ISSN 1346-7565 Acta Phytotax. Geobot. 72 (1): 23–42 (2021) doi: 10.18942/apg.202007
An Overlooked Tree Species, Micromeles calocarpa (Rehder) M. Aizawa (Rosaceae), from Central Japan
Mineaki Aizawa
Department of Forest Science, School of Agriculture, Utsunomiya University, 350 Mine-machi, Utsunomiya, Tochigi 321-8505, Japan. [email protected]
In Japan, two simple-leaved species of trees of Rosaceae tribe Maleae have been treated as Sorbus alni- folia and S. japonica or have been assigned to the genus Aria. However, they are morphologically distinct from Aria and Sorbus and should be treated as species of Micromeles. Under S. japonica, variety calo- carpa (hereafter only calocarpa) was described based on specimens collected in Nikko, Japan, where calocarpa is commonly found. Although calocarpa has been neglected, it is hypothesized that it should be treated as a distinct species characterized by larger leaves with a dense white persistently tomentose abaxial surface and round to truncate leaf base. The phylogenetic position of the Japanese simple-leaved species, including calocarpa, in the tribe Maleae was examined using chloroplast (cp) DNA regions. CpDNA analyses demonstrated that the Japanese taxa should be assigned to Micromeles. Second, to test the hypothesis that calocarpa should be recognized as a distinct species, its phylogenetic relationships among Japanese Micromeles using cpDNA and nuclear low-copy-number genes was examined. Leaf morphology of the three taxa was also compared. The phylogenetic and morphological analyses indicated that calocarpa is indeed distinct from M. japonica and M. alnifolia. Therefore, a new status and new combination, Micromeles calocarpa (Rehder) M. Aizawa, is proposed.
Key words: Aria, chloroplast DNA, leaf morphology, Micromeles, nuclear low-copy number gene, Sorbus
Two simple-leaved species of trees previously ly lobed leaves, flowers in corymbs, a dimerous assigned to Sorbus L. subgen. Micromeles (Dec- to pentamerous gynoecium with styles coalescent ne.) J. B. Phipps, K. R. Robertson & Spongberg at least at the base, inferior ovary, deciduous up- (Phipps et al. 1990) as S. alnifolia (Siebold & per part of the hypanthium and fruit with mem- Zucc.) K. Koch and S. japonica (Decne.) Hedl. branous endocarp and distinct annular cicatrice (Rosaceae tribe Maleae) are common in Japan. at the apex (Kovanda & Challice 1981). The two They were most recently assigned to Aria (Pers.) simple-leaved Japanese species should now be Host (Ohashi & Iketani 1993, Iketani & Ohashi treated as Micromeles alnifolia (Siebold & Zucc.) 2001). Lo & Donoghue (2012) showed that Sor- Koehne and M. japonica (Decne.) Koehne, but bus sensu lato is polyphyletic and that phyloge- their phylogenetic position within Micromeles nies based on chloroplast DNA (cpDNA) and nu- have not been determined. clear ribosomal internal transcribed spacer (ITS) In 1915, Rehder proposed Sorbus japonica supported the recognition of several genera, in- var. calocarpa Rehder based on specimens col- cluding Micromeles from within Sorbus s.l. Ac- lected in Yumoto, Nikko, Tochigi Prefecture, Ja- cordingly, Micromeles is now regarded as distinct pan (Rehder 1915; Fig. 1). According to Rehder’s from Aria and Sorbus sensu stricto (Li et al. 2017, description, var. calocarpa differed from S. ja- Sennikov & Kurtto 2017, Zhang et al. 2017, ponica var. japonica by having larger fruits (ca. Mezhenska et al. 2018). Micromeles is character- 1.5 cm long) ripening orange-yellow or golden- ized by the deciduous, simple, serrate or shallow- yellow and lacking lenticels and larger leaves 24 Acta Phytotax. Geobot. Vol. 72
(about 10 cm long and 8 cm wide) with a dense species using previously used primers (Wang & white, appressed, persistently tomentose abaxial Zhang 2011, Guo et al. 2016) was conducted, but surface. In contrast, Sorbus japonica var. japoni- it either failed PCR amplification or did not ob- ca produces red fruits with white lenticels and tain sufficiently clear sequence chromatograms. has leaves with loose and somewhat floccose to- As an alternative, to elucidate the phylogenetic mentum that sometimes partially wears off to- relationships among the Japanese species of Mi- ward autumn (Rehder 1915). Later studies cromeles and calocarpa, nuclear low-copy-num- (Hayashi 1969, Ohwi 1975, Kitamura & Murata ber or single-copy genes can be used by referring 1979) continued to recognize plants with larger, to the phylogenetic study of Sorbus s.s. (Li et al. orange-yellow fruit without lenticels as S. japon- 2017). ica var. calocarpa, but Yonekura (2005) regarded In the present study, the phylogenetic position it as S. japonica f. calocarpa (Rehder) Yonek. of the Japanese simple-leaved species, including Other treatments did not recognize var. calocar- calocarpa, in the Maleae was examined using cp- pa (hereafter as calocarpa) probably because the DNA regions that can distinguish between Mi- yellow fruit was considered to be merely varia- cromeles, Aria, and Sorbus s.s. (Lo & Donoghue tion within S. japonica, cf. orange in Ohashi 2012, Sun et al. 2018). Then, to test the hypothe- (1989), orange to scarlet in Iketani & Ohashi sis that calocarpa is a separate species, the phylo- (2001), and reddish or sometimes orange-yellow- genetic relationships between calocarpa and M. ish in Aldasoro et al. (2004). My field observa- alnifolia and M. japonica was examined using tions around Yumoto, Nikko, suggested that ca- two granule-bound starch synthase genes, partial locarpa was relatively common in this region, exons (GBSSI-1) and starch-branching enzyme whereas S. japonica var. japonica was absent. I genes (SBEI) of four nuclear genes analyzed by also observed that the large leaves with a dense Li et al. (2017) as well as cpDNA for samples col- white persistently tomentose abaxial surface, lected from populations across their natural range round to truncate leaf base and shallowly lobed of distribution in Japan. Leaf morphology as a di- margins are more reliably diagnostic of calocar- agnostic character for Japanese Micromeles and pa than fruit coloration. Thus, I hypothesized that calocarpa was also evaluated. calocarpa should be treated a distinct species rather than as an infraspecific taxon of Mi- cromeles japonica. Materials and Methods Previous phylogenetic analyses of Sorbus s.l. and the tribe Maleae, Rosaceae, used either a Sample collection and DNA isolation combination of cpDNA and ITS regions (Lo & Samples of calocarpa, Micromeles japonica, Donoghue 2012), exclusively various chloroplast and M. alnifolia were collected from naturally regions (Sun et al. 2018), or exclusively ITS re- growing trees across their typical range of distri- gions (Wang & Zhang 2011, Li et al. 2012, Guo et bution in Japan (Table 1). For calocarpa, a pre- al. 2016). The respective phylogenies were incon- liminary herbarium survey and the description of sistent between studies, perhaps reflecting that Hayashi (1969) indicated that it was present on Sorbus s.l. has undergone complex evolutionary Yatsugatake in Nagano Prefecture. I therefore events as a result of apomixes, polyploidization collected samples on Yatsugatake in addition to and hybridization (Nelson-Jones et al. 2002, Pel- the collections from around Yumoto, Nikko, licer et al. 2012, Dłużewska et al. 2013). More- Tochigi Prefecture, which is the type locality of over, it is assumed that Micromeles may have calocarpa. In total, 13 trees of calocarpa, 25 of originated through hybridization between Sorbus M. japonica, and 32 of M. alnifolia were collected s.s. and Aria (Lo & Donoghue 2012). Since none from 22 sites, including five sites (Omyojin, Mt. of the studies analyzed M. japonica including ca- Takahara, Funyu, Hosoo, and Hiruzen) where M. locarpa, my preliminary analysis of ITS for the alnifolia and M. japonica occur sympatrically February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 25
