....•.••..•..•••.•• 174 Appendix 2 Sequence Alignments S8Pl .T ...... A ...... GPlO ... T .....•.. A .. G .. A .. A .•...... A .. A .. T ..•.. A .. AC .•.. C ...... cca .•...... A ...••...... •...... SB3 C .. C ...... A ...... G .. A .. G .. T ..... C ...... G ...• A .... . 8R3 C .. C ...... A ...... G .. A .. G .. T .•... C ...... A .... . CC3 C .• C ...... A ....•... G .. A .. G .. T ...•• C ..•••• G .•.. A ..••. 8811 C .. C ...... A ...... G .• A .. G .. T .. C .. C .....• G .... A ..•.. SBP2 C .• C ...... A .•.•.•.. G .• A .. G •• T .•... C .•...• G .•.• A •.••. SHB A ..... C ..... A ...... A .. T ..... A .. A .. A .. C .. T .• CC.C ..... A ...•. AI2 ... C ...... A .. G .. A .• A ...... A .. A .• T .•..• A .• AC .... C .•••..•. SBP3 ... T ...... A .. G .. A .• A ...... • A .. A •• T ..•.. A .• AC .... C ..••.••. SBS ... T ..•..... A .. G .. A ..A ..•..... A .. A .. T ..... A .. AC .... C ...... •. BRl ... T ...... A .. G .. A ..A ...... A .. A .. T .•... A .. AC ...• C ...... •. CCl A ...... C MJ2 ...... A.G .. A .. G ..... T ...•. G ..•.. A .. T .. C .. T .. CC .... T .. C ...•. SRl ..•...... G .. G .. G ..... T .. G .. G ..... A .. T ....• T .. CC.G .. T .. C ...•. LBlO .T .... T ..... T .. T .. C .. T .. C .. G .. A ..... T .. C .. T .. CC.T .. T .• A .. C .. HP6 .T ...... A ..... A ..A ...... A .. C •...• C .. T ... C.T .• T .. A .... . HP7 A ...... C ..A ...... A ...... C •. T .• C ....• T .. C .. C .. SB2 TGCTCATTCC GGTGCTTCAG TAGATTTATC TATTTTTTCT TTACATTTAG CTGGAGCTTC AI6 SBPl GPlO ...•.. C .. T ..•.. A ...... C.C .. A ...••.••. C.T .. C ..... C ...•.... CCB SB3 . . . A .. C .. A .. A .. A ...... • C .• G .. A •••.•••.• .c ...... BR3 . . . A .. C .. A .. A .. A ....•... C .. G .. A ...•...•. .c ...... CC3 ..• A .. C .. A .. A .. A ...... C .. G .. A ••.••..•• .c ...... 8Bll ... A .. C .. A .. A .. A ...... C .. G .. A ..•...... •. . c ...... SBP2 . . . A .. C .. A .. A .. A ...... C .. G .. A ....•.•••..•..••.•. . c ...... SHS C ..... C .. G .. A .. A ...... C •.... A •...... • C .T .• CC .•• AI2 ...•.. C .. T ..... A ...... ••. C.C .. A .. , .....• C.T .• C ..••. C .. T ..... SBP3 ...•.. C .. T ..... A ...... C.C .. A ...•..... C.T .. CC .•.. C ..•..... 885 ...... C .. T ..... A ...... C.C .. A ...... •. C.T .. CC .... C .•...... 8Rl ...... C .. T ..... A ...•...•• C.C .. A ...... C.T .. C •.•.. C ...... CCl MJ2 ...... C .. A .. A .. A .. C .. G .. C ..... A .. C •.... C ..... C ..•.. G .. G .. A •. SRl ...... C .. A .. A .. A .. T .. G .. C .. G .. A .. C ..... C ..... C ..... G .. G •. A .. LBlO ...... C .. A .. A ..... T .. G ... C.C ...... C .•. C.T .. C ..•.• G ...... •. HP6 C ..... C .. T .. A .. C ...... A ...... •. C.T .. C ..... C ...... HP7 ... A ..... T .. A .. C ...... C.C .. A .. C .. C .. C C.C .. CC .... C ...... SB2 TTCAATTTTA GGTGCTATTA ATTTTATGTC TACAGTTATT AATATACGGG CAGAAACATT AI6 ...... c ...... SBPl ...... C .. A ..•...... ••.....•...... GPlO ... T ...... G . . A .. C ...... A . . C . . .•. G . • • . . C . . . . . • . . T .• G .. TC . CCB SB3 ... C ...... A ...... A .. A ...•. A .•...... • A •.... G •. T .. BR3 ... C ...... A .. A ...... A .. A ..... A .....•..... A ...•.... T .. CC3 ... C ...... A .. A ...... A .. A ..... A ..•...... A ...... T .. 8811 .•. C ...... A .. A ...... A .. A •..•. A .•••...... A ....• G .. T •. SBP2 ... C ...... A .. A ..•...... •. A .. A ...•• A .•..•••.•.. A ...•. G •. T .• SHS A ...... C.. . .A ..... C ...... A ..... C .. A ...... A...... •. T .. AI2 ... T ...... G .. A .. C...... A . . C ..... G . . . . . C...... • T .. G .. TC. SBP3 ... T ...... G .. A .. C...... A . . C ..... G. • • . . C. . . • . . . • T .. G .• TC. SBS .•. T ...... G .. A .. C ...... A . . C ..... G • • . . • C...... T •. G .. TC. BRl ... T ...... G .. A .. C...... A . . C ..... G. . . . . C...... T •. G .. TC. CCl MJ2 G .•.•.... G .. G ...... A ..•...•. A •••.. C •. G .. A .•. A .... T .. SRl G .. G...... G ...... •.•. A .....••. A ...•..•. G .. A. .G •• G •. T .. LBlO G ..•.. C... . .A .. A ...... AA .•.. T •...... • C •• G .. T .. T •. G .GTC. HP6 C .. C ... C . T .. A ...... C...... • • . . • ...... • • • • • . . . T •.... CC . HP7 ..• T ... C.T .. A ..•.. C .• C ...•. A .. C ...•...•... C .•..• A •• C •.•.• C .. 175 Appendix 2 Sequence Alignments 882 AACTTTTGAT CGTATCCCAT TGTTTGTTTG GAGAGTTTTC GTAACTGTAA TTCTTCTTTT AI6 8BP1 ...... c .. GPlO ... C .. C .. C ..... T .. TC .A ..... C .. A ...... A ...... T.A ... C. cca ...... c .. 883 . . . C .. C ..... A .. T ..... A .. C .. A .. A .. T ..... T ..... A .. G ..•.. GT.A .. BR3 ... C .. C. . . . .A .. T ..... A .. C .. A .. A .. T ..... T ....• A .. G ..... GT.A .. CC3 ... C .. C ..... A .. T ..... A .. C .. A .. A .. T ..... T ..... A .. G ..... GT.A .. BEll ... C .. C ..... A .. T ..... A .. C .. A .. A .. T ..... T ..... A .. G ..... GT.A .. 8BP2 ... C .. C... . .A .. T ..... A .. C .. A .. A .. T ..... T ..... A .. G ..... GT.A .. 8H8 ...... C. . . . . AC ...... A .. T .. C .. T A . T .. A . . . . • ... G ... C. AI2 ... C .. C .. C ..... T .. TC .A ..... C .. A ...... A ...... T.A ... C. 8BP3 ... C .. C .. C ..... T .. TC .A ..... C .. A ...... A ...... T.A ... C. 885 ... C .. C .. C ..... T .. TC .A ..... C .. A ...... • A ..•... T.A ... C. BRl ... C .. C .. C ..... T .. TC .A ..... C .. A ...... A ...... T.A ... C. CCl ...... c .. MJ2 ... C...... CC ...... A...... A. A ... A .. T A • T .• C ...... T. AC. SRl ... C ...... C...... A. . . . . • . . A ..•.. A .. T A. T .• C .. G...... T. AC . LBlO C .. A ...... C.T .. G . A ..... C .. T .. C .. C .. T ..•.. AT.G .. HP6 . . . C .. C. . . . . CC. T .. TC . T ...... A .. T ..... T A. C...... C •.• C. HP7 ...... C .. CC . A. . . . . A .• C. . . . . A .. C. . . . • . A . T .. A ...... C. 882 ATTATCTTTA CCTGTATTGG CTGGTGCTAT TACTATACTA TTAACTGACC GTAATTTAAA AI6 ...... c ...... c ... . SBPl .. c ...... c ...... GPlO TC ..... C. C .. A .. T .. A ..A .. G .. A .. C ...... T .. C ..•. A .. T .• A •.. C ... . cca ...... C ...... C ...... T ...... • 883 .C. T .. AC. T .. A ..... A ..A .. A ...... A •.. T ..•...• A .. T. BR3 . C. T .. AC. T .. A ..... A .. A .. A...... A ... T ...... A •. T. CC3 . C. T .. AC. T .. A ..... A. . A .. A...... A ... T. . . ..•. A .. T . 8811 . C. T .. AC. T .. A ..... A ..A .. A ...... •. A ... T ..•.... A .. T. 8BP2 . C. T .. AC. T .. A ..... A .. A .. A ...... A ... T ....•.. A .. T ...... •... 8H8 TC .... AC. T .. C .. T .. A. . A .. A...... G ... T. . C. T .. A .. T. . ... C .... . AI2 TC ..... C. C .. A .. T .. A ..A .. G .. A .. C •..... T .. C •..• A .. T. .A ... C ... . 8BP3 TC ..... C. C .. A .. T .. A. . A .. G .. A . . C ...... T. G C .... A .. T. . A ... C ... . 885 TC ..... C . C .. A .. T .. A . . A .. G .. A . . C .. ; ... T. G C .... A •. T. . A ... C ... . 8Rl TC ..... C . C .. A .. T .. A. . A .. G .. A. . C ...... T. . C .... A .. T. . A .•. C ... . CCl ...... c ...... MJ2 T ..... AC. T ..... T .. A. . C .. G .. A. . C .. A ... T. . C .... A .. T. . A •. C •.... SRl T ..... A C. T ...... A. . C .. G .. A. . C .. A ... T. G C. T .. A .. T. . G .. C .... . L810 .C.T ... C ...... T .. A .. A .. G ...... T C.T ...... A •.. C.T .. HP6 TC .... CC. T .. A ... C. A . . A .. A...... A ... T...... T. . G ... C. T .. HP7 CC. T...... A .. CC. A . . C .. A...... G .. T C. T .. A . . . . . A ... C. T .. 882 TACCTCTTTT TTTGACCCTA CAGGTGGAGG GGATCCCATT CTTTACCAAC ATTTATTT AI6 . . . T ...... •..• A .. G .. SBPl ... T ...... G ..... C ...... GPlO ...... A .. C .T ..... T .. A .. C .. T ... T.A .. T ..... C .. G .. C ccs ... T ...... ••..... G ..•...•..•••.••.•••••... C •.••• 883 ... T .. A ...... A .. G .. A ..... T ... T.A .. T ..... C ..... C BR3 ... T .. A ...... A .. G .. A ..... T ... T.A .. T ..... C ....• C CC3 ... T .. A ...... A •. G .. A •.... T ..• T.A .. T •.••. C •.... C BEll ... T .. A ...... A .. G .. A ..... T ... T.A .• T ..•.. C ....• C 8BP2 ... T .. A ...... T ....•... A .. G .. A ••••. T •.• T.A .. T •..•. C •..•• C SH8 ... T .. A ...... T .. C ....• A ..... A .. C .. A ... T.A ...... C ••..•. AI2 ...... A .. C ...... T .•... T ..•.. C .. T ..• T.A .. T ..... C .. G .. C 8BP3 ...... A .. C ...... T ..... T .. A .. C •. T ... T.A .. T ...•. C .. G .• C 885 ...... A .. C .T ...•. T .. A •. C .. T ... T.A .. T ..... C .. G .. C 8Rl ...... A •. C .T ..... T .. A .• C •• T ..• T.A .. T ...•. C •• G .• C CCl ... T ...•.. ••••••• G •.••• C •••.••.•••.••••••••••••• MJ2 . . . A .. C ..... C ...... • . ....•. G ...•. C .. G.A ..••.. T ...... C.T .•. SRl ...... C ...... T .. C. ...•... G .. A .. C •. A •.•.••.. T ••.... C.T .. C 176 Appendix 2 Sequence Alignments LBlO ...•..... C ..... T ...... A ..... A .• C .. T ..• T.A .. T ....•....•.. HP6 ... A .. C .. C ...... A ..... A ..... A .. C .. T .. C T.A .. T .. G .. C .. G •. C HP7 ..• A .. C .. C .... A ..... A •..•• T ....•••..•...• C .•.•. C 177 Appendix 2 Sequence Alignments A2.2 Alignment of Australian 16S rRNA Sequences Sequence alignment of partial 16s rRNA sequences for selected Australian samples of barnacle. 21 species, 326 sites Name Sequences HP6 AGACGAGAAG ACCCTATAGA GTTTTATATT TTGAATAATT TTTTCTAATT AGATTTTTTT SHB ...... A ...... GC. C.A .. GT.C ...... A. T.G ...•. AC HP7 ...... A AG ... G •.. C . C .... TC. . G ...... A Ail ...... • T.A GCT.TA.TA. AAG.T.T .•...... AAAA AI6 ..... G ...... A.A .. G .AATT.CT .. G ... TAT.C .....•.. C.A BEll ...... A ...... GAA G.A .. A •.... CAAT. T •...... C ... A. BRl ...... T.A G.T.TA.TA. AAG.T.T ...... AAAA BR3 ...... GAA G.A .. A ...•. CAAT. T ...... C ..• A. CC3 ...... GAA G.A .. A ..... CAAT.T ...... C ..• A. cca ..... G ...... A.A .. G .AATT.CT .. G ... TAT.C ...... A GP9 ...... T .A G. T. TA. TA. AAG. T. T...... •.. AAAA GP2 C ... AGG ...... A . A .. G . AA TT. CT. . G ... TAT. C. . •.•... C. A SBS ...... T . A G. T. TA. TA. AAG. T. T...... AAAA SB2 ...... A ...... G ...... A .A .. G .AATT. CT .. G ... TAT .C ...... C.A S83 ...... GAA G.A .. A ...•. CAAT. T ...... C ... A. SBP3 ...... T.A G.T.TA.TA. AAG.T.T .•.•..•.. AAAA SBPl ..... G ...... A.A .. G .AATT.CT .. G ... TAT.C ....•... C.A SBP2 ...... GAA G.A .. A ..... CAAT. T ...... C ... A. MJ2 ...... •. :A AAA ... TTA. . . ACT . T. G. . . T. C .• CAA SRl ...... •. A AAA ... TTA ... ACT. T .G ... T ...• CAA LBlO ...... A .AA.C .. T .. ACA.T.T.A .. AC ...•. AG HP6 AGATAAAATT TTTTTATAAT ATTTTGTTGG GGCGACATTT ATATAAAAAA AACTCTTTAT SHB .... T .. G.A .AAAGGCG-C ...... •...... A .G ...... G ...... HP7 -AGA. G. TG. . . GGG .. T ...... • G ...... G ...... T. Ail TA.CTT.T .. C.A.C.CT.G ...... A .G ...... G ...... AI6 TAGA. C. . . . CA. GCG- C. . TA...... •...... A . G .•.. G...... •.... T. BBll GA .. G ...... GG .. C-TTC ...... A .G ...... T . BRl TA.CTT.T .. C.A ... CT.G ...... A .G ...... G ...... BR3 GA .. G...... GG .. C- TTC ...... A . G...... T. CC3 GA .. G...... GG .. C- TTC ...... •... A . G...... T. CCB TAGA. C. . . . . A. G. G- C. . TA...... A . G .... G...... •.... T. GP9 TA. CTT. T .. C .A. C .CT .G ...... •..... A .G ...... G ...... GP2 TAGA. C.... .A .G .G-C .. TA ...... •...... A .G .... G...... T. SBS TA.CTT.T .. C.A.C.CT.G ...... A .G ...... G. SB2 TAGA.C .... CA.GCG-C .. TA ...... •...... A .G .... G ...•...... T. SB3 GA .. G ...... GG . . C- TTC ...... A . G ...... T. SBP3 TA.CTT.T .. C.A.C.CT.G ...... A .G ...... G. SBPl TAGA. C.... .A .G .G-C .. TA ...... •...... A . G .... G ...... T. SBP2 GA .. G...... GG .. C- TTC ...... A . G...... T. MJ2 GAG.TT.TAG A. C ... -T ...... A ...... A .G ...... •.•. G .. SRl .AG.TT.TAG A. C ... -T ...... A ...... A .G: ...... G .. LBlO . AT . GT .. A- . AAAG. CT .. .G ...... T .... . HP6 TTT-AAAAAC TTTATTAAAA GAATT-GAAT GATCCTTTAA AAAAGATCAT AAGAAAAAAT SHB ...... T ... TA. GG. . A. T .... TT. . .•... C . . . . . G ...... A ...... HP7 .AA .. G...... TA ...... G.AG .. TT ...... CC .GT .. GG...... ••.... Ail .... GT...... A.A. TT. . . G ...... T. . .•... C •. G •. G •..... A AI6 ..• TA.G .... C ..... TT .•.••..• A .....••.. A.. . •.. T ..... BBll .C ... T...... CTA .. GT .. GT.A .. TT ....•.. C ••... G •....• A BRl ..•. GT...... A.A.TT ... G ..•..• T ...... C .• G .• G .•...• A 178 Appendix 2 Sequence Alignments BR3 .C ... T ...... CTA .. GT .. GT.A .. TT .•....• C .. G .. G ...... A ...... CC3 .C ... T...... CTA .. GT .. GT .A .. TT ...... C ..... G ..•... A ...... cca ...... TA.G .... C ..... TT ...... •. A ...•.•... A ...... T .... . GP9 .... GT...... A.A. TT ... G ...... T .....•. C .. G .. G ...... A ...... GP2 ... T...... TA ...... C ..... TT ...... A ...... A .•.... T .... . SBS •... GT...... A.A. TT ... G ...... T ...... C .. G .. G ...... A SB2 ...... TA.G .... C ..... TT ...... A ....•.... A ...... T .... . SB3 . C ... T...... CT A .. GT. . GT . A .. T T. • ..... C . . . . . G •..... A ...... SBP3 .... GT...... A.A. TT. . . G ...... T...... C .. G .. G ...... A ...... SBPl ...... TA.G .... C ..... TT ...... A ...... A...... T .... . SBP2 .C ... T ...... CTA .. GT .. GT.A .. TT ...... C ..... G ...... A ...... MJ2 .... TTT...... CA...... TTCA .. TT...... T .. SRl . C .. TTT...... CA...... TTCA .. TT. . ..•... T .. LBlO A...... CA .A. TTG .. T .. C. T. C...... T.A ... T.T .... HP6 TACCTTAGGG ATAACAGCGT AATCTTTTTT GAGAGTTCTA ATCGACAAAA AGGTTTGCGA SH8 HP7 Ail AI6 ..... c .... .•...... CT BBll ...... c ...... c. BRl BR3 ...... c ...... c. CC3 ...... c ...... c. cca ..... c ...... CT GP9 GP2 ..... c ...... CT SBS SB2 ..... c ...... CT SB3 ...... c ...... c. SBP3 SBPl ..... c ...... CT SBP2 ...... c ...... c. MJ2 ...... c. SRl ...... c. LBlO ..... CCC ...... C .. A ...... • GGG HP6 CCTCGATGTT GGACTAAAAT TTAGGCAAGG TGCAGTAGTT TTGCTTTAAG GTCTGTTCGA SH8 ...... •... G .•..... C •••• C .••.•••••••••.••.•• HP7 .. G .... G ...... C .... C ..•.... G. Ail ...... G . . . . T .. C. . . . C ...... TG . AI6 ... AA.GTA ...... C. AC. T .... G. BBll ...... T ...... CC . C . A .. TC ... G. BRl ...... G . . . . T .. C . . . . C ...... TG. BR3 ...... T ...... CC . C . A .. TC ..• G . CC3 ...... T . . . • . .. CC . C . A .. TC . . • G . cca .... A.GTA ...... C. AC. T .... G. GP9 ...... G . . . . T .. C . . . . C . • . . . . TG . GP2 .... A.GTA ...... C. AC.T .... G. SB5 ...... G . . . . T .. C. . . . C . . • . . . TG . SB2 .•.. A.GTA ...... C. AC. T .... G. SB3 ...... T ...... CC . C . A .. TC . . . G . SBP3 ...... G .... T .. C .... C ...... TG. SBPl .... A.GTA ...... C. AC. T .... G. SBP2 ...... T ...... CC . C . A .. TC ..• G. MJ2 ..... C ...... G. SRl ..... C ...... G. LBlO .A.ACT ...•..... A ... C .. AGA .• T •. HP6 CCTATAATAT TTTACATGAT CTGAGT SH8 .. A--. HP7 .. CG ...... Ail .. CG ...... 179 Appendix 2 Sequence Alignments AI6 .c BBll .c. BRl .CG. BR3 .c. CC3 c. cca .c. GP9 .CG. GP2 .c. .G SBS .CG. SB2 .c 883 .c. SBP3 .CG. SBPl .c SBP2 .c MJ2 .c. .T. SRl c. LBlO .GAT. 180 Appendix 2 Sequence Alignments A2.3 Alignment of Globai16S rRNA Sequences Sequence alignment of partial 168 rRNA sequences for intertidal barnacle species from Australia and worldwide. 56 species, 330 sites Name Sequences ------ GriffithP2 AGACGAGAAG CCCCAGGAGA GTTTAAAATG TAATTTCTTT GTTTTATACT AGATTTT--C B.crenatus ...... A .. .TAT ...... T.TG.C .AAAT .. A T . . CTA.T. T ...... T C.polymeru ...... A .. .TAT ...... T.TT.A GTTA.AA.A. AAG .. T .. T...... A .. A M.tintinna ...... A. .TAT ...... T.T.CT .T.AAATAC . T.CCCTA.A...... T T.squamosa ...... A. . TAT ...... T.T . . c .CGGAAAA .. T . . CT .. A. G ...... T I .quadriva ...... A. .TAT ...... G .. GAA AGGA.AAAGA T .A ... GGTG .AT.AGAAGT B.glandula ...... A. .TAT ...... T.TG.C . . .AAAT .. A T. .. CTA.T. T ...... T S .balanoid ...... A. .TAT ...... T.TG.C .CTAAATA.A T.A.CTA.T. T ...... T CapeConra8 ...... A. .T.T ...... " ...... T Aireyslnl6 ...... A . .T.T ...... SorrentoB2 ...... A ... A . . T.T ...... SBPortlndl ...... A . .T.T ...... SorrentoB3 ...... A. .TAT ...... T.TGAA GT.AAAAA .. TCAA.T .. T . . ... C .... T BerryBeall .. . . . A. . . A . . TAT ...... T.TGAA GT.AAAAA .. TCAA.T .. T . . ... C .... T CapeConra3 ...... A . .TAT ...... T.TGAA GT.AAAAA .. TCAA.T .. T . . ... C .... T BlackRock3 ...... A . . TAT ...... T.TGAA GT.AAAAA .. TCAA.T .. T . . ... C .... T SBPortlnd2 ...... A. .TAT ...... T.TGAA GT.AAAAA .. TCAA.T .. T . . ... C .... T ScottsHea8 . . . . .A ... A. . TAT ...... T.TGCT CT.AAGTAC . T . .. CTA.A . T.G ...... T Hernli tPoi 7 ...... A. .TAT ...... T.T. .A AGGAAGAA.C TC .. CT. CT. G ...... T HermitPoi8 .. . . A . . TAT ...... T.T. .A AGGAAGAA.C TC ... T. CT. G ...... T Aireysinll ...... A . . TAT ...... T.TT.A GCTA.AA.A. AAG .. T .. T...... A .. A BlackRock2 ...... A . . TAT ...... T.TT.A GTTA.AA.A . AAG .. T .. T ...... A .. A SBPortlnd3 ...... A. .TAT ...... T.TT.A GTTA.AA.A. AAG .. T . .T ...... A .. A GriffithP9 ...... A . . TAT ...... T.TT.A GTTA.AA.A. AAG .. T .. T ...... A .. A SorrentoBS ...... A . . TAT ...... T.TT.A GTTA.AA.A. AAG .. T .. T...... A .. A HermitPois ...... A . . TAT ...... T.T . . T .TGAA.AA .. T . . . CTA.T ...... T HermitPoi6 ...... A . . TAT ...... T.T . . T .TGAA.AA. T ... CTA.T ...... T CHeaNorthS ...... A . . TAT ...... T.T . . T . TGAA.AA. T . .. CTA.T ...... T M.spinosus . . A . . TAT ...... T.T . . c . C.AAATAC . T.A .. TA.A ...... T M. aquila . . . . A . . TAT ...... T.T . . T .T.CAATA .. T. .. CTA.T. T ...... T C.bisinuat . . . .. A . . TAT ...... C.T. .A GT.AG.AA.C A.A .. G .. TC . .G ...... T A.psittacu . . . A . . TAT . . . . . T.TGCT CT.AAATAC. T. .. CTA.A. T.G ...... T LondonBri9 ...... A . . TAT ...... T.T. .A .. . AC.A . ACA .. T .. A. .AC ...... T LondonBrlO ...... A . . TAT ...... T.T. .A . . . AC.A ... ACA .. T .. A . .AC ...... T M. californ ...... A . . TAT. . . .. T.T.CT . T.AAATAC. T.CCCTA.A...... T B .perforat . . . .. A. . TAT ...... T.TG.T . . . AAATA . T . .CTA.T. T ...... T C.brunnea . . A . . TAT ...... T.TGAA GT.AAAAA. TCAA.T .. T . .•.. C .... T T. j aponica . . . . . A. .TAT ...... T.T . . c ACGAA.AA .. T.C .. T .. G. .. G ...... T P.polymeru . . . . A . . TAT ...... T. . T.AGAA.A . AGA .. T. -T . " ...... T c. stellatu ...... A . . TAT ...... T.T . . A GT.AG.TCC. A.A ... .. T...... T C.challeng ...... A. .TAT ...... T.T . . A GT.AACTA.C A.A. .G .. T. .... C.G .. A S .cariosus ...... A . . TAT ...... T.TG.T . T.AAGTA.A T .• .CTA.T. c ...... T NZl ...... A . . TAT ... A .. .T.T.AA .T.AAAAA .. T.AA.T .. T. G ...... T NZ2 ...... A . . TAT ... A .. .T.T.AA .T.AAAAA. T.AA.T .. T. G ...... T NZ6 ...... A. .T.T ...... G.TG.A AT.AAGAA. T.A .. T .. T. G .•...... A NZ4 ...... A . . TAT ...... T.T . . A A . .AG.TAA. T.A .. TC.T . . . T .. .G .. G Dunl ...... A. .TAT ...... T.T. . A A . . GG.TAA. T.A .. TC.T . . . T .. .G .. G Dun2 ...... A. .TAT ...... T.T . . A A . .AA.T.A. T .AC. T .. G . . . T ...... HermitPolO ...... G. . TAT ...... T.T . . A A . . AA.T.A. T .AC.T .. AA .. T ...... MarloJetyl ...... A. .TAT ...... T.T . . A A .. AA.T.A . T.AC.T .. G. . .T.C .... T 181 Appendix 2 Sequence Alignments MarloJety2 A ... TAT ...... T.T .. A A .. AA. T .A. T .AC. T .. G ... T. C .... . HermitPoi9 A ... TAT ...... T.T .. A A .. AA.T.A. T.AC.T .. G ... T ...... SanRemoJyl A ... TAT ...... T.T .. A A .. AA.T .A. T .AC.T .. G ... T •...... E. modest us A ... TAT ..•.... T.T .. A A •. GG. TAA. T .A .. TC. T ... T ••. G .. G E.kingii A ... TAT ..•.... T .T. CA A .. AAAT •.. T .•• CTA.T ..•.•...... T.purpuras A ... TAT ...... T.T .. T .TTCGAAA .. T .... T .. T ...... T GriffithP2 TATAGAACA- ATTTATGTGC ATTATTTGTT GGGGCGACAT TAAGATAAGA AAAACTCTTT B. crenatus A.AGATTATA .A.AG.AA-G .CAT ...... •• TAT C.polymeru A ... ACTT. T T. C ... CACT .GAT ...... A. G ...... •. M. tintinna .CAG.CGA.G TA.A.ATG-G G.AT ...... A. G ....•.... T. squamosa . TGGAT.A.A T ... T.TGTG G.AT ...... T ...•. C .. G ...... I .quadriva AT .. TT .ATA .. A. TCTCTT TC. T ...... AG.AT .. TA ...... T .. . B.glandula A.AGATTATA .A.AG.AA-G .CAT ...... TAT S. balanoid ATAGATTTCA TA ... AAG-G .CAT ...... TA. CapeConra8 Aireysinl6 ... c ... c .. SorrentoB2 . . . c ... c .. SBPortlndl SorrentoB3 ATG.ATGA ...... GGT.CT TCAT .....• ...... A. BerryBeall ATG.ATGA ...... GGT.CT TCAT ...... •.... A. CapeConra3 ATG.ATGA ...... GGT.CT TCAT ...... A. BlackRock3 ATG .ATGA...... GGT.CT TCAT ...... •..•... A. SBPortlnd2 ATG.ATGA ...... GGT.CT TCAT ...... •..•. A. ScottsHea8 ACAGATTA.G TA.A.A.G-. GCAT ...... •.••... A. G ...... •. HermitPoi 7 . . AGA.G- .T G ... GG.ATT .. AT ...... T ...... A. G ...... HermitPoi8 . . AGA.G-.T G ... GG.ATT .. AT ...•.. .T ...... A. G ...... Aireysinll A ... ACTT. T T . C ..• CACT . GAT .....• ...... • A. G ...... BlackRock2 AG .. ACTT.T T.C ..• CACT .GAT .....• . ..•.... A. G ...... SBPortlnd3 A ... ACTT.T T.C ... CACT .GAT ...... ••..•• A. G .••....•. GriffithP9 A ... A CTT. T T . C ... CACT . GAT ...... • ...... A. G ...... •. SorrentoB5 A ... A CTT. T T . C ... CACT . GAT ...... • • . A. G ...... HermitPoi5 .TAGAT.A.A T ... T.TATA .. AT .. , .. . .T ...... HermitPoi6 . TAGAT .A.A T ... T. TATA .. AT ...... T.T ...• A. CHeaNorth5 . TAGAT .A.A T ... T. TATA .. AT .....• .T ...... M. spinosus .CA.AT.A.A TA.A.ACA-G G.AT .....• M.aquila ATAGA.TA.A TA .. TAAG-A G.AT ...... •...... TA. C. bisinuat . TCG. T. TG. . ... GGT .CT •. A ...... TA. A.psittacu ACAGATTA.G TA.A.A.G-. GCAT ...... • CA. LondonBri9 AGA. TTGT.. .A.A .A .ACT .. AT ...... T ...... A ...... T ..• LondonBrlO AGA.TTGT ... A.A.A.ACT .. AT ...... T ...... A ...... T .. . M. californ . CAG.TGA.G TA.A.ATG-G G.AT ...... •...... A. G ...... •.. B .perforat ATGGATCA.A TA ... AAG-A .CAT ...... T ..... TA. C .brunnea ATG .ATGA...... GGT .CT TCAT ...... A. T. j aponica . TGGAT .A.A T ... T. TGTG .. AT ...... P .polymeru . TA. TTTATG T .. ACG .. T. G.AT ...... GT ...... G C.stellatu GT . G- T . T . . G . . . GAT . CT .. A ...... •.. TA. G ••..