DOCSLIB.ORG

Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,B,*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,B,* Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,b,* a Key Laboratory of Arid and Grassland Agroecology of Ministry of Education, School of Life Sciences, Lanzhou University, Lanzhou 730000, P. R. China. Fax: +869318912561. E-mail: [email protected] b Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Lanzhou 730000, P. R. China * Author for correspondence and reprint requests Z. Naturforsch. 62c, 757Ð764 (2007); received November 23, 2006/February 7, 2007 A molecular phylogenetic analysis of Rhizoplaca melanophthalma, Rhizoplaca chrysoleuca, Rhizoplaca peltata and Rhizoplaca haydenii is presented based on the nuclear ribosomal internal transcribed spacer (ITS) regions and morphology. Rhizoplaca species were collected at 3400Ð3900 m in Tianshan Mountains, Xinjiang province, China. Rhizoplaca haydenii is reported for the first time in China. Maximum parsimony (MP) analysis of ITS sequences obtained from Tianshan Mountains samples and GenBank reveals that the evolution rela- tionship of Rhizoplaca melanophthalma and Rhizoplaca chrysoleuca is closer to each other than to Rhizoplaca peltata, and Rhizoplaca haydenii showed closer relatedness to Rhizoplaca melanophthalma. When the four species groups from Tianshan Mountains were analyzed alone through the neighbour-joining (NJ) and minimum evolution method, we obtained the same result. The morphology analysis of Rhizoplaca Zopf which reveals the pruinose discs and apothecial discs of species did not show convincing evidences to prove phylogenetic relationship among Rhizoplaca species. In our study, the result further proved that Rhizo- placa should be rejected as a genus separate from Lecanora. Key words: Rhizoplaca Zopf, Phylogeny, ITS Introduction (Zopf, 1905). Afterward, Poelt (1958) advanced The lichen has a widely geographical distribu- that Rhizoplaca Zopf is a genus separate from Le- tion in the world. It is a symbiotic association canora. Whereas, Ryan and Nash (1997) doubted which is constituted by fungi and algae or cyano- the relationship between Rhizoplaca Zopf and Le- bacteria. The biological character of lichen is re- canora and suggested to do some further investi- flection of the essentiality of fungi within the sym- gation. Arup and Grube (2000) adapted that Rhi- biotic association. Therefore, lichen has been zoplaca Zopf is not a genus separate from named lichen-forming fungi (Hawksworth and Lecanora and may not be a monophyletic genus. Hill, 1984) or lichenized fungi (Wei, 1982). Cansaran et al. (2006) also supported this result. Rhizoplaca Zopf belongs to the division lichen- At present, researchers focus on the phylogenetic forming Ascomycetes and family Lecanoraceae. It relationship among Rhizoplaca Zopf and other comprises more than nine species distributed correlated genera (Arup and Grube, 2000), how- throughout the world, only six of them are found ever, studies on phylogenetic relationships among in China. There are R. chrysoleuca (Sm.) Zopf, R. these species are very limited. fumida X. Q. Gao, R. huashanensis Wei, R. melan- Originally, lichenologists used thallus structure ophthalma (Ram. in Lam. & DC.) Leuckert et Po- and secondary metabolism to study the phyloge- elt, R. subdiscrepans (Nyl.) and R. peltata (Ram.) netic relationship of the lichen (Sundin and Tehler, Leuckert et Poelt including two variations v. pel- 1998; Crespo et al., 1999). However, there is not tata and v. regalis (H. Magn.) Wei (Wei, 1991). Ac- distinct difference of the characters within genera cording to the study of Wei and Wei (2005), R. or between species and no further support for gen- fumida may be treated as one of the chemotypes era that are characterized mainly by their thallus within R. chrysoleuca. morphology. In addition, chemical similarity or Rhizoplaca Zopf was separated from the genus