Fig. 1. Holotype of Sorbus japonica (Decne.) Hedl. var. calocarpa Rehder (E. H. Wilson 7643, 16 Oct., 1914, A [00112644]). 26 Acta Phytotax. Geobot. Vol. 72
Table 1. Sample list with taxon, sites, number of samples for genetic analyses (Ng) and leaf morphological analyses (Nm), and observed cpDNA haplotypes and nuclear DNA genotypes. cpDNA Nuclear DNA Lat. Long Altitude Haplotype Genotype Taxon Site (°N) (°E) (m) Ng Nm matK+rbcL GBSSI-1 SBEI Micromeles Suganuma, Katashina, Gunma Pref. 36.82 139.36 1,744 1 - CH1 (1) GH1/GH1 (1) SH1/SH1 (1) calocarpa Yumoto, Nikko, Tochigi Pref.‡ 36.81 139.42 1,520–1,667 6 6 CH1 (6) GH1/GH1 (6) SH1/SH1 (6) Mt. Nyoho, Nikko, Tochigi Pref. 36.80 139.53 1,750 1 1 CH1 (1) GH1/GH1 (1) SH1/SH1 (1) Yachiho, Nagano Pref.‡ 36.04 138.39 1,646–1,694 5 5 CH1 (5) GH1/GH1 (5) SH1/SH1 (4); SH1/SH2 (1) 13 12 Micromeles Omyojin, Shizukuishi, Iwate Pref.† 39.66 140.91 274–365 3 3 CH2 (3) GH5/GH8 (2); SH6/SH6 (3) japonica GH5/GH5 (1) Mt. Takahara, Shioya, Tochigi 36.88 139.80 892–913 4 4 CH2 (4) GH5/GH7 (3); SH6/SH6 (4) Pref.† GH5/GH5 (1) Hanazono, Kitaibaraki, Ibaraki 36.86 140.61 675 1 - CH2 (1) GH5/GH7 (1) SH6/SH6 (1) Pref. Funyu, Shioya, Tochigi Pref.† 36.78 139.82 375–381 4 4 CH2 (4) GH5/GH5 (2); SH6/SH6 (3); GH4/GH5 (2) SH3/SH6 (1) Hosoo, Nikko, Tochigi Pref.† 36.71 139.52 1,080–1,145 2 2 CH2 (1); GH5/GH5 (1); SH3/SH6 (1)*; CH3 (1)* GH5/GH11 (1)* SH6/SH6 (1) Shima, Nakanojo, Gunma Pref. 36.70 138.79 803 1 1 CH2 (1) GH5/GH5 (1) SH3/ SH6 (1) Mt. Mitsumine, Chichibu, Saitama 35.92 138.94 1,137 1 1 CH2 (1) GH5/GH5 (1) SH3/SH6 (1) Pref. Hiruzen, Maniwa, Okayama Pref.† 35.31 133.58 650–771 4 3 CH2 (4) GH5/GH7 (2); SH3/SH6 (3); GH5/GH6(1); SH3/SH3 (1) GH5/GH9(1) Ashiu, Minamitanba, Kyoto Pref. 35.30 135.72 371 1 1 CH2 (1) GH5/GH5 (1) SH3/SH6 (1) Kibune, Kyoto Pref. 35.13 135.76 667–678 2 - CH2 (2) GH5/GH5 (1); SH3/SH3 (1); GH5/GH7 (1) SH3/SH6 (1) Nara park, Nara Pref. 34.67 135.87 387 1 1 CH2 (1) GH5/GH5 (1) SH3/SH6 (1) Naka, Tokushima Pref. 33.76 134.25 519 1 1 CH2 (1) GH6/GH7 (1) SH6/SH6 (1) 25 21 Micromeles Tomakomai, Hokkaido 42.67 141.59 21–38 4 4 CH1 (2); GH11/GH11(2); SH5/SH6 (3); alnifolia CH3 (2) GH2/GH11 (1); Unphased (1) § GH13/GH13(1) Omyojin, Shizukuishi, Iwate Pref.† 39.66 140.92 233–339 3 3 CH1 (2); GH2/GH11 (1); SH5/SH6 (3) CH4 (1) GH14/GH16(1); Three types (1)+ Nishikawa, Yamagata Pref. 38.42 140.10 423–487 4 3 CH3 (4) GH11/GH11 (3); SH5/SH6 (2); GH2/GH11 (1) SH5/SH5 (1); SH6/SH7 (1) Tadami, Fukushima Pref. 37.34 139.31 417 1 1 CH3 (1) GH11/GH11 (1) SH6/SH6 (1) Mt. Arasawa, Yuzawa, Niigata Pref. 36.88 138.87 600–793 2 2 CH3 (2) GH2/GH11 (1); SH5/SH6 (2) GH11/GH14 (1) Mt. Takahara, Shioya, Tochigi 36.88 139.80 871–913 3 3 CH3 (3) GH2/GH10 (1); SH4/SH6 (1); Pref.† GH2/GH11 (1); SH6/SH7 (1); GH11/GH15 (1) Unphased (1) § Otari, Nagano Pref. 36.82 137.92 540–565 3 3 CH3 (3) GH2/GH2 (1); SH5/SH5 (2); GH2/GH11 (1); SH5/SH6 (1) GH2/GH15 (1) Yumoto, Nikko, Tochigi Pref.‡ 36.80 139.43 1,481–1,482 2 1 CH3 (2) GH2/GH12(1); SH4/SH7 (1); GH2/GH15 (1) Unphased (1) § Funyu, Shioya, Tochigi Pref.† 36.78 139.82 372–386 3 3 CH3 (2); GH2/GH15(2); SH3 SH6 (1)*; CH2 (1)* GH5/GH5 (1)* SH5/SH6 (1); SH5/SH7 (1) Sainoko, Nikko, Tochigi Pref. 36.75 139.40 1,305–1,306 2 2 CH3 (2) GH2/GH2 (1); SH5/SH5 (1); GH2/GH11 (1) SH5/SH6 (1) Hosoo, Nikko, Tochigi Pref.† 36.71 139.52 1,146 1 1 CH3 (1) GH2/GH3 (1) SH6/SH6 (1) Yachiho, Nagano Pref.‡ 36.07 138.38 1,618–1,822 3 3 CH3 (3) GH2/GH11 (2); SH6/SH7 (2); GH2/GH2 (1) SH6/SH6 (1) Hiruzen, Maniwa, Okayama Pref.† 35.32 133.58 754 1 1 CH3 (1) GH11/GH11 (1) SH5/SH5 (1) 32 30 Sorbus Mt. Arasawa, Yuzawa, Niigata Pref. 36.88 138.87 920 1 na CHC1 (1) na SHCa/SHCb (1) commixta Yachiho, Nagano Pref. 36.07 138.37 1,833 1 na CHC1 (1) na SHCa/SHCc (1) Hiruzen, Maniwa, Okayama Pref. 35.32 133.58 750–766 2 na CHC2 (2) na SHCa/SHCa (2) Sorbus Hosoo, Nikko, Tochigi Pref. 36.70 139.51 1,050 1 na CHG (1) na SHG/SHG (1) gracilis Malus Omyojin, Shizukuishi, Iwate Pref. 39.65 140.89 306 1 na CHT (1) GHTa/GHTb (1) SHTa/SHTb (1) tschonoskii ‡ sites where Micromeles calocarpa and M. alnifolia occur sympatrically. † sites where M. alnifolia and M. japonica occur sympatrically; nuclear DNA genotype in each individual sample was indicated using slash. () numbers in parentheses of haplotype and genotype indicate their frequencies. * potential natural hybrids between M. japonica and M. alnifolia. + the genotype of one tree consisting of three types was excluded from subsequent analyses; § trees for which the phase of the genotype was not determined; na, not analyzed. February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 27
Table 2. Comparison of characteristics of mature leaves among Micromeles calocarpa, M. japonica, and M. alnifolia of Japan. Characteristics Micromeles calocarpa M. japonica M. alnifolia Abaxial surface of leaf densely persistently white somewhat densely or loosely glabrous except for tomentose or somewhat white tomentose appressed hairs on nerves densely white tomentose or rarely pubescent on veinlet Shape of leaf base round to truncate widely cuneate round or truncate (rarely slightly cordate in flowering shoots) Leaf margin irregularly shallowly/ regularly and distinctly doubly serrate or obscurely distinctly lobed and doubly (rarely shallowly) lobed and lobed and doubly serrate serrate simply serrate
and two sites (Yumoto and Yachiho) where calo- (Applied Biosystems, Foster City, CA, USA) with carpa and Micromeles alnifolia occur sympatri- 15 μL reaction volume containing 10 ng genomic cally (Table 1). I identified the three taxa based on DNA, 0.2 mM of each dNTP, 1× PCR buffer, 1.5 the appearance of the hairs on the abaxial surface mM MgCl2, 0.5 U Taq polymerase (Promega, of leaf and the shape of the leaf base and margin Madison, WI, USA), and 0.5 μM of each primer. of mature leaves (Table 2). Furthermore, samples Thermocycling parameters for matK amplifica- from three species were collected as outgroups: tion were as follows: 1 min at 94 °C; 35 cycles of four of Sorbus commixta Hedl., one of S. gracilis 30 s at 94 °C, 20 s at 52 °C, and 50 s at 72 °C; and (Siebold & Zucc.) K. Koch, and one of Malus a final elongation step at 72 °C for 10 min. Ther- tschonoskii (Maxim.) C. K. Schneid. (Table 1). mocycling parameters for rbcL amplification The collected leaves were used for genetic and were as follows: 4 min at 95 °C; 35 cycles of 30 s morphological analyses. For genetic analyses, at 94 °C, 1 min at 55 °C, and 1 min at 72 °C; and several leaves were either immediately silica- a final elongation step at 72 °C for 10 min. In sev- dried and stored at room temperature or stored in eral samples, one or both chloroplast genes could a freezer at –20 °C until DNA isolation. Total not be amplified. This was probably due to PCR DNA was isolated from ca. 50 mg of silica-dried inhibitors, such as polyphenolics and polysaccha- leaves or fresh leaves using the DNeasy Plant rides, which are particularly common in Rosace- Mini Kit (Qiagen, Hilden, Germany), according ae, in the DNA extracts (e.g., Porebski et al. to the manufacturer’s instructions. 