MOLECULAR SYSTEMATlCS OF NEOTROPICAL DEER MICE OF THE PEROMYSCUS UEXTCAVUS SPECIES GROUP
Nicola Lourdes Wade
A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Zoology University of Toronto
O Copyright by Nicola Lourdes Wade 1999 National Library Bibl'ithèque nationale du Canada Acquisitions and Acquisitions et Bibliographie Services sentices bibliographiques 395 Wellington Street 395. rue Weilingtori Ottawa ON KlA ON4 OttawaON KIAW Canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive Licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, dismbute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imphés reproduced without the author's ou autrement reproduits sans son permission. autorisation. ABSTRACT
Molecular Systematics of Neotropical Deer Mice of the Peromysclrs mexicanus Species
Group. 1999. Nicola Lourdes Wade. Graduate Department of Zoology, University of
Toronto.
Mitochondrial DNA sequences of cytochrorne b, M)3, ND4L, and ND4 were used as phylogenetic markers to re-examine the systematic arrangement of the P. rnexicanus species group. Phylogenetic relationships were estimated on the combined sequences using neighbour joining, weighted (6: 1) parsimony, and maximum likelihood rnethods. Contrasting phylogenetic hypotheses of Hooper and Musser (1964, as rnodified by Huckaby 1%O), and Carleton (1989) were tested.
Phylogenetic analysis of the mtDNA data most closely approximates Hooper and
Musser's (1 964) concept of the species group. Withh the 'core' rnexicanus group, P. mexicanur is not monophyletic, and is segregated into three phylogenetically distinct groups. The nucleotide sequence data supported the polyphyletic arrangement of P. nudipes, which may be a result of separate invasions fiom two different P. mexicanus popuIations. The phylogenetic relationships between the highland taxa including P. sarhynchus, P. guatemalensis, and P. grandis do not conform to any of Huckaby's (1 980) three hypotheses, merdemonstrating their complex geographical relationships.
Phylogenetic evidence suggests that P. g~mnotisand membea of the western P. mexicanus lineage are conspecific. ACKNOWLEDGEMENTS
1 would like to thank Dr. Mark Engstrom my supervisor, for giving me the opportunity to study molecular systematics of deer mice, for funding the project, and editing my thesis under such time constraints. 1 wodd also like to thank hun for sharing with me his extensive knowledge in mammalogy, particularly with Peromysctts, and 1 appreciate his broad knowledge of Central America
1 would also Iike to thank Dr. Allan Baker my adjunct supervisor for his support, advice, and encouragement throughout the course of my degree. 1 thank him for allowing me to work in his lab and the use of his cornputers to perform my analysis (despite the immense cornpetition for computing time).
A warm thank you to my family for their support and encouragement. Without them this thesis would not be possible.
Special thanks goes to Oliver Haddrath for assisting me with getthg started in the lab, for showing me the 'ropes' ,and for his support, and advice. Oliver is one of the most patient, understanding, and kind people 1 have ever had the pleasure of knowing.
His keen imagination always managed to amaze me; 1 have my lab bench to thank for that! (Oliver, the war is not over yet!).
Another special thanks goes to my colleague and dearest fnend Tara Paton. Her fnendship and support has meant the world to me. 1 thank her for her assistance and constant advice during ail phases of my thesis. The two of us together made a great team, we conquered PAUP*! 1 hope 1 have the pleasure of working with her again in the future.
iii I especially thank my additionai surrogate family fiom the lab who have made my graduate expenence exciting and fun. Maryann Burbidge, my bench partner, thank you for your help in the [ab, for your good advice, and your pep talks about 'the worst thhgs that could happen'. Many thanks to Andy Given for his fun little antics that managed to take the pressure off'
I wouid like to express my gratitude to Mark Peck for his endless supply of patience and use of his computer, Dr- AIejandro Lynch for his computer advice, Burton
Lim for his assistance with locating the Perornyscus samples and localities, and Amy
Lathrop for her expertise and patience with my many parsimony-related questions.
1 would also like to thank the folîowing people for discussions: Dr. Jan Hughes,
Dr. Alessandro Grapputo, Dr. Mike Dennison, Dr. John Barlow, and Annette Greendade.
For their administrative assistance, 1 would like to thank Elizabeth Tudor-
Mulroney and Susan Del Tufo fiom the Zoology Graduate Department, and Cathy Ayley from the ROM.
This research was hded in part by a Natural Sciences and Engineering Research
Council of Canada operating grant to Dr. M. D. Engstrom, the ROM foundation, Dr. M.
D. Engstrom, and the field work fund fiom the Centre for Biodiversity and Conservation
Biology at the ROM. 1 would also Iike to thank Ange10 State University (ASNHC);
Institut0 de Biologia, Universidad Nacional Authorna de Mexico (IBUNAM); The
Natural History Museum of Los Angeles County (LACM); Brigham Young University
(BYU); University of Kansas, Museum of Natural History (KU); Cincinnati Museum of
Natural History (CM); and the Royal Ontario Museum (ROM) for supplying tissue samples. TABLE OF CONTENTS
.. ABSTRACT ...... 11 ... ACKNO WLEDGEMENTS ...... LU
TABLE OF CONTENTS ...... ,.., ...... v .. LIST OF TABLES ...... vu
LIST OF FIGURES ...... ix .. LIST OF APPENDICES ...... xu rNTRODUCTION ...... 1
MATERIALS AND METHODS ...... 8
Tissues exarnined ...... ,...... -8
Molecular procedures ...... 8
Sequence analysis ...... 12
Anal ytical methods ...... 13
Phylogenetic analysis ...... 16
RESULTS ...... 22 Gene characteristics ...... 22
Gene Region Variability ...... -35
Test for saturation ...... -38
Models of sequence evolution ...... 38
Distance measures ...... -46
Rate variation among sites within genes ...... 47
Phy logenetic reconstruction ...... -55 Conformance to previous systematic hypotheses ...... 68
DISCUSSION ...... ,...... ,,, ...... 73
Content of the Peromyscus mexicanus species group ...... -73
Phylogenetic relationships among members of the P . mexicallus group ...... 74
Speciation within the 'core' mexicarms group ...... -75
SUMMARY ...... 81
LITERATURE CITED ...... -83
APPENDICES ...... 93 LIST OF TABLES
Table 1. An overview of the different hypotheses relationships in the Peromyscus
mexiconus species group according to Osgood (1 909), Hooper and Musser
(1964), Hooper (1968), and Carleton (1 989) ...... 3
Table 2. Sequence charactenstics for al1 four rnitochondrial genes among 20 species of
the subgenus Peromysctls ...... 23
Table 3. Average number of transitions and transversions for each of four
mitochondrid genes in 20 species of the subgenus Peromyscus ...... -25
Table 4. Percentage nucleotide composition for dl20 species of the subgenus
Peromyscu~,excluding the outgroups Reithrodontomys, Boiomys, and
Onychomys ...... -28
Table SA. Codon frequency for al1 20 species of the subgenus Peromyscus
excluding the outgroups Reithrodontornys, Baiomys, and Onychomys ...... -32
Table 5B. Amino acid names, and their one-letter abbreviation, and classification
according to charge, polarity and hydrophobicity ...... 33
vii Table 6. Two tailed test of nucleotide saturation performed on 20 species of the
subgenus Peromyscus ...... -43
Table 7. Selected models of nucleotide substitution for al1 mitochondrial genes ...... -45
Table 8. Pair-wise Tamura-Nei (1993) + 1 + G distance matrix for 20 species of the
subgenus Peromyscus, 1 species of the genus Reirhrodontomys, 1 species of
the genus Baiomys, and 1 species of the genus Onychomys ...... 48
TabIe 9. Average percent sequence divergence (d) and the alpha parameter (a)
estirnated among species of Peromyscus and within the mexicanus species
group ...... -52
Table 10. Results fiom the relative rates test performed in pair-wise cornparisons
among dl 20 species of the subgenus Perornyscus ...... -58
Table 1 1. Kishino-Hasegawa (1 989) tests performed for aU optimal tree topologies for
20 species of the subgenus Peromyscw using Reithrodonfomys, Bniomys,
and Onychomys as outgroups ...... -64
Table 12. Kishïno-Hasegawa (1 989) test of dif35erent hypothetical tree topoiogies based
on previous systematic arrangements of the P. mexicanus species group ....7 1
viii LIST OF FIGURES
Figure 1. Diagram of the mammalian mitochondrial genome showing the
genes sequenced with their respective primes ...... 9
Figure 2. Map of Central America iadicating the Locations of the 20 species of the
subgenus Peromyscus, 2 species of the genus Reifhrodontomy, 1 species of
the genus Baiomys, and 2 species of the genus Onychomys used in this study
Figure 3. The average proportion of transitions and transversions among 20 species of
the subgenus Peromyscm for al1 four rnitochondrial genes ...... 26
Figure 4. Histogram presenting the transition / transversion ratio for dl four
mitochondrial genes at each codon position, based on al1 20
species of the subgenus Peromyscw (43 individuais) ...... 27
Figure 5. Percent amino acid composition for al1 four mitochondrial genes, based on al1
20 species of the subgenus Peromysncî ...... -34
Figure 6. Percentage nucleotide sequence variation for each of the four
mitochondrial genes sequenced at each codon position for 20 species of the
genus Peromyscus ...... -36 Figure 7. The nurnber of ciifferences in amino acid composition for each gene,
calculated for al1 20 species of the subgenus Peromyscus ...... -.3 7
Figure 8. Saturation plot for al1 four Wtochondrial genes at first, second, and third
positions based on al1 20 species of the subgenus Peromyscm ...... -39
Figure 9. Relative rates of nucleotide substitution for first, second, and third positions
based on al1 20 species of Peromyscus ...... 56
Figure 10. Neighbor-joining tree constnicted in PAUP* (Swofford 1998) using the TN
+ 1 + r mode1 of nucleotide substitution using 20 species of the subgenus
Peromyscus, with Reithrodontomys, Onychomys, and Babmys as outgroups
...... -61
Figure I 1. The consensus of IO maximum parsimony trees for al1 20 species of the
subgenus Peromyscus using Reithrodontornys, Onychomys, and Baiomys as
outgroups ...... 63
Figure 12. Maximum parsimony tree using a weighting scheme of 6: 1 transversion /
transition ratio for al1 20 species of the subgenus Peromyscus with
Reithrodontomys, Onychomys, and Baiomys as outgroups ...... 66 Figure 1 3. Strict consensus parsimony tree for al1 1 1 species members of the P.
mexicafius species group, using a weighting scheme of 6: 1 tranmersion /
transition ratio with P. ochraventer as the outgroup ...... -67
Figure 14. Strict consensus parsirnony tree includirig d 5 species of the P. mexicanus
'core' group, using a weighting scheme of 6: 1 transversion / transition ... ..69
Figure 1 5. Maximum likelihood tree for al1 20 species of the subgenus Peromyscus with
Reirhrodüntornys, Onychomys, and Buiomys as outgroups ...... -70
Figure 16. Map of Mexico, Guatemala, El Salvador, Honduras, Costa Rica, and Panama
outlining the Iocalities for the 5 species of the P. rnexicanus 'core' group ...76 LIST OF APPENDICES
APPENDIX A. Species name, general location, identification number, and map number
...... ,...... 93
APPENDIX B. List of specimens examineci ...... 95
APPENDIX C. Cytochrome b nucleotide sequence ...... ,...... 99
APPENDIX D. Nitcotinamide adenine dinucleotide dehydrogenase subunit 3 (ND3)
nucleotide sequences ...... -117
APPENDIX E. Nitcotinamide adenine dinucleotide dehydrogenase subunit 4L (ND4)
nucleotide sequences ...... 124
APPENDIX F. Nitcotinamide adenine dinucleotide dehydrogenase subunit 4 (ND4)
nucleotide sequences ...... -13O
xii INTRODUCTION
Over the past century, a large effort has been expended to discem systematic relationships of North Amencan deer mice (Peromyscus). Peromyscus fiinction as mode1 systems in a variety of studies fiom genetic and rnolecular evolution to ecology and behaviour. In that sense, they are regarded as the "Dros~phild'of North Amencan rnammals (Carleton 1989). Historically, taxonomie arrangements of Peromyscus for the most part were phenetic, relying on morphologicai characters (Osgood t 909, Hooper and Musser 1964, Hooper 1968, Huckaby 1980, and Carleton 1989). More recently, systematic relationships have been refined using a phylogenetic approach (Carleton 1980, Rogers et al. 1984, Stangl and Baker 1984, Rogers and Engstrom 1992, and Van Coeverden de Groot 1995). in a phylogenetic system, the primary goal for classification centers on detennination of monophyly and reconstnicting genealogical relationships within and arnong monophyletic groups. Conconiitantly, as aew data sets have ken integrated, the phyletic cohesiveness of the genus, and the subgenus Peromyscus, have been challenged dong with the composition of the included species groups.
As presently conceived, Peromyscus comprises 2 subgenera: Peromysm and Haplomy[omys, with 53 and 1 I species respectively (Carleton 1989). The subgenus Peromyscus is fbrther subdivided into 13 species groups (Carleton 1989). The mexicanus species group is both the largest and most pooriy understood of the 13, historically ranging in size from 7 to 17 species. Systernatic relationships within this group are complex and inconsistent with their traditional assignment to a single monophyletic taxon. Most of these species of deer rnice are concentrated in the highly dissected mountains of Mexico and Central America. It is critical that we understand the relationships within the P. rnexicanus group to determine its composition, patterns of speciation, and historical biogeography. The first comprehensive review of the systematics of the P. mexicanus group was by Osgood (1909). Based on body size, colour, skull, and teeth characteristics, Osgood defined eight species groups within the subgenus P eromyscw. Members of the P. mexicanus species group, as currently recognized, were assigned to three different species groups, the [ephcm, rnexicanus, and megalops groups (Table 1). Based on morphology of the glans penis, Hooper (1958) assembled Osgood's eight species groups into one major informai phenetic category, the Maniculatus Division- This division was then broken down into manicularus and boylei clusters, the Iatter of which contained mernbers of the rnexicanus species group. Hooper and Musser (1 964) presented the fmt formal revision of the genus Peromyscus (Table 1) since Osgood (1909). In contrast to Osgood's arrangement, this classification hcluded the P. megalops group within the P. mexicanics group. Peromyscus nudipes, P. fùm,P. guatedensis, and P. altifaneus were removed fiom the lepturus group and placed in the P. mexicanus species group.
Peromyscus banderanus was resioved fiom the mexicanus group and placed into the newly defined, monotypic subgenus Osgoodomys. Seven additional species were included within the mexicanus species group, resulting in a total of 17 species (Table 1). Subsequentiy ,Musser (1 964) synonymized P. augustirostris with P. furvus. P. hondurensis was transferred to the boylii group (Hooper 1968) and synonymized with P. oaxacensis (Musser 1969), and P. sloeops was synonymized with P. mexicanus (Hooper 1 968. Musser 1969). The resulting P. rnexicanus species group contained 14 species (Hooper 1968) (Table 1). Later, Musser (1971) reinstated P. gyrnnotis as a species and synonymized Osgood's (1 904) P. allophylus with it Hail (197 1) synonymized P. lutiriostris with P. finus? and finally Carleton (1989) suggested the possibility that P. altilaneus is actually a junior synonym of P. mexicanus. Huckaby (1 973, 1980) later revised the mexicantrs group based on a suite of characters from the skull, male reproductive system, and extemal morphology. Huckaby (1 980) noted that 6 of the 12 species in the mexicanus group (P. ochraventer, P. stirtoni, Table 1: An overview of the different hypotheses or relationships in the Perot~ryscust)rcxicantis species group according to Osgood (1 909), Hoopcr and Musser (1 964), Hooper (1 968), and Carleton (1 989). Species included in this study are indicated with bold face type. Species names indicated with an asterisk are no longer considered valid. Osgood ( 1909) llooper and Musser ( 1964) Hooper (1 968) Carleton ( 1989) lepfurus group: P. lepturus niexicariiis group: P. ochraventer niexictrrrus group: P. ochraventer rriexicarius group: P. mexicanus
P. loph urus P. yucatanicus P. yucatarricus P. gymnotis P. siniulatus P. hondurerisis * P. mexicanus P. guatemulensIs P. nutlipes P. mexicanus P,allophylus * P. zarhynchus
P. furvus P. alloplaylus P. stirîoni P. grandis
P. guatemalensis P. stirtoni P. nudipes P. yucatanicus P. altilar~iirs* P. nudipes P. furvus P. stirtoni mexicanus grou p: P. maicanus P. furvus P. latirostris * jrrvus group: P. furvus P. allophylus P. lafirostris* P. altilaneus * P. ochraventer P. bariderarius P. angusfirosiris * P. guatemalensis P. mayensis
P. yucatanicus P,al filatteus* P. megalop$ niegalopsgroup: P.megnlops nrega/ops group: P. megalops P. guatemalensis P. melanocarpus P. nrelanurus
P. melanocarpus P. megalops P. zarhynchus P. melanocarpus
P. zarhynchus P. sloeops* P. grcrndis
P. melanocarpus
P. zarhynchus
P. grandis P. yucatanicus, P. firmsI P. megalops, and P. melanocarpus) morphologically were discretely distinguishable fkom one another and the other species in the group. The remaining six species, referred to as the 'core' mexicanus group (P. gymnotis, P. mexicanus. P. grandis. P. guaremalensis, P. nudipes, and P. zarhynchus), contained no qualitative characters distinguishing hem other than size and colour (Huckaby 1980, Carleton 1989). As a result, he synonymized P. nudipes with P. mexicanus. Huckaby (1973) initially treated P. zarhynchus, P. grandis, and P. guaremalensis as fiagmented populations of a single species, P. zarhynchus. Based on size and colour, P. zarhynchus
resembles P. grandis more than P. guaiemalensis, and yet P. guatemalemis occurs between them. This led Huckaby (1980) to formulate three possible scenarios: 1) each taxon represents an isolated population of a single common ancestor and therefore could be considered conspecific: 2) P. guatemafensis arose indepdently of the other two, and now occupies the area once inhabited by the common ancestor of P. zarhynchus and P. grandis, or: 3) al1 three species arose independently of one another by separate invasions of their montane habitats fiom one or more lowland forms, and the similarities between P. zarhynchzcs and P. grandis are a result of convergent evolution. Unable to decide among these hypotheses, he chose to maintain them as separate species. Huckaby (1980)
noted that a population of P. rnexicanus fiom Finca San Rafeal, Guatemala, fell within the size range of P. guaternalensis, and suggested that P. guatemalensis may grade into P. mexicanus in the easten part of its range. He thus considered P. mexicanus and P. guotemalemis to be closely allied. Osgood (1909) considered P. g~mnotisto be a subspecies of P. mexicanus. Musser's (1971) studies indicated that populations of P. gymnotis were morphologicaily and ecologically more like those of P. rnexicanus than =y other form placed in the rnexicanus species group. Based on a lack of evidence of morphological intergradation between these species, Muser (1971) elevated P. gymnotis fiom subspecies to species status. Huckaby (1980) believed adjacent populations of P. rnexicanus limited the geographic range of P. gymnotis and supported Musser's (1971) decision. Carleton and Huckaby (1975) Iater described P. mayensr's fiom the mountains of Huehuetenango, Guatemala. Bascd on the glans pais and complement of male
accessory reproductive gland, this distinctive species was assigned to the subgenus Peromyscus. Peromyscus mayensis shared some characteristics in common with P. fimus namely the presence of tbree pair of mammae, a long glans pais with dorsal
lappets. hourglass-shaped interorbital area, and complex molars with a deeply bifiucated anterocone. Carleton (1973) reported P. rnegalops melunurus to dBer fiom P. megalops rnegalops in gastric anatomy. Later, Huckaby (1 980) regarded P. melanurus as a distinct species, and documented its range confined to Oaxaca and fringing that of P. megalops on lower, Pacific-facing slopes. Carleton (1989) reviewed the classification of Peromysms using the total available evidence including chrornosomal and allozjmic data as well as rnorphology. He removed P. firrvz~~,P. ochraventer, and P. mayensis Erom the mexicanus species group and placed them in thefurvus species group. Evidence such as a discoglanddar stomach morphology, mammae count, complex dentition, and smooth interorbital region (fiooper 1968, Carleton 1973, and Huckaby I980), suggested that P- furvus stands apart fiom any other members of the mexicanus species group and exhibits a closer affiliation with P. mayensis (Carleton 1989). Also, cranial and dental traits, gastrk anatomy, and number of marnmary glands, allied P. ochraventer with P. fims (Carleton 1973, and Huckaby 1980). Characters including the small glans penis (Hooper and Muser 1964) and a derived chromosomal inversion, resulting in a biarmed pair 6 (Rogers et ai. 1984, Stangl and Baker 1984) distinguish P. ochraventer fiom al1 members of the mexicanus species group. Carleton (1989) also reinstated a portion of Osgood' s (1 909) P. megalops group and included the geographically proximal P. melanocarpus in it dong with P. megalops
and P. melanurus (Table 1). Carleton (1 989) Mercommented on the status of P. gymnotis and in light of new evidence concemïng the distributionai patterns of the species, characterized P. gymnotis as an endemic of the Pacific costal plain and adjacent foothills of Middle Amenca He suggested that some P. mexicanus fiom El Salvador, Nicaragua, and the isthmus of Tehuantepec, also were P. gymnotis. Carleton (1989) questioned the status of P. stirtoni as a member of the P. mexicanus species group based on its unique delicate skull with supraorbital beading and its densely-haired, bicoloured tail. Peppers et al. (1999) found the G-band karyotype of P. stirtoni to be indistinguishable from that described for other members of the mexicanw group. Finally, Carleton (1989) mentioned bnefly that the geographically isolated P. yucatanicus, broadly speaking, exhibited a close aftiliation to P. mexicanus. P. guatemaIensis, and P. rnegalops. rather than with P. fim or P. ochrmenter. However, he pointed out the relationship of P. yucatanicus was disputable and needed to be re-examined (Carleton 1989). Despite the morphological diversity encompassed by the mexïcanus species group, karyotypic banding patterns are identical in ail members of the group examined, with the exception of P. ochraventer (which differs by an inversion in chromosome 6, Rogers et al. 1984, Stangl and Baker 1984, and Smith et al. 1986). Rogers and Engstrom (1 992) examined allozymic variation at 28 presumptive genetic loci for nine members of :iie P. mexicanus group. They found six species (P. guatemalensis, P. gymnotis, P. me-xicanus, P. nudipes, P. yucotaniais and P. rarhynchus) were genetically sirnilar, but relationships among these taxa were unresolved in a cladistic analysis. Phylogenetic reconstmctions revealed the paraphyly of the species, P. mexicanus. In addition, a population of P. mexicanus from the cenaal highlands of Chiapas shared two derived allelic character states with P. gymnotis (also f3om Chiapas), and these samples were identified as sister taxa. Peromyscus ochruventer, P. melanocarpus, and P. megalops appeared as outliers to the P. rnexicanus group. Contrary to Carleton's (1989) hypothesis,
P. rnegalops and P. melanocarpus did not appear as sister taxa. Van Coeverden de Groot (1 995) examined restriction hgment length polymorphisms for the ND3, ND4L and ND4 mtDNA region for the 'core' P. mexicanus group. His results failed to support the monophyly of the highiand group, P. zmhynchw, P. guaremakmis and P. grandis, relative to P. mexicanus, further confuming the complex relationships exhibited by the 'core' of the species group. In general, the systematic composition, and relationships within the P. mexicanus species group have remained enigmatic, in part because of a lack of chromosomal, morphological, and allozymic divergence, especiaiiy among the phylogenetic 'core' of the species group. The prirnary objective of this thesis was to re-examine the systematics of the mexicanus species group using a new data set of sequences of mitochondriai DNA
(cytochrome b, ND3, ND4L and ND4) as phylogenetic markers. The three main gods are: 1) to use phylogenetic reconstruction to test the monophyly of the mexicanus species group according to the contrasting phylogenetic hypotheses of Hooper (1968), Huckaby (1 980), and Carleton (1 989); 2) to discem phylogenetic relationships among the members of this larger monophyletic group; 3) to reconstnict the phylogenetic relationships among the monophyletic 'core' of the mexicanus species group. 1examined the mtDNA genes ND3. ND4L and ND4 because Van Coeverden de Groot (1995) used this same gene region in his RFLP analysis of speciation in the mexicanus group. Likewise, Engel et al.
(1998) used sequence data fiom ND3, ND4L and ND4 to examine rnolecular systematics of South American Sigmodontine rodents including some Peromyscus, and I sequenced the sarne gene region for direct cornparison. To inçrease sample size of characters and to reduce the chance of recovenng a gene tree rather than a species tree, 1 also sequenced cytochrome b. This gene had proven to be an efficient phylogenetic marker in other species groups of Peromyscus. For example, Sullivan et al. (1997) used it to resolve the systematics of the P. uztecus species group. MATERIALS AND METHODS
Tissues examined
A total of 978 base pairs of cytochrome b, and 1371 base pairs of the region spanning the ND3, ND4L and ND4 subunits of the nicotioamide adenine dinucleotide dehydrogenase genes (Fig. 1) were examined in a total of 47 specimens fkom 33 lodities
(Fig. 2). Within the subgenus Peromyscus, seven representative species groups were included and nearly ail recognized species in the mexicanus species group (Appendix B).
Al1 specimens were collected previously and deposited in the following collections:
Angelo State Natural History Collections, Angelo State University (ASNHC); Instituto de B iologia, Universidad Nacional Aut6noma de Mexico (IBUNAM); The Naturd
History Museum of Los Angeles County CACM); The Brigharn Young University
(B YU); University of Kaasas, Museum of Natrnal History (KU); Cincinnati Museum of
Natural History (CMNH); and the Royal Ontario Museum (ROM).
hlolecular procedures
Total DNA was isolated fkom fiozen liver, kidney and heart tissue using standard
STE / SDS / proteinase K / phenol / chlorofonn extraction procedures (Sambrook et al.
1989). Approximately 0.1 - 0.5g of heart, liver or kidney tissue was placed into a 1.Sm1 micro-centrifuge tube containing 360~1of STE buffer, 40p1 of 10% SDS lysis bufTer and
3pl of Proteinase K (ProK). The tubes were secured with parafilm to prevent evaporation, and then placed in a rotating hybaid overnight. Mercompletion of Figure 1. Diagram of the mammalian mitochondrial genome showing the genes sequenced and their respective primers. Arrows indicate the direction of the sequenchg reaction. G = tRNA glycine, R = tRNA arginine, H = tRNA histidine, S = tRNA serine, L = tRNA leucine, E = tRNA glutamic acid, T = tRNA threonine, and P =
RNA proline. For primer sequence refer to the methods section.
Figure 2. Map of Central Amenca indicating the locations of the 20 species of the subgenus Perornyscus, 2 species of Reifhrodontomys, 1 species of Baiomys, and 2 species of Onychomys used in this study. For definition of sample numbers and specific locations, see Appendix A, incubation, the samples were extracted using the Phenol / Chloroform method (Sambrook et al. 1989).
The 978 base pair segment of cytochrome b was amplified fiom total DNA using the tailed primers B 1TF universal 5'-cacgacgttgtaaacgacccatccaacatctcagcatgatg-3' and MouseTR 5'-ggataacaattcacacaggttcttcatttytggtttacaagacca-3' (base pairs highlighted in bold represent the M 13 primer tails). The 1371 base pair segment of ND3,
ND4L and ND4 was initially amplified fiom total DNA using the primers GLYTF
5'-cacgacgttgtaaacgactaactagtacaagtgacttcc-3' and ND4L2TF 5'-cacgacgttgtaaaacgac ccgctcacacctaatatc-3' (Engel et al. 1998). The product of this ampiification was then re-ampli fied with GLYTF (see above) and ND4L REV2TR 5'-ggataacaatttcacacaggt gagattttgtacgtagtctgt ttc-3' to achieve the 345 base pair region of ND3 and the initial 170 base pair segment of ND4L. The product of the inîtial PCR was amplified again using
ND4L2TF (see above) and NAP2TR 5'-ggataacaatttcacacaggtggagcttctac gtgggcttt-3' to acquire the remaining 124 base pairs of ND4L and 657 base pairs of ND4 pig. 2). The amplification protocol according to Perkin-Eimer Amplicycle TM, proceeded as follows: 18.3~1of distilled HzO;2.5 pl of Erica Hagelberg (10 x EH) buffer; 1pl of dNTP; I p1 of each primer; 0.2 pl of Taq DNA polyrnerase; 1 pl of DNA template for each sample in a 25p1 volume. The PCR reaction was initially set for a two minute pre-soak at 9S°C followed by amplification through a thermal cycle of: denaturing at
WCfor 30 sec; annealing at 55OC for 30sec; extension at 72OC for 30 sec for 36 cycles.
Arnplified products were subjected to electrophoresis through a 2% agrose gel in
0.5 X TBE buffer, with 2pl of EtBr (lOmg/ml). Negative controls, a rnolecular weight ladder and a positive control were included where necessary. The agrose gel containhg the DNA was then visualized on a short-wave UV radiation transilluminator. The PCR
bands were excised fiom the gel and centrifbged through filter tips for 10 minutes at 5000
rpm to purifjr the DNA-
DNA sequences were detemlloed by automatic sequencing on a LI-COR Long
Read 4200 bidirectional sequencer. Sequencing reactions using the Thermo Sequenase
DYEnamic Direct cycle sequencing kit were prepared according to the LI-COR suggested protocol as follows: 1Op1 DNA; L .5p1 IRD700 primer (1 pmoV@) and 1Spi
IRD800 primer (1 pmoVpl); 5p1 distilled water to a final volume of 18~1.For each sample
0.2~1of dNTPs (IOmM) was added to 4.0~1of the template/primer mix rnentioaed above.