difference is not a reliable evidence of systematic Squamaria DC. based on its single central rhizoid relationships because chemistry is varied in many 0939Ð5075/2007/0900Ð0757 $ 06.00 ” 2007 Verlag der Zeitschrift für Naturforschung, Tübingen · http://www.znaturforsch.com · D 758 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca species and sporadically shared by different 80 μl high concentration CTAB/NaCl (Biodee) groups (Leuckert et al., 1977; Wei, 1984; Ryan and and 100 μl NaCl (5 m) were added to the solution. Nash, 1997; Arup and Grube, 2000; Wei and Wei, Then the solution was incubated at 65 ∞C for 5 min 2005; Zhou et al., 2006). With the improvement of to further eliminate protein. One volume of equili- molecular technology, more and more lichenolo- brated phenol/chloroform/isoamylalcohol [25:24:1 gists began to deeply reveal the phylogenetic rela- (v/v/v)] (Biodee) was added and mixed thoroughly tionship of the lichen and identify the cryptic ge- by inversion. Then, samples were centrifuged at nus within morphologically homogeneous groups 12,000 ¥ g for 5 min (MIKRO 22R, Hettich, Tutt- using modern molecular techniques. The internal lingen, Germany). If precipitated protein was still transcribed spacer regions of nuclear ribosomal observed at the aqueous/organic interface, extra DNA have been proved to be very useful in ana- washes were performed as necessary. 0.54 Volume lyzing the genetic relationship among species. In- of isopropanol was added and incubated at 4 ∞C ternal transcribed spacer (ITS) sequences infor- for 2 h to precipitate DNA. Following centrifuga- mation has been one of the primary criteria in tion (14,000 ¥ g, 5 min), the pellet was washed investigating the relationship at the specific level. twice with 80% ethanol, dried in air and re-sus- The aim of our study was: 1) to investigate the pended in 50 μl of TE buffer [10 mm Tris-HCI, phylogenetic relationship among Rhizoplaca spe- 1mm EDTA (pH 8.0)]. Total DNA was examined cies by using ITS sequence analysis; 2) through an- for quantity and quality on an ethidium-bromide- alyzing morphological characters, to research stained 1% agarose gel (Yito Enterprise Comp. whether pruinose discs and apothecial discs can be Ltd., Shanghai, China) and stored at Ð20 ∞C. used to test the phylogenetic relationship among DNA reaction mixture was performed in 25 μl Rhizoplaca species. using 10Ð50 ng genomic DNA as template, 2.5 μl dNTP (Takara, Ootsu-shi, Shiga-ken, Japan), 2.5 μl Materials and Methods 10 ¥ PCR buffer (Takara), 1.5 μl10mm primers and 0.3 U Dynazyme Taq polymerase (Takara). Growth conditions and sample collection ITS4 (TCCTCCGCTTATTGATATGC) (White et The lichens in our study were collected from an al., 1990) and ITS1-F (CTTGGTCATTTAGAG- ice-free cirque (43∞ 05Ј N, 86∞ 49Ј E, with an alti- GAAGTAA) (Gardes and Bruns, 1993) were used tude of 3400Ð3900 m) near the No. 1 glacier in the to amplify the ITS sequence. Polymerase chain re- source area of Urumqi river in Tianshan Moun- action (PCR) amplification was executed with the tains, Xinjiang province, China. The annual aver- following program: initial denaturation at 95 ∞C age temperature is lower than 5 ∞C in daytime for 4 min, and subsequently a 35 cycles reaction and Ð4 ∞C at night. The temperature also under- with annealing at 50 ∞C for 1 min, extension at goes a big fluctuation from nearly 4 to Ð10 ∞C dur- 72 ∞C for 1 min, denaturation at 94 ∞C for 1 min ing the favourable growth season from June to and final extension at 72 ∞C for 5 min. The PCR September. All samples were carefully cleaned products were visualized on 1% agarose gel as a with distilled water to remove possible epiphytic band of approx. 