••••. C. challeng NTCGATTTG. . ... TAT .CT G.A ...... • ...... A. S. cariosus ATAGATTATA TAC .. GA. -G .CAT ...... •..... TA. NZl .. A. TTGA...... GGT .TT T .AT ...... •...... A. NZ2 . . A. TTGA...... GGT. TT T. AT...... •...... A. . ..•...... NZ6 ATATAT.A ...... GGT.TT .CAT ...... TA ...... · NZ4 A.A.ATT .. T TAA.- .C.AT .. AT ..•...... •.•.•....•.. A ...... · · .. · Dunl A.A.ATT .. T TAA.-CC.AT .. AT ...... •...... ••...... A .•..•. · ·. · · Dun2 A.A .. TTT.T .GA. -CT.AT .. AT .. A ...... •...... •... A .•...... G HermitPolO .. A . TTTT . T . GA. -CT. AT ... T •. AT...... T...... A. . ..•..... G fvlarloJetyl A.A .. TTT. T . GA. -CT. AT .. AT .. A . . • . . . • • . • • . • . •...... A. . •...... · G MarloJety2 A. G .. TTT. T . GA. -CT. AT .. AT .. A ...... •... A. . •...... · G HermitPoi9 A.A .. TTT. T . GA. -CT. AT •. AT .. A ...... • . • . • . . • ..••... A. • •...•.•. G SanRernoJyl A.A .. TTT. T . GA. -CT. AT .. AT •. A ...... • • . . • . • . •..•••. A. • •..• • · . · G E. modest us A.A.ATT .. T TAA.- .C.AT .. AT ...... •...••.•.••.•.. A ....•.• · · · · E .kingii CTAG.TTA.A .A .. TATA-T G.AT •....• .T; ..... A. T.purpuras CTA.A .• A.A T .. AGG.AAA G.AT •..... • •.•.•. TA. 182 Appendix 2 Sequence Alignments GriffithP2 TTTTTTAAAA ACTTTTATAA AAGCATT--- GTTTGATCCT TAAAAAAAGA TAATAAGATA 8. crenatus A .... AT .. - . T ...... AGC. . . . . T ...... CT. T .• G. . • . C. A .... A . C.polymeru A .... -GT...... AA •. TT ... G...... A ...... •. CT .G .. G... . C.A .... A. M. tintinna A ..... T .. - .T ... A .. T ... AT .. G ...... CT ..•. G .... C.A .... A. T. squamosa A. GAGA ... - ...... T. G. . .. A...... A...... CT...... C ...•.. A . I. quadri va A . AAA- . T. . . .. A ... CTT T .. AGGAA...... G . T. - .• GC. . • T. A. G .. A. B .glandula A .... AT .. - .T ...... AGC ..... T ...... CT.T .. G .... C.A .... A. S .balanoid A .... C ... - . T ...... AGT...... C. . . . • . . . CT .... G. . . . C. A .... A . CapeConraB ...... G. Aireysinl6 ...... G. SorrentoB2 ...... G. SBPortlndl ...... •. G. SorrentoB3 ... C.- .T ...... C .... G T .. GT.A .. . CT .... G. . . . C . A .... A . BerryBeall ... C . - . T ...... C .... G T .. GT . A ...... CT .... G. . . . C . A .... A . CapeConra3 ... C. - . T...... C .... G T .. GT. A ...... • . CT .... G. . . . C. A .... A. BlackRock3 ... C. - . T...... C .... G T .. GT. A...... CT. G .. G. . . . C. A .... A. SBPortlnd2 ... C. - . T...... C .... G T .. GT. A...... CT .... G. . . • C. A .... A. Scott sHe aS A .... A ... - . T ...... GG .. AA T...... CT .••. G. . . . C. A .... A . HermitPoi7 ... AA-. G...... G.AG...... • C CTGT .. GG.. . C ....•. A. HermitPoiB . . . AA- . G ...... G. AG . . . • .....•.• C CTGT .. GG. • • C ..•... A . Aireysinll A .... -GT ...... AA .. TT ... G ...... A ..•....• CT.G •. G .•.. C.A •... A. BlackRock2 A .... -GT...... AA .. TT ... G...... A ..•..•.. CT .G .• G... . C.A .... A. SBPortlnd3 A .... - GT...... AA .. TT ... G...... A...... • . CT. G .. G. . . . C. A .... A. GriffithP9 A .... - GT...... AA .. TT ... G...... • A. . . . • . . . CT. G •. G. . . . C. A .... A. SorrentoBS A .... - GT...... AA .. TT ... G...... A. ~ . . • • . . CT. G •. G. . . . C. A ...• A . Hermit Po iS A ...... - ..... AT ...... A .•..... AA .••••••• T ...•..... C ..•..• A. HermitPoi6 A .... A ... - ..... AT ...... A ..••..• AA ••.••••• T .••..•..• C .••..• A. CHeaNorthS A ...... - ..... AT ...... A ..••..• AA .....•.• T ...... C •..... G. M. spinosus A .... AT .. - .T ...... AT .• - •.. A ...... •. CT .... G •... C.A .... A. M. aquila A .... C ... - . T ... A .. G. . . AA T. • ...... • CT ..•. G. . . . C. A ...• A. C.bisinuat .... A-. C ...... T .AG.A ... AC ...... •.. T ..•. G...... A. A. psittacu A ..... TTTT .T .. C .... G .. AAT.G •...... CT ..•. G .•.. C.A .... A. LondonBri9 A.A .. - ...... CAA .. TT G .. T ... T .. -AC ....••. -T...... T.A •.. TAT LondonBrlO A.A .. - ...... CAA .. TT G .. T .. CT .. -AC ...... -T ...... •.• T.A ... TAT M. californ A . . . . . T .. - . T ... A .. T . . . AT .. G ...... • . CT .... G. • . . C. A .... A • B. perforat A ...... - . T ...... AG. AA . . . . C...... • . CT. G .• G. • . . C. A .... A . C. brunnea . . . C . - . T ...... C .... G T .. GT . A ...... CT ...• G. . . . C . A .... A • T. j aponica A .... G ... - ..... AC...... A...... AAC...... T. G .. G. • . . C ...... A . P.polymeru A . A .. - ...... CA ... G ... TT. A . . . - ...... • • T ...... T . C ... GA . C.stellatu . . ... - .. TG ...... G . . .. TTGA . . . A ...... T ...... C ...... A . C. challeng ... A.- ...... G ..... T.A .. A ... AC ...... T ...... •..... S. cariosus A .... A ... - .T ...... AGC ...... • CT .... G .... C.A .... A. NZl . . . C . - . T ...... T .. G .. AA ...... CT . G. . G . . . . C . A .... A . NZ2 . . . C . - . T ...... T .. G .. AA ...... CT . G .. G . . . . C . A .... A . NZ6 ... C.- .T ...... AC .. TT T .. GTGG .... A ...... CT .... G .... C.G .... A. NZ4 A . . .. - TT ...... TT. A . . . . C ...... T ...... C ..•... A . Dunl A . . .. - TT ...... TT . A . . . . C . • ...... T ...... C ..•... A . Dun2 A . . .. - TTT ...... C ...... TTCA •.. .T ...... T ...... A. Hermit PolO A . . .. - TTT ...... CG .. G ... TTCA .. . .T ...... T ...... A. MarloJetyl A . . .. - TTT ...... C ...... TTCA .. . .T ...... T ...... A. MarloJety2 A . . .. - TTT ...... C ...... TTCA .. . .T ...... T ...... A. HermitPoi9 A . . C . - TTT ...... C ...... TTCA .. . .T ...... T ...... A. SanRemoJyl A . . C . - TTT ...... C ...... TTCA .. . .1. ••• "' ••••• .T ...... T ...... A. E. modestus A . . .. - TT ...... TT. A • . • . C . . . . . • . . . T. . . • . . . . . C ...... A . E. kingii A .... - TG...... T ... AT...... A. . . . T...... • . . T. A •.•. A . T .purpuras A ...... - ..... G ...... A .. AATA .•...... T...... C ....•. A. GriffithP2 AAATTACCTC AGGGATAACA GCGTAATCTT TTTTGAGAGT TCCTATCGAC AAAAAGGTTT B. crenatus ...... T •. TA .•.•.. C.polymeru ...... T .. TA .....• M. tintinna ...... T .. TA ...•.. T. squamosa ...... T .. TA ..•.•. 183 Appendix 2 Sequence Alignments I .quadriva ..•....•. T .... A ...... A .....•. B.glandula ...... T ...... TA ...... S.balanoid ...... T .. TA ...... CapeConraB Aireysinl6 SorrentoB2 SBPortlndl SorrentoB3 ...... T ••• C .•...... A .•.••. BerryBeall ...... T •.. C ..••..... A .•.••. CapeConra3 ...... T •.. C ...... •. A .•.••• BlackRock3 ...... T •.• C ..•.•.... A ••.•.. SBPortlnd2 ...... T ••• C .••••...• A •••••• ScottsHeaB ...... T .. TA ...... HermitPoi 7 ...... T .. TA ...... HermitPoiS ...... T .. TA ...... Aireysinll ...... T .. TA ...... BlackRock2 ...... T .. TA ...... SBPortlnd3 ...... T .. TA ...... Gri ffithP9 ...... T .. TA ...... SorrentoB5 ...... T .. TA ...... HermitPoi5 ...... T .. TA ...... HermitPoi6 ...... T .. TA ...... CHeaNorth5 ...... T .. TA ...... M. spinosus ...... T .. TA ...... M.aquila ...... T .. TA ...... C.bisinuat ...... T .. TA ...... A.psittacu ...... T .. TA ...... LondonBri9 ...... T ...... C CC ...... C .. AA .•....• GGG ...... LondonBrlO ...... T ...... C CC ...... C .. AA •.•...• GGG ...... M. californ ...... T ...... TA ...... B.perforat ...... T ...... TA ...... C.brunnea ...... T .•. C ...... ••• A •••.•• T. j aponica ...... T .. TA ...... P.polymeru ...... T .. TA ...... C. stellatu ...... T .. TA ...... C. challeng ...... T .. TA ...... S. cariosus ...... T .. TA ...... NZl ...... T .•. A ...••• NZ2 ...... T ••. A .•••.. NZ6 .. TA ...... NZ4 ...... T . . TA ...... Dunl ...... T .. TA ...... Dun2 ...... T .•. A ••.... HermitPolO ...... T .•. A ...•.. MarloJetyl ...... T •.• A .•.•.. MarloJety2 ...... T ... A ....•• Hermi tPoi9 ...... T ... A ...... SanRemoJyl ...... T ... A ...... E. modest us ...... T .. TA ...... E.kingii ...... T ...... A . C C...... TA...... GG ...... T. purpuras ...... T .. TA ...... GriffithP2 GCGACCTCGA TGTTGGACTA AAATTTAGAC GTAGTGCAGT AGCTACGTTT TAGGGTCTGT B. crenatus ...... G. AGG ...... C .. T. CT .C ... TA ...... C. polymeru ...... G. AGG ... T .. C .. T.CT.C ... T ...... M. tintinna ...... G. AGG ...... C .. T. CT . C . . . . A ...... T. squamosa ...... AGG ...... T.CT ..... T ...... I. quadriva .... AA. . . . AAG...... T. TT . . . . . TA ...... B .glandula ...... G. AGG ...... C .. T. CT . C. . . TA ...... S. balanoid ...... G. AGG ...... C .. T. CT . C. . . TA ...... CapeConraS Aireysinl6 .....•. A .. SorrentoB2 184 Appendix 2 Sequence Alignments SBPortlndl SorrentoB3 ...... G. A.G ...... C C .... T .. C. BerryBeall ...•.... G. A.G ...... C C .... T .. C. CapeConra3 ...•.... G. A.G ...... C C .... T .. C. BlackRock3 ...... G. A.G ...... C C •... T .. C ...... SBPortlnd2 ...... G. A. G ...... C C .... T .. C ...... ScottsHea8 ...... G. AGG ...... C .• T. CT . C. . . . A ...... HermitPoi 7 ...... G. G. AGG ...... C .. T. CT. C .. HermitPoi8 ...... G.G. AGG ...... C .. T.CT.C .. Aireysinll ...... G . AGG ... T .. C .. T . CT . C. . . T...... BlackRock2 ...... G . AGG ... T .. C .. T . CT . C . . . T ...... SBPortlnd3 ...... G. AGG ... T .. C .. T.CT.C ... T ...... GriffithP9 ...... G. AGG ... T .. C .. T. CT . C. . . T ...... SorrentoBS ...... G. AGG ... T .. C .. T. CT. C. • . T ..•..... HermitPoiS ...... G. AAG ...... T.TT.C .... A ...... HermitPoi6 ...... G. AAG ...... T .TT .C .... A ...... CHeaNorthS ...... •• G. AAG ...... T.TT.C .... A ...... M.spinosus ...... •. G. AGG ...... C .. T. CT . C. . . . A ...... M.aquila ...... G. AGG ...... C .• T. CT . C. • . . A ...... C.bisinuat ...... T . AG ...... C .... T. A...... A.psittacu ...... •• G. AGG ...... C .. T . CT . C . . . . A ...... LondonBri9 ..... A.ACT AAG ...... A .. TCTTAGA .. TA ...... LondonBrlO ..... A.ACT AAG ...... A .. TCTTAGA .. TA ...... M. californ ...... G. AGG ...... C .. T.CT.C ....A ...... B.perforat ...... G. AGG .....• C .. T. CT . C. . . . A ...... C.brunnea ...... • G. A.G ...... C C •... T .. C ...... • T. j aponica ..... C .• G. AGG ...... T .CT .• C .. TA ..•.... P.polymeru ....•... G. AAG ...... C .• T. TT . C. • . .•..•.... C.stellatu ...... • GT AGG .....•..... CTAC ... TA .••.... C. challeng ....••••• T .. G ..•... C ..•..• A ..•..•.•..••• S.cariosus ...... G. AGG ...... C .. T. CT . C. • . TA •....•. NZl A.G ...... C C., .. T ... . NZ2 A.G ...... C C .... T ... . NZ6 ...... G. A.G ...... C C .•.. T ...• NZ4 ...... G. AAG ...... C .. T. TT . C •. Dunl ...... G. AAG ...... C .. T.TT.C .• Dun2 ...... G. AAG .....• C .. T.TT.C .. HermitPolO ...... • G. AAG ...... C .. T .TT .C .. MarloJetyl ...... G. AAG ...... C .. T. TT . C .. MarloJety2 ...... • G. AAG ...... C .. T.TT.C .. HermitPoi9 ...... G. AAG ...... C .. T.TT.C .. SanRemoJyl ...... G. AAG ...... C .. T. TT . C...... •... E.modestus ...... G. AAG ...... C .. T. TT • C...... E.kingii ...... GT AGG ...... C .... CTAC .... A ...... T. purpuras ...... G. AAG...... T. TT . C. . . . A .....•. Gri ffithP2 TCGACCCATA ATATTTTACA TGATCTGAGG B. crenatus ...... T ... C ...... T C.polymeru ...... G ...... C ...... T M. tintinna ...... T ...... G ...•..••• T T. squamosa ...... G .. C ...... •. T I. quadri va ...... TT .. G.T ...... T B.glandula ...... T ...... G ...... ••• T S.balanoid ..••.. T .....•...... G .•.•..•••• CapeConraB ...... •• T Aireysinl6 ...... T SorrentoB2 ...... T SBPortlndl ...... T SorrentoB3 ...... T BerryBeall ...... •. T CapeConra3 ...... ••• T BlackRock3 ..•••.••. T SBPortlnd2 .•.••.••• T 185 Appendix 2 Sequence Alignments ScottsHeaB .T. .AT-- HermitPoi7 .G. .T HermitPoiB .G. .T Aireysinll .G. .T BlackRock2 .G. .T SBPortlnd3 .G. .T GriffithP9 .G. .T SorrentoBS .G. .T HermitPoiS .T. .T HermitPoi6 .T. .T CHeaNorthS .T. .T M. spinosus .T. c. .T M.aquila .T. c. .T C.bisinuat .G. c. .T A.psittacu .T. .G .T LondonBri9 .T. .AT. LondonBrlO .T. GAT. .T M.californ . T. c . .T B.perforat .T. c. .T C.brunnea .T T .japonica .T. .G P.polymeru . T. .A. c . .T C.stellatu .T. .T C.challeng .T S.cariosus .T. c. .T NZl .T NZ2 .T NZ6 .TT NZ4 .TT Dunl .T Dun2 .T Hermit PolO .T MarloJetyl .T MarloJety2 .TT HermitPoi9 .T SanRemoJyl .T E.modestus .G E.kingii .TT. .A. .G .T T.purpuras . T. C . .T 186 Appendix 2 Sequence Alignments A2.4 Alignment of Elminius 16S rRNA Sequences Sequence alignment of partial 168 rRNA sequences for samples of Elminius from Australia and overseas. 36 species, 543 sites Name Sequences PI3 TCGCCTGTTT TAACAAAAAC ATTTCCTCTT AGAAAAAG-A GGTAAGGCCT GCTCACTGAT GB1.2 •...... •.... TT •...•.... C .•...••....••.• G PIS PI9.2 PI9.4 GJ1.2 A.- ...... TC ••..•• • ... C ...• A PAl.l A.- ...... TC ....•. • .•. C ..•• A PA1.2 A.- ...... TC •.•.•• • ... C .•.• A PA2 .1 . .TC ....•• • .•.•.•.• A PA2.2 A.- ...... TC ....•• .... C .... A MJl MJ2 ... G ...... C2A A.- ...... TC •..••• . •.• C .•.• A CSA A.- ...... TC •...•. . ...•.... A NZ4 C6.1 A.- ...... •. TC •....• ••..•..•. A KI1.2 A.- ...... TC •..•..••..••...••.•...••• A KI1.4 A . - ...... •..• T . . • . TC •.••• G • • . • • . . • • • • ••• C ••.• A KI4.1 A.- ...•...... •.•.•.. TC ....••.•• C •.....••.•..... A KI4.2 A.- ...... •...... •• TG •....•..•••.•.•••...•• CTGA KIS.l A.- ...... TC ...••••.•.•.•.•...•• C .... A KI6.1 A.- ...... TC •.•.•• ••••.. -TGA Dunl A.- ...... TT •..••• • ••• C •••• G Dun2 HP9 Hbl A.- ...... TT ....•...... • G Pil A.- ...... PI4 PI7 A.- ...... PI9.1 A.- ...... E.kingii ---.T.CTC .. TG ... T.G. • ..••..•. A E. modest us .. TT ...... ••...• G PI9.3 A.- ...... T. rosea A . - ...... T • C GAT ... G . G • . •.... A. . . • ..•. A ..• - A. imperate A . - ...... C . GA TTG ... G • . .•... A. • . . . . • . . •.• SRl PI3 AAATTAAAGA GCCGCAGTAT TCTA-ACTG- TGC-TAAGGT AGCATAATCA TTAGCCTTTT GB1.2 T ...... C ..•...... •...... C ...... •. PIS PI9.2 PI9.4 GJ1.2 PAl.l ...• G ..... PA1.2 PA2.1 PA2.2 MJl ----.---- MJ2 C2A ••. G •••.•• CSA ..•. N .... N 187 Appendix 2 Sequence Alignments NZ4 ---.------C6.1 KI1.2 KI1.4 KI4.1 KI4.2 ... A.T ... . KIS.l ...... c .. . KI6.1 ... A.T ... . •..•.•.•• G Dunl T ...... c ...... Dun2 HP9 Hbl T ...... C .•.•....•••.•• G ..•. Pil PI4 .T ...... PI7 PI9.1 E.kingii T ...... •.. -TGC ...... T.T ..... E.modestus T ...... c ...... PI9.3 T .rosea .GT ...... C .. G ...... T ..... A. imperate A .. G .....• •..• T ...•• SRI PI3 AATTGGAGGC TGGTATGAAT GGCTAAACGA GAAATTGACT TTTTTTATTA TACAGATCTA GB1.2 . . . • . A .•.. .. A. C ... G • PIS PI9.2 PI9 .4 c ...... GJ1.2 •. G ••• A ••• . ..• A .. T .• PAl.l • . G ... A ••. ..•. A .. T •. PA1.2 .• G .•. A .•. • •.• A .. T •. PA2.1 • • G ••. A ••• .. T.A .. T .. PA2 .2 • . G ••• A ••• ...• A .. T •. t-1Jl MJ2 C2A •. G ••• A .•• . •.• A .. T •. CSA . . G .•. A .•• .•.• A .. T .. NZ4 C6.1 • • G ••• A .•• ...• A •. T .. KI1.2 • • G ••• A •.. •... A .. T .. KI1.4 •. G ... A ...... ••.. A •. T .. KI4.1 .. G ... A ....•...... G ...• A .. T •. KI4.2 • • G .•• A •...... A .. T .. KIS.l . . G •.. A .•• .... A .. T •. KI6.1 . . G ... A ... ..•• A •. T .• Dunl ..... A ...... A.C .. TG. Dun2 HP9 Hbl ..... AC ... .. A.C ... G. Pil PI4 PI7 PI9.1 •.•••.. T .. E.kingii ...... A. .. ATAT.TG . E .modest us . . . . . A ...... A.C ... G . PI9.3 • ...... T .. T. rosea ...... A. .. T ...... CA ...... GC . . . . G. A ... A. A. imperate ...... A. .. T ...... G .. CAG ...... G . T .. TG . SRl PI3 ATTTAATTTT TTAGTGAAAA AGCTAAAATT ATTTAGAAAG ACGAGAAGAC CCTATAGAGT GB1.2 PIS 188 Appendix 2 Sequence Alignments PI9.2 PI9.4 GJ1.2 .c ...... PAl.l .c ...... PA1.2 .c ...... PA2.1 . c ...... PA2.2 .c ...... MJl MJ2 .. c ...... C2A .c ...... CSA .c ...... NZ4 ------A TC ...... C6.1 .c ...... KI1.2 .c ...... KI1.4 .c ...... KI4.1 .c ...... KI4.2 .c ...... KIS.l .c ...... KI6.1 .c ...... Dunl Dun2 HP9 Hbl Pil PI4 PI? PI9.1 E.kingii . C .. T ..... T .. C ...... E. modest us PI9.3 T.rosea T .. C •..... A. imperato ...... c ... G ...•.... G GG.C ...•.• SRl PI3 TTTATATAAA AAATTTATTT ACTTTAGTAG TTTTTCAAAA GTTTATATAT CTTAT-ATAT GB1.2 ...... GG . . A . . . . . T . . C . T ...... GG • . . . A .. C .. TA . . TC .•.....• PIS ...... •...... •...G •.•.•.....•. PI9.2 ..••..• G .. PI9.4 .. C ...... G .. GJ1.2 .... C. T ...... GT ...... ••. A.G T ••.....•. PAl.l . . . . C.T ...... G ...... A .. T ...•..... PA1.2 .... C.T ...... G ...... •...• A .. T ....•.... PA2.1 . . c ...... C. T ...... GT ...... A.G T ...... PA2.2 . ... C.T ...... G .•.....••... A .. T ...•.•.•. MJl ...... C .. T ...... G ...... MJ2 •. C ...•. G •..•.... G .. C2A ...... C.T ...... G .....•..•..• A .. T ...... CSA .. c ...... C. T...... GT...... A. G T ...... NZ4 . . G .. A. . . . . T .. C. T ...... GG . . . . A .. C .. TA. . TC ...... C6.1 ...... C. T ...... GT ...... A.G T ...... KI1.2 ...... C. T ...... GT ...... A.A T ...... •. Kil .4 ...... C.T ...... GT ...•...... A.G T ...... KI4.1 .. c ...... C. T .•..•.• GT •..•.•..... A.G T ....•.... KI4.2 ...... C.T ...... GT •...... A.G T •...... i 189 Appendix 2 Sequence Alignments PI9 .1 •..••..••.•..••.• G •. E.kingii ...... C...... A .. T. . . TTC. A. T . . . A .. ; •. CT. G ... A.A. AT. TA •..• G ..• E.modestus ...... GG .. A. . . . . T .. C. T. . • . ..• GG .... A .. C •. TA. . TC ••..•..• PI9 .3 •..••..••.••.••.• G .. T.rosea ...... TTT G ... AAT ... TTC .A.T ... A ..•• TTT. G A.AA.AT.T. T ••.. A ...• A. imperate ...... •. G G .• GAATC.C TTC .. CT. G. A ..•• TT .. G A-AG .. G.T. GGG .. T •... SRl ...•..• G •• PI3 TTAGTTGGGG CGACATTAAG ATAAAAAAAA CTCTTGATTC TTTTAACTTT CATAAAAGTT GB1.2 .. T ...... T .•• T •.. A ..••.. T .••...... PIS PI9. 2 PI9.4 ... ; ..... T GJ1.2 .. T ...... • .. T ...... ••... T .•. T T ... G .•. AA PA1.1 .. T ...... T ...... T ... T T ..• G .•. AA PA1.2 .. T ...... T ...... T ... T T .•. G ... AA PA2 .1 .. T ...... T ...... •. T ... T T ..• G .•. AA PA2 .2 .. T ...... T ...... •.... T ... T T .•• G ..• AA MJl ...•....• T MJ2 •..•....• T C2A .. T ...... T ...... •. T ... T T ..• G ..• AA CSA .. T ...... T ...... •...• T ... T T ..• G .•. AA NZ4 . . T ...... •. T ..• T ... A ...... T ..•..•... CG .1 .. T ...... T ...... •. T ... T T ..• G .•• AA KI1.2 .. T ...... T ...... •.... T ..• T T ..• G ••• AA KI1.4 .. T ...... T ...... • T .•. T T ..• G ... AA KI4 .1 .. T ...... T ...... T .•• T T ..• G •.• AA KI4 .2 .. T ...... T ...... T ... T T ..• G .•• AA KIS .1 .. T ...... T ...... •.. T ... T T ..• G .•• AA KI6.1 .. T ...... T ...... T ... T T ..• G ... AA Dunl .. T ...... • .•.. T ... T ... A ...... T ..•...•.• Dun2 ...... • T HP9 Hbl .. T ...... T ..• T ... A ...•.. T ...... •.. PI1 PI4 PI7 PI9.1 E.kingii . . T ...... T ...... T ... T .. GA ...••. T ... T ... A. E. modest us .. T ...... T .•• T ... A ....•. T ...... •.. PI 9. 3 T.rosea .. T ...... T ...... G ...... T .•• T .AAA ...... AT .•...• AA A.imperato .. T ...... T ...... • G ...... TT .. A AAGA ...... T ..•.... GA SRl PI3 CAGTTTGATC CTTTAAAAAA GATTATAAGA AAAAATTACC TTAGGGATAA CAGCGTAATC GB1.2 T .. C ...... C ...... •... • · . · · · · · · · · · · · · · · · · · · · PIS PI9.2 PI9.4 GJ1.2 T ...... PAl .1 T ...... PAl. 2 T ...... PA2 .1 T ...... PA2. 2 T ...... MJl MJ2 C2A T ...... C5A T ...... NZ4 T .. C ...... c ...... C6. 1 T ...... •.. KI1.2 T ...... •.. Kil. 4 T ..... , •.. 190 Appendix 2 Sequence Alignments KI4.1 T ...... KI4.2 T .•...... KIS.l T ...... KI6.1 T ...... Dunl T .. C ...... ·.. c ...... Dun2 HP9 Hbl T .. C ...... c ...... Pil PI4 PI7 PI9.1 E.kingii TT ...... A...... A ... . E .modest us T .. C ...... c ...... PI9.3 T. rosea TT.AA ...... C ...... A. imperate AG...... CC . GT .. GG ... C ...... SRl PI3 TTTTTTGAGA GTTCCAATCG ACAAAAAGGT TTGCGACCTC GATGTTGGAC TAAAATTTAG GB1.2 ...... T ...... •...... •...... •...... •.. PIS ...... PI9.2 PI9 .4 ...... c .. I' GJ1.2 ...... A ...... T ..•...... PAl.l ...... A ...... T .... . PA1.2 ...... A ...... T .... . PA2.1 ...... A ...... T .... . PA2 .2 ...... A ...... T .... . MJl MJ2 C2A .•.... A ...... T .... . CSA ...... A ...... T .... . NZ4 .... T .... . C6.1 • . . . . . A ...... T .... . KI1.2 ..•... A ...... T .... . KI1.4 ...... A.A. A ... T .... . c ...... KI4.1 •..... A ...... T .... . KI4.2 ...... A ...... T .... . KIS .1 ...... A ...... T .... . KI6 .1 ...... A ...... T .... . Dunl . . . . T .... . Dun2 HP9 Hbl .... T ..... Pil PI4 PI? PI9 .1 E.kingii . A . CC ...... T ...... GG ...... E. modest us .... T ..... PI9. 3 T. rosea .... T .... . A. imperate .... T ...... G. SRl PI3 GCAAGGTGCA GCAGTTTTGC TTTAGGGTCT GTTCGACCCA TAATATTTTA CATG-ATCTG GB1.2 PIS PI9 .2 PI9 .4 GJ1.2 .c ...... PAl.l .c ...... 191 Appendix 2 Sequence Alignments PAl. 2 ·.C ...... PA2 .1 .c ...... PA2. 2 . c ...... MJl MJ2 C2A .c ...... CSA .c ...... NZ4 C6.1. .c ...... KI1.2 .c ...... KI1.4 .c ...... KI4 .1 .c ...... KI4. 2 .c ...... KIS .1 .c ...... KI6 .1 .c ...... Dunl Dun2 HP9 Hbl .... G ... C. Pil PI4 PI? .... A ..... PI9 .1 ...... Y ..•. Y .....•• E.kingii . T . G...... C. C . A . . ... A...... TT ... A...... G ...... E.modestus .G .•...... PI9.3 ----.----- T. rosea ...... T ...... A ...... ••.... T. A. imperato ... G ...... C ...•...... •.•.•..• G SRl PI3 AGT GB1.2 PIS PI9.2 PI9.4 GJ1.2 PAl .1 PA1.2 PA2 .1 PA2.2 MJl MJ2 .T. C2A C5A NZ4 .T- C6.1 KI1.2 KI1.4 KI4 .1 KI4. 2 KIS .1 KI6 .1 Dunl Dun2 HP9 Hb1 PI1 PI4 PI? PI9 .1 E.kingii E . modest us .. G PI9.3 192 Appendix 2 Sequence Alignments T. rosea A. imperato SRl 193 Appendix 2 Sequence Alignments A2.5 Alignment of Catomerus polymerus Cytochrome Oxidase I Sequences Sequence alignment of partial Cytochrome Oxidase I sequences for samples of Catomerus polymerus from Australia. 34 species, 611 sites Name Sequences BB4 AACCTTATAT CTAATCTTTG GTGCTTGATC TGCTATAGTA GGTACAGCTC TTAGAATACT BPl ...... T ...... BP2 T ...... THl T ...... TH2 T ...... CHSl T ..... C .. . CHS2 T ...... CB2 T ...... PBS PB6 PSB BBlS CpC7 CpCB SBP3 ...... c Ail AI2 BRl BR2 ...... CA. GP9 GPlO ECl SGl T ....