Samples were then placed in the thermal cycler programmed for the following: 92OC for 2 minutes; 92OC for 30 seconds; 60°C for 15 seconds; 70°C for 15 seconds repeated for 30 cycles. 3p1 of LI-COR Stop Solution was added once cycling was completed. Samples
were denatured at 90°C for 2 minutes then loaded ont0 a 66cm Long Ranger gel (0.25m.m thickness) following the standard LI-CORrecommendations.
Sequence analysis
Sequences were read using the Bare ImagelR 3.0-image analysis package fiom
LI-COR. The ND3, ND4L, ND4, and cytochrome b sequences were digned by eye using the computer program XESEE (Cabot 1994), with the Mu~USU~US sequence as a reference. Comparison of the 700 forward and 800 reverse channels for each strand clarified any arnbiguous sites within a sequence. Sequences were re-run when ambiguities could not be resolved. Sequences were also compared to some published
GenBank sequences to vewauthenticity. There was no question as to whether a nuclear homolog was amplified instead of a mitochondrial copy, because (1) double bands were absent on sequencing gels, and al1 amplifications were consistent, (2) upon translation of the sequences, there were no point insertions, deletions or stop codons that might disrupt the reading hune. Due to a large number of ambiguities in the non-protein coding tRNA arginine located between ND3 and ND4L (approximately 67 base pairs), that region was excluded fiom subsequent analysis dong with the tRNA glycine present at the 3' end of
ND3. Al1 stop codons between genes as weli as a codon insertion discovered in P. nztdipes sample 1, and P. nudipes sample 3, located at position 1992 were removed.
Analytical methods
Before phylogenetic relationships among species can be reconstructed, the patterns of nucleotide substitution need to be assessed. Nucleotide composition, codon biases, transition / tranversion ratios, and variation plots for each gene region were determined and compared using MEGA (Kumar et al. 1993).
By plotting pair-wise p-distances, a test for saturation was perfomed for the number of pair-wise transitions and transversions at each codon position. Another alternative method would be to plot the number of pair-wise transitions and transversions against maximum Iikelihood distances (Engel et al. 1998). However, this method produces a modified distance matrix where transition / tramversion bias and multiple hits are incorporated- The raw distance matrix was therefore chosen to perform the saturation test. The program DAMBE (Xia, 1999) was used to test if the observed saturation index
(calculated fiom the data) and the expected values assuming fbll saturation were homogeneous. Estimation of phylogenetic relationships ushg distance methods requires a statistical approximation of the pattern of nucleotide substitution, keeping in mind the biologicai context of the molecular sequences. This is necessary because distance-based methods make assumptions about the process of evolution, which depend on the underlying models of nucleotide substitution. Therefore, the probability of acquiring the tree topology that best describes the evolutionary relationships arnong the taxa in question increases when a suitable mode1 is selected. The substitution process is modeled as a reversible time homogeneous stationary Markov process. The important assumption underlining this mode! is that substitutions are reversible. The PUZZLE program
(Strirnrner and Haeseler 1997) implements this model under a maximum likelihood fiamework.
MODELTEST Version 2.0 (Posada 1998) was used to determine the most appropriate model of nucleotide substitution for mtDNA sequences. This program tests up to 40 different models of substitution for a given data set and estimate which of these models best fits the distribution of substitutions. MODELTEST is designed to compare different nested models of DNA substitution in a hierarchical hypothesis-testing fiamework. For example, it tests al1 possible models of substitution starting with the simplest Jukes-Cantor (1969) model (which assumes independent nucleotide substitutions at al1 sites with equd probability) and then, adds more parameters such as unequd base fiequencies, gamma parameters, and proportion of invariable sites, for al1 pair-wise cornparisons perforrning a log likelihood ratio test (LRT). The 'best' model is chosen using the LRT, and an AIC measure (Akaike Information Criterion, or the minimum theoretical information criterion). The AiC is a usefiil measure that rewards models for good fit, but imposes a penalty for unnecessary parameters (Posada 1998). This test was performed using a parsimony tree, computed in PAUP* (Swofford 1998), to preserve the nesting of the models. Parsimony analysis does not require a model of substitution to reconstruct a tree and was chosen to perform the 'modeltest' because it is neutral relative to varying rates of intragenomic nucleotide substitution and should be fiee of any assumptions invoked by any particular mode1 of substitution. MODELTEST 2.0 was mu for the each gene separately and for the concatenated data set of ail genes-
Variation in rates of nucleotide substitution across sites is a cornmon characteristic among nucleotide sequences. Dif5erent genes have difTerent hctional and structural constraints. In a combined data set such as this one for Peromyscus, a model of substitution that cm account for this rate variation is required. Furthemore, rate heterogeneity among sites can bias the reconstruction of species relationships based on distance methods, when the algorithm for estimating distances make assumptions about the rate of nucleotide substitution (Lopez et al. 1997). Rate heterogeneity can be taken into account by introducing Gamma-distributed rates for the variable sites, and by considering the proportion of invariable sites. Variation of substitution rates across nucleotide sites is modeled by a discrete gamma distribution that uses severai categories to approximate the continuous gamma model with equal probability. Rates of substitution over nucleotide sites are regarded as random variables drawn fiom a discrete distribution (Yang 1994). The gamma distribution uses a shape parameter, where a very small a less than 1 results in a negative binomial (L-shaped) distribution. This means that most sites have very Iow substitution rates or are virtuaiiy 'invariable', while a few sites exhibit very high rates, or are 'hotspots' (Xmg 1999). When a is greater than 1 the resulting distribution is bell-shaped, as most sites having intermediate rates, while few sites have very low or very high rates. As a approaches infinit., the model reduces to a constant rate at al1 sites (Yang 1999). Rate heterogeneity within the Peromyscus data set was determined by cornparhg the shape parameter a among genes and arnong codon positions.
The discrete gamma distribution was modeled using four different rate categories.
Each nucleotides site was assigned to a rate category thai ranged fiom 1 to 4, category 1 having a relative rate = 0.0000, category 2 = 0.0042, category 3 = 0.2234, and category 4
= 3.7724. The likelihood fùnction was used to determine the probability that a particdar site fits one of the above mentioned rate categories (the computation was done without a clock assumption and assurning the quartet-pudhg tree). This cornputation was performed in PUZZLE for the Peromyscus data based on the Tamura-Nei 1993 + 1 + G model of substitution.
In addition to rate variation among nucleotide sites, rates can also vary among lineages within a phylogenetic tree. This may result in fdse impressions of relationships among taxa based on distances. To test whether this would be a problem, a relative rates test (Takezaki, Rzhetsky and Nei 1995) was performed using PHYLTEST. This test was performed in a pair-wise fashion for a subset of individuals within the Perornyscuî mexican us group.
Phylogenetic analysis
Neighbor-Joining (NJ), Maximum Parsimony ('Ml'), and Maximum Likelihood
(ML) rnethods were used to assess systematic relationships among taxa. None of the positions were saturated and so al1 positions were considered for phy logenetic reconstmction.
The Neighbor-Joining (NJ) method is a simplified version of the minimum evolution method for inferring a bifürcating tree. Neighbor-Joinîng is an algorithm based on pairwise distances for inferring an additive tree. NJ trees were constmcted for 45 taxa using PAUP* version 4.0b (Swofford 1998). The analysis criterion was set to distance and the following options were used: Tamura-Nei (1 993) modei; rates = gamma; shape =
1.0702; Proportion of invariable sites (Pinv) = 0.4995; base fiequency = empïrical.
Robustness of the phylogenetic results was tested by bootstrap analyses (Felsenstein
1985) as implemented by PAUP*4.0b with LOO replications each.
In Maximum Parsimony (MP) methods, a given set of nucleotides sequences are considered, and the nucleotides of ancestral sequences for a hypothetical topology are inferred, under the assumption that mutational changes occur in al1 directions among the four di fferent nucleotides. The smallest number of nucleotide substitutions (based on informative sites only) that explains the entire evoIutionary process for the given topology is then cornputed. This computation is done for al1 possible topologies, and the tree topology that requires the smallest number of substitutions (or fewest number of steps) is chosen to be the best tree (Nei 1996). This method is usefid when the number of nucleotide diEerences per site is small for al1 cornparisons of sequences, and when the number of nucleotides examined is very large (Yoshio et al. 1994), a pattern consistent with the Peromyscus data set. Maximum parsimony methods were performed on data sets with (1) 45 samples, (2) 32 samples (P. mexicanur species group in a broad sense), and (3) 2 1 samples ('core' rnexicanus group) for al1 genes ushg PAUP'hOb (Swofford 1998). Parsimony analysis was performed on a total of 2268 characters. The heuristic
search settings were as follows: %uthg tree(s) obtained via stepwise addition; addition
sequence = random; number of trees held at each step during stepwise addition = 10;
branch-swapping algorith = tree-bisection-reconnection (TBR); steepest descent option
in effect; initial maximum trees set to LOO; multiple trees in effect. The random addition
sequence method decreases the likelihood that a search will find sub-optimal trees in
"tree islands" other than those containhg the most-parsimonious trees (Maddison 199 1).
The following weighting schemes were considered: equal weights; transversions
weighted according to the transition / transversion ratios estimated in MODELTEST (or
PUZZLE); codon weighting of 5 for fipositions, 10 for second positions, and 1 for third positions. When two or more parsimonious trees were produced, a strict consensus tree was constmcted. Confidence levels were determined by examining levels of bootstrap support and decay indices.
The maximum likelihood (ML) method uses statistical models to estimate
Iikelihood values based on how well a chosen tree topology fits the model of nucleotide substitution exhibited by the data set. Construction of phytogenetic trees is accomplished through maximhtion of the likelihood value, which is done for each topology separately by using a different likelihood hction, and the topology with the highest (maximum) likelihood is chosen as an estimate of the true topology (Swofford and OIsen 1990).
Unlike parsimony, in maximum likelihood the likelihood of a change in codon position is a function of branch length. In addition, maximum parsimony looks at the single, most parsimonious solution (based only on parsimony informative sites or synapomorphic characters), whereas maximum likelihood looks at the total likelihood for ali solutions (ancestral nucleotides) consistent with the tree and branch lengths (Felsenstein 1978,
Swofford and Olsen 1990). The entire dataset as described above was subjected to the
ML method using PAUP*4.0b (Swofford 1998). The options under the maximum likelihood analysis were as foilows: Number of substitution types (NST) = 6; Rmatnx
(the values for a six-parameter instantaneous rate matrix estimated by MODELTEST) =
1, 14.6084, 1, 1, and 17.7998; base fiequency = 0.379132 (A), 0.297569 (C),0.06396 1
(G), 0.259338 (T); rates = gamma; shape = 1.0760; number of categories to divide the discrete approximation of the gamma distribution (NCAT) = 4; Pinv (proportion of invariable sites) = 0.4974. To decrease computing the, the most parsimonious tree was used as the starting tree for the ML method. However, the ML method was computationally intensive for such a large number of taxa, and analyses with this method were restricted. Because of the large number of taxa it was not possible to compute bootstrap support, and thus caution was exercised when making inferences on nodes that are known to have weak support fiom alternative anaiyticai methods.
Quartet Puzzlïng (Strïmmer and Von Haeseler 1996) is a faster method of tree reconstruction. This method uses a three-step process. First, maximum likelihood tree reconstructions are applied to ail possible quartets that can be formed from n sequences
(maximum-likelihood step). Then the quartet trees are repeatedly combined to an overall tree (puding step), and fdlythe majority rule consensus of al1 intermediate trees is computed giving the quartet-puzzling tree (consensus step). Quartet pdingwas used to compute bootstrap support, which was prohibitively time consuming under a maximum likelihood search. The computation was perfonned in PUZZLE (Strimmer and Haeseler
1997), under the fo 1lowing options: model of substitution = Tamura-Nei 1993 ; model of rate heterogeneity = rnixed mode1 (1 invariable rate + Gamma distributed rates);
proportion of invariable sites = 0.5; shape parameter = 1.08; number of rate categories =
4; number of puzzling steps = 1000; parameter estimation uses NJ tree; parameter
estimates = approximate. The confidence values presented on the fdtree are the number of times the group is reconstructed during the puzziïng steps. Because this method cornputes the rnajority rule consensus tree, al1 reliability values below 50% autornatidly result in a collapsed node. Strimmer and Haeseler (1996), suggest that only reliability values well over 50% can be tnisted.
Before phyiogenetic trees are constnicted, it is important that appropriate outgroups are chosen. Ideally, the optimal outgroup would comprise cIosely allied species to the subgenus Peromyscus. Carleton (1989) and Greenbaurn et al. (1 994) outline the cornplex systematic problem of detennining genenc boundaries of
Peromyscus, due to the incongruent evidence fiom morphological and karyological data
However, based on al1 the evidence, Onychomys, Baiomys and Reirhrodontornys were chosen as outgroups to Peromyscus. An outgroup comparison test (Watrous and Wheeler
198 1) was perîormed using maximum parsirnony to determine the number of appropriate outgroups needed for phylogenetic analysis. initially, tree reconstructions were based on al1 47 taxa. One by one, the most distantly related taxa were eliminated each tîme constructing a new tree. Three as opposed to five outgroups were preferred including
Baiomys, one Reithrodontomys individuai, and one Onychomys individual. Increasing the number of outgroups also increases the number of long branches anchoring the tree, thereby effecting the polarity of the whole tree. Therefore, the optimal outgroup number was three and anything beyond this number resuited in a change in the tree topology. All tree topologies were viewed and manipulated in TREEVIEW. The statisticd confidence of the resulting most parsimonious trees were evaluated by calculating the standard deviation of the differences in melengths, using the formula of Kishino and
Hasegawa (1 989) (K-H test), as implemented in PAUPS4.0b (Swofford 1 998). The optimal tree topology resulting £iomthe K-H test was then used as the ndhypothesis to test alternative hypotheses regarding the systematic arrangement of the P-mexicanus species group. niese hypothetical trees were creaîed and edited in TREEVIEW (Page
1998), then subjected to the K-H test again. RESULTS
Gene characteristics
A total of 2268 base pairs was sequenced fiom 20 species of the subgenus
Peromyscus (43 individuals), 2 species of Reithrodontomys (2 individuals), I species of
Baiomys (1 individual), and 1 species of Onychomys (2 individuals). The largest gene sequenced was cytochrome b with 972 base pairs. The srnailest was NIML with 345 base pairs (Table 2). Ai1 the genes show the same bias in transitions and tramversions (Table
3). T-C transitions are favoured over A-G transitions, and A-T, A-C transversions were favoured over T-G, C-G transversions (Fig. 3). Base changes involving guanine were
Iess frequent than those for other bases. In general for ail genes (and at ail sites), the rate of transitional substitution is up to nine times higher that the transversiond rate (Table 2)-
On average, the highest transition / transversion ratio (1 8.62) is at third codon positions for al1 genes (Fig. 4). Cytochrome b and ND4L deviate fiom this observation showing a higher ratio at second codon positions md tkst codon positions, respectively. Because
ND4L is such a small gene, deviation fiom the mean may be an artefact of sarnple size.
Cytochrome 6 has the highest ratio for second codon positions at 29.65. However, this value has a standard error of +/-13.84.
The average nucieotide composition at dl codon positions foliowed the trend:
A>T>C>G at 33.2%, 29.5%, 26.4%, and 1 1.O%, respectively (Table 4). Fust codon positions show a higher fiequency of adenine (32.0%) and a proportionately Iower fiequency of guanine (1 1.O%), whereas the fkequencies of thymine (29.5%) and cytosine
(26.4%) are similar. Second codon positions have a disproportionately high fkequency of Table 2: Sequence characteristics for al1 four initochondrial genes anlong 20 species of the subgenus Peronayscirs including first, second and third codon positions: total number of sites; number of variable sites; transition 1 transversion ratio; purine 1 pyrimidine ratio; and nucleotide frequencies using the Taniura-Nei (1 993) mode1 of substitution with gamma. Standard erron are given in parentheses. Total number Number of variable Transition/ Purinel Nucleotide frequencies Gene of sites sites (Percentage) Transversion ratio Pyrimidine ratio pi (A) pi (C) pi (G) pi (T) Cytb 1.10 (0.13) 0.284 first position 3.68 (0.94) second Position 5.90 (5.50) third position 0.53 (0.06) ND3 1.65 (0.2 1) first position 2.78 (1.28) second Position 5.90 (4.59) third position 0.55 (O. 13) ND4L 1.28 (0.23) first position 5.92 (1.65) second Position 4.01 (2.05) third position 0.91 (0.13) ND4 1.28 (O. 19) first position 4.00 (1.16) Table 2 continued. Total number Nuniber of variable Transition1 Purinel Nuclecdide frequencies
Gene of sites sites (Percentage) Transversion ratio Pyrimidine ratio pi (A) pi (C) pi (G) pi (T) third position 219 165 (75.3) 23.5 (3.03) 0.93 (O. 13) 0.494 0.286 0.026 O. 194
All Genes 2268 861 (38.0) 8.89 (0.52) 1.32 (0.09) 0,334 0,263 0.109 0.295 first pit ion 756 195 (25.8) 7.90 (0.76) 3.35 (0.48) 0.321 0,238 0.195 0,247 second Position 756 76 (10.1) 8.48 (2.64) 2.38 (0.64) 0.20 1 0.250 0.106 0.444 third position 756 599 (78.0) 18.6 (0.82) 0.73 (0.03) 0.479 0,302 0.025 0.194 Table 3: Average nunmber of transitions and transversions for each of four niitochondrial genes in 20 species of the subgenus Peromyscus. These values were calculated for each of the four mitochondrial genes with thier respective standard deviation (S.D.). The averages ovcr al1 genes are given at the bottom of the table. Gene AG S.D. TC S.D. AT S.D. AC S.D. TC S.D. CC S.D. Cytochrome b 14.75 4.18 74.10 17.84 9.26 4.54 11.26 6.12 0.71 0.89 0.79 0.96 ND3 7.27 3.29 29.63 8.77 3,67 2.74 3.19 2.38 0.97 1.08 0.73 0.16 ND4L 6.24 2.58 22.95 7.81 2.46 2.51 2.51 2.44 0.12 0.34 0.2 0.42 ND4 11.57 4.45 54.07 14.53 6.82 4.86 8.64 5.39 OS 0.68 0.58 0.71
Total Average 9.96 3.63 45.19 12.24 5.55 3.66 6.40 4.08 0.58 0.75 0.58 0.56 Figure 3. The average proportion of transitions and tranmersions among 20 species of the subgenus Peromyscus for four mitochondrial genes. The average was calculated fiom the total number of transitions or transversions across al1 genes, (see Table 2).
Figure 4. Histogram presenting the transition / transversion ratio for four mitochondrial genes at each codon position, based on 20 species of the subgenus Peromyscus (43 individuals). Ratios were calculated using the Tamura-Nei (1 993) mode1 of substitution with gamma distributeci rate variation across sites (a= 1.07, Table 2). Transition / Transversion Ratio
First Position
.--- .. 7 Second Position sz-:A. 1 Third Position
First Position --.-I second position -
- Second Position !i 4
FUS*Position 1 +
! Thini Position -i AUGenes , d
First Position +1- - Second Position - Third Position ,- Table 4: Percentage nucleotide composition for 20 species of the subgenus Pcro»yscics excluding the outgroups Reithrodontoinys, Baiomys and O~~ychornys.The total percent composition for ali positions, first position (11, second position (2), and third position (3) were included. There was a total of 2268 bases at ail sites and 756 bases at each position. Average percent composition and their respective standard deviation (S.D.)are given at the boitorn of the table. A T C G Al Tl Cl G1 A2 T2 C2 G2 A3 T3 C3 G3 mexl 33.3 29.2 26.8 10.7 32.1 24.3 24.3 19.2 20.1 44.7 24.6 10.6 47.618.5 31.5 2.4
stirl 34 30.7 24.6 10.7 32.5 25.3 22.6 19.6 20.1 45 24.3 10.6 49.3 21.8 26.9 2 stir2 33.9 30.8 24.4 10.9 32.4 25 22.8 19.8 20.1 45.2 24.1 10.6 49.1 22.1 26.5 2.4 Table 4: continued, yuc3 zarl guat 1 guaî2 nud 1 nud2 nud3 nud4
meg l me1 1 me12 may 1 may2 ochl mela l
azt1 leu l Table 4: continued. lep 1 32.5 29 27.3 11.3 31.6 23.8 24.6 20 20.1 44.8 24.6 10.4 45.6 18.3 32-7 3.4 th01 32.7 28.9 27.3 11.1 31.5 24.7 23.8 20 20.1 44.8 24.5 10,6 46.4 17.3 33.5 2.8
Average 33.2 29.3 26.5 11.0 31.9 24.6 23.9 19.6 20.1 44.4 24.9 10.6 47.6 18.9 30.8 2.7 thymine (44.4%) and a low fiequency of guanine (10.6%). Third codon positions have a very high fiequency of adenine (47.7%) and a low fiequency of guanine (2.7%). Overall there was a low percentage of guanine and a high percentage of adenine, which is consistent with published mitochondnal sequences (Reyes et al. 1998). A low proportion of codons ending in G (Table SA) substantiates the bias against guanine. In addition, there was an observable bias favouring codons ending in A. For example, the codon
CUA was most frequent (66.1) followed by AUC (42.0), AUA (39.4), and ACA (30.3)
(Table 5A). This trend was consistent with codon fiequencies in the Ruttus norwegicus mitochondrial genome (Gadaleta et ai. 1989).
A common characteristic among mtDNA genes is the high proportion of the amino acid leucine (irwin 199 1, Fig. 5). Cytochrome b also exhibited a high proportion of isoleucine (a nonpolar, hydrophobic amino acid) folîowed by threonine (a polar, uncharged, hydrophilic amino acid), and glycine (a nonpolar, hydrophilic amino acid,
Table 5B). Cysteine, a polar, uncharged, hydrophobic amino acid was the least common.
ND3 had a high proportion of uncharged, hydrophobic amino acids such as methionine, alanine, and phenylalanine, whereas the positively charged, hydrophilic amino acid histidine was absent (Table 5B). ND4L showed a high proportion of isoleucine, alanine, and serine (an uncharged, hydrophilic amino acid), whereas tryptophan (a hydrophilic amino acid) was absent aitogether. ND4 showed a hi& proportion of the amino acids isoleucine and threonine, whereas arginine occurred with the lowest fiequency. The majoris of the arnino acids present in al1 four genes were hydrophobic, suggesting that large portions of these proteins are embedded within the mitochondrial membrane, Table SA: Codon fiequency for al1 20 species of the subgenus Peromyscus excluding the outgroups Reithrodontomys, Brriomys ,aad Onychomys . Values în parentheses represent the relative fiequency of sysnonymous codons. An * indicates a stop codon. One-letter abbreviations for amino acids are given in parentheses, as defined in Table 5B. W(F) 21.8 (0.84) UCU(S) 7.2 (0.89) UAUCY) 11.0 (0.77) UGU(C) 1.6 (0.41) WC(F) 30.3 (1.16) UCC (S) 10.9 (1 -35) UAC (Y) 17.7 (1.23) UGC (C) 6.2 (1 -59)
UUA (L) 32.0 (1 -45) UCA (S) 24.4 (3 -03) UAA (*) 0.0 (2.00) UGA (W) 19.6 (1.86)
UUG (L) 1.5 (0.07) UCG (S) 0.7 (0.08) UAG (*) 0.0 (0.00) UGG (W) 1.4 (0.14)
CW(L) 14.3 (0.65) CCU (P) 6.9 (0.74) CAU (H) 4.0 (0.54) CGU (R) 0.9 (0.33) CUC (L) 15.2 (0.69) CCC (P) 9.0 (0.97) CAC CH) 10.8 (1.46) CGC (R) 2.1 (0.75)
CUA (L) 66.1 (3.01) CCA (P) 20.7 (2.22) CAA (Q) 17.8 (1.90) CGA (R) 7.9 (2.87) CUG (L) 2.8 (0.13) CCG (P) 0.6 (0.07) CAG (Q) 0.9 (0.10) CGG (R) 0.1 (0.04)
AUU (1) 33.0 (0.88) ACU (T) 12.4 (0.82) AAU (N) 15.7 (0.80) AGU (S) 0.9 (0.1 1) AUC (1) 42.0 (1.12) ACC (T) 17.8 (1.17) AAC 23.3 (1.20) AGC (S) 4.4 (0.54)
AUA (M) 39.4 (1 -81) ACA (T) 30.3 (2.00) AAA (K) 17.4 (1.9 1) AGA (*) 0.0 (2.00) AUG (M) 4.2 (0.19) ACG (T) 0.2 (0.02) AAG (K) 0.8 (0.09) AGG (*) 0.0 (0.00)
GUU (V) 5.3 (0.63) GCU (A) 7.2 (0.62) GAU@) 5.1 (0.72) GGU(G) 2.2 (0.25)
GUC (V) 6.0 (0.71) GCC (A) 17.5 (1 -50) GAC @) 9.0 (1.28) GGC (G) 5.1 (0.59)
GUA (V) 21.1 (2.49) GCA(A) 21.9(1.87) GAA(E) 16.2 (1.79) GGA(G) 24.1 (2.76) GUG(V) 1.4 (0.17) GCG(A) 0.2 (0.02) GAG@) 1.9 (0.21) GGG(G) 3.5 (0.40) Figure SB: Amino acids name, their three one-letter abbreviations, and classification according to charge, polarity and hydrophobicity (Lehninger et al. 1993). Amino Acid Abbreviated Names Nonpolar, Hydrophobic Alanine Ala Valine Val Leucine Leu Isoleucine Ile Nonpolar. Hydrophiiic Glycine G~Y Proline Pro Aromatic, Hydropha bic P he ny la1 mine Phe Aromatic. Hydrophilic Tyrosine TF Tryptophan TV Polar, Uncharged, Hydropho b ic C ysteine CYS Me thio nine Met Poiar, Uncharged, Hydrophilic Serine Ser Threonine Thr Asparagine Asn Glutamine Gln Negativeiy charged Hydkophiiic Aspartate Asp Glutamate Glu Posit ively charged, Hydrophilic Lysine LYS Arginine A% Histidine His Figure 5. Percent amino acid composition of four mitochondrid genes, in 20 species of the subgenus Peromyscus. Amino acids are listed according to their one-letter abbreviation, (defmed ui Table SB).
consistent with published data (Esposti et al. 1993).
Gene region variabiliiy
Variation in rates of nucleotide substitution foliows a trend in the order of ND3 >
ND4 > ND4L > Cytb Fig. 6). Third codon positions were most variable. This was
expected conside~gmost nucleotide substitutions that occur at the third codon position
are synonymous. Second codon positions were the teast variabIe and al1 nucleotide substitutions at this codon position are nonsynonymous. First codon position substitutions are also nonsynonymous (except for leucine), and they are more variable than second codon positions, but much less variable than third codon positions.
The number of amino acid changes among amino acid sites exhibited regions of high varïabiIity followed by invariable regions (Fig. 7). This pattern is expected in transmembrane proteins given the structural and hctionai constraints associated with the positioning of these proteins within the membrane. AIL of the ND genes show an erratic pattern of variation in amino acid substitutions among sites compared to cytochrome b
(Fig. 7). Cytochrome b consists of highly conserved, followed by highly variable regions, depending on what part of the membrane the protein spans (irwùl 1991, Esposti et al. 1993, GrÏfiths 1997). The range of variability at the amino acid level for al1 the genes examined had the trend: ND3 > ND4 > ND4L > Cytb. Cytochrome b and ND4L exhibit a simiiar amount of variability in amino acid substitutions mghg fiom O to 5 amino acid substitutions per protein coding site arnong sarnples. ND3 and ND4 also showed a similar range of 0-8 amino acid substitutions per protein coding site among Figure 6. Percent nucleotide sequence variation for each of the four mitochondnal genes sequenced at each codon position for 20 species of the genus Peromyscls.
Figure 7. The number of ciifferences in amino acid composition for each gene.
Measurements were made in non-overlapping windows of 10 amino acid positions each, across ail four rnitochondnal genes. The number of variable sites was calculated for 20 species of the subgenus Perornyscus. OSL- ILL OSL- LPL
OZZ- 1 1Z samples.
Test for saturaîion
Common characteristics of mtDNA are that transitions accumulate much more
fiequently than tramversions and that third codon positions are most variable. A general
assumption for unsaturated sites is that as time since divergence of taxa increases, pair-
wise sequence dserences between taxa shouid also increase (Griffith 1997). Therefore,
as taxa diverge the chance of satwation at third codon positions for transitions increases.
Saturation results in multiple hits at prïmarily third positions in codons, obscuring
patterns of homology and underestimating the actuai nurnber of substitutions that have
occ urred since divergence. Pair-wise numkrs of transitions and transversions for dl
codon positions were plotted against p-distances among al1 taxa to detennine if saturation had occurred (Fig. SA through D). Plots of al1 codon positions showed a linear increase with time (Le. no saturation), and this confirmed by DAMBE (Table 6). Although third codon position transitions were approaching saturation, the accumulation of substitutions remained linear. Based on this observation third codon position transitions were retained in the data set.