500 or 800 bp. Then the products contaminants and then air-dried at room tempera- were cleaned using the purification kit (Takara) ture. Finally, all dried samples were conserved following the manufacturer’s instructions. Sequen- at Ð20 ∞C. cing was accomplished using an automated se- quencer ABI3730 (ABI, Foster City, USA). DNA isolation, PCR and sequencing Total DNA was obtained from dried lichen us- Sequence alignment and phylogenetic analysis ing the modified CTAB (cetyl-trimethyl ammo- nium bromide) method (Murtagh et al., 1999). The Our sequences were aligned using Clustal X1.83 extraction procedure was as follows: Lichen her- (Thompson et al., 1994). All parameters were de- barium materials were ground under liquid nitro- fault values of the software. Maximum parsimony gen and 0.1 g suspended in 600 μl extraction buffer (MP) analysis was determined using PAUP*4b4a (50 mm Tris [tris(hydroxymethyl) amino methane]- (Swofford, 1999) with the following settings: the HCl (pH 8.0), 50 mm EDTA; Biodee, Beijing, matrix was subjected to 10 replicates of random China) and 100 μl of 10% SDS (Biodee). The solu- sequence additions using heuristic searches, tree tion was incubated in water at 65 ∞C for 3Ð5h. bisection and reconnection (TBR) branch swap- X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca 759 ping. Gaps were treated as “missing”. One tree ited in GenBank. The species, localities and the was held at each step during stepwise addition. GenBank accession numbers of twenty ITS data Confidence limits for branches of the trees were of Rhizoplaca Zopf obtained from GenBank are performed by bootstrap analysis with 1,000 repli- shown in Table I. cations. Rooted with Parmelia sulcata (AF410840) and Neighbour-joining (NJ) and minimum evolution Protoparmelia badia (AF070023) as outgroups our method analysis were carried out using MEGA3.1 analysis is justified through the results of molecu- (Kumar et al., 2004) with the following settings: lar investigation in the relationship among species two-parameter method was used to calculate the of the Rhizoplaca genus (Arup and Grube, 2000; genetic distance matrix and construct the neigh- Zhou et al., 2006). bour-joining tree and minimum evolution analysis. One hundred maximum parsimony trees with Gaps and missing data were completely deleted. 761 parsimony-informative characters [consistency Confidence limits for branches of the trees were index (CI) = 0.5608; retention index (RI) = 0.6319] performed by bootstrap analysis with 1,000 repli- were found by a heuristic search, one of the trees cations.
Load more

Recommended publications
  • 1307 Fungi Representing 1139 Infrageneric Taxa, 317 Genera and 66 Families ⇑ Jolanta Miadlikowska A, , Frank Kauff B,1, Filip Högnabba C, Jeffrey C
    Molecular Phylogenetics and Evolution 79 (2014) 132–168 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families ⇑ Jolanta Miadlikowska a, , Frank Kauff b,1, Filip Högnabba c, Jeffrey C. Oliver d,2, Katalin Molnár a,3, Emily Fraker a,4, Ester Gaya a,5, Josef Hafellner e, Valérie Hofstetter a,6, Cécile Gueidan a,7, Mónica A.G. Otálora a,8, Brendan Hodkinson a,9, Martin Kukwa f, Robert Lücking g, Curtis Björk h, Harrie J.M. Sipman i, Ana Rosa Burgaz j, Arne Thell k, Alfredo Passo l, Leena Myllys c, Trevor Goward h, Samantha Fernández-Brime m, Geir Hestmark n, James Lendemer o, H. Thorsten Lumbsch g, Michaela Schmull p, Conrad L. Schoch q, Emmanuël Sérusiaux r, David R. Maddison s, A. Elizabeth Arnold t, François Lutzoni a,10, Soili Stenroos c,10 a Department of Biology, Duke University, Durham, NC 27708-0338, USA b FB Biologie, Molecular Phylogenetics, 13/276, TU Kaiserslautern, Postfach 3049, 67653 Kaiserslautern, Germany c Botanical Museum, Finnish Museum of Natural History, FI-00014 University of Helsinki, Finland d Department of Ecology and Evolutionary Biology, Yale University, 358 ESC, 21 Sachem Street, New Haven, CT 06511, USA e Institut für Botanik, Karl-Franzens-Universität, Holteigasse 6, A-8010 Graz, Austria f Department of Plant Taxonomy and Nature Conservation, University of Gdan´sk, ul. Wita Stwosza 59, 80-308 Gdan´sk, Poland g Science and Education, The Field Museum, 1400 S.