1997). For those samples, another PCR amplifica- tion method was performed using a KAPA3G Chloroplast DNA sequencing and multiple se- Plant PCR Kit (KAPA Biosystems, Wilmington, quence alignment for Maleae species MA, USA), which contained a DNA polymerase Four cpDNA regions (matK, rbcL, psbA-trnH, with higher tolerance of common plant-derived and trnL 5’exon-trnF) were used to reconstruct PCR inhibitors. A reaction volume of 20 μL, con- the phylogenetic relationship among 25 species of taining 20 ng genomic DNA, 1× KAPA Plant Maleae. The sequences of representatives of Jap- PCR buffer, 0.4 U KAPA3G Plant DNA poly- anese Micromeles, calocarpa, and Sorbus (one merase, and 0.3 μM of each primer, was used. tree each from calocarpa, M. japonica, and S. Thermocycling parameters for matK amplifica- gracilis and two trees each from M. alnifolia and tion were as follows: 3 min at 95 °C; 35 cycles of S. commixta) were determined, and the sequenc- 20 s at 95 °C, 15 s at 52 °C, and 30 s at 72 °C; and es of 20 species of Maleae were used from Gen- a final elongation step at 72 °C for 1 min. Ther- Bank (Appendix 1). mocycling parameters for rbcL amplification For matK and rbcL, PCR amplification was were as follows: 3 min at 95 °C; 35 cycles of 20 s conducted using a GeneAmp 2720 PCR System at 95 °C, 15 s at 55 °C (rbcL), and 30 s at 72 °C; 28 Acta Phytotax. Geobot. Vol. 72 and a final elongation step at 72 °C for 1 min. For ume containing 20 ng genomic DNA, 0.2 mM of psbA-trnH and trnL-trnF regions, PCR amplifi- each dNTP, 1× PCR buffer, 2.0 mM MgCl2, 0.5 cations were performed using a KAPA3G Plant U Taq polymerase (Promega), and 0.3 μM of each PCR Kit as detailed above, but with an annealing primer. Thermocycling parameters for GBSSI-1 temperature of 60 °C. All PCR products that pro- amplification were as follows: 4 min at 95 °C; 35 duced a single band were purified using an Exo- cycles of 45 s at 95 °C, 45 s at 63 °C, and 1 min at SAP-IT Kit (Affymetrix, Cleveland, OH, USA). 72 °C; and a final elongation step at 72 °C for 10 Direct sequencing of both strands was performed min. Thermocycling parameters for SBEI ampli- using the BigDye Terminator v.3.1 Cycle Se- fication were as follows: 4 min at 95 °C; 35 cycles quencing Kit (Applied Biosystems) and an ABI of 45 s at 95 °C, 45 s at 55 °C, and 1 min at 72 °C; 3500 Genetic Analyzer (Applied Biosystems). and a final elongation step at 72 °C for 10 min. Of Each individual DNA sequence was inspected vi- the 76 samples, 47 samples failed to produce an sually and edited using BIOEDIT software amplicon of one or both fragments. The PCR am- v.7.0.9.0 (Hall 1999). The obtained sequences plification of those samples was repeated using were multiple-aligned using CLUSTAL W the KAPA3G Plant PCR Kit as described above (Thompson et al. 1994) and adjusted manually. regarding cpDNA amplification, but with an an- The primers for amplification and sequencing of nealing temperature of 60 or 63 °C (GBSSI-1) or the four cpDNA regions are shown in Appendix 55 °C (SBEI). All products that produced a single 2. The cpDNA sequences obtained were deposit- band were purified using an ExoSAP-IT Kit and ed in GenBank under the accession numbers sequenced. However, the PCR products of GBS- LC437814–LC437845 (Appendix 1). SI-1 from all samples of S. commixta and S. grac- ilis showed multiple bands on agarose gel electro- Chloroplast and nuclear DNA sequencing and phoresis. Li et al. (2017) also reported a failure to multiple sequence alignment of the Japanese spe- produce GBSSI-1 sequences from Japanese Sor- cies of Micromeles bus s.s. Thus, these samples were excluded from To examine the phylogenetic relationships the GBSSI-1 analyses. Direct sequencing of both among Japanese Micromeles, sequences of matK strands was performed using the BigDye Termi- and rbcL for 12 trees of calocarpa, 24 trees of M. nator Cycle Sequencing Kit and an ABI 3500 Ge- japonica, 30 trees of M. alnifolia, two trees of netic Analyzer. In the chromatograms of the PCR Sorbus commixta, and one tree of Malus tschono- product of GBSSI-1 of 19 samples, continuous skii were additionally determined (the sequences double peaks, which were caused by containing for several trees had already been determined; fragments of different lengths because of indels see section above). PCR amplification and se- within an individual sample, were observed; quencing were performed as detailed above. therefore, two internal primers were designed to For 13 trees of calocarpa, 25 of Micromeles unambiguously determine the downstream se- japonica, 32 of M. alnifolia, four of Sorbus com- quences from the indel in both strands (Appendix mixta, one of S. gracilis, and one of Malus 2). DNA sequences were subjected to visual in- tschonoskii, the GBSSI-1 and SBEI genes were spection and edited using BIOEDIT. Heterozy- amplified and sequenced using the primers pub- gous sites were inspected visually for double lished by Li et al. (2017) (Appendix 2). Previous peaks using the Poly Peak Parser web application studies have shown that there are two copies of (Hill et al. 2014) and whether the double peaks GBSSI-1 in Rosaceae (Evans & Campbell 2002) occurred at the same position in both strands and a single copy of SBEI in Rosaceae (Shi et al. were confirmed. 2013). Each target region of GBSSI-1 and SBEI The phase of sequences with heterozygous comprises exons/introns and only an exon. The sites was estimated using PHASE software v.2.1.1 PCR amplification was performed using Gene- (Stephens et al. 2001, Stephens & Scheet 2005) Amp 2720 PCR System with 15 μL reaction vol- with default setting (number of iterations = 100, February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 29 thinning interval = 1, burn-in interactions = 100, matrix. Two cpDNA regions (matK & rbcL) in the and probability threshold = 0.9) as a part of haplotype analysis for Japanese Micromeles were DnaSP v.5 (Librado & Rozas 2009). It was im- also concatenated to produce a single haplotype possible to determine the genotypes of some matrix. In nuclear DNA analysis, the two genes samples using this probability threshold (0.9). were analyzed separately. Phased nuclear se- Therefore, for those samples PHASE was also quences were treated as haplotypes. According to run using probability threshold = 0.6 based on the previous studies (Lo & Donoghue 2012, Sun et suggestions by Garrick et al (2010) and Miraldo al. 2018), Amelanchier arborea (F. Michx.) Fer- et al. (2011). The phase of one genotype of GBS- nald and Malus tschonoskii were selected as out- SI-1 was resolved by this treatment; however, the groups in the phylogenetic analysis and the haplo- phase of four genotypes (three of Micromeles al- type analysis. nifolia and one of Malus tschonoskii) of SBEI was Phylogenetic relationships among species of still undetermined; each contained a single Maleae and among haplotypes of cpDNA and nu- IUPAC ambiguity code (i.e., Y, R, K, or W) in a clear genes of Japanese Micromeles were recon- position. The unphased genotypes of SBEI were structed by maximum