DOCSLIB.ORG

Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,B,*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,B,* Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,b,* a Key Laboratory of Arid and Grassland Agroecology of Ministry of Education, School of Life Sciences, Lanzhou University, Lanzhou 730000, P. R. China. Fax: +869318912561. E-mail: [email protected] b Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Lanzhou 730000, P. R. China * Author for correspondence and reprint requests Z. Naturforsch. 62c, 757Ð764 (2007); received November 23, 2006/February 7, 2007 A molecular phylogenetic analysis of Rhizoplaca melanophthalma, Rhizoplaca chrysoleuca, Rhizoplaca peltata and Rhizoplaca haydenii is presented based on the nuclear ribosomal internal transcribed spacer (ITS) regions and morphology. Rhizoplaca species were collected at 3400Ð3900 m in Tianshan Mountains, Xinjiang province, China. Rhizoplaca haydenii is reported for the first time in China. Maximum parsimony (MP) analysis of ITS sequences obtained from Tianshan Mountains samples and GenBank reveals that the evolution rela- tionship of Rhizoplaca melanophthalma and Rhizoplaca chrysoleuca is closer to each other than to Rhizoplaca peltata, and Rhizoplaca haydenii showed closer relatedness to Rhizoplaca melanophthalma. When the four species groups from Tianshan Mountains were analyzed alone through the neighbour-joining (NJ) and minimum evolution method, we obtained the same result. The morphology analysis of Rhizoplaca Zopf which reveals the pruinose discs and apothecial discs of species did not show convincing evidences to prove phylogenetic relationship among Rhizoplaca species. In our study, the result further proved that Rhizo- placa should be rejected as a genus separate from Lecanora. Key words: Rhizoplaca Zopf, Phylogeny, ITS Introduction (Zopf, 1905). Afterward, Poelt (1958) advanced The lichen has a widely geographical distribu- that Rhizoplaca Zopf is a genus separate from Le- tion in the world. It is a symbiotic association canora. Whereas, Ryan and Nash (1997) doubted which is constituted by fungi and algae or cyano- the relationship between Rhizoplaca Zopf and Le- bacteria. The biological character of lichen is re- canora and suggested to do some further investi- flection of the essentiality of fungi within the sym- gation. Arup and Grube (2000) adapted that Rhi- biotic association. Therefore, lichen has been zoplaca Zopf is not a genus separate from named lichen-forming fungi (Hawksworth and Lecanora and may not be a monophyletic genus. Hill, 1984) or lichenized fungi (Wei, 1982). Cansaran et al. (2006) also supported this result. Rhizoplaca Zopf belongs to the division lichen- At present, researchers focus on the phylogenetic forming Ascomycetes and family Lecanoraceae. It relationship among Rhizoplaca Zopf and other comprises more than nine species distributed correlated genera (Arup and Grube, 2000), how- throughout the world, only six of them are found ever, studies on phylogenetic relationships among in China. There are R. chrysoleuca (Sm.) Zopf, R. these species are very limited. fumida X. Q. Gao, R. huashanensis Wei, R. melan- Originally, lichenologists used thallus structure ophthalma (Ram. in Lam. & DC.) Leuckert et Po- and secondary metabolism to study the phyloge- elt, R. subdiscrepans (Nyl.) and R. peltata (Ram.) netic relationship of the lichen (Sundin and Tehler, Leuckert et Poelt including two variations v. pel- 1998; Crespo et al., 1999). However, there is not tata and v. regalis (H. Magn.) Wei (Wei, 1991). Ac- distinct difference of the characters within genera cording to the study of Wei and Wei (2005), R. or between species and no further support for gen- fumida may be treated as one of the chemotypes era that are characterized mainly by their thallus within R. chrysoleuca. morphology. In addition, chemical similarity or Rhizoplaca Zopf was separated from the genus difference is not a reliable evidence of systematic Squamaria DC. based on its single central rhizoid relationships because chemistry is varied in many 0939Ð5075/2007/0900Ð0757 $ 06.00 ” 2007 Verlag der Zeitschrift für Naturforschung, Tübingen · http://www.znaturforsch.com · D 758 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca species and sporadically shared by different 80 μl high concentration CTAB/NaCl (Biodee) groups (Leuckert et al., 1977; Wei, 1984; Ryan and and 100 μl NaCl (5 m) were added to the solution. Nash, 1997; Arup and Grube, 2000; Wei and Wei, Then the solution was incubated at 65 ∞C for 5 min 2005; Zhou et al., 2006). With the improvement of to further eliminate protein. One volume of equili- molecular technology, more and more lichenolo- brated phenol/chloroform/isoamylalcohol [25:24:1 gists began to deeply reveal the phylogenetic rela- (v/v/v)] (Biodee) was added and mixed thoroughly tionship of the lichen and identify the cryptic ge- by inversion. Then, samples were centrifuged at nus within morphologically homogeneous groups 12,000 ¥ g for 5 min (MIKRO 22R, Hettich, Tutt- using modern molecular techniques. The internal lingen, Germany). If precipitated protein was still transcribed spacer regions of nuclear ribosomal observed at the aqueous/organic interface, extra DNA have been proved to be very useful in ana- washes were performed as necessary. 0.54 Volume lyzing the genetic relationship among species. In- of isopropanol was added and incubated at 4 ∞C ternal transcribed spacer (ITS) sequences infor- for 2 h to precipitate DNA. Following centrifuga- mation has been one of the primary criteria in tion (14,000 ¥ g, 5 min), the pellet was washed investigating the relationship at the specific level. twice with 80% ethanol, dried in air and re-sus- The aim of our study was: 1) to investigate the pended in 50 μl of TE buffer [10 mm Tris-HCI, phylogenetic relationship among Rhizoplaca spe- 1mm EDTA (pH 8.0)]. Total DNA was examined cies by using ITS sequence analysis; 2) through an- for quantity and quality on an ethidium-bromide- alyzing morphological characters, to research stained 1% agarose gel (Yito Enterprise Comp. whether pruinose discs and apothecial discs can be Ltd., Shanghai, China) and stored at Ð20 ∞C. used to test the phylogenetic relationship among DNA reaction mixture was performed in 25 μl Rhizoplaca species. using 10Ð50 ng genomic DNA as template, 2.5 μl dNTP (Takara, Ootsu-shi, Shiga-ken, Japan), 2.5 μl Materials and Methods 10 ¥ PCR buffer (Takara), 1.5 μl10mm primers and 0.3 U Dynazyme Taq polymerase (Takara). Growth conditions and sample collection ITS4 (TCCTCCGCTTATTGATATGC) (White et The lichens in our study were collected from an al., 1990) and ITS1-F (CTTGGTCATTTAGAG- ice-free cirque (43∞ 05Ј N, 86∞ 49Ј E, with an alti- GAAGTAA) (Gardes and Bruns, 1993) were used tude of 3400Ð3900 m) near the No. 1 glacier in the to amplify the ITS sequence. Polymerase chain re- source area of Urumqi river in Tianshan Moun- action (PCR) amplification was executed with the tains, Xinjiang province, China. The annual aver- following program: initial denaturation at 95 ∞C age temperature is lower than 5 ∞C in daytime for 4 min, and subsequently a 35 cycles reaction and Ð4 ∞C at night. The temperature also under- with annealing at 50 ∞C for 1 min, extension at goes a big fluctuation from nearly 4 to Ð10 ∞C dur- 72 ∞C for 1 min, denaturation at 94 ∞C for 1 min ing the favourable growth season from June to and final extension at 72 ∞C for 5 min. The PCR September. All samples were carefully cleaned products were visualized on 1% agarose gel as a with distilled water to remove possible epiphytic band of approx. 