Characterization of the Ion Transporter NKCC1 in the Field of Chemosensation

Dissertation to obtain the degree Doctor Rerum Naturalium (Dr.rer.nat.) at the Faculty of Biology and Biotechnology Ruhr-University Bochum

International Graduate School of Biosciences Ruhr-University Bochum (Department of Cellphysiology)

submitted by Claudia Haering

from Dortmund, Germany Bochum (April, 2015)

First Referee: Prof. Dr. Dr. Dr. Hatt Second Referee: Prof. Dr. Wiese

Charakterisierung des Ionentransporters NKCC1

in der Chemosensorik

Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät Biologie und Biotechnologie an der Internationalen Graduiertenschule Biowissenschaften der Ruhr-Universität Bochum

angefertigt im Lehrstuhl für Zellphysiologie

vorgelegt von Claudia Haering

aus Dortmund, Deutschland Bochum (April, 2015)

Referent: Prof. Dr. Dr. Dr. Hatt Korreferent: Prof. Dr. Wiese

ERKLÄRUNG

Hiermit erkläre ich, dass ich die Arbeit selbständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völlig übereinstimmende Exemplare. Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den

(Claudia Haering)

Table of contents

1. Introduction ______1

1.1 General introduction - Olfaction______1

1.1.1 The olfactory system ______1

1.1.2 Cellular composition of the main olfactory epithelium ______2

1.1.3 The olfactory receptor ______4

1.1.4 The olfactory signal transduction pathway ______6

1.1.5 Neurogenesis of the adult olfactory epithelium ______9

1.1.6 Cloride concentration of OSN ______11

1.2 Assumed chloride transporter of OSNs ______11

1.2.1 The cation-chloride cotranporter NKCC1 ______12

1.2.2 Involvement of NKCC1 in plasticity of the brain ______14

1.2.3 Involvement of NKCC1 in neurogenesis______16

1.2.4 Regulation of NKCC1 ______17

1.2.5 NKCC1 Knock-out mice ______19

2. Objectives ______20

3. Materials and Methods ______21

3.1 Materials ______21

3.1.1 Equipment ______21

3.1.2 Chemicals ______22

3.1.3 Buffer and solutions ______23

3.1.4 Consumables ______26

3.1.5 Kits ______27

3.1.6 Antibodies ______27

3.1.7 Oligonucleotides ______28

3.2 Methods ______31

3.2.1 Animals ______31

3.1.2 Preparation of olfactory epithelium ______31

3.1.3 RNA isolation ______32

3.1.4 Complementary DNA (cDNA) sythesis ______32

3.1.5 RNA sequencing (RNA-Seq) analysis ______32

3.1.6 Reverse transcription polymerase chain reaction (RT-PCR) ______33

3.1.7 Agarose gel electrophoresis ______34

3.1.8 SDS-Polyacrylamide gel eletrophoresis (PAGE) ______35

3.1.9 Western blotting ______35

3.1.10 Electro-olfactogram (air-phase) ______35

3.1.11 Submerged electro-olfactogram ______36

3.1.12 Cilia preparation (calcium shock method)______37

3.1.13 Preparation of olfactory epithelium cryosections ______37

3.1.14 Immunohistochemistry ______37

3.1.15 Hematoxylin-/Eosin-staining ______38

3.1.16 Measurement of neuronal layer thickness and Cell counting ______38

3.1.17 Microscopy ______39

3.1.18 Statistical data analysis ______39

4. Results ______40

4.1 Genotyping of NMRI background mice ______40

4.2 Localization of NKCC1 in the murine olfactory epithelium ______41

4.3 Localization of olfactory signal transduction proteins in the murine olfactory epithelium ______42

4.4 Transcriptome analysis of the olfactory epithelium ______43

4.4.1 RNA-Sequencing analysis of olfactory epithelium of NKCC1+/+ and NKCC1-/- mice ______44

4.4.2 RNA-Seq: Expression analysis of chloride-associated cotransporters ______45

4.4.3 RNA-Seq: Expression analysis of olfactory signal transduction proteins and adaptation-related proteins ______49

4.4.4 RNA-Seq: Expression analysis of olfactory receptors ______50

4.4.5 RNA-Seq: Expression analysis of significantly regulated genes ______53

4.4.6 RT-PCR: Expression of chloride-associated cotransporters ______55

4.4.7 RT-PCR: Expression of signal transduction proteins and adaptation-related proteins ______56

4.4.8 RT-PCR: Expression of olfactory receptors ______57

4.5 Protein expression analysis of the olfactory epithelium of NKCC1+/+ and NKCC1-/- mice ______58

4.5.1 Protein expression analysis of signal transduction proteins and adaptation- related proteins ______58

4.5.2 Protein expression analysis of a ciliary protein and development- related proteins ______59

4.6 Doublecortin expression in the murine olfactory epithelium of a DCX-promo-EGFP transgenic mouse ______60

4.7 Electro-olfactogram recordings ______61

4.7.1 Air-phase EOG recordings of NKCC1+/+ and NKCC1-/- mice: Odorant concentration dependency ______62

4.7.2 Air-phase EOG recording of NKCC1+/+, NKCC1+/- and NKCC1-/-mice _____ 62

4.7.3 Air-phase EOG recording of NKCC1+/+ and NKCC1-/- mice: Henkel100 versus 10 odorants mixture ______64

4.7.5 Air-phase electro-olfactogram of NKCC1+/+ and NKCC1-/- mice: Repetitive stimulation with Henkel100 ______64

4.7.6 Submerged EOG recordings of NKCC1+/+ and NKCC1-/- mice: Calcium- activated chloride channel inhibition with niflumic acid and tannic acid _____ 65

4.7.7 Submerged electro-olfactogram of NKCC1+/+ and NKCC1-/- mice: Calcium- activated chloride channel inhibition with niflumic acid ______66

4.8 Morphological changes of the olfactory epithelium in NKCC1-/- mice ______67

4.8.1 Measurements of turbinate lengths of NKCC1+/+ and NKCC1-/- mice ______68

4.8.2 Measurements of the olfactory neuronal layer thickness of NKCC1+/+, NKCC1+/- and NKCC1-/- mice ______68

4.8.3 Differences of the cell number in the olfactory epithelium of NKCC1+/+, NKCC1+/- and NKCC1-/- mice ______69

5. Discussion ______71

5.1 Localization of NKCC1 in the murine olfactory epithelium ______71

5.2 Localization of olfactory signal transduction proteins in the murine olfactory epthelium ______72

5.3 Transcriptome analysis of the olfactory epithelium of NKCC1+/+ and NKCC1-/- mice ______72

5.3.1 Expression analysis of chloride-associated cotransporters ______73

5.3.2 Expression analysis of olfactory signal transduction proteins and adaptation- related proteins ______76

5.3.3 Expression analysis of olfactory receptors ______76

5.3.4 Expression analysis of significantly regulated genes ______77

5.4 Western blot analysis of the olfactory epithelium of NKCC1+/+ and NKCC1-/- mice ______78

5.5 EOG recordings ______80

5.6 Morphological changes of the olfactory epithelium of NKCC1+/+, NKCC1+/- and NKCC1-/- mice ______82

5.7 The impact of NKCC1 in chloride accumulation of OSNs or how NKCC1 is a modulator of neurogenesis ______83

6. Conclusion ______86

6.1 Summary ______86

6.2 Zusammenfassung ______88

7. Bibliography ______91

8. Attachments ______123

I. List of Abbreviations ______126

II. List of Figures ______128

III. List of Tables ______130

IV. Curriculum Vitae ______131

Academic History ______131

School Training ______131

V. List of Publications ______132

VI. List of Posters ______133

VII. Own Contribution ______134

VI. Acknowledgements ______135

Introduction

1. Introduction

1.1 General introduction - Olfaction

The olfactory system detects a wide variety of chemical and mechanical stimuli such as odorants, pheromones and temperature in a broad spectrum of concentration. The perception of one distinct group of stimuli and/or combination of diverse stimuli is a fundamental sense in mammals (Keller and Vosshall, 2008). Odorants provide information about the environment, food sources, predators or social behaviors, thus their detection is essential for survival of the organism (Zou et al., 2015). Consequently, odorant discrimination, classification and evaluation are of significant importance for mammals and therefore these valuations were performed by different olfactory subsystems with some overlapping functions.

1.1.1 The olfactory system

The olfactory system is a chemosensory system capable of detecting several different stimuli. It consists of to two distinct parts: First, the main olfactory epithelium that is responsible for detection of volatile substances and second, the accessory olfactory system that enables sensation of fluid-phase stimuli, e.g. pheromones (Sam et al., 2001; Spehr et al., 2006). The latter is further divided into following subsystems (Figure 1): the vomeronasal organ (VNO) which is responsible for detection of pheromones (Dulac and Torello, 2003), the Grueneberg ganglion responding to chemical stimuli associated with so called alarm pheromones induced by injury, distress, or the presence of predators (Brechbuhl et al., 2008) and temperature (Mamasuew et al., 2011; Schmid et al., 2010) and the septal organ of Masera which detects chemical (Ma et al., 2003; Tian and Ma, 2008) and mechanical stimuli (Grosmaitre et al., 2007).

Introduction

Figure 1: The olfactory system of mice. Sagittal cross section through the nasal region of the head, lower jaw is not shown. The main olfactory epithelium (MOE) and main olfactory bulb (MOB) are shown in green, and the two parts of the VNO and corresponding regions in the accessory olfactory bulb (AOB) are indicated in yellow and red. SOM = septal organ of Masera, NG = necklace glomeruli, NC = nasal cavity, GG = Grueneberg ganglion, GCD = guanylyl cyclase-D system. Modified from (Mombaerts, 2004a; Tirindelli et al., 2009).

These subsystems send signals through axon targeting into the olfactory bulb (OB) which is the initial cognitive processing system for stimuli detection (Klenoff and Greer, 1998; Luo et al., 2003). Neurons convey electrical signals through their axon in distinct regions of the OB called glomeruli (Mori et al., 1999). These glomeruli are spherical structures which form the interface between terminals of the olfactory nerve and the dendrites of mitral, periglomerular and tufted cells (Mori et al., 2006; Pinching and Powell, 1971). Olfactory sensory neurons (OSNs) that express the same olfactory receptor project their axons in the same glomeruli (Mombaerts, 2006) which might encourage the signal processing and thus the odorant coding (Mori et al., 2006; Wilson and Mainen, 2006). Odorant signal is lately processed in higher brain regions including the piriform cortex, the amygdale and the hippocampus (Royet and Plailly, 2004).

1.1.2 Cellular composition of the main olfactory epithelium

The human olfactory epithelium (OE) covers the inner surface of the nasal cavity where it enables sufficient detection of odorants. In rodents the olfactory epithelium rests on cartilaginous structures, called turbinates (Figure 1). The OE mainly harbors three different cell types, the olfactory sensory neurons (OSNs), sustentacular cells (SCs) and basal cells

Introduction

(BCs), each having a distinct function in the synergy of olfaction (Figure 2 A) (Graziadei and Graziadei, 1979; Huard et al., 1998).

Figure 2: Cellular composition and structure of the olfactory epithelium and a frog olfactory sensory neuron. A) Schematic structure of the OE. OSNs are shown in green and blue. Red circles are odorant binding proteins (OBP) which dissolve odorants, lead them to the cilia and increase the binding affinities for the receptor. Modified from (Mombaerts, 2004a) B) Image of an isolated frog OSN under differential interference contrast optics. c, cilia; d, dendrite; s, soma; a, axonal segment. Scale bar 10 µm. Modified from (Kleene, 2008).

OSNs are bipolar cells whose soma rests in the middle of the neuronal layer. They reach the mucus, the semi-liquid barrier between air-phase and epithelium, with the dendrite ending in a small bulge, called the dendritic knob (Figure 2 B). This knob is the starting point of approximately 20 cilia that penetrate the mucus. The cilia contain proteins for the olfactory signal transduction pathway and thus are key players in olfaction. In current understanding, it is hypothesized that one OSN only expresses a single olfactory receptor gene (Malnic et al., 1999; Mombaerts, 2004a). This hypothesis is called the one receptor- one neuron theory although there is no experimental evidence for this theory and this paradigm is not undeniable (Mombaerts, 2004b). However, OSNs lately extend their axon in the OB, thus forming a connection between the place of primary odorant detection and the cognitive processing region (Figure 1). The SCs, also called supporting cells, rest in a single layer on the apical surface of the olfactory epithelium and have thin cytoplasmic

Introduction

projections that end at the basal lamina (Beites et al., 2005). These cells have main function in metabolic, detoxifying and physical assistance of OSNs since they express enzymes involved in metabolism of foreign compounds, e.g. cytochrome p450, glutathione-S-transferase and carbonyl reductase (Yu et al., 2005). However, basal cells rest on the basal lamina of the neuronal layer and represent the neuroregenerative cell source of OSNs. Due to this mechanism, the olfactory epithelium regenerates throughout life with a turnover of approximately one month (Mackay-Sim and Kittel, 1991). Basal cells are classified into two groups depending on the expression levels of different marker proteins (refer section 1.1.5 Neurogenesis of the adult olfactory epithelium). Beside these three main cell types, brush cells and Bowman´s glands are additionally found in the OE (Andres, 1975). Brush cells are columnar cells which bear microvilli reaching the mucus and a basal surface in contact with afferent nerve endings. Their function still remains unknown, although there is evidence that they are involved in the processing of olfactory stimuli (Kaske et al., 2007). Bowman´s glands secrete odorant binding protein-rich liquids through ducts onto the surface of the mucosa in order to dissolve odorants upon detection and enhance the binding affinities to their receptor (Frisch, 1967; Vogt et al., 1991).

1.1.3 The olfactory receptor

Olfactory receptors (ORs) were identified by Linda Buck and Richard Axel in OE of rat in 1991 (Buck and Axel, 1991). These proteins belong to the family of G protein-coupled receptors (GPCRs) and to date over 1,000 genes encoding ORs are found in the mammalian genome (Firestein, 2001) of which ~900 OR genes have been found to be functional in mice (Buck and Axel, 1991; DeMaria and Ngai, 2010; Glusman et al., 2001; Godfrey et al., 2004; Mombaerts, 2004b; Niimura and Nei, 2007) and ~350 in humans (Glusman et al., 2001; Zozulya et al., 2001).

ORs form the largest subfamily of GPCRs which evolved through gene duplication or gene conversion (Nei and Rooney, 2005). Within the OR family, proteins share similarity in a range of 40-90% and are divided into two families (>40% similarity) and 18 subfamilies (>60% similarity) (Godfrey et al., 2004; Young et al., 2002; Zhang and Firestein, 2002). Class I ORs belong to the fish-like receptors and are believed to detect hydrophilic

Introduction

odorants while class II ORs are considered to be unique to terrestrial vertebrates and bind hydrophobic ligands (Freitag et al., 1995). Beside this, some class I ORs are also known to detect volatile odorants and are therefore evolutionary relics in terrestrial vertebrates (Mombaerts, 2001). ORs are mostly encoded via one exon and the polypeptide is predicted to have seven transmembrane α-helices and a range of conserved amino acids (Figure 3) (Firestein, 2001).

Figure 3: Schematic structure of an OR. ORs are predicted to have seven transmembrane domains, an extracellular N-terminus and an intracellular C-terminus. Amino acids are presented in a color code indicating degree of conservation, with blue being highly conserved and red highly variable (Mombaerts, 2004a).

They also display exclusive features such as an unusually long second extracellular loop with conserved cysteines (Firestein, 2001). ORs additionally show a region of hypervariability in their sequence. This region comprises the third, fourth and fifth transmembrane helices (Firestein, 2001) which are assumed to form a binding pocket for ligands (Gelis et al., 2012; Pilpel and Lancet, 1999). Furthermore, G protein binding is suggested to be mediated by only the third transmembrane helix which consists of a conserved aspartic acid-arginine-tyrosine (DRY) motif (Gaillard et al., 2004; Rovati et al., 2007). ORs are able to specifically detect odorants thereby tolerating a broad range of structural similar ligands (Araneda et al., 2000; Krautwurst et al., 1998; Saito et al., 2009; Touhara et al., 1999; Triller et al., 2008). Conversely, one odorant could be recognized by

Introduction

a combination of different ORs allowing a high discrimination of a broad spectrum of odorants.

Six years after the first ORs were cloned by Linda Buck and Richard Axel (Buck and Axel, 1991), ORs of zebrafish and C.elegans were heterologically expressed in HEK293 (Wellerdieck et al., 1997). Following this, it was demonstrated that increased expression of a single gene led to greater sensitivity to a small subset of odorants in rat OE (Zhao et al., 1998). This was later followed by the first human OR (OR17-40), which was functionally expressed one year later (Hatt et al., 1999; Wetzel et al., 1999). However, the expression of ORs is not limited to the OE so that human OR mRNAs was also detected in several tissues (Flegel et al., 2013). Subsequently, ORs were already identified to be expressed in human germ cells (Parmentier et al., 1992), human erythroid cells (Feingold et al., 1999) and in human prostate cancer cells (Xu et al., 2000). In addition, murine ORs expression was confirmed in the ganglia of the autonomic nervous system of mice (Weber et al., 2002), in the mice brain (Otaki et al., 2004) and the hearts of rat and mouse (Drutel et al., 1995). Beside this, ORs were also found to be functionally expressed in human spermatozoa (Spehr et al., 2003; Veitinger et al., 2011), human keratinocytes (Busse et al., 2014), human hepatocarcinoma cells (Massberg et al., 2015), human enterochromaffin cells (Braun et al., 2007), in testis, kidney and pancreatic α-cells of mice (Fukuda et al., 2004; Kang et al., 2015; Pluznick et al., 2009).

1.1.4 The olfactory signal transduction pathway

The primary odorant perception of vertebrates occurs in the cilia of the OSN and is mainly mediated through a cyclic adenosine monophosphat (cAMP)-dependent signaling pathway (Figure 4) (Gold, 1999; Schild and Restrepo, 1998). First, the odorant recognition is initiated by the binding of an odorant molecule to its specific G protein-coupled receptor, an OR (Buck and Axel, 1991). Activation of the G protein, where the alpha subunit binds to adenylyl cyclase, then catalyses the formation of cAMP (Bakalyar and Reed, 1990). The rising cAMP concentration subsequently causes the opening of cyclic nucleotide-gated channels, thereby inducing the influx of calcium ions and initializing the depolarization of the OSN (Dhallan et al., 1990). The calcium ions bind to a chloride channel that undergoes

Introduction

a conformational change and thereby enables the efflux of chloride ions (Billig et al., 2011; Lowe and Gold, 1993; Rasche et al., 2010; Stephan et al., 2009). The chloride channel TMEM16b/Ano2 might be responsible for the chloride efflux, but its role in olfaction is discussed in literature (Billig et al., 2011; Pifferi et al., 2012; Rasche et al., 2010).

Figure 4: Scheme of the olfactory signal pathway. First, an odor binds to its G-protein coupled receptor (GPCR) which leads to a dissociation of the G protein in the α and subunit and an subsequent exchange of GDP for a GTP. The activated Gα-GTP complex binds the adenylyl cyclase which catalyses the formation of cAMP. The cAMP opens cyclic-nucleotide gated channels (CNG channel) that allow the influx of extracellular calcium and sodium and thereby initialize the depolarization of the olfactory neuron. The depolarization is increased by a chloride efflux mediated by the calcium-depended opening of chloride channels. AC, adenylyl cyclase; CNG channel, cyclic nucleotide-gated channel; PDE, phosphodiesterase; PKA, protein kinase A; ORK, olfactory receptor kinase; RGS, regulator of G proteins; CaBP, calmodulin-binding protein. Green arrows indicate stimulatory pathways; red indicates inhibitory (feedback) (Firestein, 2001).

Studies on Ano2 knockout mice revealed that calcium-activated chloride currents are dispensable in this model system and the mice achieved near-physiological levels of olfaction (Billig et al., 2011). Consequently, the function and importance of Ano2 remains obscure. However, the chloride efflux, also called chloride boost, represents the main depolarization (80%) of an OSN (Kurahashi and Yau, 1993; Lowe and Gold, 1993).

Introduction

Neurons of the OE require an active accumulation mechanism for chloride ions, through a chloride ion transporter. Several publications demonstrated that the chloride concentration is much higher in OSNs, especially in the knob, compared to surrounding cells and the mucus (Kaneko et al., 2001; Kaneko et al., 2004; Reuter et al., 1998). The identity of such chloride accumulator still remains unknown. Several attempts were undertaken to reveal the ion transporter and the involvement of the controversially discussed sodium-potassium-chloride transporter NKCC1 (Nickell et al., 2006; Nickell et al., 2007; Reisert et al., 2003; Reisert et al., 2005; Smith et al., 2008a). Nevertheless, the cAMP depended signalling pathway was verified using knockout mice of the olfactory G protein, the adenylyl cyclase and the cyclic nucleotide-gated channel subunit alpha 2 (CNGA2) all showing anosmia (Belluscio et al., 1998; Brunet et al., 1996; Wong et al., 2000). Beside the canonical pathway alternative signaling was also shown to appear in OSNs via activation of phospholipase C (PLC) and phosphoinositide 3-kinase (PI3K) (Ache, 2010; Breer et al., 1990; Klasen et al., 2010; Spehr et al., 2002; Ukhanov et al., 2010).

Continuous detection of odorants leads to desensitization of OSNs which therefore provides a general mechanism preventing saturation of signal transduction components and maintenance of high sensitivity. Odorant-evoked responses are modulated through a negative feedback pathway involving calcium ions (Kurahashi and Menini, 1997). During odorant response, inflowing calcium is bound by calmodulin which in turn interacts with the binding site at the CNG channel decreasing its sensitivity to cAMP (Chen and Yau, 1994; Kramer and Siegelbaum, 1992; Liu et al., 1994). Therefore, a stronger odorant stimulus is required to produce sufficient cAMP to open the channel (Firestein, 2001). Additionally, modulation of the cAMP concentration affects OSN sensitivity. Phosphodiesterase activity decreases cAMP level and thereby weakens the odorant response (Borisy et al., 1992; Cygnar and Zhao, 2009; Yan et al., 1995). Modeling of activities of signal transduction proteins tunes the odorant responses. A regulator of G protein signaling (RGS) was shown to directly decrease adenylyl cyclase activity (Sinnarajah et al., 2001). Another direct modulation of signaling is mediated via two kinases, the olfactory receptor kinase and the protein kinase A, which phosphorylate activated ORs and convict them into a desensitized state (Dawson et al., 1993; Schleicher et al., 1993).

Introduction

1.1.5 Neurogenesis of the adult olfactory epithelium

Neurogenesis is the process of the lifelong regeneration of neurons in a few exclusive regions of the adult nervous system (Graziadei and Graziadei, 1979; Schwob, 2002). The continuous development of neurons is most active in the pre-natal stage of an organism and has been demonstrated to continue in two different parts of the adult mammalian brain, the subventricular zone and subgranular zone (Alonso et al., 1999; Jin et al., 2001). Stem cells and progenitor cells produce new neurons which migrate from the subventricular zone of the OB to the rostral migratory stream (Bergmann et al., 2012; Ernst et al., 2014). Besides this, neurogenesis occurs in the adult OE where stem cells and other specialized cells mediate this regeneration process with a turnover of approximately one month (Mackay- Sim and Kittel, 1991). These regenerated cells comprise of stem cells, globose basal cell (GBC) and horizontal basal cells (HBC) progenitors resting in the basal region (Figure 5 A) (Murdoch et al., 2010). The embryonic OE lacks distinct cellular structure and mainly consists of early progenitor cells. HBCs and sustentacular cells do not appear until late embryonic or early postnatal development (Murdoch et al., 2010). Several publications have demonstrated the existence of distinct progenitor cell states distinguishable by expression of marker proteins and localization in the OE (Figure 5 B). Achaete-scute homolog 1 (ASCL1), originally named mammalian achaete scute homolog 1 (MASH-1), and neurogenin1 (Ngn) are expressed in dividing immediate neuronal precursors (INPs). The presence of both marker proteins induces the expression of another marker protein NeuroD (Neurod1) in differentiating neurons (Cau et al., 2002; Cau et al., 1997; Fode et al., 1998; Ma et al., 1998; Ma et al., 1996). In contrast, mature OSNs do not express these neurogenesis marker proteins although they produce -III-tubulin (Cau et al., 2002). It was demonstrated that the OE of ASCL1 knockout mice contains excessive number of progenitor cells suggesting an impaired maturation of these cells (Murray et al., 2003; Paschaki et al., 2013). The most famous marker protein is the olfactory marker protein (OMP) which is almost exclusively expressed in mature OSN (Wensley et al., 1995). Its function still remains elusive but experiments with OMP knockout mice caused alterations in the physiological activity of OSNs (Buiakova et al., 1996; Reisert et al., 2007).

Introduction

Figure 5: Schematic model of the neurogenesis of OE. A) Stem cells self-renew and also give rise to Mash1 positive (Mash1+) progenitors which give rise to ORNs through an immediate neuronal precursor (INP) stage. OE stem cells may also give rise to sustentacular cells (SUS) and olfactory ensheathing cells (OEC) cell lineages which encircle bundles of ORN axons and possess characteristics of both Schwann cells and astrocyte. Curved arrows indicate self-renew properties, HBC: horizontal basal cells B) Scheme of the neurogenesis and histological localization of cells in mature OE. Neuronal stem cells (red) give rise to progenitors which express Mash1 (blue), followed by immediate neuronal precursors (INPs; purple), which express Ngn1. The INP divides and daughter cells maturate into ORNs (green), which are distinguished by polysialylated-neuronal cell adhesion molecule NCAM, -III tubulin and OMP expression. Modified from (Beites et al., 2005; Paschaki et al., 2013).

Diverse neuronal progenitor proteins are known, especially for neurogenesis in the mammalian brain and OB. For instance, the intermediate filament nestin which is specifically expressed in neural progenitor cells (Lendahl et al., 1990) and Ki-67, a nuclear protein expressed in dividing cells for the entire duration of the mitotic activity, are some marker proteins detected in progenitors (Abrous et al., 2005; Endl et al., 2001; Kee et al., 2002). Doublecortin (DCX), a microtubule-associated protein, is expressed specifically in all migrating neuronal precursors of the developing central nervous system (Couillard- Despres et al., 2001; des Portes et al., 1998; Gleeson et al., 1998), dorsal root ganglia (Dellarole and Grilli, 2008) and the trigeminal nerve (Barreiro-Iglesias et al., 2011). This protein was demonstrated to be expressed in regions of high neurogenetic activity, e.g. the hippocampus and subventricular zone/olfactory bulb axis (Balentova et al., 2014; Brown et al., 2003a). In contrast, DCX staining has also been described in regions of no adult

Introduction

neuronal migration, e.g. the corpus callosum, the piriform cortex layer III/endopiriform nucleus and the striatum (Nacher et al., 2001) so that it was hypothesized DCX is also expressed in nearly differentiated/immature neurons. Highest expression of DCX has been found while generation of neuroblasts and its expression is downregulated accompanied by the appearance of the mature neuronal marker NeuN (Couillard-Despres et al., 2005).

1.1.6 Cloride concentration of OSN

Odorant recognition, particulary the binding of an odorant to its specific ORs, triggers a signal pathway leading to in- and outward ion currents and thus the depolarization of the OSN. About 80% of the depolarization of OSNs is mediated through the efflux of chloride ions (Kurahashi and Yau, 1993; Lowe and Gold, 1993; Nickell et al., 2006) due to the high intracellular chloride concentration achieved in these neurons (Kaneko et al., 2001; Kaneko et al., 2004). Although the exact chloride concentration in OSNs still remains unknown, several research groups used different approaches to determine this ion concentration. Based on reversal potential of receptor currents of Xenopus laevis olfactory receptor neurons, the intracellular chloride concentration was estimated to reach approximately 120 mM (Zhainazarov and Ache, 1995). Using the chloride-sensitive fluorescent dye N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide (MQAE), this concentration was calculated to be 40 mM (Inoue et al., 1991; Verkman et al., 1989). Furthermore, patch-clamp experiments revealed 23 mM in the mudpuppy (Dubin and Dionne, 1994) and energy-dispersive X-ray (EDX) microanalysis displayed a chloride concentration of 68 mM in rat OSNs (Reuter et al., 1998). This value was verified by MQAE-measurements of the chloride concentration [~80mM] of knobs and soma of rat OSN (Kaneko et al., 2001). In summary, the actual chloride concentration of OSNs and especially in the cilia, where the signal transduction occurs, continues to be elusive.

1.2 Assumed chloride transporter of OSNs

The ion transporter NKCC1 is a candidate which fits the role of a chloride accumulator that causes the high chloride concentration inside OSNs. It is common knowledge that

Introduction

NKCC1 is expressed in the OE and it has an impact on chloride accumulation of acute dissociated olfactory neurons (Hengl et al., 2010; Hubner et al., 2001; Nickell et al., 2007; Reisert et al., 2005). Moreover, loss of NKCC1 was demonstrated to affect electro- olfactogram recordings (EOGs) of the intact OE (Nickell et al., 2007; Reisert et al., 2005). Mice lacking the ion transporter exhibit a 39% or 57% reduction in generated surface potentials in EOGs compared to wild type mice depending the used method and age of mice. (Nickell et al., 2006; Nickell et al., 2007). In contrast, behavioural tests of mice lacking the transporter demonstrate no impairments in odorant perception (Smith et al., 2008a). The ongoing debate of the impact of NKCC1 in chloride accumulation of OSNs leads to the requirement of further investigations.

1.2.1 The cation-chloride cotranporter NKCC1

The cation-chloride cotransporter NKCC1 (Na, K, 2Cl) electroneutrally transports one Na+, one K+ and two Cl- ions and belongs to the solute-carrier (Slc) transporter family (Kaplan et al., 1996). The Slc-transporter family groups over 300 membrane transport proteins and regarding the name this family carries diverse charged/uncharged ions and organic/inorganic molecules (Hediger et al., 2004; Schlessinger et al., 2013). Within this family some transporters were grouped into one subfamily, the cation-chloride cotransporter (CCCs) (Isenring and Forbush, 2001; Park and Saier, 1996). This subfamily is also divided into three classes: the Na-coupled, the K-coupled and CCC-interacting proteins. The sodium-dependent transporter group consists of NCC (sodium-chloride symporter) (Gamba et al., 1993), NKCC1 (Delpire et al., 1994) and NKCC2 (Gamba et al., 1994) whereas the exclusive potassium-dependent branch comprises the four isoforms of the potassium-chloride cotransporter (KCC1-KCC4) (Gillen et al., 1996; Mount et al., 1999; Payne et al., 1996). The last branch includes CCC-interacting proteins, e.g. CCC- interacting protein 1 (CIP1) (Caron et al., 2000), whose transport function remains elusive.