likelihood (ML) analysis omitted from the phylogenetic analyses, except using RAxML GUI software v.1.5 (Silvestro & for M. tschonoskii, which was used as an out- Michalak 2012) and Bayesian inference (BI) us- group by excluding the single nucleotide position ing MrBayes v.3.2 (Ronquist et al. 2012). All in- with the ambiguity code. Chromatograms of the dels found in the cpDNA regions and GBSSI-1 PCR product containing fragments of different haplotypes were binary-coded (gap absence = 0 lengths because of indels were separated using and presence = 1) using a simple coding method the web-based indel discovery tool Indigo (https:// (Simmons & Ochoterena 2000) implemented in gear.embl.de/indigo/) with reference chromato- FastGap v.1.2 (Borchsenius 2009), which pro- grams of samples of the same species without in- duced a coded gap (binary) matrix of each haplo- dels. The phase of sequences with indels was de- type. This binary matrix was then manually con- termined by visual chromatogram inspection of catenated with the end of each haplotype. In the both strands using the method of Flot et al. (2006) ML analysis, for these gap coding haplotypes, and Indigo software. Multiple-sequence align- ‘ML + rapid bootstrap’ analyses were performed ments were performed using CLUSTAL W, fol- with the following settings: Data Type = ‘Mixed’ lowed by manual adjustment. The nuclear raw with two partitions [DNA and BIN (binary)], unphased sequences of samples without indels or number of bootstraps = 1,000, GTRGAMMA phased sequences of samples with indels were de- model (replaced automatically by BINGAMMA posited in GenBank under the accession numbers for binary data; Scheunert et al. 2012). A phylo- LC437846–LC437910. The sequences of the two genetic tree was produced using FigTree software nuclear genes of M. aronioides (Rehder) Kovanda v.1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/). & Challice (KU760505 & KU760620) and M. In the BI analysis, the setting ‘mixed data’ globosa (T. T. Yu & H. T. Tsai) Mezhenskyj [DATATYPE = mixed (DNA and Restriction)] (KU760506 & KU760621) were included in the was used in MrBayes block. The data were split phylogenetic analyses. into two partitions (DNA and gap binary data). In the DNA partition, ‘Lset’ was specified as a SYM Phylogenetic analyses + G substitution model (nst = 6, rates = gamma) As the chloroplast genome is assumed to be and ‘Prset’ as fixed prior [statefreqpr = fixed haploid and inherited like a locus not undergoing (equal)], which was selected based on Akaike In- recombination, the sequences of four cpDNA re- formation Criteria (AIC) implemented in the gions (matK, rbcL, psbA-trnH, and trnL-trnF) in software MrModeltest v.2.3 (Nylander 2004) on a the phylogenetic analysis for species of Maleae pipeline in PAUP* v.4.0a163 (Swofford 2002); in were concatenated to produce a single haplotype the gap binary partition, ‘Lset’ was specified as 30 Acta Phytotax. Geobot. Vol. 72 rates = gamma, coding = variable, and ‘Preset’ as and LBA, the mean from three leaves from each Dirichlet prior (1.00, 1.00). Two simultaneous individual tree was used for analyses. For TLM, runs of the Bayesian Markov chain Monte Carlo the median of three leaves from each individual (MCMC) algorithm were performed with 4 × 106 tree was used for analyses. For DDH, the median generations using four chains. Trees were sam- of three leaves of maximum grades from each pled every 1,000 generations, and the first 25% of leaf was used for analyses. Median, minimum, sampled trees were discarded as burn-in. MCMC and maximum values for each leaf characteristic was continued until the averaged standard devia- were calculated for each taxon, excluding two tion of split frequencies (ASDSF) dropped below possible hybrids identified based on genetic anal- 0.01. MCMC convergence was inspected using yses. Nonparametric multiple comparisons be- Tracer software v.1.6 (http://tree.bio.ed.ac.uk/ tween taxa were conducted using Steel-Dwass software/tracer/) and was confirmed using a con- test on R (R Core Team 2018). vergence diagnostic value, the potential scale re- duction factor (PSRF), approaching 1.000. A Herbarium research 50% majority rule consensus tree was generated To determine the geographical distribution of including the posterior probability of branches. calocarpa, 591 specimens, which were originally The phylogenetic tree was visualized using Fig- identified as Micromeles japonica (or Sorbus ja- Tree. ponica), in herbaria GMNHJ, SHIN, TI, TNS, TOCH, and TOFO, were examined and re-identi- Leaf morphological analyses fied based on leaf characteristics (Table 2). For the Japanese Micromeles and calocarpa, three mature leaves from shoots without inflores- cences (irrespective of short or long shoots, be- Results cause there was no difference in morphology be- tween them) per individual tree were used for Phylogenetic relationship among species of Ma- morphological analyses. In total, 189 leaves from leae 63 trees (12 calocarpa, 21 M. japonica, and 30 M. The cpDNA sequence lengths of four cpDNA alnifolia; Table 1) were examined for six charac- regions were 801–810 bp of matK, 520 bp of rbcL, teristics: blade (lamina) length (BL), maximum 90–91 bp of psbA-trnH, and 932–956 bp of trnL- blade width (BW), petiole length (PL), leaf base trnF for species in the tribe Maleae. The length of angle (LBA; Fig. 2A), type of leaf margin (TLM; alignment of four concatenated cpDNA regions Fig. 2B), and degree of density of hairs on the ab- was 2,409 bp (810 bp of matK, 520 bp of rbcL, 91 axial surface of the leaf (DDH; Fig. 2C). TLM bp of psbA-trnH, and 988 bp of trnL-trnF). The was evaluated using three ordered scales [1: dou- ML and BI trees indicated that the Japanese sim- bly serrate or obscurely lobed and doubly serrate, ple-leaved species including calocarpa were 2: irregularly shallowly/distinctly lobed and dou- monophyletic with Micromeles folgneri C. K. bly serrate, 3: regularly and distinctly (rarely Schneid. from China [maximum likelihood boot- shallowly) lobed and simply serrate; Fig. 2B]. strap values (BSML) = 68 and Bayesian posterior DDH was determined within three circles 6 mm probability (PPBI) = 99; Fig. 3]. Moreover, the in diameter that were randomly set on the abaxial trees showed that the clade was phylogenetically surface of a leaf under a stereomicroscope and distinct from Aria and closely related to Sorbus evaluated using four ordered scales [0: glabrous s.s., although the support values were not high except for hairs on nerves or rarely appressed hair (BSML = 37 and PPBI = 69; Fig. 3). on veinlets, 1: pubescent (sparse appressed hairs on veinlets), 2: loose or somewhat densely tomen- Phylogenetic relationship among the Japanese tose (epidermis visible), 3: densely tomentose Micromeles (epidermis not visible); Fig. 2C]. For BL, BW, PL, Out of 70 samples from three Japanese taxa, February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 31