    [Show full text]
  • H. Thorsten Lumbsch VP, Science & Education the Field Museum 1400
    H. Thorsten Lumbsch VP, Science & Education The Field Museum 1400 S. Lake Shore Drive Chicago, Illinois 60605 USA Tel: 1-312-665-7881 E-mail: [email protected] Research interests Evolution and Systematics of Fungi Biogeography and Diversification Rates of Fungi Species delimitation Diversity of lichen-forming fungi Professional Experience Since 2017 Vice President, Science & Education, The Field Museum, Chicago. USA 2014-2017 Director, Integrative Research Center, Science & Education, The Field Museum, Chicago, USA. Since 2014 Curator, Integrative Research Center, Science & Education, The Field Museum, Chicago, USA. 2013-2014 Associate Director, Integrative Research Center, Science & Education, The Field Museum, Chicago, USA. 2009-2013 Chair, Dept. of Botany, The Field Museum, Chicago, USA. Since 2011 MacArthur Associate Curator, Dept. of Botany, The Field Museum, Chicago, USA. 2006-2014 Associate Curator, Dept. of Botany, The Field Museum, Chicago, USA. 2005-2009 Head of Cryptogams, Dept. of Botany, The Field Museum, Chicago, USA. Since 2004 Member, Committee on Evolutionary Biology, University of Chicago. Courses: BIOS 430 Evolution (UIC), BIOS 23410 Complex Interactions: Coevolution, Parasites, Mutualists, and Cheaters (U of C) Reading group: Phylogenetic methods. 2003-2006 Assistant Curator, Dept. of Botany, The Field Museum, Chicago, USA. 1998-2003 Privatdozent (Assistant Professor), Botanical Institute, University – GHS - Essen. Lectures: General Botany, Evolution of lower plants, Photosynthesis, Courses: Cryptogams, Biology
    [Show full text]
  • A Multigene Phylogenetic Synthesis for the Class Lecanoromycetes (Ascomycota): 1307 Fungi Representing 1139 Infrageneric Taxa, 317 Genera and 66 Families
    A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families Miadlikowska, J., Kauff, F., Högnabba, F., Oliver, J. C., Molnár, K., Fraker, E., ... & Stenroos, S. (2014). A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families. Molecular Phylogenetics and Evolution, 79, 132-168. doi:10.1016/j.ympev.2014.04.003 10.1016/j.ympev.2014.04.003 Elsevier Version of Record http://cdss.library.oregonstate.edu/sa-termsofuse Molecular Phylogenetics and Evolution 79 (2014) 132–168 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families ⇑ Jolanta Miadlikowska a, , Frank Kauff b,1, Filip Högnabba c, Jeffrey C. Oliver d,2, Katalin Molnár a,3, Emily Fraker a,4, Ester Gaya a,5, Josef Hafellner e, Valérie Hofstetter a,6, Cécile Gueidan a,7, Mónica A.G. Otálora a,8, Brendan Hodkinson a,9, Martin Kukwa f, Robert Lücking g, Curtis Björk h, Harrie J.M. Sipman i, Ana Rosa Burgaz j, Arne Thell k, Alfredo Passo l, Leena Myllys c, Trevor Goward h, Samantha Fernández-Brime m, Geir Hestmark n, James Lendemer o, H. Thorsten Lumbsch g, Michaela Schmull p, Conrad L. Schoch q, Emmanuël Sérusiaux r, David R. Maddison s, A. Elizabeth Arnold t, François Lutzoni a,10,
    [Show full text]
  • Characterization of Microsatellite Markers in the Cosmopolitan Lichen
    A peer-reviewed open-access journal MycoKeys 14:Characterization 31–36 (2016) of microsatellite markers in the cosmopolitan lichen-forming... 31 doi: 10.3897/mycokeys.14.9729 DATA PAPER MycoKeys http://mycokeys.pensoft.net Launched to accelerate biodiversity research Characterization of microsatellite markers in the cosmopolitan lichen-forming fungus Rhizoplaca melanophthalma (Lecanoraceae) Hanna Lindgren1, Steven D. Leavitt1, H. Thorsten Lumbsch1 1 Integrative Research Center, The Field Museum of Natural History, 1400 S. Lake Shore Drive, Chicago, IL 60605, USA Corresponding author: Hanna Lindgren ([email protected]) Academic editor: P. Divakar | Received 30 June 2016 | Accepted 23 August 2016 | Published 31 August 2016 Citation: Lindgren H, Leavitt SD, Lumbsch HT (2016) Characterization of microsatellite markers in the cosmopolitan lichen-forming fungus Rhizoplaca melanophthalma (Lecanoraceae). MycoKeys 14: 31–36. doi: 10.3897/mycokeys.14.9729 Abstract Rhizoplaca melanophthalma s.l. is a group of morphologically distinct and chemically diverse species that commonly occur in desert, steppe and montane habitats worldwide. In this study, we developed microsat- ellite markers to facilitate studies of genetic diversity, population structure, and gene flow in the nominal taxon of this group, Rhizoplaca melanophthalma. We characterized 10 microsatellite markers using a draft genome of R. melanophthalma s. str. assembled from Illumina reads. These loci were tested for 21R. mel- anophthalma s. str. specimens and also with a subset of 18 specimens representing six additional species in the R. melanophthalma complex. The number of alleles per locus inR. melanophthalma s. str. ranged from 3 to 11 with an average of 6.7. Nei’s unbiased gene diversity ranged from 0.35 to 0.91.