The two varieties of the sodium, potassium and chloride cotransporter are, NKCC1 and NKCC2, each encoded by a different gene in spite of sharing ~60% identity (Payne and Forbush, 1994). NKCC1 is expressed in several different tissues whereas NKCC2 is primarily expressed in the loop of Henle in the kidney (Gamba, 2005; Ji et al., 2012). Both

Introduction

isoforms have important functions in organs that secrete fluids and both are inhibited by mercury and loop diuretics, e.g. furosemide and bumetanide (Evans et al., 2000; Haas and Forbush, 2000; Lytle et al., 1995).

NKCC1 is widely distributed though several tissues and in different cell types where it functions as a chloride accumulator, e.g. in the epithelia cells of the colon, the exocrine glands of cochlea, central nervous system and in the trigeminal ganglion neurons (Bouyer et al., 2013; Chen and Sun, 2005; Crouch et al., 1997; Kakigi et al., 2009; Schobel et al., 2012). The membrane spanning human symporter NKCC1 is encoded by the Slc12a2 gene on chromosome 5 and has 1,212-amino acids (predicted molecular weight: 132 kDa, experimental: ~170 kDa) (Payne et al., 1995). The human NKCC1 shows 91% identity to NKCC1 of mus musculus (Payne and Forbush, 1994).

NKCC1 is a membrane protein whose crystal structure is not yet solved. Nevertheless, structural predictions indicate NKCC1 to have 12 transmembrane helices with a large C- and N-terminus (Figure 6) (Payne et al., 1995). Several structure-related experiments were performed to localize the transport domains, ion-binding amino acids or posttranslational modifications (Dehaye et al., 2003; Somasekharan et al., 2013; Somasekharan et al., 2012). These experiments demonstrate that the region between transmembrane domain seven and eight plays a central role in the transport function of NKCC1 (Payne et al., 1995). This extracellular loop region contains two sites for amino- glycosylation. Several phosphorylation sites are also present in the predicted cytoplasmic C- and N-terminal domain of NKCC1 (Flemmer et al., 2002; Kurihara et al., 1999). Additionally, NKCC1 forms homodimers (Moore-Hoon and Turner, 2000; Pedersen et al., 2008) through a conserved domain located at its C-terminus (Simard et al., 2004)

Introduction

Figure 6: Schematic structure of NKCC1in the cell membrane. The picture shows the predicted domain structure, the large N- and C-terminus and 12 transmembrane helices. Two predicted glycosylation sites are indicated between transmembrane domain 7 and 8.

The ion transporter NKCC1 was first described in 1980 in Ehrlich ascites tumor cells and mainly functions in cell volume regulation and secretion of fluids (Geck et al., 1980; Hamann et al., 2010; Kidokoro et al., 2014). It is commonly found in the basolateral membrane of the cell and electroneutrally transports one sodium, one potassium and two chlorides from the extracellular space into the cell via a secondary active transport (Chabwine et al., 2009). The symport of these ions is mediated through ion gradients of Na+ or K+. Therefore, its transport mechanism is indirectly associated with activity of the Na+/K+-ATPase (Terashima et al., 2006). This ATPase actively pumps sodium extracellular and potassium intracellular against their electrochemical gradient using ATP for the transport energy. In essence, the sodium gradient which is established by the Na+/K+-ATPase is the main driving force for the ion transport by NKCC1.

1.2.2 Involvement of NKCC1 in plasticity of the brain

Beside maintaining the cell homeostasis and fluid secretion, the ion transporter NKCC1 contributes to brain development and plasticity due to its altered expression during maturation (He et al., 2014; Pontes et al., 2013). The involvement of NKCC1 in development relies on the action of the neurotransmitter -aminobutyric acid (GABA) on the GABA-A receptors that act as ligand-gated chloride channels. In adulthood, GABA

Introduction

leads to inhibitory activation due to chloride release of neurons (Figure 7) (Ben-Ari et al., 1989). Studies have demonstrated that NKCC1 expression changed during brain development of mice. Pre-natal, post-natal and juvenile mice display a high expression of NKCC1 that decreases until three weeks after birth (Clayton et al., 1998; Hubner et al., 2001; Liu and Wong-Riley, 2012). This high expression of NKCC1 results in an excitatory response to GABA (Pfeffer et al., 2009) and a depolarization of the neuron. The depolarization can lead to further spontaneous giant depolarization potentials modulating the activity of other neurons in the developing hippocampus (Garaschuk et al., 1998; Khazipov et al., 1997a, b; Leinekugel et al., 1997). In turn, voltage-gated calcium channels trigger calcium oscillations causing neuronal growth.

Figure 7: The “GABA/chloride switch” of developing neurons. NKCC1 is highly expressed in immature neurons. The chloride extruder KCC2 is barely expressed thereby both causing a relatively high chloride concentration. The activation of GABA-A receptors generates an efflux of chloride and an excitation of immature neurons. In contrast, NKCC1 expression is low and KCC2 is upregulated in mature neurons leading to a low chloride concentration. GABA-induced activation results in chloride influx and hyperpolarization of the neuron. Modified from (Ben-Ari, 2002).

The expression of NKCC1 decreases during maturation of neurons of the central nervous system while an chloride-extruding protein is up-regulated (Ben-Ari, 2002). This protein is the potassium-chloride transporter member 5 (KCC2) which mediates the transport of

Introduction

potassium and chloride causing a low intracellular chloride concentration (Gulyas et al., 2001). Accordingly, GABA then induces inhibitory responses in adult mice (Rivera et al., 1999; Stein et al., 2004). These reversed expression patters of both proteins is the so-called “GABA-switch” or “chloride switch” of the brain. In summary, NKCC1 expression modulates the chloride concentration which results in excitatory or inhibitory effects of GABA on neurons and ultimately contributes to plasticity of the brain (Clarkson et al., 2010; Karpova et al., 2011). Beside this, neuronal seizures and epilepsy are associated with hyperactive neurons which have an imbalance in chloride concentration of neurons and lately alterations of excitatory or inhibitory responses (Dzhala and Staley, 2003; Khazipov et al., 2004). The pharmacological inhibition of NKCC1 with loop diuretics prevents neonatal seizures based on changes in intracellular chloride concentration (Dzhala et al., 2005; Puskarjov et al., 2014; Wang et al., 2015).

1.2.3 Involvement of NKCC1 in neurogenesis

The ion transporter NKCC1 is involved in several mechanisms, from homeostasis of cells through influencing of brain development and plasticity. These various effects are directly or indirectly related to its ability of chloride accumulation. Interestingly, NKCC1 was also described to contribute to proliferation and neurogenesis beside GABA-response modulation (Pieraut et al., 2007). Its function in proliferation was demonstrated in cultured cell lines where NKCC1 influences the mitosis in mouse fibroblasts. Overexpression of NKCC1 resulted in proliferation and phenotypic transformation of these cells (Panet et al., 2002; Panet et al., 2000). Also reversed effects were described whereby NKCC1 expression was up-regulated after treatment of PC12D cells, a rat pheochromocytoma cell line, with nerve growth factor (NGF) (Nakajima et al., 2007). These findings confirm the relevance of NKCC1 in cell proliferation. Furthermore, NKCC1 also influences the regeneration after both nerve injury in dorsal root ganglia and traumatic brain injury (Lu et al., 2014; Pieraut et al., 2007). Axotomized neurons showed faster growth compared to neurons lacking NKCC1. This artificial nerve injury in addition to induced phosphorylation of NKCC1 indicates higher activity of this protein. Furthermore, NKCC1 activity was demonstrated to be necessary for immature neuroblasts to migrate along the rostral migratory system (RMS) replacing the olfactory bulb interneurons (Mejia-Gervacio

Introduction

et al., 2011). The pharmacological inhibition of the transporter decreases cell proliferation of forebrain neuronal progenitor cells. In conclusion, NKCC1 expression affects the regulation of continuous regeneration/neurogenesis (Sun et al., 2012).

1.2.4 Regulation of NKCC1

The expression of the ion transporter NKCC1 is altered by hyperosmotic stress or hypotonic low chloride concentrations. These circumstances additionally stimulate the WNK kinase (with-no-lysine kinase (amino acid symbol: K for lysine), lysine deficient protein kinase 1), SPAK (Ste20/Sps1-related proline/alanine-rich kinase) and OSR1 kinase (oxidative stress-responsive kinase 1) (Vitari et al., 2005) indicating a relationship between these kinases and NKCC1 (Richardson and Alessi, 2008). The ion transporter was initially identified to be a binding partner of SPAK and OSR1 (Dowd and Forbush, 2003; Piechotta et al., 2003). Indeed few years later, in vitro studies demonstrated that SPAK and OSR1 kinases phosphorylate NKCC1 at tyrosine residues located at its N-terminus (Figure 8) (Gagnon et al., 2007; Moriguchi et al., 2005; Vitari et al., 2005; Vitari et al., 2006).

Introduction

Figure 8: Regulation of NKCC1 activity. The lysine deficient protein kinases 1-4 (WNK1-WNK4,with-no-lysine kinase), regulates the sterile 20 kinase family (Ste20) which includes the sterile-20 (Ste20)-related proline-alanine-rich kinase (SPAK) and the oxidative stress-responsive kinase 1 (OSR1). These kinases directly promote phosphorylation of NKCC1 which induces the activation state. Protein phosphatase 1 (PP1) can inhibit the STE20 family and NKCC1 via dephosphorylation.

Latest research also showed that SPAK kinases influence GABA signaling and development of seizures in the hippocampus (Yang et al., 2013). This study additionally showed co-localization of SPAK kinase and NKCC1 in the hippocampal neurons. In conclusion, SPAK kinase is a mediator of NKCC1 activity in the hippocampus. NKCC1 activity is in turn reduced when it is dephosphorylated via a phosphatase. Studies demonstrated that the protein phosphatase 1 (PP1) reduces NKCC1 activity. Experiments with recombinant expressed PP1, SPAK and the N-terminus of NKCC1 showed that the kinase and the NKCC1 fragment were dephosphorylated via PP1 in a time-dependent manner (Gagnon and Delpire, 2010).

Introduction

1.2.5 NKCC1 Knock-out mice

Functional studies of NKCC1 in diverse tissues have been often performed using loop diuretics for pharmacological inhibition. Unfortunately, these compounds also inhibit other transporter family members as well which leads to the need for other approaches. In 1999 Flagella and coworkers have been generated a mutant mice by a combination of embryonic stem cell and gene targeting technology to directly study the physiological function of NKCC1 (Flagella et al., 1999). These mice carry a null mutation in the NKCC1 gene at the Slc12a2 gene locus. They inserted a neomycin gene in the exon 6 of the Slc12a2 gene which interrupts the reading frame (Flagella et al., 1999). Northern blot analysis confirmed the loss of both NKCC1-coding RNA in several tissues of knockout mice, e.g. brain, heart and skeletal muscle, and the reduction of this RNA in heterozygous mice. (Flagella et al., 1999). First, phenotypical differences were obtained between wild type and NKCC1- deficient mice. The most notable difference is that NKCC1-deficent mice exhibit shaker/walzer behavior including bidirectional circling, hyperactivity and head tossing due to inner ear defects and resulting imbalance. Furthermore, the NKCC1-defiecient mice showed growth retardation (~80%) compared with wild type littermates (Flagella et al., 1999) and roughly 30% of knockout mice died within three weeks after birth. Flagella and coworkers also identified some other characteristics of the null mutant mice. These mice exhibit a reduced blood pressure, ocassional intestinal bleedings and no Preyer´s reflex (Jero et al., 2001) indicating an impairment of hearing (Flagella et al., 1999). In this study, all experiments regarding tissues of mice were performed using the mice generated by Flagella and coworkers. Beside the NKCC1-deficient mice of Flagella and coworkers, several other NKCC1-related mutant mice were generated and characterized. For example, insertion of an adenine into exon 21 of NKCC1 gene generates a frameshift mutation (Dixon et al., 1999) or insertion of an artificial gene cluster (Delpire et al., 1999) both resulting in a non-functional NKCC1 protein. Other NKCC1-deficient mice were designed using gene fragments of neomycin inserted in the transmembrane domain (comprising helices 7 and 8) and the C-terminus of NKCC1 (Pace et al., 2000). Studies of this mice mutant not only confirmed the previous observations of phenotypical abnormalities, but also show evidence of an impairment in spermatogenesis (Pace et al., 2000).

Objectives

2. Objectives

Olfaction is one of the most crucial senses for vertebrates to perceive food edibility and toxic substances or to communicate with sexual partners via pheromones. Therefore, it is of particular interest to investigate the sense of smell, its function on the molecular level, involved signaling proteins and the identity of required ion-transports.

The canonical olfactors signaling cascade is initialized through activation of an olfactory receptor ultimately leading to a depolarization of the neuron. The main depolarization is accomplished by a massive efflux of chloride ions. Therefore a high intracellular chloride concentration is necessary for odorant signal detection. During the past years, the impact of the ion transporter NKCC1 in chloride accumulation of OSNs was controversially discussed. For that reason, this study addresses the issue of a main chloride accumulator in OSNs. Here, a combination of state-of-the-art transcriptome analysis validated by RT-PCR approaches and well-established electrophysiological experiments enable the investigation (I) of the impact of the transporter NKCC1 in chloride accumulation and thus odorant- evoked responses. Beside this, this study focuses on morphological changes of the OE of NKCC1-deficient mice using immunohistological methods, therefore investigating (II) an involvement of NKCC1 in the continuous neurogenesis of the OE.

Materials and Methods

3. Materials and Methods

3.1 Materials

3.1.1 Equipment

Name Model Manufacturer

Agarose gel chamber - RUB. Bochum Analytical balance A210P Sartorius MC1 Sartorius Gel imager Multiimage Light Biozym Fusion-SL 3500-WL Vilber Lourmat Cryotom CM 3050 S Leica Camera SensiCam pco Imaging Microscope Telaval 31 Zeiss Axiovert 200 Zeiss PCR cycler Mastercycler Eppendorf pH meter pH 3.3 Mettler Taledo Western blot chamber Criterion Blotter BIORAD SDS gel chamber Mini-Protean II Zelle BIORAD Shaking incubator Certomat R Braun Power supply EV231 Consort Power Pac 3000 BIORAD Photometer Nanodrop ND 1000 peqlab Thermoblock Thermomixer 5436 Eppendorf Vortexer Vortex-Genie TM Scientific industries Centrifuge Centrifuge 5415R Eppendorf Centrifuge 5415C&D Eppendorf

Materials and Methods

Centrifuge RC6+ Sorvall Minifuge RF Heraeus

3.1.2 Chemicals

Name Manufacturer

2-desoxycytidin-triphosphat (dCTP) Fermentas 2-desoxyguanosin-triphosphat (dGTP) Fermentas 2-desoxythymidin-triphosphat (dTTP) Fermentas 6x loading dye Fermentas Adenosintriphosphat (ATP) Sigma Acrylamide Sigma Agarose LE Biozym

Calcium chloride (CaCl5) J.T. Baker

Calcium nitrate (Ca(NO3)2) Sigma Casein Thermo Scientific Dimetyl sulfoxide BIO-RAD dithiothreitol (DTT) DNA ladder (50 bp. 1 kb) Fermentas Eosin Sigma Ethidiumbromid AppliChem Ethylenediaminetetraacetic acid (EDTA) Merck Gelatin from cold water fish skin Sigma Glucose AppliChem Glycine AppliChem Haematoxylin Merck Henkel100 Henkel 4-(2-hydroxyethyl)-1-piperazine AppliChem Ethanesulfonic acid (HEPES)

Materials and Methods

Immersol 518F Zeiss Isopropyl alcohol J.T.Baker Methanol J.T.Baker Mowiol C. Roth N.N.N´.N´- tetramethylethylenediamine (TEMED) Fluka Biochemika Paraformaldehyde (PFA) Prolabo Ponceau S Fluka Biochemika Potassium chloride (KCL) J.T. Baker Protease inhibitor (cOmplete Mini) Roche. Mannheim Saccharose AppliChem Sodium dodecylsulfate (SDS) AppliChem Reaction tube (15 mL. 50 mL) Sarstedt Tris-HCL Biomol Triton X-100 Sigma

3.1.3 Buffer and solutions

Name Composition

Blocking solution for 1% gelatine immunohistochemistry 0.1% TritonX100 in PBS- -

Fixation solution for cryosections 4% PFA (pH 7.5) in PBS + +

Coomassie staining solution 45% (v/v) ethanol 10% (v/v) acetic acid 0.25% (w/v) Coomassie-Brilliant Blue

Materials and Methods

DNA sample buffer 0.025% (m/v) bromphenol blue 20% Ficoll 400 100 mM EDTA 0.025% (m/v) xylene cyanol

Deciliation buffer 140 mM NaCl

(pH 7.5) 2 mM MgSO4 7.5 mM D-Glucose 20 mM HEPES 5 mM EGTA

20 mM CaCl2 30 mM KCl 1 tablet protease inhibitor cOmplete Mini dNTP-Mix 25 mM dATP 25 mM dTTP 25 mM dCTP 25 mM dGTP

Oxygenated saline buffer 120 mM NaCl

(pH 7.5) 25mM NaHCO3 5 mM KCl 5 mM BES

1 mM MgSO4

1 mM CaCl2 10 mM glucose

PBS- - (pH 7.2) 2.7 mM KCL

1.5 mM KH2PO4 137 mM NaCl

8.1 mM Na2HPO4

Materials and Methods

PBS++ (pH 7.3 - 7.5) 2.7 mM KCL

1.5 mM KH2PO4 137 mM NaCl

8.1 mM Na2HPO4

0.9 mM CaCl2

0.48 mM MgCl2 Ringer solution (pH 7.4) 140 mM NaCl 5 mM KCL 10 mM HEPES

2 mM CaCl2

1 mM MgCl2 10 mM glucose

Radio-Immunoprecipitation Assay 150 mM NaCl (RIPA) buffer 50 mM Tris-HCL 1% nonident 0.5% deoxycholic acid 0.1% SDS 1 tablet protease inhibitor tablet

SDS Page electrophoresis 250 mM Tris-HCL buffer (10x) 1.92 M glycine 1% (w/v) SDS

SDS sample buffer (5x) 312.5 mM Tris-HCL 10% (w/v) SDS 50% (v/v) glycine 25% (v/v) 2-mercaptoethanol

TBE buffer 90 mM Tris-HCL 90 mM Borsäure 2 mM EDTA

Materials and Methods

TBS 100 mM Tris-HCL 150 mM NaCl

TBS-T 0.02% (v/v) Triton X-100 in TBS

TE 10 mM Tris-HCL 1 mM EDTA

TEM buffer 10 mM Tris

(pH 7.4) 3 mM MgCl2 2 mM EGTA 1 tablet protease inhibitor cOmplete Mini

Wash solution for 0.1% TritonX100 immunohistochemistry in PBS- -

3.1.4 Consumables

Name Manufacturer

Conical centrifuge tubes Falcon. Sarstedt Coverslips Menzel-Gläser ECL Westernblotting detection reagents Amersham/GE Healthcare Single-use syringe Braun Leica Jung Tissue Freezing Medium Leica Biosystems Transfer membrane. PVDF Milipore Sample slides Superfrost Plus Menzel-Gläser PAP pen Sigma-Aldrich Pipette tips Sarstedt Vials (1.5 ml und 2 ml) Eppendorf

Materials and Methods

Whatman paper Whatman

3.1.5 Kits

Name Manufacturer

Catch and Release® v2.0 Milipore iQ™ SYBR® Green Supermix BIO-RAD iScriptTM cDNA synthesis kit BIO-RAD Phire Animal Tissue Direct PCR Kit Thermo Scientific Turbo DNAse digest Ambion

3.1.6 Antibodies

3.1.6.1 Primary antibodies 1. Antibody Dilution Manufacturer

Goat-α-adenylyl cyclase III, 1:250 (Western blot) Santa Cruz polyclonal 1:50 (Immuno staining)

Rabbit-α-adenylyl cyclase III, 1:250 (Western blot) Santa Cruz polyclonal 1:50 (Immuno staining)

Goat-α-Gαolf, polyclonal 1:250 (Western blot) Santa Cruz 1:50 (Immuno staining)

Rabbit-α-Gαolf, polyclonal 1:250 (Western blot) Santa Cruz 1:50 (Immuno staining)

Mouse-α-Calmodulin, monoclonal 1:250 (Western blot) Santa Cruz 1:50 (Immuno staining)

Goat-α-CNGA-4, polyclonal 1:250 (Western blot) Santa Cruz 1:50 (Immuno staining)

Materials and Methods

Goat-α-CNGA-2, polyclonal 1:250 (Western blot) Santa Cruz 1:50 (Immuno staining)

Rabbit-α-PCD1C, polyclonal 1:200 (Western blot) Eurogentec 1:50 (Immuno staining)

Rabbit-α-NKCC1, polyclonal 1:200 (Western blot) Abcam 1:200 (Immuno staining)

Mouse-α-acetylated α Tubuline, 1:250 (Western blot) Santa Cruz monoclonal 1:50 ( Immuno staining)

3.1.6.2 Secondary antibodies 2. Antibody Dilution Manufacturer

HRP-goat-α-rabbit 1:10000 (Western blot) BIORAD HRP-goat-α-mouse 1:10000 (Western blot) BIORAD

HRP-rabbit-α-goat 1:10000 (Western blot) BIORAD AlexaFluor660 goat-α-mouse/rabbit 1:1000 (Immuno staining) Molecular Probes AlexaFluor546 goat-α-mouse/rabbit 1:1000 (Immuno staining) Molecular Probes AlexaFluor488 goat-α-mouse/rabbit 1:1000 (Immuno staining) Molecular Probes

3.1.7 Oligonucleotides

Name Sequence (5´3´) NKCC1-for GGAACATTCCATACTTATGATAGATG NKCC1-rev CTCACCTTTGCTTCCCACTCCATTC dNEO-PolyA GACAATAGCAGGCATGCTGG Olfr1303 fwd GCTGGAAACATCCTCATTG Olfr1303 rev AGTGATACAGCCTCCAAAG Olfr332 fwd AAGTTCCCTATTCCTGTGCCTTTC

Materials and Methods

Name Sequence (5´3´)

Gnal fwd GGGAAAAGCACTATCGTCA Gnal rev CATGGTCAAAGAACTCCTG Adcy3 fwd AGATTGGAGTCATGTTTGC Adcy3 rev GTGTTGACATCTGGTGTG Cnga2 fwd CGGACTACATTGACTAAGG Cnga2 rev ACCTGTGGAGATTTCTTGC Cnga4 fwd GACAGAAAGACGCAGCTG Cnga4 rev GAAGACCATCGTGTTCAG Ano2 fwd AGCTATGTCTACGTGTTCGACGGTTA Ano2 rev AAGGCTCTAGGCTGTGGTCCAGGTCCCA Calm1 fwd GTGCATAACACTGTAGCTTG Calm1 rev ACACCCCCGAACTTGGAA Calm2 fwd GCGAAGTGAAGACATTGT Calm2 rev GCTTAGATATAGCCAGAG Calm3 fwd TGTGGAAGGGTGGGAAGA Calm3 rev GAGCGGCATGGGATGTTA Actb fwd TGACGTTGACATCCGTAAAG Actb rev CACTTGCGGTGCACGATG Slc4a1 fwd CAGAAAGAGTGTTCCGCATTACC Slc4a1 rev GATAACGGCGCCGGATATCACG Slc4a2 fwd GAAGACTTTGAATACCACCGCCAG Slc4a2 rev CAGTTCAGTTCTTTCTCCAAGAGG Slc4a3 fwd CCCACAGAAAGCAAAGTTCTCC Slc4a3 rev CTCCAGCCGATGACTCTTCATG Slc6a6 fwd AGCCAGTTTGTTGAAGTCGAAG Slc6a6 rev GACGAAACATCCAACACAAAGAGC Slc12a2 fwd ATGATCGAGCCGTACAGACTTC

Materials and Methods

Name Sequence (5´3´)

Slc12a4 fwd TTCTACCTGGGGACGACATTTG Slc12a4 rev CTTGGCACAGATGTCAAACTGG Slc12a6 fwd TCGGCGTACGCTATGTGAATAA Slc12a6 rev GTCTTGATGACAGGGTACGGTT Slc12a7 fwd CAGAGTCTAACGGAGCCATGC Slc12a7 rev TGATGAAAGGGCTGTTTTCCCT Slc12a9 fwd TTGCCTACATCATTCTGGCACT Slc12a9 rev ACGTCCAGTATAGACTCCACCA Slc26a7 fwd CATTCCAAACGGGATTCCTCCTC Slc26a7 rev GATATTAGACAAGCCACCTGCGTC Slc26a9 fwd GCTCCATCGTCTTTACCTTCATTG Slc26a9 rev CATCTCCTGGTTAGAATCCACATC Slc26a11 fwd GGACAGATCAAGAACCTGCTGG Slc26a11 rev CATTGCGAGCTGTTGTGACAGT

Materials and Methods

3.2 Methods

3.2.1 Animals

NKCC1-deficient mice were generated by Prof. Dr. Gary Shull, University of Cincinnati (Flagella et al., 1999) and kindly provided by Prof. Dr. med. Ursula Seidler (Hannover Medical School, Hannover, Germany). Feeding and mating of heterozygous mice was done by the keeper in the animal facility. Biopsies of mice caudate were collected by the keeper and used for genotyping. DNA extraction of mice caudate was performed using the Phire® Animal Tissue Direct PCR kit (Finnzyme, Finland). Two polymerase chain reaction approaches were done for each DNA sample using iQ™Sybr®Green Supermix. During PCR the wild type alleles were amplified resulting in a 105 bp-fragment and NKCC1- deficient allele leads to a 156 bp-fragment.

Table 1: PCR program used for genotyping of mice.

Temperature in °C Time Cycle 5 3 min - 95 20 sec 50 20 sec x34 72 40 sec 72 3 min -

3.1.2 Preparation of olfactory epithelium

Adult mice (older than 12 weeks) of male and female of each genotype (NKCC1+/+ and NKCC1-/-) were killed by cervical dislocation and subsequently decapitated. The head was skinned and sagittally cut in half to expose the turbinates. The olfactory epithelium covering the turbinates was carefully collected to prevent olfactory bulb tissue contamination. Olfactory epithelium was subsequently collected in appropriate buffer solutions according to following methods.

Materials and Methods

3.1.3 RNA isolation

Total RNA was isolated from olfactory epithelium with the RNeasy Plus Mini Kit (Qiagen. Hilden, Germany) according to the manufacturer´s protocol with optional on-column DNaseI digestion.

3.1.4 Complementary DNA (cDNA) synthesis

After RNA purification, cDNA was synthesised using the Synthesis Kit (BIO RAD, Munich, Germany) according to the manufacturer´s protocol.

3.1.5 RNA sequencing (RNA-Seq) analysis

Preparation of mice OE from male and female NKCC1+/+ (12 ± 1 weeks) and NKCC1-/- mice (16.5 ± 3.5 weeks, NMRI background) was prepared, and RNA was isolated as described in section 3.1.3 including the optional on-column DNaseI digestion. Each RNA sample was prepared from an OE pool of 4 (mixed-gender pool RNA isolation) or 2 (gender RNA pool) different mice for each condition. The RNA-Seq analysis was performed as described by Kanageswaran and coworkers (Kanageswaran et al., 2015). Libraries for RNA-Seq were prepared from total RNA and subjected to DSN normalization by standard Illumina protocols. Afterwards, Illumina sequencing was performed on a HiSeq-2000 again by standard Illumina protocols (101-bp, paired end). The raw sequence data were analyzed in fastq format as previously described (Trapnell et al., 2012). RNA-Seq reads were aligned to version mm9 of mouse reference genome and transcriptome using TopHat (v2.0.7) (Trapnell et al., 2009) which uses the ultra-fast short-read mapping program Bowtie to arrange the alignment (Langmead et al., 2009). TopHat output files in BAM format were sorted and indexed with SAMtools (Li et al., 2009). In order to reduce the alignment of repetitive reads, a multiread-correction was used allowing up to 5 hits per read. Aligned RNA-Seq reads for each sample were assembled into transcripts and their abundance was estimated by the program Cufflinks (v1.3.3) (Trapnell et al., 2010) using the RefSeq mm9 reference transcriptome in Gene Transfer Format (GTF) obtained from the UCSC Genome Bioinformatics database (University of California Santa Cruz). In order to estimate transcript expression, the GTF-file was

Materials and Methods

supplied to Cufflinks. The parameter “--compatible-hits-norm” was set to guarantee that FPKM normalization was performed based on reference transcriptome only. Cufflinks was provided with a multifasta file (mm9.fa) to improve accuracy of the relative transcript abundance estimation (Roberts et al., 2011). A masked command “–M” and the mask GTF rmsk.gtf were used to identify all possible reads from RNA repeats (including tRNA, snRNA, scRNA, srpRNA) short and long interspersed nuclear elements (SINE, LINE) and other classes of repeats. Cufflinks indicates and quantifies the relative abundances of transcripts in the unit FPKM (Trapnell et al., 2010). The data sets were visualized and investigated by the Integrative Genomic Viewer (www.broadinstitue.org/igv) for proving sequence alignments and correct mapping of reads for expressed genes. Whilst the raw data analysis was performed on a Linux based computer, further calculations were carried out with Microsoft Excel 2007. For a differential gene expression analysis, the program Cuffdiff was used that identifies significant changes in transcript expression between two datasets (Trapnell et al., 2012)

3.1.6 Reverse transcription polymerase chain reaction (RT-PCR)

Primers for reverse transcription polymerase were around 22 nt long and designed to generate a 200-300 bp DNA fragment. To avoid gDNA detection and false-positive amplification, primers bind to an exon-exon junction. RT-PCR was performed with iQ™ SYBR® Green Supermix in a Mastercycler® Eppendorf realplex2 real-time PCR machine (Eppendorf. Hamburg. Germany). The DNA amplification was estimated through the profile of the melting curve which showed a single sharp peak and PCR products were additionaly analysed via a 1% agarose gel. Also control experiments were performed whereby a –RT (no-reverse transcriptase)-template or water was used.