500 or 800 bp. Then the products contaminants and then air-dried at room tempera- were cleaned using the purification kit (Takara) ture. Finally, all dried samples were conserved following the manufacturer’s instructions. Sequen- at Ð20 ∞C. cing was accomplished using an automated se- quencer ABI3730 (ABI, Foster City, USA). DNA isolation, PCR and sequencing Total DNA was obtained from dried lichen us- Sequence alignment and phylogenetic analysis ing the modified CTAB (cetyl-trimethyl ammo- nium bromide) method (Murtagh et al., 1999). The Our sequences were aligned using Clustal X1.83 extraction procedure was as follows: Lichen her- (Thompson et al., 1994). All parameters were de- barium materials were ground under liquid nitro- fault values of the software. Maximum parsimony gen and 0.1 g suspended in 600 μl extraction buffer (MP) analysis was determined using PAUP*4b4a (50 mm Tris [tris(hydroxymethyl) amino methane]- (Swofford, 1999) with the following settings: the HCl (pH 8.0), 50 mm EDTA; Biodee, Beijing, matrix was subjected to 10 replicates of random China) and 100 μl of 10% SDS (Biodee). The solu- sequence additions using heuristic searches, tree tion was incubated in water at 65 ∞C for 3Ð5h. bisection and reconnection (TBR) branch swap- X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca 759 ping. Gaps were treated as “missing”. One tree ited in GenBank. The species, localities and the was held at each step during stepwise addition. GenBank accession numbers of twenty ITS data Confidence limits for branches of the trees were of Rhizoplaca Zopf obtained from GenBank are performed by bootstrap analysis with 1,000 repli- shown in Table I. cations. Rooted with Parmelia sulcata (AF410840) and Neighbour-joining (NJ) and minimum evolution Protoparmelia badia (AF070023) as outgroups our method analysis were carried out using MEGA3.1 analysis is justified through the results of molecu- (Kumar et al., 2004) with the following settings: lar investigation in the relationship among species two-parameter method was used to calculate the of the Rhizoplaca genus (Arup and Grube, 2000; genetic distance matrix and construct the neigh- Zhou et al., 2006). bour-joining tree and minimum evolution analysis. One hundred maximum parsimony trees with Gaps and missing data were completely deleted. 761 parsimony-informative characters [consistency Confidence limits for branches of the trees were index (CI) = 0.5608; retention index (RI) = 0.6319] performed by bootstrap analysis with 1,000 repli- were found by a heuristic search, one of the trees cations.
Load more

Recommended publications
  • DISSERTAÇÃO Lidiane Alves Dos Santos.Pdf
    UNIVERSIDADE FEDERAL DE PERNAMBUCO CENTRO DE BIOCIÊNCIAS DEPARTAMENTO DE MICOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA DE FUNGOS LIDIANE ALVES DOS SANTOS RELAÇÕES FILOGENÉTICAS DOS GÊNEROS LECANORA ACH. E NEOPROTOPARMELIA GARIMA SINGH, LUMBSCH & I. SCHIMITT (LECANORALES, ASCOMYCOTA LIQUENIZADOS) Recife 2019 LIDIANE ALVES DOS SANTOS RELAÇÕES FILOGENÉTICAS DOS GÊNEROS LECANORA ACH. E NEOPROTOPARMELIA GARIMA SINGH, LUMBSCH & I. SCHIMITT (LECANORALES, ASCOMYCOTA LIQUENIZADOS) Dissertação apresentada ao Programa de Pós- Graduação em Biologia de Fungos do Departamento de Micologia do Centro de Biociências da Universidade Federal de Pernambuco, como parte dos requisitos para a obtenção do título de Mestre em Biologia de Fungos. Área de Concentração: Micologia Básica Orientadora: Profª. Dra. Marcela Eugenia da Silva Caceres. Coorientador: Dr. Robert Lücking. Recife 2019 Catalogação na fonte Elaine C Barroso (CRB4/1728) Santos, Lidiane Alves dos Relações filogenéticas dos gêneros Lecanora Ach. e Neoprotoparmelia Garima Singh, Lumbsch & I. Schimitt (Lecanorales, Ascomycota Liquenizados) / Lidiane Alves dos Santos- 2019. 52 folhas: il., fig., tab. Orientadora: Marcela Eugênia da Silva Cáceres Coorientador: Robert Lücking Dissertação (mestrado) – Universidade Federal de Pernambuco. Centro de Biociências. Programa de Pós-Graduação em Biologia de Fungos. Recife, 2019. Inclui referências 1. Fungos liquenizados 2. Filogenia 3. Metabólitos secundários I. Cáceres, Marcela Eugênia da Silva (orient.) II. Lücking, Robert (coorient.) III. Título 579.5 CDD (22.ed.) UFPE/CB-2019-312 LIDIANE ALVES DOS SANTOS RELAÇÕES FILOGENÉTICAS DOS GÊNEROS LECANORA ACH. E NEOPROTOPARMELIA GARIMA SINGH, LUMBSCH & I. SCHIMITT (LECANORALES, ASCOMYCOTA LIQUENIZADOS) Dissertação apresentada ao Programa de Pós- Graduação em Biologia de Fungos do Departamento de Micologia do Centro de Biociências da Universidade Federal de Pernambuco, como parte dos requisitos para a obtenção do título de Mestre em Biologia de Fungos.