    [Show full text]
  • Taxonomic Recognition of Some Species-Level Lineages Circumscribed in Nominal Rhizoplaca Subdiscrepans S. Lat. (Lecanoraceae, Ascomycota)
    Taxonomic recognition of some species-level lineages circumscribed in nominal Rhizoplaca subdiscrepans s. lat. (Lecanoraceae, Ascomycota) Katarzyna Szczepa«ska1, Jacek Urbaniak1 and Lucyna Śliwa2 1 Department of Botany and Plant Ecology, Wroclaw University of Environmental and Life Sciences, Wrocªaw, Poland 2 Department of Lichenology, W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków, Poland ABSTRACT Background. Rhizoplaca subdiscrepans (Nyl.) R. Sant., a saxicolous, placodioid lichen, is considered to have a worldwide distribution in warm-temperate to boreal-arctic areas in Asia, Europe and North America. However, recent studies have revealed that this species includes five unrecognized species-level lineages—‘subd A, B, C, D and E'. During research focused on the diversity of saxicolous lichens in mountainous areas of southern Poland, some interesting representatives of the genus Rhizoplaca were found. The main aim of our study was to determine the taxonomic status of the collected specimens by means of molecular tools and a comparative analysis of similar herbarium materials. Methods. Detailed morphological, anatomical and chemical examinations of reference material from Asia, Europe and North and South America focused primarily on a selected group of lecanoroid taxa with a placodioid thallus. In addition, 21 new generated sequences representing Lecanora pseudomellea, Protoparmeliopsis muralis, Rhizoplaca opiniconensis, R. subdiscrepans s. lat. and R. phaedrophthalma were selected for molecular study using the internal transcribed spacer region (ITS rDNA), together with 95 available GenBank sequences mainly from the genus Rhizoplaca. Submitted 20 January 2020 Results. Polish specimens that clustered with members of a potential species-level Accepted 25 June 2020 lineage `subd E' of Rhizoplaca subdiscrepans complex were recovered.
    [Show full text]
  • Shotgun Sequencing Decades-Old Lichen Specimens to Resolve Phylogenomic Placement of Type Material
    Boise State University ScholarWorks Biology Faculty Publications and Presentations Department of Biological Sciences 12-2019 Shotgun Sequencing Decades-Old Lichen Specimens to Resolve Phylogenomic Placement of Type Material Steven D. Leavitt Brigham Young University Rachel Kueler Brigham Young University Clayton C. Newberry Brigham Young University Roger Rosentreter Boise State University Larry L. St. Clair Brigham Young University © 2019 W. Szafer Institute of Botany Polish Academy of Sciences Plant and Fungal Systematics 64(2): 237–247, 2019 ISSN 2544-7459 (print) DOI: 10.2478/pfs-2019-0020 ISSN 2657-5000 (online) Shotgun sequencing decades-old lichen specimens to resolve phylogenomic placement of type material Steven D. Leavitt1,2*, Rachel Keuler1, Clayton C. Newberry 2, Roger Rosentreter3 & Larry L. St. Clair1,2 Abstract. Natural history collections, including name-bearing type specimens, are Article info an important source of genetic information. These data can be critical for appropriate taxo- Received: 23 Mar. 2019 nomic revisions in cases where the phylogenetic position of name-bearing type specimens Revision received: 31 Jul. 2019 needs to be identified, including morphologically cryptic lichen-forming fungal species. Accepted: 1 Aug. 2019 Here, we use high-throughput metagenomic shotgun sequencing to generate genome-scale Published: 2 Dec. 2019 data from decades-old (i.e., more than 30 years old) isotype specimens representing three Associate Editor vagrant taxa in the lichen-forming fungal genus Rhizoplaca, including one species and Damien Ertz two subspecies. We also use data from high-throughput metagenomic shotgun sequenc- ing to infer the phylogenetic position of an enigmatic collection, originally identified as R. haydenii, that failed to yield genetic data via Sanger sequencing.