Materials and Methods

Table 2: RT-PCR approach (3fold apporach).

Reagent Volume (µL) SYBR® Green Supermix 37.5 each primer (diluted 10 µM) 1.7 cDNA 2

ddH2O 32.1

Table 3: PCR program used for RT-PCR.

Temperature in °C Time Cycle 95 3 min - 95 45 sec 50-60 (depending on primers) 45 sec x40 72 1 min 72 5 min - 95 15 sec - 60 15 sec - 60  95 (temperature ramp) 20 min - 95 15 sec -

3.1.7 Agarose gel electrophoresis

Agarose gel electrophoresis was used to separate DNA according to its length and to quantify and qualify DNA. For this purpose, a 1% agarose solution in TBE buffer was prepared. After heating, the agarose dissolved and was mixed with 0.07% ethidium bromide. The ethidium bromide is used as an intercalator which binds to DNA and enables a UV light detection. The TBE/agarose mixture was moulded into a customized electrophoresis chamber for curing. Also a comb was stuck in the gel to form pockets in which the DNA sample could be applied. The DNA sample was mixed with 5x sample loading buffer. Additionally, the 1% agarose gel is covered with TBE buffer, DNA samples were loaded into the gel pockets and a power supply was added to generate a voltage field of 130 V. Due to the negative charge of DNA, the voltage field forces the DNA to pass the agarose gel. Consequently, the DNA was separated by its length and 34

Materials and Methods

formed clusters of DNA fragments with the same size. After 45 min of electrophoresis, the agarose gel was analysed under UV-light using the gel imager (Multiimage Light, Biozym).

3.1.8 SDS-Polyacrylamide gel eletrophoresis (PAGE)

A discontinuous, denaturating sodium dodecyl sulfate (SDS) gel was prepared as described in literature (Laemmli, 1970) using a Mini-PROTEAN® Tetra Handcast Systems (BIO-RAD, Munich, Germany). A SDS-PAGE chamber was filled with electrophoresis buffer and connected to a power supply followed by electrophoresis for 1 h at constant voltage of 150 V. The SDS gel was removed from the glass carrier and subsequently either stained with Coomassie Billiant Blue or used for western blot analysis.

3.1.9 Western blotting

Olfactory epithelium preparation was performed as described previously (section 3.1.2), collected in RIPA buffer and solubilized mechanically. Cell lysate was mixed with sample buffer, loaded on a SDS gel and electrophoresis was performed. A nitrocellulose membrane was applied on the SDS-PAGE and inserted in a wet western blot chamber filled with transfer buffer. For protein blotting, the chamber was connected to a power supply (100 V, 30 min). Afterwards the proteins were transfered to the membrane which was subsequently washed in blocking solution for 1 h at RT. The presence of a protein was detected through specific antibodies (dilution 1:50-2500 in 25% blocking solution) which were applied for 12 h at 4°C. After three washing steps with TBS-T for 10 min, a second antibody linked to a horseradish peroxidase was applied and incubated for 1 h at RT. The visualization of proteins was performed using a chemiluminescence detection system (GE Healthcare, Germany).

3.1.10 Electro-olfactogram (air-phase)

The head of a mouse was sagittally hemisected to expose the septum which is covered with OE. The halved head was placed on an agarose block in which the reference electrode was embedded. Additionally, the Ag/AgCl recording electrode filled with Ringer solution was placed directly on the surface of the epithelium exemplified by the increase in electrical 35

Materials and Methods

resistance. The electro-olfactogram (EOG) recordings were performed while a continuous humidified air stream (2.4 L/min) was applied to the OE on the septum. Provoking a change in the surface potential, an odorant mixture of 100 odorants (Henkel100 (Henkel, Düsseldorf, Germany), used as 1:1000 dilution in Ringer solution) or 10 odorants (carvone, isoamylacetate, pyridine, benzaldehyde, hexanoic acid, cineole, n-butanol, ethyl butyrate, 2-heptanone and anisole, each 100 µM in DMSO, used as 1:1000 dilution in Ringer solution) was delivered for 100 ms on the OE and was injected into the air stream via a custom made device. Each OE was repetitively stimulated (10 times) at different locations of the OE. Responses were recorded and the current amplitudes were calculated as the time between 10% and 90% of the maximum amplitude. The maximum amplitude and area under curve were calculated for each mouse using Clampfit 10.2.0.14 (MDS Analytical Technologies, Sunnyvale, California). In addition, rise and decay time were calculated via curve fitting with Igor Pro6.0 (WaveMetrics, Portland, Oregon) and implemented via Microsoft Exel 2007 (Seattle, USA).

3.1.11 Submerged electro-olfactogram

The OE was exposed and the halfed head was placed in low melting agarose to facilitate a transverse position of the septum. The OE was continuously perfused with oxygenated saline (95% O2, 5% CO2, pH 7.4) using a custom made air-pressure application device (0.6 mL/min) whereby the application cannula was placed on the calvaria. The continuous stream of buffer solution was ensured by using a suction cannula located under the septum edge. The tip of the recording pipette (β MΩ) was first soaked with 3% agarose, filled with Ringer solution and placed on the surface of the OE before continuous oxygenated saline application. In addition, the reference electrode was embedded in low melting agarose. The stimulation of the OE was computer controlled (0.5 s) and allowed a rapid and consistent application of the odorant mixture Henkel100. For blocking experiments, 300 mM niflumic acid was applied for 20 s and washed out with Ringer buffer for 5 min. Surface potentials were recorded and amplified with a DigiData 1200 Series interface (WPI), a 5111A oscilloscope (Tektronix) and DP-311 differential amplifier and visualized with the WinEDR V.3.1.2. program (University of Strathclyde, Glasgow, Scotland). The maximum amplitude was calculated for each mouse using Clampfit 10.2.0.14 (MDS Analytical Technologies, Sunnyvale, California) and Microsoft Exel 2007 (Seattle, USA). 36

Materials and Methods

3.1.12 Cilia preparation (calcium shock method)

Olfactory epithelium was collected in 500 µL deciliation buffer as described in section 3.1.2. After 20 min incubation at 4°C on a shaker at 300 rpm, the solution was centrifuged at 6600 rcf at 4°C for 5 minutes. Supernatant was stored and the pellet was resuspended in 300 μl deciliation buffer. The protocol was repeated four times to receive ~1.4 mL cilia fraction. Pooled fractions were centrifuged at 35000 rpm at 4°C for 30 min. The pellet contained the cilia of the OE and was stored in TEM buffer.

3.1.13 Preparation of olfactory epithelium cryosections

The mouse was killed through cervical dislocation and subsequently decapitated. The head was skinned and cleared of hair. Then the jawbone was cut off and teeth removed. First, the head was incubated in 4% PFA (in PBS++ buffer) at 4°C to fix tissue and proteins for further preparation. After fixation, the head was stored in 1 M EDTA (in PBS++ buffer) at 4°C for 24 h (for a P20 mouse) or one week (for an adult mouse) for decalcification. This preparation step intenerated the skull and enables crysectioning of the head. In the last incubation step, the head was stored in 30% saccarose over night to prevent damage caused by freezing. Then the head was placed in freezing medium and freezed at -28°C. Cryosections of 14 µm thickness were cut at a microtome using a cutting angle of 4° during constant temperature of -28°C. The sections were placed on Superfrost Plus slides, dried for 5 min at RT and afterwards stored at -20°C.

3.1.14 Immunohistochemistry

Cryosections of mice OE were prepared as described in section 3.1.13. First, sections were kept in blocking solution for 1 h at RT to enable cell penetration of antibodies and saturation of unspecific binding sites. Primary antibodies were diluted in blocking solution according to their proposed dilution factors. OE sections were surrounded with a PAP pen and dried at RT. A humidity chamber was prepared in which cryosections were stored for next steps. A drop of the blocking solution containing the first antibody was placed on each cryosection and incubated over night at 4°C. The next day, the cryosections were washed with washing solution three times for 10 min. Secondary antibodies were also diluted in

Materials and Methods

blocking solution (1:1000) and incubated for 1 h at RT. Subsequently, three washing steps with wash solution (each 10 min) followed and sections were dried. Immunohistochemical staings were covered with mowiol and a cover slip and stored at 4°C.

3.1.15 Hematoxylin-/Eosin-staining

Cryosections of olfactory epithelium were prepared as described in section 3.1.13 and incubated in PBS++ for 5 min at RT. Afterwards a drop of hematoxylin ready-to-use solution was added on each OE section and incubated for 5 min at RT. The cryosections were then blued by intensively washing with piped water. The eosin staining was performed with a 1% solution of eosin in water. A drop of staining solution was added to the section and incubated for 2 min at RT. After 2 washing steps for 2 min the sections were dried, covered with mowiol and a cover slip. Analysis was performed using an Axioscope 2 (Zeiss, Ulm, Germany).

3.1.16 Measurement of neuronal layer thickness and Cell counting

Cryosections (14 µm) of OE wereprepared and stained with heamatoxylin and eosin (Sigma-Aldrich) (section 3.1.13 and 3.1.15) and subsequently analysed with a microscope (Zeiss Axioscope 2, Ulm, Germany). Three different cryosections were analysed for each mouse whereby pictures of the olfactory neuronal layer were taken with a 40-fold magnification in the same area of the nasal cavity. The neuronal layer thickness was measured 5 times in each nasal cavity using image analysis software Fiji (Schindelin et al., 2012). Moreover, cells located in the neuronal layer of the OE were counted using DAPI stainig. Therefore, three cryosections of each mouse were stained with DAPI (1:300 in blocking solution), incubated at RT for 1 h and analysed with a Zeiss LSM 510 Meta confocal microscope using a 40-fold magnification. Cell counting was performed with the help of Fiji (Schindelin et al., 2012) whereby the cell number was normalized to the neuronal layer area.

Materials and Methods

3.1.17 Microscopy

Immunofluorescence was detected via confocal microscopy (LSM 510 Meta, Zeiss) using a MaiTai Ultrafast Laser (SpectraPhysics) for DAPI staing and a multiline argon laser at 488 nm for GFP- excitation and green fluorescing secondary antibodies. Image acquisition was performed using a 40x objective (1.4 numerical aperture) and custom software (CarlZeiss AIM) and the pinhole was set to one array unit. Image setting (gain, offset, zoom) were equal between different object slides to guarantee comparability.

3.1.18 Statistical data analysis

Student´s t-test was used for statistical analysis using STATISTICA 10 (StatSoft, Hamburg, Germany) and significant differences were calculated (***: P<0.001, **: P<0.01, *: P<0.05).

Results

4. Results

The Slc-transporter NKCC1 is ubiquitinously expressed throughout several tissues (Bouyer et al., 2013; Chen and Sun, 2005; Crouch et al., 1997; Kakigi et al., 2009; Schobel et al., 2012). The ion tranporter is well established to function in cell homeostasis in some cells due to its ion import ability (Bush et al., 2010), but the impact of NKCC1 partially remains ambigous especially in OSNs. These cells maintain their high chloride concentration due to a chloride accumulator, namely a chloride transporter. This chloride transporter preserves the chloride gradient over the membrane so that odorant-evoked responses were amplified (~80% of depolarization) by a chloride efflux (Kurahashi and Yau, 1993; Lowe and Gold, 1993). To date, several publications controversaly discuss the impact of NKCC1 in chloride accumulation of OSNs (Hengl et al., 2010; Nickell et al., 2006; Nickell et al., 2007; Reisert et al., 2005; Smith et al., 2008a), but the identity of the responsible chloride accumulator ultimately remains obscure.

This study attempts to answer the question of the chloride accumulator identity in OSNs utilizing NKCC1-deficient compared with wild type mice. For the first time, transcriptome analysis through RNA-Seq experiments were performed using OE lysate of NKCC1+/+ and NKCC1-/- mice. Protein contents of specifical olfactory-related proteins were analyzed. Beside this, electrophysiological approaches were accomplished to characterize the odorant-evoked responses and finally morohological investigations were performed.

4.1 Genotyping of NMRI background mice

To characterize the role of NKCC1 in OSN, a NKCC1-deficient mice model was used. The NKCC1 gene is disrupted in the knockout mice via a neomycin gene which is inserted in exon 6 resulting in a nonfunctional protein (Flagella et al., 1999). NKCC1-deficient mice exhibit a prominent phenotype with growth retardation and difficulties in maintaining their balance (Flagella et al., 1999) whilst heterozygous mice show no phenotype distinguishable from wild type. Therefore, it is necessary to genotype the mice before any experiment using PCR. During PCR, the genomic DNA sample of mice is tested in two trials. Each trial tested for either the intact NKCC1 gene (generating a 105 bp fragment) or the disrupted NKCC1 gene (156 bp fragment). Using this two trial-PCR, the detection of

Results

wild type, NKCC1-deficient and even heterozygous mice is possible (Figure 9). All used mice in this study were tested for their genotype according to the described method in section 3.1.1.

Figure 9: PCR analysis of mice genotypes. First example shows two DNA fragments (~100 bp and ~150 bp) indicating a heterozygous (NKCC1+/-) mouse. Second sample demonstrates only a fragment in the “WT”-qPCR (~100 bp DNA fragment) suggesting a wild type (NKCC1+/+) mouse. The third example only shows one DNA fragment in the “KO”-trial indicating a NKCC1-deficient (NKCC1-/-) mouse. (M= 50 bp DNA ladder).

4.2 Localization of NKCC1 in the murine olfactory epithelium

The molecular function of the ion transporter NKCC1 was known for several years (Bouyer et al., 2013; Chen and Sun, 2005; Kakigi et al., 2009; Kaplan et al., 1996; Schobel et al., 2012) but its possible role in OSNs still remains unknown. The ubiquitinous expressed ion transporter was often demonstrated to be incorporated in the basolateral plasma membrane of diverse cell types (Crouch et al., 1997; Delpire et al., 1999; Goto et al., 1997). In contrast, its localization in OSNs remains obscure. First, immunohistological stainings demonstrated a localization stricted to the dendrolateral membrane of ORNs (Reisert et al., 2005). A second study showed a controversial site of expression namely the ciliary membrane of OSNs (Hengl et al., 2010). Therefore, it is of particular interest to reveal the localization of NKCC1 representing its possible importance in OSNs. This study used western blot analysis to uncover the ion transporter localization since immunohistological approaches failed to specifically stain NKCC1 protein in OE cryosections (Figure 10). During western blot analysis, antibody specificity was tested using OE cell lysate of wild type and NKCC1-deficient mice.

Results

Figure 10: Western blot analysis of NKCC1 antibody specificity and protein localization. A) NKCC1 antibody specificity tested with NKCC1+/+ and NKCC1-/- OE lysate. Western blot analysis of the housekeeping protein actin indicates approximately the same protein amount in both samples. B) Detection of NKCC1 protein in a cilia-enriched fraction of NKCC1+/+ OE and remaining OE-lysate. Western blot analysis of the housekeeping protein actin indicates approximately the same protein amount in both samples. A large amount of the acetylated ciliary protein α tubulin is detected in the cilia-enriched fraction. (n=3) (Haering et al., 2015).

NKCC1 was detected in wild type but not in OE lacking the ion transporter confirming the accurate detection by the antibody (Figure 10 A) To identify the localization of NKCC1, a cilia-enriched fraction of wild type OE was prepared (section 3.1.12) and analyzed via western blot (Figure 10 B). NKCC1 was found exclusively in the cilia-enriched fraction of OSNs. Western blot analysis also demonstrated nearly identical actin amounts in both samples whereas acetylated α tubulin was enriched in the ciliary fraction.

4.3 Localization of olfactory signal transduction proteins in the murine olfactory epithelium

Additional histochemical approaches were executed to study the localization of olfactory signal transduction-related proteins in wild type and NKCC1-deficient OE. Stainings of the olfactory α-subunit of the G protein, the adenylyl cyclase 3 and the alpha 2 subunits of the cyclic nucleotide-gated channel were detected in apical parts of the neuronal layer (Figure

11 A).

Results

Figure 11: Immunohistological staining of NKCC1+/+ and NKCC1-/- OE cryosections. Olfactory signal transduction proteins were stained with AlexaFluor488. Gαolf: α-subunit of the olfactory G protein, ACIII: adenylyl cyclase III, CNG2: cyclic nucleotide-gated channel alpha 2. Immunohistological staining (AlexaFluor488) of the acetylated ciliary α tubulin and secondary antibody control stainings. (n=3, Scale bar 50 µm).

Furthermore, acetylated α tubulin was stained in OE cryosections indicating a ciliary localization of both tubulin and the signal transduction proteins (Figure 11 B). A qualitative comparison of staining intensities revealed no significant differences in fluorescence intensities except for the α-subunits of the olfactory G protein.

4.4 Transcriptome analysis of the olfactory epithelium

RNA Sequencing (RNA-Seq) is a powerful tool to analyze the transcriptome of diverse eukaryotic cells or tissues, e.g. Saccharomyces cerevisia, Arabidopsis thaliana, brain, kidney, testis and the mouse olfactory epithelium (Flegel et al., 2013; Lister et al., 2008; Mombaerts, 2004a; Nagalakshmi et al., 2008; Wilhelm et al., 2008).

Results

4.4.1 RNA-Sequencing analysis of olfactory epithelium of NKCC1+/+ and NKCC1-/- mice

To characterize ion transporter gene expression in NKCC1+/+ and NKCC1-/- mice, the OE transcriptome (Figure 12) was analyzed using Illumina RNA-Seq. Three OE samples for each condition (NKCC1+/+/NKCC1-/-) were prepared, one sample of mixed gender and two additional samples of male only and female only. Each RNA sample was prepared from the OE of three different mice; in the mixed gender pool, two OE of each gender were used. The mixed gender pools were the first samples to be analyzed via RNA-Seq, thus only ~10 million reads (101 nt-long DNA fragments) were generated and sequenced (Figure 12 A). The gender specific samples were analyzed in greater detail by amplifying and sequencing up to ~38 million 101 nt-long fragments from NKCC1+/+ and NKCC1-/- adult mouse OEs. The FPKM (fragments per kilobase of exon per million fragments mapped) value was the quantitative number of gene expression in the RNA-Seq experiments. First, the comparability of datasets was tested analyzing expression patterns of different housekeeping genes (Figure 12 B).

Results

Figure 12: Summary of RNA-Seq data. A) List of generated and mapped reads for each RNA-Seq analysis of different OE pools B) Distribution of different housekeeping genes in OE samples of NKCC1-/- and NKCC1+/+ mice. Heatmap showing the expression levels of several housekeeping genes in OE samples of NKCC1+/+ (mixed gender, male and female OE sample). Higher FPKM values are indicated by darker colors. Actb: -actin, cytoplasmic 1, Tubb 3: tubulin beta-3 chain, Gapdh: glyceraldehyde-3-phosphate dehydrogenase, Ldha: L-lactate dehydrogenase A chain isoform, Hprt: hypoxanthine-guanine phosphoribosyltransferase 2, Ubc: polyubiquitin-C (Haering et al., 2015).

FPKM values are roughly divided into 3 categories whereby FPKM value of ~1 indicates weakly expressed genes, ~10 labels medium expression, and ~100 marks highly expressed genes based on comparisons to housekeeping genes. The analysis of housekeeping genes revealed medium to high expression for all tested genes. Additionally, expression profiles of housekeeping genes seemed to be consistent through all samples. For differential gene expression analysis between wild type and NKCC1-deficient mice, the three OE transcriptome raw datasets for each condition (NKCC1+/+/NKCC1-/-) were collectively analyzed using Cuffdiff (Trapnell et al., 2012). Cuffdiff analysis ultimately enabled differential expression analysis for each condition (NKCC1+/+/NKCC1-/-) providing the basis for transcriptome characterization in this study.

4.4.2 RNA-Seq: Expression analysis of chloride-associated cotransporters

The olfactory epithelium (OE) consists of different cell types with distinct functions, comprising the olfactory neurons, the supporting cells and the basal cells (Graziadei and Graziadei, 1979; Huard et al., 1998). Each cell type fulfills a distinct function in the totality of the OE (Mombaerts, 2004a). The ORs play the most prominent role in this epithelium

Results

due to their initial odorant detection ability (Persuy et al., 2015). The odorant binding to its specific receptor ultimately leads to the depolarization of the OSN (Nakamura and Gold, 1987). This depolarization is initially mediated via a calcium influx and enhanced through a chloride efflux. Due to this, an unusually high intracellular chloride ion concentration is necessary in OSN and thus an active chloride accumulation mechanism. It is known for several years, that 80% of the OSN depolarization is due to a chloride efflux (Lowe and Gold, 1993; Reisert et al., 2003) but the responsible ion transporter remains unknown. Therefore, the RNA-Seq data were first screened for ion transporter expression. 293 Slc-transporter were obtained by RNA-Seq experiments whereby 19 transporters demonstrated significant changes in expression. Moreover, NKCC1 was the 19th highest expressed Slc-transporter (Attachment Figure 34). Further analysis focused on the expression level of several chloride-related ion transporters that have a FPKM > 1 in wild type mice and have been previously described in literature (Nickell et al., 2007) (Figure 13).

Figure 13: RNA-Seq results for putative chloride-related and anion/cation organic transporters and channels of the olfactory epithelium with FPKM average > 1. Transporter subfamilies: Slc4 and Slc26 belong to anion exchangers, Slc6: sodium-/chloride-dependent neurotransmitter symporter and amino acids, Slc12: electroneutral, cation-coupled cotransporters, Slc14/Slc22: organic anion/cation transporters. (n=3) (Haering et al., 2015).

15 Slc-transporters were identified (Figure 13) whereby nine showed a low expression profile in wild type (FPKM: 1-10), four displayed medium expression (FPKM: 10-50) and two demonstrated high expression (FPKM>50). The RNA-Seq results revealed high

Results

numbers of mRNA transcripts of the Slc6a6 transporter in wild type (FPKM 85.2) and NKCC1-deficient OE (84.6). The Slc12a2 gene, which encodes the protein NKCC1, displayed the second highest FPKM in wild type OE (FPKM 50.7). NKCC1 mRNA was also detected in knockout mouse OE due to the nature of the mouse. The neomycin cassette was inserted into exon 6 of the NKCC1 gene to disrupt the reading frame. This insertion does not inhibit the transcription of the NKCC1 gene (Figure 14), but leads to a nonfunctional protein which is rapidly degraded in the cells (Figure 10 A).

Figure 14: Read coverage detected in RNA-Seq experiments. Examples for mapped reads to exon 6 of the NKCC1 gene in NKCC1+/+ and NKCC1-/- OE transcriptomes. Read coverage demonstrated less reads in case of NKCC1-/- mice and partial coverage.

RNA-Seq analysis revealed a FPKM value of 20.7 for the NKCC1 gene in deficient mice and a doubled value (50.7) for wild type (Figure 13). Figure 13 additionally illustrates RNA-Seq data from heterozygous OMP (olfactory marker protein) fluorescence-activated cell sorting (FACS)-sorted OSNs (Kanageswaran et al., 2015) enabling a comparison of 47

Results

these data with the results of OE tissue from wild type and NKCC1-deficient mice. Interestingly, in FACS-sorted OMP+/- neurons (Potter et al., 2001) NKCC1 displayed the highest FPKM (188.0) followed by the FPKM value (71.9) of the taurin transporter Slc6a6 (Kanageswaran et al., 2015). The third highest expressed chloride related-transporter was the Slc26a7 anion exchanger. This transporter is constantly expressed with an average FPKM of 26 in the transcriptomes. A slightly lower FPKM value was demonstrated for the Slc4a2 anion exchanger in OE of NKCC1-deficient (25.9) and wild type mice (19.7). The cation-coupled cotransporter members 6 and 7 (Slc12a6 and Slc-12a7) demonstrated identical expression in both wild type and NKCC1-deficient OE. The protein Slc12a9, also known as the cation-chloride cotransporter interacting protein 1 (CIP1) (Caron et al., 2000), displayed nearly identical expression in wild type (7.6) and NKCC1-deficient (7.9) transcriptomes while displaying a higher expression (12.8) in OMP+/- neurons. Electroneutral potassium-chloride cotransporter 1 (KCC1) was detected in OE of both NKCC1+/+ and NKCC1-/- mice whereas it was not found to be expressed in neurons. The widely expressed Slc12a8 gene codes for the second CIP transporter which transport function remains elusive (Hebert et al., 2004). Here, Slc12a8 showed an overall low expression profile in each condition. Beside this, RNA-Seq data for the first time revealed the presence of the Slc26a11 mRNA in OE and OMP+/- OSNs. Heterological expression in HEK293 cells indicated a chloride channel function of the prominently brain expressed Slc26a11 transporter (Rahmati et al., 2013). The anion exchanger Slc4a3 (Morgans and Kopito, 1993), was detected in OE (both transcriptomes ~1.7) and OMP+/- OSNs (3.3) with low FPKM values. Moreover, the neuron specific potassium-chloride Slc12a5 cotransporter showed a slight but significant expression decrease in NKCC1-deficient mice OE. The function of this transporter remains ambivalent because of either an efflux or influx mechanisms depending on the chemical concentration gradients of potassium and chloride (Payne et al., 2003). In the CNS Slc12a5 expression is up-regulated during maturation of neurons and consequently lowers the chloride concentration in these cells (Gulyas et al., 2001). The transporters Slc26a9, Slc26a6 and Slc4a1 were detected in low amounts in the OE of both wild type and NKCC1-deficient mice while no expression was demonstrated in the OMP+/- neurons. In general, the expression profiles of chloride-related ion transporters monitored in OMP+/- neurons (Potter et al., 2001) were comparable to the transporter expression ranking found in both OE samples. 48

Results

4.4.3 RNA-Seq: Expression analysis of olfactory signal transduction proteins and adaptation-related proteins Mature olfactory neurons play a major role in odorant recognition due to their ability to convert chemical signals into an electrical cell response (Buck and Axel, 1991). Therefore, OSN exhibit a large set of different proteins involved in signal transduction, thus in odorant detection (Su et al., 2009). ORs play a key role in odorant detection whereby the following proteins, e.g. G protein and adenylyl cyclase III, enhance the signal (Bakalyar and Reed, 1990; Jones and Reed, 1989; Lowe et al., 1989). The involvements of cyclic nucleotide-gated (CNG) channels and chloride channels ultimately convert the chemical signal in an electrical response (Lowe and Gold, 1993). Due to the importance of all these signal transduction-related proteins, the RNA-Seq data were analyzed focusing on these genes (Figure 15). Interestingly, RNA-Seq data revealed that signal transduction-related transcripts decreased in the OE of NKCC1-deficient mice. Significant reduction in mRNA expression level was detected for the cyclic nucleotide-gated channel subunit alpha 4 (Cnga4) (NKCC1+/+/NKCC1-/- FPKM: 155.3/75), the chloride channel anoctamin 2 (Ano2) (78.3/44) and the phosphodiesterase 1C (PDE1C) (73.6/40.5). Beside signal transduction related proteins, the olfactory marker protein also demonstrated a reduction in FPKM values (2850.6/1658.3) for NKCC1-deficient mice. In summary, the OE transcriptome of NKCC1-deficient mice revealed nearly half the transcript number of signal transduction- related genes compared to their wild type littermates.

Results

Figure 15: RNA-Seq analysis of olfactory signal transduction and adaptation-associated proteins. Comparison of FPKM values found in both NKCC1+/+ and NKCC1-/- mice. Omp: olfactory marker protein, Gnal: α-subjunit of the olfactory G protein, Adcy3: adenylyl cyclase 3, Cnga2: cyclic nucleotide-gated channel alpha 2, Cnga4: cyclic nucleotide-gated channel alpha 4, Ano2: anoctamin 2, Calm1-3: calmodulin isoforms 1-3, Pde1c: phosphodiesterase 1C. (n=3; *: P<0.05, **: P<0.01) (Haering et al., 2015).

4.4.4 RNA-Seq: Expression analysis of olfactory receptors

OSNs are characterized by their chloride accumulation ability and a dominant expression of mainly one odorant specific G protein-coupled receptor, a so-called olfactory receptor (OR) (Buck and Axel, 1991). To date, ~900 OR genes have been found to have an open readingframe in mice (Buck and Axel, 1991; DeMaria and Ngai, 2010; Glusman et al., 2001; Godfrey et al., 2004; Mombaerts, 2004b; Niimura and Nei, 2007). ORs form the first interface for odorant detection, namely the binding surface for specific odorants (Jones and Reed, 1989). Therefore, RNA-Seq data were analyzed focusing on OR distribution and the amount in NKCC1-deficient OE compared to wild type. RNA-Seq detected the expression of nearly all ORs and OR pseudogenes (NKCC1+/+/NKCC1-/-: 1060/1040, FPKM>0.1) in both transcriptomes (Figure 16 A). The summation of all FPKM values annotated for ORs of each condition (NKCC1+/+/NKCC1-/-) revealed a summed FPKM value of 3766 for wild type and 2131 for NKCC1-deficient mice. The calculated medians were 2.1 for NKCC1+/+ and 1.1 for NKCC1-/- mice (Figure 16 B). In addition, the distribution of FPKM values for ORs detected in NKCC1-/- was lower compared to wild type mice, which is also illustrated by Figure 16. The highest expressed ORs was Olfr533 (NKCC1+/+/NKCC1-/-: 86.9/31.9) in

Results

both conditions (Figure 17). Furthermore, the calculated median was lower for NKCC1-deficient mice (NKCC1+/+/NKCC1-/-: 2.1/1.1) (Figure 16 B).

Figure 16: Expression analysis of NKCC1+/+ and NKCC1-/- mice olfactory receptors. A) Number of olfactory receptors detected in three different RNA-Seq experiments (FPKM>0.1) and FPKM summation of olfactory receptors of NKCC1+/+ and NKCC1-/- mice mice. B) Comparison of FPKM values of ORs. The values of median, upper and lower quartile are indicated in each box. ORs in wild type are expressed at higher levels compared to NKCC1-/- mice (Haering et al., 2015).