•.... SG2 WC2 T ...... WCl T ...... LB7 LBB SBS SB6 T ...... FM7 ClB7 ClBB Bi9 A.imperato ...... C T .... T ..... A .. A ..... C ...... A ..... C ...... G.T .. T.rosea ... T ...... T .... T ..... G .. A ..... A ..... G ..... G ..... C ...... G.CT. BB4 AATCCGGGCT GAACTAGGTC AACCCGGCAG CCTGATTGGT GATGATCAAA TTTACAATGT BPl ...• T ..•.. T ....•...• BP2 .... T •.••. T ....••.•• THl .... T ..... T ...... TH2 ...• T .•... T ....••.•. CHSl .... T ..... T ...... CHS2 .... T •.••. T ••..•••.• CB2 ...... A. .... T .•••. T •.••••••• PBS ...... c .. PB6 PSB 194 Appendix 2 Sequence Alignments BBlS .. G ...... CpC7 CpC8 ... ; ..... c ..... c .... SBP3 Ail •.... G ...... A ...•. AI2 BRl BR2 ...... c GP9 GPlO ECl .... T ..... T ...... SGl .... T ..... T ...... SG2 WC2 .... T ..... T ....•.... WCl .... GG.T ...... T ..... T ...... LB7 ..... c .... LB8 ...... c SBS ..•••. A ... SB6 ••. A .•...• FM7 ...... c ClB7 ••. A .•••.• ClBB Bi9 A.imperato ... T .. A .. A ... T ...... T .. A .. A .. A ..... A ..... C ..... C .. T .. C .. T.rosea T .. T .. A .. A ...... A ..... A .. A .. A .. T ..... A ..... C .. G.. C .. T .... . BB4 AATCGTCACT GCTCATGCAT TTATTATAAT TTTTTTCATG GTTATACCTA TTATAATTGG BPl ...... G ...... BP2 ...... • G •.••...••.. A THl .•...•• G •• TH2 •...••• G •• CHSl ....•.. G •. CHS2 •.....• G •. CB2 ...... G ..••...••.. A PBS ...... A PB6 PS8 BBlS ...... A CpC7 CpCB SBP3 ...... A Ail .... G ..•.. AI2 BRl BR2 GP9 GPlO ECl ....••. G •. SGl .....•• G .• SG2 WC2 ...... G •.•....•... A WCl •..•..• G •.••••••• G •. LB7 LB8 SBS .. ; ..... c. SB6 FM7 ClB7 ClB8 Bi9 A. imperato . . . T .. A .. A .. C .. C .• T. C ...•• T .• A •. A ..•.. A • T.rosea C .. T .. T .. A .. C .• C .. T. ... C .• T .. A ...... c .. 195 Appendix 2 Sequence Alignments BB4 AGGTTTTGGG AATTGACTTT TACCTCTTAT ATTAGGAGCT CCAGACATAG CTTTCCCCCG BPl ...... C ...... G •...... T ...... • T .... . BP2 •••... C ...... •....•..•...•. G •...•...... T •.••....•.. T •..•• THl ...... c .. . G ....•...•.. T ...•••..... T .•..• TH2 ...... c .. . G •...... T ..•.....•..•••.•• CHSl ...... c .. . G •...•...•.. T ...... •••.. T ••.•. CHS2 ...... c .. . G •....•.•... T ...... •.•. T ••... CB2 ...... c .. . G •...••..••. T ...... •.•. T •...• PBS .c ...... PB6 PS8 BBlS CpC7 CpC8 SBP3 Ail G ....•...• AI2 BRl BR2 GP9 GPlO ECl G .••.. C .. . G ....•...•.. T .•.•.•.••.• T ••.•. SGl ...... c .. . G ...... •• T ....•.••••• T •..•• SG2 WC2 ...... c .. . G ....••..•.. T .•••••.••.• T ••..• WCl c ..... c .. . G .....•..•.. T .•.••..•.•. T ••.•• LB7 LB8 SBS SB6 FM7 ClB7 ClBS Bi9 A . i mpe rat o T .. A ..... A ...... A...... G .. C .. T ..••. G. . C .•..• T •• T. rosea ... G ..... A ...... C ..... CT .A ...... C ..... T .. G .. C ..... A .. BB4 ATTGAATAAT ATAAGCTTCT GGCTCCTTCC CCCAGCTCTT ATATTACTGA TTAGAGGATC BPl ...... A ...... BP2 ...... A. THl ...... •. A. TH2 ...... A. CHSl ...... A. CHS2 ...... A. CB2 ...... T.A ... T ...... PBS ... A ...... PB6 ..... T .... T ...... PSB BB15 CpC7 CpCS ...... A. SBP3 ... A ...... Ail AI2 ...... A. BRl BR2 GP9 ...... A. GPlO ECl ... A ...... A. SGl . . ; ...•. A. SG2 T •...... WC2 ..•..••. A. WCl ..•..... A. 196 Appendix 2 Sequence Alignments LB7 ..... T .... T ...... • . ..•..• G .• LB8 SBS SB6 FM7 ClB7 ClB8 Bi9 A. imperate . C. T ..... C ..... A. . . . . A .. TT. A . . T .. C...... C. TT. A, T. rosea .C.T ...... A ..... A .. T .. C .. T ...... A ... C.TT.A. BB4 TCTTGTAGAA GCAGGGGCAG GAACAGGATG AACAGTTTAT CCACCACTAT CCAGTAATAT BPl ...•...... A .....•...... ••.•. G ••••••.••••.••••••••.•• BP2 ...•...... A ...... •...... •.•. G .•...•••.•• , ..••..•..•. THl ...... A .....•.•...... •. A •.••.••..••••.••.....•. TH2 •••••••••...••• A .•..••.•...••.•.•.•• G ..••.••.••.••.•••..•.•• CHSl ..••.•...... A •....•..•.....•.•... G ..•....•••.•.••.•••...• CHS2 ..... A ... . •••.•. G .•• CB2 . . . . . A ... . • ••.•. G ..• PBS PB6 PS8 BBlS .. c ...... CpC7 epee •.••.• A .•• SBPJ Ail AI2 ... c ...... BRl BR2 GP9 GPlO ECl . . • . . A .•.. .•.••. G .•• SGl . . . . . A .... ••..•• G .•• SG2 WC2 . . . . . A ... . ••..•• G ..• WCl C .... A ... . •....• G .•• LB7 LB8 SBS SB6 FM7 ClB7 ClB8 Bi9 A. impera to A .. A ...... C .. A .. C. . . . T .. C .. C .. T .. CT. . . . T .. C .. C . . T. rosea .T.A ...... A ...... C .. C .. C .. T .. T .. T .. T .. A ..... BB4 TGCTCACTCT GGTGCATCAG TAGATCTCTC AATTTTTTCT CTTCACCTAG CCGGAGCTTC BPl ...... G ..•...•. T ...... T .. . BP2 ...... G ...... T ...... T .. . THl ...... G ...... T ...... T ..• TH2 ...... G ...... T •...... T ... CHSl ...... G ...... T .. . ..•.• T ..• CHS2 ...... G .....•.. T •. . ...•. T •.. CB2 ...... • G .•...... G ...... T •. . ...•. T •.. PBS ...... T ... PB6 PS8 .T ...... BB15 .. , ... T .•. CpC7 .T ...... CpC8 ...... c ....•• T ••• SBP3 197 Appendix 2 Sequence Alignments Ail ...... T ... AI2 ...... T ...... T ..•.. BRl ..•... T ...... BR2 ..•.•. T ... GP9 GPlO ...... T ... ECl ...•..•• G ..•....• T .• ...... T .•. SGl • . . . . . • • G ..•....• T ...... T ... SG2 WC2 ...... •• G .••..... T .. ..•••. T .•. WCl ...... G .•.....• T .. .•.... T .•. LB7 LB8 ...... T ... SBS SB6 FM7 ...... T .•. ClB7 ...... T ... ClBB Bi9 A. impera to . . . A .. T .. . . . A .. C ...... c .. c .. c .. c ...... T. rosea c ...... A .. C ...... T.A ...... T .•. BB4 TTCTATTTTA GGGGCAATCA ATTTTATATC CACAGTGATT AACATACGGG CTGAGACTCT BP1 BP2 THl TH2 CHSl ..... G .•.. CHS2 CB2 ...•. G .•.. PBS PB6 PS8 .. A ....•.. BB15 CpC7 CpCB SBP3 Ail AI2 BRl BR2 GP9 .... A ..•.. GP10 ECl SGl SG2 WC2 ..... G .•.. WCl . .. G.G .... LB7 LBB S85 SB6 FM7 ClB7 ClBB Bi9 A. impera to ...... C. T .. A .. T. . . . . C...... T ...... A. . C .. A .. CT. T. rosea C .. C ... C.T .. A .. T .. T .. C ..... G .. T ..... T ..... T ...... A .. C.· BB4 AACCTTCGAC CGTATTCCTC TATTTGTCTG AAGAGTTTTC GTAACAGTAA TTTTACTTCT BP1 BP2 ...... "' ...... TH1 ••••••••••••• ".Ill ...... ' 198 Appendix 2 Sequence Alignments TH2 CHSl CHS2 CB2 .. T ...... • PBS •. A ....•...... c .. c ...... PB6 PSB ...... T ... BBlS .. A •.•.•.. CpC7 CpC8 ...... G. SBP3 Ail ...... T AI2 BRl BR2 GP9 GP10 EC1 SG1 .. A ...... SG2 WC2 .. T •••.•.. WC1 • • . . . . G ... LB7 LBB SBS SB6 FM7 .. A ...... ClB7 ClBB Bi9 A.imperato ... T .. T ..... CC.A .. AT .... C .. T ..... C ...... A.T ...... C.T .... . T . rosea ...... T .. CC ...... T ..... T . . . .. T ..... T A. C .. T . • . . . . C. C .... . 884 TCTATCTCTC CCAGTTTTAG CAGGAGCAAT CACTATATTG CTAACAGATC GAAATCTAAA BPl ...... G .. G .• T ...... A .. T ...... BP2 .... G ..... T ...... A .. T ...... THl . . . . G ..... T ...... A .. T ..•.... TH2 .... G ..... T ...... A .. T .•....• CHSl .... G ..... T ...... A .. T ...... CHS2 ...... G ..... T ...... A .. T ...... CB2 ...... G ..... T ...... A .. T .. G ... . PBS ..... G ...... G ....•...... A ...... PB6 .... G ...... • G .••.•.. PSB . . . . G .... . 8815 .... G ...... CpC7 .... G ...... A CpCB .... G ...•. T •.....•. A SBP3 .... G ...... Ail ...... T . . . . G ...... A AI2 .... G ..... : ...... A BRl .... G ...... A BR2 .... G ...•...... A GP9 .... G ..... GPlO . . . . G ...... •..•.. A ECl .... G ..... T ...... A .. T ...... SGl .... G ..... T ...... A .. T ..••... SG2 .... G ...... •.••..•.•..•....••• WC2 . . . . G ..... T ....•.•. A .. T ••..... WCl .... G ..... T .....••. A •. T ...... A LB7 .... G ...... •...••.•.••...•.•• LB8 . . . . G ...... ••.. A •.. T •.•.•• SBS .•.• G .•••. SB6 .... G •.... 199 Appendix 2 Sequence Alignments FM7 .... G ...••••.••••.. A C1B7 .... G ...... •.•. A C1B8 .... G ..... Bi9 .... G ...•. A. imperate C .. T ... T . A . . . . . CC . . . . C ..... T . . T . . . . . GC . T .. T ..... C ...... T .. T. rosea ...... C .. T . . . . . AC ...... T . . T . . A . . ... A T .... T . . . . . G ...•. T .. BB4 TACCTCATTC TTTGACCCTA CTGGTGGTGG AGACCCTATT TTATATCAAC ACTTGTTC BPl •...... •...... •. G •...... • C ...•...... •..•.. BP2 ..•...... G •...•...• C ..••.....••..•... THl ...... G •...•...• C ••....•••...•.... TH2 G ...•...•. C •...•.... CHSl •.•...• G .. G •..••..•• C ...•.•••. CHS2 G ...... • C •.••.••.. CB2 G ..•...••• C .•.••. C.A C .•••••• PBS PB6 PS8 BBlS CpC7 epee SBP3 Ail AI2 G .•.•••.•• BRl BR2 GP9 GPlO ECl ....•.. G •• ...... c ...... SGl G .••..•.•• C .•.•....• SG2 WC2 G •...••••. C •..•..•.• WCl .G ...... G ...... C. C .. A ...... LB7 LB8 ....•.. G .. SBS SB6 FM7 ClB7 ClB8 ...... G ... Bi9 A. impera to ... A .. C .. . .A .. A .. A ..... T ...... C.T .. C ...... A .. . T. rosea . . . A .. C ...... A .. A .. A .. A ...... •... C ....•..• G . 200 Appendix 2 Sequence Alignments A2.6 Alignment of Catomerus polymerus Control Region Sequences Sequence alignment of partial Control Region (D-loop) sequences for samples of Catomerus polymerus from Australia. 34 species, 611 sites Name Sequences GP9 TCTACTGAGA ACACCTACCA ATTATTAATT A-TTAATCAA ATTCTCACAC AAATTTACAT GPlO BPl ..... T ... . CBl ..... T ... . 886 ECl ..... T ... . CB2 ...... T...... T ... . CHSl . .... T ... . CpC7 CpCB EC2 ..... T .... PSB SG2 THl ...•. T ...• TH2 ..... T .... WC2 ..... T •... BB3 BB4 .A .•.. A .. . SGl ..... T ... . LB7 LBB BP2 ....• T .... BR2 BRl SBS Ail WCl ..... T .•.. SBP3 Bi9 ClB7 ClBB FM7 ...... G. T. rosea TTCT .. TA-T .CA.C.CTA .. GC .. T.T.T TACTA-G.TT ... C ...... Aimperator . TTT .A .AAT TCA .. CT .AA .GAA ..... T T ... AAG. C. TT.C ....•. GP9 GTAAAACAAC TAACTAGCTA AAACAACAAC TCGGACCTCA ACGATCTT-- CAATAA- -AG GPlO BPl ...... A •. CBl ••..... A •. 886 ECl ...•. T.A .. CB2 ...... A •. CHSl ...... A .. CpC7 CpC8 EC2 •...... A .• PSB SG2 •• 'f ••••••• TH1 • • • • • • • A •. TG .••.•••• TH2 •••••.• A •• WC2 .••••.. A .. 201 Appendix 2 Sequence Alignments BB3 BB4 SGl ....•.• A •. LB7 LBS T ...•..... BP2 .....•. A •. BR2 BRl SBS Ail WCl ....••• A •• SBP3 Bi9 ClB7 ClBS FM7 T.rosea ... G.TTT .. A .. AA.A .... G .. T ..... A ...... T .. AG ... CC .. GTCTC Aimperator ... G.TTT.T AT.AC ...... T ..... A ...... T .. AAAA T.T.T.TC.T GP9 TGAAAAATTT TACTATTTAA TTTAATTTTT TTAGCCATAT AACTTTTTTT -AGGAGTTTA GPlO BPl . A ...... TC ...... CBl .A ...... c ...... SB6 .. T •...... ECl . A ..•...... c ...... A .•..... CB2 .A ...... c ...... CHSl . A ..•...... c ...... CpC7 .••.• A .•.• epee EC2 . A .••...... c ...... PSB ..... T ... . SG2 THl . A ...... c ...... TH2 . A ...... c ...... WC2 . A ...... c ...... 883 884 SGl .A ...... c ...... LB7 T .•.••...• LBB BP2 .A ...... c ...... BR2 BRl •••.••..• G SB5 Ail WCl . A ...... e.G .... SBP3 Bi9 ClB7 ...... c T ..•..•.•. ClBB .. T ...... FM7 .A ...... T. rosea . T ..... CAC .TTC.G.ACC AAC .. AAA.C .. CCATG.T. TTT ... AAAG GTAATT.AG. Aimperator . TT. T . C. . . . TTC . AAA. . AA .. CAAAAA CA . AA T- .. A .• A. AAAAAG A. AA . T. CC . GP9 TATTATGTAC AATTTAACTA AATATACAAC TTTTTAA-GC TACAACATGA CTCTTATAAT GPlO ..•.•...... G ...••.•..• G ...•.•...•. AG ...• C ••.•• BPI ••••••.. C .•...... •...•.• GA ... " ... - ...... A ...... C.CT .. CBl ....•... C ...... C ...... • GA ..• . . • . - . • • . • • •.•• A • . . • • ••• C . CTT. SB6 . . . . • • G ...• G .••.•.••..•• C •.. G. ECl ...... c...... GA .•• .... - .....•..•. A •••.... AC.CTT. CB2 ...... c...... GA ..• . .•. - . . • . . • ..•• A • • • • • ..• C • CTT. CHSl ...... c. ..• T.GA ••• . ..•• A •.•••..• C.CTT. CpC7 . ...•• G •..•..• G •••••.... C ..•.• 202 Appendix 2 Sequence Alignments CpC8 •..•.. G •..•.. G.G ..•. .T ...... EC2 ...... c ...... GA .•. •.... A .•..•... C. CTT . PSB . . . . • . G ... • . • . . • G ...... c ..... SG2 G ...... • G ... TH1 ...... c...... GA ...... A •...... C.CTT . TH2 ...... c. . .. G. GA ...... A ...... C. CTT • WC2 ...... c...... GA ...... A ..•..... C. CTT. BB3 •••••• G •...... c .... . BB4 . . . • . . G ...... • G ...... c .... . SGl ...... c...... GA ... C .... A ...... C. CTT. LB7 ....•. G ..• ...... c ..... LBB ...•.. G .•...... A ....•• G ..•...•..••. G ••.. C •.... BP2 ...... c...... GA ...... A ...... C. CTT . BR2 ...... G .•.•.... G •...... ••.••. G ..•. C •••.• BRl ...... c ..... SBS G ...... •...•• G •.•...•••.•.•..•. C •.•.. Ail ...... • . . . . . G ...... G •••• C ••... WCl ...... c...... GA ..• . .... A .. A. . ..• C • CTT. SBP3 .....• G ..• ...... cc ..... Bi9 G ...... •..•.. G.A .....•...... C •.•.. ClB7 ... TA ...... G .•••....•... G .••• C •••.• ClBB ...... ••...• G ..•..•....•....•. C •••.• FM7 ... GA ...... • G ..•.....•.•. C T.rosea .. A ...... T .. A .. TTA ... A.A.G.C .... C ... CC ... A.T .. AA. AAAAACA .. A Aimperator ...... C. C .. AA .. -AT T.A.A.A.TT AAAAA.TCA. C.A .... CA. A.T .. T .. TA GP9 ATATA-TATT TTATAGATTA GAGAATTAAT AAAAAAAGAA ATTGACCTCA GGAGACT--G GPlO .•• A .••••• BP1 ....•. T ... A ...... •...•..•• AG. • .• A •••.•. CBl ...... T ... A ....•....•.•.••• AG. • •• A .•••.• SB6 .•• A ••..•• ECl ...... T ... A ... G •.•....•.••. A •. ••• A .•••.. CB2 ...... T. . . A...... AG. . ...•.•.. G .•• A ...... CHSl ...... T ... A .....•....•....• AG .....•....•.•. A ••••.. CpC7 ...... G .. G ..•••••..•••....•...•.••••.••... CpCB ••• A •••••• EC2 ...... T ... A ...... •..... A •. ••• A ••••.• PSB ..•.••. A .• SG2 .•• A .•..•. THl ...... T ... A ...... AG. • •• A .••..• TH2 ...... T. . . A ... G ...... AG...... G ... A .••.•• WC2 ...... T ... A ...... • AG ...... A •••..• BB3 BB4 .. A .••.... SGl . . . • . . T ... A ...... •.... AG ...... A •....• LB7 . . . • ...... • ...... G ....••.• GG LBB T ...... G. ... A ...••• BP2 ...... T ... AG ...... G . . .• A .•••.• BR2 ...•....•.....••. G ...•.••••.•• .. . . • . . . . G .•• A .••.•. BRl ...... G .. •.. A .•...• SBS ....•.. G .• • .. A .•.•.. Ail ••. A •••••• WCl ...... C ... A ...••...•...... AG. . . . A ...... SBP3 .. A ...... •... G. Bi9 ClB7 ..•...• C ..... A ••..•. ClBB ...... "" ...... FM7 • • . . . . A ...... •.....•....••••.•.•.•••....••..••..A ••••.. T.rosea .CC.CCA.AA ... -- .CC .. A.T.TCG.CA ..• T.TTTC. GG- .. ATAGG AA.A.~QM.! .... Aimperator .. T.CC.CC ...... CC .. A.A ...... G.A .. GG- ..• AAA ...• A.T- ••• GP9 TTGCCTTCAA ATA--TACAA AAAGGTTATT TAAAATTAAA GGTTGATTT- --TGTTCTAT GPl. 0 ••....•.••••..• A ••• G ...••••.•••..•••••••••••.••••••••.• C.C •• 203 Appendix 2 Sequence Alignments BP1 . . . . . c ... . . - .....• A .... G.A ....•... A .....•••.. A. C .. CBl ..... c ... . . - ..•... A .... G.A ....•... A .. C •...... A.C .. SB6 ..•.. A. C .. EC1 . . . . . C ...... G .. - ...... A .... G.A ....•... A ... C ..••.. A.C .. CB2 ..... C ...... - ...... AC ... G.A ...... A ...... •.. A. C .• CHS1 ..... C ...... -.A .... AC ... G.A ...... A ....••.••. A. C .• CpC7 ..... C ...... A ...... CA ...... •.••. A.C .. CpC8 ..... A...... AC .... G...... • C. • .... C. C .. EC2 ..... c ...... - ...... AC ... G.A ...... A .•••...••. A.C •. PSB . . . . . A ...... •...... C ...... •.•.... C .. SG2 ...... G ...... • C ...... c ...... c .. THl ...... G .. - ...... A .... G.A ...... A ...... A.C .. TH2 .•... C...... - ...... AC ... G. A .. G. . ... A. . • • . . •••. A. C .. WC2 . . . . . C ...... A ..... - ....•. AC ... G.A ...... A ..•..•.••. A. C .. BB3 .•.... C ...... A ..... C ..... C ....•..••..• C .•.... A. C .. BB4 ...... •...... A ....•••.•...••. G ..••. G ..•.•••••.• A •••..•• C .. SGl...... C ...... G .. - ...... A .... G.A ....•..• A .....•• C •. A.C .. LB7 ...... G ...... C ...... •...•.••••... C .• LBB ..... A ...... •..•.•. CC ..•.••...... •••. C.C .. BP2 ..... c ...... - ...... A .... G.A ...... • A ..• C .•.... A.C .. BR2 . . . . . A ...... G ...... CT. . . • . • . • . • . • • .••. C. C .• BRl ..... A ...... •.. A ...... • A ..• C .••••..... C SBS ..... c ...... c ...... c .. Ail . . . . . A ...... •.•..•...•.•.... A .••••.•••••••• C.C •• WCl ..... c .... . - ...... AC ... G. A...... A...... ••.. A ... C SBP3 ...... c Bi9 ...... c ClB7 . • . . . A .... •. C.A •...••••...• C .. ClB8 • . . . • . . . . C ••• G ••...• ...... c .. FM7 ..... A ..... G •...... C.,. . .c ...... T.rosea .CA .. AGA.C .. TTTG.TT. GT.TAAA ..... T .... --. AA.CC.CA.T .. - .. A.A .. Aimperator G.A.TGAA ...... A.TC. TT .. AACT ... GG •. A.GG. AAC.T .. AAT ACA •. A ...• GP9 TTTTTT--CT ATTTTCTCTA AATTTCTAAT TCTATTTAAG CTTAATTTTT CAAACAAAAT GPlO ...... T ...... C ...... BPl . . . . . -A. T. . . • . • . • T .. T.A .•....• CBl ..... -c. T...... T .. T.A .••.... SB6 ...... T ... ECl ..... -c. T...... T .. T.A ..•.... CB2 . . . . . -c. T...... T .. T.A .•..... CHS1 . . . . . -C. T...... T .• T.A ••..... CpC7 ...... T ... CpC8 EC2 . .. . . -C.T...... T .• T.A ...... PSB ...... T .. . SG2 ...... T .. . THl ...... C.T...... •• T .. T.A ...... TH2 . . . . . -c. T...... T .. T.A .....•. WC2 . . . . . -c. T...... T .. T.A ...... BB3 C ..... T ...... c. BB4 ...... T .. . SGl . . . . . -C.T. • ...... T .. T.A ...... 187 . . . . . -.T .. . LBB ...... T .. . .G ...... BP2 ..... -C.T...... T .. T.A ....•.. BR2 ...... T ... BRl SBS ...... TT .. Ail WCl . . • . . -C.T. • •..••• T •. T.A .•..... SBP3 •..•.. T •.• Bi9 ••• G •••••• ClB7 ••.... T .•. 204 Appendix 2 Sequence Alignments ClBB ...... T ...... •...... •...... •...... FM7 ...... T ...... •...... •...•...•..•••.... C .•••.•...... T. rosea G .... AACAA ..... AC-- ... A .. T. CT. CTCC .. A ... TC.CT ... AC .TTTT .. C.A Aimperator A ..... ATAA .AAAAGCTC ... AC .. CCC .. TAT ... C.C AC .. T .. C.A T .T.T .... A GP9 TTCTCACACA AAAGTTTTTC TTATCTTTAA ATTAAAAGTT TAATGCTTTG TATTAAGCTA GPlO BPl CBl SB6 ECl . -A ...... CB2 CHSl CpC7 CpC8 EC2 PSB SG2 THl TH2 WC2 BB3 BB4 SGl LB7 LBB BP2 BR2 BRl SBS Ail WCl SBP3 Bi9 ClB7 ClB8 FM7 .. T ...... T. rosea . -T ...... A. A ...••.•.. Aimperator A-T ...... G .... A .. A. A ...••••.. GP9 CTGTATGGAC TACTCTAGAC CCAAACTATC TTTTATTTAG TTTAATAGCA ACGGGATTAC GPlO ... c ...... BPI ... C ...... A ... . CBl . . . C ...... AC .. . SB6 ... c ...... G •... ECl ...... A .. .A. C ...... A ... . CB2 ... C ...... A ... . CHSl . . . C ...... A ...• CpC7 ... c ...... CpCB ... c ...... EC2 ... C ...... A ... . PS8 ... c ...... SG2 ... c ...... THl ... C ...... A ...• TH2 ... C ...... A ...• WC2 ... C ...... A ...• BB3 ... c ...... BB4 ... c ...... SGl ... C ....•..••.. A •..• LB7 ... c ...... c .. LB8 ... c ...... BP2 ... C ...•...... • A ...• BR2 ... c ...... 205 Appendix 2 Sequence Alignments BR1 . . . . • • . A .. ... c ...... SBS ... c ...... AI1 ... c ...... WC1 ... C ....•..••.. A .... SBP3 ... c ...... Bi9 ... c ...... ClB7 ... c ...... ClB8 ...... A .. C ...... C ...... FM7 ... c ...... A ...... •...... G. T.rosea ...... TTA .. A .. G .•... T ... AA.A ...... AC- G ..•..• AT. GTA.T •. CG. Aimperator ...... A.A ATT .. C.A ... T .. ----- ..•• C.GAATT A ..•... AT. GTA.A .•... GP9 ACCGTTTCCT TTAGAGTCAA ATTCTACTGT TCCTGTAAAC CAGCTATTAA AA-TAAGATG GP10 BP1 .•.. A •...• CB1 .... A ..... SB6 ECl ...... G ...... A .... . CB2 .... A ...•• CHSl .•.• A ...•• CpC7 epee EC2 .... A ..... PSB SG2 THl .•.. A •.••• • ••..••.. A TH2 .... A ..•.. WC2 .... A ..•.. BB3 BB4 SGl .•.• A .•... •••...••. A LB7 . .A ...•... LBB BP2 .... T ..... BR2 T ...... BR1 SBS Ail WC1 .... A ..... SBP3 Bi9 ...... G ... ClB7 ClBB ...... c ... FM7 T. rosea .. TAC ...... CGC ...... ACG ...•..•. A ..... T.AT ...... -- •.•.. G •• Aimperator .. TAC ... T .. C. C ...... GCGA ...... T ..... T.AT...... •..... GP9 CCTGAAAAAA G GPlO BPl CB1 G ...... SB6 •.... T ... G - ECl ..... T ... . CB2 ..... T ... . CHSl ..... T ... . CpC7 CpCB ..... T .... EC2 •...... A PS8 ..... T .... SG2 ...•• T ..•. THl ...•• T ••.. TH2 ..••• T •... WC2 ..••• T •.•. 206 Appendix 2 Sequence Alignments BB3 ••... T ..•. BB4 ..... T ... G - SGl •.... T .•• G - LB7 .... T .. G-- - LB8 .•... T ... G - BP2 ..... T .... A BR2 ..... T ... G - BRl ..... T ... G - SBS ••... T ... G - Ail ..... T ... . WCl •.... T ... . SBP3 •.... T ... G - Bi9 ••... T ..•. ClB7 •.... T ... G - ClB8 •.... T ... . FM7 •...• T .•. G - T.rosea ...... G- - Aimperator ..... T .... 207 Appendix 2 Sequence Alignments A2.7 Alignment of Chtltamalus antennatus 16S rRNA Sequences Sequence alignment of partial 168 rRNA sequences for samples of Chthamalus antennatus from Australia. 34 species, 337 sites Name Sequences SHl AGACGAGAAG ACCCTGTAGA GTTTAA-AAT GTAATTTCTT TGTTTTATAA TAGATTTTCT CHNl ...... A ...... •...... •..•...... C ..•...... HPl ...... c ...... HP2 ...... c CB3 ...... c TH3 ...... c BP3 ...... c BP4 .... T ...... c GP2 C ... A.G ...... c GP4 ...... c BB2 ...... c BB13 ...... c BB14 ...... c SBl ...... c SB2 ...... A ...... c LBl ...... c LB3 ...... c SBPl ...... c CpCl ...... c CpC2 ...... c PSl ...... c PS2 ...... c PEl ...... c WH2 ...... c WP2 .....•... T StH2 ...... c Fml ...... c Fm2 ...... c Bil .. G .....••...... •. C Bi2 ...... c ClBl ...... c BBy2 ...... c THS_Cham . . . . . A ...... T . TG . A . . . . AAAA . . . CAA .. - .. T ..... C .. - . CB6_Cham . . . . . A ...... T . TG . A . . . . AAAA . . . CAA .. - .. T ..... C .. - . SHl ATAGAACAAT TTATGTGCAT TATTT-GTTG GGGCGACATT AAGATAAGAA AAACTCTTTT CHNl ...... c ...... HPl .... G ....• HP2 .c ...... CB3 TH3 •..... A .. . BP3 •..... A .. . BP4 GP2 GP4 .c ...... BB2 .c ...... BB13 BB14 881 SB2 .c ... c .... LBl LB3 208 Appendix 2 Sequence Alignments SBPl CpCl .c ...... CpC2 .•..... G .. PSl PS2 ... T ...... A .. . PBl ...... A ... WH2 WP2 StH2 ...... A ... Fml Fm2 ...... A ... Bil Bi2 ClBl BBy2 THS_Cham .. GA . TG .. A .. TG .. TTT . C . . .. T . . .. . •....• A .• CB6_Cham .. GA . TG .. A .. TG .. T. T . C .... T ...... A .. SHl TTTT-AAAAA CTTTTATGAA AGCATTGTTT GATCCTTAAA AAAAGATAAT AAGATAAAAT CHNl ... A ....•. HPl HP2 •.•.••• A •. CB3 TH3 BP3 ..... T .... BP4 GP2 •.•. T ...... A .. GP4 . . T .••.... BB2 ...... A .. BB13 BB14 SBl ••••• fl'- • •• SB2 LBl LB3 SBPl CpCl .. T .....•. CpC2 PSl PS2 PBl ...... T .. WH2 ...... T .. WP2 StH2 Fml Fm2 ...... T •. .•... T •••. Bil Bi2 .. T ....