Fig. 2. Leaf characteristics other than length and width of Japanese Micromeles examined. A. Leaf base angle (LBA). B. Types of leaf margin (TLM). 1: doubly serrate or obscurely lobed and doubly serrate, 2: irregularly shallowly/distinctly lobed and doubly serrate, 3: regularly and distinctly (rarely shallowly) lobed and simply serrate. C. Degree of density of hairs on abaxial surface (DDH). 0: glabrous except for hairs on nerves or rarely appressed hairs on veinlets, 1: pubescent (sparse appressed hairs on veinlets), 2: loosely or somewhat densely tomentose (epidermis visible), 3: densely tomentose (epider- mis not visible). B-1 (Micromeles alnifolia), B-2 (M. calocarpa), and B-3 (M. japonica). C-0 and C-1 (M. alnifolia), C-2 (M. japonica), and C-3 (M. calocarpa). Scale bar = 5 cm (B) and 1 mm (C). the genotypes of 66 trees were successfully de- SH7). In cpDNA, sequence variation was ob- tected (Table 1). One tree of Micromeles alnifolia served in matK, but not in rbcL. Calocarpa with three haplotypes of GBSSI-1 was excluded showed a single cpDNA haplotype (CH1), a sin- from subsequent analyses because the species is gle GBSSI-1 haplotype (GH1), and one major considered to be diploid (Iketani & Ohashi 2001) SBEI haplotype (SH1) and one minor SBEI haplo- and the possibility of sequence determination er- type (SH2) (Table 1; Fig. 4). In M. japonica, most ror could not be ruled out. In addition, three other trees showed CH2 of cpDNA, GH4–GH9 of trees of M. alnifolia with unphased SBEI were GBSSI-1, and SH3 and SH6 of SBEI, but one tree omitted from the analyses. The sequence length from Hosoo, Tochigi Prefecture, showed CH3 of of cpDNA was 1,390 bp (837 bp of matK and 553 cpDNA (exclusively found in M. alnifolia). The bp of rbcL), that of GBSSI-1 was 546–554 bp tree had GH5 (exclusively found in M. japonica) (alignment length: 555 bp), and that of SBEI was and GH11 (exclusively found in M. alnifolia) of 711 bp. The cpDNA sequences produced four GBSSI-1, and SH3 (exclusively found in M. ja- haplotypes (CH1–CH4), the GBSSI-1 sequences ponica) and SH6 (found in both M. japonica and produced 16 haplotypes (GH1–GH16). The SBEI M. alnifolia) of SBEI (Table 1). In M. alnifolia, sequences produced seven haplotypes (SH1– most trees showed CH3 of cpDNA, GH2–GH3 32 Acta Phytotax. Geobot. Vol. 72
Fig. 3. Phylogenetic relationship of species of Maleae, including Micromeles calocarpa, M. japonica, and M. alnifolia in Japan, reconstructed by using maximum likelihood analysis based on four cpDNA regions (matK, rbcL, psbA-trnH, & trnL- trnF). Numbers with branches are maximum likelihood bootstrap values (BSML) and Bayesian posterior probabilities (PPBI), respectively; both values are shown for branches with PPBI of more than 50%. and GH10–GH16 of GBSSI-1 and SH4-SH7 of SBEI. Micromeles globosa and M. aronioides SBEI; however, four trees from Tomakomai, Hok- showed different GBSSI-1 haplotypes from the kaido, and Omyojin, Iwate Prefecture, showed Japanese taxa, but M. aronioides shared SH6 of CH1 of cpDNA (in calocarpa). In addition, one SBEI with M. japonica and M. alnifolia. tree from Funyu, Tochigi Prefecture, showed The phylogenetic trees of haplotypes for cp- CH2 of cpDNA (exclusively in Micromeles DNA and two nuclear genes indicated that the japonica), GH5 (exclusively in M. japonica) of monophyly of each taxon was not well resolved in GBSSI-1, SH3 (exclusively in M. japonica) and the ML and BI analyses (Fig. 4); however, the SH6 (in both M. japonica and M. alnifolia) of monophyly of taxa was statistically supported in February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 33
Fig. 4. Phylogenetic relationships among haplotypes of cpDNA (matK & rbcL) and two nuclear low-copy number genes (GBS- SI-1 & SBEI) for Micromeles calocarpa, M. japonica, and M. alnifolia from Japan using maximum likelihood analysis. Numbers with branches indicate maximum likelihood bootstrap values (BSML) and Bayesian posterior probabilities (PPBI), respectively; both values are shown for branches with BSML of more than 50%; The sample size (N) of each hap- lotype is indicated by circle size; frequency of species is shown by pie chart.
SBEI for calocarpa (BSML = 71; PPBI = 98) and carpa shared haplotype CH1 with a few trees of GBSSI-1 for Micromeles japonica, except for one M. alnifolia (Table 1, Fig. 4). M. alnifolia (BSML = 99; PPBI = 100). Calocar- pa was genetically distinct from M. japonica and Leaf morphological analyses M. alnifolia in the nuclear genes although calo- Frequency distribution of individual trees for 34 Acta Phytotax. Geobot. Vol. 72 each leaf characteristic indicated that Japanese Discussion Micromeles and calocarpa were morphologically distinct (Fig. 5); calocarpa has significantly larg- CpDNA phylogenetic analyses of species of er leaves (BL, BW & PL) with a round to truncate Maleae clearly showed that the Japanese simple- leaf base (LBA), an irregular, shallowly/distinctly leaved species including calocarpa were mono- lobed, doubly serrate leaf margin (TLM) and a phyletic with Micromeles folgneri (Fig. 3). In ad- dense white persistently tomentose abaxial sur- dition, their phylogenetic distinction from Aria face (DDH). and sister relationship to Sorbus s.s. was con- firmed, as indicated in previous studies (Li et al. Distribution of calocarpa 2012, Lo & Donoghue 2012, Sun et al. 2018, Liu Of the 591 specimens identified asMicromeles et al. 2019), although statistical support values japonica (or Sorbus japonica), 92 specimens were low, probably because of the small number were re-identified as calocarpa (see ‘Additional of cpDNA regions in the present study. The re- specimens examined’ in Taxonomic treatment). sults demonstrated that the Japanese simple- Based on the 92 specimens, calocarpa occurs in leaved species should be assigned to Micromeles mountainous regions at elevations above approxi- rather than to Aria and Sorbus s.s. mately 1,500 m in mountains on the Pacific Ocean The phylogenetic analyses using cpDNA and side in central Japan (Fig. 6). Nikko, including two nuclear low-copy number genes indicated Yumoto in Tochigi Prefecture, Katashina and Mt. that the monophyly of each taxon was not well re- Hanamagari in Gunma Prefecture, Yatsugatake solved, but the nuclear genes indicated that calo- in Nagano Prefecture, Akaishi Mountains (South- carpa is in fact distinct from Micromeles japoni- ern Japanese Alps), covering Nagano, Yamanashi, ca as well as M. alnifolia (Fig. 4). The results and Shizuoka prefectures, Kurobe valley in Toya- were in line with the morphological distinction of ma Prefecture, Mt. Fuji in Yamanashi and Shi- the leaves of calocarpa from M. japonica and M. zuoka prefectures, and the Chichibu Mountains alnifolia (Fig. 5), namely, that calocarpa tends to in Nagano and Saitama prefectures. have larger leaves with a dense white persistently
Fig. 5. Frequency distribution of individual trees for six leaf morphological characteristics for Micromeles calocarpa, M. ja- ponica, and M. alnifolia. Values indicate median; values in parenthesis indicate minimum and maximum values. Different letters on plots of each characteristic indicate significant differences between taxa based on Steel-Dwass multiple com- parison tests (P < 0.05). February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 35