To visualize the FPKM distribution regarding the ORs, the FPKM values for ORs (FPKM>10) in wild type were compared to FPKM values for NKCC1-deficient mice (Figure 17). Approximately 80% of the ORs annotated in wild type data set demonstrated higher FPKM values compared to NKCC1-deficient data set.

Results

Figure 17: Expression profile of ORs in NKCC1+/+ and NKCC1-/- mice. Comparison of FPKM values of ORs detected in OE of NKCC1+/+ and NKCC1-/- mice (FPKM>10) (n=3) (Haering et al., 2015).

Cuffdiff analysis enables investigation of differentially expressed genes in the knockout OE compared with wild type OE. 14% (149 ORs) of the ORs found in wild type OE were significantly higher expressed (P<0.05) compared to NKCC1-deficient littermates (Figure

18 A, left panel). Additionally, 16% of all ORs demonstrated more than a 3-fold higher FPKM value, and 44% of ORs had a 2-fold higher FPKM value in wild type OE (Figure 18 A, right panel). In contrast, 19.3% of the annotated ORs in wild type OE displayed higher FPKM values in the NKCC1-deficient transcriptome. Two ORs showed a significantly higher expression (Olfr711 and Olfr513, P<0.05) in NKCC1-/- (Figure 18 B, left panel). Beside this, approximately 4% of ORs demonstrated a 2-fold higher FPKM whereby 1% exhibited a 3-fold higher FPKM value compared to wild type OE.

Results

Figure 18: Percentage of differentially expressed ORs. A) Percentages of ORs detected in NKCC1-/- OE that were expressed to a lower degree compared to NKCC1+/+ ORs. Left panel: Significantly lower expressed ORs in NKCC1-/- (*: P<0.05, **: P<0.01, ***: P<0.001), Right panel: comparison of ORs (except significantly expressed ORs) detected in NKCC1-/- mice with calculated log2(fold change) of -1 (doubled FPKM value) or -1.6 values (threefold higher FPKM values). B) Percentages of ORs detected in NKCC1-/- OE that were higher expressed compared to wild type ORs. Left panel: Significantly higher expressed ORs in NKCC1-/- (*: P<0.05, **: P<0.01, ***: P<0.001) Right panel: comparison of ORs detected in NKCC1-/- mice with calculated log2(fold change) of +1 (doubled FPKM value) or +1.6 values (threefold higher FPKM values) (n=3) modified to (Haering et al., 2015).

4.4.5 RNA-Seq: Expression analysis of significantly regulated genes

RNA-Seq data of NKCC1-deficient OE enables to study the influence of the NKCC1 protein absence on the transcriptome. Thus, transcriptome analysis reveals changes in gene expression, especially of olfaction-related proteins. Cuffdiff analysis additionally allows calculating significant (P ≤ 0.05, Q ≤ 0.05) changes in the expression of genes. In this study, the Cuffdiff analysis revealed six ORs which expressions are significantly reduced in NKCC1-deficient mice OE (Table 4). These ORs genes are randomly distributed on several chromosomes of mus musculus (Sullivan et al., 1996; Young et al., 2003; Zhang et al., 2004).

Results

Table 4: Cuffdiff analysis of RNA-Seq data. A) Genes with significantly lower FPKM values in NKCC1-/- mice B) and with higher FPKM values in NKCC1-/- mice compared to NKCC1+/+. Gene names highlighted in green indicate ORs, blue colors suggest different ion channels and the neuronal receptor PCDH10, red highlights transporter and orange indicates tight junction associated proteins (n=3).

Results

Focusing on ion-related proteins, two Slc-transporters, the urea transporter Slc14a2 (Fenton et al., 2002) and the sodium/potassium/calcium exchanger 2 (Slc24a2) (Li et al., 2002) showed reduced expression in NKCC1-deficient mice. The calcium-activated potassium channel (Kcnmb3) involved in neuronal excitability (Behrens et al., 2000; Hu et al., 2003) and a channel-associated protein (Dlg2) that acts as a scaffolding protein in neurons (Roberts et al., 2012) demonstrated increased expression in wild type OE. Additionally, the Dlg2 gene was reduced in NKCC1-deficient mice. This gene is known to be involved in mitotic cell organization in neuronal synapses in Drosophila melanogaster (Albertson and Doe, 2003; Goode and Perrimon, 1997).

Cuffdiff analysis also reveals genes with higher expression levels in knockout compared to wild type mice. A calcium-activated chloride channel (Clca2) (Piirsoo et al., 2009) exhibited a higher FPKM value in the NKCC1-deficient transcriptome. This chloride channel is expressed in a subset of OSNs and may play a role in odorant transduction in cilia (Gonzalez-Silva et al., 2013). Moreover, protocadherin 10 (Pcdh10), a protein with key roles in suppressing cell proliferation (Zhong et al., 2013), displayed a higher FPKM value in NKCC1-deficient mice. The transient receptor potential channel subfamily M member 5 (Trpm5) and two claudins (Cldn2, Cldn4) were higher expressed in OE lacking NKCC1. Trpm5 channels mediate pheromone transduction in the OE (Lopez et al., 2014), and claudins are tight junction components that maintain the cellular polarity (Morita et al., 1999). In summary, RNA-Seq identified several ion- and development-related genes with modified expression levels in NKCC1-deficient mice.

4.4.6 RT-PCR: Expression of chloride-associated cotransporters

To verify the RNA-Seq data, similar expression levels were obtained by RT-PCR regarding ion transporter expression (Figure 19 A) (Bouvain, 2014). The RT-PCR results confirmed that the taurin transporter TauT (Slc6a6) and NKCC1 (Slc12a2) were the most highly expressed in wild type and NKCC1-deficient olfactory epithelium. In order to analyze changes in transcription profiles, the expression of transporters in deficient mice was normalized to mRNA expression of wild type mice. Using this method, three Slc12 subfamily transporters (Slc12a2/5/9) were identified with significantly decreased 55

Results

expression in knockout OE (Figure 19 B). In contrast, no significant upregulation of any transporter transcripts in NKCC1-deficient mice was detected.

Figure 19: Transcription level of chloride-related ion transporters. A) ΔCT values of ion transporters of olfactory epithelium. Values are normalized to -actin expression. B) Relative mRNA transcription level of transporters found in NKCC1-/- OE compared to NKCC1+/+ (100%, indicated by red-dotted line). Slc12a2 corresponds to NKCC1. (n=3; *: P<0.05, **: P<0.01) (Haering et al., 2015).

4.4.7 RT-PCR: Expression of signal transduction proteins and adaptation- related proteins

As indicated by the RNA-Seq data, olfactory signaling-related proteins showed a decreased expression in NKCC1-deficient mice. RT-PCR experiments were performed to confirm 56

Results

these reductions in expression levels. All tested signaling-involved proteins demonstrated a decrease in expression compared to wild type mice (Figure 20). Moreover, the adenylyl cyclase (Adycy3), the subunits of the cyclic nucleotide-gated channel alpha 2 and 4 (Cnga2, Cnga4), calmodulin isoforms 1 and 3 (Calm1, Calm3) and the chloride channel anoctamin 2 (Ano2) showed significant reduction in expression.

Figure 20: Relative transcription level of olfactory signal protein components obtained via RT-PCR. Percentage of proteins amounts detected in NKCC1-/- mice normalized to NKCC1+/+ transcription level (100%). Gnal: α-subjunit of the olfactory G protein, Adcy3: adenylyl cyclase 3, Cnga2: cyclic nucleotide-gated channel alpha 2, Cnga4: cyclic nucleotide-gated channel alpha 4, Calm1-3: calmodulin isoforms 1-3, Ano2: anoctamin 2. (n=3; *: P<0.05, **: P<0.01, ***: P<0.001) (Haering et al., 2015).

4.4.8 RT-PCR: Expression of olfactory receptors

Additionally, the expression of two ORs was analyzed by RT-PCR (Figure 21). Both ORs demonstrated reduced expression (35% and 51%) compared to wild type mice (100%) whereby Olfr1303 showed a significant decrease.

Results

Figure 21: Expression analysis of two ORs via RT-PCR. Olfr1303 (n=4) and Olfr332 (n=5) expression in NKCC1-/- OE compared to NKCC1+/+ OE (100%) (*: P<0.05) (Haering et al., 2015).

4.5 Protein expression analysis of the olfactory epithelium of NKCC1+/+ and NKCC1-/- mice

4.5.1 Protein expression analysis of signal transduction proteins and adaptation-related proteins

While RNA-Seq and RT-PCR data indicate a decrease in mRNA expression of olfactory signal transduction proteins and ORs, protein expression was not yet determined in NKCC1-deficient mice compared with wild type mice. The presence of the α subunit of the olfactory G protein (Gαolf), adenyly cyclase (ACIII), the nucleotide-gated channel subunit alpha 2 (CNGA2) and acetylated tubuline were confirmed in NKCC1-/- mice via immunohistological staining of OE cryosections (Figure 11). These proteins involved in the signal transduction pathway were located in the cilia of OSNs in both OEs of NKCC1+/+ and NKCC-/- mice. The immunohistological method did not provide information about the whole protein content, thus this methods impairs the comparison of protein expressions. In order to characterize the protein expression of transduction-related proteins, western blot anaysis was performed. Therefore, OE lysates of NKCC1+/+ and NKCC1-/- mice were preparated and analyzed via western blot (Figure 22). Western blot analysis is a common method to analyze the protein content of a distinct tissue and were used for seveal decades in biochemistry (Renart et al., 1979).

Results

Figure 22: Western blot analysis of olfactory signal transduction proteins. Comparison of protein amounts in pooled mixed-gender OE lysates of NKCC1+/+ and NKCC1-/- mice. Asterisks indicate protein bands corresponding to expected protein sizes. Gαolf: olfactory G protein (45 kDa), ACIII: adenylyl cyclase III (130 kDa), CNGA4: cyclic nucleotide- gated channel subunit alpha 4 (66 kDa), CaM: calmodulin (17 kDa), PDE1C: phosphodiesterase 1C (81 kDa) and Actin: -actin (43 kDa) in pooled OE lysates of NKCC1-/- and NKCC1+/+ mice (n=3).

The results indicate a reduced protein expression for the olfactory Gα protein, the adenylyl cyclase (ACIII), the cyclic nucleotide-gated channel subunit alpha 4 (CNGA4), calmodulin (CaM) and the phosphodiesterase 1C (PDE1C). Western blotting showed rather the same expression of Actin in wild type and NKCC1-deficient mice samples.

4.5.2 Protein expression analysis of a ciliary protein and development- related proteins

Beside the protein expression analysis of signal transduction proteins, both ciliary and neurogenesis-related protein amount were characterized. First, the protein expression of a ciliary protein, the acetylated tubulin, was demonstrated to be decreased in NKCC1-deficient mice (Figure 23). Additionally, the neuronal migration protein doublecortin (Gleeson et al., 1998), a marker protein for progenitors and immature neurons, showed a clearly reduced protein expression level compared to wild type mice, whilst the transcription factor Pax7 of the paired box (PAX) family (Basch et al., 2006) demonstrated a slightly higher expression in deficient mice OE samples. The progenitor cell related achaete-scute family BHLH transcription factor 1 (Ball et al., 1993) displayed the same expression in both samples. The housekeeping protein Actin was also detected in the same amount in both OE lysates.

Results

Figure 23: Western blot analysis of a ciliary protein and development-related proteins. Comparison of protein amounts in pooled mixed-gender OE lysates of NKCC1+/+ and NKCC1-/- mice. Asterisks indicate protein bands corresponding to expected protein sizes. Acet. tubuline: the acetylated ciliary tubulin, ASCL1: Achaete-scute family BHLH transcription factor 1, Pax7: paired box 7 protein belonging to a family of transcription factors, DCX: doublecortin and Actin: -actin in pooled OE lysates of NKCC1-/- and NKCC1+/+ mice (n=3).

4.6 Doublecortin expression in the murine olfactory epithelium of a DCX-promo-EGFP transgenic mouse

Western blot analysis indicated a decreased protein amount of doublecortin in NKCC1-deficient mice (Figure 23). Doublecortin is a microtubule-associated protein specifically expressed in neuronal progenitors of the developing and adult central nervous system (Karl et al., 2005). Therefore, it is commonly employed as a marker protein for neurogenesis in the brain (Couillard-Despres et al., 2005) and OE (Benardais et al., 2010; Reiner et al., 2006). In this study, OE cryosections of DCX-promo-EGFP transgenic mice were produced and imaged using a confocal microscope (Couillard-Despres et al., 2006) (Figure 24).

Results

Figure 24: Sagittal cryosections of DCX-promo-EGFP transgenic mice. Pictures were taken from the OE-arch of the nasal cavity of a 5-day old mouse (P5) and an adult mouse (n=1, scale bar 50 µm).

This transgenic mouse expresses the enhanced green fluorescent protein in cells also expressing doublecortin (DCX). The cryosection of juvenile mice (P5, 5 days after birth) demonstrated a high DCX content in OSN compared to adult mice, thus confirming the decreasing neurogenesis mechanism during aging. Moreover, expression of DCX was predominantly found in immature neurons which displayed starting knob formation. Unfortunately, immunohistological experiments using several different DCX antibodies failed to specifically stain immature neurons of wild type or NKCC1-deficient OE cryosections.

4.7 Electro-olfactogram recordings

The ancient electro-olfactogram (EOG) was established by Ottoson in 1956 during his studies of frog and rabbit OEs (Ottoson, 1955). Since then, this method is widely used to characterize odorant-evoked responses in vertebrates. This method primarily visualizes the summed generator potentials caused by individual responsive OSNs in the recording field (Cygnar et al., 2010; Ottoson and Shepherd, 1967; Scott and Scott-Johnson, 2002). In order to characterize the impact of the ion transporter NKCC1 in olfaction, several air-phase and submerged electro-olfactogram recordings were performed.

Results

4.7.1 Air-phase EOG recordings of NKCC1+/+ and NKCC1-/- mice: Odorant concentration dependency

First, electro-olfactogram recordings were performed with dilutions of an odorant mixture containing 100 different odorants (Henkel100). This odorant mixture allows for the stimulation of a great variety of OSNs (Spehr et al., 2002).The results showed that for all tested dilutions, wild type mice OE displayed significantly higher amplitudes than NKCC1-/- mice except for the highest dilution tested (1:100,000) (Figure 25 A). The relative amplitudes demonstrated that wild type mice and NKCC1-deficient mice exhibit approximately equal percentage of the maximum response at the same Henkel100 concentration (Figure 25 B). This experiment also indicated that the half maximal effective concentration for both genotypes is reached at a dilution of 1:1000 (~5 mM). Therefore, this Henkel100 dilution was used in subsequent air-phase electro-olfactogram experiments.

Figure 25: Air-phase EOG recordings of NKCC1+/+ and NKCC1-/- mice with different Henkel100 dilutions. A) Comparison of odorant-evoked amplitudes. B) Relative amplitudes for NKCC1-/- and NKCC1+/+ mice, amplitude generated with the lowest dilution of Henkel100 was normalized to 100%. (NKCC1+/+: n=10, NKCC1-/-: n=5; *: P<0.05, **: P<0.01) (Haering et al., 2015).

4.7.2 Air-phase EOG recording of NKCC1+/+, NKCC1+/- and NKCC1-/-mice

EOG recordings were performed using wild type, heterozygous and NKCC1-deficient mice. In order to quantify the odorant-evoked responses and desensitization mechanism, multiple experiments were analyzed regarding the amplitude, rise and decay time of 62

Results

responses and the area under the curve. The average EOG amplitude in wild type mice was -12.19 ±1.1 mV, whilst the average amplitude in NKCC1-/- mice was -3.04 ±0.71 mV, which is a highly significant reduction (75%, P<0.001) (Figure 26 A and E). Moreover, the EOG of heterozygous mice demonstrated a slight (~ 18%) but not significant reduction in amplitude (-9.95 ±1.12 mV, n=15 mice) compared with wild type. The relative rise time was fitted and calculated for each odor response, and it was prolonged in NKCC1-/- mice (Figure 26 B). The NKCC1-deficient mice also demonstrated a significant increase (~162%, P<0.01) in the relative decay time (Figure 26 C). Due to the decreased amplitude, the area under the EOG trace was reduced by approximately 66% (P<0.001) in NKCC1-deficient mice (Figure 26 D).

Figure 26: Air-phase EOG recording analysis of Henkel100-induced amplitudes in NKCC1+/+, NKCC1+/- and NKCC1-/- mice. A) Normalized amplitude of the measured summed surface potential, B) Normalized rise time, C) Normalized decay time, D) Normalized area under curve, all normalized to NKCC1+/+ mice (100%), E) Representative EOG traces of NKCC1+/+, NKCC1-/* and NKCC1-/- mice. Arrows indicate 100 ms Henkel100 application. NKCC1+/+ (n=18), NKCC1+/- (n=15) and NKCC1-/- mice (n=16), except for relative rise time (n=15;*: P<0.05, **: P<0.01, ***: P<0.001) (Haering et al., 2015).

Results

4.7.3 Air-phase EOG recording of NKCC1+/+ and NKCC1-/- mice: Henkel100 versus 10 odorants mixture

In order to analyze the odorant mixture-evoked amplitudes of wild type and NKCC1- deficient mice, EOG recordings using Henkel100 were compared with measurements applying a mixture of ten odorants (Figure 27 A). In general, the amplitudes generated by Henkel100 application in OE of NKCC1-deficient mice were significantly decreased (54%) compared to wild type mice (100%) (Figure 27 A and B). Application of the ten odorants mixture ultimately induced smaller amplitudes in both NKCC1+/+ (amplitude reduction: 43%) and NKCC1-/- mice (55%).

Figure 27: Comparison of air-phase EOG recordings of Henkel100 and 10 odorants mixture induced amplitudes in NKCC1+/+ and NKCC1-/- mice. A) Odorant mixture evoked amplitudes of NKCC1+/+ and NKCC1-/- mice and B) Relative amplitudes each normalized to NKCC1+/+ responses (100%). (NKCC1+/+: n=10, NKCC1-/-: n=5; *: P<0.05).

4.7.5 Air-phase electro-olfactogram of NKCC1+/+ and NKCC1-/- mice: Repetitive stimulation with Henkel100

The characterization of the odorant-evoked responses in wild type, heterozygous and NKCC1-deficient mice revealed a significant increase of the relative decay time in deficient mice. To analyze the desensitization mechanism in these mice, repetitive responses were induced using 6 s-long odorant impuls intervals (Figure 28). Once again, NKCC1-deficient mice demonstrated decreases in amplitudes (50-54%) compared to wild type (100%) (Figure 28 A). Focussing on the relative amplitudes, almost equal amplitudes were displayed for both mice populations and same stimuli (Figure 28 B). 64

Results

Figure 28: Air-phase EOG recordings of repetitive stimuli. A) EOG amplitudes of NKCC1-/- and NKCC1+/+ mice and B) Relative amplitudes (regarding first stimulus) induced by Henkel100 application. Odorant impulse: 100 ms, stimulus interval: 6 s (NKCC1+/+: n=5, NKCC1-/-: n=10; *: P<0.05).

4.7.6 Submerged EOG recordings of NKCC1+/+ and NKCC1-/- mice: Calcium-activated chloride channel inhibition with niflumic acid and tannic acid

After characterizing the odorant-evoked responses in NKCC1-deficient mice, the nature or ion composition of the response remains still unclear. It was hypothesized that NKCC1-deficient mice have defects in chloride accumulation of OSNs, leading to a diminished depolarisation and thus in a decreased EOG signal. Due to this, the EOG response may consist primarily of the calcium and sodium influx. To analyze the composition of the EOG response, complementary submerged EOG experiments were performed. The use of submerged EOG enabled the application of inhibitors of calcium- activated chloride channels. First, two different inhibitors, niflumic acid (Lerma and Martin del Rio, 1992) and tannic acid (Kucherenko et al., 2013), were tested (Figure 29 A and B).

Results

Figure 29: Submerged EOG recordings of wild type OE using chloride channel inhibitors. A) Example traces for Henkel100 induced amplitudes. Left trace panel: Incubation of niflumic acid (NFA), Right trace panel: Incubation of tannic acid (TA). B) Generated amplitudes before and after inhibitor incubation and after washout with Ringer solution. C) Relative amplitudes induced by Henkel100 application are normalized to first amplitude (100%). (n=1).

Incubation of niflumic acid resulted in a ~50% reduction of the Henkel100-induced response which was reversible after 5 min Ringer solution application (Figure 29 C). In contrast, the same concentration of tannic acid and equal incubation resulted in a ~68% decrease in amplitude with no washout opportunity. Due to this, inhibitor experiments were performed with niflumic acid to enable multiple experiments and to guarantee vitality of OSN during EOG recordings.

4.7.7 Submerged electro-olfactogram of NKCC1+/+ and NKCC1-/- mice: Calcium-activated chloride channel inhibition with niflumic acid

EOG amplitudes were significantly reduced (~85%) in NKCC1-deficient mice compared to wild type mice (Figure 30 A and C) as indicated by the representative traces for the generated surface potentials. In inhibitor experiments, 50% of the amplitude was inhibited

Results

using niflumic acid, a calcium-activated chloride channel inhibitor but subsequent washout with Ringer solution receive an approximately 80% signal recovery (Figure 30 C). Interestingly, niflumic acid had the same effect on NKCC1-deficient and wild type OE.

Figure 30: Submerged electro-olfactogram recordings of NKCC1+/+, NKCC1+/- and NKCC1-/- mice using niflumic acid. A) Exemplary traces of surface potentials after Henkel100 exposure with and without niflumic acid incubation and washout procedure for NKCC1+/+ (n=7) and NKCC1-/- (n=5) mice, B) Quantification of mean amplitudes displayed as absolute potentials (mV) and C) Relative potentials (%) normalized to initial amplitude (100%). (*: P<0.05, ***: P<0.001) (Haering et al., 2015).

4.8 Morphological changes of the olfactory epithelium in NKCC1-/- mice

The absence of the ion transporter NKCC1 results in some apparent defects in mice, e.g. growth retardation, higher risk of death during weaning and difficulties in maintaining the balance (Flagella et al., 1999). Beside this, NKCC1 is known to play a role in brain plasticity and to function in homeostasis of diverse cell types (Ikeda et al., 2003). Therefore, changes in NKCC1-/- OE morphology came into focus of this study.

Results

4.8.1 Measurements of turbinate lengths of NKCC1+/+ and NKCC1-/- mice

First, the length of the turbinates was measured and normalized to the size of the mouse nasal cavity. No significant length difference was found between wild type and NKCC1-deficient mice (Figure 31).

Figure 31: Normalized length of turbinates of NKCC1+/+ and NKCC1-/- mice. The length of turbinates was measured from the ethmoid bone to the end of turbinate I and normalized to the distance between olfactory bulb and tip of the nose (NKCC1+/+: n=7, NKCC1-/-: n=9).

4.8.2 Measurements of the olfactory neuronal layer thickness of NKCC1+/+, NKCC1+/- and NKCC1-/- mice

Nevertheless, morphological changes of OE lacking NKCC1 were also analyzed. To visualize changes of the OE, hematoxylin/eosin stainings of coronal cryosections were prepared of wild type, heterozygous and NKCC1-deficient mice. The neuronal layer thickness of the OE was measured and analyzed. A significant decrease (20%) in neuronal layer thickness was calculated for NKCC1-deficient mice (Figure 32). Heterozygous OE also showed a slight decrease (10%) in neuronal layer thickness.

Results

Figure 32: Morphological changes of the OE of NKCC1+/+, NKCC1+/- and NKCC1-/- mice. Olfactory neuronal layer thickness is decreased in NKCC1+/- and NKCC1-/- mice compared to NKCC1+/+ mice (100%). (NKCC1+/+: n= 10, NKCC1+/-: n=13, NKCC1-/-: n= 10; *: P<0.05, **: P<0.01; Scale bar 50 µm) (Haering et al., 2015).

4.8.3 Differences of the cell number in the olfactory epithelium of NKCC1+/+, NKCC1+/- and NKCC1-/- mice

As indicated by the hematoxylin/eosin staining, NKCC1-deficient mice exhibit significant reduction in the neuronal layer thickness (Figure 32). This reduction might be due to changes of the morphology of the OSN or a decreased number of OSN in NKCC1- deficient mice. Therefore, an additional DAPI staining of OE cryosections was performed.

This method enabled visualization and counting of all cells in the neuronal layer (Figure

33). Analyses of wild type, heterozygous and NKCC1-deficient cryosections revealed ~20% fewer cells in NKCC1-deficient OE compared to wild type OE. There was no significant difference in cell number between wild type and heterozygous OE.

Results

Figure 33: Analysis of the cell number in the OE of NKCC1+/+, NKCC1+/- and NKCC1-/- mice. The cell number is decreased in NKCC1+/- and NKCC1-/- compared to NKCC1+/+ (100%). Cell number was normalized to analyzed OE area (NKCC1+/+: n= 10, NKCC1+/-: n=11, NKCC1-/-: n= 12; *: P<0.05; Scale bar 50 µm) (Haering et al., 2015).

Discussion

5. Discussion

5.1 Localization of NKCC1 in the murine olfactory epithelium

This study aims to clarify the influence of NKCC1 absence in olfaction and thus uncover its function in OSNs. In order to study the lack of NKCC1, experiments were accomplished using a NKCC1 knockout mouse model (Flagella et al., 1999). First, the absence of NKCC1 protein in OE of NKCC1-deficient mice was confirmed by western blot experiments (Section 4.2). In general, the role of NKCC1 in OSN gave rise to a number of debates due to contoverse results using different experimental approaches (Nickell et al., 2006; Nickell et al., 2007; Reisert et al., 2005; Smith et al., 2008a). Furthermore, even the localization of NKCC1 in OSN remains obscure. Two possible localizations were described in literature, at the soma- and dendrolateral membrane (Reisert et al., 2005) and the ciliary membrane of OSNs (Hengl et al., 2010). In fact, these expression sites imply different functions of NKCC1 in the olfactory protein assembly. The dendrolateral membrane as expression site for NKCC1 would indicate an overall function of this ion transporter, e.g. cell-volume regulation (Bush et al., 2010; Jiang et al., 2001), whilst a ciliary localization would suggest an involvement of NKCC1 in the olfactory signal transduction pathway. It is known that OSNs actively accumulate chloride ions and that the chloride concentration is higher in the cilia and declining in dendrites and soma of OSNs (Hengl et al., 2010; Kaneko et al., 2001; Kaneko et al., 2004). Therefore, it is of enormous interest to identify the localization of NKCC1 in OSN. In this study, western blot analysis was performed to clarify localization of the ion transporter. The antibody specificity was tested using OE lysate of wild type and NKCC1-deficient mice (Figure 10 A). A single protein band was identified in the wild type sample which showed a protein size above 250 kDa. NKCC1 is described to have a molecular weight of 135- 170 kDa depending on the glycosylation and phosphorylation status of the protein (Smith et al., 2008b; Zhang et al., 2006). NKCC1 also appears to form homodimers (Moore-Hoon and Turner, 2000) via a conserved domain located at its C-terminus (Simard et al., 2004). For this reason, the used antibody in this study specifically detected NKCC1 homodimers. To reveal the localization of NKCC1 in OSNs, a cilia-enriched fraction was prepared and subsequently analyzed via western blot (Figure 10 B). The detection of actin in both

Discussion

samples indicated a uniform protein distribution, so that both contained nearly identical amounts of proteins. In addition, acetylated α tubulin is mainly found to be expressed in cilia (Piperno et al., 1987). Western blot analysis displayed a high amount of tubulin in the cilia-enriched fraction thus confirming the method. NKCC1 was found to be exclusively expressed in the cilia-enriched fraction. It might be that small NKCC1 protein amounts are still present in the remaining OE-fraction, but western blot analysis was not sensitive enough to detect them. In summary, NKCC1 is incorporated in the cilia membrane. It transports ions into the cilia and thus might drastically modulate the ion concentration in OSNs resulting in an indirect impact on the olfactory signal transduction pathway.

5.2 Localization of olfactory signal transduction proteins in the murine olfactory epthelium

The overall absence of the ion transporter NKCC1 leads to a high diversity of impairments in mice (Flagella et al., 1999). Retardation in growth, higher risk of death during weaning, a decreased blood pressure and difficulties in maintaining the balance are some known defects (Flagella et al., 1999; Meyer et al., 2002). Further immunohistological approaches were performed to analyze the presence and correct localization of signal transduction- related proteins in NKCC1-deficient mice (Figure 11 A). These experiments confirmed the presence of the α subunit of olfactory G protein, the adenylyl cyclase and the cyclic nucleotide gated channel alpha2 in NKCC1-/- mice. In addition, the control experiments (Figure 11 B) approved the ciliary localization of these proteins and for the first time indicating that the olfactory signal pathway remains intact in NKCC1-deficient mice.

5.3 Transcriptome analysis of the olfactory epithelium of NKCC1+/+ and NKCC1-/- mice

The RNA-Seq experiments enabled the quantitative characterization of the whole transcriptome of NKCC1-deficient mice compared to wild type littermates. In this study

Discussion

three independent RNA-Seq experiments were executed, one sample of mixed gender and two additional samples of male only and female only. The analysis of housekeeping genes demonstrated a uniform expression pattern of these genes (Figure 12 B) facilitating analysis of three biological replicates. In general, this study did not find any significant differences in mRNA expression between male and female OE transcriptomes, so that further analysis refers gene expression differences between NKCC1-deficient and wild type mice. Therefore, the three raw datasets of each condition were collectively analyzed and evaluated using Cuffdiff (Trapnell et al., 2012).