Models of sequence evolution
Initially, the appropriate mode1 of sequence evolution was chosen by comparing the log likelihood values calculated in PUZZLE for the Hasegawa, Kishino and Yano @KY} 1985, and the Tamura-Nei (TN) 1993 models of evolution, both with Figure 8. Plot if the number of transitions and tranwersions verses uncorrected p- distance for dl four mitochondrial genes at £kt,second, and third positions. Triangles indicate the nurnber of transitions, squares indicate the number of transversions.
Calculations were based on 20 species of the subgenus Perornyscus, A. Cytochrome 6. .st Position Transitions , s t Position Transve n ions
O 0.02 0.04 0.06 0.08 0.1 0.12 O. 14 0.16 0.18 Pairwisc P-Dis tance
l- 8- ~2ndPositionTransitions YYI. r AA-yyYa a 7 * IC. -2nd Position Transvenions
- - > 90 - u A 3rd Position Transitions r 80 - a i3rd Position Transversions il 70 - 60 - -f 50: 5 40 : C1 30 - i 20-
-y.5 10- O .-lt O O .O2 0.04 0.06 0.08 O. 1 O. 12 0.14 0.16 0.18 Painvise P-Dis tance Figure 8. Continued B. ND3. 20 - A g r 1st Position Tmnsitioas A 18 A u - A A A 16 - i1st Position Tramversions A AA- -A-A 14 - MAA- A O A --AM& 12 - A A PAA 4A AAAAA-u A -g 10 - M UAA AA CI MY MAA 8- Y.. --UA. AA 3 6- A A Y -mm 11 mi Ls A A Asmm 2 4- Y- IJ. 1 mm m g 2- 4A A YLUYY. AA YImU' m 7. O0- P O 0.05 O. 1 0.1 5 0.2 025 Pairwise P-Dis tance
C 8- A 2nd Position Tmmitions A A A % 5 m 2nd Position Tramvenions 7- -A
Pairwis e P-Dis tance
A 3rd Position Transitions A& i3rd PositionTmnsve~ions A A -
0.05 O. 1 O. 15 03 025 Pairwise P-Dis tance Figure 8. Continued C.ND4L. A A 1st Position Tiansitions AA A 1st Position Tr~iuveniom A A A - Y-.Y.y UAA A Y P AA A AAA --MM& A A A-rlrlrrw AM A w- Y A un rlrrrrrrr -AA A w -Y- -A - -.- a..
A 2 nd Position Trans itions AAA
m 2nd Position Tr~nsvemionsA a A .y
O -- -1-- O 0.0s O. 1 O. 15 0.2 0.25 Painvise P-Dis tance
a 35 - A 3id Position Transitions
O 0.05 O. 1 0.15 O -2 O .2S Pairwise P-Distance Figure 8. Continued D. ND4. 'lumbcr of Painvisc Tb and Pv 'lumhrr of Fainvise l3 and TL Yumbcr of Painvisr TS and R --NhJW OwOvlO'.nO Tablc 6: Two-tailed test of nuckotide saturation between the observed saturation index and the expected value assuming full saturation for al1 genes. This test was performed on 20 species of the subgenus Pcroi~tyscusfor first position(l), second position (2), third position (3), first and second positions (1 +2) and at al1 positions (1 +2+3). All values were highly sipificant (P < 0.00 1) relative to the expected value at full saturation, with the minor exception of ND3 at third positions, which was different at P < 0.01. Cytb 1 Cytb 2 Cytb 3 Cytb lt2 Cytb l+2+3 ND3 1 ND3 2 ND3 3 ND3 1t2 ND3 1t2t3 Mean (observed) 0.1 543 0.033 1 0.67 12 0.0937 0,2858 0.2525 O. 1059 0.6954 O. 1792 0.35 13 Variance (observed) 0.10 1 7 0.0 198 0.1998 0.0643 O, 1834 O. 148 0.0591 0.2104 0.1085 0.20 14 Standard Error 0.0 1 77 0.0078 0.0248 0.0099 0.01 37 0.0359 0.0227 0.0428 0.02 17 0,0242 Mean (expected) 0.9743 0.9191 0,8025 0.9655 0.9498 0,9724 0,8886 0.81 1 1. 0.9541 0,9377 T value 46.347 1 13.5853 5.2836 87.621 48.3839 20.0672 34.5 184 2.705 1 35.6759 24.2725
Tablc 6 continued, ND4L 1 ND4L 2 ND4L 3 ND4L 1t2 ND4L 1+2+3 ND4 1 ND4 2 ND4 3 ND4 1t2 ND4 l+2+3 Mean (observed) 0.201 6 0.0648 0.6693 0.1332 0.31 19 0,2541 0.0798 0.6693 0.167 0,3339 Variance (observed) O. 1 174 0.0347 O. 1472 0.0804 0,t 663 O. 1475 0.0422 0.1738 O. 1023 0.1819 Standard Error 0,0346 0.01 88 0,0388 0,0203 0,0238 0.0259 0.01 38 0,0282 0.01 52 0,O 166 Mean (expected) 0.965 0.87 19 0.833 0.9443 0.9363 0,9293 0.8888 0.8079 0.9309 0.9096 T value 22.0528 42.8841 4.2236 40.0496 26.2538 26.0733 58.41 16 4.9192 50.1108 34.6532 8 and without a gamma distribution. The Jukes-Cantor (JC) 1969 or Kimura two-parameter
(K2) 1980 models were not considered, because the Peromyscus data set violates many of the assurnptions underlying these models. For example, the Jukes-Cantor model assumes independent nucleotide substitutions at al1 sites with equal probability (Li 1997). in the
Peromyscus data set, the rate of transitions to transversions was unequal, and the nucleo tide composition was biased against guanine. The Kimura two-parameter model does take into account the differences in nucleotide substitution rate between transitions and transversions, but it does not consider unequal base fiequencies (Li 1997). The HKY
(1 985) model allows for the differences in transitions and transversions rates as weii as unequal base fiequencies, whereas the TN (1 993) model accounts for the transition / transversion ratio, unequal base fiequencies, and purine / pyrimidine differences. These models of nucleotide substitution were implemented under a maximum likelihood framework which simultaneously accounts for transition / transversion rate bias, unequal nucleotide frequencies, and rate variation among sites (Yang 1998).
The Tamura-Nei (TN) 1993 model of nucleotide substitution with a gamma parameter (G), and a proportion of invariable sites (I), was the most appropriate model of nucleotide substitution (Table 7). The Gened Time Reversible (GTR+G+I) model had the best log likelihood, and is the most complex model amongst the 40 models considered. However, when the AiC measure (Akaike Information Critenon) was invoked, the Tamura-Nei (TN93+I+G) model was preferred. Each systern of testhg assigns fiee parameters designating a particular type of base change to each mode1 of nucleotide substitution. In the following diagram (Posada 1998), lower case letters are Table 7: Selected rnodels of nucleotide substitution for al1 mitochondrial genes. All models selected were with the miniiiium AIC (Akaike information criterion) measure.
Gene Model* -InL P-inv** Gamma Shape Ti / TV ratio ~(a)' R(b) R(c) R(d) R(e)
Cyt b HKYtItG 6141.55 0.603 1.3064 9.67 18 .) rn I - -
ND3 TN+ItG 2264.5391 0.5103 1,9686 NIA 1 14,0407 1 1 27.6793 ND4L HKY + 1+ G 1738.833 0,5723 3.1 123 10,8433 - - - - - ND4 K3P + 1 + G 655 1.8999 0.4268 0,9683 N/A 1 t 6.7 136 0.4402 0.4402 16.7136 Al1 ND genes K3P t 1 + G 13038.7676 0.45 1 1 1.0266 N/A 1 17.7583 0.6767 0.6767 17,7503
All genes TN t 1 -t G 23880.861 3 0.4971 1.0814 NIA 1 14.5754 1 1 17.9195
* HKY= Hasegawa,Kishino and Yano (1985) model, TN = Tamura-Nei (1 993) model, and K3P = Kimura-3-parametet (1 98 1). ** P-inv (1) is the proportion of invariables sites. t R(a), R(b), R(c), R(d), R(e) are the free parameters. free parameters, which represent the proportion of change fiom one base to another.
b
A-G
The simpiest mode1 of nucleotide substitution (JC) would have one liee parameter where a=b=c=d=e=f and xA = nC = srG = srT (base fiequencies). Whereas the model with the highest complexity (GTR+I+G) would have nine fiee parameters where a, b, c, d, e, and f, would al1 be estimated fiom the data set and ItA, xC, nG, xT are not equal. Each gene exhibits a unique proportion of transition and transversion substitutions, apparent from the different models of nucleotide substitution chosen (Table 7). The model of nucleotide substitution chosen for the Peromyscus data set that included al1 protein-coding genes was TN (1993) + 1 + G (Table 7), whîch has 6 fiee parameters where a=c=d=f, b, e (with equd fiequencies). Al1 transversions are weighted equally and the proportion of AG, and
TC transitions are estimated fiom the data set separately.
Distance rneasures
The percentage of sequence divergence within the subgenus Peromyscus ranged fiom 0.49% between the P. mexicanus sample 1 (Tabasco, Mexico), and P. mexicanur sample 6 (Santa Ana, El Salvador), to 61 -49% between P. Jir17rus sample 1 weracruz,
Mexico), and P. yucatanicus sample 2 (Yucatin, Mexico), (Table 8). When the average percent sequence divergence was compared by codon position among al1 Peromyscus, and within the P. mexicanus species group, the major@ of the signal was at third codon positions (Table 9). Sequence divergence was bighest for ND3 and ND4, ranging fiom
20.2 percent to 20.7 percent respectively. Average percent sequence divergence was lowest for cytochrome b at 18.8 percent among species of Peromy~cus~However, when just considering the mexicanus species group, cytochrome b had the largest percent sequence divergence with 1 1.7 percent, followed by ND3 with 1 1.1 percent, ND4 with
10.5 percent, and ND4L with 7.9 percent-
Rate variation among sites within genes
Variation of substitution rates across nucleotide sites cm be modeled by a discrete
Gamma distribution that uses several dif5erent rate categories to approximate the continuous Gamma model, each rate occurring with equal probability. Rates across sites are regarded as random variables drawn fiom a discrete distribution (Yang 1994). The
Gamma distribution uses a shape parameter alpha (a)were an a value of greater than 1 means there is little to no rate heterogeneity between sites, and a small a less than 1 indicates a large arnount of rate heterogeneity. Rate variation between genes and among codon positions are reflected from the gamma shape parameter a (Table 9). The alpha
(a)values were calculated with, and without a proportion of invariant sites (1 in parentheses, Table 9). Al1 genes exhibit high rate heterogeneity among positions, with an alpha value of 0.1 9 (without 1), when ail positions and were considered. Cytochrome b had the lowest a = 0.15 and, whereas the d the ND genes combined had an a = 0.24.
Table 8 continued, mexl mex2 mex3 mex4 mexS mex6 inex7 mex8 mex9 mexlO stirl stir2 granl gran2 yucl yuc2 me12 0.241 1 0.2574 0,2497 0,2461 0.2464 0.2399 0.2328 0.2470 0.1975 0.21 78 0.4760 0,4879 0.2553 0.2489 0.3460 0.3202 mayl 0.3256 0.2841 0.3262 0.3033 0.3268 0.33 13 0.2893 0.31 76 0.2622 0.2845 0.4296 0,4535 0.3040 0.3353 0.5713 0.5107 may2 0.3 168 0.2907 0.2974 0.2735 0.3099 0.3 141 0.2812 0.2882 0.2546 0.2829 0.3938 0.4150 0.3109 0.3181 0.5187 0.4674 fur1 0.5228 0.4475 0.4275 0.4020 0.5453 0,5338 0.4549 0.3691 0.4414 0.4384 0.4476 0,4198 0.4987 0.4218 0.6071 0.6149 fùr2 0.5228 0.4475 0,4275 0.4020 0.5453 0.5338 0.4549 0.3691 0.4414 0,4384 0.4476 0,4198 0.4987 0.4218 0.6071 0.6149 ochl 0.4190 0.3748 0.5000 0.4872 0.4057 0.4069 0.4130 0,4138 0.4666 0.4505 0.4298 0,4381 0.4137 0,4834 0.5150 0.5246 melal 0.3322 0.3398 0.3901 0.3975 0.3333 0.3379 0.3005 0.3504 0.3186 0.3338 0,3706 0,3760 0.3760 0,3501 0.4159 0.4377 azt1 0.4949 0.3829 0.6072 0.5875 0.4565 0.4627 0.4552 0.4528 0.3986 0.4432 0.5424 0,5752 0.4974 0.4265 0.6047 0.5760 leu1 0.3703 0.3681 0.3860 0.4187 0.3682 0.3852 0.4083 0.4250 0.4353 0,4089 0.4940 0,4785 0,4331 0.4490 0.5214 0.5040 leu2 0.3452 0.3544 0.3744 0.3854 0.3507 0.3587 0.3650 0.4480 0.3666 0.3759 0.4823 0,4694 0,4027 0.4218 0.4881 0.4691 levl 0.3210 0.2842 0.3717 0,3773 0,3444 0.3419 0.3435 0,3293 0.3140 0,2998 0.3397 0,3432 0.3609 0.3035 0.4100 0,4250 lopl 0.5053 0.4081 0.4137 0.4230 0.4778 0.4998 0.4832 0.4602 0.53 14 0.5548 0.4718 0.4481 0.5926 0.5490 0.5990 0.5996 lepl 0,3800 0.3443 0.3607 0.3646 0.3803 0.3966 0.3527 0.3921 0.3789 0.3924 0.4334 0.4336 0.4106 0.4452 0.3852 0.3818 th01 0.2693 0.2484 0.3169 0.3476 0.2780 0.2828 0.2737 0,3020 0.3178 0.3359 0.4634 0,4553 0.3035 0.2968 0.4086 0.4359 Reithl 0,5540 0.5 162 0.5524 0.5237 0.5774 0.57 18 0.61 32 0.5891 0.5007 0.5488 0.6703 0,5951 0.61 14 0,5388 0.681 5 0.63 12 Baiol 0,4988 0.4943 0.4610 0.4663 0,5156 0.5179 0.5624 0,3910 0.5750 0.5637 0.5902 0,5504 0.5914 0.5894 0.6166 0.6422 Onycl 0.5845 0.5465 0.5277 0.5192 0.6168 0.5882 0.6217 0.5153 0.5920 0.6403 0.6835 0.6649 0.7578 0.6094 0.6210 0.6009 00 3 V) w ? X O w d - CV d ". -% O O
L. fi m d V! O? O rn LI 00 C CC) VI X d t- N m P- VI 00* 2 O m L. cc) Q\ d m T O O * * VI fi O* ? -* O O VI m s œ fi ? % O a CCL CI CV 00 z '? * O O P- CV * VI Q\ - ? O X N VI 09 d* O X X \O O b LI d O -. -? O O 00 zt M 25 d Y Y O O QO \O \Om s * O X m d d z u! 'm. O O
œ - b 9 z O Table 8 continued. fur1 fur2 ochl melal ami leu1 leu2 levl lopl lep1 th01 Reithl Baiol fur2 0.0000 mela l azt 1 leu l leu2 lev 1 lop l lep 1 th0 1 Reithl Baio 1 Onyc 1 Table 9: Average percent sequence divergence (d)and alpha paraineter (a)estimated anlong species of Pei-o»ysct~.sand among species wit hin the niexicunirî group. Numbers in brackcts represent a values when the proportion of invariable sites were considered.
Among Peromyscrcs W ithin the nicxicunilc. group
Gene d Range a J Range a cytb 0.00312.0.324 0.15 (0.79) 0.1 17 0.00312,0.19198 0.13 (0.52) first position second Position third position ND3 first position second Position third position ND4L first position second Position third position Table 9 continued Among P~~ro~~i)tsctc,s Wi thin the inexicanics group
Gene d Range a d Range a ND4 0.202 0.00780,0.380 0.24 (0.7 1) O. 105 0.00953, O. 18768 O. 17 (0.96) first position 0.126 0.00473,0.337 0.200 0.063 0.0047 1, O. 12706 0,220 second Position 0.02 1 0.00463,0.049 O. 190 0.0 1 1 0,00459,O.O 1897 0.620 third position 0.609 0.01 900, 1.370 1.850 0.254 0.02368,0.49549 1.640 All Genes 0.196 0.00493,0.446 0.19(1.08) 0.106 0.00494,0.14774 0.16(0.67) first position 0.104 0.00405,0.222 O. 120 0.054 0.00405,0,09187 O, 140 second Position 0.021 0.001 33,0,039 0.020 0.0 11 0.00 13 3,0,02200 0.020 third position 0.582 0,00948, 1,242 2.430 0.304 0.00948,0,50000 1,740 When the proportion of invariable sites was designated (1 was implemented), the alpha
values increased seven-fold. For Peromyscus, alpha values increased fiom 0.15 to 0.60 in
cytochrome 6, fiom 0.24 to 1.96 in ND3,0.24 to 3.1 1 in ND4L and 0.24 to 0.968 in ND4
when invariant sites were included.
Third codon positions are theoretically fkee of functional constraints and therefore
exhibit weak rate heterogeneity or small dflerences in the rate of nucleotide substitution.
Except for Ieucine (which is degenerate at the f'irst codon positions), al1 other
substitutions at first codon positions are nonsynonymous, and hence many of these sites
are invariable with a few sites exhibithg change in a given gene. Therefore, high rate
heterogeneity is expected at these sites, but not as high as in second codon positions
which typically experience even fewer substitutions tkan first codon positions. This trend
was observed in the Perornyscz~sdata set. The a values at third codon positions ranged
from 1-85 in ND4 to 3 -89 in cytochrome 6, first codon positions ranged fiom 0.12 in
slower-evolving cytochrome b to 0.23 in ND4L. Similar trends were observed when
comparing rate variation among the P. rnexicanus species group. There was an overall
decrease in a which reflects increasing similarity among individuals in the mexicanus
group, with the exception of third codon positions in ND3 and fïrst codon positions in
ND4L. Because among-site rate variation is dependent on the number of taxa sampled, estimation of a is more reliable when estimated fiom a larger data set then fiom a smder
sample set (Sullivan 1 996).
Each nucleotide site was assigned to one of the four rate categories approximated
by the discrete Gamma distribution (see methods). Rate variation among sites was examined for each codon position separately and graphed according to gene (Fig. 9 A through D). Characteristically among al1 the niitochondrial genes studied here, rate variation at first and second codon positions was either very high (peaks shown in Fig. 9
A-D), or zero. Cytochrome b contains sequences of approximately 40 base pairs that are invariant (at second codon positions), suggesting a region that is highly constrained. The first 20 and the last 40 base pairs of ND3 have a region of high rate variation among second codon positions compared to the centrai region of the molecule. First positions in
ND3 showed more Ereedom to vary within the central region. ND4L like ND3 showed more rate variation among sites for first codon positions but not as high as for second codon positions. ND4 exhibited a more sporadic rate variation compared to al1 other genes. For al1 genes combined, third codon positions have a more unifonn distribution of rates of substitution across al1 sites-
The relative rates test between Iineages indicated that al1 individuals except for P. grandis sample 1 fiom Baja Verapaz, Guatemala, and P. megalops sample 1 fiom
Guerrero, Mexico, are evolving at a statistically homogeneous rate (Table 10). The P. grandis sample appean to be evolving faster than the P. mexicanus samples 1,2, 7 and 8, whereas, the P. megalops sample 1 appeared to be evolving slower than all samples except P. rnexicanur sample 2. Any phylogenetic inferences involving distances were made with caution relative to the fast evolving samples.
Phylogenetic reconstruction
Al1 tree reconstructions were based on 2268 base pairs of Cytochrome b, ND3, Figure 9. Relative rates of nucleotide substitution for f~fst,second, and third positions, based on 20 species of Peromyscus. A. Cytochrome b and ND3.
Figure 9. Continued B. ND4L and ND4.
TablelO: Results from the relative rates test performed in pair-wise cornparisons between al1 20 species of the subgenus Peroniyscirs. Rrifhrodonornys,Baiomys and Onychoniys were used as outgroups. The dots represent the pair-wise taxa that are evolving at the same rate.
A negative or positive sign means the individuals in rows are relatively faster or relatively slower evolving compared to the species in the column.
mxl
mex10 . .
stkl . a . . . s
ND4L and ND4. Neighboudoining trees were constructed under a Tamura-Nei (1 993) +
1 + G mode1 of nucleotide substitution with the proportion of invariable sites set at 0.4995
and the alpha value set at 1.0702 (Fig. 10). There was less than 50% bootstrap support
for the P. mexicanus species group, in the broad sense, (including P. stirtoni, P. mayensis,
P. megalops, P. melanocarpus, and P. yucatanicus). Very Little confidence was found for
the exact placement of nodes for P. stirtoni. P. megalops, and P. mayensis within the P.
rnexicanus species group. In addition, bootstrap support for the position of P.
melanocarpus and P. yucatanicus with the remahhg mexicanw species group was weak
(57% and 56% respectively). Peromyscusfurvus and P. ochraventer were grouped with
other species of Peromysçz~sand not with the P. rnexicanus species group as traditionally
defined. Perumysczi-s ochraventer clustered with the P. leucopus species group witb a
bootstrap value of 6 1%. Peromyscusfûrvus tentatively clustered with Habromys with a
low bootstrap value less than 50%. Nodal support for relatiooships among taxa in general
was low, aithough there were several important exceptions. Two samples of P. nudipes
(nud2 and nud4) fiom Costa Rica consistently grouped with the Honduras samples of P.
mexicanus (mex9 and mexl0) and these samples appeared as the sister group to an
eastern P. mexicanus-P. guatemalensis-P. grandis (mexl, mex5, mex6, mex7, guatl ,
guat2, ganl. and gran2) complex with a bootstrap value of 91%.
Of 2268 total characters, 124 1 were invariant, 846 were phylogenetically
informative, and the remaining 18 1 were autapornorphic. Parsirnony analysis was nin
with equal weighting, and 10 most parsimonious trees were produced with a length of
488 1, CI = 0,299 and Ri = 0.546. Two additional parsimony analyses were run with Figure 10. Neighbor-joining tree constructed in PAUP* (Swofford 1998) using the TN
(1993) + 1 + r mode1 of nucleotide substitution. The tree was constmcted using 20 species of the subgenus Peromyscus with Reilhrodontonrys, Onychomys, and Baiomys as outgroups. Numbers represent bootstrap support for the nodes. & rnex 10
mex4 gymI mex8 nud f nud3 separate weighting schernes. In the ktweighting system, transversions / transitions were assigned weights of 6: 1. This value was estimated based on differential transition / transversion ratios in the empincai data set using PUZZLE, which averages this ratio over al1 genes and al1 positions. The 6: 1 weighting scheme resulted in 6 most parsimonious trees with a length of 981 1, CI = 0.388 and RI = 0.580. The second mixed weighting system was the most complex, and involved assigning a merent weighting regimen to each gene within the data set based on the results of MODELTEST (Table 6), as follows: bases 1-972 (cytochrome b) were assigned a weight of 1 :10 (transitions : transversions); bases 973- 13 17 (ND3 were wsigned al1 transversion = 28, A-G transitions = 2, and C-T transitions = 1; bases 1318- 16 1 1 (ND4L) were assigned a transition / transversion ratio of
1 :1 1; bases I 6 12 - 2268 (ND4) were assigned A-C and G-T transversion = 17, A-T and
C-G transversion = 39, ail transitions = 1. Out of 2268 characters, 860 were phylogenetically informative. The results fiom this anaiysis produced 2 most panimonious trees with a lengdi of 18995, CI-0.445, and RI=0.613.
Sixteen different tree topologies in total were found through maximum parsimony analysis, including aii weighted and non-weighted methods. These 16 topologies were subjected to a K-H test (1989) to detemine which phylogenetic hypothesis best fits the
Peromyscus data (Table 1 1). The second tree found using a 6:l weighted regimen was statistically the best. Al1 of the reinaining tree topologies could not be rejected within a
5% significance level. Among these 16 trees, most variation occurred in the exact arrangement of P. melanocarpus, P. mayensis, P. rnegalops, and P. yucatanicus with the broader P. mexicanus species group, which is reflected in the low bootstrap support for Figure 11. The consensus of the 10 shortest maximum parsimony trees for 20 species of the subgenus Peromyscus using Reifhrodontomys. Onychomys, and Baiomys as outgroups. Numbers represent bootstrap support for the nodes. mexf
b yucl
100 yuc3 yuc2 lop 1 iepi 100 rnelal 58thOl
may 1 100 Lma3'2
megl aztl lev 1 - bai01 onycl reith 1 Table 11: Kishino-Hasegawa (1989) tests perfonned under a maximum likelihood aigorithm for al1 tree topologies found using parsimony, neighbor-joining, and maximum Likelihood methods. Phylogenetic reconstnictions were based on 20 species of the subgenus Peromyscus using Reithrodontomys ,Baiomys ,and Onychomys as outgroups. Tree Length LengthDiff S-D.(Difi) T P* Pars no weighting scheme 1 9880 69 47.92 0.15 Pars no weigh~gscheme 2 69 Pars no weighting scheme 3 51 Pars no weighting scheme 4 43 Pars no weighting scheme 5 51 Pars no weighting scheme 6 51 Pars no weighting scheme 7 43 Pars no weighting scheme 8 43 Pars no weighting scheme 9 51 Pars no weighting scheme 10 43 Pars + transition weighting (1 :6) 1 O Pars + transition weighting (16) BEST Pars + transition weighting (1 :6) 3 O Pars + transition weighting (1 :6) 4 O Pars + transition weighting (1 :6)5 O Pars + transition weighting (1 :6) 6 O * Probability of getting a more extreme T-value under the null hypothesis of no difTerence between the two trees (two-tailed test). Asterisked values in table (if any) indicate signifïcant Merence at P < 0.05. ** Indicates a signifïcant difference at P < 0.05. these nodes. Additional variation occurred at branch tips, particularly involving minor rearrangements of taxa including the position of a subset of P. nudipes (nudl and nu&) and variation within the eastern mexicanus group including mex (1,5,6,7), P. grandis
(gran 1 and grad), and P. guatemalensis (guat 1 and guatî), (Fig. 1 1 and 12). The monophyletic 'core' of the mexicanus group (Fig. 12), comprises P. mexicanus, P. grandis,P. guatemalensis, P. nudipes, P. zarhynchus, and P. gymnotis, and was consistently supported with a strong bootstrap value of 98% and decay indices greater than 13.
Parsimony analysis was also used to test the monophyly of the P. mexicanus species group. This was accomplished by condensing the data set to the 32 samples that comprise the mexicanus species group (detennined fiom the larger data set in Fig. 12), and using P. ochraventer as the nearest outgroup. A total of 675 phylogenetically informative sites were used to construct a 6: 1 weighted parsimony tree resulting in 6 most parsimonious trees with Iength = 4442, CI = 0.488, and RI = 0.634 (Fig. 13). The same analysis was performed on the P. mexicanus 'core' group by condensing the data set to the 2 1 samples that comprise the 'cor& group, with P. rnexicanus sampIe 2 fiom EL Petén,
Guatemala as the nearest outgroup. A total of 41 9 phylogenetically informative characters resulted in 2 most parsimonious trees with length = 2070, CI = 0.605, and RI =
0.646 (Fig. 14).
Despite the large nurnber of taxa involved in the analysis, maximum Likelihood tree reconstructions were attempted in PAUP*. To reduce cornputhg time, a parsimony tree was given as a starting tree in the ML analysis, and al1 parameters Grom Figure 12. Maximum parsimony tree using a weighting scheme of 6: 1 for transversions and transitions for 20 species of the subgenus Peromyscus with Reithrodonfomys,
Onychomys, and Baiomys as outgroups. This tree represents the second topology found out of 6 rnost parsimonious trees. Based on the Kishino and Hasegawa (1989) test this tree was statisticaily the best and was used as the working hypothesis in subsequent cornparisons of the composition, and phy logenetic relationships within the P. mexicanus species group. Numbers on the inside of nodes are bootstrap values, numbers to the outside in italics and bold face are decay indices. mexS mex6 mex 1 mex7 gran 1 wtl guaQ gran2 mex9 nud2 mexl O nud4
- - hl Io0 fbr2
O, 5, 56 melal
t -E th01 >13 53 aztl + lev 1 leu l 56 9 +!eu2 & ochl 6 bai01 4 € onycï reith 1 Figure 13. Strict consensus parsïmony tree for 11 species comprising the monophyletic portion of the P. mexicunur species group, using a weighting scheme of 6: 1 for traflsversions and transitions, and with P. ochraventer as the outgroup. Numbers on the inside nodes represent bootstrap values, numbers to the outside of a node represent decay indices mex5 mex6
8s mex 1
7 mex7
'13 1.*m md 4 nud.2 61 2131tw mexlO 65 nud4
zar 1 51 zar2 mex3 mex4 90 2 76 a '13 L* gyml mex8 >13 , nud 1 nud3 '1 '1 56 mex2 me1 1 I2 62 me12 yuc2
- 100 yuc3 63 9 67 YUC 1 a meg 1 l I stirl O stir2 may 1 may2 och 1 MODELTEST were imput so that no estimations were required. The analysis was
tenninated after 6273 8 rearrangements (Fig. 15). Quartet puzziïng on the other hand,
performs an approxirnate and much quicker estimation of the maximum likelihood tree
which was computationally more feasible, and gave confidence support values. The
quartet puzzling analysis was perfonned on a condensed data set that inciuded the same
32 sarnples presented in Fig. 13 of the parsimony analysis. The resulting tree gave a bootstrap value of 99% for the P. mexicanus species group and 100% for the 'core' group.