Fig. 6. Distribution map of Micromeles calocarpa in central Japan. Open circles represent localities of 92 herbarium speci- mens examined in present study. Solid circles indicate locations of sampling in present study. Prefectural boundaries are shown by dotted lines. tomentose abaxial surface, a round to truncate show shared haplotypes of cpDNA and the two base, and an irregular, shallowly/distinctly lobed, nuclear genes, but four trees of M. alnifolia from doubly serrate margin. Taken together, the results northern Japan shared cpDNA haplotype (CH1) indicate that calocarpa is indeed a separate spe- with M. calocarpa (Table 1, Fig. 4). The geo- cies, Micromeles calocarpa (see Taxonomic graphic distributions of M. calocarpa (Fig. 6) and treatment). M. alnifolia (Horikawa 1972) do not overlap in Between Micromeles japonica and M. alnifo- northern Japan. It is possible that CH1 cpDNA lia, the shared haplotypes of the nuclear genes haplotype sharing may be due to past introgres- were observed at sympatric sites (Hosoo and Fu- sive hybridization between M. alnifolia and M. nyu; Table 1), suggesting natural hybridization calocarpa, or because from M. alnifolia retaining between them, although identification of the pu- an ancestral polymorphism. Unfortunately, the tative hybrids based on morphology was impos- present study could not include M. calocarpa sible at the time the samples were collected in the from sites other than Nikko and Yatsugatake. To field. Micromeles calocarpa and M. alnifolia, resolve the phylogeographic history of M. calo- sympatric in Nikko and on Yatsugatake, do not carpa, including such a cpDNA haplotype shar- 36 Acta Phytotax. Geobot. Vol. 72 ing event, it would be desirable to conduct further pilose, abaxial surface densely and persistently research on genetic diversity of Micromeles calo- white tomentose or somewhat densely white to- carpa throughout its range of distribution. mentose (or rarely loose white tomentose on Based on the morphological and genetic evi- young or suppressed trees), tinged yellowish- dence obtained in the present study, I recognized brown when falling. Inflorescences terminal three simple-leaved species of Micromeles in Ja- compound corymbs, pedicels and outer calyx pan and propose a new status and new combina- sparsely white tomentose. Flowers 10–17, late tion, M. calocarpa, as detailed below. May to early July, after development of leaves, ca. 2 cm in diameter. Pedicels 8–15 mm long. Bracts linear, 7–13 mm long, caducous. Hypanthium Taxonomic Treatment bell-shaped, 2–3 mm long. Sepals 5, reflexed, tri- angular, apex attenuate-acuminate, 2–3 mm long, Micromeles calocarpa (Rehder) M. Aizawa, inner surface white tomentose. Petals 5, patent or comb. & stat. nov. ― Figs. 1 & 7. reflexed, white, ovate to widely ovate, apex Micromeles calocarpa differs from M. japonica and M. rounded, base short clawed, 6–8 mm long, entire, alnifolia in having larger leaves with a dense white persis- adaxial surface white pilose at base. Stamens ca. tently tomentose abaxial surface, a round to truncate 20, 6–7 mm long; anthers yellow; filaments white. base, and an irregular, shallowly/distinctly lobed, doubly Styles 2, base connate, ca. 5 mm long. Fruit serrate margin (Table 2, Figs. 2, 5 & 7). pomes, October, orange-yellow or scarlet at ma- Typus. Japan. Hondo: around Lake Yumoto, common in woods, E. H. Wilson 7643, 15–19 Oct. 1914 (Holo- A turity, obovoid to ellipsoid, 10–17 mm long, 9–14 [00112644] digital image!, Iso- K [000758171] MO mm wide, glabrous, with inconspicuous sparse [100001] & US [00097463] digital images!). dark to light brownish or white lenticels on epi- Sorbus japonica (Decne.) Hedl. var. calocarpa dermis; sepals deciduous; pulp yellowish brown, Rehder in Sarg., Pl. Wilson. 2: 276 (1915). heterogeneous, bitter. Seeds brown, narrowly Aria japonica Decne. f. calocarpa (Rehder) ovoid, 6–8 mm long, 2.5–4 mm wide. Yonek. in J. Jap. Bot. 80: 324 (2005), ‘chlorocarpa.’ [Sorbus japonica Hedl. f. calocarpa Okuyama Japanese name. Kimi-no-urajironoki (Okuyama ex Sugimoto, New Key Jap. Tr.: 234 (1961), nom. 1960) nud.] [Sorbus japonica Hedl. f. calocarpa (Rehder) Distribution. Tochigi Pref. (Nikko), Gunma Okuyama ex Hayashi, Ill. Book Useful Tr.: 306 Pref. (Katashina and Mt. Hanamagari), Nagano (1969), nom. nud.] Pref. (Yatsugatake, Akaishi Mountains and Chi- [Sorbus japonica Hedl. f. calocarpa Okuyama, chibu Mountains), Toyama Pref. (Kurobe Valley), Handb. Plant Coll.: 450 (1974), nom. nud.] Yamanashi Pref. (Yatsugatake, Mt. Fuji and Akaishi Mountains), Shizuoka Pref. (Akaishi Trees, deciduous, to 15 m tall, diameter at breast Mountains), and Saitama Pref. (Chichibu Moun- height to 30 cm (rarely to 1 m). Young branches tains) (Fig. 6). white tomentose, then almost glabrous with white lenticels. Leaves alternate; stipules membrana- Habitat. ca. 1,500–2,100 m a.s.l.; from upper ceous, linear, 1–5 mm long, caducous; petiole temperate to lower subalpine (cold temperate) 1–2.3 cm long, white tomentose; blade orbicular forests. to broadly ovate, apex acuminate, base rounded to truncate (rarely slightly cordate on flowering Note. Four sheets of the type (E. H. Wilson shoots), 8–13 cm long, 7–11 cm wide, irregularly 7643) were found in A, K, MO, and US. On the and shallowly/distinctly lobed and doubly serrate, sheet in A (00112644; Fig. 1) is an annotation serrations with an apical gland, nerves 8–11 pairs, ‘Holotype. S. A. Spongberg, December, 1989.’ craspedodromous, adaxial surface sparsely white Based on their labels, the four sheets were col- February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 37 lected by E. H. Wilson on different dates (16 Oc- (TNS907319); Kamiina, Mt. Nokogiri, 29 July 1923, H. tober 1914 for the A and US specimens and on 18 Koidzumi 5314 (TNS534466), 48569 (TNS534467), & 48570 (TNS534456); Yatsugatake, 8 Aug. 1924, H. Mura- October 1914 for the K and MO specimens). Wil- matu s.n. (TI); ibid., 21 July 1927, collector unknown, s.n. son photographed a tree of Sorbus japonica var. (TNS01069598); ibid., collector unknown 2375 & 2376 calocarpa on 18 October, 1914 (AEE-03661; (TNS01212375 & 01212376); Mt. Tateshina, collector un- http://id.lib.harvard.edu/images/olvwork297069/ known 2750 & 2751 (SHIN33171 & 33172); ibid., 16 June catalog) in Yumoto. Wilson might have collected 1979, S. Noshiro 836 (TOFO); ibid., 11 July 1982, A. from this tree on different dates in Yumoto. Ac- Yamazaki s.n. (SHIN099629); Yatsugatake, below Honza- wa-onsen in a national forest, 13 July 1930, T. Inokuma curate typification should be done in future. 2606-6 (TOFO); Yatsugatake, above Inago–Shibunoyu, 8 Additional specimens examined. Japan, Tochigi July 1933, T. Inokuma 440 & 441 (TOFO); Yatsugatake, Pref. (formerly Shimotsuke Prov.): Nikko, Yumoto, 20 en route from Karasawa-toge to Shibunoyu, 9 July 1938, July 1889, collector unknown s.n. (TOFO); ibid., 25 June H. Yamazaki & H. Matsuda s.n. (TI); Kamiina, Inazato, 1940, T. Nakai s.n. (TI); ibid., 3 Oct. 1958, H. Kubota s.n. Mibu River, Oyokokawa, 2,000 m, 20 July 1954, H. Mat- (TNS137605); ibid., 18 Aug. 1953, C. Ohkawa s.n. suda s.n. (TI); Hase, Hachozaka, 1,600 m, 7 Aug. 1958, (TNS627931); Nikko, Konsei-toge, 29 June 1899, collec- Y. Karayama H-22 (SHIN159248); Shimoina, Sanpuku- tor unknown s.n. (TOFO); ibid., 3 Aug. 1906, H. Sakurai toge to Shiokawa, 19 Aug. 1964, S. Matsuda 3586 s.n. (TNS6956); ibid., 4 June 1911, S. Komatsu s.n. (TI); (TNS868934); Minamisaku, Kawakami, 19 Sep. 1971, K. ibid., 2 July 1930, Y. Komori 2002 (TI); Nikko, lakeside of Sato s.n. (TI); Mt. Nishi, 1,600 m, 25 Aug. 1974, collector Yunoko, 29 June 1923, Y. Yamamoto s.n. (2 sheets, TI); unknown Hi73 (SHIN33174); ibid., 1,800 m, 25 Aug. 1974, Yumoto, 3 July 1924, M. Honda s.n. (TI); ibid., 2 July collector unknown IM264 (SHIN33176); Yatsugatake, 