•.. ClBl BBy2 THS_Cham .. C ... T ...... C ... AGT .. GT.A ...... CT .... G .... C.A .... A .... . CB6_Cham .. C ... T ...... C ... AGT .. GT.A ...... CT .... G .... C.A .... A ... .. SHl TACCTCAGGG ATAACAGCGT AATCTTTTTT GAGAGTTCCT ATCGACAAAA AGGTTTGCGA CHNl HPl HP2 CB3 ...... c ... TH3 BP3 BP4 GP2 GP4 209 Appendix 2 Sequence Alignments BB2 BB13 BB14 SBl SB2 LBl LB3 SBPl CpCl CpC2 PSl PS2 PBl WH2 WP2 StH2 Fml ...... N Fm2 Bil Bi2 ClBl BBy2 THS_Cham ..... T ...... • C •••...•.• A CB6_Cham ..... T ...... C ...... A SHl CCTCGATGTT GGACTAAAAT TTAGACGTAG TGCAGTAGCT ACGTTTTAGG GTCTGTTCGA CHNl HPl HP2 CB3 .•..... A .. TH3 BP3 BP4 . . . . c ...... A ...... C .... . GP2 GP4 BB2 ...... T ... BB13 BB14 SBl SB2 LBl LB3 SBPl CpCl CpC2 PSl PS2 PBl WH2 WP2 Stl-12 Fml Fm2 Bil Bi2 ClBl BBy2 TH5 Cham .... G . A . G ...... CC . . . . T .. C .... . CB6_Cham .... G. A . G ...... CC . . . . T .. C . . .. . SHl CCCATAATAT TTTACA CHNl HPl 210 Appendix 2 Sequence Alignments HP2 CB3 TH3 BP3 BP4 GP2 GP4 BB2 BB13 BB14 SBl SB2 LBl LB3 SBPl CpCl CpC2 PSl PS2 PEl WH2 ... G .•.... WP2 StH2 Fml Fm2 Bil Bi2 ClBl BBy2 THS_Cham CB6_Cham 211 Appendix 2 Sequence Alignments A2.8 Alignment of Chthamalus antennatus Cytochrome Oxidase I Sequences Sequence alignment of partial Cytochrome Oxidase I sequences for samples of Chthamalus antennatus from Australia. 50 species, 658 sites Name Sequences SHl AACTTTATAT CTAATTTTTG GTGCTTGATC CGCCATGGTG GGGACAGCTC TAAGACTTTT SH2 CHNl ... C ...... T ...... T ...... C ....•.. C .. . CHN2 HPl ... T ..•.•• HP2 CB3 CB4 T ....•...... G ••... TH3 BP3 T ...... C. BP4 ...... c. CCl ccs ..•. A .•... cca .• T ...... CCll CC12 ...... c. CC13 ...... T. T ...... •• A ..•.. CT •...•••.. A CC14 ...... c ...... GPl A ...... GP2 GP3 ...... c. GP4 BBl BB2 BB13 BB14 SBl . . . . c ...... c . SB2 LBl T ...... •.. C. LB3 ...... c BR6 .. T .••••.. AI6 AI7 ...... c. SBPl ...... c. SBP4 ...... c PB2 ...... c CpCl CpC2 ...... c. PSl ...... c. PS2 WP2 ...... T WH2 StH2 Fml Fm2 ...... c. Bil Bi2 ...... c. ClB2 SB3Chamesi ... GC .... C T ...... CA . A .. A...... A .. A .. A .. T .. CT ..... A .. A . GPSChamesi . . . AC .... CT ...... C ..A .. A ...... A .. A .. A .. T .. CT ..... A.AC. 212 Appendix 2 Sequence Alignments SH1 AATTCGAGCA GAATTAGGTC AACCCGGAAG TTTAATTGGG GACGACCAGA TTTATAATGT SH2 CHN1 CHN2 HP1 HP2 CB3 CB4 TH3 BP3 BP4 CC1 ccs T •...... CCB CC11 CC12 CC13 T ...... c ...... CC14 •• T •••..•• GP1 GP2 GP3 c ...... GP4 BB1 BB2 8813 8814 SB1 c ...... 882 L81 .... T ..... LB3 8R6 AI6 AI7 SBPl SBP4 P82 CpCl CpC2 .... T ••..• PSl PS2 •..•. T .•.. WP2 ...... c. WH2 .c ...... StH2 Fml .c ...... Fm2 Bil .c ...... Bi2 ClB2 SB3Chamesi T ...... GT .. GC.T .. A ..... A ..... AC ...... A ..... T .. A. GPSChamesi T ...... T .. GC . T .. A . . ... A. . . . . A ...... A ..... T .. A. SHl AATTGTAACT GCACATGCAT TTATTATAAT TTTTTTCATA GTAATGCCTA TTATAATTGG SH2 CHNl ...... T CHN2 HPl HP2 CB3 CB4 TH3 BP3 BP4 •••.• A ..•• 213 Appendix 2 Sequence Alignments CCl ccs ...... c CCB CCll CC12 CC13 CC14 GPl GP2 GP3 GP4 BBl BB2 BB13 BB14 SBl SB2 LBl LB3 BR6 AI6 AI7 SBPl SBP4 PB2 CpCl CpC2 PSl PS2 WP2 WH2 StH2 ...... N. Fml Fm2 Bil ... c ...... • •.•• A .... Bi2 ClB2 SB3Chamesi ...... T ..... C ..... T ...... G ..... C .. T •.•.•.•. A .•.. GPSChamesi ...... T .. C .. C ..... T ..•...•. G ••••• C •• T ••••. G •• A .••• SHl GGGTTTTGGA AATTGATTAC TACCGTTAAT ATTGGGAGCC CCTGATATGG CTTTCCCACG SH2 CHNl CHN2 .c ...... HPl .... A ..... HP2 . . . . G ...... c ... CB3 CB4 TH3 BP3 BP4 CCl ccs .G ...... CCB CCll CC12 CC13 CC14 .G ...... •. GPl GP2 GP3 ..••...•. T GP4 BBl 214 Appendix 2 Sequence Alignments BB2 ...... c ... BB13 BB14 SBl SB2 .... T ..... LBl ..•.•... A. LB3 .... T ..... BR6 ...... T AI6 .... T ..... AI7 8BP1 SBP4 •..•.. G .•. PB2 ••.... G .•. CpCl CpC2 PSl PS2 .c ...... WP2 ••• G .•.... WH2 ...... c ... StH2 .c ...... Fml Fm2 Bil ...... c ... Bi2 A ...... ClB2 SB3Chamesi A .. A ..... T .... CC . . . . . C ....•.. A ....••.. A. • .•...• T •• GPSChamesi A .. A ..... T .... CC . . . . . C ...... A ...... A...... T .. SHl ATTAAATAAT ATGAGCTTTT GACTACTACC TCCTGCTTTA ATATTATTAA TTAGTGGGTC SH2 CHNl . . . . . T .....• T ••...•• .... c ..... CHN2 ...... T .. HPl HP2 ...... c. CB3 ...... c. CB4 TH3 ..... T.G .. BP3 . . T ...•...... c .... . BP4 .. T .•.•.•. . ... c .... . CCl ...... c ccs ...... c .. CCB CCll ..•. A ••..• CC12 . . T ...... c ..... CC13 CC14 .. T ..•.... GPl GP2 GP3 .. T .•...... c ..... GP4 ..... T .... BEl ...... c BB2 ...... c. BB13 ...... c. BB14 881 • . T ....••• .... c ..... 882 L81 ...... T ..... L83 ...... C ...•.•.. G •• BR6 ...... c. AI6 AI7 •• T .••.•.• .... c .... . S8Pl . . T ••...•. .... c .... . S8P4 ...... c. 215 Appendix 2 Sequence Alignments PB2 ...... c. CpCl ..... T ... . CpC2 .. T ...... c .... . PSl .. T ...... c .... . PS2 ...... c ... WP2 WH2 ...... c. StH2 Fml Fm2 Bil ...... c . Bi2 . . T ...... c ..... ClB2 .. T .... G .. SB3Chamesi .. A .. A...... TT...... C...... C. TC...... A .. A .. GPSChamesi .. A .. A...... TT...... C ...... C. TC...... A .. A .. SHl TCTAGTAGAA GCCGGAGCTG GGACAGGATG AACTGTCTAC CCGCCTTTAT CAAGTAATAT SH2 .....••...•...... •• T CHNl .T ...... G ..•...... T CHN2 .•..••..• T HPl ....•.... T HP2 .•••....• T CB3 . . • • • • . • . T .... c ..... C84 TH3 ...... T BP3 .T ...... G ...... •.....•. T BP4 .T ...... • •...•.•• T CCl ...... •. T ccs ••••..••. T CCB ...•..••• T CCll .T ...... T CC12 .T ...... •....•... T CC13 CC14 .T ...... GPl GP2 GP3 .T ...... T GP4 ...... T .. T ...... C .. . BBl ...... • T BB2 ..•.•...• T BB13 .A ...... T BB14 SBl .T ...... , .• T SB2 G ...••.•• T LBl .A ...... T LB3 ...... •• T BR6 .. T ...... T AI6 ...... T AI7 .T ...... •...... T SBPl .T ...... , •. T .••.••..•. SBP4 ...... T .. T ...... PB2 ...... •...... T .. T ...... CpCl ...... T .. T ...... C.G. CpC2 . T ...... •. G ..•....•... T .•..•..... PSl . T ...... G ...... T ...... PS2 ..•.....• T WP2 ...... T WH2 ..•...... T StH2 ...... T •••. A ••.•. Fml Fm2 •.••.•• G •.•.•••••.• T Bil ...... •...... • T Bi2 .T ...... ••. T 216 Appendix 2 Sequence Alignments ClB2 ...... •...... •.••.•... T •.•••...••.••...•... SB3Chamesi C .. C ...... A ...... G ..... G .. T .. T .. C ...... G .... A .•... GPSChamesi C .. C ...... A ...... •. G .•..• A .. T .. T .. C ...... G .... A .••.. SHl TGCTCATTCC GGTGCTTCAG TAGATTTATC TATTTTTTCT TTACATTTAA CTGGAGCTTC SH2 •••••.•.•.••..•...•..•••. C •..••.•.•.••••••••••.•• G .•...••••. CHNl ...••..••...... •.•....•.•••..•.•..•.••••..•••••• G •.•..•••.. CHN2 •••.••.•• G HPl •••.••.•. G HP2 ..... c .... • .G .....• G CB3 •••..•... G CB4 •.•...•.. G TH3 ...... •. G BP3 ••••••••• G BP4 •..••.••• G CCl ••.•••.•• G ccs .. A ...•.•. • ••.•..•• G CCB •••••.••• G CCll •••••..•• G CC12 •••••.••• G CC13 •.••..••• G CC14 ..•••.•.• G GPl •••••.••• G GP2 ••••••••• G GP3 •.••....• G GP4 ••••.•••• G BBl .•••••••• G BB2 ..... c .... • ••.••.•• G BB13 ...••.••• G BB14 ••••••••• G SBl ••••••••• G SB2 .....•••• G LBl •.••••.•• G LB3 ..••..••• G BR6 •••••••.• G AI6 ..••.•••• G AI7 ...•..•.• G SBPl ...... • G SBP4 •.•..•••• G PB2 •.•••••.• G CpCl ..••••••. G CpC2 .••.••.•• G PSl •••.•.••. G PS2 ...... T ••.•••••. G WP2 ...... •. G WH2 ..•.••.•• G StH2 .••.•.••• G Fml ..••••••. G Fm2 ...••...... •..••...•..•...••..•••.•..•. G ..••.•.••. Bil ...... •....•...... ••.....•.•.•• G .•.•...•.. Bi2 ...... G ...... •... ClB2 ...... •...... •...•...•.•...... G ....•••... SB3Chamesi ... A •. C .. A .. A .. A .....•.. C .. G .• A ...•.•.•...... •... G .C ••.•.... GPSChamesi ... A .. C .. A .. A .. A ...... C .. G .. A ...... G .C ...... SHl TTCAATTTTA GGTGCTATTA ATTTTATGTC TACAGTTATC AATATACGAG CAGAAACATT SH2 ....•...... •...... •.••. T •..•.... G .•.•••..•.. CHNl ...... A .. ..•...••....••.... G . CHN2 ...... T ...... G. HPl ...... •. T ...... G. HP2 ...... T .....•.. G. CB3 ...... T ...... G. CB4 .....••.. T ...... • G. 217 Appendix 2 Sequence Alignments TH3 ...... T ...... G. BP3 ...... • A ..•.•...••. T .....•.. G. BP4 ...... • A ....•...... T ...... G. CCl ...... T .•...... G. ccs ...... T ...... G. cca ...... T ...... G. cell ...... T ...... G. CC12 ...... A ...... T ....•... G. CC13 ...... T ...... G. CC14 .....•• A ..•...... T .••..••. G. GPl ...... T ...... G. GP2 ...... G. GP3 ...... T ...... G. GP4 ...... T ...... G. BBl ...... T ...... G. BB2 ...... T ...... G. BB13 ...... T ...... G. BB14 .... C ...•...•...••• T •....•.. G. SBl ...... T ...... G. SB2 ...... T ...... G. LBl .••...... T ....•... G. LB3 ...... •...... •. T ...... G. BR6 .....•.....•..•..•• T •..•.•.• G • AI6 . . . . C ...... • T ..•..... G. AI7 ...... A ..•...... •. T .•..•... G. SBPl .... C .. A ...... T .••.•... G. SBP4 ...... T ...... G. PB2 ...... T ...... G. CpCl ...... •••.•...• T ••.•.•.• G . CpC2 ...... A ..•••...••. T •••.••.• G. PSl ...... • A ...•..••.••.•.•.•..• G . PS2 ...... T ...... G. WP2 ...... T ...... G. WH2 ...... T ...... G. StH2 ...... T ....•... G. Fml ...... •A •.•.....••• T •..••... G • Fm2 ...... T ...... G. Bil ...... T ...... G. Bi2 ...... G ...... A ....•.•.•.• 'I' •...•... G. ClB2 ...... •...... • A ..•...... •• T ..•.••.. G. SB3Chamesi . . . C ...... •. A •...... • A •• A .•••• A .. T .•••.•..•• •..• G •• T .. GPSChamesi . . . C ...... A .. A ...... A .. A •...• A •. T ••.. G .. T .. SHl AACTTTTGAT CGTATCCCAT TGTTTGTTTG GAGAGTTTTC GTAACTGTAA TTCTTCTCTT SH2 CHNl CHN2 .•...•. T .. HPl ..... T .... HP2 CB3 CB4 TH3 ...... T .••.... T .. BP3 BP4 CCl ccs CCB CCll CC12 CC13 CC14 A •.•••••.• GPl GP2 •••.•.• T .• 218 Appendix 2 Sequence Alignments GP3 GP4 BBl BB2 BB13 BB14 SBl 882 ...... T .. LBl LB3 ...... T BR6 AI6 ..••... T .. AI7 SBPl SBP4 PB2 CpCl CpC2 ...... •. T PSl PS2 .•••••. T .. WP2 ...... G. WH2 StH2 Fml ...... • T Fm2 Bil Bi2 ClB2 ...... •...... •....•..•.•.... A .. S83Chamesi ... C .. C ..... A .. T ..... A .. C .. A .. A .. T ..... T ..... A .. G ..... GT.A .. GP5Chamesi ... C .. C ..... A .. T ...•. A .. C •• A .. A •. T .••.. T ••••• A .• G .•.•. GT.A .. SHl ATTATCTTTA CCTGTATTAG CTGGTGCTAT TACTATACTA CTAACTGACC GTAATTTAAA SH2 ...... G ..•...... ••....•.••.•••.....•.•••••••• CHNl .. C ..... G. ..•...••. G CHN2 ...... G. HPl ...... e.G. HP2 ...... G. C83 ...... G. CB4 ...... G. THJ ...... G. BP3 .. C. C ... G. BP4 .. C ..... G. CCl ...... G .. C ...... •.. G ccs ...... G .....•....• T ...... ccs ...... G .. C ...... T. CCll ...... G. .... c ..... CC12 .. C ..... G . CC13 ...... G. CC14 ...... G. GPl ...... G. GP2 ...... G. GPJ .. C ..... G . GP4 ...... G. BBl ...... G .. C ...•.... BB2 ...... G .....•..... 8813 ...... G. 8814 ...... G...... • T .. SBl .. C ..... G. SB2 ...... G. T ...... LBl .•...... G. LB3 ...... G. BR6 ...... G. T •..••.••.. C •• G ••.•. AI6 ...... G...... c .... 219 Appendix 2 Sequence Alignments AI7 .. C ..... G. SBPl .. C ..... G. SBP4 ...... G. .c ...... PB2 ...... G. .c ...... CpCl ...... G. CpC2 ...... G. PSl .. C ..... G...... •. G PS2 ...... G. WP2 ...... G. WH2 ...... G. StH2 ...... G. Fml ...... G. Fm2 ...... G. Bil ...... G. Bi2 .. C ....• G . Cl82 . . . . . G .. G...... c .... 8B3Chamesi . C. T .. AC. T .. A ...... A .. A ...... A ... T .. T .... A .. T. GP5Chamesi .C.T .. AC.T .. A .•...••. A .. A ...... A ... T .. T .... A .. T. SHl TACTTCTTTT TTTGACCCTA CAGGTGGGGG GGATCCCATT CTTTACCAAC ATTTATTT SH2 CHNl ...... T •. CHN2 HPl HP2 CB3 CB4 ... c ...... TH3 ... c ...... BP3 ...... T .. BP4 . . . . . T ...... T .. CCl T .•...... CC5 cca .. c ..... CCll ..... T .... CC12 CC13 CC14 ...... T .. . GPl ... c ...... GP2 . . . c ...... GP3 ...... T .• GP4 BB1 T ...... BB2 BB13 8814 881 ...... T .. 882 . . . c ...... A .. L81 LB3 .. cc ...... BR6 ...... c. AI6 .... A ..... AI7 SBPl ... c ...... SBP4 PB2 CpCl CpC2 ...... T .. PSl ...... T .• PS2 WP2 WH2 8tH2 Fm1 220 Appendix 2 Sequence Alignments Fm2 Bil Bi2 ...... T ...... T .. . ClB2 .. C ...... T .•..•.•....•.....•....•.•..... SB3Chamesi ...... A ...... A ..... A ..... T ... T.A .. T ..... C ..... C GPSChamesi ...... A ..• .G .. A ..... A ..... T ... T.A .. T ..... C ..... C 221 Appendix 2 Sequence Alignments A2.9 Alignment of Chamaesiplzo tasmanica 16S rRNA Sequences Sequence alignment of partial 168 rRNA sequences for samples of Chamaesipho tasmanica from Australia. 27 species, 315 sites Name Sequences· CHN3 AGACGAGAAG ACCCTATAGA GTTTTATGAA GTAAAAAATT TCAATT-TAT TAGATCTT-T CHN4 HP3 THS BP6 GPS GP6 BBll ...... A •.. LBS . . . . • G ...... CTT ... LB6 883 884 .. c ...... 8BP2 CpC3 PS3 PS4 PJl WP3 8tH4 Fm4 Bi3 Bi4 ClB3 BBy3 BBy4 CHNl - Chtha .... A . A ...... G ...... A . -A . T .... TTT C . . . GTT .. A .. C ..... T .. C • 8Hl Chtham ...... G ...... A • -A . T . . . . TTT C . . . GTT .. A .• A •...• T .. C. CHN3 ATGAATGAAA TTTGGTTCTT CATTTTGTTG GGGCGACATT AAGATAAAAA AAACTCTTTT CHN4 HP3 THS ...... T .. BP6 GP5 GP6 •....•. A .. BEll LBS LB6 883 884 .A ... A .... 88P2 CpC3 PS3 PS4 PJl WP3 StH4 Fm4 Bi3 Bi4 Cl83 222 Appendix 2 Sequence Alignments BBy3 BBy4 CHNl_Chtha .. AG . AC .. C .. AT .. G . A . T .... - ... . • ...... G .• SHl_Chtham .. AG . AC .. T .. AT .. G . A . T .... - ...... G •• CHN3 TTCTATAAAC TTCTATAGTA GGTTAGTTTG ATCCTCTAAA AGAGATCAAA AGAAAAAA'l'T CHN4 HP3 THS BP6 GPS GP6 BBll LBS LB6 SB3 SB4 SBP2 CpC3 PS3 ... c ...... PS4 ...... G. PJl WP3 StH4 Fm4 Bi3 Bi4 ClB3 BBy3 BBy4 CHNl Chtha .. TA . A...... T ... GAA . . CA . T ...... TA. . . . A .... A. T . . .. T ...... SHl_Chtham .. T .. A...... T ... GAA . . CA . T ...... TA . . . . A .... A. T. . .. T ...... CHN3 ACCTTAGGGA TAACAGCGTA ATCTTTTTCG AGAGTTCCAA TCGACAAAAA GGTTTGCGAC CHN4 HPJ THS BP6 GPS GP6 BEll LBS LB6 SB3 SB4 SBP2 CpCJ PS3 .. T ...... PS4 PJl WP3 StH4 Fm4 Bi3 Bi4 ClB3 BBy3 BBy4 CHNl Chtha . . . . c ...... T ...... •. T . SHl_Chtham . . . . c ...... T ...... T . CHN3 CTCGATGTTG GACTAAAATT TAGGCATGGT GCAGCCGCTA TGTCTTAGGG TCTGTTCGAC CHN4 223 Appendix 2 Sequence Alignments HP3 THS BP6 GPS GP6 BBll LBS LB6 SB3 SB4 SBP2 CpC3 G •.•••.•.• PS3 PS4 PJl WP3 StH4 Fm4 Bi3 Bi4 • • • • • • •.,. "• • • • "•' • "• ... • • ..... • II" otl ClB3 ...... BBy3 ...... "' ...... " BBy4 ...... ' .... ' ...... It. CHNl_Chtha ... A. G.A •..•.• TA •••. C .• T •..... SHl_Chtham .•. A. G. A. • . ... TA. • • . C .• T •..•.• CHN3 CCATAATATT TTACA CHN4 HP3 THS BP6 GPS GP6 8811 LBS LB6 SB3 SB4 SBP2 CpC3 PS3 PS4 PJl WP3 StH4 Fm4 Bi3 Bi4 ClB3 BBy3 BBy4 CHNl - Chtha SHl_Chtham 224 Appendix 2 Sequence Alignments A2.10 Alignment of Chamaesipho tasmanica Cytochrome Oxidase I Sequences Sequence alignment of partial Cytochrome Oxidase I sequences for samples of Chamaesipho tasmanica from Australia. 22 species, 685 sites Name Sequences CHN3 AACACTATAC TTAATTTTCG GAGCATGATC CGCCATAGTA GGAACTGCCT TAAGAATACT HP3 CBS CB6 THS . . . . TAG ...... T ...... CC3 CC9 CClO GPS GP6 BEll BB12 BR3 BR4 SB3 . . . G ....•.....••... A ...... TA . SBP2 Bi4 BBy3 BBy4 CPC3 WH2 Chth ... TT .... T C ...... T . . T . . T ...... G .. G .. G .. A .. TC ..... C . TT . StH2 Chth ... TT .... T C ...... T . . T .. T...... G .. G .. G .. A .. TC ..... C. TT. CHN3 TATTCGAGCT GAGCTTGGAC AACCAGGAAG ATTAATTGGA GACGATCAAA TTTATAATGT HP3 CBS CB6 THS ...... T...... c .. CC3 CC9 CClO GPS GP6 BEll 8812 ...... c .. BR3 BR4 883 ...... G. .c ...... SBP2 Bi4 BBy3 BBy4 CPC3 WH2_Chth A ...... A .. AT.A .. T ..... C ..... T ...... G ..... C .. G .. C ...... StH2_Chth A ...... A .. AT.A .. T ..... C ..... T ...... G ..... C .. G ...... CHN3 AATTGTTACC GCCCATGCTT TTATTATGAT TTTCTTTATA GTAATACCTA TTATAATTGG HP3 CBS ...... "' •••••• " ...... tl ...... * •• 225 Appendix 2 Sequence Alignments C86 ....•..•. T .... c ..... THS CC3 ....•.... T CC9 .•..•.... T .. c ...... CC10 ...... T ••.•. T ••.. GPS .. G ...••.. GP6 ...... T 8811 ...... T 8812 ...... T. 8R3 8R4 883 ...... •.. T 88P2 ....•.... T 8i4 ...... T •••.. G •••• 88y3 BBy4 ....•.•.. T CPC3 ...... T WH2_Chth ...... A .. T .. A ..... A ...... A ..... T .. C ...... G ... . 8tH2_Chth ....•. A .. T .. A ..... N .....•.. A .•..• T .. C •.•.•... G .•.• CHN3 AGGATTTGGT AATTGATTAC TACCCCTAAT ACTGGGAGCA CCTGATATAG CTTTCCCTCG HP3 .T ...... CBS C86 THS CC3 G ••.•.•••• CC9 CC10 GPS GP6 ... G ...... 8811 BB12 BR3 BR4 .... A .•... 883 8BP2 8i4 ...... c ... BBy3 ...... ' ...... BBy4 . . . . . ' . . . ~ ...... ~ . . . . CPC3 ...... "' ...... WH2_Chth G .. T ..... A ...... C ...... GT ..... T ...... C ...... G ...... A .. 8tH2 Chth G .. T ..... A ...... GT ...... •.....• C ...•.... G ..••..•• A .. CHN3 ATTAAATAAT ATAAGATTTT GACTTTTACC TCCTGCCTTA ATACTTCTAA TTAGAGGATC HP3 .. G ...... CBS . . . c ...... • •. A ..••.• CB6 ...... G. THS CC3 CC9 CClO GPS GP6 BB11 8812 BR3 8R4 SB3 SBP2 Bi4 8By3 BBy4 CPC3 .G ..••.••• 226 Appendix 2 Sequence Alignments WH2_Chth .. G .. C .. C ..... AC ...... T ...... T .AT ...... T .. G .. StH2_Chth .. G .. C...... AC...... T...... T. AT...... T .. G .. CHN3 CCTCGTAGAA GCCGGAGCAG GGACAGGGTG AACGGTTTAT CCCCCTTTAG CAAGAAATAT HP3 .•• A ..••.• CBS ••• A ..•..• ...... c .. CB6 ..... c .... THS .•• A .•.•.• CC3 CC9 CClO GPS ..• A ..••.• GP6 BEll ...... c BB12 BR3 ...•..•.. T BR4 •.• A ••••.• 883 SBP2 Bi4 BBy3 •.• A ••••.• BBy4 CPC3 ....•...... •....•..•••.•..•••...••• , .• A .••.••.••.•• WH2_Chth T .. A ...... T ...... A ..... T .. C ..... G ...... T .... T .... . StH2_Chth T .. A •...... T ...... •. A .••.• T .• C ••••• G •.••.• T •.••.••••. CHN3 TGCACACTCA GGAGCATCAG TAGACTTGTC AATTTTTTCT TTACATTTAG CCGGAGCTTC .HP3 CBS CB6 THS CC3 CC9 CClO GPS GP6 BEll BB12 BR3 BR4 883 SBP2 Bi4 BBy3 BBy4 CPC3 •.. G ...... WH2 Chth . . . T .. T .. C .. T .. T ...... T .. A .. T .•....•.. .T ...... StH2 Chth . . . T .. T .. C .. T .. T ...... T .. A .. T ...... T ...... CHN3 TTCCATTTTA GGAGCAATTA ATTTTATATC AACAGTAATT AATATACGAG CAGAAACTTT HP3 ...... •...... •.•.•.•.••.•.••G •••.. CBS •... G •.... CB6 ••.• G ••..• THS ••.• G •••.• CC3 CC9 ••.• G .••.• CClO •.•. G •..•• GPS •••. G .•... GP6 •••. G .•.•. BEll ...• G .•••• BB12 BR3 BR4 , ••• G •••.. 227 Appendix 2 Sequence Alignments 8B3 ..... T .... . ••• G ..•.. 8BP2 .••. G .••.. Bi4 •.•• G ••••• BBy3 .••• G .•... BBy4 .... G ••..• CPC3 .... G •.•.. WH2_Chth ... A ...... T .. T ...... G .. T ..... T ...... G ...... A .. 8tH2_Chth ... A ...... T .. T ...... G .. T .••.. T .....•..... G ...... A .. CHN3 AACCTTCGAT CGAATTCCAT TATTCGTATG AAGTGTTTTT GTAACAGTGA TTCTGTTATT HP3 ...... A .. CBS CB6 THS CC3 CC9 CClO GPS GP6 BBll BB12 BR3 BR4 8B3 8BP2 Bi4 ....••. G .. BBy3 BBy4 CPC3 WH2_Chth ... T .. T ..... T .. C ..... G .. T .. T .. G .. A ••••• C ..... T .. A ..... TC.C .. 8tH2 Chth ... T .. T ..... T .. C ..... G .. T .. T .. G .. A .•••. C ..... T .. A ..... TC.C .. CHN3 ACTTTCACTT CCAGTATTAG CAGGAGCTAT TACAATATTA TTAACAGATC GTAATTTAAA HP3 ...... A ..•.. A .. A • CBS CB6 THS CC3 CC9 CClO ... C ..•...•••••.•.• T GPS GP6 BEll BB12 BR3 BR4 SB3 SBP2 Bi4 BBy3 BBy4 CPC3 WH2_Chth . T . A . . TT . A .. T . . ... G . . T . . T ...... T ... C. . C .... T .. C. StH2 Chth . T . A . . TT . A .. T . . ... G . . T .. T ...... T ... C . . C .... T .. C . CHN3 TACTTCATTT TTTGACCCTA CGGGAGGGGG AGATCCTATT TTATATCAAC ACTTATTC HP3 •..... A ... CBS ... c ...... CB6 .A ...... TH5 ... c ...... CC3 .A ....•... CC9 CClO •.•...•.• G .A.A ...... G ••.••. A 228 Appendix 2 Sequence Alignments GPS GP6 .A ...... BBll ...... A ...... BB12 •...... T ... A ...... BR3 ...... A ...... BR4 ... c ...... SB3 .A ...... SBP2 ..... T ..... A ...... Bi4 .A ...... BBy3 . . . c ...... BBy4 .A ...... CPC3 .A ...... WH2_Chth ...... T .. . .A .. T ..... G ..... C ... C.T .. C ..... T ..... T StH2_Chth ... - .. T .. . .A .. T ..... G ..... C ... C.T .. C ..••. T ...•. T 229 Appendix 3 Microsatellite Data Appendix 3 A3.1 C polymer us Microsatellite Genotype Data Microsatellite genotypes for 399 individuals of Catomerus polymerus for five microsatellite loci. ? indicates no amplification or ambiguous genotype. Sample Population Catomerusl Catomerus2 Catomerus3 Catomerus4 CatomerusS ID EC1 Cape Conran 310 320 229 229 274 274 191 194 192 192 EC2 Cape Conran 306 308 229 229 274 276 192 201 192 192 EC3 Cape Conran 306 308 229 229 274 276 188 201 192 192 EC4 Cape Conran 306 308 229 229 274 276 201 201 190 192 EC5 Cape Conran 312 312 233 233 274 276 190 191 192 192 EC6 Cape Conran ? ? 227 229 274 276 176 200 192 192 EC7 Cape Conran 306 308 229 229 274 276 200 201 192 192 EC8 Cape Conran 306 308 ? ? ? ? 190 201 ? ? EC9 Cape Conran 318 330 229 229 276 293 190 200 190 192 EC10 Cape Conran 308 308 233 233 ? ? 176 199 ? ? SG1 Cape Conran 312 324 229 229 276 276 200 200 190 192 SG2 Cape Conran 312 324 229 233 276 276 201 201 190 192 SG3 Cape Conran 316 316 227 229 274 294 201 201 192 192 SG4 Cape Conran 312 324 227 229 274 295 200 201 190 192 SG5 Cape Conran 307 307 233 233 276 295 190 200 190 192 SG6 CaQ_e Conran 307 307 229 ---233 276 295 201 201 192 192 SG7 Cape Conran 308 308 229 233 274 298 199 200 190 192 SG8 Cape Conran 308 318 233 233 276 287 191 201 190 190 SG9 Cape Conran 310 326 227 227 274 295 200 201 192 192 SBP3 Portland 308 308 227 227 276 290 201 201 192 192 SBP6 Portland 306 306 227 229 276 291 190 190 192 192 SBP7 Portland -. 311 312 227 229 276 296 190 200 192 192 SBP8 Portland 308 308 227 229 276 276 200 201 192 192 SBP9 Portland 308 308 227 229 276 292 190 192 192 192 SBP10 Portland 308 310 227 229 276 293 190 201 192 192 SBP11 Portland 306 308 227 233 276 293 192 201 192 192 SBP12 Portland 306 308 224 227 276 297 198 200 192 192 SBP13 Portland 308 312 227 227 276 276 200 201 192 192 SBP14 Portland 306 308 227 229 276 296 190 201 192 192 SBP15 Portland 306 308 224 227 276 276 192 200 192 192 192 SBP16 Portland 308 308 227 - 229 276 276 201 204 192 SBP17 Portland 306 308 227 227 276 293 191 201 192 192 SBP18 Portland 306 306 227 229 276 276 201 201 192 192 SBP19 Portland 306 306 227 229 276 276 192 201 192 192 SBP20 Portland 310 310 227 229 276 276 201 203 192 192 SBP21 Portland 308 312 229 229 276 278 191 201 192 192 SBP22 Portland 306 306 227 227 276 297 200 200 192 192 SBP23 Portland 308 312 227 229 276 276 191 201 192 192 230 Appendix 3 Microsatellite Data SBP24 Portland 306 310 227 227 276 276 191 201 192 192 SBP25 Portland 306 312 227 229 276 276 201 203 192 192 SBP26 Portland 306 312 227 229 276 276 190 200 192 192 SBP27 Portland 306 308 ? ? 