Conformance to previous systemutic hpothesis
The optimal hypothetical tree topology was the parsimony tree number 2, with a weighting scheme of 6: 1 (Table 1 1). This was chosen as the nul1 hypothesis fiom which to compare trees constraïned to confom to relationships proposed in modem classifications of the P. mexicanus species group (Hooper and Musser 1964 as modified by Huckaby I 980; Carleton 1989), (Table 12)- Additional hypotheses were tested, which represent modifications of refationships proposed by these authors as follows: 1) P. ochravenrer deleted from Hooper and Musser's (1964) general concept of the P. mexicanus species group; 2) P. fürvus deleted fiom Hooper Musser's (1964) general concept of the P. rnexicanus group; 3) P. firrvus and P. ochraventer deleted fiom
Carleton's (1989) more restricted concept of the mexicanus group. The last modification was not performed on Hooper and Musser (1964) classification (as modified by Huckaby
1980) because their hypothesis with P. ochraventer and P. fintus removed, was identical Figure 14. Strict consensus parsimony tree including the 5 species comprising the phylogenetic core of the P. mexicanus group, using a weighting scheme of 6: 1 for transversions and transitions. This tree uses P. mexicanza sample 2 as the outgroup.
Numbers represent bootstrap values, letters A, B, C,and D represent monophyletic subsets of samples that include the species P. mexicanrrs.
Figure 15. Maximum likelihood tree for 20 species of the subgenus Peromyscus ushg
Reithrodontomys, Onychomys, and Baiomys as outgroups. This tree was based on the TN
+ I + r mode1 of nuclcotide substitution using the parsimony tree in Figure 11 as the beginning topology . meg 1 , stirl stir2 may 1 may2 lev 1 hl fur2 lop 1 lep 1 melal th0 1 aztl leu1 leu2 ochl reithl rnyc 1 baîol to the null hypothesis. All constrained trees were significantly different fkom the null hypothesis and were rejected (Table 12). DISCUSSION
Composition of the Peromyscus mexicanus species group
Regardless of the methods employed, neighbour joining, maximum parsimony,
and maximum likelihood trees essentiaiiy found the same assemblage of the P. mexicanus species group. A monophyletic group including P. mexicanus, P. guutemalemis, P. grandis, P. nudipes, P. zarmchus, PP.gyrnnotis. P. melanocarpus, P. yucatanicus, P. megalops, P. stirroni, and P. mayensis was found in ail analyses, although support for monophyly often was not strong. Although consistently placed within a group including P. rnexicanus, P. stirtoni, P. mayensis, and P. megalops appear as poorly resolveci basal branches and support for the exact placement of these nodes relative to one another was relatively weak in the mexicanus group. Bootstrap values supporting their inclusion typically were less than SO%, except for the parsimony analysis where bootstrap values were higher and monophyly of the group including P. stirtoni, P. rnegalops, P. mayensis, and P. yucatanicus was bolstered by a relatively high decay index of 12.
Composition of the P. mexicanus species group was consistent among ail analyses
(e-g. Fig. 1 1) and differs fkom previous hypotheses regarding the systematics of the group. The optimal tree (Fig. 1 1) was most consistent with Hooper's (1968) classification with the exception of his inclusion of P. ochraventer and P. firm in the P. mexicanus group. Bases on al1 analyses of the mtDNA sequence data neither P. ochraventer nor P. fùm are sister to, or are included within a monophyletic P. mexicanus species group. Perornysm ochravenfer appears basal to the P. leucopus group, and P. fum appears as a sister to P. lepturus and P. lophtrrur (members of the genus Habromys, following Carleton 1980;1989) in ail tree reconstructions. Also, any topology used in the K-H test (Table 11) that iocluded P. ochrmenter or P. fim in the mexicanus group signincantly increase the tree length and were therefore rejected. in the most current systematic review of Peromyscus, Carleton (1 989) removed P. firmand P. ochraventer from the mexicanus group (as defined by Hooper 1968) and placed thern in thefims group dong with P. mayensis. None of the analyses of mitochondrial genes 1 conducted suggest that P. furvu.s1 P. ochraventer or P. mayensis or any combination of the three form a monophyletic group. Thus, Carleton's (1989)fim group appears to be po lyphy letic. Carleton (1 989) also reinstated and redefined Osgood's (1909) megalops group to include P. megalops, P. melanocarpus, and P. melanurus. Peromyscus melanurus was not included in my study, but P. megalops and P. melanocarpus did not form a monophyletic group in any tree reconstructions. Therefore, as noted previously for allozymes by Rogers and Engstrorn (1992), this group appears to be an artificial construct.
Phylogenetic relafionships among members of the P. mexicanus group
The results of my study indicate that P. rnexicanus. P. guatemalensis, P. grandis,
P. nudipes, P. zarhynchus, P. gymnofis, P. melanocarpus. P. yucuranieus, P. megalops,
P. stirtoni, and P. mayensis form a monophyletic group, and are herein delimited in a redefined P. mexicanus species group (probably also including P. rnelanwvs which was not examined in this study). To examine relationships among species within this redefined group, I condensed the data set to include those 32 samples within the apparently monophyletic P. mexicanus species group rooted using P. ochraventer as a fùnctionai outgroup (Watrous and Wheeler 1981). The consensus tree (fiorn six most parsimonious trees) resulting fiom a parsimony analysis with a weighting system of 6: 1 transversions:transitions (Fig. 12) was identical to that fiom the full, weighted parsimony analysis (Fig. 1 1) including al1 45 taxa; bootstrap support and decay indices for nodes were comparable. The ingroup was not unequivocally monophyletic relative to P. ochraventer, with P. rnuyemis appearhg as an unresolved basal node together with the outgroup. This suggests that P. mayensis might not be included in the f - rnexicanus species group. Again, there was weak bootstrap support for the nodes denning exact placement of P. melanocarpus, P. rnegalops, P. stirfoni and P. yucatanim within the P. mexicanus group.
Speciation within the 'core ' mexicanus group
Regardless of the method of tree reconstruction the P. rnexicanus 'core' group always embodied the same samples namely P. mexicanus. P. grandis. P. guatemaIemis,
P. nudipes. P. rarhynchus, and P. gymnotis. with strong bootstrap support of 99% fiom parsimony (with a decay index greater than 12), and 100% from quartet p~zzlhg.
P. rnexicanus inhabits the largest geographic range of al1 mernben of the rnexicanus species group beginning in the tropical lowlands as far north as San Luis
Potosi, and as far south as the moderate to high elevations of Costa Rica and extreme western Panama (Huckaby 1980). Contrary to what one might expect fiom a single, interbreeding array of populations, this species appears to be paraphyletic. For example,
(mex5, mex6) mexl) mex7) appears more closely allied with (guat 1, gran1)guatS) than they are to the rernaîning members of their own species (Fig- 13)- There were four main
groupings within P. mexicanus (Fig. 13). Group A (Fig. 13) mentioned above, consists
of two samples of Guatemaian P. mexicanus (mex5 and mex7) and two of P. mexicanus
from El Salvador (mexl and mex6) (Fig. 14), which in tuni are sister to a group including
P. guatemalensis and P. grandis (guatl, guat2, and granl) with bootstrap support of 87% and decay index of 8 (Fig. 14). The second group B involves P. mexicanus samples fiom
Honduras, which form a monophyIetic group with the P. nudipes from Costa Rica, at bootstnp values of 100% (Fig. 14, Fig. 16). Group C consists of the two P. mexicanus samples fiom Chiapas, Mexico, one P. mexicanus from Veracruz, Mexico, and P. gymnotis from Chiapas, with bootstrap support of 91% (Fig, 14, Fig. 16). This monophyletic assemblage supports the argument that P. gymnotis and some samples of P- mexicanus are conspecific (Rogers and Engstrom 1992, Van Coeverden de Groot 1995).
The last group D includes the P. mexicanus sample kom El Petén, Guatemala, that always appears basai to the remaining members of the mexicanus 'core' group and is clearly not conspecific with the P. mexicunus in any sense. Clades A and C (Fig. 13) constitute the eastem mexicanus group and Clade D the western mexicanus group (Fig.
15) as previously defined by Van Coeverden de Groot (1995).
Peromyscus guatemalensis, P. zarhynchus, and P. grandis comprise a group of allopatric montane species in Central America (Carleton 1989). Al1 three occur in disjunct montane habitats, wherein P. guafemalensis occurs in intermediate to high elevation mesic forests of southem Chiapas, and west-central Guatemala Peromyscus zarhynchus occurs in high elevation cloud forest of central and northern Chiapas, and P. grandis is found at intermediate elevation mesic forests in east-central Guatemala Figure 16. Map of Mexico, Guatemala, El Salvador, Honduras, Costa Rica, and Panama outiining the locations of samples used to represent the 5 species of the P. mexicanus
'core' group. Solid shading represents populations of the western mexicanus group and striped lines represent the eastem mexicanus samples (as defhed by Van Coeverden de
Groot 1995). For definîtion of species name and locality, see Appendix A and B.
(Carleton 1989). Huckaby fomulated three hypotheses on the ongin of these three taxa.
First, he suggested that aii three species (guatemahis. zarhynchur. grandis) were
derived fiom a single widely disaibuted ancestor. Second, that al1 three groups arose
independently of one another by separate invasions of one or more lowland forms, and
much of their morphological similarities were convergence ((guatemalensis. mexicanus),
(grania's, mexicanus), (zarhynchus, mexicanus). And third, that P. guatemalensis arose
independently fiom P. grandis and P. z~~~hynchus,and now occupies the area once
inhabited by ancestral populations that intergraded between the present P. zarhynchus
and P. grandis ((grandis. zarhynchus) guatemalensis). Based on the first hypothesis,
Huckaby (1 973) arranged the three highland taxa (P. zarhynchus, guatemalensis, and grandis) as allopatric subspecies of P. zurhynchus. Later, however, he suggested that
morphologically P. zarhynchus was more closely allied with P. grandis thm either was to
P. guatemolensis (hypothesis 3). The sequence data suggest that P. grandis fiom Baja
Verapaz, Guatemala, is more closely related to P. guatemalensis and Guatemalan P.
mexicanus (eastem mexicanus assemblage), than any of these samples are to the
remaining taxa in the mexicanus group. Contrary to the expectation for conspecific
populations, the two samples of P. grandis did not form a monophyletic group (Fig. 14).
Instead, the granl individuai f?om Baja Verapaz, Guatemala, appeared ta be more closely related to the P. guatemalansis Mce (guatl and guat2), then it was to the gran2 sample
found adjacent to it fiom Zacapa, Guatemala. Peromysncr rarchynchus consistently appears as an outlier to a group including these taxa and clade of P. mexicanus and P. nudipes (in part). Thus based on my data there is linle evidence supporthg any of
Huckaby's three alternatives. Van Coeverden de Groot (1 995) also found that samples of P. grandis did not form a monophyletic group. He suggested that some of these P.
grandis populations might have hybridized with a member of the P. guatemalemis-
eastem rnexicanus lineage. Accordingly, hybridization introduced a divergent haplotype
in to the P. grandis population fiom Baja Verapaz (granl). Subsequent drifi may then
have resulted in the mixture of divergent haplotypes in this population explainhg its high
Ievel of variability and enigmatic phylogenetic fity.
Huckaby (1980), viewed populations of P. nudipes as the southemmost extension
of P. mexicanus based on morphometric similarity. Despite the large geographic distance
that separates my samples of P. mexicanus £Ïom those of P. nudipes (Fig. 14), nud2 and
nud4 are more closeiy related to P. mexicanus fiom Honduras than they are to the two
remaining P. nudipes fiom Chiriqui, Panam& and Cartago, Costa Rica These latter two
P. nudipes samples are basal to the remainder of the 'core' rnexicanus group and indeed
could not be resolved as members of the ingroup relative to P. mexicanus sample 2 (used
as a functionai outgroup to the remainder of the 'corel group). Regardless of their exact
position, they are phylogenetically distinct from the Honduras P. mexicanus-P. nudipes
complex. A possible explanation for this relationship could be that these two groups of
P. nudipes arose fiom separate invasions by different ancestral P. mexicanus group
populations. The Honduras P. mexicanus-P. nudipes complex are more close1y allied
with the eastem P. mexicanus group (Fig 16). The second P. nudipes clade (nudl, 3) is
basal to the remainder of the 'core' P. rnexicanus group (Fig. 16).
P. gymnotis inhabits the foothills and adjacent coastai plain of southem Chiapas.
Limits to its range are determined by the presence of P. mexicanus to the north and south of it on the coastai plain and by the presence of P. guatemalensis in the mountaïns above it. Peromyscus gymnotis is distinguished fiom these species based on size and colour
(Huckaby 1980). Perornyscus gymnotis fiom Chiapas, Mexico (gym 1) is phylogenetically closely allied with the two P. mexicanus samples fiom Chiapas (mex.3 and mex4) and the P. rnexicanus fiom Veracruz, Mexico (mex8, Fig. 14). This geographic pattern of similarity has been noted by severai authors (Musser 1971,
Huckaby 1980, Rogers and Engstrom 1992, and Van Coeverden de Groot 2995).
Huckaby (2973) maintained P. gymnotis and P. mexic411us as distinct species based on near sympatry of representative populations fiom Volcan Agua, in south-central
Guatemala. However, this was a case of sympatry between the eastern and western rnexicanus Iineages (Van Coeverden de Groot 1995), which are likely not conspecific.
Phylogenetic evidence suggests that P. gyrnnotis and members of the western P. mexicanus lineage are conspecific (Fig. 14).
Based on the phylogenetic evidence suggesting that P. mexicanus is paraphyletic and a novel pattern of relationships arnong the remaining members of the 'core' rnexicunus group, the taxonomy of the 'core' mexicanus group should be revised. Within the 'core' group, one clade consists of P. mexicanrts (group A, Fig. 14) fiom Guatemala and El Saivador which together with its sister clade containing P. grandis and P. guatemalensis could be synonymized under one name (P. guatemcrlensis). A second monophyletic group includes P. mexicanus samples fiom Honduras and P. nudipes
(group B, Fig. 14) which also appears to be conspecific (P. nicaraguae is the oldest available name). Peromyscus zarhynchus is an outlier to the first two groups.
Peromyscus mexicanus (fiom Chiapas and Veracruz) and P. gvmnotis (group C, Fig. 14) are obviously conspecific and should be synonymized under the name P. mexicanus. Perornyscus nudipes samples 1 and 3 form a separate monophyletic group and include the
type locality of P. nudipes remain as P. nudipes. Peromyscus rnexicanus nom El Petén is
the most distant outlier of the 'core' group and may correspond to the taxon P. fropicalis.
Resuits of the phylogenetic anaiysis of mtDNA sequence data of the cytochrome
b, ND3, NDBL, and ND4 genes most closely approximate Hooper and Musser's (1964)
concept of the species group. The P. mexicanus species group consists of: P. mexicanus,
P. guatemalensis, P. grandis, P. nudipes, P. gymnotir. P. stirtoni, P. yucafanicus. P.
mrhynchzrs, P. megalops, P. melrinocarpus, and P. mayemis, although support for
monophyly of the group as a whole was low. Perornyscusfu~~usand P. ochi-uventer
which were included in the P. mexicanus group by Hooper and Musser (1 964), but
removed by Carleton (1989), are not rnembers of this monophyletic clade. The mtDNA
data were insufficient to resolve the exact relationships among the more distant species
relative to the 'core' mexicanus group, namely: P. stirtoni, P. yucatanicus, P. rnegalops,
P. mayensis, and P. mefanocarpus. Reexamination of the relationships among these
species using a more phylogenetically informative gene, such as control region, or even a
nuclear gene, may resolve their positions. Peromysm rnem'canus is not monophyletic,
and is segregated into three phylogenetically distinct groups: 1) within the western
lineage; 2) with the eastem mexicanus lineage (including P. guatemaiensis and P. grandis); and 3) divergent samples of P. mexicanus fiom El Petén, Guatemala These
taxa clearIy are not conspecific. Peromyscus nudipes is polyphyletic, perhaps as a result of separate invasions fiom two different P. mexiçanus populations. The phy logenetic relationships between the highland taxa including P. zaryhnchus, P. guaternalensis, and
P. grandis do not confom to any of Huckaby's (1980) three hypotheses. Finally P. mexicanus was divided into four different species, as opposed to the current classincation of the group under one taxonomie name. Adachi. J., and M. Hasegawa 1995. Phylogeny of whaies: Dependence of the inference on species sampling, Mol. Biol. Evol, 12(1): 177-1 79. Bielawski, J. P. and J. R. Gold. 1996. Unequal synonymous substitution rates within and
between two protein-coding mitochondrial genes- Mol. Biol. Evol., 13(6):889-892. Brownell, E. 1983. DNA/DNA hybridization studies of Muroid rodents: Symmetry and rates of molecular evolution. Evolution, 37(5): 1034- 1051. Carleton, M. 1980. Phylogenetic relationships in Neotornine-Peromyscine rodents (Muroidea) and a reappraisal of the dichotomy within New WorId Cricetinae. Misc. Publ. Mus. 2001. Univ. Mich., 157:l-146. Carleton, M* 1989. Systematics and Evolution. pp.7- 141, in Advances in the study of
Peromyscus (Rodentia) (G. L. Kirkland, Jr. and J. N. Layne, eds). Texas Tech University Press, Lubbock, 366pp. Cao, Y., J. Adachi, A. Janke, S. Paabo, and M. Hasegawa. 1994. Phylogenetic reiationships among Eutherian orders estimated from inferred sequences of mitochondrial proteins: instability of a tree based on a single gene. J. Mol. Evol., 395 19-527. Catzeflis, F. M., F. H. Sheldon, J. E. Ahlquist, and C. G. Sibley. 1987. DNA-DNA hybridization evidence of the rapid rate of Muroid rodent DNA evolution- Mol. Biol. Evol., 4(3):242-253. Cummings, M. P., S. P. Otto, and J. Wakeley. 1995. Sampling properties of DNA sequence data in phylogenetic analysis. Mol. Biol. Evol., I2(5):814-822. DeBry, R. W., and L. G. Abele. 1995. The reiationship between parsimony and maximum-likelihood analyses: tree scores and confidence estimates for three real data sets. Mol. Biol. Evol., l2(2):29 1-297. Easteal, S. 1990. The pattern of mammalian evolution and the relative rate of molecular evolution, Genetics, 124: 165- 173. Engel, S., K. Hogan, J. Taylor, and S. Davis. 1998. Molecular Systematics and Paleobiogeography of the South American Sigmodontine rodents. Mol. Biol. Evol., 15(1):35-49. Eposti, M. D., S. De Vriew, M. Crimi, A. Ghelli, T. Patarneilo, and A. Meyer. 1993. Mitochondrial cytochrome 6: evolution and structure of the protein. Biochemica
et Biophysica Acta., I I43:243-271.
Farris, J. S. 1969. A successive approximations approach to character weighting. Syst. Zool., l8:374-385. Felsenstein, J. 1978. Cases in which parsimony or compatibility methods will be
positively misleading. Syst. Zool., 27:4O 1-410. Felsenstein, J. 198 1. Evolutionary Trees fiom DNA Sequences: A Maximum Likelihood Approach. J. Mol. Evol., 17:369-376. Felsenstein, J. 1985. Confidence Limits On Phylogenies: An Approach Using The Bootstrap. Evolution, 9(4):783-79 1. Felsenstein, J., and G. A. Churchill. 1996. A hidden markov mode1 approach to variation arnong sites in rate of evolution. Mol. Biol. Evol., 13(1):93-104. Gillespie, J. H. 1986. Variability of evolutionary rates of DNA. Genetics, 113:1077-1091. Goodwin, G. G. 1932. Three new Reirhrodontomys and two new Pemmyscw fiom Guatemala, American Museum Novitates, 560: 1-5- Goodwin, G.G. 1938. Four new manimals fiom Costa Rica American Museum Novitates, 987: 1-5. Goodwin, G. G. 1964. A new species and a new subspecies of Pemmyscus fkom Oaxaca,
Mexico. American Museum Novitates, 2 183 : 1-8. Greenbaum, 1. F., S. J. Gunn, S. A. Smith, B. F. McAilister, D. W. Hale, R J- Baker, M- D. Engstrom, M. J- Hamilton, W. S, Modi, L. W. Robbins, D. S. Rodgers, O. G. Ward, W. D. Dawson, F. F. B. EIder, M. R Lee, S. Pathak, and F. B. Stangl Jr. 1994. Cytogenetic nomenclature of deer mice, Peramys~~~(Rodentia): revision and review of the standardized karyotype. Cytogenet. Ceii Genet., 66: 181 - 195. Grîffiths, S. C. 1997. Correlation of hctional domains and rates of nucleotide substitution in cytochrome b. MoiecuIar Phyiogenetics and Evolution, 7(3):352-365. Gu, X., Fu Y., and W. Li. 1995. Maximum likelihood estimation of the heterogeneity of substitution rate among nucleotide sites. Mol. Biol. Evol., 12(4):546-557. Harris, D., and D. S. Rogers. 1999. Species Iimits and phylogenetic relationships among populations of Peromyscusfirvt(s. J. of Mamrn., 80(2):530-544. Hills, D. M., J. P. Huelsenbeck, and C. W. Cunningham, 1994. Application and accuracy of molecdar phylogenies. Science, 264:67 1-76 Hills, D. M., and J. P. Huelsenbeck. 1994. Assessing molecular phylogenies. Science, 267:253-56. Hogan, K. M., S. K. Davis, and 1. F. Greenbaum. 1997. Mitochondrial DNA analysis of
the systematic relationships within the Peromyscus maniculutus species group. J. of Marnm.. 78(3):733-743. Hooper, E. T. 1958. The male phallus in mice of the genus Peromyscur. Misc. Publ. Mus. 2001. Univ. Mich., 1021-24.
Hooper, E. T. 1968. Classification Pp. 27-74, in Biology of Peromyscus (Rodentia) (J.A. King, ed.). Spec. Publ. Amer. Soc. Mammal., No. 2, xiii + 593 pp. Hooper, E. T., and G. G. Musser. 1964. Notes on the classification of the rodent genus Peromyscus. Occasional Papers of the Museum of Zoology, University of Michigan, 635:l-13. Howell, N. and K. Gilbert. 1988. Mutational analysis of the mouse mitochondrial cytochrome b gene. J. Mol. Biol., 203:607-618. Howell, N. 1 989. Evol utionary conservation of protein regions in the protonmotive cytochrome b and their possible roles in redox catalysis. J. Moi. Evol., 29: 157-169, Huckaby, D. 1980. Species Limits in The Peromyscus Mexicanm Group. Contrib, Sci. Natur. Hist. Mus. Los Angeles County, 326: 1-24. HueIsenbeck, J. P. 1995. Performance of phylogenetic methods in simulation. Syst. Bi01 M(l): 17-48.
Irwin, D. M., T. D. Kocher, and A. C. Wilson. 1991. Evolution of the cytochrome b gene of mammais. J. Mol. Evol., 32: 128-144, Jermilin, L. S., D. Graur, R. M. Lowe, and R. H. Crozier. 1994. Analysis of directional mutation pressure and nucleotide content in mitochondriai cytochrome b genes. J. Mol Evol., 39:160-173. Kishino, H. and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of the evolutionary treed topologies fiom DNA sequence data, and branching order in Hominoidea. J. Mol. Evol., 29: 170-179, Kuhner, M. K. and J. Felsenstein. 1994. A Simulation cornparison of phylogeny algonthms under equal and unequal evolutionary rates. Mol. Biol. Evol., 11 (3):459-468. Kuma, K. and T. Miyata. 1994. Mammalian phylogeney inferred fiom multiple protein data. Jpn. J. Genet., 69555-566. Kumar, S. 1996. Patterns of nucleotide substitution in mitochondrial protein coding genes of vertebrates. Genetics, 143 :537-548. Lawlor, T. E. 1965. The Yucatan deer mouse, Peromyscus yucatanicus. University of Kansas Publications, Museum of Natural History, l6(4):42 1-438. Lehninger, A. L., D.L. Nelson, and M. M. Cox. 993. Principles of Biochemistry. Second edition. Worth publishers, New York. Li, W- 1993. Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J, Mol. Evol., 36:96-99. Li, W. 1 997. Molecular Evolution. Sinauer Associates, Inc., Massachusetts.Ch. 1 & ChS. Lopez, J. V., M. Culver, J. C. Stephens, W. E. Johnson, and S. J. O'Brien. 1997. Rates of nuclear and cytoplasmic mitochondrial DNA sequence divergence in mammals. Mol, Biol, Evol., 14(3):277-286. Ma, D., A. Zharkikh, D. Graur, J. L. VandeBerg, and E. Li. 1993. Structure and evolution of opossum, guinea pig, and porcupine cytochrome b genes. J. Mol. Evol., 36:327-334, Maddison, D.R. 199 1. The discovery and importance of multiple islands of most-parsimUnious trees. Syst. Zool., 40:3 15-328. Mindell, D. P. and C. E. Thacker. 1996. Rates of rnoIecular evolution. Annu. Rev. Ecol. Eyet., 27:279-303. Morales, J. C., and M. D. Engstrom. 1989. Morphological variation in the painted spiny pocket mouse, Liomys pictus (Family Heteromyidae), fiom Colima and Southem Jalisco, Mexico. Life Sciences Occasional Paper, 3 8: 1 - 1 6. Muse S. V., 1996. Estimating synonymous and nonsynonoymous substitution rates. Mol. Biol. Evol., 13(1):105-114. Muse S. V., and B. S. Gaut, 1994. A likelihood approach for cornparhg synonymous and nonsynonymous nucleotide substitution rates, with application to the chioroplast genome. Mol. Biol. Evol., 1 l(5):713-724. Musser, G. G. 1969. Notes on Perornyscus (Muridae) of Mexico and Central America American Museum Noviatates, 23 57: 1-23. Musser, G. G. 1964. Notes on geographic distribution, habitat, and taxonomy of some Mexican marnmds. Occasional papers of the museum of zoology, University of Michigan, 636: 1-21. Musser, G. G. 1971. Peromyscus aZIophyZus Osgood: a synonym of Peromysucs gymnotis Thomas (Rodentia, Muridae). Amencan Museum Novitaies, 2453 :1 - 10 Nachman, M. W., S. N. Boyer, and C. F. Aquadro. 1994. Nonneutrai evolution at the mitochondrial NADH debydrogenase subunit 3 gene in mice. Proc. Natl. Acad, Sci., 91 :6364-6368. Naylor, G., and F. Kraus. 1995. The relationship between s and m and the retention index- Syst, Biol., 44(4):559-562. Naylor, G. and W. M. Brown. 1997. Structural biology and phylogenetic estimation. Nature, 388527-28. Nei, M.. 1996. Phylogenetic analysis in molecuiar evolutionary genetics. AMU.Rev. Genet., 30:371-403. Osgood, W. H. 1904. Thirty new mice of the genus Peromyscus fiom Mexico and Guatemala Proceedings of the Biological Society of Washington, XVIM 5-77. Osgood, W. H. 1909. Revision of the mice of the Arnerican genus Peromyscus. N. Amer, Fauna,, 28:l-285. Peppers, J. A., O. G. James, R. D. Bradley. 1999- The karyotype of Peromyscus stirtoni (Rodentia: Muridae). The Southwestern Naturalist, 44(1): 109- 12. Posada, D., and K. A. Crandall. 1998. MODELTEST: testing the mode1 of DNA substitution. Bioinfonnatics, l4(9):8 17-8 18. Reeves, J.H. 1992. Heterogeneity in substitution process of amino acid sites of proteins coded for by mitochondrïai DNA. J. Mol. Evol., 35: 17-3 1. Robbins, L. W., M .P.Moulton, and R. J. Baker. 1983. Extent of geographic range and magnitude of chrornosomal evolution. J. Biogeography, lO:S33-54 1. Rogers, D., and M. Engstrom. 1992. Evolutionary implications of allozymic variation in tropical Peromyscus of the mexicanus species group. J. of Mamm., 73(1):55-69. Rogers, D., 1. Greenbaum, S. Gunn, and M. Engstrom. 1984. Cytosystematic value of chromosomal inversions data in the genus Peromyscus (Rodentia: Cricetidae). J. Mamm., 65(3):457-465.
