Phylogenetic Analysis of Lichen-Forming Fungi Rhizoplaca Zopf from China Based on ITS Data and Morphology Xiao-Ling Zhenga, Hong-Mei Shenga, and Li-Zhe Ana,b,* a Key Laboratory of Arid and Grassland Agroecology of Ministry of Education, School of Life Sciences, Lanzhou University, Lanzhou 730000, P. R. China. Fax: +869318912561. E-mail: [email protected] b Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Lanzhou 730000, P. R. China * Author for correspondence and reprint requests Z. Naturforsch. 62c, 757Ð764 (2007); received November 23, 2006/February 7, 2007 A molecular phylogenetic analysis of Rhizoplaca melanophthalma, Rhizoplaca chrysoleuca, Rhizoplaca peltata and Rhizoplaca haydenii is presented based on the nuclear ribosomal internal transcribed spacer (ITS) regions and morphology. Rhizoplaca species were collected at 3400Ð3900 m in Tianshan Mountains, Xinjiang province, China. Rhizoplaca haydenii is reported for the first time in China. Maximum parsimony (MP) analysis of ITS sequences obtained from Tianshan Mountains samples and GenBank reveals that the evolution rela- tionship of Rhizoplaca melanophthalma and Rhizoplaca chrysoleuca is closer to each other than to Rhizoplaca peltata, and Rhizoplaca haydenii showed closer relatedness to Rhizoplaca melanophthalma. When the four species groups from Tianshan Mountains were analyzed alone through the neighbour-joining (NJ) and minimum evolution method, we obtained the same result. The morphology analysis of Rhizoplaca Zopf which reveals the pruinose discs and apothecial discs of species did not show convincing evidences to prove phylogenetic relationship among Rhizoplaca species. In our study, the result further proved that Rhizo- placa should be rejected as a genus separate from Lecanora. Key words: Rhizoplaca Zopf, Phylogeny, ITS Introduction (Zopf, 1905). Afterward, Poelt (1958) advanced The lichen has a widely geographical distribu- that Rhizoplaca Zopf is a genus separate from Le- tion in the world. It is a symbiotic association canora. Whereas, Ryan and Nash (1997) doubted which is constituted by fungi and algae or cyano- the relationship between Rhizoplaca Zopf and Le- bacteria. The biological character of lichen is re- canora and suggested to do some further investi- flection of the essentiality of fungi within the sym- gation. Arup and Grube (2000) adapted that Rhi- biotic association. Therefore, lichen has been zoplaca Zopf is not a genus separate from named lichen-forming fungi (Hawksworth and Lecanora and may not be a monophyletic genus. Hill, 1984) or lichenized fungi (Wei, 1982). Cansaran et al. (2006) also supported this result. Rhizoplaca Zopf belongs to the division lichen- At present, researchers focus on the phylogenetic forming Ascomycetes and family Lecanoraceae. It relationship among Rhizoplaca Zopf and other comprises more than nine species distributed correlated genera (Arup and Grube, 2000), how- throughout the world, only six of them are found ever, studies on phylogenetic relationships among in China. There are R. chrysoleuca (Sm.) Zopf, R. these species are very limited. fumida X. Q. Gao, R. huashanensis Wei, R. melan- Originally, lichenologists used thallus structure ophthalma (Ram. in Lam. & DC.) Leuckert et Po- and secondary metabolism to study the phyloge- elt, R. subdiscrepans (Nyl.) and R. peltata (Ram.) netic relationship of the lichen (Sundin and Tehler, Leuckert et Poelt including two variations v. pel- 1998; Crespo et al., 1999). However, there is not tata and v. regalis (H. Magn.) Wei (Wei, 1991). Ac- distinct difference of the characters within genera cording to the study of Wei and Wei (2005), R. or between species and no further support for gen- fumida may be treated as one of the chemotypes era that are characterized mainly by their thallus within R. chrysoleuca. morphology. In addition, chemical similarity or Rhizoplaca Zopf was separated from the genus difference is not a reliable evidence of systematic Squamaria DC. based on its single central rhizoid relationships because chemistry is varied in many 0939Ð5075/2007/0900Ð0757 $ 06.00 ” 2007 Verlag der Zeitschrift für Naturforschung, Tübingen · http://www.znaturforsch.com · D 758 X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca species and sporadically shared by different 80 μl high concentration CTAB/NaCl (Biodee) groups (Leuckert et al., 1977; Wei, 1984; Ryan and and 100 μl NaCl (5 m) were added to the solution. Nash, 1997; Arup and Grube, 2000; Wei and Wei, Then the solution was incubated at 65 ∞C for 5 min 2005; Zhou et al., 2006). With the improvement of to further eliminate protein. One volume of equili- molecular technology, more and more lichenolo- brated phenol/chloroform/isoamylalcohol [25:24:1 gists began to deeply reveal the phylogenetic rela- (v/v/v)] (Biodee) was added and mixed thoroughly tionship of the lichen and identify the cryptic ge- by inversion. Then, samples were centrifuged at nus within morphologically homogeneous groups 12,000 ¥ g for 5 min (MIKRO 22R, Hettich, Tutt- using modern molecular techniques. The internal lingen, Germany). If precipitated protein was still transcribed spacer regions of nuclear ribosomal observed at the aqueous/organic interface, extra DNA have been proved to be very useful in ana- washes were performed as necessary. 