276 276 200 201 192 192 SBP28 Portland 306 308 227 229 295 295 176 176 192 192 SBP29 Portland 312 316 229 229 276 276 ? ? 192 192 SBP30 Portland 308 308 229 233 276 276 201 201 192 192 SBP31 Portland 306 308 227 227 288 293 ? ? 192 192 SBP32 Portland 306 306 227 227 296 312 200 201 192 192 SBP33 Portland 306 306 227 227 276 278 200 201 192 192 SBP34 Portland 306 308 227 227 276 276 200 201 192 192 LB7 Portsea 312 312 227 229 276 290 190 201 192 192 LB8 Portsea 308 308 229 229 276 278 176 200 192 192 LB11 Portsea 306 306 227 227 276 296 198 201 192 192 LB12 Portsea 306 307 227 233 276 276 190 198 192 192 LB13 Portsea 306 316 230 233 276 292 201 203 192 192 LB14 Portsea 306 308 229 229 274 276 191 201 192 192 LB15 Portsea 308 312 229 229 294 296 195 200 190 192 LB16 Portsea 306 306 229 229 274 276 200 201 192 192 LB17 Portsea 306 312 227 227 276 292 200 200 192 192 LB18 Portsea 306 308 227 229 276 318 190 201 192 192 LB19 Portsea 308 324 229 233 ? ? 190 201 190 192 LB20 Portsea 306 308 227 227 278 292 200 201 192 192 LB21 Portsea 306 308 227 229 276 292 200 200 192 192 LB22 Portsea 306 308 227 229 276 291 190 200 192 192 LB23 Portsea 314 316 229 229 276 291 201 203 192 192 LB24 Portsea 308 308 227 227 276 278 190 201 184 192 L825 Portsea 306 308 227 229 276 273 201 201 ? ? SB5 Sorrento 306 324 229 229 274 294 176 200 192 192 SB6 Sorrento 306 306 227 233 291 293 200 201 192 192 SB10 Sorrento 306 326 229 229 276 276 201 203 192 192 5811 Sorrento 310 310 227 227 276 278 191 200 192 192 S812 Sorrento 308 308 229 229 295 295 190 190 192 192 SB13 Sorrento 308 312 229 229 274 276 190 200 192 192 SB14 Sorrento 306 310 227 229 276 280 200 201 192 192 SB15 Sorrento 308 310 229 233 274 297 191 200 192 192 SB16 Sorrento 306 306 227 229 276 297 190 200 192 192 SB17 Sorrento 308 308 227 233 ? ? ? ? 192 192 SB18 Sorrento ? ? ? ? ? ? ? ? 192 192 BP1 Bastion Point 308 318 227 229 292 292 190 201 192 192 BP2 Bastion Point 308 308 229 229 ? ? 176 200 192 192 BP13 Bastion Point 324 333 229 233 274 293 200 201 190 192 BP14 Bastion Point 308 318 229 233 274 276 201 201 190 192 BP15 Bastion Point 308 310 227 229 276 290 201 201 190 190 BP16 Bastion Point 312 322 229 229 276 294 200 201 190 192 BP17 Bastion Point 309 320 229 233 276 288 194 201 190 190 BP18 Bastion Point 322 324 229 229 276 290 191 201 190 190 BP19 Bastion Point .320 324 227 229 274 289 194 200 192 192 BP20 Bastion Point 320 335 227 229 276 291 200 201 190 192 BP21 Bastion Point 307 316 229 233 276 293 201 203 192 192 BP22 Bastion Point 321 331 229 229 292 294 190 194 190 192 BP23 Bastion Point 308 316 227 229 274 276 192 201 190 192 BP24 Bastion Point 308 308 227 233 274 295 200 200 190 192 231 Appendix 3 Microsatellite Data BP25 Bastion Point 312 316 229 233 276 291 197 200 192 192 BP26 Bastion Point 308 308 229 233 274 283 190 200 192 192 BP27 Bastion Point 307 324 227 233 276 278 201 201 192 192 BP28 Bastion Point 307 326 229 229 274 276 176 191 192 192 BP29 Bastion Point 308 324 229 229 291 294 191 194 190 192 BP30 Bastion Point ? ? ? ? ? ? ? ? 192 192 BP31 Bastion Point 304 304 227 229 274 276 190 201 190 192 BP32 Bastion Point 310 310 229 233 276 276 190 202 190 192 BP33 Bastion Point 308 323 227 233 274 276 190 200 190 190 BP34 Bastion Point 308 322 229 233 276 291 192 201 190 192 BP35 Bastion Point 318 332 229 233 276 294 176 201 190 190 BP36 Bastion Point 308 318 231 233 276 291 185 192 190 192 BP37 Bastion Point 308 324 227 229 274 294 176 194 190 192 BP38 Bastion Point 306 325 227 229 276 276 190 191 192 192 BP39 Bastion Point 308 308 229 229 276 287 194 200 192 192 BP40 Bastion Point 308 308 229 229 274 274 194 200 192 192 BP41 Bastion Point 324 331 229 233 291 293 200 203 192 192 PS7 Point Sinclair ? ? ? ? ? ? ? ? ? ? PS8 Point Sinclair 306 308 224 224 276 276 200 201 192 192 PS9 Point Sinclair 308 308 224 227 276 292 190 200 192 192 PS10 Point Sinclair 308 308 229 233 294 304 200 200 192 192 PS11 Point Sinclair 308 308 224 227 292 295 190 191 192 192 PS12 Point Sinclair 306 308 224 227 276 295 191 200 192 192 PS13 Point Sinclair 308 316 233 233 295 295 191 200 186 192 PS14 Point Sinclair 308 308 227 233 276 294 202 201 192 192 PS15 Point Sinclair 308 310 224 230 276 296 200 200 192 192 PS16 Point Sinclair 306 308 227 230 276 276 192 194 192 192 PS17 Point Sinclair 304 308 227 227 276 294 194 201 192 192 PS18 Point Sinclair 306 316 224 233 290 292 199 200 192 192 PS19 Point Sinclair 304 310 229 233 276 294 190 201 192 192 PS20 Point Sinclair 306 310 224 230 276 276 201 203 192 192 PS21 Point Sinclair 307 316 229 233 294 294 191 200 192 192 PS22 Point Sinclair 308 308 ? ? 276 293 191 198 192 192 PS23 Point Sinclair ? ? ? ? ? ? ? ? 190 192 PS24 Point Sinclair 306 310 233 235 ? ? ? ? 192 192 PS25 Point Sinclair 308 308 224 224 ? ? ? ? 192 192 PS26 Point Sinclair 308 308 233 233 276 276 190 200 186 192 PS27 Point Sinclair 308 310 232 234 276 292 200 200 192 192 PS28 Point Sinclair 306 308 224 230 276 278 190 200 192 192 PS29 Point Sinclair 306 308 229 233 276 276 200 201 192 192 PS30 Point Sinclair 300 306 224 233 276 276 199 200 192 192 PS31 Point Sinclair 310 312 227 230 276 292 200 201 192 192 PS32 Point Sinclair 306 308 230 235 276 293 190 200 192 192 PS33 Point Sinclair 309 309 224 227 276 276 200 202 192 192 PS34 Point Sinclair 304 306 224 227 276 276 190 203 192 192 PS35 Point Sinclair 310 314 224 227 276 276 200 201 192 192 PS36 Point Sinclair 304 306 227 233 276 291 192 200 192 192 PBS Pennington Bay 308 320 229 233 ? ? 200 201 192 192 PB6 Pennington Bay 306 308 227 233 276 292 192 200 192 192 PB7 Pennington Bay 308 316 227 229 276 278 192 200 192 192 PB8 Pennington Bay 306 310 229 233 276 293 200 201 192 192 PB9 Pennington Bay 306 308 224 229 276 292 200 200 192 192 PB10 Pennington Bay 306 308 227 233 276 276 198 201 192 192 232 Appendix 3 Microsatellite Data PB11 Pennington Bay 306 308 227 233 276 294 176 201 192 192 PB12 Pennington Bay 308 312 224 224 276 294 191 200 192 192 PB13 Pennington Bay 306 308 224 224 276 292 ? ? 192 192 PB14 Pennin_gton Bay 308 308 224 230 276 278 192 200 192 192 PB15 Pennington Bay 306 308 227 227 276 276 194 201 192 192 PB16 Pennington Bay 308 314 227 233 278 294 191 203 192 192 PB17 Pennington Bay 308 308 233 235 276 276 200 201 192 192 PB18 Pennington Bay 306 306 ? ? 276 293 193 194 192 192 CpC7 Cape Carnot 308 310 224 224 276 276 192 201 192 192 CpC8 Cape Carnot 306 308 224 235 276 290 199 201 192 192 CpC9 Cape Carnot 304 308 224 225 276 276 190 201 192 192 CpC10 CaJ?e Carnot 304 306 224 227 278 292 201 225 192 192 CpC11 Cape Carnot 308 310 229 233 276 302 191 200 192 192 CpC12 Cape Carnot 306 308 227 227 278 292 190 201 192 192 CpC13 Cape Carnot 308 308 227 229 276 292 190 200 192 192 CpC14 Cape Carnot 308 320 233 233 276 276 190 200 192 192 CpC15 Cape Carnot 306 308 224 229 276 292 200 203 192 192 CpC16 Cape Carnot ? ? ? ? 276 276 191 200 192 192 CpC17 Cape Carnot 304 308 227 233 276 276 190 200 192 192 CQ_C18 Cape Carnot 308 308 227 229 276 276 201 202 192 192 CpC19 Cape Carnot 308 308 224 227 276 276 176 200 192 192 CB1 Cape Banks 320 326 227 227 276 298 201 201 190 190 CB2 Cape Banks ? ? 227 229 ? ? ? ? 190 192 CB11 Cape Banks 312 316 227 229 276 276 200 201 190 192 CB12 Ca_pe Banks 312 318 229 233 274 296 201 201 190 192 CB13 Cape Banks 320 330 229 229 276 276 176 194 190 190 CB14 Cape Banks 328 334 229 229 276 276 194 202 190 192 CB15 Cape Banks 325 333 229 229 276 291 194 202 190 190 CB16 Cape Banks 308 326 227 229 274 276 194 201 190 190 CB17 Cape Banks ? ? 229 233 ? ? ? ? 190 192 CB18 Cape Banks 308 320 229 230 276 301 192 192 190 192 CB19 Cape Banks 308 308 229 233 274 276 200 201 190 192 CB20 Cape Banks 308 326 229 229 276 276 194 201 190 190 CB21 Cape Banks 308 316 227 229 274 274 192 201 190 192 CB22 Cape Banks 308 312 229 230 274 296 192 194 192 192 CB23 Cape Banks 308 308 227 233 289 291 191 201 190 192 TH1 Tura Head 308 316 227 233 280 282 191 203 190 192 TH2 Tura Head 324 324 227 229 294 298 201 201 190 190 TH11 Tura Head 310 326 229 233 274 276 191 201 192 192 TH12 Tura Head 308 326 233 233 274 274 201 201 190 192 TH13 Tura Head 308 316 227 229 274 276 194 201 190 192 TH14 Tura Head 322 326 229 229 272 276 201 201 192 192 TH15 Tura Head 308 322 227 229 276 294 190 201 190 190 TH16 Tura Head 308 308 229 229 295 299 201 201 190 192 TH17 Tura Head 320 324 229 233 276 293 192 202 190 190 TH18 Tura Head 308 326 233 233 276 294 201 201 190 192 TH19 Tura Head 308 331 229 233 297 298 190 201 184 192 TH20 Tura Head 308 322 229 229 276 294 194 201 192 192 TH21 Tura Head 316 326 224 233 290 293 192 200 190 192 TH22 Tura Head 322 326 229 229 274 294 200 201 190 192 TH23 Tura Head 308 333 229 229 276 295 200 201 192 192 TH24 Tura Head 308 308 227 229 274 276 192 200 190 192 TH25 Tura Head 318 320 227 229 276 295 201 201 190 192 233 Appendix 3 Microsatellite Data TH26 lura Head 320 322 229 229 292 294 194 200 190 192 TH27 Tura Head 308 322 229 229 276 295 192 200 190 190 TH28 Tura Head 306 322 229 229 287 293 200 200 '190 192 TH29 lura Head 312 331 229 229 276 295 191 194 190 192 TH30 Tura Head 321 327 229 229 276 293 190 201 190 192 TH31 Tura Head 310 320 229 229 291 296 194 199 184 190 TH32 lura Head 323 329 229 229 274 302 200 201 192 192 TH33 Tura Head 308 308 233 233 276 276 191 200 190 190 TH34 Tura Head 308 308 229 229 276 276 190 200 190 192 TH35 Tura Head 310 321 227 229 276 294 200 201 192 192 TH36 Tura Head 320 325 229 229 276 276 202 201 190 190 TH37 Tura Head 310 312 229 233 276 293 194 200 192 192 TH38 Tura Head 323 327 229 233 274 292 190 201 192 192 CHS1 Charlotte Head 322 326 229 229 274 276 192 201 190 192 CHS2 Charlotte Head 320 324 227 229 276 276 191 201 190 192 CHS5 Charlotte Head 308 323 227 229 274 294 201 201 190 192 CHS6 Charlotte Head 306 308 229 233 274 274 190 201 190 190 CHS7 Charlotte Head 308 308 227 227 274 293 190 203 190 192 CHS8 Charlotte Head 312 324 227 229 276 294 194 200 192 192 CHS9 Charlotte Head 308 312 229 229 276 295 202 202 192 192 CHS10 Charlotte Head 324 330 229 229 274 291 194 200 192 192 CHS11 Charlotte Head 308 324 229 229 276 296 190 201 ? ? CHS12 Charlotte Head 318 318 229 229 296 298 190 200 190 190 CHS13 Charlotte Head 310 310 227 229 274 276 201 201 190 192 CHS14 Charlotte Head 308 322 227 229 ? ? ? ? 190 192 CHS15 Charlotte Head 322 324 227 229 274 274 190 200 192 192 CHS16 Charlotte Head 308 322 227 229 276 276 194 201 192 192 CHS17 Charlotte Head 309 328 227 229 274 276 192 194 190 190 GP9 Griffith Point 308 328 229 229 276 296 190 191 192 192 GP10 Griffith Point ? ? ? ? 274 276 200 203 192 192 GP12 Griffith Point ? ? ? ? ? ? ? ? 192 192 GP13 Griffith Point ? ? ? ? 274 276 200 203 192 192 GP14 Griffith Point 308 320 ? ? 274 276 191 203 190 192 GP15 Griffith Point ? ? ? ? ? ? ? ? 192 192 GP16 Griffith Point 306 308 229 229 276 293 200 201 190 192 GP17 Griffith Point 306 306 230 233 276 294 200 201 192 192 GP18 Griffith Point 306 312 227 227 276 291 194 200 190 192 GP19 Griffith Point 306 306 229 233 286 294 201 201 192 192 GP20 Griffith Point 306 306 229 233 276 292 ? ? 192 192 GP21 Griffith Point 310 325 229 230 276 292 200 202 192 192 GP22 Griffith Point 306 306 224 229 290 290 190 203 192 192 GP23 Griffith Point 306 308 229 229 276 291 199 200 192 192 GP24 Griffith Point 306 306 230 233 274 276 199 203 192 192 GP25 Griffith Point 306 308 229 233 276 276 191 198 192 192 GP26 Griffith Point 306 306 229 229 . 293 293 199 200 192 192 GP27 Griffith Point 306 306 230 233 276 292 200 201 192 192 GP28 Griffith Point 306 320 229 229 276 276 190 201 192 192 GP29 Griffith Point 306 329 229 229 276 293 200 201 192 192 GP30 Griffith Point 306 308 229 230 276 293 200 201 192 192 GP31 Griffith Point 312 322 229 229 290 294 200 201 192 192 GP32 Griffith Point 308 308 229 229 276 290 190 201 192 192 GP33 Griffith Point 306 308 229 233 274 276 190 201 192 192 GP34 Griffith Point 305 305 233 233 292 298 201 201 190 192 234 Appendix 3 Microsatellite Data GP35 Griffith Point 312 329 227 229 274 283 200 200 190 192 GP36 Griffith Point 308 308 229 233 274 296 190 201 192 192 GP37 Griffith Point 306 310 224 233 276 276 190 201 192 192 StH7 St Helens 308 310 227 227 276 276 191 201 190 192 StH8 St Helens 304 308 227 227 276 278 192 201 192 192 StH9 St Helens 306 308 227 229 276 276 191 200 192 192 StH10 St Helens 308 310 227 227 276 276 200 200 192 192 StH11 St Helens 306 318 224 229 276 295 191 201 192 192 StH12 St Helens 308 324 224 229 286 295 190 197 190 192 StH13 St Helens 306 306 227 229 276 276 176 200 192 192 StH14 St Helens 316 316 227 229 276 276 192 200 192 192 StH15 St Helens 308 308 227 227 276 293 191 200 192 192 StH16 St Helens 310 310 229 229 276 276 192 201 192 192 Fm7 Falmouth 308 308 227 227 278 278 200 201 192 192 Fm8 Falmouth 306 308 ? ? 276 276 192 201 192 192 Fm9 Falmouth 306 312 227 227 276 276 197 201 192 192 Fm10 Falmouth 306 308 227 229 276 276 200 204 192 192 Fm11 Falmouth 306 312 227 229 276 276 190 201 192 192 Fm12 Falmouth 310 310 227 227 276 293 191 200 192 192 Fm13 Falmouth 308 308 227 233 276 276 199 201 192 192 Fm14 Falmouth 310 328 229 233 276 276 190 191 192 192 Fm15 Falmouth 306 308 227 229 276 291 200 201 184 192 Fm16 Falmouth 306 318 227 227 276 294 192 200 192 192 Fm17 Falmouth 306 310 229 233 276 276 201 201 192 192 Fm18 Falmouth 308 318 229 229 276 286 190 201 184 192 Fm19 Falmouth 310 316 227 227 276 293 200 201 192 192 Fm20 Falmouth 306 306 227 229 276 276 200 203 192 192 Fm21 Falmouth 304 306 227 229 ? ? ? ? 192 192 Fm22 Falmouth 306 306 227 229 292 294 176 201 192 192 Fm23 Falmouth 306 324 229 229 276 285 192 200 192 192 Fm24 Falmouth 306 312 227 229 276 276 191 192 192 192 Fm25 Falmouth 318 326 224 227 276 291 200 201 192 192 Fm26 Falmouth 308 308 227 229 276 276 201 203 192 192 Fm27 Falmouth 306 306 227 229 276 276 201 201 192 192 Fm28 Falmouth 308 308 227 229 276 276 191 191 192 192 Fm29 Falmouth 310 310 227 230 276 281 199 201 192 192 Fm30 Falmouth 306 332 ? ? 276 276 199 200 184 192 Fm31 Falmouth 306 310 227 230 276 276 190 194 192 192 Fm32 Falmouth 306 306 227 227 276 276 197 201 192 192 Fm33 Falmouth 306 310 227 229 276 276 191 192 192 192 Fm34 Falmouth 306 308 227 229 276 276 176 200 192 192 Fm35 Falmouth 308 318 229 229 276 292 201 201 192 192 Fm36 Falmouth 306 308 227 227 276 276 194 194 192 192 Fm37 Falmouth 308 308 224 227 276 276 190 201 192 192 Fm38 Falmouth 306 308 227 227 276 276 190 191 192 192 Fm39 Falmouth 306 308 229 229 276 276 190 201 192 192 Fm40 Falmouth 306 308 227 229 276 276 176 190 192 192 Bi8 Bicheno 306 310 229 229 276 276 191 201 192 192 Bi9 Bicheno 306 306 227 229 276 276 191 191 192 192 Bi1 0 Bicheno 306 306 227 230 276 276 200 201 192 192 Bi11 Bicheno 306 308 ? ? 276 276 ? ? 190 192 Bi12 Bicheno 306 308 229 230 276 276 192 200 192 192 Bi13 Bicheno 306 328 227 227 276 290 201 201 192 192 235 Appendix 3 Microsatellite Data Bi14 Bicheno 310 318 227 227 278 290 201 201 192 192 Bi15 Bicheno 306 308 ? ? 276 276 199 200 184 192 Bi16 Bicheno 310 314 227 229 276 288 200 201 184 192 Bi17 Bicheno 322 324 227 229 276 276 192 201 192 192 Bi18 Bicheno 308 326 227 230 276 276 190 191 192 192 Bi19 Bicheno 306 306 227 229 276 276 199 201 184 192 Bi20 Bicheno 306 308 229 233 276 276 ? ? 192 192 Bi21 Bicheno 306 316 227 227 276 276 201 201 192 192 Bi22 Bicheno 304 322 227 229 276 276 200 200 192 192 Bi23 Bicheno ? ? ? ? 276 276 ? ? 190 192 Bi24 Bicheno 308 308 227 229 276 290 194 201 192 192 Bi25 Bicheno 306 308 227 227 276 276 191 201 192 192 Bi26 Bicheno 306 326 227 229 276 276 194 200 192 192 Bi27 Bicheno 308 308 229 229 276 276 201 201 192 192 Bi28 Bicheno 308 308 227 227 276 276 191 201 184 192 Bi29 Bicheno 306 306 227 230 276 276 191 191 192 192 Bi30 Bicheno 306 322 227 229 276 276 191 201 192 192 Bi31 Bicheno 306 310 227 227 276 293 190 191 192 192 Bi32 Bicheno 306 308 227 227 276 276 187 191 192 192 Bi33 Bicheno 306 308 227 229 276 276 190 200 192 192 Bi34 Bicheno 308 308 227 229 276 276 190 201 192 192 BBy7 Blackman'sBay 306 308 227 229 ? ? 190 190 192 192 BBy8 Blackman'sBay 306 308 229 229 276 278 191 191 192 192 BBy9 Blackman'sBay 306 308 ? ? ? ? 201 201 192 192 BBy10 Blackman'sBay 306 308 227 227 276 276 190 200 192 192 BBy11 Blackman'sBay 308 308 ? ? 276 292 ? ? 192 192 BBy12 Blackman' sBay 306 310 224 227 276 276 194 198 192 192 BBy13 Blackman'sBay_ 308 315 227 227 276 291 200 200 192 192 BBy14 Blackman'sBay 306 308 227 231 276 276 190 199 192 192 8By15 Blackman'sBay 308 308 227 227 276 276 ? ? 192 192 8By_16 Blackman'sBa_y_ 316 322 227 227 276 276 191 200 192 192 BBy17 Blackman'sBay_ 306 308 227 227 276 276 176 200 192 192 BBy18 Blackman'sBay 326 332 227 227 276 276 200 201 192 192 BBy19 Blackman'sBay 308 308 ? ? 275 287 190 201 192 192 BBy20 Blackman'sBay 308 308 ? ? ? ? ? ? 192 192 BBy21 Blackman'sBay 308 310 227 229 276 276 191 201 192 192 B~y_22 Blackman'sBay 308 308 ? ? 276 276 191 201 184 192 BBy23 Blackman'sBay 306 310 227 229 276 294 201 203 190 192 BBy24 Blackman'sBay 306 312 227 227 276 276 200 201 192 192 BBy25 Blackman'sBay 308 308 227 227 276 276 191 204 192 192 BBy26 Blackman'sBay_ 307 324 227 229 274 276 200 200 184 192 8By27 Blackman'sBay 306 308 227 227 276 276 191 201 184 192 BBy28 Blackman'sBay 286 308 ? ? 276 276 200 200 192 192 BBy29 Blackman'sBay 306 308 227 227 291 276 198 201 192 192 B8y30 Blackman'sBay 306 308 227 229 276 282 203 203 192 192 BBy31 Blackman'sBay 308 322 ? ? 276 294 201 201 192 192 BBy32 Blackman'sBay 308 326 227 227 276 278 191 201 192 192 BBy33 Blackman'sBay 306 306 227 227 276 288 190 201 192 192 BBy34 Blackman'sBay 306 310 227 227 276 276 ? ? 192 192 BBy35 Blackman'sBay 306 326 227 227 276 276 198 200 192 192 BBy36 Blackman'sBay 306 308 224 227 276 276 190 200 192 192 CIB7 Coles Bay 306 310 227 227 276 276 190 201 192 192 CIB8 Coles Bay 308 308 227 229 291 291 201 201 192 192 236 Appendix 3 Microsatellite Data CIB9 Coles Bay 308 310 227 229 276 278 201 201 192 192 CIB10 Coles Bay_ 306 328 229 229 ? ? 191 200 192 192 CIB11 Coles Bay 308 308 227 229 ? ? ? ? 184 192 CIB12 Coles Bay 309 309 227 229 294 299 201 203 192 192 CIB13 Coles Bay 316 316 227 227 276 276 191 200 192 192 CIB14 Coles Bay 308 308 224 229 276 276 191 201 192 192 CIB15 Coles Bay 302 322 227 230 276 294 200 201 192 192 CIB16 Coles Bay 308 316 227 229 276 293 190 191 184 192 CIB17 Coles Bay 308 332 227 227 ? ? ? ? 192 192 CIB18 Coles Bay 308 330 227 230 276 292 200 201 192 192 CIB19 Coles Bay 308 308 227 229 276 276 200 201 192 192 CIB20 Coles Bay 306 308 227 229 276 276 191 191 192 192 PrB7 Pirate's Bay 310 320 227 227 276 276 ? ? 192 192 PrB8 Pirate's Bay 306 306 227 227 276 276 201 202 192 192 PrB9 Pirate's Bay_ 308 308 227 227 276 276 191 200 192 192 PrB10 Pirate's Bay 306 308 227 229 276 276 200 200 184 192 PrB11 Pirate's Bay 308 308 227 227 276 294 190 190 192 192 PrB12 Pirate's Bay 306 306 227 227 276 276 201 203 192 192 PrB13 Pirate's Bay_ 306 306 227 227 276 295 200 201 192 192 Pr814 Pirate's Bay 306 308 227 227 276 276 190 200 192 192 PrB15 Pirate's Bay 308 326 227 227 276 286 190 191 192 192 Pr816 Pirate's Bay 308 318 227 227 276 276 201 201 192 192 PrB17 Pirate's Bay 306 306 227 227 276 276 201 201 192 192 PrB18 Pirate's Bay 308 308 227 229 276 295 190 201 192 192 PrB19 Pirate's Bay 316 316 227 229 276 276 201 201 192 192 PrB20 Pirate's Bay 306 328 227 227 276 276 191 200 192 192 PrB21 Pirate's Bay 308 310 227 229 276 276 191 200 192 192 PrB22 Pirate's Bay 308 312 227 227 276 276 199 203 192 192 PrB23 Pirate's Bay 306 308 227 229 276 276 201 201 192 192 PrB24 Pirate's Bay 306 316 227 227 276 291 201 201 192 192 PrB25 Pirate's Bay 306 306 229 233 276 276 192 203 192 192 PrB26 Pirate's Bay 308 326 227 227 276 276 201 203 184 192 PrB27 Pirate's Bay_ 305 305 224 229 276 276 190 200 192 192 PrB28 Pirate's Bay 322 324 227 229 276 276 201 201 192 192 PrB29 Pirate's Bay 306 308 227 227 276 290 190 191 192 192 PrB30 Pirate's Bay 306 306 227 227 276 276 190 201 192 192 PrB31 Pirate's Bay 306 308 227 227 276 276 191 201 192 192 PrB32 Pirate's Bay 310 325 227 227 276 290 191 200 192 192 PrB33 Pirate's Bay 306 308 227 229 276 276 191 201 192 192 PrB34 Pirate's Bay 308 308 227 227 290 294 200 201 192 192 PrB35 Pirate's Bay 326 326 227 227 276 276 194 200 192 192 Pr836 Pirate's Bay_ 308 317 227 227 276 276 190 200 190 192 Pr837 Pirate's Bay 306 306 227 230 276 276 200 201 192 192 237 Appendix 3 Microsatellite Data A3.2 C polymerus Hardy-Weinberg Equilibrium Sample size of each population, and number of alleles, expected and observed heterozygosities, and tests for Hardy-Weinberg equilibrium per locus and population. Sample Catomerusl Catomerus:Z Catomerus3 Catomerus4 CatomerusS Total Size cc 19 Number 11 3 7 9 2 32 alleles HE 0.853 0.579 0.689 0.763 0.389 0.594 Ho 0.667 0.333 0.824 0.737 0.412 0.655 HWE 0.000 0.026 0.962 0.563 0.812 <0.050 SPB 30 Number 6 4 11 9 1 31 alleles HE 0.674 0.526 0.498 0.756 0.000 0.495 Ho 0.600 0.621 0.467 0.786 0.000 0.491 HWE 0.152 0.574 0.215 0.563 - 0.335 LB 17 Number 7 4 10 8 3 32 alleles HE 0.709 0.600 0.740 0.765 0.174 0.625 Ho 0.706 0.471 0.938 0.824 0.188 0.598 HWE 0.373 0.218 0.969 0.748 0.982 0.842 SB II Number 6 3 9 6 1 25 alleles HE 0.740 0.585 0.821 0.753 0.000 0.533 Ho 0.500 0.500 0.778 0.889 0.000 0.580 HWE 0.121 0.399 0.615 0.561 - 0.414 BP 31 Number 20 4 13 11 2 so alleles HE 0.863 0.591 0.800 0.832 0.467 0.730 Ho 0.767 0.733 0.862 0.867 0.419 0.710 HWE 0.032 0.271 0.804 0 .. 