Russo, C. A. 1997. Efficiencies of different statictical tests in supporting a known vertebrate phylogeny. Mol. Biol. Evol., M(l O):lO7l-l080. Russo, C. A., N. Takezaki, and M. Nei. 1996. Efficiencies of different genes and different tree-building methods in recovering a known vertebrate phylogeny. Mol, Biol- Evol., 13(3):SZ-S36. Rzhetsky, A., and M. Nei. 1994. Unbiased estimates of the number of nucleotide substitutions when substitution rate varies arnong different sites. J. Mol. Evol., 3 8:295-299. Sarnbrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York. Sanderson, M. J. 1995. Objections to bootstrapping phylogenies: A critique. Syst. Biol., 44(3):299-320. Saitou, N., and M. Nei. 1987. The neighbor-joining method: A new method for reconstnicting phylogenetic trees. Mol. Biol. Evol., 4(4):406-425. Smith, S. A., R. D. Bradley, and 1. F. Greenbaum. 1986. Karyotypic conservatisrn in the Peromyscus rnexicanur grou p. J. Mamm., 67(3):584-586. Stangl, F. B. Jr., and R J. Baker. 1984. Evolutionary relationships in Peromyscus:
Congruence in chromosomal, genic, and classical data sets. J. mamm., 65(4):643-654. Strirnmer, K., and A. Van Haseler. 1996. Quartet Puzzling: -AQuartet Maximum-Likelihood Method for Reconstmcting Tree Topologies. Mol. Biol. Evol., 1 3(7):964-969. Strirnrner, IC, and A. Von Haeseler. 1997. PUZZLE: Maximum Likelihood Analysis for Nucleotide; Amino Acid, and two-state data. Zoologisches Institut, Unicersitat Munchen, Munchen, Germany. Sullivan, J., J. A. Markert, and C. W. Kilpatrick. 1997. Phylogeography and molecular systematics of the Peromyscus aztecus species group (Rodentia: Mwidae) inferred using parsimony and likelihood. Syst. Biol., 46(3):426-440. Sullivan, J., K. E. Holsinger, and C. Simon. 1995. Among-site rate variation and phylogenetic analysis of 12s rRNA in Sigmodontine rodents. Mol. Biol. Evol., l2(6): 988-1001. Sullivan, J., K. E. Holsinger, and C. Simon. 1996. The effect of topology on estimates of among-site rate variation. J. Mol. Evol., 42:308-3 12. Swofford. D., 1998. PAUP*: Phylogenetic Analysis Using Parsimony. Version 4.0, beta- Sinauer Associates, Sunderland Massachusetts. Pp 1 - 173. Swofford, D., and D. P. Begle. 1993. PAUP: Phylogenetic analysis using parsimony, User's manual. Laboratory of Molecular Systematics Smithosonian Institution. Illinois, USA. Swofford, D., and G. J. Olsen. 1990. Phylogeny reconstruction. Chapter 1 1 Pages 41 1-501 in Molecular Systematics @. M. Hills and C. Moritz, ed.). Sinauer Associates, Inc, Massachusetts. Tamura. K.. and M. Nei. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol., 10(3):512-526. Tateno, Y., N. Takezaki, and M. Nei. 1994. Relative efficiencies of the maximum-likelihood, neighbor-joining, and maximum-parsimony methods when substitution rate varies with site. Mol. Biol. Evol., 11(2):261-277. Thomas, W. K., and A. T. Beckenbach. 1996. Variation in Sahonid mitochondrial DNA:Evolutionary constraints and mechanisms of substitution. J. Mol. Evol., 29:233-245. Thome, J. L., H. Kishino, and J. Felsenstein. 1992. Iching toward rdity: An improved likelihood mode1 of sequence evolution. J. Mol. Evol., 34:3-16. Tourasse, N. J., and M. Gouy. 1997. Evolutionary distances between nucleotide sequences based on the distribution of substitution rates among sites as a estimated by parsimony. Mol. Biol. Evol., 14(3):287-298. Van Coeverden de Groot, P. f 995. Phylogenetic systematics and speciation in highland deer mice of the Peromyscus mexicanus species group. Masters Thesis. Graduate Department of Zoology, University of Toronto. Watrous, L. E., and Q. D. Wheeler. 1981. The out-group cornparison method of character analysis. Syst. Zool., 30(1): 1- 1 1. Wolfe, K. H., P. M. Sharp, and W- Li. 1989. Mutation rates dBer among regions of the mammalian genome. Nature, 337:283-285. Xia X. 1998. The rate heterogeneity of nonsynonymous substitutions in mammalian mitochondnal genes. Mol. Biol. Evol., 15(3):336-344. Yang. Z. 1994. Maximum likelihood phylogenetic estimation fi-om DNA sequences with variable rates over sites: Approximate methods. J. Mol Evol., 39:306-3 14. Yang, Z. 1994. Estimating the pattern of nucleotide substitution. J. Mol. Evol., 39: 105-1 11. Yang, 2. 1996. Among-site rate variation and its impact on phylogenetic analyses. T.R.E.E., 11(9):367-372. Yang, 2. 1996. Maximum-likelihood models for combined analysis of multiple sequence data. J. Mol. Evol., 42:587-596. Yang, 2. 1996. Phylogenetic analysis using parsimony and likelihood methods. J. Mol. Evol., 42:294-307.
Y mg, Z., and S. Kumar. 1996. Approximate methods for estimating the pattern of nucleotide substitution and the variation of substitution rates among sites. Mol. Biol. Evol,, 13(5):650-659. Yang, Z., N. Goldman, and A. Friday. 1995. Maximum Iikelihood trees fiom DNA
sequences: A pecdiar statistical estimation problern. Syst. Biol., 44(3):3 84-3 99. Yang, Z., N. Goldman, and A. Friday. 1994. Cornparison of models for nucleotide
substitution used in maximum-likelihood phy logenetic estimation. Mol. Biol. Evol., 1 1(2):3 16-324. Zamudio. K. R., K. B. Jones, and R H. Ward. 1997. MoIecuIar systematics of short-horned Iizards: Biogeography and taxonomy of a widespread species
cornplex. Syst. Biol., 46(2) 284-305. Zardoya, R., and A. Meywe. 1996. Phylogenetic performance of mitochondriai protein-coding genes in resolving relationships among vertebrates. Mol. Biol. Evol., 13(7):933-942. Zimrnerman, E. G., C. W. Kilpatrick, and B. J. Hart. 1978. The genetics of speciation in the rodent genus Peromyscus. Evolution, 32(3):565-579. APPENDIX A Species, general location, identication number, and map number.
Species Location ID Number Map Number P. mexicanus Ahuachapan, EI Salvador mexl P. mexicanus El Peptén, Guatemala mex2 P. mexicanus Chiapas, Mexico mex3 P. mexicanus Chiapas, Mexico mex4 P. mexicanus Jutiapa, Gutaernala mex5 P. mexicanus Santo Ana, El Saivador mex6 P. mexicanus Sacatepequez, Guatemala mex7 P. mexicanus Veracruz, Mexico mex8 P. mexicanus Depto. De Oiancho, Honduras mex9 P. mexicanus La Union, Hundorus mexlO P. stirtoni EI Progreso, Guatemala stirl P. srirroni Jutiapa, Guatemala stk2
P. grandis Baja Verapaz, Guatemala -1 P. grandis Zacapa, Guatemala gran2 P. nudipes Chiriqui, Panama nud 1 P. nudipes Puntarenas, Costa Rica nud2 P. nudipes Cartago, Costa Rica nud3 P. nudipes Cartago, Costa Rica nud4 P. yucarunieus Campeche, Mexico yucl P. yucatanicus Yucatiin, Mexico yuc2
P. yucatanicus Tabasco, Mexico yuc3 P. zarhynchus Chiapas, Mexico zarl P. zarhynchus Chiapas, Mexico 2x2 P. guartemalensis Chiapas, Mexico guat I P. guuremalensis Huehuetenango, Guatemala APPENDIX A. Continued. Species Location ID Number Map Number P. gymnotis Chiapas, Mexico -1 26 P. megalops Guerrero, Mexico meg 1 27 P. melanocarpus Oaxaca, Mexico me1 1 28 P. melanocarpus Oaxaca, Mexico me12 29 P. mayensis Huehuetenango, Guatemala may 1 30 P. mayensis Huehuetenango, Guatemala may2 31 P. furvus Veracruz, Mexico fiul 32 P. furvtts Veracruz, Mexico fur2 33 P. ochraventer San Luis Potusi, Mexico ochl 34 P. uztecus Santa Ana, El Sdvador aztl 35 P. leucopus Ontario, Canada leu l 36 (not shown) P. leucopus Cozumel Island, Mexico leu2 37 P. levipes Huehuetenango, Guatemala lev 1 38 P. melanofis Distrito Federal, Mexico rnelal 39 P. lophurus Huehuetenango, Guatemala lop 1 40 P. lepturus Oaxaca, Mexico lep 1 41 P. thornasi Oaxaza, Mexico th0 1 42 R. mexican us Baja Verapw Guatemala reith I 43 R. spectabillis Cozumel Island, Mexico reith 1 44 B. musculus Colirna, Mexico baio 1 45 O. leucogaster New Mexico, USA onyc 1 46 (not shown) O. le ucozaster Texas. USA onyc2 47 (not shown) Appendix B
The following is a Iist of specimens examined. Specimens are arranged by species narne. List includes phylogenetic tree abbreviation, country, province, locality description. Museum acronym and cataiog number, or field number are in paraentheses.
Peromysctls mexicanus
MEX1.-EL SALVADOR: Ahuachapan; San Fransico Menendez, El impossible (35448
ROM). MEX2.-GUATEMALA: El Petén, 1.5 km S of Poptun, 1 km W of Poptun,
(3 1778 ROM). MEX3.-MEXICO: Chiapas; 6.6 km S of Palenque by road, (36 ASK).
MEX4.-MEXICO: Chiapas; 12 km N of Berriozabal by road, (635 ASK). MEX5.-
GUATEMALA: Jutiapa; 0-5 km SW of Santa Catarina Mita, (3 1240 ROM). MEX6.-
EL SALVADOR: Santa Ana; Parque Nacionai Montecristo, Bosque Nebuloso, (35546
ROM). MEX7.-GUATEMALA: Sacatepequez,; 5 km W of San Miguel Duenas, (3 1263
ROM). MEX8.-MEXICO: Veracniz; 1.5 kmSE of Xico, (199 YHM). MEX-
HONDURAS: Depto. De Olancho, Parque Nacional La Tigra, (1 1623 BUNAM).
MEX10.-HONDURAS: La Union, La Muraila, (1 1755 IBUNAM).
Peromyscus stirtoni
STIR1.-GUATEMALA: El Progreso; 5 km E of San Cristobal Acasaguascatlan,
(34 134 ROM). STIR2-GUATEMALA: Jutiapa; 0.5 km S W of Santa Catarina Mita,
(31238 ROM). Peromyscus grandis
GRAN 1-GUATEMALA: Baja Verapaz; 5 km E of Pu.(3 1503 ROM). GRAN%.-
GUATEMALA: Zacapa; 2 km N of San Lorenzo, Sirra De Las Minas, (34222 ROM).
Peromysctrs nudipes
NUDI- PANAMA: Chiriqui; 2 km N of Santa Clara, (38 1 85 ROM). NUD2.-COSTA
RICA: Punaenas; Monteverde, (3796 RMT). NUD3-COSTA RICA: Cartago; 12 km
N of Portero Cerrado by road (100 FAR). NUD4-COSTA RICA: Cartago; 4 km SE of
Turriaiba by road, (1 1 5 FAR),
Peromyscus yucatanicus
WC1.-MEXICO: Cornpeche; 27.5 km S of Constitution, 27.5 km S of Escarcega,
70km E of Escarcega, (2641 ASK). YUC2-MEXICO: Yucatiin; Chichen Itza, (428
ASK). YUC3-MEXICO: Tabasco; 2 1 km SE of Tenosique, (1 73 ASK).
Perornyscus zarhynchus
ZARI.-MEXICO: Chiapas; 9 km SE of Rayon by road, (609 ASK). ZAR2-MEXICO:
Chiapas; 5 km W of San Cristobal De Las Casa, (1700 LAF).
Perornysm guatemaZensis
GUAT1.-GUATEMALA: Hueheutenango; 10 km NW of Santa Eulalia by road, (3 1277
ROM). GUAT2.-MEXICO: Chiapas; El Trido, (1754 LM).
Peromyscus gymnoris
GYMl .-MEXICO: Chiapas; 6.5 km NW ofEscuintla, (33 129 ROM). Peromyscus megalops
MEC 1.-MEXICO: Guerrero; omilteme, (1 621 LM).
Peromyscus melanocarpus
MEL1.--MEXICO: Oaxaca; 11 km SW of La Epoeranza, Camino Lodoso, San Isodro,
(773 IMV). MEL2-MEXICO: Oaxaca; 3 km E of Santa Maria Yachochi, (1 1 12 JMV).
Peromyscrrs mayensis
MAY 1.-GUATEMALA: Huehuetenango;l6 km NW of Santa Eulalia by road, (3 1328
ROM). MAY2-GUATEMALA: Huehuetenango;l6 km NW of Santa Eulalia by road,
(3 1329 ROM).
Peromysw fimus
FUR1.-MEXICO: Veracw; 6 km NW of Jaiapa, (243 YHM). Fm-MEXICO:
Veracruz; 6 km NW of Jalapa, (244 YHM).
Peromyscus ochraventer
OCH1.-MEXICO: San Luis Potusi; Santa Isabel, (N/A).
Peromyscus &eau
AZT1.-EL SALVADOR: Santa Ana; Bosque Nebuloso, (35553 ROM).
Peromyscus leucopus
LEU1.-CANADA: Ontario; Scarborough, (NA). LEU2.-MEXICO: Quintana Roo;
20.3 km SE of San Miguel by road, Ida Conimel, (547 ASK).
Peromyscus levipes
LEVI.-GUATEMALA: Hueheutenango; 10 km NW of Santa Eulaiia by road, (3 1282
ROM). Perornysctrs melanotis
MELAI.-MEXICO: Distrito Federai; 3 km S of Parres, (723 ASK).
Peromyscus lophurzrs
LOP1.-GUATEMALA: Huehuetenango; 12 km NW of Santa Eulaiia by road, (3 133 1
ROM).
Peromyscus lepturus
LEP1.-MEXICO: Oaxaca; 4 km E of Santa Maria Yachochi, (1099 JMV)
Peromyscus thornasi
THO1.-MEXICO: Oaxaca; 1 1 km SW of La Epoeranza, Camino Lodoso, San Isodro,
(778 JMV).
Reithrodontomys mexicanus
REITH1.-GUATEMALA: Baja Verapnz; 5 km E of Punilha, (3 1407 ROM).
Reirhrodontomys spectabifis
RIETH2.-MEXICO: Isla Cozumel, 1.5 km N of cedral, (332 16 ROM).
Baiomys muscufz~s
BAIO1.-MEXICO: Colirna; 2 km NW of Chiapa, (1999 ASK).
Onychomys leucogaster
ONYC1.-USA: New Mexico; 1.6 Mi N of Rodeo, 1 Mi W of Rodeo, (35546 ROM).
ONYC2-USA: Texas; 1 1 Mi N of Port Isabel, 3 Mi E of Port Isabel, S Padre Is, (855
ASK). APPENDIX C
CYTOCHROME B NüCLEOTIDE SEQUENCES
------
111 111 111 122 333 333 444 444 455 555 123 456 789 012 345 678 901 456 789 O 12 345 901 234 mex 1 ATC CAA ATC CTA ACA GGA CTA CAT TAT ACA TCA ACA ACC mex2 ...... G T...... C ..* ... mex3 ...... - .--.-. mex4 ...... a.. *. . S. - S.. mex5 ..- S...... * .** rnex 6 ..- .*. ..- a.. - S. - * - Sm- . -. mex7 ...... T...... - --- ... mex8 ...... S.. ... m.. mex9 -*. .*. .*. ... T.. . *. ... *.* S.. mexlO --.--- S.- . .C T.. . .- . .C . - - .S. stirl ,,T *,. ,., ..ci T.. - - * * .C - - - *-- stir2 ..T ...... G G.. .*- . .C .-. . -. granl -*- --- .*- --- ..* ... *...... a gran2 ..- .a. .a. . .G T...... - ... yuci ...... C . .C .a- .S. yuc2 ...... *C . .C .--.-. yuc3 ... T ..... S.. -.* . .C . *C .a. . -. zarl -.. --* .*. ... T*. S.* .*. ..* ..- zar2 ..- .-. S.. ... T.. m...... guatl -.. -.-a-. --- .*. a.. . *. .--... guat2 ...... T.. . .C ... ..* S.. gyml .-. .S. ... .S. ... . -. nudl ..- .-. .-* ..- .S...... -. ... ~ud2 -.. --..a. ... T.. ..- .-. .-. S.. nud3 ...... *.* S.. S...... -• nud4 ...... C ... T.. a.. .S. .-. .S. rnegl ..- .-* .-...... C ... ..- ... me11 ...... T.. .S. .*. ... S.. me12 .--.-- --• - .C . ,C ... . -. ma y1 --- --.S...... S.. ... ma y2 .-. -.. a...... a.. *. - -.. ... fur1 -.- .m. ... T.. ..C . .C ...... fur2 ...... T.. ..C . .C ...... ochl ...... T.. ..C . .C S.. .*. melal . .T ...... C T.. . .C . .C ... S.. aztl -.* --..-. ... T...... C .-. .*. leu1 . .T T.. ..T ..C ... ..C . .C ... . .C leu2 . .T T.. ..T ..C ... ..C . .C -*- . *C levl ...... T. ... T.. ..C . .C ... .-. lopl ... T...... *.T.. ..C .a...... * lep1 -.. *-.S.. ... T.. ..C . .C .-. ... th01 ...... C . -C .--S.. Reithl .-. --.S.. ..C .-. ..- .S. Reith2 ..T ...... C . .C S.. m.. Baiol .....C ... -.. *. . . -. ... Onyc 1 ..T A...... C . .C ...... Onyc2 ,.T A...... C . . - ... .S. lil 111 555 556 666 777 777 788 888 999 999 999 O00 O00 567 890 123 345 678 901 234 123 456 789 012 678 mexl ACA GCA TTC ACA CAT ATC TGC GTA AAC TAT GGC TTA -.T C-T mex2 ... *a* ..a ... .-C .*T ...... C --- mex3 ... . .T -.. -*. ..- --. * - - mex4 -.. -...... a. ..G mex5 ..- .--...... *. -.- - *. mex6 .-. .-. -.. m.. -*. . - - - -. - - - mex7 *.. .-* --...... -. - S. ...
S.. , mex8 . - * .-. ... -.. . .C ... .G mex9 ..* ..* . .T ...... C ..* - -.
m.. S. mexlO ... ..- S...... C - a-. .C C.. stirl S.. -*. *.. -.-. . .A
.W. C.. stir2 . . * -*- * * - .-. . .C . .A qranl - - - *-. *-...... S.
S.. gran2 ...... S.. .-. S.. -.. S.. . .C ... yucl ... --- . *T ..G . .C ... ..T ..C * - * C.. yuc2 ..* .-. ,.T . .T ..C ... ..T . .C ... C.. yuc3 ..* .*- . .T ..G ..C ... ..T . .C m.. C..
.C S.. zarl - S. ..* . -...... - zar2 **...... - .C .-. - -. ..* m.. m. çuatl S.. ..- . .T ...... - guat2 S...... -.- .-. gyinl ...... -.. S.. ..- ..- S. - nudl *.* .*. ... es- - * - . .- .C nud2 ... . . - S...... -- -..
m.. S.. *. nud3 ..- ... a...... - - nud4 ..* ... m.. m.. S.. . .C - - - -.- megl -*. *. . -*...... T . .C .S. C.. me11 .*- ... . .T m.. S...... S. C-. ..G C.. me12 W.. .*. ..- . .C ... mayl -.. *.. . .T ..G ,.. . .C . .G C.. may2 -.. *-- . .T S.. S.- . .C . .G C.. .A C.. fur1 a-. *.- - -...... T . .C . ..T C.. fur2 -.. . .- . S...... C . .A ochl -.- ... --. a.. a.. . .C ..* .-- melal ...... T ..C ... . .C ... C.T aztl ... . .- -.. ..T ... . .C . .T .- - Leu1 -.. ..- ..- a.. -.. . .C ..A C.. leu2 -.. ..- .*...... C . .A - -. ..G .C C.. levl ... .W. *-* ... . -.. lopl ... ..- -.- ...... A ... a** .C .A C.. lep1 S...... th01 ...... T ...... C - S. ..* Reithl -*. .*. ,.T m.. *.- . .C S.. C.T
S.. C.. Reith2 -.. *-. . . - -.T . .C . . -
S.. ..T .C .A C.T Baiol S...... - . . Onycl ...... ,,T ...... C ..A a.. .C S.. .A Onyc2 S...... APPENDIX C. Continued.
111 111 111 111 111 111 111 111 111 111 111 Ill. 111 111 011 111 111 112 222 222 333 333 333 444 445 555 555 666 90 1 234 567 890 123 789 012 345 678 234 890 123 456 012 mexl ATC CGA TAC ATA CAC AAC GGA GCT TCC TTC TTT ATC TGC CTA TTC CTA .*. mex2 S...... - .-...... C ... --. .. * mex3 S.. --.. .T . a. - * - *..*...... -T -.. *.. ... mex4 -.. ..- . .T . . * S...... T - S. .-. -.. mex5 *.. . * - ..- - * - - - .-- -.. mex6 ... -.- ... * - - .- - -.. -** m.. S. mex? ... -.a .S. S.- - - - .- - . -. ... mex8 . -. *.* . .- .-* m. - * *. a.. -.. .a* m.. mex9 ... a.. .S. *S. . - - ..- . -. mexlO S.. ..- ..* . *. . - -.. ... stirl ... ..- ... .*. .- - -.. *-* stir2 --- C.. * * * -.- --. m.. a.. granl ... .--.-. *-- --* .--.-- .-- *-- -.. .-- S..
S.. ..a gran2 S.. -.. .*. . .G .-- ..T S.. *.* ..T . . .m.
..C .-* S.. yucl .S...... - ... . .- ...... T -.. A.T yuc2 -*- ..a S.. *. . ..- ...... C ..T S...... A.T yuc3 . *. -.- ... .-* ..- ...... C ..T S.. -.. A.T * * zarl W.. *. . . - -.. -.- . - ... T.. zar2 .-. *. . ,.T . . - -.- -.. .-.T.. guatl -.. - - - ...... T -.. .- - guat2 ... - * - . . - *.. . .T --. gyml . .T S.* . -2' ... . . - -.- nudl . -T ... . .T ...... --- nud2 .-. .a...... -* - - - nud3 - S. . -...... G . . - --- Sv- nud4 ... .*. --.-.. -.* --- ...... *-- megl . .T S.. ..- S.. . . - T.. .-. me11 ...... -. . .G - - * ..T T.. . S. me12 --.... S.. .S. . .T ..T T.. . -.
S. ma y 1 S.. ... -.. ... -.- .-- T-G . may2 .-. ..* ..* .-• S.. . . - S.. fur1 -...... - *.. ..- - - * . -. fur2 ...... S.. *W. -.- .*. . -.
a.. ochi .-. .S. . .T . .G . .T --- .-. melal -...... - ... .-. --- T.. aztl ..T ... . .T ... .*- --- T.G leu1 ... S.. . .T ... S. - .-* T.. leu2 -.- ..- . .T ... m.. . . - T.. levl *. . *. . - .T S.. -.. .-- T.. - - - lopl -.. W.. ..T . *. . -T . . - T.. .-C lep1 a. * ...... T -.- m.. S.. ..T thcl ... S...... ** a...... T T.. ,.T Reithl . .T ... . .T . .G ... ,.T T.. ..C Reith2 .*. *.. . .T . . * ... ,,T ..T
Baiol S.. S.. . . * T.. . . * . .T ..T Onycl . .T ... . .T .m. . .T --- A.. Onyc2 ... .*. S.. . .G . .T ..T A.G APPENDIX C. Continued.
111 111 111 111 111 111 111 122 222 222 222 666 666 677 778 888 888 999 900 000 000 111 345 678 901 8 90 456 789 678 901 234 567 456 mexl CAC GTA GGA ATT TAC GGC ACA TTC KAGAA AAT mex2 . .T ...... G ... --...... T -*. .- . .C mex3 ..T ...... -A --- S.. . . - -.. -.. . -. ... mex4 ..T ...... A ..- .-. -*. . .T -.- *.- . -. mex5 ...... S.. m.. .*. --..*. *. . .-. . -. mex6 ...... *-. . -. .-. -*. .-...... -m. mex7 ...... m. ... -.- *. . .--.S. ..- - S. mex8 ..T ...... -A -.. * - - S.. ..T ... ..* - -c mex9 ...... -. .m. -.. G. - ..T ..- -.* ..C mexlO ...... *-. S.. -*- S.. -.-... *.* .*C stirl ..T ...... A ..T -.- -.- ..T ..- S.. . .C stir2 ..T ...... ,A ..T ... -.- ,.T ..- -.. .,C
S.. m.. * granl .. - - .. - . . -*. S.. .m. - .T . . -.- -*- gran2 ...... S. -.. S.. -.. - *...... - yucl . .T ...... A ..T ..G -T. ,.T a.. -.* --* yuc2 ...... -A ..T . .A .T. - .T ...... - - - yuc3 ...... A ..T ..A .T. * .T m.. ... --. zarl . .T ...... ,A S.- *.. * * * - -T .*. ..- ..C zar2 . .T ...... A ..* ... -.. * .T -.- .-. ,*C
S.. *.- guatl ...... W. . . - S...... -** guat2 ...... S. . . - . * - S.. -...... gyml . .T ...... A -.. ,.A S.- - S. ..- S.. ..C nudl . .T ...... ,A . . * ..A -.. -.. ..- ... .-C nud2 ...... -. . . - ... .. - ..T S.. S.. .,C nud3 ..T ...... A .-. ... .*...... S. . .C nud4 ...... -. ... .*- .--.S. - - * S.. . .C megl ...... A .*. . .A m. - S...... -.. me11 ...... -G .. - ..- S.. *.. S.. .S. ..C me12 ...... -G --.- . ... -...... C .C mayl . .T ...... A S...... - ... ..- . -. - maya ..T ...... A ...... m.. . . .m. .-. ..C furl ...... -A .-*- .A . . - . .T .T...... C fur2 ...... ,A S.. . .A -.. . .T .T...... C ochl . .T . -G ... . .A ... - *. S.. . .T . . - ... . .C melal .-T ...... A . .T . .A ..* m.. . ,T -. ..C aztl . .T ...... -A . .T . -. *.* S...... S. . .C m.. a-. .C leu1 ...... P. S.. ..A - .A. . leu2 ...... - .A ... * .A m.. -.* .A. .-* ..C levl . .T ...... *A . .T *...... T .*. .S. ..C * a-. lopl . .T ...-.. ..A ..- S...... -. . .G lep1 . .T ...... G . .T .*. -.. . .T S.. *S. ..C th01 . .T ...... A ... . . * * *. .-. ... S.. . .C Reithl ...... G ... . .A ..C . .T S.. S.. - .C Reith2 ...... A .--. .G ,.T .** .T. ..* . .C Baiol ...... G ... . *A .T. m.. .TC . -. ..C Onycl ..T ...... A ... . *A . *T . .T ... -*- ..C Onyc2 ...... A ... .*A . *T ..T ... .S. ..C 222 222 222 222 222 222 222 222 222 222 222 222 222 222 222 222 222 222 111 222 222 222 233 333 333 334 444 444 444 555 555 555 566 666 666 667 789 012 345 678 901 234 567 890 123 456 789 012 345 678 901 234 567 890 mex 1 ATT GGT ATC GTA CTT CTA TTT GCC GTA ATA GCA ACA GCA TTC ATA GGA TAT GTC mex2 a.. ..A ... .-G A.. --...... -...... A mex3 ... ..A ...... C ...... A mex4 ... ..A ...... C ...... A mex5 ...... *...... T ...... mex6 ...... T ...S.. --C ... mex7 ..C ..A ...... ,A mex8 ... ..A ...-...... *...... mex9 ... ..A ...... -C ...... ,,G .....-..-...... -C ... rnexlO ... .,A ...... C ...... ,.G ...... T ..*...-.C ... stirl ... .-A ...... A.. ... ,,T ...... A stir2 ... .-A ...... A.- ... ,-T ...... ,A granl ... ..A ...... G ... ..T ...... m.... gran2 ... ..A ...... T ...... T ...... -.C ... yucl ... ..A G.T ... ..C ...... ,.T ...... T pc2 ... ..A G.T ... ..C ...... T ...... T yuc3 ... .-A G.T ... ..C ...... T ...... -T zarl ... ..A .....-*...... -...... zar2 ... ..A ...... *...... guatl ... .,A ,-T ...... T ...... C S.. guat2 ... ..A ...... T ...... gyml ... ..A ...... C ...... T ...... A nudl ... ..A ...... C ...... T ...... A nud2 ... ..A ...... C ...... ,,G ...... - ..T ...... -.C m.. nud3 ..C ..A ...... C ..A nud4 ... ..A ...... C ...... ,.T ...... C ... megl ... .,A ...... ,.T ..G ...... -G ... ..A me11 ..C .-A ...... me12 ..C ..A ...... ,.C ..A mayl ..C ..A ..T ... ..C ...... G ...... A may2 ..C ..A . .T .....C ...... G ...... T ...... A fur1 ..C ..A ...... A ...... C ... ..T fur2 ..C ..A ...... A ...... -C ... ..T ochl ..C ..A ... ..G ..C ...... T ... ..C ,.C ..A melal ... ..A G.T ... .-A ...... T ....*.*...... ,.C ..A aztl ..C ,.A .-T ... ..C ...... T ... ..T ,.C ... leu1 ... ..A G.A ..G ..C ...... A leu2 ... ..A G.A ... ..C ...... -A levl ..C ..A ... ..T ..A .a. ..C ...... G ... ..A lopl ..C ..A ...... C T.. ..C ..T ...... T ... ..C ...... lep1 ..C ..A ..T ... ..C T.. ..C ...... C ...... th01 ..C ..A ..T ..G ...... C ... ..G ...... ,C ... ..T Reithl ... ..A G.. ..C ..A ...... C ...... T ... ..C ... ..A Reith2 ... ..A G.A A.C ..A ...... T ...... *...... Baiol ... ..A ..T A.T ...... T ...... C -.C ..A Onycl ..C ..A G-T A.T ..A ...... A ..T ...... C ..A Onyc2 ..C ..A G.T A.T T.A ...... ,.A ..T ...... A APPENDIX C. Continued.