5.3.1 Expression analysis of chloride-associated cotransporters

The RNA-Seq analysis of the transcriptome of murine OE revealed 293 annotated Slc- transporter whereby 19 transporters demonstrated significant changes in expression in the NKCC1-deficient mice (attachment: Figure 34). Interestingly, the NKCC1 transporter (Slc12a2) is the 19th highest expressed Slc-tranporter in the murine OE. Focusing on chloride-related transporters, RNA-Seq data revealed 15 Slc-transporter with weak (~1) to moderate (~50) FPKM values compared to housekeeping genes whereby NKCC1 showed the second highest expression (Figure 13). A high number of mRNA transcripts were demonstrated for a Na+- and Cl--dependent taurin transporter (Slc6a6) in both wild type and NKCC1-deficient mice. FACS-sorted data revealed that this transporter might be mainly expressed in OSNs. Slc6a6 is a neurotransmitter transporter which either carries -amino acids or taurine to the neuronal apical membrane. Chloride ions are essential for optimal taurin uptake by the transporter so that the protein imports chloride ions into the cells. But this chloride influx is coupled to an efflux mediated by another transporter such that the net stoichiometry is 1 Taurin: 2 Na+ ions (Bicho and Grewer, 2005; Loo et al., 2000; Ramamoorthy et al., 1994). Moreover, RNA-Seq data from isolated OMP+/- neurons displayed decreased Slc6a6 mRNA transcript levels compared with the whole OE (Kanageswaran et al., 2015). This implies that the taurin transporter is predominantly expressed in other OE cell types than neurons. Thus, the involvement of Slc6a6 in olfactory neuron chloride accumulation is unlikely.

Discussion

The electroneutral chloride transporter NKCC1 was the second highest expressed chloride-related Slc-transporter in OE and the highest in FACS-sorted OSN (Kanageswaran et al., 2015). The high expression of NKCC1 in murine OE and especially in OSNs suggested an important role of this ion transporter in chloride accumulation. These results might additionally explain the controversial results found in the comparison of EOG recordings of intact OE, in which NKCC1 seemed to have only little impact on chloride accumulation, and isolated neurons, in which NKCC1 appeared to be necessary (Nickell et al., 2006; Nickell et al., 2007; Reisert et al., 2005). It was shown that NKCC1 exhibit a dominant role in isolated OSN in suction-pipette experiments (Reisert et al., 2005) which might be due to the fact that NKCC1 is the highest expressed chloride-related ion transporter in OSNs. RT-PCR experiments confirmed the outstanding expression rate of NKCC1 (Slc12a2) and the taurin transporter (Slc6a6) in the OE of wild type and NKCC1-deficient mice (Figure 19). The high expression of NKCC1 in the knockout mice might be explained by the nature of these mice. The NKCC1 reading frame is destroyed by insertion of neomycin in exon 6 which is transcripted by the RNA-polymerase (indicated by Figure 14). Flagella et al. demonstrated via northern blot a reduced amount of NKCC1 mRNA in heterozygous mice and the absence of NKCC1 mRNA in the knockout mouse (Flagella et al., 1999) in several tissues except OE. For the first time, NKCC1 mRNA presence was confirmed in tissue of NKCC1-deficient mice using the two sensitive cDNA- based methods, RNA-Seq and RT-PCR. These techniques rest upon cDNA which is more stable than RNA that is used in northern blot analysis (Streit et al., 2009). For the first time it was illustrated that further translational processing of the NKCC1 mRNA results in a non-functional protein that is rapidly degraded (Figure 10 A). The third highest expressed ion transporter in the OE was the DIDS-sensitive - - (4,4'-Diisothiocyano-β,β′-disulfonic acid disodium) Cl /HCO3 -exchanger Slc26a7. In this study, RT-PCR experiments showed a minor mRNA upregulation for this transporter in - - NKCC1-deficient mice. The Cl /HCO3 -exchanger is abundantly expressed in the kidney and could be found in the basolateral membrane of cells (Petrovic et al., 2003) where it accumulates chloride ions by its chloride ion exchanger ability (Kosiek et al., 2007; Petrovic et al., 2003). In contrast, when expressed in Xenopus laevis oocytes or HEK293 - - - cells, human SLC26A7 functions as a pHi-regulated Cl -channel with minimal OH /HCO3 permeability (Kim et al., 2005; Kim et al., 2014). Due to its controversial transport activities, its transport mechanism still remains unknown in OSNs. Nickell et al. also 74

Discussion

investigated the ion transporter repertoire of the murine OE transcriptome through RT- PCR experiments and suggested the involvement of both NKCC1 and one or more DIDS- sensitive transporters, such as Slc26a7, in the chloride accumulation of OSNs (Nickell et al., 2007). The second anion exchanger Slc4a2 (AE2) and fourth highest expressed transporter is a presumed chloride accumulator in olfactory neurons (Kurschat et al., 2008). Nonetheless, Nickell and coworkers previously determined the effect of AE2 protein loss on chloride accumulation of OSN (Nickell et al., 2007). The EOG experiments of an AE2 knockout mouse reported that the ion exchanger has no impact on chloride accumulation and therefore no effect on odorant detection. Here, the RNA-Seq data demonstrated a slightly higher FPKM value for Slc4a2 in the NKCC1-deficient transcriptome, whilst RT-PCR revealed that there was no significant increase in transcription of this chloride transporter gene. The potassium/chloride transporter member 6 and member 7, also known as KCC3 and KCC4, are integral membrane proteins that lower intracellular chloride concentrations by activation due to cell swelling (Karadsheh et al., 2004). Therefore, they do not contribute to chloride accumulation in OSN but are opponents in the mechanism of cell homeostasis. In RNA-Seq data both transporters demonstrated high expression in OE and even higher mRNA amounts in OMP+/- neurons indicating a prominent expression in OSNs. RT-PCR approaches additionally verify the uniform expression profile of these transporters in wild type and NKCC1-deficient OE. The protein Slc12a9, also known as the cation-chloride cotransporter interacting protein 1 (CIP1), was described to inhibit the activity of NKCC1 in X.leavis oocytes suggesting a modulating role of this protein (Caron et al., 2000). Till today, no physiological role has been ascribed for CIP1 in vivo (Gagnon and Delpire, 2013) so that it does not contribute to the high chloride concentration of OSNs. The transcriptome data suggest OSN being the favored expression site for Slc12a9 and RT-PCR experiments demonstrated a significant reduction of mRNA in NKCC1-deficient mice. The other highlighted chloride-related ion transporter demonstrated low expression in OE transcriptomes of wild type and NKCC1-deficient mice (Figure 13) indicating a low relevance in chloride accumulation of OSNs. In summary, NKCC1 is the highest expressed ion transporter implying a prominent if not comprehensive role of NKCC1 in chloride accumulation of OSN. 75

Discussion

5.3.2 Expression analysis of olfactory signal transduction proteins and adaptation-related proteins

After analysis of the expression profile of chloride-related ion transporter in NKCC1-deficient mice, wild type mice and FACS-sorted OMP+/- neurons, it was an obvious step to characterize other proteins involved in olfaction. First, signal transduction proteins came into focus. RNA-Seq analysis of wild type and NKCC1-deficient transcriptomes demonstrated a reduction in mRNA of signaling pathway-related genes (Figure 15). Cuffdiff analysis revealed a significant mRNA decrease of the cyclic nucleotide-gated channel subunit 4 (Cnga4), the chloride channel Ano2 and the phosphodiesterase 1C (Pde1c). These results implied a downregulation of gene transcription based on NKCC1 protein absence. But OMP also showed a reduced FPKM value indicating a reduced number of mature OSN in NKCC1-/- mice. RT-PCR experiment confirmed the expression reductions for Cnga4, Ano2 and Pde1 (Figure 20). Moreover, RT-PCR data showed a decreased expression for the adenylyl cyclase (Adcy3), the nucleotide-gated channel subunit 2 (Cnga2) and isoforms calmodulin 1 and 3. The α subunit of the olfactory G protein and the calmodulin isoforms 2 displayed no significant reduction, but mRNA content was decreased about ~50% (Gαolf) and ~30% (Calm2) compared to wild type transcriptome. The transcriptome analysis through RT-PCR revealed more significant decreases of mRNA than RNA-Seq experiments because it has a higher sensitivity and directly addresses the mRNA content of the gene of interest (Costa et al., 2013). By this point, it is not possible to explain the overall reduction of mRNA expression of signal transduction-related proteins in NKCC1-deficient mice, but further investigations of this study will elucidate these results.

5.3.3 Expression analysis of olfactory receptors

After the evidently mRNA expression reduction of signal transduction-related proteins and OMP as well, the expression of the ORs was characterized. The number of annotated ORs in both OE of NKCC1-deficient and wild type mice is nearly equal (Figure 16 A). But upon closer inspection of FPKM values, it became evident that ORs exhibited significantly less mRNA transcripts in NKCC1-deficient mice (Figure 17). In general, approximately 76

Discussion

80% of ORs found in wild type transcriptome showed a decreased FPKM value in NKCC1-deficient OE. Cuffdiff statistics additionally revealed that 14% of ORs in NKCC1 knockout mice displayed significantly reduced FPKM compared to wild type FPKM values (Figure 18 A). The log2(fold change) values further indicate that 44% of ORs detected in wild type OE exhibit at least a doubled FPKM. In contrast, 4% of the ORs showed at least doubled expression in OE of NKCC1-deficient mice whereby only 0.19% of OR FPKM values are significantly increased (Figure 18 B). The FPKM ratios of wild type and NKCC1-deficient mice for signal transduction-related mRNA (ratio NKCC1+/+/NKCC1-/-: 1.68 ± 0.25) and OR genes (ratio NKCC1+/+/NKCC1-/-: 4.76 ± 2.56) were calculated. The ratio indicates an approximately twofold decrease in expression of signal transduction-related genes in NKCC1-/- mice. The average FPKM ratio for OR genes even demonstrates that ORs displayed fourfold higher FPKM values in wild type mice, but the FPKM ratio of ORs exhibited a high variance. RT-PCR experiments were performed to exemplary characterize the mRNA expression of the olfactory receptors Olfr1303 and Olfr332 (Figure 21). Here, in both experiments a reduction in expression was detected and even a significant decrease for Olfr1303. In summary, the results also suggested decreased transcripts of ORs per ORN or a reduced number of OSNs in NKCC1-deficient mice.

5.3.4 Expression analysis of significantly regulated genes

The Cuffdiff analysis of RNA-Seq experiments revealed 45 genes with a significant (P ≤ 0.05, Q ≤ 0.0.5) regulation in NKCC1-deficient mice (Table 4). Six olfactory receptors were identified with significantly lower FPKM values in NKCC1-deficient mice (Table 4 A). These findings support the analysis in which 149 ORs (P<0.05) were detected that had a notably decreased expression in NKCC1-deficient mice. Moreover, these ORs are randomly distributed on several chromosomes of mus musculus (Sullivan et al., 1996; Young et al., 2003; Zhang et al., 2004). The chromosomal distribution of theses OR genes additionally indicates a non-participation of knockout-related promotor strength reduction. Focusing on ion-related proteins, two Slc-transporters were discovered, the urea transporter Slc14a2 (Fenton et al., 2002) and the sodium/potassium/calcium Exchanger 2 (Slc24a2) (Li et al., 2002) that had reduced expression in NKCC1-deficient mice. The Slc24a2 transporter functions as a calcium extruder in neurons (Altimimi and Schnetkamp, 2007). 77

Discussion

Therefore, its downregulation impairs calcium transport and could negatively influence the excitability of the NKCC1-deficient neurons. Additionally, a calcium-activated potassium channel (Kcnmb3) involved in neuronal excitability (Behrens et al., 2000; Hu et al., 2003) was identified. Its reduction might influence the excitability of OSN in NKCC1-deficient mice as well. The channel-associated protein (Dlg2) that acts as a scaffolding protein in neurons (Roberts et al., 2012) exhibited higher expression in wild type OE. Dlg2 is involved in mitotic cell organization in neuronal synapses in Drosophila melanogaster (Albertson and Doe, 2003; Goode and Perrimon, 1997). Consequently, the decreased Dlg2 expression in NKCC1-deficient mice negatively influences OE neurogenesis. Genes with higher expression levels in knockout compared to wild type mice were also identified (Table 4 B). A calcium-activated chloride channel (Clca2) (Piirsoo et al., 2009) exhibited a higher FPKM value in the NKCC1-deficient transcriptome. This chloride channel is expressed in a subset of OSNs and may play a role in odorant transduction in cilia (Gonzalez-Silva et al., 2013). Moreover, protocadherin 10 (Pcdh10), a gene with key roles in suppressing cell proliferation (Zhong et al., 2013), displayed a higher FPKM value in NKCC1-deficient mice. The overexpression of Pcdh10 combined with the reduced expression of the scaffolding protein might impair the adult neurogenesis of the OE in NKCC1-deficient mice. The transient receptor potential channel subfamily M member 5 (Trpm5) and two claudins (Cldn2, Cldn4) were higher expressed in deficient OE. Trpm5 channels mediate pheromone transduction in the VNO (Ogura et al., 2010) but were also demonstrated to detect pheromones in the OE (Lopez et al., 2014). Claudins are tight junction components that maintain the cellular polarity (Morita et al., 1999). In summary, several ion-/development-related genes were identified with modified expression levels in NKCC1-deficient mice that may contribute to the impaired odorant transduction and/or OE development.

5.4 Western blot analysis of the olfactory epithelium of NKCC1+/+ and NKCC1-/- mice

The western blot analysis of the NKCC1-/- proteom revealed reduced proteins levels for nearly all tested proteins (Figure 22 and Figure 23). This decrease in signal transduction-

Discussion

related proteins mainly bases on the detected mRNA reduction by RNA-Seq and RT-PCR experiments. The nucleotide-gated channel alpha 4 (CNGA4) demonstrated an enormous protein decrease which was first indicated by the significant reduction of mRNA displayed by RNA-Seq and RT-PCR experiments. In addition, the neuronal migration protein doublecortin (DCX) showed decreased protein expression (Figure 23) whereby RNA-Seq analysis demonstrated no significant decrease in mRNA expression (NKCC1+/+: 13.3, NKCC1-/-: 13.84). This leads to the hypotesis that DCX translation is somehow inhibited or regulated in cells lacking NKCC1. DCX is transiently expressed by neuronal precursor cells and immature neurons and thus acting as a marker for neurogenesis (Brown et al., 2003b; Couillard-Despres et al., 2005). The expression of DCX decreases during aging (Figure 24) but is stable in adult mice due to the continuous regeneration of the OE. In this study, adult mice were used in each experiment, thus DCX expression should be present in a limited number of cells, the neuronal precursor cells and immature OSNs. Its significant reduction in NKCC1-deficient mice indicates impairment in neurogenesis of the OE. In contrast, the expression of achaete-scute family BHLH transcription factor 1 (ASCL1) was not altered in NKCC1-/- mice. ASCL1 is also a neuronal progenitor marker in the murine OE and expressed by a subset of progenitors, the first daughter cells of the stem cells (Beites et al., 2005). Therefore, this result did not contradict the earlier finding of an impaired neurogenesis by DCX reduction in NKCC1-deficient mice. It could be hypothesized that the stem cells in NKCC1-deficient mice normally divide in progenitor cells expressing ASCL1, but they do not probably develop into immature neurons expressing DCX due to some unknown mechanism. The transcription factor Pax7 of the paired box (PAX) family (Basch et al., 2006) demonstrated a slightly higher expression in deficient mice OE samples. Pax7 is expressed prior to neural differentiation in mitotically active cells (Mansouri et al., 1996). It was demonstrated that Pax7 expression was increased in development-impaired sonic hedgehog mice mutants (SHH-/-) (Balmer and LaMantia, 2004), so that this increase suggests a defect in neurogenesis in NKCC1-deficient mice. During western blot analysis, the ciliary and acetylated protein tubulin was demonstrated to be lower expressed in NKCC1-deficient compared to wild type mice. RNA-Seq analysis also revealed a lower FPKM value for this gene in NKCC1-deficient mice (NKCC1+/+: 639.52, NKCC1-/-: 479.928). This reduction in expression could be explained by two possible reasons, first a decreased number of OSNs and thus less cilia or morphological changes of the cilia themselves. Morphological 79

Discussion

changes in turn could be less cilia per OSN or a reduced length. Western blot data demonstrated that the reduced mRNA content is not compensated by any mechanism, e.g. enhancement of the mRNA lifespan via mRNA supporting proteins or longer polyadenylation of mRNA, and therefore directly resulted in less protein amounts. Ultimately, the western blot experiments confirmed the reduced protein amount of signal transduction-related proteins and additionally suggested an impairment of OE neurogenesis in NKCC1-deficient mice.

5.5 EOG recordings The air-phase EOG recordings demonstrated that the loss of NKCC1 affects surface potentials, confirmed by the highly significant decrease (~75%) in surface amplitudes generated by NKCC1-deficient mice (Figure 26 A and E). Surface potentials were measured with different Henkel100 dilutions and displayed an overall significant decrease in deficient mice (Figure 25). Heterozygous mice displayed a slight (~ 18%) reduction in odorant-evoked amplitudes compared to wild type mice. In general, this genotype seemed to be somewhat in between regarding the odorant responses while having no obvious phenotype. At this point of knowledge, it remains obscure how mRNA expression is affected by the lack of one NKCC1 allele in mice and thus the responsiveness to odorants. Flagella and coworkers displayed that mRNA expression is decreased in NKCC1+/- compared to NKCC1+/+ mice (Flagella et al., 1999). Further RNA-Seq experiments would clarify the mRNA content of these mice and might provide explanations for reduced odorant detection by NKCC1+/-. EOG recordings also displayed the same concentration dependency for generated surface potentials and nearly identical maximal amplitudes in both wild type and NKCC-deficient mice. These findings exclude the hypothesis that NKCC1-loss induces lower sensitivity of OSNs. Furthermore, comparison of amplitudes generated by Henkel100 or a mixture of 10 odorants application revealed nearly halved responses in both wild type and NKCC1-deficient mice (Figure 27 B). Thus, the result testified the same odorant sensitivity of both mice populations. Beside this, amplitudes generated by OE of NKCC1-deficient mice again displayed smaller responses compared to wild type (Figure 27 A). The air-phase EOG recordings illustrate impairment in the desensitization mechanism in NKCC1-deficient mice shown by the increase in decay time

Discussion

of amplitudes (Figure 27 C). For this reason, repetitive responses were triggered in wild type and NKCC1-deficient mice applying Henkel100 in 6 s stimulus intervals (Figure 28 A). No significant differences in amplitudes were measured between each stimulus (Figure 28 B) while amplitudes were again reduced in NKCC1-deficient mice compared to wild type. This experiment partially disproved the hypothesis of an inhibited desensitization mechanism in NKCC1-/- mice. Further experiments with variations in stimulus intervals could proof these results. Submerged EOGs displayed reduced amplitudes and implied insufficient odorant recognition in NKCC1-deficient mice. In contrast, the inhibition of calcium-gated chloride channels by niflumic acid application demonstrated that OSN depolarization of both mouse populations relies on the same proportion of the chloride efflux. The amplitude inhibition by niflumic acid was reversible after Ringer solution application (Figure 29). However, after inhibition by tannic acid the amplitude reduction was not reversible, indicating the loss of OSN vitality. For that reason, subsequent submerged EOG experiments were performed using niflumic acid. The inhibitory effect of niflumic acid of wild type and NKCC1-deficient mice was previously described by Nickell and coworkers using EOG recordings (Nickell et al., 2007). Although they measured a minor 57% reduction in amplitudes of NKCC1-/- mice (Nickell et al., 2006), in this study a ~75% decrease in amplitudes were observed in knockout mice. These differences in amplitude are likely due to slightly different application systems and different aged mice (NKCC1+/+: 109 ± 4 days, NKCC1-/-: 109 ± 3, Nickell: NKCC1+/+: 87 ± 5 days, NKCC1-/- : 111± 11 days), resulting in strong signal amplitudes (NKCC1+/+: ~12 mV, NKCC1-/-: ~3 mV), which was also reported by Nickell (Nickell et al., 2007). In 2006, he presumed a 39% amplitude reduction in NKCC1 knockout mice, and conversely, he reported a 57% decrease in 2007 due to the age of mice and technique. The finding that the lack of NKCC1 has no impact on the proportion of chloride efflux in olfactory neurons is in contrast to the large amplitude reduction measured during EOG experiments. Electrophysiological and RNA-Seq experiments suggest that: (i) NKCC1-deficient OSNs actively accumulate chloride ions via an unidentified ion transporter and/or (ii) the OE contains less mature neurons than wild type OE.

Discussion

5.6 Morphological changes of the olfactory epithelium of NKCC1+/+, NKCC1+/- and NKCC1-/- mice

The usage of a mice model in which NKCC1 protein expression is completely disabled represents an enormous advantage for scientific issues. Comparison of these mice with wild type littermates reveals new insights into current issues and enables in vivo experiments. Beside this, NKCC1-deficient mice display the connection of NKCC1-gene loss and phenotype. The NKCC1-/- mice are bred for several years at the department of Cellphysiology (Ruhr-University Bochum) and were subject of several researches (Radtke, 2012; Rozynkowski, 2011; Schobel et al., 2012). During these studies, morphological changes of the OE of the NKCC1-deficient mice came into focus. For this purpose, turbinate length of NKCC1-deficient and wild type mice were measured and compared (Figure 31), however no differences in turbinate length were detected. After RNA-Seq analysis regarding the signal transduction-related proteins and the ORs, other morphological changes particularly of OSNs came into focus. Next, the neuronal layer thickness of NKCC1-/-, NKCC1+/- and NKCC1+/+ mice was analyzed. These measurements revealed a general decrease in the neuronal layer thickness of heterozygous and NKCC1-deficient mice compared with wild type OE (Figure 32). OE of NKCC1-deficient mice exhibited approximately 20% reduced neuronal layer thickness compared to wild type OE. This reduction of neuronal layer thickness implied two possible reasons: I) the morphology of the OSN is altered due to the loss of NKCC1 or II) the number of OSN is decreased in NKCC1-deficient mice. Accordingly, immunohistological experiments addressed this issue and also demonstrated a 20% reduction of cells, which comprise mature and immature OSN, basal and sustentacular cells, in NKCC1-deficient OE (Figure

33). OE of heterozygous mice demonstrated no reduction compared with wild type OE. In summary, the lack of NKCC1 leads to a reduced number of mature neurons due to an inhibition of cell proliferation.

Discussion

5.7 The impact of NKCC1 in chloride accumulation of OSNs or how NKCC1 is a modulator of neurogenesis

Transcriptome analysis using RNA-Seq and RT-PCR illustrated the outstanding expression of the ion transporter NKCC1 beside other Slc-transporters and particularly chloride- related transporters in the murine OE. More importantly, NKCC1 seems to be the main chloride accumulator in OSN due to transcriptome analysis notwithstanding NKCC1-deficent mice demonstrated odorant-evoked responses comprised of the same proportion of the chloride efflux as wild type mice (Figure 30). These results are at first in contradiction in terms of the role of NKCC1 in the murine OE. Combination of transcriptome analysis, EOG recordings and morphological investigations of the NKCC1-deficient OE indicate an involvement of NKCC1 in the continuous OE neurogenesis. The ion transporter NKCC1 seems to act as a driving force of OE neurogenesis due to its function in cell homeostasis (Delpire and Austin, 2010) or another unknown enrolement in cell differentiation. NKCC1 regulates phosphorylation of MAPK kinase (MEK) and extracellular regulated kinase (ERK) in fibroblasts and human corneal epithelial cells (Lu et al., 2014; Panet et al., 2006; Wang et al., 2011). Consequently, the ion transporter modulates the MAPK signaling pathway and therefore the proliferation of these cells. NKCC1 is a well-known cell cycle regulator in cultured cell lines despite the ambiguous mechanism causing the cell cycle resting (Panet and Atlan, 1991; Panet et al., 2006; Panet et al., 2002; Panet et al., 2000; Panet et al., 1994; Shiozaki et al., 2014). It is also described that NKCC1 expression is up-regulated after treatment of PC12D cells with neuronal growth factor inducing neurite outgrowth (Nakajima et al., 2011). In addition, previous studies suggested a role of NKCC1 in regeneration after nerve injuries of the dorsal root ganglion (Sun et al., 2012) and traumatic brain injury (Lu et al., 2014). This ion transporter is also involved in the postnatal neurogenesis of the brain suggested by reduced proliferation of forebrain neuronal progenitors after inhibition of NKCC1 (Pieraut et al., 2007). This finding was also illustrated by the NKCC1 knockdown which modulates GABA(A)-induced depolarizing activity and leads to a decrease in neuronal progenitor cells of the brain (Young et al., 2012). Altogether, the ion transporter NKCC1 is well-known to play an important role in plasticity and neurogenesis of the brain, but this study affords, for the first time, insights into the function of NKCC1 in OE neurogenesis.

Discussion

Considering the fact that NKCC1-deficient mice OE exhibits less mature OSNs compared to wild type OE, transcriptome analysis has to be revised. Accordingly, reduced expression of a transporter primarily expressed in OSNs of NKCC1-deficient mice is caused by the decreased number of OSNs. RT-PCR, for instance, demonstrated a significant decrease in Slc12a9 expression, which was shown to be predominantly expressed in OSN. Additionally, a reduction of Slc12a2, a highly expressed transporter in OSNs, was reported and an mRNA decrease in the mature neuron-specific Slc12a5 was shown. Thus, these decreases in transporter expressions are evoked by the reduced OSN number in NKCC1- deficient mice. These results also imply an enhanced expression of the transporters Slc6a6, Slc4a3, Slc26a7, Slc4a2, Slc12a7 and Slc12a6 compared to wild type mice. Indeed, if FPKM values of transporters are normalized to the FPKM value of OMP, a marker of mature OSNs, these ion transporters showed higher expression in NKCC1-deficient mice. The Slc4a3, Slc26a7 and Slc4a2 transporters are possible chloride accumulators in the OSN. However, only Slc26a7 is a likely chloride accumulator candidate beside NKCC1, since Slc4a2 knockout mice exhibit no defects in odorant recognition in EOG (Nickell et al., 2007), and Slc4a3 showed low expression in both RNA-Seq and RT-PCR approaches. Slc26a7 was found to be highly expressed in OE and in particular OSNs enabling its contribution to chloride accumulation. Future RNA-Seq experiments of single NKCC1-/- neurons might clarify the expression profiles of proteins, in particular the overexpression of ion transporters and the consequential compensation mechanisms. Furthermore, expression changes, particularly the reduction of genes and proteins in NKCC1-/- mice might be reconsidered and reviewed for contribution to OE neurogenesis. Pcdh10 overexpression might contribute to the neurogenesis defects in the NKCC1-deficient OE. Also the expression of the progenitor marker protein ASCL1 was not altered in NKCC1-deficient mice but DCX expression was drastically reduced. RNA-Seq analysis also demonstrated a significantly higher expression of the transient receptor potential channel subfamily M member 5 (Trpm5), which was described to be expressed in solitary chemosensory cells of the OE (Kaske et al., 2007). Thus, these results, in combination with the finding of decreased OSN number, leads to the conclusion that the ratio between OSNs and sustentacular cells is altered in these mice. Furthermore, it could be hypothesized that progenitor cell number does not vary but maturing of OSNs is impaired in NKCC1-/- mice.

Discussion

In summary, combination of all experiments and previous studies suggest that NKCC1 is involved in continuous OE neurogenesis. RNA-Seq demonstrated that NKCC1 is the most highly expressed chloride transporter in both OE and OSN. Beside NKCC1, the anion exchanger Slc26a7 may also be involved in chloride accumulation. Defects in odorant detection of NKCC1-deficient mice primarily rest upon inhibition of the neurogenesis of the OE. This study reveals a new aspect of NKCC1 loss and its consequences for odorant sensation in mice. It also attempts to explain the different results regarding the impact of NKCC1 in olfaction reported by several researchers over the years. Nevertheless, further investigations will focus on the molecular mechanism of NKCC1 in adult OE neurogenesis.

Conclusion

6. Conclusion

6.1 Summary

The olfactory sense is crucial for mammals especially for the cognition of food edibility and toxic substances. Therefore, it is of particular interest to understand the molecular mechanism of the olfactory sense. Odorant recognition is first initiated by the binding of an odorant molecule to its specific G protein-coupled receptor and followed by an activation of the adenylyl cyclase III which generates cAMP. Next, a cyclic nucleotide-gated channel is opened through binding of cAMP and leads to an influx of sodium and calcium. This cation influx in turn causes the initial depolarization of the cell. The calcium binds to a chloride channel which undergoes a conformational change and enables the efflux of chloride. Among nerve cells of vertebrates, the OSNs are uncommon in their high intracellular chloride concentration, so that 80% of the neuronal depolarization current is caused by an efflux of chloride through the opening of chloride channels. This so called chloride boost powerfully amplifies the receptor potential. To date only little is known about how OSNs maintain chloride homeostasis. Active accumulation of extracellular chloride against the electrochemical gradient might be mediated by the sodium-potassium- chloride cotransporter isoform 1 (NKCC1), which was shown to be expressed in the olfactory epithelium (OE), but its precise role has been a controversial subject in literature.

This study addresses the issue of the responsible ion transporter for chloride accumulation of OSNs. For the first time, transcriptome analysis of the OE of NKCC1-deficient and wild type littermates were performed using RNA-Sequencing approaches. The obtained results verified the outstanding expression of NKCC1 beside other chloride-related ion transporters in the OE and OSNs. During analysis of the transcriptome data, it was shown that the mRNA expressions of signal transduction-related proteins and olfactory receptors (ORs) were reduced in mice lacking the ion transporter NKCC1 compared with wild type mice. This decrease was additionally validated by reverse transcription (RT)-PCR experiments. Beside this, electrophysiological experiments indicated a high impact of NKCC1 in odorant-evoked responses. NKCC1-/- mice demonstrated significantly reduced responses compared to wild type mice in electro-olfactogram (EOG) recordings. After pharmacological inhibition of chloride channels with niflumic acid, however, EOG 86

Conclusion

amplitudes of both NKCC1-deficient and wild type littermates were equally reduced. This result demonstrated that both responses rely on the same proportion of the chloride efflux. Accordingly, the loss of NKCC1 did not provoke a drastically decrease in chloride concentration in OSN so that responses were still amplified by a chloride efflux in both mice populations. The combination of electrophysiological results and the decrease in mRNA contents raised the question of (I) a reduced gene expression (II) or a decreased number of OSNs in NKCC1-deficient mice. To address this question, histological stainings of OEs were performed. These experiments indeed revealed a decrease in the neuronal layer thickness caused by a reduced number of cells in NKCC1-deficient OE, as confirmed by hematoxylin/eosin and DAPI stainings. NKCC1 thus seems to have an impact on the continuous neurogenesis of the OE. In addition, western blot analysis displayed a reduced protein amount of doublecortin, a marker protein of immature neurons, but also demonstrated an unaltered ASCL1 amount, a marker protein of progenitor cells. Therefore, loss of NKCC1 probably impairs the development of immature neurons from progenitor cells and thus inhibits the OE neurogenesis.