    [Show full text]
  • 1307 Fungi Representing 1139 Infrageneric Taxa, 317 Genera and 66 Families ⇑ Jolanta Miadlikowska A, , Frank Kauff B,1, Filip Högnabba C, Jeffrey C
    Molecular Phylogenetics and Evolution 79 (2014) 132–168 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families ⇑ Jolanta Miadlikowska a, , Frank Kauff b,1, Filip Högnabba c, Jeffrey C. Oliver d,2, Katalin Molnár a,3, Emily Fraker a,4, Ester Gaya a,5, Josef Hafellner e, Valérie Hofstetter a,6, Cécile Gueidan a,7, Mónica A.G. Otálora a,8, Brendan Hodkinson a,9, Martin Kukwa f, Robert Lücking g, Curtis Björk h, Harrie J.M. Sipman i, Ana Rosa Burgaz j, Arne Thell k, Alfredo Passo l, Leena Myllys c, Trevor Goward h, Samantha Fernández-Brime m, Geir Hestmark n, James Lendemer o, H. Thorsten Lumbsch g, Michaela Schmull p, Conrad L. Schoch q, Emmanuël Sérusiaux r, David R. Maddison s, A. Elizabeth Arnold t, François Lutzoni a,10, Soili Stenroos c,10 a Department of Biology, Duke University, Durham, NC 27708-0338, USA b FB Biologie, Molecular Phylogenetics, 13/276, TU Kaiserslautern, Postfach 3049, 67653 Kaiserslautern, Germany c Botanical Museum, Finnish Museum of Natural History, FI-00014 University of Helsinki, Finland d Department of Ecology and Evolutionary Biology, Yale University, 358 ESC, 21 Sachem Street, New Haven, CT 06511, USA e Institut für Botanik, Karl-Franzens-Universität, Holteigasse 6, A-8010 Graz, Austria f Department of Plant Taxonomy and Nature Conservation, University of Gdan´sk, ul. Wita Stwosza 59, 80-308 Gdan´sk, Poland g Science and Education, The Field Museum, 1400 S.
    [Show full text]
  • Three Challenges to Contemporaneous Taxonomy from a Licheno-Mycological Perspective
    Megataxa 001 (1): 078–103 ISSN 2703-3082 (print edition) https://www.mapress.com/j/mt/ MEGATAXA Copyright © 2020 Magnolia Press Review ISSN 2703-3090 (online edition) https://doi.org/10.11646/megataxa.1.1.16 Three challenges to contemporaneous taxonomy from a licheno-mycological perspective ROBERT LÜCKING Botanischer Garten und Botanisches Museum, Freie Universität Berlin, Königin-Luise-Straße 6–8, 14195 Berlin, Germany �[email protected]; https://orcid.org/0000-0002-3431-4636 Abstract Nagoya Protocol, and does not need additional “policing”. Indeed, the Nagoya Protocol puts the heaviest burden on This paper discusses three issues that challenge contempora- taxonomy and researchers cataloguing biodiversity, whereas neous taxonomy, with examples from the fields of mycology for the intended target group, namely those seeking revenue and lichenology, formulated as three questions: (1) What is gain from nature, the protocol may not actually work effec- the importance of taxonomy in contemporaneous and future tively. The notion of currently freely accessible digital se- science and society? (2) An increasing methodological gap in quence information (DSI) to become subject to the protocol, alpha taxonomy: challenge or opportunity? (3) The Nagoya even after previous publication, is misguided and conflicts Protocol: improvement or impediment to the science of tax- with the guidelines for ethical scientific conduct. Through onomy? The importance of taxonomy in society is illustrated its implementation of the Nagoya Protocol, Colombia has using the example of popular field guides and digital me- set a welcome precedence how to exempt taxonomic and dia, a billion-dollar business, arguing that the desire to name systematic research from “access to genetic resources”, and species is an intrinsic feature of the cognitive component of hopefully other biodiversity-rich countries will follow this nature connectedness of humans.