924 0.670 0.375 PS 30 Number 10 8 10 10 3 41 alleles HE 0.744 0.796 0.635 0.778 0.099 0.619 Ho 0.714 0.815 0.577 0.885 0.103 0.611 HWE 0.071 0.053 0.446 0.754 0.993 0.205 PB 14 Number 7 6 5 9 1 28 alleles HE 0.640 0.775 0.621 0.796 0.000 0.649 Ho 0.786 0.769 0.769 0.923 0.000 0.567 HWE 0.899 0.093 0.873 0.297 - 0.496 CpC 13 Number 5 6 5 10 1 27 alleles HE 0.608 0.771 0.488 0.822 0.000 0.592 Ho 0.750 0.750 0.462 1.000 0.000 0.538 HWE 0.967 0.902 0.190 0.477 - 0.757 CB 15 Number 11 4 7 7 2 31 alleles HE 0.825 0.602 0.680 0.760 0.464 0.699 238 Appendix 3 Microsatellite Data Ho 0.846 0.667 0.615 0.769 0.600 0.667 HWE 0.523 0.905 0.308 0.560 0.579 0.823 TH 30 Number 17 4 17 9 3 50 alleles HE 0.873 0.517 0.827 0.766 0.529 0.687 Ho 0.833 0.433 0.867 0.767 0.533 0.702 HWE 0.052 0.126 0.064 0.305 0.997 0.056 CHS 15 Number 13 3 8 8 2 34 alleles HE 0.862 0.487 0.730 0.811 0.490 0.666 Ho 0.800 0.600 0.714 0.786 0.429 0.676 HWE 0.336 0.734 0.864 0.223 0.618 0.720 GP 28 Number 10 5 11 9 2 37 alleles HE 0.706 0.629 0.774 0.794 0.163 0.603 Ho 0.583 0.565 0.808 0.880 0.179 0.613 HWE 0.041 0.270 0.381 0.079 0.604 0.099 Stll 10 Number 7 3 5 7 2 24 alleles HE 0.780 0.565 0.420 0.800 0.180 0.520 Ho 0.600 0.500 0.400 0.900 0.200 0.549 HWE 0.281 0.231 0.493 0.359 0.725 0.538 Fm 34 Number 11 5 9 11 2 38 alleles HE 0.743 0.584 0.350 0.831 0.084 0.508 Ho 0.676 0.625 0.303 0.848 0.088 0.519 HWE 0.142 0.763 0.152 0.485 0.788 0.471 Bi 27 Number 11 4 5 8 3 31 alleles HE 0.729 0.565 0.206 0.766 0.203 0.487 Ho 0.692 0.625 0.185 0.708 0.222 0.494 liWE 0.132 0.763 0.269 0.716 0.936 0.639 BBy 30 Number 12 4 10 10 3 39 alleles 1-J.E 0.707 0.362 0.389 0.815 0.126 0.470 Ho 0.767 0.348 0.407 0.692 0.133 0.480 HWE 0.173 0.722 0.414 0.199 0.985 0.518 CIB 14 Number 10 4 7 5 2 28 alleles HE 0.745 0.579 0.570 0.712 0.133 0.527 Ho 0.571 0.714 0.455 0.750 0.143 0.548 HWE 0.106 0.459 0.249 0.942 0.773 0.537 PrB 31 Number 14 5 6 9 3 37 alleles HE 0.758 0.328 0.264 0.773 0.093 0.392 Ho 0.548 0.323 0.258 0.733 0.097 0.443 HWE 0.004 0.122 0.470 0.277 0.994 0.038 239 Appendix 3 Microsatellite Data A3.3 C. polymerus Migration Estimates Estimates of geneflow between 18 populations of Catomerus polymerus from the final of three runs ofMIGRA TE. Numbers in bold identify comparisons where asymmetrical geneflow was detected, based on non-overlapping 95% confidence intervals. Pop, CC SBP LB SB Bl' PS PB CpC CB Gl' TH CHS StH 11M Bi HBy CIB PrD I CC-3>1 SDP?I LB?I SB?i HP-3>1 PS-71 1'13-3>1 CPC?i CB?I GP-3>1 TH-3>1 CHS?/ StH~/ fM?/ lli~/ BBy-7/ CIB?/ PrB?f cc 81.34 44.37 14.79 184.87 59.16 29.58 7.39 81.34 88.74 66.55 81.34 86.97 118.31 s1.76 51.76 2218 81.34 SBP 95.14 71.36 47.57 79.29 158.!57 55.50 47.57 23.79 126.86 63.43 150.64 23.79 214.07 126.86 174.43 31.71 190.29 LB 83 87 125.80 20.97 115.32 115.32 20.97 !52.42 41.93 83.87 41.93 90S 52.42 136.28 104.113 12S.80 62.90 125.80 SB !lUI 143.63 152.27 152.27 274.08 30.45 152.27 60.91 113.111 182.71 113.18 91.36 182.72 18:1.71 UUI 30.45 113.18 BP 58.06 73.90 26.39 31.67 100.29 31.67 26.39 47.51 109.03 84.46 105.57 15.84 121.41 63.34 3U7 100.29 PS 50.30 55.88 89.41 17.94 128.53 39.12 83.83 44.71 95.00 !10.30 134.12 44.71 72.65 67.06 167.6S 61.47 100.59 PB 69.00 10450 120.75 0.00 120.75 189,75 34.50 34.50 172.4!5 120.75 86.25 17.25 155.15 I S$.25 2511.7~ SI.7S 38.00 CpC lllJ4 168.50 308.92 56.17 308.92 252.75 168.50 84.2!5 112.34 112.34 JOUl 28.08 214.67 168.50 168.50 84.25 lol.li7 en 143.80 91.51 65.37 6537 19(,.1o 130.73 52.29 0.00 209.17 91.51 156.88 26.15 78.44 S2.29 I 04 .SS 13.07 t04.S8 GP 96 87 126.67 701 44.71 283.14 14U7 19.80 29.80 89.41 96.87 126.67 37.26 141.57 104.32 74.51 59.61 126.67 Til 79 43 79 43 11.35 11J5 204.24 45.39 45.39 22.69 90.77 126.93 68.08 45.39 113.47 45.39 90.77 34.0·1 CHS 10215 134 07 25.54 12.77 I 34.07 15.1 22 57.46 I9,1S 44.69 114.91 51.07 38.30 82.99 114.91 70.23 31.92 82.99 su1 15J.2Z 65 66 109.44 43.78 87 55 175.10 21.89 21.89 65.66 87.55 21.89 Zl8.118 175.10 lJl.JJ 21.89 140.77 8142 113.13 56 56 36.00 141 98 66 85 JO.SS 61.71 36.00 7199 46.28 102.84 46.18 I 54.27 113.13 41.14 143.98 n. tiJ 50 69 s:s 96.04 26.19 IJ<) 70 174.62 52 .19 ~2.39 34.92 96.04 61.12 122.24 61.12 209.55 200.81 96.04 261.93 liBy 48 17 132.47 48.17 18.06 126.45 I6U8 72.26 30.11 42.15 84.30 30.11 120.43 30.11 138.49 102.63 72,16 em 87.93 211.02 70.34 17.59 158.27 246.19 35.17 35.17 52.76 140.68 52.76 70.34 35.17 211.o1 175.85 :m.oz 175.85 Prfl 5115 85.73 68.58 0.00 I 02.87 97.16 45.72 11.43 62.87 62.87 45.71 102.87 34.29 171.46 160.03 137.17 34.19 . 240 Appendix 3 Microsatellite Data A3.4 C tasmanica Microsatellite Genotype Data Microsatellite genotypes for 182 individuals of Chamaesipho tasmanica for five microsatellite loci. ? indicates no amplification or ambiguous genotype. Sample Population CTAClO TAGA42 CTAC16 CTAC23 CATC13 ID 8811 Berrys Beach 190 193 358 358 198 220 177 183 236 242 8812 Berrys Beach 190 192 358 358 196 200 183 183 236 242 885 Berrys Beach 190 190 ? ? 194 220 183 183 236 242 886 Berrys Beach 194 194 358 358 196 198 183 183 236 242 Bi3 Bicheno 192 192 358 358 192 198 183 183 236 242 Bi35 Bicheno 192 192 347 358 196 198 183 183 236 242 Bi36 Bicheno 190 195 358 358 198 220 183 183 236 242 8i37 Bicheno 190 190 358 358 194 198 183 183 236 244 Bi38 Bicheno 192 193 ? ? 198 220 183 183 236 242 Bi39 Bicheno 190 192 358 358 196 198 183 183 236 242 Bi4 Bicheno 190 190 358 358 192 196 183 183 236 242 Bi40 Bicheno 190 190 ? ? 196 196 183 183 236 242 Bi41 Bicheno 190 190 ? ? 204 204 183 183 236 242 BP42 Bastion Point 190 190 358 358 194 206 183 183 236 242 BP43 Bastion Point 190 190 ? ? 198 198 183 183 236 242 BP44 Bastion Point 190 194 ? ? 196 196 183 183 236 242 BP45 Bastion Point 190 190 ? ? 196 206 183 183 236 242 BPS Bastion Point 190 190 346 358 198 204 183 183 236 242 BP6 Bastion Point 190 190 358 358 190 198 183 183 236 242 BR10 Black Rock 190 190 358 358 182 188 183 183 236 242 BR11 Black Rock 190 192 ? ? 182 188 183 183 236 242 BR12 Black Rock 191 194 ? ? 182 188 183 183 236 242 BR13 Black Rock 190 192 358 358 182 188 183 183 236 242 BR14 Black Rock 190 190 300 300 182 188 183 183 236 242 BR15 Black Rock 190 193 358 358 182 188 183 183 236 242 BR16 Black Rock 190 190 358 358 182 188 183 183 236 242 BR17 Black Rock 190 190 358 358 182 188 183 183 236 242 BR18 Black Rock 189 189 358 358 182 188 183 183 236 242 BR19 Black Rock 190 190 358 358 182 188 183 183 236 242 BR20 Black Rock 190 192 ? ? 182 188 183 183 236 242 BR21 Black Rock 190 190 358 359 182 188 183 183 236 242 BR22 Black Rock 190 192 358 358 182 188 183 183 236 242 BR23 Black Rock 192 192 358 358 182 188 183 183 236 242 BR24 Black Rock 190 190 302 358 194 218 183 183 236 244 BR25 Black Rock 190 190 358 358 194 198 183 183 236 242 BR26 Black Rock 190 190 358 358 190 198 183 183 236 242 BR27 Black Rock 190 190 300 300 194 198 183 183 236 242 BR28 Black Rock 190 190 358 358 194 218 183 183 236 242 BR29 Black Rock 190 194 358 358 198 220 183 183 236 242 BR3 Black Rock 190 191 358 358 198 198 183 183 236 242 BR4 Black Rock 191 191 ? ? 198 198 183 183 236 242 BR7 Black Rock 188 190 358 358 182 188 182 183 236 242 8R8 Black Rock 190 190 358 358 182 188 183 183 236 242 241 Appendix 3 Microsatellite Data BR9 Black Rock 190 192 ? ? 182 188 183 183 236 242 CB12 Cape Banks 190 190 ? ? 198 220 183 183 236 242 CB14 Cape Banks 190 192 ? ? 196 198 183 183 236 242 CB15 Cape Banks 190 190 358 358 196 220 183 183 236 242 CB16 Cape Banks 190 192 ? ? 196 196 183 183 ? ? CB5 Cape Banks 192 192 358 358 192 198 183 183 236 242 CB6 Cape Banks 190 192 ? ? 150 220 183 183 242 242 CC10 Cape Conran 190 192 358 358 198 220 183 183 236 242 CC15 Cape Conran 190 192 358 358 198 198 183 183 236 242 CC16 Cape Conran 190 190 ? ? 196 220 183 183 ? ? CC17 Cape Conran 189 192 ? ? 192 198 183 183 236 ? CC18 Cape Conran 190 190 358 358 218 218 183 183 236 242 CC19 Cape Conran 191 194 358 358 191 195 183 183 236 242 CC20 Cape Conran 191 191 3?2 3?2 198 220 182 183 236 242 CC21 Cape Conran 190 192 358 358 196 200 183 183 236 242 CC22 Cape Conran 192 192 358 358 206 218 183 183 236 242 CC23 Cape Conran 190 193 358 358 220 220 183 183 236 242 CC24 Cape Conran 190 192 3?2 342 198 206 183 183 236 242 CC25 Cape Conran 192 194 347 358 220 220 183 183 236 242 CC26 Cape Conran 190 194 358 358 198 220 183 183 236 242 CC27 Cape Conran 190 192 358 358 196 220 183 183 236 242 CC28 Cape Conran 190 190 358 358 196 196 183 183 236 242 CC29 Cape Conran 190 190 358 358 198 198 181 183 236 242 CC3 Cape Conran 190 192 ? ? 198 206 183 183 236 242 CC30 Cape Conran 190 190 302 358 196 200 183 183 236 242 CC31 Cape Conran 190 192 358 358 194 194 183 183 236 242 CC9 Cape Conran 190 192 358 358 206 220 183 183 236 242 CHN10 Charlotte Head 191 192 358 358 194 198 183 183 236 242 CHN11 Charlotte Head 190 192 302 302 192 198 183 183 236 242 CHN12 Charlotte Head 190 192 358 358 198 198 183 183 236 242 CHN13 Charlotte Head 190 194 358 358 198 198 183 183 ? ? CHN14 Charlotte Head 190 192 ? ? 198 220 183 183 236 242 CHN3 Charlotte Head 190 190 358 358 192 200 183 183 236 242 CHN4 Charlotte Head 190 192 358 358 196 196 183 183 236 242 CpC20 Cape Carnot 192 192 358 358 182 188 183 183 236 242 CpC21 Cape Carnot 190 192 ? ? 182 188 183 183 236 ? CpC22 Cape Carnot 190 190 358 358 182 188 183 183 236 242 CpC23 Cape Carnot 190 194 340 ? 182 188 183 183 236 242 CpC24 Cape Carnot 190 192 ? ? 182 188 183 183 236 244 CpC25 Cape Carnot 190 192 ? ? 182 188 183 183 236 242 CpC3 Cape Carnot 192 192 358 358 196 198 182 183 236 242 CpC4 Cape Carnot 192 192 ? ? 198 220 183 183 236 242 GP38 Griffith Point 190 190 358 358 182 188 183 183 236 242 GP39 Griffith Point 190 190 300 300 182 188 183 183 236 242 GP40 Griffith Point 190 190 358 358 182 188 183 183 236 242 GP41 Griffith Point 192 192 358 358 182 188 183 183 236 242 GP42 Griffith Point 190 190 358 358 182 188 183 183 236 242 GP43 Griffith Point 191 192 358 358 182 188 183 183 236 242 GP44 Griffith Point 190 190 358 358 182 188 183 183 236 242 GP45 Griffith Point 190 190 358 358 182 188 183 183 236 242 GP46 Griffith Point 190 190 302 358 182 188 183 183 236 242 GP47 Griffith Point 190 190 344 358 182 188 183 183 236 242 GP48 Griffith Point 190 190 359 359 182 188 177 183 236 242 242 Appendix 3 Microsatellite Data GP49 Griffith Point 190 192 7 ? 182 188 183 183 236 242 GP5 Griffith Point 190 193 7 ? 194 194 183 183 236 242 GP50 Griffith Point 190 192 358 358 194 204 183 183 236 242 GP51 Griffith Point 190 192 358 358 200 218 183 183 236 242 GP52 Griffith Point 192 192 300 358 198 218 183 183 236 242 GP53 Griffith Point 190 190 302 ? 198 206 183 183 236 242 GP6 Griffith Point 192 192 358 358 196 198 183 183 236 242 HP15 Hermit Point 190 190 302 302 198 220 183 183 236 ? HP16 Hermit Point 190 192 358 358 196 206 183 183 236 242 HP17 Hermit Point 190 190 7 ? 198 220 183 183 236 7 HP3 Hermit Point 190 192 ? ? 198 198 183 183 236 242 HP4 Hermit Point 190 190 7 ? 198 220 183 183 236 244 LB26 Portsea 190 192 358 358 194 194 183 183 236 242 LB27 Portsea 192 192 358 358 198 198 183 183 236 242 LB28 Portsea 190 192 358 358 196 200 183 183 236 242 LB29 Portsea 192 195 7 ? 206 220 183 183 236 242 LB30 Portsea 195 195 358 358 198 220 183 183 236 242 LB5 Portsea 190 190 358 358 194 198 183 183 236 242 LB6 Portsea 190 192 302 ? 198 198 183 183 236 242 PJ1 Penneshaw 190 190 358 358 196 206 ? ? 236 242 PJ3 Penneshaw 190 190 358 358 196 200 183 183 236 242 PJ4 Penneshaw 190 190 358 358 190 198 183 183 236 242 PJ5 Penneshaw 192 192 358 358 198 206 177 183 236 242 PJ6 Penneshaw 192 192 358 358 196 202 183 183 236 242 PJ7 Penneshaw 192 194 ? ? 200 206 183 183 ? ? PJ8 Penneshaw 192 194 358 358 198 206 183 183 236 242 PJ9 Penneshaw 190 190 300 300 198 198 183 183 236 ? PS3 Point Sinclair 192 192 358 358 194 198 183 183 236 242 PS37 Point Sinclair 190 192 ? ? 182 188 183 183 236 242 PS38 Point Sinclair 190 194 ? ? 182 188 183 183 236 242 PS39 Point Sinclair 192 192 ? ? 1~2 188 183 183 236 242 PS4 Point Sinclair 192 192 ? ? 192 192 183 185 236 242 PS40 Point Sinclair 190 190 358 358 182 188 183 183 236 242 PS41 Point Sinclair 190 192 ? ? 182 188 183 183 236 242 PS42 Point Sinclair 192 192 358 358 182 188 183 183 236 242 PS43 Point Sinclair 190 190 302 358 182 188 183 183 236 242 PS44 Point Sinclair 192 194 300 300 182 188 183 183 236 242 SBP2 Portland 190 192 358 358 198 218 183 183 236 242 SBP35 Portland 190 192 ? 358 198 206 183 183 236 242 SBP36 Portland 190 190 358 358 196 196 183 183 236 242 SBP37 Portland 192 192 ? ? 198 206 183 183 236 242 SBP5 Portland 190 190 358 358 198 218 183 183 236 242 SH10 Scotts Head 192 192 364 364 194 198 183 183 236 242 SH11 Scotts Head 190 190 358 358 196 200 177 183 236 242 SH12 Scotts Head 190 192 300 300 206 206 183 183 236 242 SH13 Scotts Head 192 192 358 358 200 200 183 183 236 242 SH14 Scotts Head 190 192 300 300 204 206 183 183 236 242 SH15 Scotts Head 192 192 358 358 194 198 183 183 236 242 SH16 Scotts Head 190 190 358 358 ? 220 183 183 236 242 SH3 Scotts Head 190 190 ? ? 192 220 183 183 236 242 SH4 Scotts Head 190 190 358 358 194 198 183 183 236 242 SH9 Scotts Head 190 192 358 358 192 220 183 183 236 242 StH19 St Helens 190 190 358 358 190 196 183 183 236 242 243 Appendix 3 Microsatellite Data StH20 St Helens 190 190 358 358 198 202 183 183 236 242 StH21 St Helens 190 190 358 358 200 200 183 183 236 242 StH22 St Helens 190 192 358 358 194 198 183 183 236 242 StH23 St Helens 190 190 358 358 192 198 183 183 236 242 StH24 St Helens 162 162 358 358 198 206 183 183 236 242 StH25 St Helens 190 190 358 358 198 198 183 183 236 242 StH3 St Helens 176 190 358 358 198 198 183 183 236 242 StH4 St Helens 190 192 358 358 196 198 183 183 236 242 TH39 Tura Head 190 190 358 358 182 188 183 183 236 242 TH40 Tura Head 192 195 302 ? 182 188 183 183 236 242 TH41 Tura Head 190 190 302 358 182 188 183 183 236 242 TH42 Tura Head 192 193 302 ? 182 188 183 183 236 242 TH43 Tura Head 192 192 ? ? 182 188 183 183 236 242 THS Tura Head 190 190 ? ? 198 220 183 183 236 244 TH6 Tura Head 190 192 364 364 198 220 183 183 236 242 WH10 West Head 162 191 358 358 198 206 183 183 236 242 WH11 West Head 190 190 ? ? 198 206 177 183 236 242 WH13 West Head 190 193 302 ? 196 198 183 183 236 242 WH14 West Head 194 194 ? ? 196 200 183 183 236 242 WH15 West Head 190 194 ? ? 220 220 183 183 236 242 WH16 West Head 162 162 302 302 196 198 183 183 236 242 WH17 West Head 190 190 358 358 198 206 183 183 236 242 WH19 West Head ? ? 358 358 196 198 183 183 236 242 WH3 West Head 190 194 ? ? 220 220 183 183 236 242 WH4 West Head 190 190 ? ? 198 220 183 183 242 242 WH7 West Head 192 192 ? ? 198 206 183 183 236 242 WH8 West Head 190 196 ? ? 196 220 183 183 236 244 WH9 West Head 192 195 ? ? 196 220 183 183 236 242 WP3 Waterhouse Point 190 190 ? ? 206 220 183 183 236 242 WP4 Waterhouse Point 191 191 358 358 192 206 183 183 236 242 WP7 Waterhouse Point 192 192 358 358 196 220 177 183 236 242 WP8 Waterhouse Point 190 190 ? ? 198 220 183 183 236 242 WP9 Waterhouse Point 192 192 358 358 198 220 183 183 236 242 244 Appendix 3 Microsatellite Data A3.5 C tasmanica Hardy-Weinberg Equilibrium Sample size of each population, and number of alleles, expected and observed heterozygosities, and tests for Hardy- Weinberg equilibrium per locus and population. Sam_pie Size CTACIO TAGA42 CTAC/6 CTAC23 CATC13 Total BB Number alleles 4 1 5 2 2 14 HE 0.656 0.000 0.781 0.219 0.500 0.431 Ho 0.500 0.000 1.000 0.250 1.000 0.550 HWE 0.3206 NA 1.000 NA 0.3166 0.5993 Bi Number alleles 4 2 6 1 3 16 HE 0.574 0.153 0.772 0.000 0.549 0.410 Ho 0.333 0.167 0.778 0.000 1.000 0.456 HWE 0.0774 NA 0.4178 NA 0.0135 0.0169 BP Number alleles 2 2 6 1 2 13 Hn 0.153 0.278 0.778 0.000 0.500 0.342 Ho 0.167 0.333 0.667 0.000 1.000 0.433 HWE NA NA 0.4079 NA 0.0912 0.1596 BR Number alleles 7 4 7 2 3 23 HE 0.534 0.266 0.734 0.039 0.519 0.419 Ho 0.400 0.100 0.920 0.040 1.000 0.492 HWE 0.0624 0.0021 0.0000 NA 0.0000 <0.05 en Number alleles 2 1 5 1 2 11 Hn 0.486 0.000 0:750 0.000 0.480 0.343 Ho 0.500 0.000 0.833 0.000 0.800 0.427 HWE 1.000 NA 1.000 NA 0.4295 0.9459 cc Number alleles 6 4 10 3 2 25 HE 0.648 0.306 0.830 0.096 0.500 0.476 Ho 0.650 0.176 0.650 0.100 1.000 0.515 HWE 0.0987 0.0377 0.0119 1.000 0.0001 0.000 CHN Number alleles 4 2 6 1 2 15 HE 0.612 0.278 0.694 0.000 0.500 0.417 Ho 0.857 0.000 0.571 0.000 1.000 0.486 HWE 0.5346 0.0919 0.3095 NA 0.0892 0.1050 CpC Number alleles 3 1 5 2 3 14 HE 0.539 0.000 0.695 0.117 0.561 0.383 Ho 0.500 0.000 1.000 0.125 1.000 0.525 HWE 0.6633 NA 0.0036 NA 0.0493 0.0060 GP Number alleles 4 5 9 2 2 22 HE 0.477 0.396 0.758 0.054 0.500 0.437 Ho 0.278 0.200 0.944 0.056 1.000 0.496 HWE 0.0425 0.0318 0.000 NA 0.000 <0.05 HP Number alleles 2 2 4 1 3 11 HE 0.320 0.500 0.640 0.000 0.611 0.414 Ho 0.400 0.000 0.800 0.000 1.000 0.440 HWE 1.000 0.3330 0.2008 NA 1.000 0.7129 LB Number alleles 3 1 6 1 2 13 HE 0.643 0.000 0.735 0.000 0.500 0.376 Ho 0.571 0.000 0.571 0.000 1.000 0.429 245 Appendix 3 Microsatellite Data HWE 0.4882 NA 0.1787 NA 0.0376 0.0757 PJ Number alleles 3 2 6 2 2 15 HE 0.594 0.245 0.781 0.133 0.500 0.451 Ho 0.250 0.000 0.875 0.143 1.000 0.454 HWE 0.0051 0.0774 0.8702 NA 0.0919 0.0079 PS Number alleles 3 3 5 2 2 15 HE 0.565 0.460 0.665 0.095 0.500 0.457 Ho 0.400 0.200 0.900 0.100 1.000 0.520 HWE 0.3276 0.1085 0.0002 NA 0.0071 0.000 SBP Number alleles 2 1 4 I 2 10 HE 0.480 0.000 0.720 0.000 0.500 0.340 Ho 0.400 0.000 0,800 0.000 1.000 0.440 HWE 1.000 NA 0.2391 NA 0.1276 0.3227 SH Number alleles 2 3 8 2 2 17 HE 0.495 0.494 0.858 0.095 0.500 0.488 Ho 0.300 0.000 0.778 0.100 1.000 0.436 HWE 0.2434 0.0010 0.000 NA 0.0065 <0.05 StH Number alleles 4 1 8 I 2 16 HE 0.451 0.000 0.710 0.000 0.500 0.332 Ho 0.333 0.000 0.667 0.000 1.000 0.400 HWE 0.1509 NA 0.5973 NA 0.0106 0.0307 Til Number alleles 4 3 4 1 3 15 HE 0.612 0.611 0.704 0.000 0.561 0.498 Ho 0.429 0.333 1.000 0.000 1.000 0.552 HWE 0.1940 0.1987 0.0062 NA 0.0533 0.0040 WH Number alleles 8 2 5 2 3 20 HE 0.760 0.375 0.754 0.074 0.536 0.500 Ho 0.500 0.000 0.846 0.077 0.923 0.469 HWE 0.0308 0.1434 0.0704 NA 0.0075 0.0011 WP Number alleles 3 1 5 2 2 13 HE 0.640 0.000 0.740 0.180 0.500 0.412 HO 0.000 0.000 1.000 0.200 1.000 0.440 HWE 0.0100 NA 0.8988 NA 0.1236 0.0343 246 Appendix 4 Published Paper Appendix 4 Pu blisl1ed PatJer Molecular Ecology (2008) 17, 1948--1961 doi: 10.1111/j.1365-294X.2008.03735.x The Bassian IsthmtiS and the major ocean currents of southeast Australia inflt1et1ce tl1e pl1ylogeograpl1y and population strttcture of a soutl1ern Australian intertidal barnacle Catomerus poly1nerus (Darwin) KATHERINE L. YORK,* MARK j. BLACKETt&BELINDA R. APPLETON~ .. Department of Genetics, UHiversity of Me.lboume, Parkville, Vic/aria 3010, Australia, tCeutre for Environmcmltll Stress ami Adaptation Research, Departmelll ofGemtics, University of Mdboume, Parkville, Victoria 3010, Australia Abstract Southern Australia is currently divided into three marine biogeographical provinces based on faunal distributions and physical parameters. These regions indicate eastern and western distributions, with an overlap occurring in the Bass Strait in Victoria. However, studies indicate that the boundaries of these provinces vary depending on the species being examined, ;md in particular on the mode of development employed by that species, be they direct developers or planktonic larvae dispersers. Mitochondrial DNA sequence analysis of the surf barnacle Catoments polymerus in southern Austrillia revealed an east-west phylogeo grilphical split involving two highly divergent clades (cytochrome oxidase I 3.5 ± 0.76%, control region 6.7 ± 0.65%), with almost no geographical overlap. Spatial genetic structure was not detected within either clade, indicative of a relatively long-lived planktonic larval phase. Five microsatellile loci indicated that C. polymems populations exhibit relatively high levels of genetic divergence, and fall into four subregions: eastern Australia, central Victoria, western Victoria and Tasmania, and South Australia. F51 values between eastern Australia (from the eastern mitochondrial DNA clade) and the remaining three subregions ranged from 0.038 to 0.159, with other analyses indicating isolation by distance between the subregions of western mitochondrial origin. We suggest that the cast-west division is indicative of allopatric divergence resulting from the emergence of the Bassian land-bridge during glacial maxima, preventing gene flow between these two lineages. Subsequcnlly, contemporary ecological conditions, namely the East Australian, Leeuwin, and Zeehan currents and the geographical disjunctions at the Coorong and Ninety Mile Beach are most likely responsible for the four subregions indicated by the microsatellite data. Ke}(7vords: Australi", biogeography, Catomerus polymerus, gene flow, microsatellites, mtDNA 1\eceivl'd 7 Dl'ccm/Jer 2007: rl'vishm rl'ccivt~d 19fmwary 2008; accepted 5 Fdm111ry 2008 that there may be two species of Catomerus on mainland Introduction Australia and Tasmania (Ross & Newman 2001), but this CattJIIUrus pofymerrts (0Mvvin) is a highly distinctive species wns not examined in any detail. of intcrtid Fig. 1 Shaded regions indicate the marine biogeographical provinces of southern Australia as proposed by Bennet & Pope (1953). Extensive sandy regions (Coorong, r)-i~~ ~. Ninety Mile Beach) are indicated by 'X'. The Leeuwin Current partially reverses Peronlan ) \ during summer, while the East Australian Current extends farther south. Leeuwlo Curntnt Flindersian Maugean East j, e Australian Curren1 \\ Sovt.h Au'iotrnfta Nf'\'1 South W~ \ Clroat Aut~trnhan Ellgi'lt completely absent in the Ninety Mile Beach region, in for several weeks (Crisp 1974; Walker et al. 1987). Studies of eastern Victoria, due to lack of suitable rocky substrate. the breeding patterns of C. polymerus in New South Wales Previous studies of southern Australian marine species suggest that reproductive activity peaks during autumn/ (Bennett & Pope 1953, 1960; Knox 1963; Rowe & Vail1982) winter, with the main spawning of larvae occurring during have led to the recognition of three distinct marine bio late winter/spring (Wisely & Blick 1964; Mackiewicz 1975; geographical provinces: the Peronian province (southeast Egan & Anderson 1989). The annual breeding pattern in Australia), the Flindersian province (southwest) and the southern populations has not been determined, but Maugean province (Tasmania and southern Victoria; Fig. 1). reproductively active individuals have been collected While the causes of these biogeographical patterns are not from Tasmania during winter and autumn (Fleming 1986). entirely certain, researchers have suggested a number of The movement of C. polymerus larvae is aided by major factors. These include contemporary factors such as coastal currents in the southern Australian marine region; primarily regions which lack shallow rocky reef habitats (Edgar the Leeuwin Current, the East Australian Current and the 1986), the prevailing ocean currents in the region and Zeehan Current (Baines et al. 1983) (Fig. 1). The Leeuwin temperature gradients (Bennett & Pope 1953, 1960; O'Hara Current, a warm ocean current, flows southward along the & Poore 2000). Historical factors include the Bassian land Western Australian coast, then turns east along the South bridge which was present during glacial maxima and would Australian coast. In the region of the Great Australian have most certainly blocked gene flow betwt..