In summary, NKCC1 is the highest expressed chloride-related ion transporter in OE and its loss causes restrictions of the amplitude of odorant-evoked responses which is most probably caused by a reduced number of OSNs rather than an impaired chloride accumulation. Thus OSNs lacking the ion transporter NKCC1 successfully accumulate chloride ions through an uncertain additional transporter. This study identified a second chloride transporter Slc26a7 which could synergistically accumulate chloride ions. Slc26a7 was found to be highly expressed in OE and in particular OSNs enabling its contribution to chloride accumulation. Beside this, this study determines the involvement of NKCC1 in the neurogenesis of the murine OE and provides the basis for further investigations to finally unravel its function in the murine OE.

Conclusion

6.2 Zusammenfassung

Der Geruchssinn ist für Säugetiere ein fundamentaler Sinn zur Wahrnehmung der Umgebung und der Interaktion mit ihr. Durch ihn werden Nahrungsquellen entdeckt, toxische Stoffe erkannt und soziales Verhalten über Pheromone vermittelt. Die olfaktorische Wahrnehmung wird hauptsächlich durch einen cAMP-vermittelten Signalweg gesteuert, welcher mit der Bindung eines Duftstoffes an seinen spezifischen G- Protein-gekoppelten Rezeptor beginnt. Daraufhin wird eine membrangebundene Adenylatcyclase Typ III (AC III) aktiviert, welche Adenosintriphosphat (ATP) in zyklisches Adenosinmonophosphat (cAMP) umwandelt. Das cAMP bindet als sekundär Botenstoff an einen zyklischen-Nukleotid-gesteuerten Ionenkanal (CNG-Kanal) und löst einen Einstrom von Natrium- und Kalziumionen aus. Die einströmenden Kalziumionen öffnen einen Kalzium-aktivierbaren Chlorid-Kanal, was einen Ausstrom von Chloridionen aus dem Neuron und somit eine Verstärkung der Depolarisation bewirkt. Diese Depolarisation wird somit hauptsächlich (~80 %) durch einen massiven Chlorid-Ausstrom herbeigeführt, welcher nur möglich ist, da ORN im Gegensatz zu den meisten anderen Neuronen Chlorid aktiv akkumulieren. Der Natrium-Kalium-Chlorid-Kotransporter NKCC1 wird in ORN exprimiert und gilt als potentieller Kandidat für diese Aufgabe, jedoch wird seine Bedeutung für die Olfaktorik in der Literatur kontrovers diskutiert.

Ziel dieser Arbeit war es, den Einfluss des Ionentransporters NKCC1 auf die Chloridakkumulation von ORN mithilfe NKCC1-gendefizienter Mäuse zu untersuchen. Hierzu wurde erstmalig eine Transkriptom-Analyse des olfaktorischen Epithels (OE) von NKCC1-gendefizienten Mäusen und wildtypischen Geschwistertieren angefertigt. Die RNA-Sequenzierung ergab, dass NKCC1 der am höchsten exprimierte Transporter im OE und in ORN ist, welcher zudem in der Lage ist, Chloridionen zu akkumulieren. Proteine, welche an der Signalkaskade beteiligt sind, sowie olfaktorische Rezeptoren zeigten eine reduzierte Expression in NKCC1-gedefizienten gegenüber wildtypischen Mäusen. Diese Ergebnisse ließen sich auch durch RT-PCR-Experimente und Western Blot-Analysen bestätigen. Elektrophysiologische Experimente, in denen die Duftstoff-induzierten Antworten von wild-typischen und NKCC1-defizienten Mäusen durch Elektroolfaktogramme getestet wurden, zeigten eine signifikante Verringerung der

Conclusion

Amplituden bei gendefizienten Tieren. Diese Ergebnisse ließen zunächst die Annahme zu, dass das Fehlen von NKCC1 die Chloridkonzentration von ORN verringert und somit die Depolarisation in diesem Fall teilweise oder völlig Chlorid-unabhängig ist. Durch die Verwendung von Chloridkanal-Inhibitoren konnte jedoch demonstriert werden, dass die generierten Amplituden von NKCC1-gendefizienten Mäusen zum gleichen Anteil vom Chloridausstrom abhängig sind und somit die ORN weiterhin Chloridionen akkumulieren können. Die Verringerung der Duft-induzierten Antworten muss auf andere Mechanismen als eine reduzierte Chloridkonzentration zurückzuführen sein. Die elektrophysiologischen Ergebnisse in Kombination mit den Daten der RNA-Sequenzierung ließen den Rückschluss zu, dass entweder (I) eine Expressionsverringerung der Signalkaskadenproteinen oder (II) eine Reduktion der Anzahl an ORN für die verschlechterte Duftwahrnehmung der NKCC1-gendefizienten Tiere verantwortlich ist. Aus diesem Grund wurden histologische Färbungen an OE-Kryoschnitten vorgenommen und auf morphologische Unterschiede untersucht. Hierbei zeigte sich, dass die Schichtdicke des OE von NKCC1-gedefizienten Tieren im Vergleich zu wildtypischem OE signifikant geringer ist, was nach der Untersuchung von DAPI-gefärbten Schnitten offensichtlich auf eine verminderte Zellzahl im OE von gendefizienten Tieren zurückzuführen ist. Dies lässt den Schluss zu, dass NKCC1 an der kontinuierlichen Neurogenese des OE beteiligt ist. Weiterführende Analysen des Proteingehalts von an der Neurogenese beteiligten Markerproteinen zeigten, dass das OE von NKCC1-gendefizienten Mäuse einen geringeren Anteil an Doublecortin, einem Marker für unreife Neurone aufweist. Dies bestätigt erneut die Vermutung, dass NKCC1 an der Neurogenese des OEs beteiligt ist und der Verlust diese Transporters vermutlich die Reifung von Vorläuferzellen zu unreifen Neuronen beeinträchtigt.

Im Rahmen dieser Arbeit konnte erstmalig eine Beteiligung des Ionentransporters NKCC1 an der Neurogenese des OEs festgestellt werden. Die ermittelte Verringerung der Duftantwort von NKCC1-gendefizienten Tieren lässt sich erstmalig auf eine beeinträchtigte Neurogenese des OE zurückführen. ORN können offensichtlich auch in Abwesenheit von NKCC1 Chloridionen aktiv akkumulieren und lediglich die verringerte Anzahl an adulten ORNs führt zu den beobachteten Effekten in den elektrophysiologischen Messungen. Diese Studie bietet zudem Anhaltspunkte, dass die Chloridakkumulation

Conclusion

eventuell durch einen zweiten Chloridtranporter, den Anionen-Austauscher Slc26a7, bewerkstelligt wird. Die Transkriptomdaten zeigten, dass Slc26a7 stark exprimiert im OE und spezifisch in ORN vorliegt, was eine Beteiligung an der Chloridionen-Akkumulation ermöglicht. Die Ergebnisse dieser Studie zeigen erstmals, dass NKCC1 einen Einfluss auf die Reifung von Vorläuferzellen und somit auf die Neurogenese des OE besitzt und bieten somit wichtige Anhaltspunkte für weitere Untersuchungen für ein tieferes Verständnis der Bedeutung dieses Chloridtransporters im murinen OE.

Bibliography

7. Bibliography

Abrous, D.N., Koehl, M., and Le Moal, M. (2005). Adult neurogenesis: from precursors to network and physiology. Physiol Rev 85, 523-569.

Ache, B.W. (2010). Odorant-specific modes of signaling in mammalian olfaction. Chem Senses 35, 533-539.

Albertson, R., and Doe, C.Q. (2003). Dlg, Scrib and Lgl regulate neuroblast cell size and mitotic spindle asymmetry. Nat Cell Biol 5, 166-170.

Alonso, G., Prieto, M., and Chauvet, N. (1999). Tangential migration of young neurons arising from the subventricular zone of adult rats is impaired by surgical lesions passing through their natural migratory pathway. J Comp Neurol 405, 508-528.

Altimimi, H.F., and Schnetkamp, P.P. (2007). Na+-dependent inactivation of the retinal cone/brain Na+/Ca2+-K+ exchanger NCKX2. J Biol Chem 282, 3720-3729.

Andres, K.H. (1975). [New morphologic principles of the physiology of smell and taste]. Arch Otorhinolaryngol 210, 1-41.

Araneda, R.C., Kini, A.D., and Firestein, S. (2000). The molecular receptive range of an odorant receptor. Nat Neurosci 3, 1248-1255.

Bakalyar, H.A., and Reed, R.R. (1990). Identification of a specialized adenylyl cyclase that may mediate odorant detection. Science 250, 1403-1406.

Balentova, S., Hajtmanova, E., Adamkov, M., and Lehotsky, J. (2014). Differential Expression of Doublecortin and Microglial Markers in the Rat Brain Following Fractionated Irradiation. Neurochem Res.

Ball, D.W., Azzoli, C.G., Baylin, S.B., Chi, D., Dou, S., Donis-Keller, H., Cumaraswamy, A., Borges, M., and Nelkin, B.D. (1993). Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors. Proc Natl Acad Sci U S A 90, 5648-5652.

Balmer, C.W., and LaMantia, A.S. (2004). Loss of Gli3 and Shh function disrupts olfactory axon trajectories. J Comp Neurol 472, 292-307. 91

Bibliography

Barreiro-Iglesias, A., Romaus-Sanjurjo, D., Senra-Martinez, P., Anadon, R., and Rodicio, M.C. (2011). Doublecortin is expressed in trigeminal motoneurons that innervate the velar musculature of lampreys: considerations on the evolution and development of the trigeminal system. Evol Dev 13, 149-158.

Basch, M.L., Bronner-Fraser, M., and Garcia-Castro, M.I. (2006). Specification of the neural crest occurs during gastrulation and requires Pax7. Nature 441, 218-222.

Behrens, R., Nolting, A., Reimann, F., Schwarz, M., Waldschutz, R., and Pongs, O. (2000). hKCNMB3 and hKCNMB4, cloning and characterization of two members of the large-conductance calcium-activated potassium channel beta subunit family. FEBS Lett 474, 99-106.

Beites, C.L., Kawauchi, S., Crocker, C.E., and Calof, A.L. (2005). Identification and molecular regulation of neural stem cells in the olfactory epithelium. Exp Cell Res 306, 309-316.

Belluscio, L., Gold, G.H., Nemes, A., and Axel, R. (1998). Mice deficient in G(olf) are anosmic. Neuron 20, 69-81.

Ben-Ari, Y. (2002). Excitatory actions of gaba during development: the nature of the nurture. Nature reviews Neuroscience 3, 728-739.

Ben-Ari, Y., Cherubini, E., Corradetti, R., and Gaiarsa, J.L. (1989). Giant synaptic potentials in immature rat CA3 hippocampal neurones. J Physiol 416, 303-325.

Benardais, K., Kasem, B., Couegnas, A., Samama, B., Fernandez, S., Schaeffer, C., Antal, M.C., Job, D., Schweitzer, A., Andrieux, A., et al. (2010). Loss of STOP protein impairs peripheral olfactory neurogenesis. PLoS One 5, e12753.

Bergmann, O., Liebl, J., Bernard, S., Alkass, K., Yeung, M.S., Steier, P., Kutschera, W., Johnson, L., Landen, M., Druid, H., et al. (2012). The age of olfactory bulb neurons in humans. Neuron 74, 634-639.

Bicho, A., and Grewer, C. (2005). Rapid substrate-induced charge movements of the GABA transporter GAT1. Biophys J 89, 211-231.

Bibliography

Billig, G.M., Pal, B., Fidzinski, P., and Jentsch, T.J. (2011). Ca2+-activated Cl- currents are dispensable for olfaction. Nat Neurosci 14, 763-769.

Borisy, F.F., Ronnett, G.V., Cunningham, A.M., Juilfs, D., Beavo, J., and Snyder, S.H. (1992). Calcium/calmodulin-activated phosphodiesterase expressed in olfactory receptor neurons. J Neurosci 12, 915-923.

Bouvain, P. (2014). Mastert thesis: Charakterisierung von Ionentransportern im chemosensorischen System der Maus. Department of Cellphysilogy (Bochum, Ruhr- University Bochum), pp. 125.

Bouyer, P.G., Tang, X., Weber, C.R., Shen, L., Turner, J.R., and Matthews, J.B. (2013). Capsaicin induces NKCC1 internalization and inhibits chloride secretion in colonic epithelial cells independently of TRPV1. Am J Physiol Gastrointest Liver Physiol 304, G142-156.

Braun, T., Voland, P., Kunz, L., Prinz, C., and Gratzl, M. (2007). Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology 132, 1890-1901.

Brechbuhl, J., Klaey, M., and Broillet, M.C. (2008). Grueneberg ganglion cells mediate alarm pheromone detection in mice. Science 321, 1092-1095.

Breer, H., Boekhoff, I., and Tareilus, E. (1990). Rapid kinetics of second messenger formation in olfactory transduction. Nature 345, 65-68.

Brown, J., Cooper-Kuhn, C.M., Kempermann, G., Van Praag, H., Winkler, J., Gage, F.H., and Kuhn, H.G. (2003a). Enriched environment and physical activity stimulate hippocampal but not olfactory bulb neurogenesis. Eur J Neurosci 17, 2042-2046.

Brown, J.P., Couillard-Despres, S., Cooper-Kuhn, C.M., Winkler, J., Aigner, L., and Kuhn, H.G. (2003b). Transient expression of doublecortin during adult neurogenesis. J Comp Neurol 467, 1-10.

Brunet, L.J., Gold, G.H., and Ngai, J. (1996). General anosmia caused by a targeted disruption of the mouse olfactory cyclic nucleotide-gated cation channel. Neuron 17, 681- 693.

Bibliography

Buck, L., and Axel, R. (1991). A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175-187.

Buiakova, O.I., Baker, H., Scott, J.W., Farbman, A., Kream, R., Grillo, M., Franzen, L., Richman, M., Davis, L.M., Abbondanzo, S., et al. (1996). Olfactory marker protein (OMP) gene deletion causes altered physiological activity of olfactory sensory neurons. Proc Natl Acad Sci U S A 93, 9858-9863.

Bush, P.G., Pritchard, M., Loqman, M.Y., Damron, T.A., and Hall, A.C. (2010). A key role for membrane transporter NKCC1 in mediating chondrocyte volume increase in the mammalian growth plate. J Bone Miner Res 25, 1594-1603.

Busse, D., Kudella, P., Gruning, N.M., Gisselmann, G., Stander, S., Luger, T., Jacobsen, F., Steinstrasser, L., Paus, R., Gkogkolou, P., et al. (2014). A synthetic sandalwood odorant induces wound-healing processes in human keratinocytes via the olfactory receptor OR2AT4. J Invest Dermatol 134, 2823-2832.

Caron, L., Rousseau, F., Gagnon, E., and Isenring, P. (2000). Cloning and functional characterization of a cation-Cl- cotransporter-interacting protein. The Journal of biological chemistry 275, 32027-32036.

Cau, E., Casarosa, S., and Guillemot, F. (2002). Mash1 and Ngn1 control distinct steps of determination and differentiation in the olfactory sensory neuron lineage. Development 129, 1871-1880.

Cau, E., Gradwohl, G., Fode, C., and Guillemot, F. (1997). Mash1 activates a cascade of bHLH regulators in olfactory neuron progenitors. Development 124, 1611-1621.

Chabwine, J.N., Talavera, K., Verbert, L., Eggermont, J., Vanderwinden, J.M., De Smedt, H., Van Den Bosch, L., Robberecht, W., and Callewaert, G. (2009). Differential contribution of the Na(+)-K(+)-2Cl(-) cotransporter NKCC1 to chloride handling in rat embryonic dorsal root ganglion neurons and motor neurons. FASEB J 23, 1168-1176.

Chen, H., and Sun, D. (2005). The role of Na-K-Cl co-transporter in cerebral ischemia. Neurol Res 27, 280-286.

Bibliography

Chen, T.Y., and Yau, K.W. (1994). Direct modulation by Ca(2+)-calmodulin of cyclic nucleotide-activated channel of rat olfactory receptor neurons. Nature 368, 545-548.

Clarkson, A.N., Huang, B.S., Macisaac, S.E., Mody, I., and Carmichael, S.T. (2010). Reducing excessive GABA-mediated tonic inhibition promotes functional recovery after stroke. Nature 468, 305-309.

Clayton, G.H., Owens, G.C., Wolff, J.S., and Smith, R.L. (1998). Ontogeny of cation-Cl- cotransporter expression in rat neocortex. Brain Res Dev Brain Res 109, 281-292.

Costa, C., Giménez-Capitán, A., Karachaliou, N., and Rosell, R. (2013). Comprehensive molecular screening: from the RT-PCR to the RNA-seq. Translational Lung Cancer Research 2, 87-91.

Couillard-Despres, S., Winkler, J., Uyanik, G., and Aigner, L. (2001). Molecular mechanisms of neuronal migration disorders, quo vadis? Curr Mol Med 1, 677-688.

Couillard-Despres, S., Winner, B., Karl, C., Lindemann, G., Schmid, P., Aigner, R., Laemke, J., Bogdahn, U., Winkler, J., Bischofberger, J., et al. (2006). Targeted transgene expression in neuronal precursors: watching young neurons in the old brain. Eur J Neurosci 24, 1535-1545.

Couillard-Despres, S., Winner, B., Schaubeck, S., Aigner, R., Vroemen, M., Weidner, N., Bogdahn, U., Winkler, J., Kuhn, H.G., and Aigner, L. (2005). Doublecortin expression levels in adult brain reflect neurogenesis. Eur J Neurosci 21, 1-14.

Crouch, J.J., Sakaguchi, N., Lytle, C., and Schulte, B.A. (1997). Immunohistochemical localization of the Na-K-Cl co-transporter (NKCC1) in the gerbil inner ear. J Histochem Cytochem 45, 773-778.

Cygnar, K.D., Stephan, A.B., and Zhao, H. (2010). Analyzing responses of mouse olfactory sensory neurons using the air-phase electroolfactogram recording. J Vis Exp.

Cygnar, K.D., and Zhao, H. (2009). Phosphodiesterase 1C is dispensable for rapid response termination of olfactory sensory neurons. Nat Neurosci 12, 454-462.

Bibliography

Dawson, T.M., Arriza, J.L., Jaworsky, D.E., Borisy, F.F., Attramadal, H., Lefkowitz, R.J., and Ronnett, G.V. (1993). Beta-adrenergic receptor kinase-2 and beta-arrestin-2 as mediators of odorant-induced desensitization. Science 259, 825-829.

Dehaye, J.P., Nagy, A., Premkumar, A., and Turner, R.J. (2003). Identification of a functionally important conformation-sensitive region of the secretory Na+-K+-2Cl- cotransporter (NKCC1). J Biol Chem 278, 11811-11817.

Dellarole, A., and Grilli, M. (2008). Adult dorsal root ganglia sensory neurons express the early neuronal fate marker doublecortin. The Journal of comparative neurology 511, 318- 328.

Delpire, E., and Austin, T.M. (2010). Kinase regulation of Na+-K+-2Cl- cotransport in primary afferent neurons. J Physiol 588, 3365-3373.

Delpire, E., Lu, J., England, R., Dull, C., and Thorne, T. (1999). Deafness and imbalance associated with inactivation of the secretory Na-K-2Cl co-transporter. Nat Genet 22, 192- 195.

Delpire, E., Rauchman, M.I., Beier, D.R., Hebert, S.C., and Gullans, S.R. (1994). Molecular cloning and chromosome localization of a putative basolateral Na(+)-K(+)-2Cl- cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells. The Journal of biological chemistry 269, 25677-25683.

DeMaria, S., and Ngai, J. (2010). The cell biology of smell. J Cell Biol 191, 443-452. des Portes, V., Pinard, J.M., Billuart, P., Vinet, M.C., Koulakoff, A., Carrie, A., Gelot, A., Dupuis, E., Motte, J., Berwald-Netter, Y., et al. (1998). A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell 92, 51-61.

Dhallan, R.S., Yau, K.W., Schrader, K.A., and Reed, R.R. (1990). Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons. Nature 347, 184-187.

Bibliography

Dixon, M.J., Gazzard, J., Chaudhry, S.S., Sampson, N., Schulte, B.A., and Steel, K.P. (1999). Mutation of the Na-K-Cl co-transporter gene Slc12a2 results in deafness in mice. Human molecular genetics 8, 1579-1584.

Dowd, B.F., and Forbush, B. (2003). PASK (proline-alanine-rich STE20-related kinase), a regulatory kinase of the Na-K-Cl cotransporter (NKCC1). The Journal of biological chemistry 278, 27347-27353.

Drutel, G., Arrang, J.M., Diaz, J., Wisnewsky, C., Schwartz, K., and Schwartz, J.C. (1995). Cloning of OL1, a putative olfactory receptor and its expression in the developing rat heart. Receptors Channels 3, 33-40.

Dubin, A.E., and Dionne, V.E. (1994). Action potentials and chemosensitive conductances in the dendrites of olfactory neurons suggest new features for odor transduction. J Gen Physiol 103, 181-201.

Dulac, C., and Torello, A.T. (2003). Molecular detection of pheromone signals in mammals: from genes to behaviour. Nat Rev Neurosci 4, 551-562.

Dzhala, V.I., and Staley, K.J. (2003). Excitatory actions of endogenously released GABA contribute to initiation of ictal epileptiform activity in the developing hippocampus. The Journal of neuroscience : the official journal of the Society for Neuroscience 23, 1840- 1846.

Dzhala, V.I., Talos, D.M., Sdrulla, D.A., Brumback, A.C., Mathews, G.C., Benke, T.A., Delpire, E., Jensen, F.E., and Staley, K.J. (2005). NKCC1 transporter facilitates seizures in the developing brain. Nat Med 11, 1205-1213.

Endl, E., Hollmann, C., and Gerdes, J. (2001). Antibodies against the Ki-67 protein: assessment of the growth fraction and tools for cell cycle analysis. Methods Cell Biol 63, 399-418.

Ernst, A., Alkass, K., Bernard, S., Salehpour, M., Perl, S., Tisdale, J., Possnert, G., Druid, H., and Frisen, J. (2014). Neurogenesis in the striatum of the adult human brain. Cell 156, 1072-1083.

Bibliography

Evans, R.L., Park, K., Turner, R.J., Watson, G.E., Nguyen, H.V., Dennett, M.R., Hand, A.R., Flagella, M., Shull, G.E., and Melvin, J.E. (2000). Severe impairment of salivation in Na+/K+/2Cl- cotransporter (NKCC1)-deficient mice. The Journal of biological chemistry 275, 26720-26726.

Feingold, E.A., Penny, L.A., Nienhuis, A.W., and Forget, B.G. (1999). An olfactory receptor gene is located in the extended human beta-globin gene cluster and is expressed in erythroid cells. Genomics 61, 15-23.

Fenton, R.A., Cottingham, C.A., Stewart, G.S., Howorth, A., Hewitt, J.A., and Smith, C.P. (2002). Structure and characterization of the mouse UT-A gene (Slc14a2). Am J Physiol Renal Physiol 282, F630-638.

Firestein, S. (2001). How the olfactory system makes sense of scents. Nature 413, 211-218.

Flagella, M., Clarke, L.L., Miller, M.L., Erway, L.C., Giannella, R.A., Andringa, A., Gawenis, L.R., Kramer, J., Duffy, J.J., Doetschman, T., et al. (1999). Mice lacking the basolateral Na-K-2Cl cotransporter have impaired epithelial chloride secretion and are profoundly deaf. J Biol Chem 274, 26946-26955.

Flegel, C., Manteniotis, S., Osthold, S., Hatt, H., and Gisselmann, G. (2013). Expression profile of ectopic olfactory receptors determined by deep sequencing. PLoS One 8, e55368.

Flemmer, A.W., Gimenez, I., Dowd, B.F., Darman, R.B., and Forbush, B. (2002). Activation of the Na-K-Cl cotransporter NKCC1 detected with a phospho-specific antibody. J Biol Chem 277, 37551-37558.

Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M., Goridis, C., and Guillemot, F. (1998). The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons. Neuron 20, 483-494.

Freitag, J., Krieger, J., Strotmann, J., and Breer, H. (1995). Two classes of olfactory receptors in Xenopus laevis. Neuron 15, 1383-1392.

Frisch, D. (1967). Ultrastructure of mouse olfactory mucosa. Am J Anat 121, 87-120.

Bibliography

Fukuda, N., Yomogida, K., Okabe, M., and Touhara, K. (2004). Functional characterization of a mouse testicular olfactory receptor and its role in chemosensing and in regulation of sperm motility. J Cell Sci 117, 5835-5845.

Gagnon, K.B., and Delpire, E. (2010). Multiple pathways for protein phosphatase 1 (PP1) regulation of Na-K-2Cl cotransporter (NKCC1) function: the N-terminal tail of the Na-K- 2Cl cotransporter serves as a regulatory scaffold for Ste20-related proline/alanine-rich kinase (SPAK) AND PP1. The Journal of biological chemistry 285, 14115-14121.

Gagnon, K.B., and Delpire, E. (2013). Physiology of SLC12 transporters: lessons from inherited human genetic mutations and genetically engineered mouse knockouts. American journal of physiology Cell physiology 304, C693-714.

Gagnon, K.B., England, R., and Delpire, E. (2007). A single binding motif is required for SPAK activation of the Na-K-2Cl cotransporter. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 20, 131-142.

Gaillard, I., Rouquier, S., Chavanieu, A., Mollard, P., and Giorgi, D. (2004). Amino-acid changes acquired during evolution by olfactory receptor 912-93 modify the specificity of odorant recognition. Hum Mol Genet 13, 771-780.

Gamba, G. (2005). Molecular physiology and pathophysiology of electroneutral cation- chloride cotransporters. Physiol Rev 85, 423-493.

Gamba, G., Miyanoshita, A., Lombardi, M., Lytton, J., Lee, W.S., Hediger, M.A., and Hebert, S.C. (1994). Molecular cloning, primary structure, and characterization of two members of the mammalian electroneutral sodium-(potassium)-chloride cotransporter family expressed in kidney. The Journal of biological chemistry 269, 17713-17722.

Gamba, G., Saltzberg, S.N., Lombardi, M., Miyanoshita, A., Lytton, J., Hediger, M.A., Brenner, B.M., and Hebert, S.C. (1993). Primary structure and functional expression of a cDNA encoding the thiazide-sensitive, electroneutral sodium-chloride cotransporter. Proceedings of the National Academy of Sciences of the United States of America 90, 2749-2753.

Bibliography

Garaschuk, O., Hanse, E., and Konnerth, A. (1998). Developmental profile and synaptic origin of early network oscillations in the CA1 region of rat neonatal hippocampus. The Journal of physiology 507 ( Pt 1), 219-236.

Geck, P., Pietrzyk, C., Burckhardt, B.C., Pfeiffer, B., and Heinz, E. (1980). Electrically silent cotransport on Na+, K+ and Cl- in Ehrlich cells. Biochim Biophys Acta 600, 432- 447.

Gelis, L., Wolf, S., Hatt, H., Neuhaus, E.M., and Gerwert, K. (2012). Prediction of a ligand-binding niche within a human olfactory receptor by combining site-directed mutagenesis with dynamic homology modeling. Angew Chem Int Ed Engl 51, 1274-1278.

Gillen, C.M., Brill, S., Payne, J.A., and Forbush, B., 3rd (1996). Molecular cloning and functional expression of the K-Cl cotransporter from rabbit, rat, and human. A new member of the cation-chloride cotransporter family. The Journal of biological chemistry 271, 16237-16244.

Gleeson, J.G., Allen, K.M., Fox, J.W., Lamperti, E.D., Berkovic, S., Scheffer, I., Cooper, E.C., Dobyns, W.B., Minnerath, S.R., Ross, M.E., et al. (1998). Doublecortin, a brain- specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell 92, 63-72.

Glusman, G., Yanai, I., Rubin, I., and Lancet, D. (2001). The complete human olfactory subgenome. Genome Res 11, 685-702.

Godfrey, P.A., Malnic, B., and Buck, L.B. (2004). The mouse olfactory receptor gene family. Proc Natl Acad Sci U S A 101, 2156-2161.

Gold, G.H. (1999). Controversial issues in vertebrate olfactory transduction. Annu Rev Physiol 61, 857-871.

Gonzalez-Silva, C., Vera, J., Bono, M.R., Gonzalez-Billault, C., Baxter, B., Hansen, A., Lopez, R., Gibson, E.A., Restrepo, D., and Bacigalupo, J. (2013). Ca2+-activated Cl- channels of the ClCa family express in the cilia of a subset of rat olfactory sensory neurons. PLoS One 8, e69295.

100

Bibliography

Goode, S., and Perrimon, N. (1997). Inhibition of patterned cell shape change and cell invasion by Discs large during Drosophila oogenesis. Genes Dev 11, 2532-2544.

Goto, S., Oshima, T., Ikeda, K., Ueda, N., and Takasaka, T. (1997). Expression and localization of the Na-K-2Cl cotransporter in the rat cochlea. Brain Res 765, 324-326.

Graziadei, P.P., and Graziadei, G.A. (1979). Neurogenesis and neuron regeneration in the olfactory system of mammals. I. Morphological aspects of differentiation and structural organization of the olfactory sensory neurons. J Neurocytol 8, 1-18.

Grosmaitre, X., Santarelli, L.C., Tan, J., Luo, M., and Ma, M. (2007). Dual functions of mammalian olfactory sensory neurons as odor detectors and mechanical sensors. Nat Neurosci 10, 348-354.

Gulyas, A.I., Sik, A., Payne, J.A., Kaila, K., and Freund, T.F. (2001). The KCl cotransporter, KCC2, is highly expressed in the vicinity of excitatory synapses in the rat hippocampus. Eur J Neurosci 13, 2205-2217.

Haas, M., and Forbush, B., 3rd (2000). The Na-K-Cl cotransporter of secretory epithelia. Annu Rev Physiol 62, 515-534.