    [Show full text]
  • H. Thorsten Lumbsch VP, Science & Education the Field Museum 1400
    H. Thorsten Lumbsch VP, Science & Education The Field Museum 1400 S. Lake Shore Drive Chicago, Illinois 60605 USA Tel: 1-312-665-7881 E-mail: [email protected] Research interests Evolution and Systematics of Fungi Biogeography and Diversification Rates of Fungi Species delimitation Diversity of lichen-forming fungi Professional Experience Since 2017 Vice President, Science & Education, The Field Museum, Chicago. USA 2014-2017 Director, Integrative Research Center, Science & Education, The Field Museum, Chicago, USA. Since 2014 Curator, Integrative Research Center, Science & Education, The Field Museum, Chicago, USA. 2013-2014 Associate Director, Integrative Research Center, Science & Education, The Field Museum, Chicago, USA. 2009-2013 Chair, Dept. of Botany, The Field Museum, Chicago, USA. Since 2011 MacArthur Associate Curator, Dept. of Botany, The Field Museum, Chicago, USA. 2006-2014 Associate Curator, Dept. of Botany, The Field Museum, Chicago, USA. 2005-2009 Head of Cryptogams, Dept. of Botany, The Field Museum, Chicago, USA. Since 2004 Member, Committee on Evolutionary Biology, University of Chicago. Courses: BIOS 430 Evolution (UIC), BIOS 23410 Complex Interactions: Coevolution, Parasites, Mutualists, and Cheaters (U of C) Reading group: Phylogenetic methods. 2003-2006 Assistant Curator, Dept. of Botany, The Field Museum, Chicago, USA. 1998-2003 Privatdozent (Assistant Professor), Botanical Institute, University – GHS - Essen. Lectures: General Botany, Evolution of lower plants, Photosynthesis, Courses: Cryptogams, Biology
    [Show full text]
  • A Multigene Phylogenetic Synthesis for the Class Lecanoromycetes (Ascomycota): 1307 Fungi Representing 1139 Infrageneric Taxa, 317 Genera and 66 Families
    A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families Miadlikowska, J., Kauff, F., Högnabba, F., Oliver, J. C., Molnár, K., Fraker, E., ... & Stenroos, S. (2014). A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families. Molecular Phylogenetics and Evolution, 79, 132-168. doi:10.1016/j.ympev.2014.04.003 10.1016/j.ympev.2014.04.003 Elsevier Version of Record http://cdss.library.oregonstate.edu/sa-termsofuse Molecular Phylogenetics and Evolution 79 (2014) 132–168 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families ⇑ Jolanta Miadlikowska a, , Frank Kauff b,1, Filip Högnabba c, Jeffrey C. Oliver d,2, Katalin Molnár a,3, Emily Fraker a,4, Ester Gaya a,5, Josef Hafellner e, Valérie Hofstetter a,6, Cécile Gueidan a,7, Mónica A.G. Otálora a,8, Brendan Hodkinson a,9, Martin Kukwa f, Robert Lücking g, Curtis Björk h, Harrie J.M. Sipman i, Ana Rosa Burgaz j, Arne Thell k, Alfredo Passo l, Leena Myllys c, Trevor Goward h, Samantha Fernández-Brime m, Geir Hestmark n, James Lendemer o, H. Thorsten Lumbsch g, Michaela Schmull p, Conrad L. Schoch q, Emmanuël Sérusiaux r, David R. Maddison s, A. Elizabeth Arnold t, François Lutzoni a,10,
    [Show full text]
  • NEW RECORDS of LECANORA for BOLIVIA. II Lucyna Śliwa1, Pamela
    Polish Botanical Journal 59(1): 97–103, 2014 DOI: 10.2478/pbj-2014-0021 NEW RECORDS OF LECANORA FOR BOLIVIA. II Lucyna Śliwa1, Pamela Rodriguez Flakus, Karina Wilk & Adam Flakus Abstract. Members of the lichen genus Lecanora Ach. are important but still poorly known components of almost all vegetation types in Bolivia. In this paper, seven species new for Bolivia are presented: Lecanora bicincta Ramond, L. fulvastra Kremp., L. hagenii (Ach.) Ach., L. muralis (Schreb.) Rabenh., L. percrenata H. Magn., L. stramineoalbida Vain. and L. strobilina (Spreng.) Kieff. Their distributions are described and information on their diagnostic characters and chemistry is given. Key words: biodiversity, lichenized Ascomycota, Lecanoraceae, secondary metabolites, Neotropics, South America Lucyna Śliwa, Karina Wilk & Adam Flakus, Laboratory of Lichenology, W. Szafer Institute of Botany, Polish Academy of Sciences, Lubicz 46, 31–512 Kraków, Poland; e-mail: [email protected] Pamela Rodriguez Flakus, Department of Botany and Molecular Evolution, Senckenberg Forschungsinstitut und Naturmuseum, Senckenberganlage 25, D-60325 Frankfurt am Main, Germany; Herbario Nacional de Bolivia, Instituto de Ecología, Universidad Mayor de San Andrés, Calle 27, Cota Cota, Casilla 10077, La Paz, Bolivia Introduction A recent advanced lichenological survey in Bolivia The rich collection of Lecanora we collected revealed the remarkable diversity of its lichens and from diverse biogeographic regions of Bolivia lichenicolous fungi, which includes a large number over the past decade is a source of many new of newly described species (Flakus & Kukwa discoveries, some of which have been published 2007, 2012; Flakus 2009; Flakus et al. 2011a, (Śliwa et al. 2012a). Here we present the second 2012a; Knudsen et al.