    [Show full text]
  • Metagenomic Data Reveal Diverse Fungal and Algal Communities Associated with the Lichen 2 Symbiosis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.04.966853; this version posted March 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Metagenomic data reveal diverse fungal and algal communities associated with the lichen 2 symbiosis 3 Hayden Smith1, Francesco Dal Grande2,3, Lucia Muggia4, Rachel Keuler1, Pradeep K. Divakar5, Felix 4 Grewe6, Imke Schmitt2,7, H. Thorsten Lumbsch8, Steven D. Leavitt1,* 5 1Department of Biology and M. L. Bean Life Science Museum, Brigham Young University, 6 Provo, Utah, USA 7 2Senckenberg Biodiversity and Climate Research Centre (SBiK-F), Senckenberganlage 25, D- 8 60325 Frankfurt, Germany 9 3 LOEWE Centre for Translational Biodiversity Genomics (TBG), Senckenberganlage 25, D- 10 60325 Frankfurt, Germany 11 4University of Trieste, Department of Life Sciences, via Giorgieri 10, 34127-Trieste, Italy 12 5Departamento de Farmacología, Farmacognosia y Botánica, Facultad de Farmacia, Universidad 13 Complutense de Madrid, 28040 Madrid, Spain 14 6Grainger Bioinformatics Center, Science & Education, The Field Museum, Chicago, IL, USA 15 3Department of Ecology, Evolution and Diversity, Goethe Universität Frankfurt, Max-von-Laue 16 Str. 11, D-60438 Frankfurt, Germany 17 8Science & Education, The Field Museum, Chicago, IL, USA 18 *corresponding author: [email protected] 19 20 Francesco Dal Grande: https://orcid.org/0000-0002-1865-6281 21 Lucia Muggia: https://orcid.org/0000-0003-0390-6169 22 Pradeep K. Divakar: https://orcid.org/0000-0002-0300-0124 23 H.
    [Show full text]
  • First Data on Molecular Phylogeny of the Genus Protoparmeliopsis M
    Modern Phytomorphology 5: 63–68, 2014 FIRST DATA ON MOLECULAR PHYLOGENY OF THE GENUS PROTOPARMELIOPSIS M. CHOISY (LECANORACEAE, ASCOMYCOTA) Sergij Y. Kondratyuk 1, Jung Kim 2, Anna S. Kondratiuk 3, Min-Hye Jeong 2, Seol-Hwa Jang 2, Mykola V. Pirogov 4, Jae-Seoun Hur 2 Abstract. Results on molecular phylogeny of lichen-forming fungi of the genus Protoparmeliopsis based on nrDNA ITS1/ ITS2 and 28S LSU and mtDNA 12S SSU as well as on combined data set are provided. The position of this genus in the phylogenetic tree of the family Lecanoraceae is discussed. The genusProtoparmeliopsis found to be polyphyletic similarly to the genera Rhizoplaca, Lecanora and Protoparmelia. Key words: Protoparmeliopsis, Lecanora, Rhizoplaca, nuclear, mitochondrial DNA, sequences 1 M.H. Kholodny Institute of Botany, Tereshchenkivska str. 2, 01601 Kiev, Ukraine; [email protected] 2 Korean Lichen Research Institute, Sunchon National University, 540-742 Sunchon, Korea 3 ’Institute of Biology’ Scientific Educational Centre, Taras Shevchenko National University of Kyiv, Volodymyrska str. 64/13, 01601 Kyiv, Ukraine 4 Ivan Franko National University of Lviv, Hrushevsky str. 4, 79005 Lviv, Ukraine Introduction GenBank. Several species recently described in Protoparmeliopsis, or combined in the The first molecular data of the genus genus, based on results from morphology Protoparmeliopsis M. Choisy were provided by (Kondratyuk 2010, Kondratyuk et al. 2012, Arup & Grube (2000). Four species (P. muralis 2013 c), were here included in a molecular (Schreb.) M. Choisy, P. acharianum (A.L. Sm.) analysis. Moberg & R. Sant., P. laatokkaensis (Räsänen) Moberg & R. Sant., and P. macrocyclos Material and methods (H. Magn.) Moberg & R. Sant.) have been included in the genus since then (Santesson Specimens (Tab.