222 222 222 222 222 223 333 333 333 333 333 333 333 333 777 777 777 899 999 990 000 000 O00 111 111 111 122 222 123 456 789 901 234 890 123 456 789 012 345 678 901 234 mexl CTT CCG TGA TCC TTT GGA GCT ACA GTA ATT ACC AAC CTT CTG mex2 ..G ..A ...... C .--.a- .--.-- ..A mex3 .....A ... S.. ..C ..- .-- -.. .-c ..- mex4 ... ..A S.. a.. ..C a-- .a- .- - .-C ,.A mex5 .S. -*. .-- ...... S...... mex6 ..- -.-.-. -.-S...... - mex7 .....A ... --..*- ... mex8 ..C ..A . .* .-. .-- . - - mex9 .S.. .A ... S.- ..- a.. mexlO . .C . .A . - . --* .-- ... stirl S... .A ... .--S...... stir2 .....A ... ------.a granl .....A ... *-- .-- *-- gran2 .....A ... -*- yucl . .C . .A . - . ...
yuc2 ..C . .A ... S.- .-- ... yuc3 ..C ..A . -. --..*- ... zarl ... ..A ...... - *T zar2 ... ..A ... --- ..- . .T
guatl S... .A ... a.- se- -.. guat2 ... ..A ... -.-..- ... 9~1.... .A ... --..*- . .T nudl .....A ... --- S.. ,.T ..* nud2 m.. ..A .-- ...... nud3 .....A ... .** .a. . .T nud4 m... .A ...... - - megl ..C . .A ...... T me11 .....A ... a.. **. . .T me12 .....A .*. -S. -*- ..- ma y1 .....A ...... T ma y2 .....A ...... T
fur1 S... .A ...... -a
f ur2 .....A ... .m. S.. -.* ochl ..C . .A ...... T metal S... .A ... -a. -.* *-. azcl m... .A ...... * .T
leu1 . .C . .A ... *-- S.. ... leu2 . .C . .A ... .S. levl . .C . .A ... m.. lopl .....A ... . .T lep1 . .C . .A . - . .a. th01 ..C ..A ...... Reithl .....A ... . .T Reich2 ..S. .A ... .m.
Baiol S... .A ... ..- Onycl .....A ...... Onyc2 ... ..A ..- ..T APPENDIX C. Continued.
--
3 3 3 333 333 333 333 333 333 333 333 333 333 333 333 222 223 333 333 444 444 455 555 556 666 666 777 777 5 67 890 456 789 34 5 67 8 901 234 8 90 123 456 345 678 mexl TCA GCT CCC TAT GGA ATA ACC TTA GAA TGA ATC GGA TTC
S.. *-* mex2 . *. . .C . - - ..- ... .C. . - - .-- .S. . .T .-. mex3 .*...... A ..C - -. ..- . -. -.- . -. S.. . .T *.. .a. mex4 ... ..- ..A ..C -.. *.. --- .*- . *. .-. . .T --- S..
*. .S. .-a .*- mex5 .S. ..- . *. ..* . . - - ...... - . -. mex 6 ... ..* -.- - - ... ..- . -. .-- .-. ... *.- m.. ...
S. mex7 S...... T -.- .S. .C. .-. -S. --..S. ... .--. mex8 ... . . - - * * . .C * *. .*. . -. .-. .*- ... . - - .--... -.a mex9 -.. m.. . .T -*- S.. .S. . -. *-- .-. ... . - - ... mexlO . .G . *. -.-. .C ...... -. .-- .-...... * ... . m. .T stirl S.. ... -.. . .C ... .C. . -T C-. .-...... - --- . stir2 ... ------,.C ... *Ce . -T C.. - S. m.. S.. * ,G . .T granl ... ..- - - * - -C --..C- .----- .-. *.- .*. ... . *. gran2 - -. ... -.. -.- . -. ... .-. .-- . -G ...... *-a . -. .G yucl S.. ... -.. . .C . .G .C. . .* C.. .*. ... .-- . . -. yuc2 ... -.- - *. . .C a.. .C. .-.C.. ... S.. .-- * .C ...
S.. S.. *-* * m.. yuc3 -.. S...... C .C. . -. C.. .-. .C .a. m.. *.. zarl ... . .C .S. . .C W.. ..- .--.*- ...... zar2 ... . .C -.-. .C ...... a ..G .--.S. .*. * S. ... guatl ... . .C ..T * * * ...... -. .*- .S. S.. S.- - -. ... guat2 ...... T .-- ... .C. .-. .*- . .G ... .-. *. * S..
S.. * ,T gyml --.. .C . .A .-- ... . *- .S. .-- . -. . .T - .
m.. S.. -T nudl -.. . .C . .A a-- ...... *- --. . .T --- . nud2 ...... T .-- ... *S. . .* .*. . .G S.. ..* .--W.. nud3 ... -.. .*. -.- ... ..- . -T C.. . .G . .G .-. . .G . S. nud4 -*. . . - . .T . - - -.. m.. .-. ... * *G .-. -.- . -. .S.
S.. .S. *. meg L ...... a-. . .C ... .C. .--C.. --. . . -. meil ...... ,T . .C *-. .C. .-.C.. .S. ... .-. .*. ... me12 -.. -.. . .T . * - ... .C. .-. C.. --.* -. -.- -.- ... mayl ... -.. . .T . .C -*- -Cs . .T C. - -. .-. . .T ..- .S. may2 ... *.. . .T . .C ... .C. . .T C.. S...... T . .G --. .a- m.. S.. * fur1 --.-. - a.. . .C .C. C. * --...... - f ur2 ...... --. .C -.. .C- ... C. * ... S.. . . - -.. .*. ochl ... - .C *.. . . - ... .C. . S. C. G ...... -. . .G W.. melal ... -.. * -. .-- -.. .C. . .T C.. *-- m.. ..- ..* .-. aztl ... ,.C * -. ... S.. .C* . .T C. * .-* .S. ,.T . .G . -. leu1 ... ..C ..- . .C ... .CC *.. C.. .*. S.. -*- . .G . .T leu2 ... -.. . .A . .C . .G .CC .*. C. * . -. .-. . .T W.. . *. ..a .T levl ... - .C . *. . .C ... .CC . *A ... .--..* *.- . a.. .G lopl . .G ,.C ..A ..- ... .C. G.. C. * --. . .T . . .T lep1 ... . .C . .A . .C ... *C. G.. C.. . a...... T . .G S.. th01 .-. ..C .-. . * * ... .C. ..- C.. . -. ..* ..- ... . - * Reithl ... -.. ..- . .C ... .C. . .A ... .--... .*. . .G ... Reich2 ... . .C .-. ..- ... .CG . .A C.. ..- . .G -*. ... .m. Baiol ... ..- .--. .C . .C .C. ... *.. S...... a- . .G ..T .C .T Onycl ... -.* ... . .C ..* .C. . .A C.. *.- ..* ... . .
.a* S.. .G .T Onyc2 ... *.- . . - .-. *. . .c. .*A C...... 333 333 333 333 333 333 333 444 444 444 444 444 444 444 444 444 444 444 788 888 888 889 999 999 999 000 000 O00 011 111 111 112 222 222 222 333 901 234 567 890 123 456 789 012 345 678 901 234 567 8 90 123 456 789 012 mexl TCA GTT GAC AAA GCA ACC CTA ACC CGA TTC TTC GCA TTC CAC TTC ATC CTG CCA mex2 ...... a.. ..T -*A-.- mex3 .....C ..T ..A m.. mex4 ... ..C S.. ..A ..G mex5 ...... -.. -.-*-- mex6 .,. .,. m.. --- -.- mex7 mex8 mex9 rnexlO stirl stir2 granl gran2 yuc 1 yuc2 yuc3 ... ..A ...... T ... ..T ... zarl ... ,,C ... .-G ... ..T T...... T ...... T ...
zar2 ... ..C ...... TI...... T ...... T ... ..T S.. guatl ...... -. ,.T guac2 ...... *.. T...... 9yml ... ..A ...... -.. ..T ...... T ... ..T ... nudi ... ..A ...... T ...... T ... ..T .*. nud2 ...... *...... *.T ... ..T ... nud3 ... ..C ..T ...... T ...... T ,,T... nud4 ...... megl ... ..A ..T ...... -.T ..* ..T ...... -. ..T ... me1 l ... ..A .,T ...... T ...... *.. ..T ... me12 ... ..A ..T ...... T...... T ... ,.T ..T my1 ... ..A ..T .S...... T T.. ..T ...... T ... may2 ... ..A ...... T T.. ..T ...... **T... ..T ... fur1 fur2 ochl melal
leul ... ..A ...... -.. .*A ...... ,.A ... leu2 ... ..A ...... A ... ..T ...... T.A ... levl ... ..A ...... A ... ..T ...... T ...... A ... lopl ... ..A ..T ... .*T ...... A ... lep1 ... ..A ..T ... ..C ...... T ...... T-A ...
thol ... ..A -.T ...S.. .-T ... ..T ...... T ...... A ... Reich1 ... ..A ...... A ..T ...... T ..T ..A ... Reith2 ... ..A ..T ...... A ..C ...... T ... T.A ..*
Bai01 ... .,A ...... T.. ..A ...... T S.. ..C ... Onycl ... .,A ...... A ... ..A ...... T ... T.A ... Onyc2 ... ..A ...... A T.. ..A ...... T ...... T ..A ... APPENDIX C. Continued.
444 444 444 444 444 444 444 444 444 444 444 444 444 333 333 344 445 55s 555 666 666 677 777 777 778 888 345 678 901 890 123 789 34 5 67 8 901 23 4 5 67 890 123 mexl TTC ATC ATC ACA GCC CTT GTA GTC TTA CTA TTC CTA CAC GAA ACA mex2 ..* *-...... G W.. ..- *-. m.. ... -.- mex3 . .T .-. -.- .-A .*- S.. .*- * -. * - - *.* S.- mex4 . .T .-* -.. ..A -.. -.. -S. -. . . - ... ..- mex5 -*- .-* -.. --. . . - . -. *.. . -. W.- mex6 ... *-. --. .. * ...... * ..- -.. mex7 . . - *-* -.* m.. . . - * -. - - S. * m.- mex8 ... .-. -.a W.. . . - a-. -.- . -. .*. mex9 ... -.. S.. ... S...... - mexlO . . - -.. ..- . -. m.. S.. .S. stirl m.. -...... *+. .--. .T stir2 ... -.. -.-* *. --.SV. ,.T qranl .*- S.. --. ..A ..* .-...... gran2 ... S.. c. - *...... G .*- yucl ... -.. C.. . -. S.. -.- yuc2 ...... *-. C.. . -. . .T *.. .*. yuc3 S.. G.. ... -.. C.. .- - ..a .S. a.. zarl ... ..A -*. T.. . . * - -. --- zar2 . . - *. * ...... *. * ... -.- quatl ..- S. - -.* a...... -. S.. guat2 ... -.. ..- *-. . .T ... -.. **. S.. gyml . .T ..T . . - W...... -.- nudl . .T ..T . . *-. . . - .*. nud2 -.* -.* ... S. - . * * .-. -.. nud3 ..* *...... -a. -.- nud4 . .T -.. ... * -. S...... T megl ... S. * C.. T.. .. - .-* ,.T mell ... . .A C.. .*. ..- ...... me12 ..- . .T C.. T.. . .T ...... mayl -.- --. C.. . -. . .T T.. -*. may2 ... .---.- -.. C...... T T.. ... fur1 . .T ..C ..T ..A *. . ... -.. T*. -.- fur2 . .T .-C ..T . .A - * * ... . . T*- .-. ochl . .T .*. -.- - -. . . - . .T ... S.. .-- melal . .T ...... A m.- T.. ... T-. -**
.-a aztl S...... A C., . -C -.. .*. m.. leu1 . .T .-. S.. C. - ... . .T T.. . .T leu2 . .T .-. S.. ..- C...... T T.. - -T Levl ...... T ...... T C.- ...... lopl ..T ..T ..T ...... C ...... T ..T C.G T.. -.T ...... lep1 ...... C ...... G ..T C., ... ..T ...... th01 ...... -T ...... C ...... T ...... Reithl ..T ... ..T ... ..T ...... A.T ..T ... C...... T ..T ...... Reich2 ..T ... G...... A-C ..T ... C...... G ..T ... ..C ... Baiol ..T ...... A.C ..G ... C...... T A.T ...... Onycl ..T ...... A ...... --T ... C.T ...... C ...... C ... Onyc2 ..T ..T ..T ...... A ... A-T -.T ... C.T T...... T ..T ... ..T ... APPENDIX C. Continued.
44 4 444 555 555 55s 555 555 555 555 55s 555 555 888 999 O00 000 001 111 111 111 222 333 333 334 789 012 234 5 67 890 123 456 789 O 12 234 5 67 890 mexl TCT AAT GGC CTT AAT CCC GAT GCA GAT TTC CAC CCC mex2 . . - . .C ... . .A .-a T.. - - - .- - ..C ... * *. * *. mex3 ..C . -...... *C T.. ..- .a. .S. ... * *. .- * .a. * mex4 . . - .-- .S. . .C . .C T.. ..C ..C - - -.- ... mex5 . .- - -. ... *** - * - . a. ... . -. ... .*. .*a * mex6 ..- .-- m.. -a* ...... A.. 0.- . -. . - - - - mex7 . *. .-- . -. . ,A ... ..T ... .*. *.. * S. - * - .-- mex8 *.. . . - ... .*A . -C T.. ..C --* *.- - -...... - mex9 ,*C .-- ... . .A ... T.. . . * ... *.. . -. .--.*- mexlO . .C .-- ... . .A .--T.. . . - .-. *.- .S. ... S.. stirl . .A ... - -. . .C ... T.T . .C .*. . .C . S. ..T ..- stir2 - .A ------,,, T*T ..C * * - .C -.. . .T *-. granl . . * ...... A ...... -.-* * - -.- S.- - - - .*- .m. .T gran2 *. - . . - ... . .A ... T.. ... --...... A yucl -.* . .C ... T.A .,C ... . .A m.. ... - - - .*. ..a a*. .A yuc2 S.. . .C . . - T.A ..C ..c . yuc3 *.* . .C ... T.A ..- *.. .*C ..* . .C ... ..T . .A mA zarl *. .-- ... . .A . .C T.. ..C .--..- -. - - . . - * .T a.- zar2 *. . S.. . . - . .A . .C T.. A.C .- ..- . . . - guatl . . .-. ..- . .A *.- .-. .*- . *. - - - . * -
S.. * guat2 ..- -.. .a. . .A --- S.. . .C . .- . ... -.-
a.. S.. S.- gyml .-* m.. .*- -.* ,.C T.. A. C S.. ..- nudl .-* --. - -. ..* ,.C T.. A.C .m...... - ..a -.. nud2 . .C m.. . . - * .A .,. T.. m.. .-* ..- .S. ..* ... nud3 .-. . .C ... . .A .,. T*...... S.. S.. ..- . .T nud4 . .C -.. -.. . .A ... T.. .S...... -. --.- - - meg 1 -.. ,.C .--. .A . .C T.T . .C ... . .C -.-..- . . * mell ... . .C . . - . .C G.C T.T . *. .--. .C ... . .T ..* me12 ... ,.C -.- ... . .C T.T S...... C ... ..- -.-
S.. ,T mayl . .C ,.C . .A . .C . .C T.T . .C -.* ... ..- .
S.. S.. .T may2 . .C ,.C . .A . .C . .C T.T . .C . . * ... . f url -.. -...... T.. ..- ... ..C ... . .T . .T .T .T fur2 ... - *. S. - ...... T.. ..- ... . .C ..- . . ochl . .C . .C ... . .C .,. T.. A...... C ... ..- -.- melal . .C . .C ... . .A . .C T.A . .C .m. S.. .-. ..* .-. aztl . .C ,*C ... . .C ... T.T . *C ..a ..C . *. ... .- - * *.* leu1 ... ,,C . .A . .A . .C T.. . .C S.. ..C *-. .T leu2 ..- , .C . .A T.A . .C T.. . .C . ** a...... T . . -
S.* * .T *.* levl . .A m...... C T.. . .C ...... ,.T .T lopl . .C -.. . *. a.. . .C T.. . .C . . - ,.C ... . 1epl ... . .C ..* -.. * .C T.. . .C . - . . .C ... ..* ..T *. th01 ..- .-- ... S.. *.. T...... C ...... - Reithl . .C . .C *. . . .A . .C T-T . .C .-.. .C ...... T * .T .T .A Reith2 . .A , .C -...... C T.T . .C ... ..C . . m.. S.. Baiol ... . .C * .A S.. . *C T.. ..- --.. .C ... S.. .T Onycl . .A , .C . .A S.. . .C T.. *. . .*. . *C .-- . Onyc2 . .A *.. . .A . .A . .C T.. ..C .-. ..C S. - ... S.. APPENDIX C. Continued.
- -
555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 444 444 444 555 555 555 566 666 666 667 777 777 777 888 888 888 899 123 456 789 012 345 678 901 234 567 890 123 456 789 0 12 345 678 901 mexl TAC TAC ACT ATC AAA GAC ATT CTT GGA ATT CTC CTA TTA CTA ACA ACC CTC mex2 ...... C S.. . *C S...... C ... .-- * *. mex3 ..- ..T ...... C a...... C ..A ...... S.. ..T mex4 ... ..T ...... C .S...... A ... C.. T., .,T mexS .-- .--S.. . . - -m. mex6 .-. S.. -...... --. mex7 .-- . *C .*. ..* G...... --- ..* ..- mex8 .-. . .C -...... A . . - S.. ..T *S. mex9 . *. . .C --. . . - S.. ..T -m. mexlO -.. . .C .a. .-* m.- -*- ...... G...... *T . *. stirl ... . S. . .C ... G.C ...... C.. T.. .T. GTT . . * stir2 .-. *-- ..C -,. G-C -.- --- c--TI. .T- GTT .-- granl .*- - -C --- ... G.. -.T --- -*. .-T ,.T gran2 ... * .C . .- ...... - - * ... ..T .-- yucl . .T ..- ..* ..G GCC ... T.. .,T yuc2 . .T - - - . -- ... GCC ... T.. .,T yuc3 . .T ... .*. ..G GCC ... --.--. T.. . .T zarl ..- . .C .S. ... GCC ... ,.. C.. T.. ..a zar2 ... . .C *-* ... GCC ... ,.G C-. T.. ..- guatl -.. . .c . *- ... G.. ... *.. ... guat2 S.. . .C ..a ... G.. ... - *. -.- gyml ... ,.C ..- . .G G.. ..A T*. . . - nudl ... ..C ..- . .G G.. ..A T.. S.- nud2 S.. . .C S.. ..G ..C ... -.. A.. . - - nud3 . .T . .C -.. ... G...... C.. T.. ...
S.. .a- nud4 .S. ,.C .,G ... T.A *.. -S. G.. meg l -.. . -...... G.A ..A ... C.. T.. .T. G.T . . - me11 ...... GCC ...... C.. T...... ,A . .T me12 a.. ..C ..- ..G GCC ...... C,. S...... A ... may= ... .** . .C ... GCA ...... C-. T.. S.. ..T .-. ma y2 ... *. . . .C ... GCA ... .,. C.. T.. S.. ..T .- fur 1 ... . .C . .A .....C ..A ... C.. T...... TT . -. fur2 S.. ..C . .A .....C ..A ... C.. T-* ... .TT . . - ochl S.. ... T,A ..G G.A . . * .,. C.. T.. .T. G.T . * nelal ... S.. T.A ..G . .C T.T ... C.. T.. .T. GTT . . - aztl . . * ...... G.C . .A ..G GCC ..- ... C.. T.. .T. GTT . . - leu1 . . - a.. *.c --* *.- . .A .....C ... . .G C.. T*. .T. GTT . - * leu2 ... ..- ..C G.. S.. S.. ..G . .C . . - . .G C.. T.. .T. GTT ... levl ..- ...... T *. . . .A ... GCC ...... C*. T. - .T- G.T .*. lcpl . . - --T ...... S.. G.A ..G GCC .-A T.. C-. T.. ..C .TT . . * lepl . . - S.. . .A ... G.C ...... C.. T.. ... GTT ... th01 . . - . .C T-A ..C . .C .*. .,. C.. T.. .T. G.T *.* Reithl ... ..- T.A ...... A.T ..C C-T T.. .T. GTT *-- FZeith2 ..- ... . .A .....C A.T ..T C-T -.. .T. GTT *..
Bai01 .*a ... . .A ... G.. S.. A-C C.T T.. .T. G.T .--
Onycl ... S.. . .C ..T ... A.. . .T A. - T.. .Ta GTT -S. Onyc2 ..- . .G . .A ... G.C A.. . .T A.. T.. . .T APPENDIX C-Continued. - - 555 556 666 666 666 666 666 666 666 666 999 990 O00 000 111 333 333 444 444 444 567 890 456 789 678 123 456 012 345 67 8 mexl ATT TTA GTC TTA TTC GAT CCA GAC TAT ACC CCC
mex2 ..C .-* ..- ..T . . * *.- . *. S.- ..T ..A mex3 . .C C-. .-* -S. . .C . . - . -. ..- ,.T ..A mex4 . .C C*. .-* --. . .C . .G - . . .C . .T . .A mex5 .a. .-. --. S.- ..- -.- mex6 .-- m.. *.. ..- ..- -.- mex7 ...... * a. m.. W.. . .C . .T -.-
mex8 ..T ...... m. S.. . .C . .T *. - mex9 ...... T -.- ... a.. . .C -a- . . - mexlO ... C.. ..T *S. * S. -.. , *C . *T . - - stirl . .T .....T .*. - * * -.. . .C . .T . .T stir2 A-T ... ..T ... S.- S.. . .C ..T ..T granl .-. -.. -...... * .C . *T . .A qran2 ...... -.C...... C ... .a. , .C . .T ... yuc l ..C -.. .-A C.. -.T ..C ..T ..T - .C --- ..T yuc2 ..C ... ,.A C.. . .T ..C ..T . .T . .C -.-, .T yuc3 ..C ... ,-A C.. - .T * *c ..T . .T ,.C -a- ..T
za r l .,C -.. ... C.. ..T S.. *.. ... , .C - .T ,.T zar2 . .C C.. ... C...... m.. . .C - .T - .T guat 1 .-- S.. .S. . .C . -T . .A
guat2 a.. S.. .-. S.. ..* . *T . .C . .T . .A gyml ..C ... ..T * .C ..* a.. *. - ..T . .A nudl ..C ... ,.T S.* S.. * .C ..- m.. - - - .*T ,.A nud2 ..C ...... T ..- ..- S.. . ,C - .T -.* nud3 .CC C.. ,.T ... ..T *.. S.. .a. . .C . .T ..T nud4 ..C ... -...... T ..C ..- . - - . .C -.* megl ...... ACT -.-*.T ..* . .T .*. . .C --.. .A me11 . .C C. - ... C.. . .T .-* . .C . .T . .C ..T me12 . .C C.. ... C.. ..T . .C . .C .S. . .C **. . ,T may 1 . .T ... ..T ..- . .T . .T . .C ..T ..T
ma y2 . .T ... ..T .S. . .T . .T . .C . .T ..T f url . .T C-. ..T .-- - .C . .T , *C . .T ..T fur2 . .T C.. ..T .-. . .C . .T . .C . .T ..T
ochl . .T ... ..T .S. . .T . .T ... - -T . .T melal . .T ... ..T *.. ..- . .T . .C . .T . .T aztl . .T ... ..T ..- . .C . .T . .C . .T ..T leu1 . .T ... ..T ..- . .T . *T . .C ..T ..T leu2 . ,T ... ..T **. ..T . .T . .C -.* . .T levl . .T ... ..T . -. ..- . .T , .C . *T ,.T lopl . *T ... ..T . *. . .C . .T . .C -.-. .T
lep1 .*a S.. . .T ... ..T m.. . .C . .T . .C . .A ..T Ch01 ... ..G . .T ... *.T . . - . .C . .T . .C . .T . .T Reithl ... C.. . .T C.. ..T ..- . .T . *. . .C . .T * .A Reith2 ... C.. . .T C.. ..T .-. . .C . .T . .C . -. . .A Baiol ... ..G . .T ... ..T S.- ..* ,.T . .C . .T ..T Onycl ... ..G . .T ... ..T . . - ..- . .T . .C . .T . .T Onyc2 ... ..G . .T .-. --T . . * ..* . .T ..C . .T ,.T APPENDIX C,Continued.
666 666 666 666 666 666 666 666 666 666 666 666 777 455 555 556 666 666 777 777 777 888 889 999 999 000 901 567 890 456 789 0 12 345 67 8 234 890 123 456 012 mexl GCA CCA TTA ACT CCA GCA CAT ATT CCA TGA TAC TTC TTT mex2 .-• ..- C.T . .C -.. .-. . - - --- .*. *.. *** ..T --- mex3 . -. ..- C.T . .C .-* -*. ,-C ..- -.. *....T ... --- mex4 .-. -.. C.T ... . - * -.. . .C -.- -...... T ... ,*- mex5 ... *.. -.. .*. ... -*. . * - ..- .*. .*- mex6 ... .** ... --.... .*. .--..a a-. -.- mex7 .-. ..- C. - ..- -.. .--..- *. . --- mex8 ... -.. C.T -.. ... -.. *-- ... --. -.- mex9 ... ..- C.. . .C -.- .*. . * - ..- ... -.- mexlO ... ..- C.. . .C ... -.a - -. .-- *. . *. - stir1 . -. ... C.C ... . .C ... .--..- . . - -.- stir2 ... -.- C.C .-. - *c *.- --- ..- - -. -.- grad . -. *.* -.. --- -*. ------.- . . - *-- gran2 . - - ..* C-. . .C -.. -.- . -. ..- ... -.- yucl ... . * * C.T . .C .-. -.- . .C --- - - * *. - yuc2 ... *. * C.T . .C .-. -.. . .C .-- * -. - . yuc3 ... ..a C.T . .C ... -.. . .C * * * --. .. - zarl ... ..- C.T . .c ... *.. *-- -.- ..G -.. tar2 ... ..* C.T ...... -.-... *.- ..G -.a guatl . -. ... C.. .-* -...... -. ..* *. . -.- guat2 . -. ... C.. ..* . - -.. ..- -.- --- - * gym1 ... -.* C.T . .C ... *.. . .C .-- . . * -.- nudl ... -.. C.T . .C *.* -*- . .C ..* ... -.- nud2 ... -.- C.. . .C .-. -.* ..a ..- . . - -.- nud3 . -. ..* C.C ... ..* ... ..* . .c *.. -.. nud4 ... ..- C-. . .C .-* ... .--..* *. . -.- megl ...... C-T - -. - .T --.. .C ..- -.. *. - me11 .-. ..- C.C . .C ..C -.. --* ..- ... -.. me12 . .T . -. C.C ... . .C -.. *-. ..* -.. ,.C may1 ...... C.C - -. . .C .-. . .C ...... may2 ... -.. C.C . -. * .C ... . .C ..* .*. -.* furl -. ... C.T ...... * . .C .-- . . - ..C fur2 . - ... C-T - -. ... . -. . .C ...... C ochl . -. ... C.G ... . .C ... . .C -.a .-. . .C melal . * * ... C.C ... .-. *.. . .C ... . . - ..* aztl ...... C-C ... . .C . . * . .C .*. .-. ,.C leu1 ...... C.C ... . .C . . * . .C .-. . * * ... leu2 ... . . - C.C *. . . .C -.. . .C -...... lev1 ...... C.C ... -.--.. . .C ... . . - ... lop1 *.. .-• C.T ..C .-. --..-...... C lepl ...... C.T . .C .*. --., .C ...... C thol ... ..- C.C -a. . .C .-. . .C .-. -.. . *C Reithl ... ..C ... C.C ... ..C ...... C ... -.G ...... G ..T ..T ..C ..C Reith2 ... ..C ... C.C ... ..C ...... C ...... G ...... C ... Baiol ...... -.C.C ...... ,C ... .-C ... ..G ...... T ...... Onycl ...... C-C ...... -C ... ..C ... ..G ...... T ..T ...... Onyc2 ...... C.C ...... C ... ..C ... ..G ...... APPENDIX C.Continued-
-- - 777 777 777 777 777 777 777 777 777 777 777 777 777 777 777 777 777 777 000 000 011 111 111 112 222 222 222 333 333 333 34 4 444 444 445 555 555 345 67 8 90 1 234 567 890 123 456 789 012 345 678 901 234 5 67 890 123 456 mexl GCC TAT GCC ATC CTA CGT TCT ATC CCT PAC AAA TTA GGA GGG GTA CTA GCC CTA mex2 . .T . .C ...... C . .C . . - ..C ..T *. . . .C *.- G...... mex3 --.. .C . .T ...... C ..T *. . . .A -.* A.. -*. .*. mex4 --.. *C . .T ... T...... T *. . . .A ..G A*...... mex5 .-. .--..- ...... *-. ... .*. T...... mex6 .-. .---...... *. . -.. ... T...... mex7 ... .*- ,.T ...... A .*. T.. -*. *.* mex8 ... . .C ,.T ...... -.. .-. .*. G,...... mex9 ... . -C ...... *. . *.. . .G T...... rnexlO -.. . ,C *...... -. ... T.. ..T ... stir1 . .T .*C . .T ...... C...... A ... GI. *.T T.. stir2 ..T .,C ,,T -.-.-* .-G C.. - - * . .A -.. G.. . *T T., granl ... . *C . .T ...... --- .-* *-- . .A ... T...... gran2 ... . .C .a...... *.. C...... A . .T T...... yucl ... ..- . .T ...... *.. C.. . -. . .C ..* * -. ..T .., yuc2 ... .-. . .T ...... ,.. C...... C .-.G.. ..T ... *. .C G,. ..T yuc3 --.*a- . .T ...... -.. C...... - zarl ... . *C . .T ...... - T...... zar2 --.. .C . .T ...... *.. .-. ... T...... guatl ... *** .--...... C.. . -. . .A -.- T...... guat2 **. ... -...... A .-* T.. ..T ... gym1 .*. . .C ...... T...... A ... A,...... nudl ... . .C ...... T.. *.. . .A .-* A- * ...... *-. .*. *. T.. nud2 ..a .,C -.- ..* *.. - . -A .-...... nud3 ..* . .C -.- ..T ... *.. C.. . .G . .A .-.A- ...... nud4 . .T ... -.- ...... * *-. ..- T...... meg 1 .-. . .C . .T --.*.. ... ,*T ..- .-* ...... me 11 .-* . .C ..- .*. **...... - . .T ...... me12 --.. .C -.- ...... C...... A ... T...... may1 -.. . .C - *. .*. --. ... C., . -. . .C *.. T...... ma y2 -.. . .C , .T ...... -. C.- .*. . .c . . * T...... fnrl ... . .C . ,T ...... C.. . . - . .A . .T .-...... fur2 ... . .C .,T .** .*. ... C.. . -. . .A . .T ...... T.. ochl ..* . .C - * * .---.. ... C.. . -. . .T . .C ... -.. melal ..- . .C . * - -.. -.. ..G ... .*. . .A . . * A*...... aztl ...... *T -.* .-...... *. . .T . .C T...... leu1 ..- . .C --- ...... G C.. . -. . .A .--A...... leu2 ... . .C *...... -G C.. ..- ..A ..- A.. ... T.. lev1 ... . .C ,.T ..- ..T ... C...... T .--...... lop l ... . .C . .T ...... A . .C . . - ...... lepl .--... . .T ...... -. ..C *...... tho1 .-. . .C --...... C...... C - .c *.. ... T.. Reithl ..* ..- .-. .,T ...... C...... C -.. G.. --- ..* *.- G.. .** Reith2 a*. . .C ..T ,.T T.. ... C.. . .C ... .*. Baiol .--...... T ...... * . .A ..C . .G ...... Onycl .--. .C . .T . -T T.. ... C...... C . .T G.. ..T T.. Onyc2 . .T , .C . ,T ...... -.. . .A ... G...... APPENDIX C. Continued.