1925, M. Honda s.n. (TI); Nikko Yumoto, Hacho to Mt. Nishi, 1,950 m, 2 Aug. 1975, collector unknown Nishizawa, 18 July 1924, H. Takeda s.n. (TNS229388); IM452 (SHIN33175); Kawakami, Kawahake, 1,400 m, 14 Nikko, around Yumoto, in 1931, H. Ito s.n. (2 sheets, TI); Sep. 1975, H. Okuhara s.n. (SHIN0145454); Fujimi, Saka- Nikko, Mt. Nyoho, 2 July 1933, H. Ito s.n. (TI); ibid., ca. zukinagashi, 1,600 m, 27 June 1981, F. Yokouchi 214 2,000 m, 5 July 1953, M. Mizushima s.n. (TI); ibid., 2 July (SHIN33182); Hara, Hirogawarasawa, 1,850 m, 5 July 1961, N. Shibusa 259 (TOCH008387); Nikko, en route be- 1981, K. Wada 0105 (SHIN33181); ibid., 1,700 m, 12 June tween Yumoto and Karikomiko Lake, 4 July 1933, H. Ito 1982, K. Imai s.n. (SHIN107487); Hase, Karei-kogen s.n. (TI); ibid., 6 July 1940, T. Inokuma 29 (TOFO); Nik- highland, 1,820 m, 21 May 1983, S. Ohno 0447 ko, July 1937, collector unknown s.n. (TNS01069594); (SHIN104019); Chino, Minotoguchi, 1,500 m, 23 Sep. ibid., Y. Nakano s.n. (TNS01069590); ibid., collector un- 1983, K. Imai s.n. (SHIN095353 & 095354); Chino, Kara- known 2373 (TNS01212373); Nikko, Yunoko Lake 1,500 sawa-kosen, 1,950 m, 23 June 1985, H. Okuhara s.n. m, 2 July 1947, K. Teramoto s.n. (TNS868915); Nikko, (SHIN14212). Toyama Pref. (Ecchu Prov.): Along the Mt. Maeshirane, Shiranesawa-one, 4 July 1952, H. Kanai upper stream of the Kurobe River, Harinokidani, 7 Aug. 3964, 3965, & 4002 (TI); Nikko, around Happu, en route 1958, T. Nakamura s.n. (TNS868933). Yamanashi Pref. to Mt. Nyoho, 5 July 1953, H. Kanai 5134 (TI); Nikko, (Kai Prov.): Mt. Fuji, 5th station on Yoshidaguchi trail, Sanno-toge, 3 July 1960, S. Okuyama 14114 (TNS262324); 24 Aug. 1924, collector unknown s.n. (TNS01069609); Nikko, E. side of Yunoko Lake, 27 Sep. 1976, H. Ohba & Mt. Fuji, 16 June 1935, T. Satow 5175 (TI); Mt. Kita, Hi- J. Murata 626 (TI); Nikko, from Yunoko Lake to Sen- rogawara to Shiraneoike, 1,700–2,200 m, 28 Aug. 1970, jogahara Moor, 1,100–1,400 m, 4 Sep. 1982, J. Murata T. Shimizu 22736 (SHIN); Mt. Aka, Yatsugatake, 4 July 12305 (TI); Ashio, Mt. Koshin, on Rokurinpan trail, 1977, C. Ohkawa s.n. (TNS405429); Mt. Fuji, Minamits- 1,600 m, 18 Aug. 1989, T. Noguchi & H. Ogura s.n. uru, en route from Shôji to Komitake-Jinzya Shrine, 11 (TOCH43796); Ashio, Mt. Koshin, 1,510 m, 18 Aug. 1989, June 1978, H. Ohba 78603 (TI); Mt. Fuji, above the 3rd H. Ogura & T. Noguchi s.n. (TOCH45204); Nikko, Yu- station on the Shojiguchi trail, 1,880 m, 20 Sep. 1982, S. moto, Kare-numa swamp, 16 July 1999, T. Matsuzawa Noshiro 2770 (TOFO); Mt. Fuji, Narusawa, 1,900 m, 5 s.n. (GMNHJ BS-81377 & BS-84000). Gunma Pref. July 1985, H. Funakoshi 83 (TI); Fujiyoshida, along the (Kozuke Prov.): Kurabuchi, Mt. Hanamagari, 13 May Takizawa forest road, ca 1,900 m, 18 July 2001, T. Shi- 1977, S. Suto 4841 (GMNHJ BS-34841); Katashina, Mt. mizu et al. 01-78 (TNS710608). Shizuoka Pref. (Suruga Shirane, 8 July 1977, S. Suto 5481 (GMNHJ BS-35481); Prov.): Mt. Fuji, Subashiriguchi trail, 18 Aug. 1924, col- Katashina, Shiro-toge, 1,850 m., 14 July 2007, T. Ohmori lector unknown s.n. (TNS01069593); Nikenchaya [Note: et al. 6081 (GMNHJ BS-11712); Katashina, lakeside of this should be Nikengoya], the Southern Japanese Alps, 1 Suganuma, 24 July 2009, M. Aizawa s.n. (TOCH). Naga- Aug. 1948, H. Hirano 79775 (TNS); Along the stream of no Pref. (Shinano Prov.): Suwa, Yokodake-toge, 5 Aug. the Nishimata, upper stream of the Ooi River, 1 Aug. 1922, H. Koidzumi 3790 (TNS534464); Yatsugatake, 1949, H. Hirano s.n. (TNS94182); Nishimata, upper Natsuzawa-toge, 27 July 1922, H. Koidzumi 4528 stream of the Ooi River, 1,600 m, 4 July 1954, H. Matsuda 38 Acta Phytotax. Geobot. Vol. 72
Fig. 7. Morphological characters of Micromeles calocarpa. A. Branch with inflorescence. B. Flower. C. Immature fruit (pomes). D. Leaf: hairs on abaxial surface and serrations with apical gland. E. Ripe pome with inconspicuous light brown- ish lenticels on epidermis. F. Ripe pome with inconspicuous sparse dark brownish lenticels on epidermis. Scale bar = 5 cm (A), 1 cm (B–C and E–F), and 1 mm (D). February 2021 Aizawa — An Overlooked Tree Species, Micromeles calocarpa 39 s.n. (TI); Shizuoka, along the stream of Higashimata, in- of the Nishimata, a branch stream of the Ooi River, en terior of the Ooi River, en route from Nikengoya to Mori- route from Nikengoya to Shinjanukezawa, 5 June 1984, yazawa, ca 1,400–1,800 m, 8 Aug. 1973, F. Konta 10066 ca 1,500–1,700 m, F. Konta & E. Aihara FK16184 (TNS795314); Fujinomiya, from Ochyudo to a forest road (TNS795309); Shizuoka, Tashiro, Higashimata Hiroga- along Oosawa valley; western slope of Mt. Fuji, ca 2,100 wara, upper stream of the Ooi River, around Tokai Forest m, 6 Aug. 1976, F. Konta & A. Takahashi 128 (2 sheets; Hirogawara lodge, 1,900 m, 1 Sep. 1984, F. Konta 15739 TNS635484 & TNS795307); Honkawane, Darumazawa, (TNS795310). Saitama Pref. (Musashi Prov.): Chichibu, the source of the Sumata River, 14 Aug. 1980, H. Fuji- Mt. Hakutai, 2,000 m, 7 Sep. 1949, H. Uematu s.n. (TI). moto et al. 355 (TNS795306); Shizuoka, along the stream
Key to the Japanese species of Micromeles
1a. Abaxial surface of leaf glabrous except for appressed hairs on nerves or rarely pubescent on veinlets; inflorescences glabrescent; leaf margin usually unlobed, rarely obscurely lobed, doubly serrate ...... M. alnifolia 1b. Abaxial surface of leaves and inflorescences white tomentose; leaf margin lobed, doubly/simply serrate ...... 2 2a. Abaxial surface of leaf densely persistently white tomentose or somewhat densely white tomentose; leaf base round to truncate (rarely slightly cordate on flowering shoots); leaf margin irregularly and shallowly/distinctly lobed, doubly serrate ...... M. calocarpa 2b. Abaxial surface of leaf somewhat densely or loosely white tomentose; leaf base widely cuneate; leaf margin regularly and distinctly lobed, simply serrate ...... M. japonica
I thank the directors and staffs of GMNHJ, SHIN, TI, apple subfamily (Maloideae; Rosaceae) is clarified by TNS, TOCH, and TOFO for permission to examine spec- DNA sequence data from duplicated GBSSI genes. imens. I greatly appreciate the editor and anonymous re- Amer. J. Bot. 89: 1478–1484. viewers for their fruitful suggestions. I would also like to Flot, J. F., A. Tillier, S. Samadi & S. Tillier. 2006. Phase thank the Digital Collection of the Harvard University determination from direct sequencing of length-vari- Herbaria (Herbarium of the Arnold Arboretum; A) for able DNA regions. Molec. Ecol. Notes 6: 627–630. permission to use the image of the holotype of Sorbus ja- Garrick, R. C., P. Sunnucks & R. J. Dyer. 2010. Nuclear ponica var. calocarpa. gene phylogeography using PHASE: dealing with un- resolved genotypes, lost alleles, and systematic bias in parameter estimation. BMC Evol. Biol. 10: 118. Gil, H. Y. & S. C. Kim. 2018. The plastome sequence of References Ulleung Rowan, Sorbus ulleungensis (Rosaceae), a new endemic species on Ulleung Island, Korea. Mito- Aldasoro, J. J., C. Aedo, F. M. Garmendia, F. P. de la Hoz chondrial DNA Part B 3: 284–285. & C. Navarro. 2004. Revision of Sorbus subgenera Guo, W., Q. Fan, H. Jing, X. Hu & W. Liao. 2016. Sorbus Aria and Torminaria (Rosaceae-Maloideae). Syst. calcicola (Rosaceae), a new species from Guangxi Bot. Monogr. 69: 1–148. province in China. Phytotaxa 261: 260–266. Borchsenius, F. 2009. FastGap 1.2.