Haering, C., Kanageswaran, N., Bouvain, P., Scholz, P., Altmuller, J., Becker, C., Gisselmann, G., Waring-Bischof, J., and Hatt, H. (2015). Ion Transporter NKCC1 - Modulator of Neurogenesis in Murine Olfactory Neurons. J Biol Chem.

Hamann, S., Herrera-Perez, J.J., Zeuthen, T., and Alvarez-Leefmans, F.J. (2010). Cotransport of water by the Na+-K+-2Cl(-) cotransporter NKCC1 in mammalian epithelial cells. J Physiol 588, 4089-4101.

Hatt, H., Gisselmann, G., and Wetzel, C.H. (1999). Cloning, functional expression and characterization of a human olfactory receptor. Cell Mol Biol (Noisy-le-grand) 45, 285- 291.

He, Q., Nomura, T., Xu, J., and Contractor, A. (2014). The developmental switch in GABA polarity is delayed in fragile X mice. J Neurosci 34, 446-450.

Hebert, S.C., Mount, D.B., and Gamba, G. (2004). Molecular physiology of cation-coupled Cl- cotransport: the SLC12 family. Pflugers Arch 447, 580-593. 101

Bibliography

Hediger, M.A., Romero, M.F., Peng, J.B., Rolfs, A., Takanaga, H., and Bruford, E.A. (2004). The ABCs of solute carriers: physiological, pathological and therapeutic implications of human membrane transport proteinsIntroduction. Pflugers Arch 447, 465- 468.

Hengl, T., Kaneko, H., Dauner, K., Vocke, K., Frings, S., and Mohrlen, F. (2010). Molecular components of signal amplification in olfactory sensory cilia. Proc Natl Acad Sci U S A 107, 6052-6057.

Hu, S., Labuda, M.Z., Pandolfo, M., Goss, G.G., McDermid, H.E., and Ali, D.W. (2003). Variants of the KCNMB3 regulatory subunit of maxi BK channels affect channel inactivation. Physiol Genomics 15, 191-198.

Huard, J.M., Youngentob, S.L., Goldstein, B.J., Luskin, M.B., and Schwob, J.E. (1998). Adult olfactory epithelium contains multipotent progenitors that give rise to neurons and non-neural cells. J Comp Neurol 400, 469-486.

Hubner, C.A., Lorke, D.E., and Hermans-Borgmeyer, I. (2001). Expression of the Na-K- 2Cl-cotransporter NKCC1 during mouse development. Mech Dev 102, 267-269.

Ikeda, M., Toyoda, H., Yamada, J., Okabe, A., Sato, K., Hotta, Y., and Fukuda, A. (2003). Differential development of cation-chloride cotransporters and Cl- homeostasis contributes to differential GABAergic actions between developing rat visual cortex and dorsal lateral geniculate nucleus. Brain Res 984, 149-159.

Inoue, M., Hara, M., Zeng, X.T., Hirose, T., Ohnishi, S., Yasukura, T., Uriu, T., Omori, K., Minato, A., and Inagaki, C. (1991). An ATP-driven Cl- pump regulates Cl- concentrations in rat hippocampal neurons. Neurosci Lett 134, 75-78.

Isenring, P., and Forbush, B. (2001). Ion transport and ligand binding by the Na-K-Cl cotransporter, structure-function studies. Comp Biochem Physiol A Mol Integr Physiol 130, 487-497.

Jero, J., Coling, D.E., and Lalwani, A.K. (2001). The use of Preyer's reflex in evaluation of hearing in mice. Acta Otolaryngol 121, 585-589.

102

Bibliography

Ji, T., Liu, S., Zheng, L.F., Wang, Q., Dou, Z.F., Zhang, Y., and Zhu, J.X. (2012). Cellular distribution of NKCC2 in the gastric mucosa and its response to short-term osmotic shock. Cell Tissue Res 348, 155-165.

Jiang, G., Klein, J.D., and O'Neill, W.C. (2001). Growth factors stimulate the Na-K-2Cl cotransporter NKCC1 through a novel Cl(-)-dependent mechanism. Am J Physiol Cell Physiol 281, C1948-1953.

Jin, K., Minami, M., Lan, J.Q., Mao, X.O., Batteur, S., Simon, R.P., and Greenberg, D.A. (2001). Neurogenesis in dentate subgranular zone and rostral subventricular zone after focal cerebral ischemia in the rat. Proc Natl Acad Sci U S A 98, 4710-4715.

Jones, D.T., and Reed, R.R. (1989). Golf: an olfactory neuron specific-G protein involved in odorant signal transduction. Science 244, 790-795.

Kakigi, A., Nishimura, M., Takeda, T., Taguchi, D., and Nishioka, R. (2009). Expression of aquaporin1, 3, and 4, NKCC1, and NKCC2 in the human endolymphatic sac. Auris Nasus Larynx 36, 135-139.

Kanageswaran, N., Demond, M., Nagel, M., Schreiner, B.S., Baumgart, S., Scholz, P., Altmuller, J., Becker, C., Doerner, J.F., Conrad, H., et al. (2015). Deep Sequencing of the Murine Olfactory Receptor Neuron Transcriptome. PLoS One 10, e0113170.

Kaneko, H., Nakamura, T., and Lindemann, B. (2001). Noninvasive measurement of chloride concentration in rat olfactory receptor cells with use of a fluorescent dye. Am J Physiol Cell Physiol 280, C1387-1393.

Kaneko, H., Putzier, I., Frings, S., Kaupp, U.B., and Gensch, T. (2004). Chloride accumulation in mammalian olfactory sensory neurons. J Neurosci 24, 7931-7938.

Kang, N., Bahk, Y.Y., Lee, N., Jae, Y., Cho, Y.H., Ku, C.R., Byun, Y., Lee, E.J., Kim, M.S., and Koo, J. (2015). Olfactory receptor Olfr544 responding to azelaic acid regulates glucagon secretion in alpha-cells of mouse pancreatic islets. Biochemical and biophysical research communications.

103

Bibliography

Kaplan, M.R., Plotkin, M.D., Brown, D., Hebert, S.C., and Delpire, E. (1996). Expression of the mouse Na-K-2Cl cotransporter, mBSC2, in the terminal inner medullary collecting duct, the glomerular and extraglomerular mesangium, and the glomerular afferent arteriole. J Clin Invest 98, 723-730.

Karadsheh, M.F., Byun, N., Mount, D.B., and Delpire, E. (2004). Localization of the KCC4 potassium-chloride cotransporter in the nervous system. Neuroscience 123, 381- 391.

Karl, C., Couillard-Despres, S., Prang, P., Munding, M., Kilb, W., Brigadski, T., Plotz, S., Mages, W., Luhmann, H., Winkler, J., et al. (2005). Neuronal precursor-specific activity of a human doublecortin regulatory sequence. J Neurochem 92, 264-282.

Karpova, N.N., Pickenhagen, A., Lindholm, J., Tiraboschi, E., Kulesskaya, N., Agustsdottir, A., Antila, H., Popova, D., Akamine, Y., Bahi, A., et al. (2011). Fear erasure in mice requires synergy between antidepressant drugs and extinction training. Science 334, 1731-1734.

Kaske, S., Krasteva, G., Konig, P., Kummer, W., Hofmann, T., Gudermann, T., and Chubanov, V. (2007). TRPM5, a taste-signaling transient receptor potential ion-channel, is a ubiquitous signaling component in chemosensory cells. BMC Neurosci 8, 49.

Kee, N., Sivalingam, S., Boonstra, R., and Wojtowicz, J.M. (2002). The utility of Ki-67 and BrdU as proliferative markers of adult neurogenesis. J Neurosci Methods 115, 97-105.

Keller, A., and Vosshall, L.B. (2008). Better smelling through genetics: mammalian odor perception. Curr Opin Neurobiol 18, 364-369.

Khazipov, R., Khalilov, I., Tyzio, R., Morozova, E., Ben-Ari, Y., and Holmes, G.L. (2004). Developmental changes in GABAergic actions and seizure susceptibility in the rat hippocampus. The European journal of neuroscience 19, 590-600.

Khazipov, R., Leinekugel, X., Khalilov, I., Gaiarsa, J.L., and Ben-Ari, Y. (1997a). Synchronization of GABAergic interneuronal network in CA3 subfield of neonatal rat hippocampal slices. The Journal of physiology 498 ( Pt 3), 763-772.

104

Bibliography

Khazipov, R., Leinekugel, X., Khalilov, I., Gaiarsa, J.L., and Ben-Ari, Y. (1997b). Synchronization of GABAergic interneuronal network in CA3 subfield of neonatal rat hippocampal slices. J Physiol 498 ( Pt 3), 763-772.

Kidokoro, M., Nakamoto, T., Mukaibo, T., Kondo, Y., Munemasa, T., Imamura, A., Masaki, C., and Hosokawa, R. (2014). Na(+)-K(+)-2Cl(-) cotransporter-mediated fluid secretion increases under hypotonic osmolarity in the mouse submandibular salivary gland. American journal of physiology Renal physiology 306, F1155-1160.

Kim, K.H., Shcheynikov, N., Wang, Y., and Muallem, S. (2005). SLC26A7 is a Cl- channel regulated by intracellular pH. J Biol Chem 280, 6463-6470.

Kim, K.X., Sanneman, J.D., Kim, H.M., Harbidge, D.G., Xu, J., Soleimani, M., Wangemann, P., and Marcus, D.C. (2014). Slc26a7 chloride channel activity and localization in mouse Reissner's membrane epithelium. PLoS One 9, e97191.

Klasen, K., Corey, E.A., Kuck, F., Wetzel, C.H., Hatt, H., and Ache, B.W. (2010). Odorant-stimulated phosphoinositide signaling in mammalian olfactory receptor neurons. Cell Signal 22, 150-157.

Kleene, S.J. (2008). The electrochemical basis of odor transduction in vertebrate olfactory cilia. Chem Senses 33, 839-859.

Klenoff, J.R., and Greer, C.A. (1998). Postnatal development of olfactory receptor cell axonal arbors. J Comp Neurol 390, 256-267.

Kosiek, O., Busque, S.M., Foller, M., Shcheynikov, N., Kirchhoff, P., Bleich, M., Muallem, S., and Geibel, J.P. (2007). SLC26A7 can function as a chloride-loading mechanism in parietal cells. Pflugers Arch 454, 989-998.

Kramer, R.H., and Siegelbaum, S.A. (1992). Intracellular Ca2+ regulates the sensitivity of cyclic nucleotide-gated channels in olfactory receptor neurons. Neuron 9, 897-906.

Krautwurst, D., Yau, K.W., and Reed, R.R. (1998). Identification of ligands for olfactory receptors by functional expression of a receptor library. Cell 95, 917-926.

105

Bibliography

Kucherenko, Y.V., Wagner-Britz, L., Bernhardt, I., and Lang, F. (2013). Effect of chloride channel inhibitors on cytosolic Ca2+ levels and Ca2+-activated K+ (Gardos) channel activity in human red blood cells. J Membr Biol 246, 315-326.

Kurahashi, T., and Menini, A. (1997). Mechanism of odorant adaptation in the olfactory receptor cell. Nature 385, 725-729.

Kurahashi, T., and Yau, K.W. (1993). Co-existence of cationic and chloride components in odorant-induced current of vertebrate olfactory receptor cells. Nature 363, 71-74.

Kurihara, K., Moore-Hoon, M.L., Saitoh, M., and Turner, R.J. (1999). Characterization of a phosphorylation event resulting in upregulation of the salivary Na(+)-K(+)-2Cl(-) cotransporter. The American journal of physiology 277, C1184-1193.

Kurschat, C.E., Shmukler, B.E., Jiang, L., Hevi, S., Kim, E.H., Stewart, A.K., and Alper, S.L. (2008). Mouse strain-specific coding polymorphism in the Slc4a2/Ae2 gene encodes Ae2c2 variants differing in isoform-specific dominant negative activity. Exp Physiol 93, 458-467.

Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory- efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25.

Leinekugel, X., Medina, I., Khalilov, I., Ben-Ari, Y., and Khazipov, R. (1997). Ca2+ oscillations mediated by the synergistic excitatory actions of GABA(A) and NMDA receptors in the neonatal hippocampus. Neuron 18, 243-255.

Lendahl, U., Zimmerman, L.B., and McKay, R.D. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60, 585-595.

Lerma, J., and Martin del Rio, R. (1992). Chloride transport blockers prevent N-methyl-D- aspartate receptor-channel complex activation. Mol Pharmacol 41, 217-222.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., and Durbin, R. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079. 106

Bibliography

Li, X.F., Kraev, A.S., and Lytton, J. (2002). Molecular cloning of a fourth member of the potassium-dependent sodium-calcium exchanger gene family, NCKX4. J Biol Chem 277, 48410-48417.

Lister, R., O'Malley, R.C., Tonti-Filippini, J., Gregory, B.D., Berry, C.C., Millar, A.H., and Ecker, J.R. (2008). Highly integrated single-base resolution maps of the epigenome in Arabidopsis. Cell 133, 523-536.

Liu, M., Chen, T.Y., Ahamed, B., Li, J., and Yau, K.W. (1994). Calcium-calmodulin modulation of the olfactory cyclic nucleotide-gated cation channel. Science 266, 1348- 1354.

Liu, Q., and Wong-Riley, M.T. (2012). Postnatal development of Na(+)-K(+)-2Cl(-) cotransporter 1 and K(+)-Cl(-) co-transporter 2 immunoreactivity in multiple brain stem respiratory nuclei of the rat. Neuroscience 210, 1-20.

Loo, D.D., Eskandari, S., Boorer, K.J., Sarkar, H.K., and Wright, E.M. (2000). Role of Cl- in electrogenic Na+-coupled cotransporters GAT1 and SGLT1. J Biol Chem 275, 37414- 37422.

Lopez, F., Delgado, R., Lopez, R., Bacigalupo, J., and Restrepo, D. (2014). Transduction for pheromones in the main olfactory epithelium is mediated by the Ca2+ -activated channel TRPM5. J Neurosci 34, 3268-3278.

Lowe, G., and Gold, G.H. (1993). Nonlinear amplification by calcium-dependent chloride channels in olfactory receptor cells. Nature 366, 283-286.

Lowe, G., Nakamura, T., and Gold, G.H. (1989). Adenylate cyclase mediates olfactory transduction for a wide variety of odorants. Proc Natl Acad Sci U S A 86, 5641-5645.

Lu, K.T., Huang, T.C., Wang, J.Y., You, Y.S., Chou, J.L., Chan, M.W., Wo, P.Y., Amstislavskaya, T.G., Tikhonova, M.A., and Yang, Y.L. (2014). NKCC1 mediates traumatic brain injury-induced hippocampal neurogenesis through CREB phosphorylation and HIF-1alpha expression. Pflugers Arch.

Luo, M., Fee, M.S., and Katz, L.C. (2003). Encoding pheromonal signals in the accessory olfactory bulb of behaving mice. Science 299, 1196-1201.

107

Bibliography

Lytle, C., Xu, J.C., Biemesderfer, D., and Forbush, B., 3rd (1995). Distribution and diversity of Na-K-Cl cotransport proteins: a study with monoclonal antibodies. Am J Physiol 269, C1496-1505.

Ma, M., Grosmaitre, X., Iwema, C.L., Baker, H., Greer, C.A., and Shepherd, G.M. (2003). Olfactory signal transduction in the mouse septal organ. J Neurosci 23, 317-324.

Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J.L., and Anderson, D.J. (1998). neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 20, 469-482.

Ma, Q., Kintner, C., and Anderson, D.J. (1996). Identification of neurogenin, a vertebrate neuronal determination gene. Cell 87, 43-52.

Mackay-Sim, A., and Kittel, P.W. (1991). On the Life Span of Olfactory Receptor Neurons. Eur J Neurosci 3, 209-215.

Malnic, B., Hirono, J., Sato, T., and Buck, L.B. (1999). Combinatorial receptor codes for odors. Cell 96, 713-723.

Mamasuew, K., Hofmann, N., Breer, H., and Fleischer, J. (2011). Grueneberg ganglion neurons are activated by a defined set of odorants. Chem Senses 36, 271-282.

Mansouri, A., Hallonet, M., and Gruss, P. (1996). Pax genes and their roles in cell differentiation and development. Curr Opin Cell Biol 8, 851-857.

Massberg, D., Simon, A., Haussinger, D., Keitel, V., Gisselmann, G., Conrad, H., and Hatt, H. (2015). Monoterpene (-)-citronellal affects hepatocarcinoma cell signaling via an olfactory receptor. Archives of biochemistry and biophysics 566, 100-109.

Mejia-Gervacio, S., Murray, K., and Lledo, P.M. (2011). NKCC1 controls GABAergic signaling and neuroblast migration in the postnatal forebrain. Neural Dev 6, 4.

Meyer, J.W., Flagella, M., Sutliff, R.L., Lorenz, J.N., Nieman, M.L., Weber, C.S., Paul, R.J., and Shull, G.E. (2002). Decreased blood pressure and vascular smooth muscle tone in mice lacking basolateral Na(+)-K(+)-2Cl(-) cotransporter. Am J Physiol Heart Circ Physiol 283, H1846-1855.

108

Bibliography

Mombaerts, P. (2001). The human repertoire of odorant receptor genes and pseudogenes. Annu Rev Genomics Hum Genet 2, 493-510.

Mombaerts, P. (2004a). Genes and ligands for odorant, vomeronasal and taste receptors. Nat Rev Neurosci 5, 263-278.

Mombaerts, P. (2004b). Odorant receptor gene choice in olfactory sensory neurons: the one receptor-one neuron hypothesis revisited. Curr Opin Neurobiol 14, 31-36.

Mombaerts, P. (2006). Axonal wiring in the mouse olfactory system. Annu Rev Cell Dev Biol 22, 713-737.

Moore-Hoon, M.L., and Turner, R.J. (2000). The structural unit of the secretory Na+-K+- 2Cl- cotransporter (NKCC1) is a homodimer. Biochemistry 39, 3718-3724.

Morgans, C.W., and Kopito, R.R. (1993). Association of the brain anion exchanger, AE3, with the repeat domain of ankyrin. J Cell Sci 105 ( Pt 4), 1137-1142.

Mori, K., Nagao, H., and Yoshihara, Y. (1999). The olfactory bulb: coding and processing of odor molecule information. Science 286, 711-715.

Mori, K., Takahashi, Y.K., Igarashi, K.M., and Yamaguchi, M. (2006). Maps of odorant molecular features in the Mammalian olfactory bulb. Physiol Rev 86, 409-433.

Moriguchi, T., Urushiyama, S., Hisamoto, N., Iemura, S., Uchida, S., Natsume, T., Matsumoto, K., and Shibuya, H. (2005). WNK1 regulates phosphorylation of cation- chloride-coupled cotransporters via the STE20-related kinases, SPAK and OSR1. The Journal of biological chemistry 280, 42685-42693.

Morita, K., Furuse, M., Fujimoto, K., and Tsukita, S. (1999). Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands. Proc Natl Acad Sci U S A 96, 511-516.

Mount, D.B., Mercado, A., Song, L., Xu, J., George, A.L., Jr., Delpire, E., and Gamba, G. (1999). Cloning and characterization of KCC3 and KCC4, new members of the cation- chloride cotransporter gene family. The Journal of biological chemistry 274, 16355-16362.

109

Bibliography

Murdoch, B., DelConte, C., and Garcia-Castro, M.I. (2010). Embryonic Pax7-expressing progenitors contribute multiple cell types to the postnatal olfactory epithelium. J Neurosci 30, 9523-9532.

Murray, R.C., Navi, D., Fesenko, J., Lander, A.D., and Calof, A.L. (2003). Widespread defects in the primary olfactory pathway caused by loss of Mash1 function. J Neurosci 23, 1769-1780.

Nacher, J., Crespo, C., and McEwen, B.S. (2001). Doublecortin expression in the adult rat telencephalon. Eur J Neurosci 14, 629-644.

Nagalakshmi, U., Wang, Z., Waern, K., Shou, C., Raha, D., Gerstein, M., and Snyder, M. (2008). The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320, 1344-1349.

Nakajima, K., Miyazaki, H., Niisato, N., and Marunaka, Y. (2007). Essential role of NKCC1 in NGF-induced neurite outgrowth. Biochem Biophys Res Commun 359, 604- 610.

Nakajima, K., Niisato, N., and Marunaka, Y. (2011). Quercetin stimulates NGF-induced neurite outgrowth in PC12 cells via activation of Na(+)/K(+)/2Cl(-) cotransporter. Cell Physiol Biochem 28, 147-156.

Nakamura, T., and Gold, G.H. (1987). A cyclic nucleotide-gated conductance in olfactory receptor cilia. Nature 325, 442-444.

Nei, M., and Rooney, A.P. (2005). Concerted and birth-and-death evolution of multigene families. Annu Rev Genet 39, 121-152.

Nickell, W.T., Kleene, N.K., Gesteland, R.C., and Kleene, S.J. (2006). Neuronal chloride accumulation in olfactory epithelium of mice lacking NKCC1. J Neurophysiol 95, 2003- 2006.

Nickell, W.T., Kleene, N.K., and Kleene, S.J. (2007). Mechanisms of neuronal chloride accumulation in intact mouse olfactory epithelium. J Physiol 583, 1005-1020.

Niimura, Y., and Nei, M. (2007). Extensive gains and losses of olfactory receptor genes in mammalian evolution. PLoS One 2, e708. 110

Bibliography

Ogura, T., Krosnowski, K., Zhang, L., Bekkerman, M., and Lin, W. (2010). Chemoreception regulates chemical access to mouse vomeronasal organ: role of solitary chemosensory cells. PLoS One 5, e11924.

Otaki, J.M., Yamamoto, H., and Firestein, S. (2004). Odorant receptor expression in the mouse cerebral cortex. J Neurobiol 58, 315-327.

Ottoson, D. (1955). Analysis of the electrical activity of the olfactory epithelium. Acta Physiol Scand Suppl 35, 1-83.

Ottoson, D., and Shepherd, G.M. (1967). Experiments and concepts in olfactory physiology. Prog Brain Res 23, 83-138.

Pace, A.J., Lee, E., Athirakul, K., Coffman, T.M., O'Brien, D.A., and Koller, B.H. (2000). Failure of spermatogenesis in mouse lines deficient in the Na(+)-K(+)-2Cl(-) cotransporter. J Clin Invest 105, 441-450.

Panet, R., and Atlan, H. (1991). Stimulation of bumetanide-sensitive Na+/K+/Cl- cotransport by different mitogens in synchronized human skin fibroblasts is essential for cell proliferation. J Cell Biol 114, 337-342.

Panet, R., Eliash, M., and Atlan, H. (2006). Na+/K+/Cl- cotransporter activates MAP- kinase cascade downstream to protein kinase C, and upstream to MEK. J Cell Physiol 206, 578-585.

Panet, R., Eliash, M., Pick, M., and Atlan, H. (2002). Na(+)/K(+)/Cl(-) cotransporter activates mitogen-activated protein kinase in fibroblasts and lymphocytes. J Cell Physiol 190, 227-237.

Panet, R., Marcus, M., and Atlan, H. (2000). Overexpression of the Na(+)/K(+)/Cl(-) cotransporter gene induces cell proliferation and phenotypic transformation in mouse fibroblasts. J Cell Physiol 182, 109-118.

Panet, R., Markus, M., and Atlan, H. (1994). Bumetanide and furosemide inhibited vascular endothelial cell proliferation. J Cell Physiol 158, 121-127.

111

Bibliography

Park, J.H., and Saier, M.H., Jr. (1996). Phylogenetic, structural and functional characteristics of the Na-K-Cl cotransporter family. The Journal of membrane biology 149, 161-168.

Parmentier, M., Libert, F., Schurmans, S., Schiffmann, S., Lefort, A., Eggerickx, D., Ledent, C., Mollereau, C., Gerard, C., Perret, J., et al. (1992). Expression of members of the putative olfactory receptor gene family in mammalian germ cells. Nature 355, 453-455.

Paschaki, M., Cammas, L., Muta, Y., Matsuoka, Y., Mak, S.S., Rataj-Baniowska, M., Fraulob, V., Dolle, P., and Ladher, R.K. (2013). Retinoic acid regulates olfactory progenitor cell fate and differentiation. Neural Dev 8, 13.

Payne, J.A., and Forbush, B., 3rd (1994). Alternatively spliced isoforms of the putative renal Na-K-Cl cotransporter are differentially distributed within the rabbit kidney. Proc Natl Acad Sci U S A 91, 4544-4548.

Payne, J.A., Rivera, C., Voipio, J., and Kaila, K. (2003). Cation-chloride co-transporters in neuronal communication, development and trauma. Trends Neurosci 26, 199-206.

Payne, J.A., Stevenson, T.J., and Donaldson, L.F. (1996). Molecular characterization of a putative K-Cl cotransporter in rat brain. A neuronal-specific isoform. The Journal of biological chemistry 271, 16245-16252.

Payne, J.A., Xu, J.C., Haas, M., Lytle, C.Y., Ward, D., and Forbush, B., 3rd (1995). Primary structure, functional expression, and chromosomal localization of the bumetanide- sensitive Na-K-Cl cotransporter in human colon. J Biol Chem 270, 17977-17985.

Pedersen, M., Carmosino, M., and Forbush, B. (2008). Intramolecular and intermolecular fluorescence resonance energy transfer in fluorescent protein-tagged Na-K-Cl cotransporter (NKCC1): sensitivity to regulatory conformational change and cell volume. The Journal of biological chemistry 283, 2663-2674.

Persuy, M.A., Sanz, G., Tromelin, A., Thomas-Danguin, T., Gibrat, J.F., and Pajot-Augy, E. (2015). Mammalian Olfactory Receptors: Molecular Mechanisms of Odorant Detection, 3D-Modeling, and Structure-Activity Relationships. Prog Mol Biol Transl Sci 130, 1-36.

112

Bibliography

Petrovic, S., Ju, X., Barone, S., Seidler, U., Alper, S.L., Lohi, H., Kere, J., and Soleimani, M. (2003). Identification of a basolateral Cl-/HCO3- exchanger specific to gastric parietal cells. Am J Physiol Gastrointest Liver Physiol 284, G1093-1103.

Pfeffer, C.K., Stein, V., Keating, D.J., Maier, H., Rinke, I., Rudhard, Y., Hentschke, M., Rune, G.M., Jentsch, T.J., and Hubner, C.A. (2009). NKCC1-dependent GABAergic excitation drives synaptic network maturation during early hippocampal development. J Neurosci 29, 3419-3430.

Piechotta, K., Garbarini, N., England, R., and Delpire, E. (2003). Characterization of the interaction of the stress kinase SPAK with the Na+-K+-2Cl- cotransporter in the nervous system: evidence for a scaffolding role of the kinase. The Journal of biological chemistry 278, 52848-52856.

Pieraut, S., Laurent-Matha, V., Sar, C., Hubert, T., Mechaly, I., Hilaire, C., Mersel, M., Delpire, E., Valmier, J., and Scamps, F. (2007). NKCC1 phosphorylation stimulates neurite growth of injured adult sensory neurons. J Neurosci 27, 6751-6759.

Pifferi, S., Cenedese, V., and Menini, A. (2012). Anoctamin 2/TMEM16B: a calcium- activated chloride channel in olfactory transduction. Exp Physiol 97, 193-199.

Piirsoo, M., Meijer, D., and Timmusk, T. (2009). Expression analysis of the CLCA gene family in mouse and human with emphasis on the nervous system. BMC Dev Biol 9, 10.

Pilpel, Y., and Lancet, D. (1999). The variable and conserved interfaces of modeled olfactory receptor proteins. Protein Sci 8, 969-977.

Pinching, A.J., and Powell, T.P. (1971). The neuropil of the glomeruli of the olfactory bulb. Journal of cell science 9, 347-377.

Piperno, G., LeDizet, M., and Chang, X.J. (1987). Microtubules containing acetylated alpha-tubulin in mammalian cells in culture. J Cell Biol 104, 289-302.

Pluznick, J.L., Zou, D.J., Zhang, X., Yan, Q., Rodriguez-Gil, D.J., Eisner, C., Wells, E., Greer, C.A., Wang, T., Firestein, S., et al. (2009). Functional expression of the olfactory signaling system in the kidney. Proceedings of the National Academy of Sciences of the United States of America 106, 2059-2064.

113

Bibliography

Pontes, A., Zhang, Y., and Hu, W. (2013). Novel functions of GABA signaling in adult neurogenesis. Front Biol (Beijing) 8.

Potter, S.M., Zheng, C., Koos, D.S., Feinstein, P., Fraser, S.E., and Mombaerts, P. (2001). Structure and emergence of specific olfactory glomeruli in the mouse. J Neurosci 21, 9713- 9723.

Puskarjov, M., Kahle, K.T., Ruusuvuori, E., and Kaila, K. (2014). Pharmacotherapeutic targeting of cation-chloride cotransporters in neonatal seizures. Epilepsia 55, 806-818.

Radtke, D. (2012). Chloride homeostasis and chemoreception in trigeminal sensory neurons of mice. Department of Cellphysiology (Bochum, Ruhr-University Bochum).

Rahmati, N., Kunzelmann, K., Xu, J., Barone, S., Sirianant, L., De Zeeuw, C.I., and Soleimani, M. (2013). Slc26a11 is prominently expressed in the brain and functions as a chloride channel: expression in Purkinje cells and stimulation of V H(+)-ATPase. Pflugers Arch 465, 1583-1597.

Ramamoorthy, S., Leibach, F.H., Mahesh, V.B., Han, H., Yang-Feng, T., Blakely, R.D., and Ganapathy, V. (1994). Functional characterization and chromosomal localization of a cloned taurine transporter from human placenta. Biochem J 300 ( Pt 3), 893-900.

Rasche, S., Toetter, B., Adler, J., Tschapek, A., Doerner, J.F., Kurtenbach, S., Hatt, H., Meyer, H., Warscheid, B., and Neuhaus, E.M. (2010). Tmem16b is specifically expressed in the cilia of olfactory sensory neurons. Chem Senses 35, 239-245.

Reiner, O., Coquelle, F.M., Peter, B., Levy, T., Kaplan, A., Sapir, T., Orr, I., Barkai, N., Eichele, G., and Bergmann, S. (2006). The evolving doublecortin (DCX) superfamily. BMC Genomics 7, 188.