    [Show full text]
  • Arup Etal CJOB 2000 318
    Color profile: Disabled Composite Default screen 318 Is Rhizoplaca (Lecanorales, lichenized Ascomycota) a monophyletic genus? U. Arup and M. Grube Abstract: Rhizoplaca Zopf is a genus characterized by an umbilicate thallus with an upper and a lower cortex, as well as a cupulate hypothecium. It has been considered to be related to Lecanora Ach., the type genus of the Lecanoraceae and, in particular, to the lobate species of this genus. The phylogeny of Rhizoplaca, the monotypic Arctopeltis thuleana Poelt, and a number of representatives of different groups of Lecanora is studied, using sequences from the nuclear ri- bosomal internal transcribed spacer (ITS) regions. The results suggest an origin for Rhizoplaca species within the large genus Lecanora. A well-supported monophyletic assemblage includes the umbilicate type species Rhizoplaca melanophthalma (DC.) Leuck. & Poelt, the lobate Lecanora novomexicana H. Magn., and five vagrant Rhizoplaca spe- cies. Rhizoplaca chrysoleuca (Sm.) Zopf and Rhizoplaca subdicrepans (Nyl.) R. Sant. form a separate well-supported group and Rhizoplaca peltata (Ram.) Leuck. & Poelt is more closely related to Lecanora muralis (Schreb.) Rabenh. Together with data on secondary chemistry, the results show that the umbilicate thallus with a lower and an upper cor- tex, as well as apothecia with a cupulate hypothecium found in Rhizoplaca and A. thuleana, have developed several times in independant lineages in Lecanora. The thallus morphology in lecanoroid lichens is highly variable and does not necessarily reflect phylogenetic relationships. Key words: Rhizoplaca, Lecanora, Lecanorales, phylogeny, ITS. Résumé : Le genre Rhizoplaca Zopf est caractérisé par un thalle ombiliqué muni de cortex supérieur et inférieur, ainsi que d’ un hypothèce cupulé.
    [Show full text]
  • Three Placodioid Species of <I>Lecanoraceae</I> New for China
    MYCOTAXON ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2020 October–December 2020—Volume 135, pp. 869–876 https://doi.org/10.5248/135.869 Three placodioid species of Lecanoraceae new for China Lei Lü, Yu-Hong Yang, Jin-Xing He * College of Food Science and Engineering, Qilu University of Technology, Jinan, 250353, China * Correspondence to: [email protected] Abstract — Three placodioid lichen species,Lecanora valesiaca, Protoparmeliopsis sierrae, and Rhizoplaca phaedrophthalma, are reported for the first time from China. Detailed taxonomic descriptions with high resolution photographs, chemistry, remarks, and distribution are provided. Keywords —ascolichen, pruinose thallus, rosettes, squamulose-areolate, taxonomy Introduction Lecanoraceae Körb. (Lecanorales, Lecanoromycetes, Ascomycota) contains 26 genera with about 800 species worldwide (Lücking & al. 2017; Kraichak & al. 2018). Only 153 species representing nine genera have been reported from China thus far: Carbonea (Hertel) Hertel (3 spp.), Clauzadeana Cl. Roux (1 sp.), Lecanora Ach. (119 spp.), Lecidella Körb. (13 spp.), Miriquidica Hertel & Rambold (3 spp.), Myriolecis Clem. (3 spp.), Rhizoplaca Zopf (7 spp.), Protoparmeliopsis M. Choisy (2 spp.), and Pyrrhospora Körb. (2 spp.) (Wei 1991; Abbas & Wu 1998; Abbas & al. 2001; Aptroot & Sparrius 2003; Seaward & Aptroot 2005; Zheng & al. 2007; Zhang & al. 2012; Zhao & al. 2013, 2015; Lü & Zhao 2017). Among them, one Lecanora complex (Lecanora muralis group) and three genera (Miriquidica, Protoparmeliopsis, and Rhizoplaca) have placodioid or peltate-umbilicate thalli. During our research on the placodioid taxa of Lecanoraceae in China, we identified three new records (Lecanora valesiaca, Protoparmeliopsis sierrae, Rhizoplaca phaedrophthalma), which we describe and illustrate below. 870 ... Lü, Yang, He Materials & methods The specimens were collected from Hebei, Inner Mongolia, Ningxia, Qinghai, Sichuan, and Xizang provinces in China and are deposited in the Lichen Section of the Botanical Herbarium, Shandong Normal University, Jinan, China (SDNU).