777 777 777 777 777 788 888 888 555 666 666 666 999 900 000 000 789 012 345 678 678 901 234 5 67 mexl GTA C'TA TCT ATT CTA GTC TTA GCT TTT CTA CCA TTA (=TC CAA ACC TCA AAA mex2 A.C ... . .C ..C ...... mex3 -*. .-- ..C C.A ...... - .G mex4 ...... C C.A .. * -.--.* *.* .,G mex5 -a* .a. .--..- --- -.- mex6 ...... - mex7 a.. m.. S.. ..C ... --.a.. -.* -*- mex8 S.. T.. ..C C.A ...... mex9 ...... C ...... -. mexlO ... T.. .*. ..C ...... *.- .-T .+. -.. stirl ..C ... . .C ..A ...... C.. ..A ...... T ... stir2 ..C ... *.C ..A ...... C.. .-A -.-.....T -.. granl S.. -.. ..- .-. .a- ..C ...... -.- gran2 ...... C.. *.C ...... yuc 1 ..T A*. T.. .-T S.. ... C.. ,.G ...... -.- ..T A.. T.. . .T ...... C.. ..G ...... *. . yuc3 --T A.. T.. ..T ...... C.. ..G ..* *.- --.-. - zarl .CC a.. . .C C.. S...... zar2 .CC ... ..C C.. S.. S.* ..- --.-a- guatl ...... C ... --- a.. -*. -.- guat2 .C. ... m.. S.. S.- ...... -.-
..a gyml .-. S.. . .C C.C *.. A,. C.G ...... nudl ..* .-* . .C C.C ...... C.G ... ..- m.. S.. -..
**. .S. S.. S. nud2 S.. --. .-c ...... - ..T - nud3 ..C ... . .C C. - A.. ... C.. ..T .** ..- *.- ..G nud4 ...... A ...... C ... . .G ...... T ... -S. megl A.C ...... A.T C.. .-.C ...... a. ..T ...... *.. me11 ... T.. *. . A-T C.. .,A C.C -...... A -.* -.-a.. -.. me12 ... T.. ... A.T C.. ..A C.C -.. ... C.G ..A ...... *** mayl .C. T.. ... A.T ... .,C *.A ...... T -.-a.. -a. . .G may2 .C. T.. ... A.T ... . .C .*A .. , --.c-- --T --- *.* .S. - .G fur1 A.C A.. ... A-T ... . .C C.A T.. ... C.C .-A . .T ..T -.. ..- fur2 A. C A. . ... A.T ... . .C C-A T*. . .* C.C .*A . .T ..T ... .S. ochl A.C ... ..T A...... C . .A ...... C..A.. ..- S.. a-. S.- melal ..C ...... A..C.. . .C C.C ... . .T C.. ..A ...... - aztl ..C ..G ... A.T C.. . .C ..A ... . .T C.T ...... S.. leu1 ...... T A.T C.. ..C C.C ... . .T C.C . .A ..- -.. **- . . - leu2 ...... * .C A.. C.. . ,C C.C .. - ..T ..C ..A ..- S.. --- . . - levl ...... A..C.. ..A C...... ,*A...... C ...... * lopl ..C ...... A.T C.. . .C C.A T.. . .T C.C . .T S.- .-. -.- . . - lep1 ..C ...... A.T C.. . .C C.A T.G ... C.C ... . .G .....* S.. th01 A.C ... ..T A...... C C.A m.. ... C.. A...... m.. Reithl A.C ..C ... A..C.. . .C A.. T.. ... C.T ...... *. ..T ..- Reith2 A.C ... . .C . -- C.. ..C A.. -.T ... ..C S.. ..S... ..T m.. Baiol A.C .,C ... A..C.. T.C A.. T.. ... C.C ..A *.C S.. S.. ... Onÿcl . .C T.. A.. A-T ... A.C C- . A.. ... C.T ..A ..G ...... - Onyc2 . .C T.. ... A.T C.. ... C..A.. . ** C*C ..A ...... *.T - .G APPENDIX C. Continued.
888 888 888 888 888 888 888 888 888 888 888 888 888 888 888 888 888 111 111 111 222 222 233 333 333 334 444 444 444 555 555 555 566 666 123 456 789 012 345 901 234 567 8 90 123 456 789 012 345 678 90 1 234 rnexl CGA GGA TTA ATA TTC CCA ATC ACT CAA ACC TTA TTC TGA ATC CTA GTA GCC mex2 ... .,. C.. .C. ..- .a. ... .*C . .G .-. c-. .-. --.. .T ..- --.* -. mex3 -.* .C. . . * . -. . - * . .C .-. *.- c*. . -. *...... - ..G . .T mex4 - -. .C. -.. .-. ... - .C .a. ... C.. ... -...... - . .G * .T mex5 ... -.. *. - - - - -.. .--*-- .*. . . -.- .--.*. .-. mex6 -.. *.. . . - .-. ..* ..- .*. ... .--- -. ..- ... .-- mex7 .*...... *.. .- - . -. . .T -.* .-. *.- --.-.. .*. - -. .*- . - - . -. mex8 .a. ... C.. .C. ..- .-. .-.. .C . .G -*- c*. . .T * - * - -. . . - -*- . .T mex 9 . -. ... C.. .C. ..a ... .* - .-. .T...... T.. . * a --. mexlG .*. ... C.. .C* ... **. ... *.* .-. .T. C...... -...... *- - * - stir1 *-. .C. .*- . ,T . .T ..C . -. ,T. .-..-...... T T.. ..- * .T stir2 - - * I*- .C1 . *. ..T . .T .-C - -. .T. ... .-...... T T...... T granl - *. .., ..G ,C. . - - .-...... A . ,G .*- v-. *-. ..* ... *. - .-. *.- gran2 .-. ... C.. .C. . -. --* ... . .A ...... C...... -.. *.. yuc 1 .-. . .C C*. - -. .-- . -- ... . .C .-- ...... T., . . * -.* yuc2 ... ..C C.. ,C. . -. . *. . *. . .A .-* -*. *.- ..- T.. .---*- yuc3 --.. .C C-. . -. .-. --- ... . .A - -...... T.. ..- ..* zarl ... .C. . - - .** *...... - .T...... * . .T ... --- a. - zar2 *. . .C. .-. . . * *...... T. C.. -.. .** * .A .. - .-. -.- guat1 *-. .C. ... -.- -.* -.. . -G .T. ... *-. .-a ..T -.. .--..a guat2 ... .C. . -. *. . *.. .- * .-. -.-.-* ... *.. ... *. * . -. *.a gym1 .-. .C. . -T -...... C . .G .T. C.. ... -.. --* -.* . -G . .T nudl ...... C* . -T ..* ... . .C . .G .T- C.. *.. -...... G . .T nud2 ... ..- C.. .C...... - ... ..- . .G .T. C...... --... .-. -.. nud3 ... *.. **. .C* * -...... C .-* *.. -.. ..a ... ..- ... .-. ..a nud4 - -. ... .-G .C- .-. -.- -.. ..- . .G .T. C.. ... -*- -*- -.* .---.- rnegl ... .,. C-. .C* . -T -.- -.. . .C --.... C.. ..T a*. --- *. . .-. . .T mell -.. ... C.. ..- .-- -a- - -T . .A --- . .T C.. a. . . * ..T *. - AC - ,.T me12 - - .,. C.. .C. ... -...... A .-. .-. -.- -.. -.- -...... -. . .T may1 ... .*.c*. .C, ... -...... - ... .T. C.. ... -.- ..T -.. .-. ..- may2 .-. ... C.. .C- . -. .*. .** ..- -.. .T. C., -.. ..- ..T ... *.. *.. furl -.. .C, . .T . .T . .T . . a ... .TT C.. . .T . . - ... T...... T fur2 ... .---.. .C, . -T ,.T . .T ..* .*. .TT C.- - .T . . - -.-T.. . *. . .T cchl --- ... ..G .C. . -. . .C -.. . .C . . - GTT C...... - . . - ...... T melal ... .,. C...... -• . .T ... T.C . - ... C.- ... -.- . .T . .G .a. . .T aztl -.. ... C.G .C...... C -.. ..- ... .T. C.G - .T -.- ..T ... .-• . .T leu1 ... ..G ... -.- ... *. . .-. T.A ... GTT C.T ... -.- . .T -...... - leu2 ...... *. .-. .*. T.A -*. .TT C.T -.. ..- ..T -.. . .G -.* lev1 -.. ... C.. .C...... -...- ... GTA C. - ... -.. -.-T.. . .G ..* lop1 ... .,. C-T .C. *-. .-. ... ,.C ... .T. C...... T ... . .G ..- lepl ...... C.T . .G ... . .T ... * * - ... .T. C...... -. . . - ... . *. ... tho1 ...... G ..- . .T . .C ... ..C ... GT. C.. . .T -...... T Reithl -.. .,. C.C .C. .*. ... -...... - ... C.. . . - . - - **- T...... T Reith2 ...... C.C .C. -.. . .T . -...... c...... -.* T.. .-. . .T Baiol --* AC. C.. .C. . .T ... T.. . .A ...... C.. ..- ... -...... - Onycl ... .C. . .T . . -. ..A ..- ... C.. ... -.- -...... T Onyc2 . . - .C- . -. . .T .*. ..A ... .*. c.. . .T .. * ...... a. APPENDIX C. Continued.
888 888 888 888 888 888 888 888 888 888 888 889 999 999 999 999 999 999 666 667 777 777 777 888 888 888 899 999 999 990 O00 000 000 111 111 111 567 890 123 456 789 012 345 678 90 1 234 567 890 123 456 789 012 345 678 mexl AAC CTA CTT ATC CTC ACA TGA ATT GGA GGG CAA CCT GTT GAA TAC CCA TTT GTT mexZ ... T...... -.T ...... ,.C Se- -*A *-- . -. ..C ... . .C A.C mex3 ..T ...... GIT ...... * .C *.. .-A ..G --., .C ... ..C AC. mex4 ..T ...... T -.A ...... a...... *A ..G ... ,,C ..* .,C A-. mex5 ...... S.. . .* ..A S.. . -. a-. .. * mex6 ...... S.. .*. m.. .- - S.. .-. a*. mex7 ...... G.A ...... S.. S.. .-. -.. -.. ..C S.. mex8 ..-...... G-T ,.T ...... * .C ... . -. * -C ... ..C A.. mex9 ...... G...... S.. -.* .S. -.. .S. .-c S.. mex1O ...... G...... S.. . .G S...... * .*. *.- stirl ..T ... T.A -C. ..T ...... S.. S.. . .C ...... A.. stir2 ..T ... T.A .C. ..T ...... *O .*. . .C -.. -.. --- A*- qranl ...... T...... T ...... S.. S.. .S...... * ...... gran2 ...... - m.. *.. ... S.. .-C yucl . .T T.. T.. G-...... C S.. . -C *.C -.* S.. A.. yuc2 ..T ... T.. G-...... -. . .C . - - . .C ..C ...... A.. yuc3 ..T ... T.. G...... C . . * . ,C * .C S.. S.. A.. zarl ...... -.. . -. - -. ..* zar2 ...... G-...... -. *. . .-. ..- ... guatl ...... ----. ... .-- m.. guat2 ...... -.. .-. S.. ... W.. S.. gyml ...... *.T ....*. . .C -.. . -. ,,C *. . . ,C AC. nudl ...... C -.. .-* .-C ... . .C AC. nud2 ...... G...... * -.. .*. --...... nud3 ...... C S.. . -C . S. -.-*.- ... .,C A.. nud4 ...... - - S.. . -. ..- .*. ce- ... .*- .S. megl ...... T.. .-T ...... C ... . *C . S...... C A.. me11 ...... C .-T ..T ...... C a.. .-. . .C ... ,.C A.. me12 ...... T ..T ...... C ... . -. . .C ... . .C A.C mayl ...... T.- ... ..A ...... C ... . ,C . .C ... ..C ..C may2 ...... T...... A ...... C ... . .C . .C -.. ..C ..C fur1 ... T.. T.C ..T ..T ...... --- S. S.. . .C ... .-.A*. fur2 ... T.. T.C ..T ..T ...... - -. . .C a.. S.. A.. ochl ...... T...... T ...... C .*. . .C .a- S.. a.. A.C melal ...... T...... - .-- . .C .-...... c -.. azcl ..T T.. ..C G...... C ... . .C .S. ..- .AC ... leu1 ...... T.. G...... C -.. .-. . .C --...C S.. leu2 ...... T.. G...... S. ... .S. . .C ...... *. . ..C ... levl ...... A G.T ..A ..-... . .C . -. . *c .a. ... C*. *.. ... A.C lopl ... T.. A.A ... T.A ...... C a.. a-. . -...... C A.. -*- lepl ...... T.C G,. ..T ..T ... . .C . -. .S. . .A ..- a.. . .C A.. th01 ... T.. T.C ... ..T ...... ,C . - - .*...... C-. ... --* .-c Reithl ...... T.C G,...... - - a*. . .A ... -.* C...... A.C Reich2 ...... -T ...... C ... . .A *.. --.C.- S.. ... A.C Boiol ..T ..C ... G-A ..T ..T ...... -. . ,A ..C ... C...... A.. Onycl ... ..C ..A ...... C .-• . -A ..A ... C.. m.. *.C A.. Onyc2 ... ..G ...... T . .A -.. ... C.. ... ,.. A.C -- -- 999 999 999 999 999 999 999 999 999 999 999 999 999 999 999 999 999 122 222 222 223 333 333 333 444 444 444 455 55s 555 556 666 666 777 901 234 567 890 123 456 789 012 345 678 901 234 5 67 8 90 123 789 012 mexl ATT ATC GGA CAA CTA GCC TCC ATC AGT TAT TTT ACC ATT ATC ATT CTA ATA mex2 ... . .T . . * ..- *.. ... -.. *. * . .C .- - ,.C . .T . .C * *T G.C mex3 .,C ... . .C .-a * S. -.. * *. .. * .*C . - - a.- ..T ..C ...... -- mex4 . .C ... . *C ... .-. *. . -.. - -. ..C . * - -.-. .T . .C *. * ... .-- mex5 ...... **. ... .*...... *. ... .--*.. *.* ... ..* .*. mex6 -.. .-. *W. ..* *** ... -.. . -. -.* .-* -.- - -. ... -*. . - * mex7 S.. ... --..-* -.. ..* -.. ..T -.* *-- * * * *.* ... --- *-- *.. mex8 . .A . -. . .C .*. *.. ... ,.T . - * .*C --..** - - * * .C .*- .-- - -. mex9 ... S.. .-. *.. ..- .S. ..A ..- S.- . - - ..* .*T . .C .--......
a-. mexlO . .C S.. -.* .---.- -.. . .A .-* ... .-* .** ..T . .C S.- . *. ..* stirl . .C . .T . .G -.-... -.. ,.T ..T ..C . .C ..C -.. - .C .--. .C T.. ..- stir2 . .C . .T . .G - - - ...... T ..T . .C ..C ..C ... . .C * - - ,.C T.. ... granl ...... --.. .G .*- --- -.------.--S.. ..T m.. -.-, .C .-- g ran2 ..- ... -.. ..- .S. ... m.. .,T . .C .---.- . .T . .C ..- --. ..* yucl . .C . .T .-. . .G ... . . * ..* . .T . .C ..- -.. -.* . *...... W. yuc2 . .C . .T ..- . .G S...... T . .C --- -.. -.. . *. -.. ... *.. yuc3 . .C . .T . - * . .G ..- ... -.. . .T . .C m.. *.. ..- - *. ... -.. ... za r1 ... . .T ... . .G ..- ... . .T ... . .C ..- . .C ..* ... . .T .m. *. * zar2 ... . .T . . * . .G ...... T ... . .C .*. . .c . .T . .c . .T .m. .*. guatl .--..* . - - ...... -.- -...... -.. . .T . *. ..- . .C *-. .a. güat2 . *. .S. .-* .S. ... S.. . .T -.. .--... -.. . .T . -c *. . . .C gyml . .C . .T . .C ... S.. . . - ... S.. . .C S.. . . - . *T . .C -.. - .C .-* nudl . .C . .T . .C -.- - .. -.. a.. S.. . .C --- -.* .,T . .C *. - -.- ..-
nud2 S.. . . * ..- ... . .- . . - , .A S.. .-. S...... *T . .C -W. *. * ... nud3 - -. --..-. .S. . -...... T S.. ..C . -. . .C ... . .C ... ..- ... nud4 ...... *-- -*. ..- . . - , .A S.. .*. . - ...... a.. a.. ... megl ..- ... *-- - - - G.. ... -.- S.. ..C .*C . *C m.. . -. .m. S.. ..-
.a. S.. me11 . ,C ... -.- S.. T.. S.. .S. m.. ..C . .C . .C . .T . .C ..T me12 .-...... - -*. S.. .a. *-- m.. ..C . .C ..C . .T . .C ..T .*. ... YI . .A ..- --...- -.-... -.. *.- .*C . .C ..C ... . .C - .T . .C ... my2 . .A .*. -.* -.. ..- . - - .-. *.* .,C . .C ..C -.-. .C . .T . -. .S. fur1 ... . .T .-. ..- T.. . .T . .T ..- -.- . .C -.. . .T ..C . .T .C. ..- fur2 * -. . -T -.. a.. T*. . .T ,.T ...... C a.. . .T . .C . .T .C - . a. ochl . .A . .T .*...- -.. -.* *. . ... - .C . *C - * S.. . .C --.. .C .S. .-. melal . .A . .T ... -...... A . .T . .C .*. - * m.* ... * .T ... T.. - a. aztl .CA . *T ... -.. . . - . .T -.. *.. . .C . .C . .C . .T . .C ... ,.C T.. ... a*. leu1 . .A . .T ..- ..G . . - .S. ..A .-* ,.C *-. ..C . .A . -. -.. - - *
* S.. leu2 . .A . .T S.. ..G -.. ... ,.A .*. . ,C -*. .C . .A - .T G.. -.-
levl . .A . .T . .C -...... A S.. . .C . .C ,.C ... . .C . . - S.. ... a.. lopl .CA . .T .-. -.. S.. . .A . .T S.. .CC ..C *.. . .T ... ..C ... lep1 .CA . .T . . - -.. S.. . . - ... . .T .CC . .C ..C ... .*. ..T --. ... th01 . .A . -T ...... S. .-. . .C ..C ..C ... . .C ... ..C ... Reithl T-A . .T . .C -.. ... S.. ..A ..T . .C m.- ..C T...... T . .C .*.
m.. *. Reith2 T.A - - * . .C S.* ... . * - . .A ..T ..C ..- ..C T.. -...... Baioi . .A . -...... a -.. . .A . .T -.. ..C *.- .-C G.. ... - .T ..C ... Onycl . ,A . .T . .T ..- ... --.- - - G.. . .C . - - ..C T.T .AC ..T -.- a-. * a. Onyc2 - .A . .T . .C . . - S.. *.. .-.-.. . .C --.. .C T.T ... . .T ,.C APPENDIX D
NICO'IRJAMIDE AD- DIMJCLEOTiDE DEHYDROGENASE SUBUNIT 3 (ND3) NUCLEOTiDE SEQUENCE
111 111 111 223 333 333 444 444 444 455 555 456 012 345 67 8 8 90 456 789 012 345 67 8 901 234 mexl AAT LrT ATA GTC TTA CTA AAC ACC TTA TCC TCA TGC TTA ATT
mex2 . S. .C. -0. ..T C.. *.T ...... *. * ..C mex3 . .C A.. -.. ..T C.. ..T ... m.. *.- -.- mex4 . .C -*. ..a ..T C.. ..T ... S. - ..- .. - mex5 .m. *S. -.- -.--.- --.. - * *. - mex6 .S. . . * -.- m.. ..a ... ..O ... mex7 . -. ... a.. -.-C...... m.. S., mex8 ... A.. m.. -.- --- *.- C.. ..T ... - - - . - - -.. mex9 . -. ... S.- a.* -.. ..T ... . . - .S. . . - mexi.0 . . - S...... -.* *.* -.. ..T .-. ... .*. *.- m.. stirl .S. .C. ... T.. -.- ..- -.. ..T AT. ..- *.- stir2 .-. .C. ... T.. ... S.. S.. ..T AT. ..- .-. ..- granl ... T.. *. . .AT C.. -.T a.. . . * ... ,.C gran2 ..- T.. m.. *.. -.. ... C.. . .T ATC .. - *-- ..-
yuc 1 .S...... T.. ..- . .T ...... A-. .T. *.- G.. WC2 ...... T.. ..- . .T -.. ... A*. .T. ... G.. yuc 3 ..* ...... T.. -.. . .T m.. ... A.. .T. a.. G.. za r 1 . . * .*T .,* ..T -.* .*T ... . * * -.. ... zar2 ... ..T . .T . .T ... .,T m...... - ..* guatl ... -.. . .T -a. C.. ..T ... ..- m.- ..- guat2 S...... -. .S. C.. ..T ..* .T. -.-. - - gyml . .c AC. .-. .S. C.. ..T ..a . .- -.- ..- nud 1 ... AC. *-. ..T C.. ATT ... ..a ..a ..O nud2 *.. . -. ... .S...... T ... . - - ..- ... nud3 ... AC. m.. . .T C.. ..T ,.. .--S.- ..*
.O *.* nud4 S.. .S. ..- .S. ..* -.. C.. ..T .T. . ... megl a.. --.m.. .C. C...... -T .TA ... ..T A.. S.. . .C mell . .C A.C ... AC. C.. T.. .-. . *. C.. ... *.G . .T -.-. .C me12 . .C A.. ... AC. ... T.. . .T a.. C.. ..T ... .-. *.- . -. ma yl . .C ..C ... .CT C. . TCT .S. .T. S.. ... A.. .*. S.. . .C may2 . .C ..C ... .CT C.. TCT .-. .T. m.. ... A.. . -. ..- ,.C furl --. . .- .C. . .T C.. T.. . .T .T. C.. ..T -.. . .T C.. S.. f ur2 ... . .* .C. . .T C.. T.. . .T .T. C.. ..T ... . .T C.. ... melal .S. T.A G.. .C. C.. T.. a.. ... C.. . .A A.. CT. C., * .C
* S.. ochl S.. ,.C .C. .C. ... TC. .T ..* C.. .-.A.. . *. - .C aztl ... a.. .C. .C. C.. TC. . .T G.. ..G ..T AT. .--C., - .c leu1 . *c -.G ... .C. C.. A.. m.. . .A C.. . .A ATC CT. C.. . .C leu2 . .C ..G ... .C. C.. A.. S.. . .A C.. . .A ATC m. C.. ..C levl ... ..A ... . ,A C.. TC. .TA -.. ..G A.G .---. - . .C lopl ... - .C G-G .C. C.. TC. ..T G-T C.. ... AT. .---.- ... lep1 . .C ..C ... .C. C,. T.. . .T GT . ..* . ,T AT. . .- -.O ... t ho 1 ... ..C ... .C. ... TC. --- G. T C.. ... A.* *-. -.- ..C Reithl CT . ..A .A...... AC. .CA .AA .AC .GT A.C .TA .GT CA. Reith2 . .C ... G.. . .T C.. TC. .-T G.. C.. . .T AT. a-. *.. S.. Bai01 . .C ..A ... . S. A.. TC. ..T .T. S.* ... ..T AC. -* - ..C Onycl .*. -.A ... .-. -.. AC. . -T .TT ..T AT. AAC ATG CCT .A. Onyc2 . .A T.A ...... AC. . .T .TT ..T AT. AAC ATG CCT .A. APPENDIX D. Continued.
111 555 556 666 666 777 777 788 888 888 889 999 999 000 567 890 123 456 012 67 8 90 1 234 567 8 90 123 456 345 mexl ATA ATC GCC TTT CTG CAA CTC AAC CTT TAT ACT GAA AAT
mex2 m.. ..A -*. . .C T-A *.- . .T ,,C *-. - S. * .C mex3 G.. G-. .S. a.. . -A m.. ..- ..C a-. --. -.. mex4 G.. G.. *.. --. . .A .*G *S. - .C *.. * -G --* mexS .-. . S. -.. --- . -. ... -.. -.-- -. .*. --* mex6 ..- . *. ... S.. ... S...... S.- - -. .S. .** mex7 ... C.. m.. -.. .-. . . * S.. S.. -.C ..C - S. . .G *.- mex8 . *- G.. . -. . .A m.. -.* ,.. T-A ..C -.a . .G ..* mex9 *...... -.. . .A S.. .. - ..T ... . .C -.. ... -.. mexl0 ..- . -. ... S.* ..A ..* *.* . .C -.a .-. ... stirl -.. --.S.. ..- . .A ..- .S. . .C -.. --. -.* stir2 S.. ... S.. ,.C . -A . . - --. . *C -.. --. ... granl ...... A ... . .A m.. -.. ..C ... S.. S.- gran2 ... . .T S.. .S. . .A a.. -.. . .C S.- a.. - *C yu'= 1 -C. ..* . .T - - - - *A S. * -.. .--. .C * ** -** yuc2 .C. -.- . .T . . - ..A ..* -*. .--. .C . -. -.* yuc3 .C. -.. . .T ..- . .A ..- ... . . - . .C - *. .-- zarl a.. ,.T a.. m.. . .A ...... C S.. * .. ... za r2 *.. . .T ...... - -A ... -.. . .C -.- -.. . *. guatl ... .*. . .T S.. *.. -...... C -.- -.- . .C güat2 .*. .-...... - ... *. . ... - *c *.* . ** .-- gyml G.. G-A ... S.. . .A -.- .S. ..C .S. . .C nudl -.. S...... ,C * *A --* *. . ,,C -.** *G . -C nud2 . . S.. -*. . .C . .A -.- m.. ,.C ... *.. ... nud3 ... . . - ... . .C . .A . . * ... ..C * * -.* . .C nud4 -.. .*. . . * -*- . .A S.. .. S.. S.. .-* megl W...... - .-- . .A * * - .. -.-.*- ... - .C me11 ..* * -. . - . .- . .A ..- S.. ..C ... S.. a*. me 12 ..* .-. . . * S.. . .A - .G . .T --* . .C ... * .C mayl --* . .T - -T . .C . .A ..- ..T ..C . .C .-. * -C ma y2 .-. . .T . .T . .C . *A . . .T . .C . .C *.. * .C fur1 ... . .T a.. .*. T. A ... . .T S.. .S. ..C fur2 .-. . .T -.- ... T.A ... . .T *** ... . -. * .c rnelal .CT G.T * .T . .C . -A ... . .T . .T T.A -.- S...... C ochl GC . . . - -...... *A ... T.A ..T ... , .C ... -.. .*c aztl S.. G-A ... -.. . .A ... . .A ..T ..A . .C ... . .- S..