>en eastern Bight, the Leeuwin Current is replaced by the Great and western marine populations (Burridge eta!. 2004). Australian BightCurrent(Rochford 1986), then the weaker Barnacles undergo a two-phase life cycle of planktonic Zeehan Current which runs as far east as the west coast of larval form and sessile adult form, whereby gene flow is Tasmania (Baines et al. 1983). However, generally the Great facilitated by the larval phase. Most literature assume that Australian Bight Current is referred to as part of the species with a long-lived planktonic larval phase have Leeuwin Current. The East Australian Current (EAC) flows vast geographical distributions, and minimized genetic south along the east coast of Australia, and generates ocean structure (Booth & Ovenden 2000; Burridge 2000), while eddies, most of which rotate anti clockwise. The EAC reaches the opposite is usually true for species with short-lived its peak in summer, reaching farthest south, while it is at planktonic larvae (Planes et al. 2001; Riginos & Victor 2001). its weakest in winter (Til burg et al. 2001). It is hypothesized It is unknown what precisely is the length of the cyprid that the action of these currents will be a major contributi.ng stage of C. polymerus; however, studies of other barnacle factor in the contemporary structuring of C. polymerus species suggest that the larvae may survive in the plankton populations. @ 2008 The Authors Journal compilation C 2008 Blackwell Publishing Ltd POPULATION STRUCTURE OF CATOMERUS POLYMERUS 3 PS A StH .. FM I' I ...... __ ,." I B Fig. 2 Map of Catomerus polymerus collection sites from rocky shores in southeastern Australia. PS, Point Sinclair; CpC, Cape Camot; PB, Pennington Bay; SBP, Portland; AI, Aireys Inlet; BR, Black Rock; LB, Portsea; SB, Sorrento; 88, Berry's Beach; GP, Griffith Point; CC, Cape Conran (includes SG, WC, EC); BP, Bastion Point; TH, 'fura Head; CB, Cape Banks; CHS, Charlotte Head; StH, St Helens Point; Fm, falmouth; Bi, Bicheno; CJB, Coles Bay; PrB, Pirate's Bay; BBy, Blackman's Bay. Estimates of gene flow between 18 populations ofC.polymerus are used to indicate direction of gene flow. Single-headed arrows indicate asymmetrical gene flow, while double-headed arrows indicate bidirectional gene flow. Dashed arrows show overall migration in defined subregions (between outermost, edge, populations within the subregion). Shaded arrows indicate direction of gene flow across biogeographical breaks (Coorong, Ninety Mile Beach). Letters A-D refer to the subregions. In this study, we have utilized both mitochondrial DNA microsa tellite loci make them ideal for the study of con (mtDNA) sequence data and microsatellite analyses to temporary population structure and the ecological factors examine both the historic and contemporary processes responsible. As C. polymerus is hermaphroditic, mtDNA is which have shaped the biogeography of C. polymerus expected to be a better reflector of patterns of population populations in Australia. These data allow us to make structure than in bisexual organisms where sex-biased hypotheses as to the causes of this structuring with regards genetic pattems may be observed. to environmental and ecological factors at work in the southern Australian intertidal marine environment. Materials and methods Ecological hypotheses predict that genetic diversity is correlated with geographical barriers such as the Ninety Sample collection a11d DNA preparation Mile Beach or the Coorong (hypothesis 1), while contem porary gene flow might be correlated with major ocean Samples of Catomerus polymerus were collected by hand currents (hypothesis 2). On the other hand, a historical from rocky intertidal zones throughout the species' range vicariant hypothesis predicts that genetic diversity might (Fig. 2). Up to 30 individuals· were collected from each be correlated with the Bassian Isthmus (hypothesis 3). population, where a population is defined as a geographical mtDNA is well established as a marker for the examination collection locality. Collections were made from March 2005 of historical patterns, while the rapid rate of mutation of to December 2006, and the samples were preserved in 70% © 2008 The Authors Journal compilation© 2008 Blackwell Publishing Ltd 4 K. L. YORK ET AL. ethanol. Samples were collected in the form of whole Mitochondrial DNA sequence analysis individuals, or as partial samples, in that a few of the small imbricating plates (and associated membrane) of C. All sequences were aligned using the CLUSTAL w algorithm polymerus were carefully removed with a scalpel. Additional (Thompson et al. 1994) in MEGA 3.1 (Kumar et al. 2004) with unpublished data show that these sampled individuals default settings. Pairwise distances were calculated using survive for at least 8 months following the removal of the the Kimura 2-parameter model, and neighbour-joining (NJ) imbricating plates (K.L. York, unpublished data). trees constructed using Tesseropora rosea and Austrobalanus DNA was extracted from cirral tissue or plate membrane imperator sequences as the outgroups. Maximum likelihood following a modified lithium chloride/ chloroform protocol (ML) and maximum-parsimony (MP) analyses were also described by Gernrnel & Akiyama (1996). The tissue was conducted using the heuristic search option in PAUl'* extracted using a standard proteinase K extraction followed (Swofford 2001). MODELTEST version 3.7 (Posada & Crandall by addition of isoamyl alcohol/ chloroform and precipitation 1998) was used to select the most appropriate model of with ethanol. The DNA was then dried and resuspended molecular evolution used for the ML analyses. COl data in TE buffer. were analysed under a TVM+G model ('nst = 6'; rates= 'gamma'), while control region data were analysed under a TRN+G model (nst = 6; rates= gamma) (Tamura & Nei Mitochondrial DNA amplification and sequencing 1993). The robustness of the branching patterns were We amplified partial mtDNA cytochrome oxidase I (COl), assessed using bootstrapping (Felen.stein 1985), with 1000 and control region (CR) fragments from one to two indi replicates for NJ and MP, and 100 replicates for MLanalyses. viduals randomly selected from each of the populations of C. polymerus. We also amplified these fragments from Microsatellite isolation and allele detection samples of Tesseropora rosea and Austrobahmus imperator for use as outgroup taxa. Chthamalu.s antennatus was our first Genomic DNA from four individuals of C. polymerus was choice for the outgroup; however, no product could be combined and digested with Msel, resulting in 200-1000 bp amplified for the control region. The topology of the tree fragments. Microsatellite loci were then isolated using the was the same regardless of the outgroup taxa used. (fast isolation by AFLP of sequences containing repeats) Partial sequences of the mitochondrial COl gene were FIASCO protocol (Zane et al. 2002). The resulting poly-GA obtained using universal primers LCOI1490 and HCOI2198 and poly-CA enriched genomic libraries were cloned (Folmer et al. 1994) or LCOI1490 and COI-N R (Schram & into pGEM (T-easy vector system) (Promega) and used to Hoeg 1995). Novel primers were used to amplify a section transform Escherichia coli competent cells. of the mitochondrial control region: CR-F (5'-TTI'CYAA Fifty-three clones with inserted plasmids were randomly WATTITCTACTGAG-3') and CR-R (5'-CAAAGTAAYC selected from LB plates and incubated at 95 °C for 3 min in CTTITWTCAGGC-3'). These primers were designed from SO JlL TE buffer [100 mM Tris-HCl (ph 7.6), 1 mM EDTA]. full mitochondrial genomes of Megabalcmus volcano, Pollicipcs Resulting DNA was amplified by polymerase chain reaction polymerus and Tetraclita japonica on GenBank (Accession nos (PCR) with M13 forward and reverse primers, and seq NC_006293, NC_005936, NC_008974). uenced by Macrogen using universal primers 17 and SP6. Polymerase chain reaction (PCR) arnplifica tions were per Fifteen primer pairs flanking microsatellite regions formed on a Mastercycler gradient thermocycler (Eppendorf). were designed using PlUMER 3 (Rozen & Skaletsky 2000), Amplification consisted of an initial denaturation at 96 oc and optimized on a Mastercycler gradient thermocycler for 3 min, followed by 30 cycles of 96 oc for 30 s, the appropri (Eppendorf).1en microsatelliteswere successfully optimi1.ed; ate annealing temperature for 30 s, and 72 °C for 30 s, with however, due to monomorphism and high levels of stuttering a final extension step at 72 oc for 4 min. The annealing tem (PCR slippage), five were employed in sample genotyping. perature used for COl was 44 oc while 47 °C was used for One member of each primer pair was end-labelled with the control region. PCR products were purified using a a fluorophore (either PAM or TET). DNA amplification QIAGEN PCR purification kit. was performed in a 12.5-J.LL volume containing approxi Initially, some of the samples were sequenced in both mately 50-100 ng DNA template, 0.3 pM each of each primer, directions using the BigDye version 3.1 sequencing kit 0.2 mM each dNTP, 2.5 mM MgCI2, Sx PCR buffer, and 0.5 (Applied Biosysterns) as per the manufacturer's instructions. U GoTaq Flexi Taq DNA polymerase (Promega). Amplifica Capillary separation of samples was performed by the tion consisted of an initial denaturation at 94 °C for 3 min, Australian Genome Research Facility (AGRF). The remaining 30 cycles of denaturation at 94 oc for 30 s, annealing for samples were sent to Macrogen for sequencing and cap 30 sat a locus-specific temperature, and exten..•don at 72 oc illary separation. The nucleotide sequence data determined for 30, followed by a final step of 72 °C for 4 min. Details of for the present paper were deposited in GenBank (Accession all primer pairs including annealing temperatures are nos EU423198-EU423267). listed in Table 1. ~ 2008 The Authors Journal compilation "E'O d PCR products from multiple primer sets for each individual r!S s:: bO 0"> ...... ~ \0 R ~ were pooled, purified, and analysed on a MegaBACE1000 ] .s ~ .~ f'l f'l N ~ N Vl~ ~ ~ capillary DNA sequencer by the Genetic Analysis Facility g s s::J Oames Cook Universit)j Townsville). The output was loaded J; ~ IJ,.l ~< ~ ~ IJ,.l ~ .s ~ into FRAGMENT PROFILER version 1.2 (Amersham Biosciences) to enable scoring of genotypes. .,.... C't 1~ 0"> ~ tLI ~ ll'l ~ ~ "11' ~] ::r::: 0 0 0 0 0 .a «1 Statistical analysis of microsatellite variation R~ E i.:P:!r,i.;P:!~u~ 1~ ~~ population per generation. The analysis was run using the ~.so m.icrosatellite model (ladder model; stepwise mutation) e ro "*l :-.. {5 ::l ,...... with heated chains (10 short chains, three long chains), and &~:g 2 ~ ] ~ ran the analysis three times to verify the consistency in ~ Q) QJ ...... ~;§ Q) (1) 2008 'I11e Authors Journal compilation© 2008 Blackwell Publishing Ltd 6 K. L. YORK ET AL. f~:~; · SBP3 BR1 99/100{- 100/99/ ··-·-----.. - ...... _.______...... _ ..... _...... A. Jmperator A. fm/)ftrator '--·----{ ~------~ rosea ~~sea 0.05 Fig. 3 Neighbour joining (NJ) trees for cytochrome oxidase l (left) and control region (right), displaying bootstrap values for parsimony I NJ I ML. East and West refer to the geographical loe C 2008 The Authors Journal compilation C 2008 Blackwell P:ublishing Ltd POPULATION STRUCTURE OF CATOMERUS POLYMERUS 7 Results of spatial structure analysis Fig. 4 Spatial autocorrelation analysis of 0.800------. microsatellitevariation, with 1QO-kmdistance 0.600 classes. Correlation is significant at 300 km 0.400 and 700 km. 0.200 ~ 0.000 -lL-i--+---l--+--+--+__,f---=-f--f--+'---f-=-·¥=--1--l--~'-:::.-~-*"-i'---1 g 4 -0.200 . . -.... •••••••••• - ••••• -0.400 -0.600.l------' ######~##~~~~~~~~#~ Distance Table 2 Range and average pairwise FliT Subregions compared Range of pairwise FSI. Average Fsr AverageNm values between each of the four subregions indicated by principle components analysis. Aand B 0.063-0.159 0.142 2.46 Average gene flow estimates (Nm) between AandC 0.064-0.142 0.129 2.69 each of these subregions is also indlcatt>d A and D 0.038-0.097 0.072 4.95 BandC 0.033-0.055 0.057 7.70 Band 0 0.006-0.156 0.067 6.65 Cand D 0.032-0.055 0.051 8.33 over all loci. Average observed and expected heterozy phylograrn (Fig. 5). When the two factors that explain the gosities were high in all populations (H0 , 0.392-0.730; majority of the variation are plotted against each other, the HE, 0.443-0.71; Table Sl, Supplementary material). populations clearly separate into four subregions. Group The GENEPOP program revealed that four of the five loci A comprises all populations from New South Wales and were in HWE, with Catomcms1 showing a significant eastern Victoria, group B all populations from TaslThmia deviation from HWE in three populations (Cape Conran, and the single population from western Victoria, group C Griffith Point, and Pirates Bay) due to heterozygote deficiency comprises all populations from South Australia, and group in these populations. This was not surprising as two of 0 all populations from central Victoria. All populations these populations were at distribution limits of subregions within these subregions are adjacent except in the case of {Fig. 2). Linkage disequilibrium was possibly indicated the Victorian population included in group B. The UPGMA between only one pair of loci (Catomemsl and Catomems3), distance phylogram confirms the presence of four distinct but occurred only within three of the 18 populations (Cape subregions. Pairwise Fsr and Nm values between each of Conran, Falmouth, Bicheno). these four subregions are summarized in Table 2. There was a significant correlation between genetic dis The AMOVA test indicated significant variation among tance and geographical distance when the data are taken as the four subregions, with 10% of the variation in micro a whole, with a Mantel test showing a positive correlation satellites explained by differences between the four subregions (r = 0.4331, P = 0.0013). When the two regions are analysed (Table 3). There was also significant variation in micro separately, the western lineage again shows a positive satellites explained by populations within subregions (0.5%); correlation between genetic and geographical distance however, the majority of the variation is explained by the (r =0.3912, P =0.0083). However, no significant correlation within-population component (89%). The pairwise Fsr is indicated in the eastern lineage (r = 0.3187, P = 0.2014). estimates indicated significant differentiation between popu Spatial patterns were also summarized using spatial lations throughout the distribution of Catomerus polymerus autocorrelation. Spatial autocorrelation coefficients for the (Appendix). 100-km distance classes (Fig. 4) are significantly positive Estimates of gene flow calculated with the MIGRATE at 300 km and 700 km. The same result is present at all computer program indicated there were moderate to high distance classes up to 200 km. levels of gene flow between populations within subregions. The relationships between individuals from the different The results were consistent between all three runs. Unid.irec- populations are clearly shown by the two-dimensional tional estimates of 4Nm ranged from 0.00 to 308.92 (Table PCA of the microsatellite variation and the UPGMA distance 52, Supplementary material). Of the 18 pairwise comparisons ©2008 The Authors Journal compilation© 2008 Blackwell Publishing Ltd 8 K. L. YORK ET AL. c Coordinatd 1 (61.49%) ··-··--····~-... ;:: ::~:" ~ a.. uon Point A . Tura Head Charlotte Head Colet Bay Portland 1Falmouth 8 Blackman's Bay Pirate's Bay ~Cape Camot j Pt Sinclair C Pennington Bay Griffith Point I -"--~-- London Bridge D ISornmto 0.1 Fig. 5 Two,-dimensional plot (top) showing the relationships among populations of Catomerus polymerus based on a principle components analysis of five microsatcllite genotypes for 18 populations collected from the southcm Australian coastal region and (bottom) a UPGMA distance phylogram confirming the boundaries of the four subregions indicated. between populations within subregions, eight (44°1<>) had populations within subregions, across subregions (assessed asymmetrical gene flow as indica ted by nonoverlapping as gene flow between the outermost, edge populations), 95% confidence intervals around the estimate of 4Nm and between subregions across biogeographical breaks is into each population. The direction of gene flow between summarized in Fig. 2. «:l2008 TI1e Authors Journal compilation© 2008 Blackwell Publishing Ltd POPULATION STRUCTURE OF CATOMERUS POLYMERUS 9 Table 3 AMOVA comparing genetic variation in microsatellite data among four subregions, among populations within subregions and within populations of Catomerus polymerus Sum of Variance Fixation Percentage Source of variation d.f. squares components indices Pvalue of variation Among subregions 3 87.893 0.151 0.107 < 0.001 10.18 Among populations within subregions 14 22.953 0.007 0.005 <0.001 0.49 Within populations 778 1032.656 1.327 0.102 <0.001 89.33 Total 795 1143.503 1.486 However, during the interglacial cycles when the Bass Discussion Strait was present, gene flow between the two lineages would have been reinstated, allowing the possibility of Phylogeography and origin of populations gene flow, and therefore reducing the extent of differentiation. The phytogeographical structure from the mitochondrial As such, C. polymerus would have been prevented from data provides information regarding the history and origin completely diverging into two species. This is thought to of the current populations of Catomerus polymerus. It is be the case, given the apparent low level of gene flow (see apparent that C. polymerus has a relatively high dispersal discussion below). It is also possible that Tasmania was ability, as neither the eastern nor western mtDNA clade beyond the sou them limit of the species during the glacial shows evidence of population subdivision across reasonably periods due to considerably lower temperatures (Wilson & large geographical scales (up to 300 km). However, the Allen 1987), and was colonized during postglacial expansion mtDNA sequence data do indicate a deep phylogt>ographical of the species' range. split within southern Australia, strongly correlated with a Following the most recent inundation of the Bassian phytogeographical barrier in the Bass Strait region. While Isthmus approximately 10 000-12 000 years ago, the newly various molecular clocks exist for COl, there is no calibrated formed coastline would have provided substrate for post dock for C. polymerus. Therefore, we can approximately glacial colonization, resulting in the distribution we see date this phylogenetic event using molecular calibrations today. The mitochondrial data indicate that populations in for Chthamalus COl (3.1 'Yo per million years; Wares 2001). western and central Victoria and Tasmania are of western Based on this, the mtDNA divergence between the two origin. This appears to correlate with the formation of clades (up to 5.9%, mean 3.5%) may correspond to isolation the Bass Strait, which arose when the isthmus was flooded during the Pliocene, up to 2 million years ago. Similarly, the primarily from the west before finally breaching the east molecular dock for shrimp COl (2.2-2.6'X> per million near Wilsons Promontory (Unmack 2001). As the strait was years; Knowltonet al.1993) and echinoderm COl (3.1-3.5% formed, the lineage has expanded towards the east. A.. © 2008 The Authors Journal compilation© 2008 Blackwell Publishing Ltd 10 K. L. YORK ET AL. is in comparison with a species such as N. atramentosa Based on predictive studies of particle movement (National which is able to colonize sites between Ninety Mile Beach Oceans Office 2000), it is most probably the Zeehan Current and Wilsons Promontory, and therefore demonstrates its which is responsible for the gene flow between western disjunction at Wilsons Promontory itself. ln addition, the Victorian populations and Tasmania. The movement of the same east-west division is also seen in the jellyfish Catostylus Zeehan Current during the winter months coincides with mosaicus, and is attributed to reproductive isolation caused predominant period of larval release of C. polymerus, and by the presence of the Bassian Isthmus (Dawson 2005). studies have shown that particles as small as larvae, when released from Portland, would be collected by the current and carried south before being transported around the Contemporary population structure bottom of Tasmania and northwards onto the east coast. The microsatellite data indicate significant genetic diver Values of migration estimated using MIGRATE confirm this, gence between the eastern and western lineages of C. indicating that the overall direction of gene flow occurs polymerus, and also indicate variation within these region..