    [Show full text]
  • A Molecular Phylogeny of the Lichen Genus Lecidella Focusing on Species from Mainland China
    RESEARCH ARTICLE A Molecular Phylogeny of the Lichen Genus Lecidella Focusing on Species from Mainland China Xin Zhao1, Lu Lu Zhang1, Zun Tian Zhao1, Wei Cheng Wang1, Steven D. Leavitt2,3, Helge Thorsten Lumbsch2* 1 College of Life Sciences, Shandong Normal University, Jinan, 250014, P. R. China, 2 Science & Education, The Field Museum, Chicago, Illinois, United States of America, 3 Committee on Evolutionary Biology, University of Chicago, Chicago, Illinois, United States of America * [email protected] Abstract The phylogeny of Lecidella species is studied, based on a 7-locus data set using ML and OPEN ACCESS Bayesian analyses. Phylogenetic relationships among 43 individuals representing 11 Leci- della species, mainly from mainland China, were included in the analyses and phenotypical Citation: Zhao X, Zhang LL, Zhao ZT, Wang WC, characters studied and mapped onto the phylogeny. The Lecidella species fall into three Leavitt SD, Lumbsch HT (2015) A Molecular Phylogeny of the Lichen Genus Lecidella Focusing major clades, which are proposed here as three informal groups–Lecidella stigmatea group, on Species from Mainland China. PLoS ONE 10(9): L. elaeochroma group and L. enteroleucella group, each of them strongly supported. Our e0139405. doi:10.1371/journal.pone.0139405 phylogenetic analyses support traditional species delimitation based on morphological and Editor: Nico Cellinese, University of Florida, UNITED chemical traits in most but not all cases. Individuals considered as belonging to the same STATES species based on phenotypic characters were found to be paraphyletic, indicating that cryp- Received: July 20, 2015 tic species might be hidden under these names (e.g. L. carpathica and L.
    [Show full text]
  • The Genus Ramboldia (Lecanoraceae): a New Species, Key and Notes
    The Lichenologist 38(2): 135–141 (2007) 2007 British Lichen Society doi:10.1017/S0024282907006469 Printed in the United Kingdom The genus Ramboldia (Lecanoraceae): a new species, key and notes Gintaras KANTVILAS & John A. ELIX Abstract: The new species Ramboldia blastidiata Kantvilas & Elix, from Tasmania and mainland Australia is described, and the new combination, R. elabens (Fr.) Kantvilas & Elix is proposed. The South American R. petraeoides var. concava (Müll. Arg.) Fryday is considered a synonym of R. petraeoides (Nyl. ex C. Bab. & Mitt.) Kantvilas & Elix s. str.,andR. crassithallina Kalb and R. sorediata Kalb, both previously considered endemic to Western Australia, are recorded from Tasmania for the first time. A key to the 11 species of Ramboldia is presented. Key words: Australia, blastidia, lichens, Pyrrhospora, Ramboldia, Tasmania Introduction Carbonea (Hertel) Hertel and the Lecanora The genus Ramboldia was introduced by symmicta (Ach.) Ach. group, all of which Kantvilas & Elix (1994) to accommodate differ from Ramboldia chiefly by their ascus crustose lichens with a green, trebouxioid structure. In Miriquidica, the masse axiale is photobiont, lecideine apothecia, an inter- relatively poorly differentiated; in Lecidella,it nally unpigmented excipulum composed has a rounded apex and does not fully of radiating, branched and anastomosing penetrate the tholus, whereas in Carbonea hyphae, asci of the Lecanora-type with an and Lecanora symmicta,itiscylindrical amyloid tholus and broadly diverging masse with parallel (rather than divergent) flanks. axiale, sparsely branched and anastomosing Carbonea differs further by its opaque, car- paraphyses, and simple, hyaline, non- bonized excipulum. It remains to be seen halonate ascospores. Species of the genus how the distinction between these genera are lignicolous, saxicolous or corticolous; and the placement of individual species will one species is lichenicolous.