0.54 Volume lyzing the genetic relationship among species. In- of isopropanol was added and incubated at 4 ∞C ternal transcribed spacer (ITS) sequences infor- for 2 h to precipitate DNA. Following centrifuga- mation has been one of the primary criteria in tion (14,000 ¥ g, 5 min), the pellet was washed investigating the relationship at the specific level. twice with 80% ethanol, dried in air and re-sus- The aim of our study was: 1) to investigate the pended in 50 μl of TE buffer [10 mm Tris-HCI, phylogenetic relationship among Rhizoplaca spe- 1mm EDTA (pH 8.0)]. Total DNA was examined cies by using ITS sequence analysis; 2) through an- for quantity and quality on an ethidium-bromide- alyzing morphological characters, to research stained 1% agarose gel (Yito Enterprise Comp. whether pruinose discs and apothecial discs can be Ltd., Shanghai, China) and stored at Ð20 ∞C. used to test the phylogenetic relationship among DNA reaction mixture was performed in 25 μl Rhizoplaca species. using 10Ð50 ng genomic DNA as template, 2.5 μl dNTP (Takara, Ootsu-shi, Shiga-ken, Japan), 2.5 μl Materials and Methods 10 ¥ PCR buffer (Takara), 1.5 μl10mm primers and 0.3 U Dynazyme Taq polymerase (Takara). Growth conditions and sample collection ITS4 (TCCTCCGCTTATTGATATGC) (White et The lichens in our study were collected from an al., 1990) and ITS1-F (CTTGGTCATTTAGAG- ice-free cirque (43∞ 05Ј N, 86∞ 49Ј E, with an alti- GAAGTAA) (Gardes and Bruns, 1993) were used tude of 3400Ð3900 m) near the No. 1 glacier in the to amplify the ITS sequence. Polymerase chain re- source area of Urumqi river in Tianshan Moun- action (PCR) amplification was executed with the tains, Xinjiang province, China. The annual aver- following program: initial denaturation at 95 ∞C age temperature is lower than 5 ∞C in daytime for 4 min, and subsequently a 35 cycles reaction and Ð4 ∞C at night. The temperature also under- with annealing at 50 ∞C for 1 min, extension at goes a big fluctuation from nearly 4 to Ð10 ∞C dur- 72 ∞C for 1 min, denaturation at 94 ∞C for 1 min ing the favourable growth season from June to and final extension at 72 ∞C for 5 min. The PCR September. All samples were carefully cleaned products were visualized on 1% agarose gel as a with distilled water to remove possible epiphytic band of approx. 500 or 800 bp. Then the products contaminants and then air-dried at room tempera- were cleaned using the purification kit (Takara) ture. Finally, all dried samples were conserved following the manufacturer’s instructions. Sequen- at Ð20 ∞C. cing was accomplished using an automated se- quencer ABI3730 (ABI, Foster City, USA). DNA isolation, PCR and sequencing Total DNA was obtained from dried lichen us- Sequence alignment and phylogenetic analysis ing the modified CTAB (cetyl-trimethyl ammo- nium bromide) method (Murtagh et al., 1999). The Our sequences were aligned using Clustal X1.83 extraction procedure was as follows: Lichen her- (Thompson et al., 1994). All parameters were de- barium materials were ground under liquid nitro- fault values of the software. Maximum parsimony gen and 0.1 g suspended in 600 μl extraction buffer (MP) analysis was determined using PAUP*4b4a (50 mm Tris [tris(hydroxymethyl) amino methane]- (Swofford, 1999) with the following settings: the HCl (pH 8.0), 50 mm EDTA; Biodee, Beijing, matrix was subjected to 10 replicates of random China) and 100 μl of 10% SDS (Biodee). The solu- sequence additions using heuristic searches, tree tion was incubated in water at 65 ∞C for 3Ð5h. bisection and reconnection (TBR) branch swap- X.-L. Zheng et al. · Phylogenetic Relations in Rhizoplaca 759 ping. Gaps were treated as “missing”. One tree ited in GenBank. The species, localities and the was held at each step during stepwise addition. GenBank accession numbers of twenty ITS data Confidence limits for branches of the trees were of Rhizoplaca Zopf obtained from GenBank are performed by bootstrap analysis with 1,000 repli- shown in Table I. cations. Rooted with Parmelia sulcata (AF410840) and Neighbour-joining (NJ) and minimum evolution Protoparmelia badia (AF070023) as outgroups our method analysis were carried out using MEGA3.1 analysis is justified through the results of molecu- (Kumar et al., 2004) with the following settings: lar investigation in the relationship among species two-parameter method was used to calculate the of the Rhizoplaca genus (Arup and Grube, 2000; genetic distance matrix and construct the neigh- Zhou et al., 2006). bour-joining tree and minimum evolution analysis. One hundred maximum parsimony trees with Gaps and missing data were completely deleted. 761 parsimony-informative characters [consistency Confidence limits for branches of the trees were index (CI) = 0.5608; retention index (RI) = 0.6319] performed by bootstrap analysis with 1,000 repli- were found by a heuristic search, one of the trees cations.