D. E. Boufford & H. Ohba (eds.), Flora of Japan, IIb, Okuyama, S. 1960. Coloured Illustrations of Wild Plants pp. 115–116. Kodansha, Tokyo. of Japan V. Seibundo-shinkosha, Tokyo. (in Japa- Kitamura, S. & G. Murata. 1979. Colored Illustrations of nese). Woody Plants of Japan vol. II. Hoikusha, Osaka. (in Pellicer, J., S. Clermont, L. Houston, T. C. G. Rich & M. Japanese). F. Fay. 2012. Cytotype diversity in the Sorbus com- Kovanda, M. & J. Challice. 1981. The genus Micromeles plex (Rosaceae) in Britain: sorting out the puzzle. revisited. Folia Geobot. Phytotax. Praha 16: 181–193. Ann. Bot. 110: 1185–1193. Li, Q. Y., W. Guo, W. B. Liao, J. A. Macklin & J. H. Li. Phipps, J. B., K. R. Robertson, P. G. Smith & J. R. Rohrer. 2012. Generic limits of Pyrinae: insights from nucle- 1990. A checklist of the subfamily Maloideae (Rosa- ar ribosomal DNA sequences. Bot. Stud. 53: 151–164. ceae). Can. J. Bot. 68: 2209–2269. Li, M., T. Ohi-Toma, Y. D. Gao, B. Xu, Z. M. Zhu, W. B. Porebski, S., L. G. Bailey & B. R. Baum. 1997. Modifica- Ju & X. F. Gao. 2017. Molecular phylogenetics and tion of a CTAB DNA extraction protocol for plants historical biogeography of Sorbus sensu stricto. (Ro- containing high polysaccharide and polyphenol com- saceae). Molec. Phylogenet. Evol. 111: 76–86. ponents. Plant Mol. Biol. Rep. 15: 8–15. Librado, P. & J. Rozas. 2009. DnaSP v5: a software for R Core Team. 2018. R: A language and environment for comprehensive analysis of DNA polymorphism data. statistical computing. R Foundation for Statistical Bioinformatics 25: 1451–1452. Computing, Vienna.
era circumscription. BioMed Res. Int. 2018: 7627191. quence of wild service tree Sorbus torminalis (L.) Swofford, D. L. 2002. PAUP*: phylogenetic analysis us- Crantz. Conserv. Genet. Resour. 9: 419–422. ing parsimony (*and other methods). Version 4. Wang, G. X. & M. L. Zhang. 2011. A molecular phyloge- Sinauer Associates, Sunderland. ny of Sorbus (Rosaceae) based on ITS sequence. Acta Taberlet, P., L. Gielly, G. Pautou & J. Bouvet. 1991. Uni- Hortic. Sinica 38: 2387–2394. versal primers for amplification of three non-coding Yonekura, K. 2005. Taxonomic notes on vascular plants regions of chloroplast DNA. Plant Molec. Biol. 17: in Japan and its adjacent regions (I). –New combina- 1105–1109. tions and new names of Japanese plants–. J. Jpn. Bot. Thompson, J. D., D. G. Higgins & T. J. Gibson. 1994. The 80: 323–333. CLUSTAL W: improving the sensitivity of progres- Zhang, S. D., J. J. Jin, S. Y. Chen, M. W. Chase, D. E. sive multiple sequence alignment through sequence Soltis, H. T. Li, J. B. Yang, D. Z. Li & T. S. Yi. 2017. weighting, position-specific gap penalties and weight Diversification of Rosaceae since the Late Cretaceous matrix choice. Nucleic Acids Res. 22: 4673–4680. based on plastid phylogenomics. New Phytol. 214: Ulaszewski, B., E. Sandurska, E. Sztupecka & J. Burc- 1355–1367. zyk. 2017. The complete chloroplast genome se-
Received December 13, 2018; accepted March 25, 2020
Appendix 1. GenBank accession numbers of sequences used to reconstruct phylogenetic relationship among Maleae species using four cpDNA regions. Taxon matK rbcL psbA-trnH trnL-trnF Amelanchier arborea (F. Michx.) Fernald MG704043 MG703618 MG703830 MG703902 Aria nivea Host MG704044 MG703619 MG703831 MG703903 Aronia melanocarpa (Michx.) Elliott MG704048 MG703620 MG703832 MG703904 Chaenomeles speciosa (Sweet) Nakai MG704049 MG703621 MG703833 MG703905 Cormus domestica (L.) Spach DQ860456 MG703622 MG703834 DQ863228 Cotoneaster multiflorus Bunge MG704050 MG703623 MG703835 MG703906 Dichotomanthes tristaniicarpa Kurz MG704053 MG703626 MG703838 MG703909 Docynia delavayi (Franch.) C. K. Schneid. MG704054 MG703627 MG703839 MG703910 Eriobotrya japonica (Thunb.) Lindl. MG704056 MG703629 MG703841 MG703912 Malus baccata (L.) Borkh. MG704059 MG703635 MG703846 MG703918 Malus tschonoskii (Maxim.) C. K. Schneid. MG704055 MG703628 MG703840 MG703911 Micromeles alnifolia (Siebold & Zucc.) Koehne (CH3)* LC437817 LC437826 LC437834 LC437841 Micromeles alnifolia (Siebold & Zucc.) Koehne (CH4)* LC437818 LC437827 LC437835 LC437842 Micromeles calocarpa (Rehder) M. Aizawa (CH1)* LC437814 LC437823 LC437832 LC437839 Micromeles folgneri C. K. Schneid. MG704061 MG703637 MG703848 MG703920 Micromeles japonica (Decne.) Koehne (CH2)* LC437816 LC437825 LC437833 LC437840 Osteomeles schwerinae C. K. Schneid. MG704062 MG703638 MG703849 MG703921 Pourthiaea arguta Decne. var. salicifolia (Decne.) Hook. f. MG704065 MG703641 MG703852 MG703924 Pseudocydonia sinensis (Dum. Cours.) C. K. Schneid. MG704066 MG703642 MG703853 MG703925 Pyrus bretschneideri Rehder MG704068 MG703644 MG703855 MG703927 Rhaphiolepis indica (L.) Lindl. MG704069 MG703645 MG703856 MG703928 Sorbus commixta Hedl. (CHC1)* LC437819 LC437828 LC437836 LC437843 Sorbus commixta Hedl. (CHC2)* LC437820 LC437829 LC437837 LC437844 Sorbus gracilis (Siebold & Zucc.) K. Koch (CHG)* LC437821 LC437830 LC437838 LC437845 Sorbus ulleungensis Chin S. Chang† MG011706 MG011706 MG011706 MG011706 Stranvaesia davidiana Decne. MG704071 MG703647 MG703858 MG703930 Torminalis clusii (M. Roem.) K. R. Robertson & J. B. Phipps‡ KY457242 KY457242 KY457242 KY457242 * sequences identified in the present study, and cpDNA haplotypes in Figs. 3 & 4 are shown in parentheses. † complete cpDNA sequence (Gil & Kim 2018). ‡ complete cpDNA sequence (Ulaszewski et al. 2017). 42 Acta Phytotax. Geobot. Vol. 72
Appendix 2. Primers for amplification and sequencing used in the present study. Region Primer sequence (5’ — 3’) Reference Chloroplast DNA matK 3F_KIM CGTACAGTACTTTTGTGTTTACGAG Costion et al. (2011) 1R_KIM ACCCAGTCCATCTGGAAATCTTGGTTC Costion et al. (2011) rbcL rbcLa_F ATGTCACCACAAACAGAGACTAAAGC Costion et al. (2011) rbcLa_R GTAAAATCAAGTCCACCRCG Costion et al. (2011) psbA-trnH F ACGGGAATTGAACCCGCGCA Demesure et al. (1995) R TATTATTAACCGTGCTAACC Okaura et al. (2007) trnL 5'exon c CGAAATCGGTAGACGCTACG Taberlet et al. (1991) trnF f ATTTGAACTGGTGACACGAG Taberlet et al. (1991) Nuclear DNA GBSSI-1 GBSSI-3F TACAAACGAGGGGTTGATCG Li et al. (2017) GBSSI-7R CCTTGGTAAGCAATGTTGTG Li et al. (2017) GBSSI_intF AAATGTTAATCTGTGCATCTTCTGA designed in this study GBSSI_intR AACCTGGCATAGAAGGCTGA designed in this study SBEI SbeI-F GCTCCACGAATATATGAGGCACATG Li et al. (2017) SbeI-R TTCCATGAAATTTCCTTCATTGACCA Li et al. (2017)