    [Show full text]
  • Characterization of Microsatellite Markers in the Cosmopolitan Lichen
    A peer-reviewed open-access journal MycoKeys 14:Characterization 31–36 (2016) of microsatellite markers in the cosmopolitan lichen-forming... 31 doi: 10.3897/mycokeys.14.9729 DATA PAPER MycoKeys http://mycokeys.pensoft.net Launched to accelerate biodiversity research Characterization of microsatellite markers in the cosmopolitan lichen-forming fungus Rhizoplaca melanophthalma (Lecanoraceae) Hanna Lindgren1, Steven D. Leavitt1, H. Thorsten Lumbsch1 1 Integrative Research Center, The Field Museum of Natural History, 1400 S. Lake Shore Drive, Chicago, IL 60605, USA Corresponding author: Hanna Lindgren ([email protected]) Academic editor: P. Divakar | Received 30 June 2016 | Accepted 23 August 2016 | Published 31 August 2016 Citation: Lindgren H, Leavitt SD, Lumbsch HT (2016) Characterization of microsatellite markers in the cosmopolitan lichen-forming fungus Rhizoplaca melanophthalma (Lecanoraceae). MycoKeys 14: 31–36. doi: 10.3897/mycokeys.14.9729 Abstract Rhizoplaca melanophthalma s.l. is a group of morphologically distinct and chemically diverse species that commonly occur in desert, steppe and montane habitats worldwide. In this study, we developed microsat- ellite markers to facilitate studies of genetic diversity, population structure, and gene flow in the nominal taxon of this group, Rhizoplaca melanophthalma. We characterized 10 microsatellite markers using a draft genome of R. melanophthalma s. str. assembled from Illumina reads. These loci were tested for 21R. mel- anophthalma s. str. specimens and also with a subset of 18 specimens representing six additional species in the R. melanophthalma complex. The number of alleles per locus inR. melanophthalma s. str. ranged from 3 to 11 with an average of 6.7. Nei’s unbiased gene diversity ranged from 0.35 to 0.91.
    [Show full text]
  • Taxonomic Recognition of Some Species-Level Lineages Circumscribed in Nominal Rhizoplaca Subdiscrepans S. Lat. (Lecanoraceae, Ascomycota)
    Taxonomic recognition of some species-level lineages circumscribed in nominal Rhizoplaca subdiscrepans s. lat. (Lecanoraceae, Ascomycota) Katarzyna Szczepa«ska1, Jacek Urbaniak1 and Lucyna Śliwa2 1 Department of Botany and Plant Ecology, Wroclaw University of Environmental and Life Sciences, Wrocªaw, Poland 2 Department of Lichenology, W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków, Poland ABSTRACT Background. Rhizoplaca subdiscrepans (Nyl.) R. Sant., a saxicolous, placodioid lichen, is considered to have a worldwide distribution in warm-temperate to boreal-arctic areas in Asia, Europe and North America. However, recent studies have revealed that this species includes five unrecognized species-level lineages—‘subd A, B, C, D and E'. During research focused on the diversity of saxicolous lichens in mountainous areas of southern Poland, some interesting representatives of the genus Rhizoplaca were found. The main aim of our study was to determine the taxonomic status of the collected specimens by means of molecular tools and a comparative analysis of similar herbarium materials. Methods. Detailed morphological, anatomical and chemical examinations of reference material from Asia, Europe and North and South America focused primarily on a selected group of lecanoroid taxa with a placodioid thallus. In addition, 21 new generated sequences representing Lecanora pseudomellea, Protoparmeliopsis muralis, Rhizoplaca opiniconensis, R. subdiscrepans s. lat. and R. phaedrophthalma were selected for molecular study using the internal transcribed spacer region (ITS rDNA), together with 95 available GenBank sequences mainly from the genus Rhizoplaca. Submitted 20 January 2020 Results. Polish specimens that clustered with members of a potential species-level Accepted 25 June 2020 lineage `subd E' of Rhizoplaca subdiscrepans complex were recovered.