Reisert, J., Bauer, P.J., Yau, K.W., and Frings, S. (2003). The Ca-activated Cl channel and its control in rat olfactory receptor neurons. J Gen Physiol 122, 349-363.

Reisert, J., Lai, J., Yau, K.W., and Bradley, J. (2005). Mechanism of the excitatory Cl- response in mouse olfactory receptor neurons. Neuron 45, 553-561.

114

Bibliography

Reisert, J., Yau, K.W., and Margolis, F.L. (2007). Olfactory marker protein modulates the cAMP kinetics of the odour-induced response in cilia of mouse olfactory receptor neurons. J Physiol 585, 731-740.

Renart, J., Reiser, J., and Stark, G.R. (1979). Transfer of proteins from gels to diazobenzyloxymethyl-paper and detection with antisera: a method for studying antibody specificity and antigen structure. Proc Natl Acad Sci U S A 76, 3116-3120.

Reuter, D., Zierold, K., Schroder, W.H., and Frings, S. (1998). A depolarizing chloride current contributes to chemoelectrical transduction in olfactory sensory neurons in situ. J Neurosci 18, 6623-6630.

Richardson, C., and Alessi, D.R. (2008). The regulation of salt transport and blood pressure by the WNK-SPAK/OSR1 signalling pathway. Journal of cell science 121, 3293- 3304.

Rivera, C., Voipio, J., Payne, J.A., Ruusuvuori, E., Lahtinen, H., Lamsa, K., Pirvola, U., Saarma, M., and Kaila, K. (1999). The K+/Cl- co-transporter KCC2 renders GABA hyperpolarizing during neuronal maturation. Nature 397, 251-255.

Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., and Pachter, L. (2011). Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol 12, R22.

Roberts, S., Delury, C., and Marsh, E. (2012). The PDZ protein discs-large (DLG): the 'Jekyll and Hyde' of the epithelial polarity proteins. FEBS J 279, 3549-3558.

Rovati, G.E., Capra, V., and Neubig, R.R. (2007). The highly conserved DRY motif of class A G protein-coupled receptors: beyond the ground state. Molecular pharmacology 71, 959-964.

Royet, J.P., and Plailly, J. (2004). Lateralization of olfactory processes. Chem Senses 29, 731-745.

Rozynkowski, M. (2011). Master thesis: Molekulare Mechanismen der Chemosensorik in der Maus (Mus musculus). Department of Cellphysiology (Bochum, Ruhr-University Bochum), pp. 81.

115

Bibliography

Saito, H., Chi, Q., Zhuang, H., Matsunami, H., and Mainland, J.D. (2009). Odor coding by a Mammalian receptor repertoire. Sci Signal 2, ra9.

Sam, M., Vora, S., Malnic, B., Ma, W., Novotny, M.V., and Buck, L.B. (2001). Neuropharmacology. Odorants may arouse instinctive behaviours. Nature 412, 142.

Schild, D., and Restrepo, D. (1998). Transduction mechanisms in vertebrate olfactory receptor cells. Physiol Rev 78, 429-466.

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682.

Schleicher, S., Boekhoff, I., Arriza, J., Lefkowitz, R.J., and Breer, H. (1993). A beta- adrenergic receptor kinase-like enzyme is involved in olfactory signal termination. Proc Natl Acad Sci U S A 90, 1420-1424.

Schlessinger, A., Khuri, N., Giacomini, K.M., and Sali, A. (2013). Molecular modeling and ligand docking for solute carrier (SLC) transporters. Curr Top Med Chem 13, 843-856.

Schmid, A., Pyrski, M., Biel, M., Leinders-Zufall, T., and Zufall, F. (2010). Grueneberg ganglion neurons are finely tuned cold sensors. J Neurosci 30, 7563-7568.

Schobel, N., Radtke, D., Lubbert, M., Gisselmann, G., Lehmann, R., Cichy, A., Schreiner, B.S., Altmuller, J., Spector, A.C., Spehr, J., et al. (2012). Trigeminal ganglion neurons of mice show intracellular chloride accumulation and chloride-dependent amplification of capsaicin-induced responses. PLoS One 7, e48005.

Schwob, J.E. (2002). Neural regeneration and the peripheral olfactory system. Anat Rec 269, 33-49.

Scott, J.W., and Scott-Johnson, P.E. (2002). The electroolfactogram: a review of its history and uses. Microsc Res Tech 58, 152-160.

Shiozaki, A., Nako, Y., Ichikawa, D., Konishi, H., Komatsu, S., Kubota, T., Fujiwara, H., Okamoto, K., Kishimoto, M., Marunaka, Y., et al. (2014). Role of the Na (+)/K (+)/2Cl(-) cotransporter NKCC1 in cell cycle progression in human esophageal squamous cell carcinoma. World journal of gastroenterology : WJG 20, 6844-6859. 116

Bibliography

Simard, C.F., Brunet, G.M., Daigle, N.D., Montminy, V., Caron, L., and Isenring, P. (2004). Self-interacting domains in the C terminus of a cation-Cl- cotransporter described for the first time. J Biol Chem 279, 40769-40777.

Sinnarajah, S., Dessauer, C.W., Srikumar, D., Chen, J., Yuen, J., Yilma, S., Dennis, J.C., Morrison, E.E., Vodyanoy, V., and Kehrl, J.H. (2001). RGS2 regulates signal transduction in olfactory neurons by attenuating activation of adenylyl cyclase III. Nature 409, 1051- 1055.

Smith, D.W., Thach, S., Marshall, E.L., Mendoza, M.G., and Kleene, S.J. (2008a). Mice lacking NKCC1 have normal olfactory sensitivity. Physiol Behav 93, 44-49.

Smith, L., Smallwood, N., Altman, A., and Liedtke, C.M. (2008b). PKCdelta acts upstream of SPAK in the activation of NKCC1 by hyperosmotic stress in human airway epithelial cells. J Biol Chem 283, 22147-22156.

Somasekharan, S., Monette, M.Y., and Forbush, B. (2013). Functional expression of human NKCC1 from a synthetic cassette-based cDNA: introduction of extracellular epitope tags and removal of cysteines. PLoS One 8, e82060.

Somasekharan, S., Tanis, J., and Forbush, B. (2012). Loop diuretic and ion-binding residues revealed by scanning mutagenesis of transmembrane helix 3 (TM3) of Na-K-Cl cotransporter (NKCC1). J Biol Chem 287, 17308-17317.

Spehr, M., Gisselmann, G., Poplawski, A., Riffell, J.A., Wetzel, C.H., Zimmer, R.K., and Hatt, H. (2003). Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science 299, 2054-2058.

Spehr, M., Kelliher, K.R., Li, X.H., Boehm, T., Leinders-Zufall, T., and Zufall, F. (2006). Essential role of the main olfactory system in social recognition of major histocompatibility complex peptide ligands. J Neurosci 26, 1961-1970.

Spehr, M., Wetzel, C.H., Hatt, H., and Ache, B.W. (2002). 3-phosphoinositides modulate cyclic nucleotide signaling in olfactory receptor neurons. Neuron 33, 731-739.

117

Bibliography

Stein, V., Hermans-Borgmeyer, I., Jentsch, T.J., and Hubner, C.A. (2004). Expression of the KCl cotransporter KCC2 parallels neuronal maturation and the emergence of low intracellular chloride. The Journal of comparative neurology 468, 57-64.

Stephan, A.B., Shum, E.Y., Hirsh, S., Cygnar, K.D., Reisert, J., and Zhao, H. (2009). ANO2 is the cilial calcium-activated chloride channel that may mediate olfactory amplification. Proc Natl Acad Sci U S A 106, 11776-11781.

Streit, S., Michalski, C.W., Erkan, M., Kleeff, J., and Friess, H. (2009). Northern blot analysis for detection and quantification of RNA in pancreatic cancer cells and tissues. Nature protocols 4, 37-43.

Su, C.Y., Menuz, K., and Carlson, J.R. (2009). Olfactory perception: receptors, cells, and circuits. Cell 139, 45-59.

Sullivan, S.L., Adamson, M.C., Ressler, K.J., Kozak, C.A., and Buck, L.B. (1996). The chromosomal distribution of mouse odorant receptor genes. Proc Natl Acad Sci U S A 93, 884-888.

Sun, L., Yu, Z., Wang, W., and Liu, X. (2012). Both NKCC1 and anion exchangers contribute to Cl(-) accumulation in postnatal forebrain neuronal progenitors. Eur J Neurosci 35, 661-672.

Terashima, K., Takeuchi, A., Sarai, N., Matsuoka, S., Shim, E.B., Leem, C.H., and Noma, A. (2006). Modelling Cl- homeostasis and volume regulation of the cardiac cell. Philos Trans A Math Phys Eng Sci 364, 1245-1265.

Tian, H., and Ma, M. (2008). Activity plays a role in eliminating olfactory sensory neurons expressing multiple odorant receptors in the mouse septal organ. Mol Cell Neurosci 38, 484-488.

Tirindelli, R., Dibattista, M., Pifferi, S., and Menini, A. (2009). From pheromones to behavior. Physiol Rev 89, 921-956.

Touhara, K., Sengoku, S., Inaki, K., Tsuboi, A., Hirono, J., Sato, T., Sakano, H., and Haga, T. (1999). Functional identification and reconstitution of an odorant receptor in single olfactory neurons. Proc Natl Acad Sci U S A 96, 4040-4045.

118

Bibliography

Trapnell, C., Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111.

Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D.R., Pimentel, H., Salzberg, S.L., Rinn, J.L., and Pachter, L. (2012). Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7, 562-578.

Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28, 511-515.

Triller, A., Boulden, E.A., Churchill, A., Hatt, H., Englund, J., Spehr, M., and Sell, C.S. (2008). Odorant-receptor interactions and odor percept: a chemical perspective. Chem Biodivers 5, 862-886.

Ukhanov, K., Corey, E.A., Brunert, D., Klasen, K., and Ache, B.W. (2010). Inhibitory odorant signaling in Mammalian olfactory receptor neurons. J Neurophysiol 103, 1114- 1122.

Veitinger, T., Riffell, J.R., Veitinger, S., Nascimento, J.M., Triller, A., Chandsawangbhuwana, C., Schwane, K., Geerts, A., Wunder, F., Berns, M.W., et al. (2011). Chemosensory Ca2+ dynamics correlate with diverse behavioral phenotypes in human sperm. The Journal of biological chemistry 286, 17311-17325.

Verkman, A.S., Sellers, M.C., Chao, A.C., Leung, T., and Ketcham, R. (1989). Synthesis and characterization of improved chloride-sensitive fluorescent indicators for biological applications. Anal Biochem 178, 355-361.

Vitari, A.C., Deak, M., Morrice, N.A., and Alessi, D.R. (2005). The WNK1 and WNK4 protein kinases that are mutated in Gordon's hypertension syndrome phosphorylate and activate SPAK and OSR1 protein kinases. The Biochemical journal 391, 17-24.

119

Bibliography

Vitari, A.C., Thastrup, J., Rafiqi, F.H., Deak, M., Morrice, N.A., Karlsson, H.K., and Alessi, D.R. (2006). Functional interactions of the SPAK/OSR1 kinases with their upstream activator WNK1 and downstream substrate NKCC1. The Biochemical journal 397, 223-231.

Vogt, R.G., Prestwich, G.D., and Lerner, M.R. (1991). Odorant-binding-protein subfamilies associate with distinct classes of olfactory receptor neurons in insects. Journal of neurobiology 22, 74-84.

Wang, S., Zhang, X.Q., Song, C.G., Xiao, T., Zhao, M., Zhu, G., and Zhao, C.S. (2015). In vivo effects of bumetanide at brain concentrations incompatible with NKCC1 inhibition on newborn DGC structure and spontaneous EEG seizures following hypoxia-induced neonatal seizures. Neuroscience 286, 203-215.

Wang, Z., Bildin, V.N., Yang, H., Capo-Aponte, J.E., Yang, Y., and Reinach, P.S. (2011). Dependence of corneal epithelial cell proliferation on modulation of interactions between ERK1/2 and NKCC1. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 28, 703-714.

Weber, M., Pehl, U., Breer, H., and Strotmann, J. (2002). Olfactory receptor expressed in ganglia of the autonomic nervous system. J Neurosci Res 68, 176-184.

Wellerdieck, C., Oles, M., Pott, L., Korsching, S., Gisselmann, G., and Hatt, H. (1997). Functional expression of odorant receptors of the zebrafish Danio rerio and of the nematode C. elegans in HEK293 cells. Chemical senses 22, 467-476.

Wensley, C.H., Stone, D.M., Baker, H., Kauer, J.S., Margolis, F.L., and Chikaraishi, D.M. (1995). Olfactory marker protein mRNA is found in axons of olfactory receptor neurons. J Neurosci 15, 4827-4837.

Wetzel, C.H., Oles, M., Wellerdieck, C., Kuczkowiak, M., Gisselmann, G., and Hatt, H. (1999). Specificity and sensitivity of a human olfactory receptor functionally expressed in human embryonic kidney 293 cells and Xenopus Laevis oocytes. J Neurosci 19, 7426- 7433.

120

Bibliography

Wilhelm, B.T., Marguerat, S., Watt, S., Schubert, F., Wood, V., Goodhead, I., Penkett, C.J., Rogers, J., and Bahler, J. (2008). Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution. Nature 453, 1239-1243.

Wilson, R.I., and Mainen, Z.F. (2006). Early events in olfactory processing. Annu Rev Neurosci 29, 163-201.

Wong, S.T., Trinh, K., Hacker, B., Chan, G.C., Lowe, G., Gaggar, A., Xia, Z., Gold, G.H., and Storm, D.R. (2000). Disruption of the type III adenylyl cyclase gene leads to peripheral and behavioral anosmia in transgenic mice. Neuron 27, 487-497.

Xu, L.L., Stackhouse, B.G., Florence, K., Zhang, W., Shanmugam, N., Sesterhenn, I.A., Zou, Z., Srikantan, V., Augustus, M., Roschke, V., et al. (2000). PSGR, a novel prostate- specific gene with homology to a G protein-coupled receptor, is overexpressed in prostate cancer. Cancer Res 60, 6568-6572.

Yan, C., Zhao, A.Z., Bentley, J.K., Loughney, K., Ferguson, K., and Beavo, J.A. (1995). Molecular cloning and characterization of a calmodulin-dependent phosphodiesterase enriched in olfactory sensory neurons. Proc Natl Acad Sci U S A 92, 9677-9681.

Yang, L., Cai, X., Zhou, J., Chen, S., Chen, Y., Chen, Z., Wang, Q., Fang, Z., and Zhou, L. (2013). STE20/SPS1-related proline/alanine-rich kinase is involved in plasticity of GABA signaling function in a mouse model of acquired epilepsy. PLoS One 8, e74614.

Young, J.M., Friedman, C., Williams, E.M., Ross, J.A., Tonnes-Priddy, L., and Trask, B.J. (2002). Different evolutionary processes shaped the mouse and human olfactory receptor gene families. Hum Mol Genet 11, 535-546.

Young, J.M., Shykind, B.M., Lane, R.P., Tonnes-Priddy, L., Ross, J.A., Walker, M., Williams, E.M., and Trask, B.J. (2003). Odorant receptor expressed sequence tags demonstrate olfactory expression of over 400 genes, extensive alternate splicing and unequal expression levels. Genome Biol 4, R71.

Young, S.Z., Taylor, M.M., Wu, S., Ikeda-Matsuo, Y., Kubera, C., and Bordey, A. (2012). NKCC1 knockdown decreases neuron production through GABA(A)-regulated neural progenitor proliferation and delays dendrite development. J Neurosci 32, 13630-13638.

121

Bibliography

Yu, T.T., McIntyre, J.C., Bose, S.C., Hardin, D., Owen, M.C., and McClintock, T.S. (2005). Differentially expressed transcripts from phenotypically identified olfactory sensory neurons. J Comp Neurol 483, 251-262.

Zhainazarov, A.B., and Ache, B.W. (1995). Odor-induced currents in Xenopus olfactory receptor cells measured with perforated-patch recording. J Neurophysiol 74, 479-483.

Zhang, L.L., Fina, M.E., and Vardi, N. (2006). Regulation of KCC2 and NKCC during development: membrane insertion and differences between cell types. J Comp Neurol 499, 132-143.

Zhang, X., and Firestein, S. (2002). The olfactory receptor gene superfamily of the mouse. Nat Neurosci 5, 124-133.

Zhang, X., Rodriguez, I., Mombaerts, P., and Firestein, S. (2004). Odorant and vomeronasal receptor genes in two mouse genome assemblies. Genomics 83, 802-811.

Zhao, H., Ivic, L., Otaki, J.M., Hashimoto, M., Mikoshiba, K., and Firestein, S. (1998). Functional expression of a mammalian odorant receptor. Science 279, 237-242.

Zhong, X., Zhu, Y., Mao, J., Zhang, J., and Zheng, S. (2013). Frequent epigenetic silencing of PCDH10 by methylation in human colorectal cancer. J Cancer Res Clin Oncol 139, 485- 490.

Zou, J., Wang, W., Pan, Y.W., Lu, S., and Xia, Z. (2015). Methods to measure olfactory behavior in mice. Curr Protoc Toxicol 63, 11 18 11-11 18 21.

Zozulya, S., Echeverri, F., and Nguyen, T. (2001). The human olfactory receptor repertoire. Genome Biol 2, RESEARCH0018.

122

Attachments

8. Attachments

Figure 34: Analysis of Slc-transporter detected in RNA-Seq experiments. Significant expression differences are shown whereby red labeled transporter notations indicate higher FPKM values in NKCC1-deficient OE transcriptomes (n=3; *: P<0.05, **: P<0.01, ***: P< 0.001).

123

Attachments

Table 5: Validation RT-PCR experiments. M = 50 bp DNA ladder, + = cDNA; − = RNA.

124

Attachments

Table 6: RNA-Seq results normalized with OMP FPKM for putative chloride-related and anion/cation organic transporters and channels of the olfactory epithelium with FPKM. Values are first normalized to OMP FPKM values for each condition and then multiplied with 100 for easy presentation. Transporter subfamilies: Slc4 and Slc26 belong to anion exchangers, Slc6: sodium-/chloride-dependent neurotransmitter symporter and amino acids, Slc12: electroneutral, cation-coupled cotransporters, Slc14/Slc22: organic anion/cation transporters (n=3).

125

List of Abbreviations

I. List of Abbreviations

°C degrees Celsium

ACIII, Adcy3 adenylyl cyclase (protein/gene name) Ano2 Anoctamin2 bp base pair CaM Calmodulin cAMP cyclic adenosine monophosphate

CNG cyclic nucleotide-gated

C-terminus carboxy terminus

DIDS 4,4′-Diisothiocyanatostilbene-β,β′-disulfonic acid disodium salt hydrate

DNA desoxyribonucleic acid

EOG electro olfactogram

FACS fluorescence activated cell sorting

GABA gamma-aminobutyric acid

GBC globose basal cells

Gnal olfactory G alpha protein

GPCR G protein-coupled receptor

G protein guanosine triphosphate (GTP)-binding protein

HBC horizontal basal cells MOE main olfactory epithelium mRNA messenger ribonucleic acid MQAE N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide NFA niflumic acid NKCC Na+-1K+-2Cl--cotransporter

N-terminus amino terminus

OB olfactory bulb 126

List of Abbreviations

OE olfactory epithelium

OMP olfactory marker protein

OR olfactory receptor

OSN olfactory sensory neuron

P postnatal day

PAGE polyacrylamid gel electrophoresis

PBS phosphate buffered saline

PCR polymerase chain reaction

PDE phosphodiesterase

PLC phospholipase C

PI3K phosphoinositide 3-kinase

RNA Ribonucleic acid

RT-PCR reverse transcription polymerase chain reaction

SC sustentacular cell

SDS sodium dodecyl sulfate

127

List of Figures

II. List of Figures

Figure 1: The olfactory system of mice. ______2 Figure 2: Cellular composition and structure of the olfactory epithelium and an olfactory sensory neuron. ______3 Figure 3: Schematic structure of an OR. ______5 Figure 4: Scheme of the olfactory signal pathway. ______7 Figure 5: Schematic model of the neurogenesis of OE. ______10 Figure 6: Schematic structure of NKCC1in the cell membrane. ______14 Figure 7: The “GABA/chloride switch” of developing neurons. ______15 Figure 8: Regulation of NKCC1 activity. ______18 Figure 9: PCR analysis of mice genotypes. ______41 Figure 10: Western blot analysis of NKCC1 antibody specificity and protein localization. ______42 Figure 11: Immunohistological staining of NKCC1+/+ and NKCC1-/- OE cryosections. __ 43 Figure 12: Summary of RNA-Seq data. ______45 Figure 13: RNA-Seq results for putative chloride-related and anion/cation organic transporters and channels of the olfactory epithelium with FPKM average > 1. ______46 Figure 14: Read coverage detected in RNA-Seq experiments. ______47 Figure 15: RNA-Seq analysis of olfactory signal transduction and adaptation-associated proteins. ______50 Figure 16: Expression analysis of NKCC1+/+ and NKCC1-/- mice olfactory receptors. __ 51 Figure 17: Expression profile of ORs in NKCC1+/+ and NKCC1-/- mice. ______52 Figure 18: Percentage of differentially expressed ORs. ______53 Figure 19: Transcription level of chloride-related ion transporters. ______56 Figure 20: Relative transcription level of olfactory signal protein components obtained via RT-PCR. ______57 Figure 21: Expression analysis of two ORs via RT-PCR. ______58 Figure 22: Western blot analysis of olfactory signal transduction proteins. ______59 Figure 23: Western blot analysis of a ciliary protein and development-related proteins. _ 60 Figure 24: Sagittal cryosections of DCX-promo-EGFP transgenic mice. ______61

128

List of Figures

Figure 25: Air-phase EOG recordings of NKCC1+/+ and NKCC1-/- mice with different Henkel100 dilutions. ______62 Figure 26: Air-phase EOG recording analysis of Henkel100-induced amplitudes in NKCC1+/+, NKCC1+/- and NKCC1-/- mice. ______63 Figure 27: Comparison of air-phase EOG recordings of Henkel100 and 10 odorants mixture induced amplitudes in NKCC1+/+ and NKCC1-/- mice. ______64 Figure 28: Air-phase EOG recordings of repetitive stimuli. ______65 Figure 29: Submerged EOG recordings of wild type OE using chloride channel inhibitors. ______66 Figure 30: Submerged electro-olfactogram recordings of NKCC1+/+, NKCC1+/- and NKCC1-/- mice using niflumic acid. ______67 Figure 31: Normalized length of turbinates of NKCC1+/+ and NKCC1-/- mice. ______68 Figure 32: Morphological changes of the OE of NKCC1+/+, NKCC1+/- and NKCC1-/- mice. ______69 Figure 33: Analysis of the cell number in the OE of NKCC1+/+, NKCC1+/- and NKCC1-/- mice. ______70 Figure 34: Analysis of Slc-transporter detected in RNA-Seq experiments. ______123

129

List of Tables

III. List of Tables

Table 1: PCR program used for genotyping of mice. ______31 Table 2: RT-PCR approach (3x). ______34 Table 3: PCR program used for RT-PCR. ______34 Table 4: Cuffdiff analysis of RNA-Seq data. ______54 Table 5: Validation RT-PCR experiments.______124 Table 6: RNA-Seq results normalized with OMP FPKM for putative chloride-related and anion/cation organic transporters and channels of the olfactory epithelium with FPKM. 125

130

Curriculum Vitae

IV. Curriculum Vitae

Name: Claudia Haering Date of birth: 11/28/1985 Place of birth: Dortmund, Germany Nationality: German

Academic History

10/2011-today PhD student, Prof. Dr. Dr. Dr. Hanns Hatt, Department of Cell Physiology, Ruhr-University, Bochum “Characterization of the Ion Transporter NKCC1 in the Field of Chemosensation” 12/2010-05/2011 Scientific employee, Dr. S. Raunser, Max Planck Institute of Molecular Physiology, Germany 01/2010-11/2010 Master thesis, Dr. S. Raunser, Max Planck Institute of Molecular Physiology, Germany “Structural and functional studies of Sonic Hedgehog“ 10/2008-11/2010 Studies, Master of Science “Chemische Biologie”, TU Dortmund, Germany 04/2008-10/2008 Bachelor thesis, Dr. H. D. Arndt, Max Planck Institute of Molecular Physiology, Germany, “Einfluss von Mutationen im ribosomalen GTPase Zentrum auf die Affinität von Thiopeptid-Inhibitoren“ 10/2005-09/2008 Studies, Bachelor of Science “Chemische Biologie”, TU Dortmund, Germany

School Training

08/2003-06/2005 Abitur, Helmholtz Gymnasium, Dortmund, Germany 1996-2005 Gymnasium, Helmholtz Gymnasium, Dortmund, Germany 1992-1996 Elementary School, Vincke Elementary School,

131

List of Publications

V. List of Publications

Haering, C., Kanageswaran, N., Bouvain, P., Scholz, P., Altmuller, J., Becker, C., Gisselmann, G., Wäring-Bischof, J., and Hatt, H., Ion Transporter NKCC1 - Modulator of Neurogenesis in Murine Olfactory Neurons. J Biol Chem.

Baumann S, Schoof S, Bolten M, Haering C, Takagi M, Shin-ya K, Arndt HD. “Molecular determinants of microbial resistance to thiopeptide antibiotics” J Am Chem Soc, 2010 May 26; 132(20):6973-81.

132

List of Posters

VI. List of Posters

Claudia Haering, Ninthujah Kanageswaran, Pascal Bouvain, Janine Waering, Hanns Hatt, “NKCC1 - Chloride Accumulator in the Murine Olfactory Epithelium”at the 5th IMPRS student symposium, Max Planck Institute of Molecular Physiology, Dortmund, 3rd 5th Nov 2014

Claudia Haering, Ninthujah Kanageswaran, Pascal Bouvain, Janine Waering, Hanns Hatt, “NKCC1- Chloride Accumulator in the Murine Olfactory Epithelium” at the 36th Association for Chemoreception Sciences (AChemS) Annual Meeting 2014, Huntington Beach, California, April 9th-12th 2014

Claudia Haering, Pascal Bouvain, Janine Waering, Hanns Hatt, “Loss of NKCC1- Insights into Olfaction” at the Research Day 2013 of the Ruhr-University Bochum, Germany, Novermber 21th 2013

Claudia Haering, Janine Waering, Hanns Hatt, “Characterization of the Ion Transporter NKCC1 in the Field of Chemosensation” at the 35th Association for Chemoreception Sciences (AChemS) Annual Meeting 2013, Huntington Beach, California, April 17th-20th 2013

Claudia Haering, Janine Waering, Hanns Hatt, “Characterization of the Ion Transporter NKCC1 in the Field of Chemosensation” at the 10th Göttingen Meeting of the German Neuroscience Society 2013, Goettingen, Germany, March 13th-16th 2013

133

Own Contribution

VII. Own Contribution

Ion Transporter NKCC1 - Modulator of Neurogenesis in Murine Olfactory Neurons

Project planning: 70%

Experimental contribution: 75%

Manuscript preparation: 85%

Graduate student Pascal Bouvain additionally contributed to results of this work:

Results displayed in modified Figure 19 and Figure 20 were obtained by Pascal Bouvain.

134

Acknowledgements

VI. Acknowledgements

Zunächst möchte ich mich bei Prof. Dr. Dr. Dr. Hatt für die Möglichkeit zur Promotion an seinem Lehrstuhl, zur Bereitstellung eines interessanten wissenschaftlichen Themas und für die Unterstützung danken.

Prof. Dr. Wiese danke ich für die Übernahme des Korreferats und das Interesse an meiner Arbeit.

Danke an Dr. Janine Wäring-Bischof für das Thema, Hilfestellungen und Korrekturarbeiten. Ein großes Dankeschön an Dr. Sabrina Baumgart für die Unterstützung und Freundschaft. Du standest mir mit gutem Rat und Kaffee zur Seite.

An diesem Project haben auch zwei tolle Studenten gearbeitet, Pascal Bouvain und Sabine Tewes, danke für eure Hilfe.

Den „Jungs“ danke ich für unzählige Stunden Spaß, fachlicher Kompetenz und für eure Freundschaft! Danke Paul für die Gelassenheit, Danke Benji für die Verwegenheit und Danke Fabian für den Sarkasmus (und die PC-Not-Hilfe).

Ich danke auch meinen lieben Kollegen aus dem Büro, Ninthu (bald Dr. Ninthu), Lea und Max. Danke für die offenen Ohren, die Geduld, wenn ich mal wieder unter Stress stand, den Salat und die Waffeln!

Ich danke Fabian Jansen und Simon Pyschny für die Einführung und Hilfe bei Fragen der Elektrophysiologie und Max für die gemeinsame Submerged-EOG-Zeit.

Für das Korrekturlesen bedanke ich mich bei Dr. Janine Wäring-Bischof, Dr. Desiree Maßberg, Dr. Shymal Mosalaganti und Simon Haering.

Für den Spaß bei der Arbeit und fachlichem Rat danke ich auch Dr. Caroline Flegel und Ivi (bald Dr. Ivi), Jazz (bald Dr. Jazz) und Nikolina.

Für die technische Unterstützung möchte Simon Pyschny, Thomas Lichtleitner, Uta Müller und Farideh Salami danken. Des Weiteren danke ich Ulrike Thomes für ihre Hilfe bei allem Organisatorischen.

135

Acknowledgements

Diese Arbeit wäre jedoch nicht zu Stande gekommen, wenn nicht Anja Coenen meine Mäuse gehegt und gepflegt hätte. Wir beide wissen, was das für eine schwierige Zucht war, aber wir haben es geschafft!

Meinen Freunden Jasmin, Maja, Anna und Tobi danke für die schönen Abende, die Zuversicht und die Freundschaft!

Meiner Familie, ohne deren Unterstützung mein Studium und diese Arbeit nicht möglich gewesen wären, sei es finanziell oder durch Hausmannskost, danke ich von Herzen.

Zu guter Letzt danke ich meinem Mann Simon, der wirklich eine harte Zeit mit mir durchmachen musste. Danke, dass es dich gibt! Wir haben gemeinsam den Bachelor, den Master und nun auch die Promotion geschafft…und was steht als nächstes an?!

136