<;. northward up the east coast of Tasmania. The populations in the eastern mitochondrial lineage The major current system influencing the population remain as a separate subregion (group A). The PCA dearly structure in South Australia is the Leeuwin Current, also shows that the western region is divided into a further known as the Great Australian Bight Current at its eastern three subregions (Fig. 5). The three western subregion':l end. Migration values obtained suggest that there is asym have clear geographical divisions; populations from South metrical and bidirectional movement of larvae between the Australia form one subregion (group C), those from central three populations in South Australia (region C, Fig. 5). Victoria another (group D), and the third subregion comprises However, the overall larval migration across this subregion all populations from Tasmania and a single population is from west to east, which coincides with the eastward from western Victoria (group B). The geographical separation flow of the Leeuwin Current, particularly during winter of these populations is supported by significant spatial when the current is at its strongest, and the peak larval autocorrelation results at 300 km and 700 km, which release period is underway. Migration values also suggest suggest that interbreeding subregion populations occur reduced migration into Victoria compared with levels of approximately within a 300-km section of coastline. The migration within South Australia, aiding the separation of significant result at 700 km is probably due to regional these subregions. (east-west) differentiation. In addition to the influence of the current systems, the In addition to the role of vicariance in the shaping of the data suggest that phylogeographical breaks coincide with population genetic structure of C. polymerus, it is apparent sandy regions devoid of rocky reef habitat. Group A in that a number of contemporary environmental factors have Fig. 5 comprises all populations in eastern Victoria and helped to shape the biogeography of U1e species. In particular, New South Wales, and is clearly a separate subregion com the East Australian and Leeuwin currents appear to pared to all other populations (Fsr 0.072-0.142; Table 2). promote gene flow across broad geographical scales; the This break appears to coincide with Ninety Mile Beach. former promotes gene flow between populations on the There is no rocky, high-impact surf habitat in tb.is region for east coast of Australia, while the latter is likely responsible C. polymerus to settle on, and it would appear that contem for gene flow across South Australia and into Victoria. The porary ocean currents do not regularly successfully carry Zeehan Current also appears to play a role, promoting migrants across this barrier. The direction of the EAC is migration between mainland Australin and Tasmania. also such that larvae would be carried southward, then Estimates of migration between populntions on the east eastwards and away from Australia's east coast. There is coast suggest movement of larvae up nnd down the coast. no indication of significant currents travelling westward While seemingly in contrast with the southward moving into Bass Strait which would aid their dispersal into central EAC, it is possible that eddies from the EAC cmry some Victoria. Gene flow estimates in C. polynrerus support this, larvae north of their release site. The predominant period indicating an average of five migrants (Nm) per generation of larval release is during winter, when the EAC shortens across this disjunction. Rare dispersal events across this sit,rnificantly. This suggests n decrease in migration to southern junction have been noted in Tesseropora rosea; however, this New South Wales. However, while winter is the mnin period species does not survive for prolonged periods west of for larvae to be released, studies also suggest that repro Bastion Point (J. Sm.issen, personal communication). These ductively active C. polymcrus arc found at all times of year rare dispersal events are also supported in our mitochon (Wisely & Blick 1964), including when the EAC is at its most drial data, as one individual of western origin was sampled powerful, and extends past the southern limit of mainland to the east of Ninety Mile Beach. Estimates of migration Australia. Despite indication of movement of larvae up and between the NSW and central Victorian subregions suggest down the coast, the overall majority of migration is south asymmetrical gene flow from NSW to Victoria, which is ward (Fig. 2), in keeping with the direction of the EAC. in contrast with the finding of a western individual of It? 2008 The Authors Journal compilation@ 2006 Blackwell Publishing Ltd POPULATION STRUCTURE OF CATOMERUS POLYMERUS 11 C. polymerus in the east. However, migration between the equal investment of resources. In addition, Victoria also two populations which border Ninety Mile Beach (Griffith contains three of the fou~ genetically distinct subregions of Point, Cape Conran) suggest bidirectional gene flow, which the species. While C. polymerus is itself not an endangered suggests complexity in the patterns of currents in the species, it is endemic to the cool temperate waters of southern Bass Strait. Australia and is an important member of the rocky intertidal The populations in South Australia (group C, Fig. 5) belong community. These results may prove useful as a guide to to the western clade, and are likely the source of gene flow possible population structuring within other intertidal for postglacial founder populations in Victoria and Tasmania. spl>cies with a similar planktonic larval phase, thereby The three subregions indicated by microsatellite data supporting conservation of biodiversity on our shores. In (groups B, C and 0 Fig. 5) are separate contemporary popu particular, these results may be applicable to conunercially lations but low levels of gene flow are maintained, and important species such as abalone and crayfish, which also isolation by distance is strongly supported. A reduction have a planktonic larval phase. Furthermore, these results in gene flow between South Australia and Victorian and may also be applicable to the prediction and prevention Tasmanian subregions is potentially due to the large sandy of spread of invasive pest species with a similar dispersal region at the Coorong (see Fig. 1) which, like Ninety Mile phase, such as starfish, Beach, is devoid of rocky habitat suitable for this species. This is again supported by gene flow estimates, which Conclusion indicate that between six and eight migrants (Nm) per generation disperse across this region. Meanwhile, gene We conclude that both historical and ecological factors flow estimates between populations within these subregions have interacted to shape the extant distribution of Catoments are significantly higher. MIGRATE indicates that the small polymerus. While the distribution of this species may have level of gene flow that does occur across this region occurs once been continuous, it appears that the cyclic emergence in an easterly direction (Fig. 2), in keeping with the of the Bassian land-bridge promoted allopatric divergence direction of movement of the Leeuwin Current. and resulted in the two highly divergent clades illustrated in the mtDNA data. Analysis ofmicrosatellite data provided the opportunity to examine the species' contemporary One species or two? structure, and suggested the presence of four subregions. While it has previously been suggested that C. polymerus is We suggest that Australia's distinct East Australian, Leeuwin, in fact two species, we do not believe that our data support and Zeehan currents facilitate gene flow while the two large that conclusion. The mitochondrial sequence divergence geographical breaks (Ninety Mile Beach and the Coorong) is within the normal range for population variation within prevent gene flow between these regions. other species of barnacles (K. L. York, unpublished), and there is an equivalent level of variation both within and Acknowledgements between the two mtDNA clades. We also sampled a single individual in eastern Victoria which was found to have The authors would like to thank the following people who helped collect C. polymerus samples: Joanne Smissen, Suzanne York, Fallon mtDNA of western origin. lhis suggests that complete Mody, Kate Ryan, Melanie Norgate and Dale Appleton. 'Ibanks reciprocal monophyly is not present in this species as a also to Joanne Smissen for sharing her knowledge of the ecology small level of mtDNA gene flow is being maintained. of C. polymerus. Collections were completed wlfu permlsslon from Microsatellite analysis also appears to support this, with New South Wales Fisheries (permit POS/0097), Victoria Department estimates of migration suggesting low levels of gene flow of Sustainability and Environment (perrnit 10003:M4), South between these eastern and western lineages. As such, we Australia Primary Industries and Resources SA (permit 98/0917) suggest that C. polymerus remains as a single species. and Tasmania Department of Primary Industries and Water (permit 7060). We would also like to thank the Subject Editor Michael Hansen and three anonymous referees for their helpful Management recommendations comments and suggestions for improving this manuscript. This research was supported by the Australian Research Council via As the eastern and western clades indicated by themtDNA their Special Research Centre Scheme and Parks Victoria. data are highly distinct, and show very low levels of gene flow, it appears that these regions have been evolving References independently for a long period of time. Therefore, we suggest that these two regions represent evolutionary Baines PG, Edwards RJ, Fandry CB (1983) Observations of a new baroclinic cw·rent along the western continental slope of Bass significant units (ESUs) for management purposes. This Strait. Australiatt foumal of Marine. and Freshwater Researclt, 34, is particularly relevant to Victoria, as both mitochondrial 155-157. lineages, and therefore both ESUs, are present in that one BeerU P (2002) MIGRATE: documentation and prognun, part of LAMARC. state, As such, rocky shores in each of these regions require Version 2.0, http://evolution.gs.washington.edu/1amarc.html © 2008 The Authors Journal compilation© 2008 Blackwell Publishing Ltd 12 K. L. YORK ET AL. Bennett I, Pope EC (1953) Intertidal zonation of the exposed rocky gence across the isthmus of Panama. Proceedings of the Royal Society shores of Victoria, together with a rearrangement of the biogeo 8: Biological Sciences, 265, 2257-2263. graphical provinces of temperate Australian shores. Australian Knowlton N, Weigt LA, Solorzano LA, Mills OK, Bermingham E Journal of Marine and Freshwater Researclz,4, 105-159. (1993) Divergence in proteins, mitochondrial DNA, and repro Bennett I, Pope EC (1960) Intertidal zonation of the exposed ductive compatibility across the Isthmus of Panama. Science, rocky shores of Tasmania and its relationship with the rest of 260, 1629-1632. Australia. Australian Journal of Marine and Freshwater Research, Knox GA (1963) The biogeography and intertidal ecology of 11, 182-2:2.1. Australasian coasts. Oceanography and Marine Biology Annual Benzie JAH (1999) Major genetic difference between crown-of-thorn Reviews, 1, 341-404. starfish (Acantlzaster plancz) populations in the Indian and Pacific Kumar S, Tamura K, Nei M (2004) MEGA 3: integrated software for oceans. Evolution, 53, 1782-1795. molecular evolutionary genetics analysis and sequence alignment. BoothJD, OvendenJR (2000) Distribution of fassus spp. (Decapoda: Briefings in Bioinfonnatics, 5, 150-163. Palinuridae) phyllosomas in southern waters: implications for Lessios HA, Kessing BD, Robertson DR, Paulay G (1999) Phyla larval recruitment. Marine Ecology Progress Series, 200,241-255. geography of the pantropical sea urchin Eucidaris in relation to Bowen BW, Bass AL, Rocha LA, Grant WS, Robertson DR (2001) land barriers and ocean currents. Evolution, 53, 806-817. Phylogeography of the trumpetfishes (Aulostomus): Ring Lessios HA, Kessing BD, Pearse JS (2001) Population structure and species complex on a global scale. Evolution, 55, 1029-1039. speciation in tropical seas: global phylogeography of the sea Burridge CP (2000) Molecular genetics of cirrlzitoid fishes (Perciformes: urchin Oiademn. Evolution, 55,955-975. Cirrltitoidae): phylogeny, taxonomy, biogeography and stock structure Mackiewicz LG (1975) Tlte feeding biology and reproductive biology of PhD, University of Tasmania, Australia. Catophragmus polymerus Darwin (Crustacea, Cirripedia) Honours Burridge CP, Hurt AC, Farrington LW, Coutin PC, Austin CM 1besis, University of Sydney. (2004) Stepping stone gene flow in an estuarine-dwelling sparid Mantel N (1967) The detection of ctiseasc clustering and generalised from south-east Australia. Joumal of Fish Biology, 64,805-819. regression approach. Cancer Research, 27, 209-220. Chenoweth SF, Hughes JM, Keenan CP, Lavery S (1998) When McCartney MA, Keller G, Lessios HA (2003) Dispersal barriers in oceans meet: a teleost shows secondary intergradation at an tropical oceans and speciation in Atlantic and eastern Pacific Indian-Pacific interface. Proceedings of the I Schram FR, Hoeg JT (1995) New frontiers in barnacle evolution. Wilson BR, Allen GR (1987) Major Components and Distribution of In: Crustacean Issues (eds Schram FR, Hoeg JT), pp. 297-312. Marine Fauna. Australian Government Publishing Service, Balkema, Rotterdam. Canberra. Swofford DL (2001) PAUl' ... Phylogenetic Analysis Using Parsi Wisely B, Blick RAP (1964) Seasonal abundance of first stage mony (,.and other Methods). Sinauer Associates, Sunderland, nauplii in 10 species of barnacles at Sydney. Australian Journal of Massachusetts. Marine and Freshwater Research, 15, 162-171. Tamura K, Nei M (1993) Estimation of the number of nucleotide Zane L, Bargelloni L, Patamello T (2002) Strategies for microsatellite substitutions in the control region of mitochondrial DNA in isolation: a review. Molecular Ecology, 11, 1-16. humans and chimpanzees. Molecular Biology and Evolution, 10, 512-526. ThompsonJD, Higgins DG,Gibson 1J (1994) CLUSTAL w: improving Katherine York studied the taxonomy and population genetics the sensitivity of progressive multiple sequence alignment through of southern Australian barnacles during her PhD studies. Mark sequence weighting, position-specific gap penallies and weight Blacket and Belinda Appleton are interested in the application matrix choice. Nucleic Acids Research, 22, 4673-4680. of molecular approaches to phylogeographical and systematic Til burg CE, Hurlburt HE, O'Brien JJ, Shriver JF (2001) The dynamics problems. of the East Australian current system: the Tasman front, the East Auckland current, and the East Cape current. Journal of Physical Oceanography, 31,2917-2943. Unmack PJ (2001) Biogeography of Australian freshwater fishes. Supplementary material Joumal of Biogeography, 28, 1053-1089. The following supplementary material is available for this Walker G, Yule AB, Nott JA (1987) Structure and function in article: balanomorph larvae. In: Crustacean Issues 5, Barnacle Biology (ed. Southwood AJ), pp. 307-338. A.A. Balkema, Rotterdam. Table Sl Sample size of each population, and number of alleles, Wares JP (2001) Pa ttems of speciation inferred from mitochondrial expected and observed heterozygosities, and tests for Hardy DNA in North American Chtlzamalus (Cirripcdia: Balanomorpha: Weinberg equilibrium per locus and population Chthamaloidea). Molecular Pltylogwetics and Evolutio11, 18, 104-116. Table S2 Estimates of gene flow between 18 populations of Waters JM, O'Loughlin PM, Roy MS (2004) Cladogenesis in a Catomerus polymcrus from the final of three runs of MIGRATI! starfish species complex from southern Australia: evidence for vicariant speciation? Molecular Phylogenctics and Evolution, 32, This material is available as part of the online article from: 236-245. http: I I www.b lackwcll-synergy.com/ doi I abs/ Waters JM, King TM, O'Loughlin PM, Spencer HG (2005) Phyla 10.1111/j.1365-294X.2008.03735.x geographical disjunction in abundant high-dispersal littoral (This link will take you to the article abstract). gastropods. Molecular Ecology, 14, 2789-2802. Wells P, Okada H (1996) Holocene and Pleistocene glacial p.llac Please note: Blackwell Publishing are not responsible for the con oceanography off southeastern Australia, based on foraminifers tent or functionality of any supplementary materials supplied by and nannofossils in Vema cored hole V18-222. Australian Journal the authors. Any queries (other than missing material) should be of Earth Science, 43, 509-523. directed to the corresponding author for the article. © 2008 The Authors Journal compilation© 2008 Blackwell Publishing Ltd 1-.l If:>. ?'! r' -< 0 ::-::1 ?'! tT:1..., ;:::,.. l"' Appendix Genetic differentiation as measured by Wright's Fsr are shown below the diagonal. Nonsignificant differences in pairwise Fs-r5 are indicated in bold. Geographical distances in kilometres are shown above the diagonal Cape London Bastion Point Pennington Cape Cape Tura Charlotte Griffith St Helen's Blackman's Coles Pirate's Conran Por+Jand Bridge Sorrento Point Sinclair Bay Camot Banks Head Head South Point Point Falmouth Bicheno Bay Bay Bay Cape Conran - 641.7 358.7 357.8 93.7 1567.8 1001.6 1210.9 479.2 149.6 699.4 305.2 388.0 413.6 454.0 590.4 4827 5833 Portland 0.117 - 283.9 2853 7.34.6 1036.8 430.2 640.2 1004.0 767.1 1108.4 ID.2 673.0 679.1 701.7 715.6 716.1 752.4 London Bridge 0.039 0.015 - 1.7 452.1 1268.8 674.9 888.4 759.4 4903 974.5 63.7 452.7 466.6 499.3 565.0 521.1 587.8 Sorrento 0.034 0.057 -0.005 - 450.9 1270.5 676.6 890.1 T:>8.9 4893 974.2 620 451.0 464.9 497.6 563.5 519.5 586.2 Bastion Point --{}.003 0.127 0.049 0.044 - 1645.6 1087.4 1295.1 419.1 81.1 635.0 398.9 429.7 455.5 494.1 638.0 522.1 624.4 Point Sinclair 0.095 0.076 0.056 0.050 0.097 - 606.6 402.4 1713.1 1639.9 1838.4 1331.9 1705.1 1713.1 1737.7 1748.0 17527 1787.0 Pennington Bay 0.089 0.047 0.031 0.044 0.091 -0.007- 213.6 1246.8 1097.2 1416.4 738.6 11005 1107.7 11315 11427 1146.2 1181.0 CapeCarnot 0.102 0.047 0.043 0.062 0.097 --{}.004 --{}.008 - 1428.7 1301.0 1585.5 952.0 1312.4 1319.0 1341.8 1347.0 1355.8 1386.7 Cape Banks 0.043 0.198 0.114 0.164 0.015 0.188 0.180 0.185 - 338.9 221.1 728.8 848.5 878.2 912.4 1057.1 940.1 1042.5 TuraHead 0.007 0.1.54 0.073 0.069 --{}.()02 0.128 0.119 0.128 0.001 - 556.2 443.2 510.6 536.4 575.1 718.6 603.2 705.5 Olarlotte Head South 0.013 0.146 0.063 0.072 -0.002 0.148 0.143 0.141 0.005 0.002- 946.9 1061.9 1087.5 1124.6 111"1..1 1151.9 1254.1 0 Griffith Point 0.030 0.080 0.009 0.006 0.048 0.056 0.044 0.074 0.139 0.066 0.084 - 396.4 411.8 446.2 512.7 469.4 541.8 >= -'"I St Helen's Point 0.082 0.007 0.026 0.035 0.077 0.041 0.032 0.021 0.135 0.101 0.091 0.078- 25.8 66.0 2093 94.7 195.7 :l e. Falmouth 0.108 -<1.003 0.023 0.052 0.115 0.068 0.047 0.042 0.180 0.142 0.133 0.068 -0.004 - 40.9 183.8 69.5 17.0 n 0 Bicheno 0.129 o.ou 0.044 0.102 0.131 0.091 0.074 0.062 0.194 0.151 0.152 0.100 0.002 -<1.006 - 149.0 28.7 13Q.4 .,9 Blaclcrnan's Bay 0.140 0.0002 0.032 0.091 0.131 0.056 0.042 0.026 0.214 0.163 0.158 0.118 --{}.008 0.005 0.015- 124.9 49.0 t::.: 1024 ll;1 Coles Bay 0.078 0.012 0.006 0.046 0.068 0.054 O.Q38 0.024 0.150 0.091 0.089 0.071 -<1.010 0.015 0.028 0.004 - p:. 0 Pirate's Bay 0.184 0.017 0.076 0.136 0.180 0.115 0.102 0.087 0.245 0.208 0.197 0.156 0.027 0.021 0.015 -<1.005 0.043- :l @ 8co m i» ~@ {!.tV-8 "'co§:;I ::r>Gi' Minerva Access is the Institutional Repository of The University of Melbourne Author/s: York, Katherine L. Title: Taxonomy, biogeography and population genetic structure of the southern Australian intertidal barnacle fauna Date: 2008 Citation: York, K. L. (2008). Taxonomy, biogeography and population genetic structure of the southern Australian intertidal barnacle fauna. PhD thesis, Department of Genetics, The University of Melbourne. Publication Status: Unpublished Persistent Link: http://hdl.handle.net/11343/37454 File Description: Taxonomy, biogeography and population genetic structure of the southern Australian intertidal barnacle fauna Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.