    [Show full text]
  • Cryptic Diversity and Symbiont Interactions in Rock-Posy Lichens ⇑ Steven D
    Molecular Phylogenetics and Evolution 99 (2016) 261–274 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Cryptic diversity and symbiont interactions in rock-posy lichens ⇑ Steven D. Leavitt a, , Ekaphan Kraichak b, Jan Vondrak c, Matthew P. Nelsen d, Mohammad Sohrabi e, Sergio Perez-Ortega f, Larry L. St Clair g, H. Thorsten Lumbsch a a Science & Education, The Field Museum, Chicago, IL, USA b Department of Botany, Kasetsart University, Bangkok 10900, Thailand c Faculty of Environmental Sciences, Czech University of Life Sciences Prague, Kamy´cká 1176, Praha 6, Suchdol, Czech Republic d Geological Sciences, Stanford University, Stanford, CA, USA e Department of Biotechnology, Iranian Research Organization for Science and Technology, Tehran, Iran f Real Jardín Botánico (CSIC), 28014 Madrid, Spain g Department of Biology and M.L. Bean Life Science Museum, Brigham Young University, Provo, UT 84602, USA article info abstract Article history: Identifying factors that influence species interactions is central to research in symbiotic systems. While Received 11 September 2015 lichens represent iconic models of symbiosis and play important roles in understanding the biology of Revised 18 March 2016 symbiotic interactions, patterns of interactions in lichen symbionts and mechanisms governing these Accepted 22 March 2016 relationships are not well characterized. This is due, in part to the fact that current taxonomic approaches Available online 24 March 2016 for recognizing diversity in lichen symbionts commonly fail to accurately reflect actual species diversity. In this study, we employed DNA-based approaches to circumscribed candidate species-level lineages in Keywords: rock-posy lichen symbionts (mycobiont = Rhizoplaca s.
    [Show full text]
  • Squamarina (Lichenised Fungi) Species Described from China Belong to at Least Three Unrelated Genera
    A peer-reviewed open-access journal MycoKeys 66: 135–157A (2020) revision work on the Squamarina species described from China 135 doi: 10.3897/mycokeys.66.39057 RESEarcH ARTICLE MycoKeys http://mycokeys.pensoft.net Launched to accelerate biodiversity research Squamarina (lichenised fungi) species described from China belong to at least three unrelated genera Yan-Yun Zhang1,2, Xin-Yu Wang1, Li-Juan Li1,2, Christian Printzen3, Einar Timdal4, Dong-Ling Niu5, An-Cheng Yin1, Shi-Qiong Wang1, Li-Song Wang1 1 CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650201, China 2 University of Chinese Academy of Sciences, Beijing 100049, China 3 Department of Botany and Molecular Evolution, Senckenberg Research Institute, 60325 Frankfurt am Main, Germany 4 Natural History Museum, University of Oslo, P.O. Box 1172, Blindern, N-0318 Oslo, Norway 5 Department of Life Science, Ningxia University, Yinchuan, Ningxia 750021, China Corresponding author: Li-Song Wang ([email protected]) Academic editor: E. Gaya | Received 13 August 2019 | Accepted 23 March 2020 | Published 24 April 2020 Citation: Zhang Y-Y, Wang X-Y, Li L-J, Printzen C, Timdal E, Niu D-L, Yin A-C, Wang S-Q, Wang L-S (2020) Squamarina (lichenised fungi) species described from China belong to at least three unrelated genera. MycoKeys 66: 135–157. https://doi.org/10.3897/mycokeys.66.39057 Abstract New collections of six Squamarina species from type localities in China were studied. The compari- son of morphological characteristics and secondary metabolites with those of the type specimens and phylogenetic analyses suggest that S.
    [Show full text]