    [Show full text]
  • Shotgun Sequencing Decades-Old Lichen Specimens to Resolve Phylogenomic Placement of Type Material
    Boise State University ScholarWorks Biology Faculty Publications and Presentations Department of Biological Sciences 12-2019 Shotgun Sequencing Decades-Old Lichen Specimens to Resolve Phylogenomic Placement of Type Material Steven D. Leavitt Brigham Young University Rachel Kueler Brigham Young University Clayton C. Newberry Brigham Young University Roger Rosentreter Boise State University Larry L. St. Clair Brigham Young University © 2019 W. Szafer Institute of Botany Polish Academy of Sciences Plant and Fungal Systematics 64(2): 237–247, 2019 ISSN 2544-7459 (print) DOI: 10.2478/pfs-2019-0020 ISSN 2657-5000 (online) Shotgun sequencing decades-old lichen specimens to resolve phylogenomic placement of type material Steven D. Leavitt1,2*, Rachel Keuler1, Clayton C. Newberry 2, Roger Rosentreter3 & Larry L. St. Clair1,2 Abstract. Natural history collections, including name-bearing type specimens, are Article info an important source of genetic information. These data can be critical for appropriate taxo- Received: 23 Mar. 2019 nomic revisions in cases where the phylogenetic position of name-bearing type specimens Revision received: 31 Jul. 2019 needs to be identified, including morphologically cryptic lichen-forming fungal species. Accepted: 1 Aug. 2019 Here, we use high-throughput metagenomic shotgun sequencing to generate genome-scale Published: 2 Dec. 2019 data from decades-old (i.e., more than 30 years old) isotype specimens representing three Associate Editor vagrant taxa in the lichen-forming fungal genus Rhizoplaca, including one species and Damien Ertz two subspecies. We also use data from high-throughput metagenomic shotgun sequenc- ing to infer the phylogenetic position of an enigmatic collection, originally identified as R. haydenii, that failed to yield genetic data via Sanger sequencing.
    [Show full text]
  • Metagenomic Data Reveal Diverse Fungal and Algal Communities Associated with the Lichen 2 Symbiosis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.04.966853; this version posted March 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Metagenomic data reveal diverse fungal and algal communities associated with the lichen 2 symbiosis 3 Hayden Smith1, Francesco Dal Grande2,3, Lucia Muggia4, Rachel Keuler1, Pradeep K. Divakar5, Felix 4 Grewe6, Imke Schmitt2,7, H. Thorsten Lumbsch8, Steven D. Leavitt1,* 5 1Department of Biology and M. L. Bean Life Science Museum, Brigham Young University, 6 Provo, Utah, USA 7 2Senckenberg Biodiversity and Climate Research Centre (SBiK-F), Senckenberganlage 25, D- 8 60325 Frankfurt, Germany 9 3 LOEWE Centre for Translational Biodiversity Genomics (TBG), Senckenberganlage 25, D- 10 60325 Frankfurt, Germany 11 4University of Trieste, Department of Life Sciences, via Giorgieri 10, 34127-Trieste, Italy 12 5Departamento de Farmacología, Farmacognosia y Botánica, Facultad de Farmacia, Universidad 13 Complutense de Madrid, 28040 Madrid, Spain 14 6Grainger Bioinformatics Center, Science & Education, The Field Museum, Chicago, IL, USA 15 3Department of Ecology, Evolution and Diversity, Goethe Universität Frankfurt, Max-von-Laue 16 Str. 11, D-60438 Frankfurt, Germany 17 8Science & Education, The Field Museum, Chicago, IL, USA 18 *corresponding author: [email protected] 19 20 Francesco Dal Grande: https://orcid.org/0000-0002-1865-6281 21 Lucia Muggia: https://orcid.org/0000-0003-0390-6169 22 Pradeep K. Divakar: https://orcid.org/0000-0002-0300-0124 23 H.
    [Show full text]