..a S.. leu1 .C. G-T ..* . *C . .A .S. . ,T .-A -.* ... - * * leu2 .C. G-T ... ..C . .A ...... T A.A . .C ...... S.
.a. levl S.. . .T ... ..C . .A . -...... A.. *-- .-. * *c lopl .C. . .T . . -.. . .A ... . .T . .T A.G *.- m.. m.. .. - lep1 .C. *.. S.. -.- T.A ... . .T ..T A.A ..C ...... C th01 GC...... C . .A ... T.A ..T ... ..C ... .a. ..C
Reithl C.C ...... C . .T ... S.. S.. ..C - -. , .C ... ..C Reith2 ... . .T . .T ..- T.A ... ..T . .T A.A S...... -. ..C
a. Baiol C.. G.A . .A . .C . .A ... *W. . *T Ga. * .C --• . ..C Onycl T.. . .T ...... T m.. . .T ..T . .C ..- . .C .-. . .C Onyc2 T.. . .T ... ..C . .C -.. * .T . *T T.A -.a ...... C APPENDIX D. Continued.
- .. Ill 111 111 111 111 111 111 111 111 111 111 111 111 011 111 111 112 222 222 222 333 333 333 4 44 445 555 901 234 567 890 123 456 789 012 345 67 8 234 890 789 mexl TAC GAA TGC GGA TTT GAT CCG ATA AGC TCA CGC CCA ATA mex2 *.- ...... - -.- . .C . .T -.* . * * . .T .*. -.. mex3 .--..* ... .-. ..* . .C . .T -.- .*. -.. .*. ... mex4 .*- . . - -a. .a. --- . .C . .T --- .-. ... .*. ... mexS * *. ... .-. . *. - * - .*. .. - -*- ..a ...... -.* mex6 ...... *. .--*.- ... . . - --- .. * ... .*. ... mex7 ... -.. .-. .-. . -...... T --- **...... mex8 ...... -. -.- . .C . .T -.- . - * ... -*. ... mex9 -.* ...... -. --- . .C . .A --- ..- -.. -*. ... mexlO ... -.. . .T .-. --- . .C . .A -.- . - * ... *-. ... stir1 . .T ... .*. -...... T -*...... A -.. ... stir2 . .T ... . -. --..-. . -. ..T --- * - - - -A - -- granl . * * ...... --* . .- . .C .. -.. ..* ... -*. ... gran2 -...... T . .G -.* . .C ..a --...... -.- ... yucl . .T *. . .*. . . - - -- ... . .A --- ..- ... -.. . . yuc2 . .T . . - .*. . . - ..a ... . .A --- ...... *-. --. 0 yuc3 ..L -.* ... . - - ... --.. .A -.- ...... -.. ... zarl ... ..- . . - . . ..- . .C . .T --- ... -.. - -. .-. tar2 -.. . . - -.. . - - ..a . .C . .T -...... guat 1 ... -...... - ..- . .C ... -.- ...... -.. ... guat2 . .T ..- ...... - ,.C . .A --- ... . *. ... .-. gym1 .-. ..* ...... C ..T -*- . . * .*...... nudl -.. ..- . .T . . - ... . .C ..T --...... T -.. ... nud2 -.. .*. . .T -.- ... . .C . .A --- . -. . * - ...... nud3 ... ..- . .T --- ... - .c ..T -.- ... . .T *.. ... nud4 ... ..* . .T -.. ..- . .C . .A *.. -.. *.. --. ... megl -.. ..a .*. .--. .C . .C . .C --- ... . . - -. ... meli . .T ... -.- ... .-.. .C . .C -.. .-. .-. .*. -.. -.. me12 . .T . .G -.. .--... . .C . .C - -- G...... -.. ... may1 -...... -a. -.. . .C . .T --. .-. . .T -.. ... may2 . - - ... -.. . *. .--. .C . .T -.. . -...... T ...... furl . .T ... ..T ... . .C . .C . .C a. - . .T ...... -.. fur2 . .T -.. ..T .-.. .c . .C . .C *.. . .T ...... rnelal . .T -.. -.. .*. ... *.. . .T -.. G.. . .T ... -.. ... ochl . .T . .G . .T ...... T ...... *. ..G ... aztl ...... -.. .-...... C . .T -.- ... -.* -.. ... leu1 -.. -.. -.. . .G ..* ... . .A -.- . -C . .T -.. .-. Leu2 *.a -.* -.-. . * ..* ... . .A ... . -C ... -.. .*. lev1 . .T . .G . .T . .G --..*. . .T ..* .-. . .A -*. *. . lop1 . .T ... . .T ..- ..* . .C . .T ..- . *. - .T -.. -.. lepl . .T ...... *. ..* . .C . .T ..- .-- -.. ... -.- tho1 ... . .G -.. . -...... C -.- -. -.. ... --- Reithl * .T -*. -.- .*...... C . .A -.- . -. . .A . .C -.. Reith2 ... -.* ..T .*. ... -.. ..C ... .*. --. ... -.- Baiol ... ..- -.. . .G - -c . .C . .T - a. .-- - .A - * * -.. Onycl .-.*.* ..T . -C *. * - .C . .C - .G * -. ..A -.. - *. Onyc2 ... -.. . .T . . -.. . .C . .C -.* . -. -.. -.- *. . APPENDIX D. Continued.
111 111 111 111 111 111 111 111 111 111 111 111 122 222 222 222 222 222 666 666 677 777 777 778 888 888 888 999 999 999 900 O00 000 001 111 111 345 678 901 234 567 890 123 456 789 012 345 678 901 234 567 890 123 456 mexl TTC TTT CTA GTA GCA ATC ACT TTC CTA CTA TTT GAC T'TA GAA ATT GCA CTA CTA mex2 ... ..C ...... -T ..C ...... T ...... mex3 ...... T ...... mex4 ...... --T ...... mex5 ...... mex6 ...... mex7 ...... mex8 ...... T ...... ,.T ...... mex9 ... ..C ...... T ...... C ..T ...... mexlO ...... T ...... C ,,T ...... C ...... stirl ... ..C T...... C ..T T...... C .,T ...... C ...... stir2 ... ..C T...... C ..T T...... C ..T ...... C ...... granl ...... C ...... gran2 ... ..C ...... -.T ...... yucl ...... T ...... -,T ...... C ...... -.G yuc2 ...... T ...... T...... T ...... C ...... G yuc3 ...... T ...... T ...... C ...... -.G zarl ...... T ...... G ...... C ...... zar2 ...... T ...... G ...... guatl ...... guat2 ...... gyml ...... T ...... ,.T *...... nudi ...... - ..T ...... T-...... T ... ..G ...... nud2 ...... -T ...... C ,,T ...... nud3 ...... T ...... G T...... T .-. ..G ...... nud4 ...... T ...... T ...... megl ... ..C T., ...... T.. T.. ...-...... G ...... me11 ... ..C ...... T ..C ... T.. T...... C...... me12 ...... T ...... T.. T.. *.. ..T C...... C ...... mayl ... ..C ...... T ...... C --T ..G ... ..C ..C ...... maya ... ..C ...... T ...... -.T ..G ... ..C ..C ...... fur1 ... ,.C T...... T ..A ..T ... T...... G ..C ... ..C ... fur2 ... ,.C T...... T ..A ..T ... T.. ..*...... G ..C ... ..C ... melal ..T ...... T T.. T,. ..*... C-...... T ... ochl ... -.C ...... T.. T-. ..C ..T ...... C T.. aztl ..T ..C ...... T ..C ..T T.G T., ...... C T., leu1 ..T ...... C .-T T...... CI. .*...... *. -.T leu2 ..T ..C ...... -T ... ..T T...... C...... -.-. levl ... ..C ...... C ... ..A ... T.. T.. ..C ... C...... C ..T ... -.T lopl ... ..C T...... T ..C ... T.. T.. ..C ... C...... -... ..T ..- lep1 ..T ..C T.- ...... C ...... C...... T ... th01 ... ..C T...... T.. ..C ... -.G .....a... ..C T., Reithl ..T ..C ...... T ..T ...... C T...... C...... C ... Reith2 ..T ..C ...... T ..C ...... T...... C ... Baiol ... ..C ..G ...... T ... ..T ..C ...... C...... T ... ..C Onycl ... ..C T...... T ..T ..C ...... T C.. ..G ...... T ... Onyc2 ..T -.C ...... T ..C ...... C ... APPENDIX D. Continued.
222 222 222 222 222 222 222 222 222 222 222 222 222 222 222 222 111 222 222 222 233 333 333 444 444 444 555 555 555 566 666 666 789 O 12 34 5 678 901 234 567 123 456 789 012 34 5 67 8 901 234 567 mexl CTA CCA CTA CCA TGA GCC ATT ATA TAC AAC ATT AAT ACA ATA ATA TTA mex2 ... .*. .-. ..T G-C *. . .C...... mex3 . *. ... T*. .-* -.- -.. -.* ...... C.- mex4 S.. ... T.. .-- ..- *.. S...... C*. mexS S.. .-. S.. .-* m.. S.. -.- ... mex6 . -. .S. S.. .-- *. . --...... mex7 . -. - -. . -. .-- ..- a.. a.. . . - mexû .-. ..G T.. .-- ..T m.. a.. . -. mex9 S.. .S. .*. .-- .*- -.. *S. S.. mexl0 ... .-...... - .---.. ... *.. *. - m...... stirl . *T S.. T.. .*- ,*T ,.. -. ..C ..C ... S..... A.. stir2 . .T ... T.. *-- ,.T G.. -.- ..C - .C ... granl . *. .--. S. --- ..T ... .. - . .C ...... gran2 S.. --.. -. .-- ..T ... -.- ... S. * ...... yuc l **...... T ... ..- a-. ..C ...... A.G yuc2 .-. . -. . .T ..- ..- *.* ..C . . * ...... A-G yuc3 S.. *S. . .T ..- ... a.. ,*C ...... A.. za r 1 ... .-.A.. .-- ..T G.. ..C .-. za r2 ... .--A,. -a. ,.T G. * - .C ...
-S. * guatl ... S.. .*- -.. .C . .C ... guat2 . .G -.. . -. .S. -.- - .C .-. ..- ...... gyml .-. *S. T*. *-- ..- -...... -...... C.. nudl .m. W.. *.. ..- ..T ..C - .C .- - nud2 ... S.. m.. ... --.*.. . S. . *. nud3 .-. ... a.. ..- . .T . .C . .C ... nud4 .*. .-. .*. .-* . . - S.. ..* ...... megl -.. ..a T.. .-- . .T . .C ... m.. .C. S.. C.- me11 m.. .-. ... .-- ...... C . a. .C...... me12 T...... -- -.. A.* -.* ... S...... C. ... mayl . .T S.. T.. .-* ... ..T . .T . .C . .C T. - .C...... a may2 . .T .a. T,. ..* ... ..T . .T . .C . .C T.. .C. S.. C., " furl . .C .-. 1.. .*- .-G .-. .-. . .C .-. . * - ...... C.. fur2 . -c *.. T*. *.. ..G ...... C ... *...... C.. melal . .T ...... -.- ... ..T . .T .S. . .C .TT -.. -.. -.. ochl . -c . .C ... -.- .*.A.T ,.T ... ..- . * * ...... C.. aztl ..- ... *.. ..- .. C AGT . .T ... S.. GT ...... C.. leu1 .** ... a.. *...... T *.* .CC . .C . .T leu2 .-...... S...... T S.. .CC . .C . .C ...... levl . .T S.. T.. -*. ..G ... . .T . .C . .C .T. .C. ... A.. lopl - * * . .G . .G *. - ... A.T . .T ... . .C S...... C..
.m. lepl . .C .*. S...... A-T . .T ... . .C ...... C*. th01 . .C . .C ...... A*. . .T m.. . .C * -. a.. -.. c.. Reithl . .C . .T ..* -.* . .T CC- -...... A .TT .C. ... C.. Reich2 - .T . -- . .T ..a ... ..T . .T . .C W.. *. . Baiol T.. ..- A. C ..- .C. CCA G.T ... . .A ... Onycl . .T -.-..- .*- ... CC. . *T .C. ... .TT
Onyc2 . .T S.. . .T ..- ... CC. .TT . .C ... . .C APPENDIX D. Continued.
222 222 222 222 222 222 222 222 223 333 333 333 333 333 333 777 777 777 888 888 899 999 999 990 O00 000 111 111 122 222 123 456 789 345 678 901 234 567 890 123 456 012 678 901 234 mexl GCC TTT ATC GTC TCC GTT CTA GCC TTG GGC CTA TAT TGA ATA CAA -* mex2 m.. . .C . - * ... . . - ,,- - . .T ..A ..G T.. ..C .-- --* mex3 S.. * .c . * * ,.T -.-,,C . .T C.A ..A T,, . *C - ,- mex4 ..- . .C .-. . .T .--. ,C --* - .. C.A . .G T,- ..C .-- mex5 ..- ... S.. -.. - S. .-* .** .-, ...
-a. S. * .S. mex6 ... . . - ... S.. ,.. ... mex7 .-. ... a-. ..- * - - .,C S. - .,- ... mex8 S.. S...... - --.. .C S.- . -C . .G mex9 ..- S.. m.. . .T a.. -S...... C S.. mexlO ..- ... a.. . .T *.. .-...... C .S. S.. ... stirl ..- . .C *.. . .T ..T A- C T., .-- .*. .-G ... stir2 ... . .L- *.. . .T ..T A.. T. * *-* ... G.G *-- p-anl --* *.. --* - *. -.. ,.C ..- . .C ... G.. S.. gran2 T., -.- -.. . .T S. - --...* ...... C S.. .C. ... yuc 1 ... . .C . .T . .T . .T . .C ..* * .G T.. . .C *.G *.. ... yuc2 ... . .C . .T . .T . .T ,.C ..- . .G T.. . .C ..G ... . -. yuc3 ... . .C . .T . .T - .T .-C ..- . .G T.. . .C ..G ...... a-- *. zarl m.. ... - -. ... .-T ... . .C . za r2 .-. ..* ... . . * ..T ..C ... . .C --. guatl .-• ... -.. - -. - -. ..C ..- . .C .-. guat2 . m. ..- ...... - -. ..C ..* - .C . S. gyml ...... -. ... - -. . -C ..- . .C .a- nudl . -. ..- * * - S.. a.. .,C S.. . .C .--
S.. m.. * nud2 ...... S.. * .T ,-- . .C . . nud3 . -. ..- -.. . .T --.. *C ..- . -C ... nüd4 ... ..- ... .*T -.. a-. m.. -.. --. . .C ...... -. megl . *T . .C ... ,-. ..A --- m.- ,.. T.. . .C ..G G.T ... meIl .-. . .C --- . .T ,.T ..C -.* . .G T.. . -C -.. S.. ..* me12 ... . .C ... . .T ... ..C .-. ..A T.. . .C -.G ...... * *.. mayl - -. . .C - -. -.. ,m. ..C T,. ..G ... - - ... ..G may2 . -. . .C *-. - -. .-C T*. ..G ... .S...... G ..*
fur1 ... . .C S.. -.. ,.T A.. . . - . ,C .. - .C. .S. fur2 ..* . .C .-. *. ..T A,...... C S.. .C. ... melal . .T . .C a-. -.. -.. . .A ... . .C ..G G.. S.. ochl ...... S.. m.. -.. . .A T. * ,-C *. aztl ... .S. .S. S.. S.. . .C T.. ,.C ... leu1 . .T . . . .T ..a .--. .G T.. . .C ... leu2 -...... T S.. . .T . .G T.. -.a -.- ,.C ... levl -.. ... -.. . .T . .T --* S.* ..A ..- .* - *. - lopl T.. . .C ,.T . .G .S. --- ..- ... T.. .-. ... lepl a...... T S.. ... -.- .-. A...... C -.. th01 ...... -.* S.. -.. . .A ..- . .G T.. .-C -.-..* .*. Reithl T...... T . .A A.A ,.A S...... ,.C ... T.T .S. Reich2 ... . .C -.- . .A . .T .-C . . * ..G ..- * ,C -.-.C. - -. Baioi S.. ..- ,.T . .A ... A. C m.. . .G T.. .*. ... GCC ... Onycl T.T ... -.- ,.A . .T ,.C S.. ..G T.. . ,C ... C.T ... Onyc2 ... . .C ... . -A ..T ,.C m.- ..G ..* . .C ... GCT .-. APPENDIX D. Continued.
333 333 333 333 333 333 333 222 223 333 333 333 444 444 567 890 123 456 789 012 345 mexl AAA GGA CTA GAA TGA AC24 GAA
mex2 .S. .-. ,.T --- mex3 .-* .....C ..G mex4 .,...... T ..G mex5 . -...... mex6 . -. ..* *.* --- mex7 ... .-. -.. -..
mex8 S.. ... G-C ...
mex9 S.. ... --G... mexlO ...... G ... stirl ..- ... G.T ..G stir2 ... G.T ..G
granl S.* .--.-- gran2 S.. ,----. yucl .....T ... yuc2 .....T S.. yuc3 ..* *.T *.. zarl ... ..T S.. zar2 . .G -.C -.. guatl ...... G guat2 ..- -.---. gyml ... ,.C ... nudl --* -.-.-* ... ..C ... nud2 .., ,.- T.. a.. -.G S..
nud3 ..a S.* S.. ... ,.C S.. nud4 ...... T.. *.- -.* .*. megl ... ..-T.. - * - - *c . -G me11 ...... T.. ., . .,C .-- me12 ...... S. --T .,- a..... T.. ... ,,T ... WY~ ...... T.. ... ,.T ... fur1 ...... T.. --- *.c +** fur2 ...... T...... C ... rnelal .-.,.T ..G ochl ...... C ... aztl ...... ci .-G ..T -** leu1 . .G . .G T.. . . - . .T . .G leu2 ... .-G T...... *T . .G levl .-. .*- .-- lopl ...... ,T ...
lep1 ... ..G T.. .S.. ,C ... rhol ...... T.. ,.G . .C ... Reithl a.. ..C ... a.. ..C ... Reith2 ...... T ... Bai01 . .G . .C T.. *.. ,.C ... Onycl --* -.c ..-
Onyc2 S.. ..C .*. APPENDIX E
NICOTINAMIDE ADlZMNE DINUCLEOTIDE DEHYDROGENASE SUBUNIT 4L (ND4L)
111 111 122 222 222 223 333 333 4 44 444 444 345 678 901 234 567 890 456 789 012 345 678 mexl ATG TCG CCT ACC CTC AAC ACT ATA CTA TAT ATC TTT TCA TTC mex2 ..- - *. --.*T * .-.T. * .TC ...... ---. . =ex3 G...... * *Ta .a. .-* . .C S.. . - - ..- - S. mex4 . -...... Te ... .-- -.-.a- ..* -.. -* a.. a. mex5 .a- . S. S.. ..- .C. - - - ...... - . mex6 ...... -...... a. ... **- . * - . *. . *. *.*
*.* *. S.. a.. mex7 ... .*. m...... -.T. - . ..- mexû .--A, - ..T .T. .-- T. - . .C S.. . . - . - a -.a mcx9 a.. m.. .-. ... .m. T.. ------mexlO .--.-. - -- ... ..- T.. .---. . . . - S.. -.. stirl . *T T.. ,.T .T* -- * S.. .-...... - ..- ... stir2 . .T T.. . .T .T. --. - -. *.. ..- *.* *..
**. S.. .-• granl . - - ... --.. -. m.. T.. *.. ..* grzn2 . . - ...... - .C* T.. . .C ... C.. S.. C.. yucl .-.T.. . .T .T. .-.T.. - -. -...... -.. yuc2 . . - T.. . .T .T. .a. T.. .-. -.. . .- -.- -.. yuc 3 *.- T.. ..T .T. a.. T.. .-. *.* ......
S.. *.. zarl . .T . -. S.. .T. .*. .-c *.. ..* ..A zar2 . ,T -.-. *. .T. .-. -.. .*C .C. . .C ..- ..T
m.. S. S.. guatl -S. --.. -. . . .-.T.. . .C ... -
.m. guat2 .a- ... m.. S.* --.T.. .-. . -. -.- -.. gyml ... . . - ... .T. -*. S.. .S. m.. .m. S.. -.. nudl ..- ..* ..- .TI .*. T.. ..- .S. m.* m.. nud2 ...... -.. . ** ... -.. .-...... * ... nud3 *.. *.* ... .T. .-.T.. . .C ..- ... ..* ..* nud4 *.* -.- m.. ... -a. T.. .a. .CI ... -.- S..
.a. .*. .a- .S. meg 1 S.- T. - S.. .TC -.. . .C .*. me11 ... T.. --..T. ... T*. . .C -.--.. ... C..
..a .S. me12 ...... T T.. * S. .T. ... T.. . .C ... . .C mayl ... *.A -.- ... T...... TC --.T.. .S. .Cl' . .C m.. C.. n may2 . . - . -n -.- . .T T...... T. .-.T. * .S. .CT . .C S.. C..
S.. fur1 ... ..A T.. S.. T.. * .T .T. m.. .- - . .C - .T ... C.T fur2 ... ..A T.. -.. T.. . .T .T. ... .- - . .C * .T .-. -.. C.T melal ... C.A T.. *.. TCT ... ,T. ,-G T.. .T. TCA ... -.. - *T ochl ... ..A T.. -.. S.. . ,T .TC . -. -.- .T, .,T . .C . - - C.. aztl ... C.A T.. S.. T.T . .T .T. --.T.. .TC . .T ... -.. . .T
S.. m.. leu1 ... C.A T.. S.. TC. . .T .T. S.. * - - .TC TCA ...
m.. S. leu2 ... C.A T.. .S. TC. . .T .T. .-. . - - .TC TCA -.. . levl ... ..A T.. .TA T...... TC .. - T.. *.- . .T . -. ... C.T lopl ... ..A T.. . *T T.. . .T .T. .---. - ... . .T ... . -. . .A lepl ... C.A T.. ... T.T . .T .T. .-. -.- +. * . *T . . . . - C-T th01 ...... T.. ... A.T . .T .T. C. - . . - .T. . .T . .C ..- -S. Reithl ... C-A T.. . .A -...... TC .-..-. .T - . .T .-. . .C .S. Reich2 ...... T.. --.T.A ..* .TC ..- ..* m.. GC . .-. . -. S.. Bai01 ... A.A T.. . *T A.T . .T .T. . .T --- .TC T.. . *C . .T --. Onycl ... C.P. T.. . .T A-T -.. .T. T.. a. - .T. ... . * * . * . .A
*.- S.. Onyc2 ...... T.. ... T.A m.. .TC .--S. - ... GC . --. 111 111 111 555 556 666 788 888 889 999 999 999 000 O00 O00 567 890 123 901 5 67 890 123 456 789 012 345 67 8 mex 1 ACT CTC GTA TTC CGC CAC ATA ACA TTA TTA TGT CTA GAG GGT ATA mex2 ... ..T ... ,.G a.. c.- . .C T.. ..G mex3 . .C T,. ,.G mex 4 S.. a.. -.-. .C T.. . .G mex5 ..* *.* --- .S. m.. mex6 S.. m.. -.- -.. --- mex7 . .C ...... -.. C...... mex 8 . .C ..A - ...... C T-. mex9 . .C . .T .. - *.. --G ..C T.. mexlO . .C . .T ...... C.G ..C T.. stirl . .C . .T A*. C.. C-. ..C T.. stir2 . .C . .T A., C.. C.. ..C T.. granl ..C .,* **. ... C.. ..* T.. gran2 . .C . .T ...... C T.. yucl . .C - .T A.G C.. ,.. ... T.. yuc2 ..C ... A.G C...... , T.. yuc3 . .C . *T A.G C.. S.. ... T.. zarl . .C . .T .-. S.. -.. C.. ..C T.. zar2 . .C . .T ... S.. C.. . .C T-. guatl . .C .a.... S.. ... T,. guat2 ..C ...... - T.. gyml ... A.A ... .m. -.-. .C T.. nudl . .C . .T A.. ..- C.. ..C T.. nud2 . .C . .T .. - ..- *.G . .C T.. nud3 . .C . .T A.. S.. ... C.. . .C T.. nud4 . .C . .T ..G ... ..G . .C T.. megl ..C ... A.. C.. C.. . .C T.. mell ..C ... A.. --.C.. . .C T.. me12 ...... A.. ... C.. . .C T.. ma yl ...... A.. ... C.. . .C T-- na y2 ...... A.. ... C.. . .C T.. fur1 . .C . .T A.. ... T., fur2 - .C . .T A.. -.-S.. m.. S.. ... T.. melal ..A T.A A.. ..T ..T C.C C.. ..C ..C ochl -.C ...... C.. C.. . .C T.. aztl ,.C .....- ...... C T,, leu1 .....A . *G ... C.. ..C ... leu2 ..a. .A ... C.. C.- ..C ... levl . .C . .T A-. ... C.. . .C T.. lopl . .C ..T A.. ... C.. ..C T.. lep1 ... ..T A.. ..G C.. ..C T.. th01 ...... -.. c.. ..C T., Reithl ... ..A A-. C.. C.. ..C .., Reith2 . .C . .A A.. ... T., Baiol . .A . .A A.. .., T.G Onycl ... ..T A-. ..C ... Onyc2 ..C ... A.. -.. S.. ... T.. APPENDIX E. Continued.
111 111 111 111 111 111 111 111 111 111 111 11 1 111 111 111 111 011 111 111 112 222 222 333 333 333 344 444 444 4 4 5 555 555 666 901 234 5 67 890 456 789 012 345 678 901 234 5 67 8 90 456 789 012 mexl ATA CTA TCA CTA TTT ATT ATA ACC ACA ATC ACC TCC CTC AAC TCC CAT TCA ATA mex2 ... -.- --.... -.- ..C mex3 -.. .*. -.. *. . .*C mex4 ..* . -. -.. --- ..C mex5 ...... -.- -.- -*. mex6 . * - . . -.. -.- ..- mex7 * - - ... .*. *-- ..- -.. mex8 m.. T.. -.. -.. --...... C mex9 *. * ...... - ,.C mexl0 -.- -.. ..* ... ..C stir1 *.- .T- ... . -T . .C stir2 -.-.T, .. - . -T ..C granl . - - ... *.- **. ..C gran2 ...... -.. -.-*.- .-- ..- yucl T.. G-A *. . -.. . .A . .T ..C yuc2 G-A ... *.. . -A . *T ..C yuc3 G.A ... -.- . *A . .T . .C zarl *.- . . * ... .--. - - ..C zar2 T...... -. .*- . -. ..C guatl .-. -.. .*...... guat2 -...... *- .*. .-- gym1 T...... -. .-- . .C nudl . -. -.. . .T .*. - .C nud2 .a. ... .-. -.. . .C nud3 ... ..* . -T ... . .C nud4 *...... *. . .T . *T . .C rnegl -.. T...... -. ... - -. . .C me11 T.. -.. . ,T . .A . .T ... . .C me12 -.. T.. .*. . .A , .T *.. ..C may1 T.. T. - . .T -.- -a. -.. .,C may2 T.. T...... -...... C furl TI. ..* . .T .*- . .T ... fur2 -.. T.. . . - . .T ... . .T ... melal T.. . .G . . * * .A ..T . .C ochl T.. T.. . . * . .T . .A ..- .,C aztl T.. . .T * .T -** ,.T .,A leu1 . .T ..T -...... C leu2 . .T ,.T * - - ..a .*C lev1 ...... T ,,A . .T . .T ..C lop1 T.. G., ...... - - ... ..- lepl ..a -.. G.. . .T . -. -.. . .T . .C tho1 T.. T.. . . - ... . .A -.- . .C Reithl . .C -.- . .T ..A -.. . .A ..C Reith2 ... T.. . .T . .A -.. . .A . .C Baiol T.. T.. . .T ... . .G . .A ..C Onycl T.. T.. . .T ..A . .A . .A . .C Onyc2 ..- --.-.. . .A . .C 111 111 111 111 111 111 111 111 111 111 122 222 222 222 222 222 666 666 67 7 778 888 888 888 999 999 999 900 000 000 001 111 111 345 678 901 890 123 456 789 0 12 345 67 8 901 234 567 890 123 456 mexl ATA ATA TAC CCC ATT ACC ATT TTA GTA TTC GCC GCA TGC GAA GCA GCC mex2 . -. . . - --...... - ...... T mex3 . -. *.. .a. ..T ..- ... . .G * mex4 .S. .--. - . *T . -- .*. . .G mexS . -. S.* . * - -*. a. - S. - ... mex6 --. ..* . S. - m. ..- ..* S.. *. mex7 S.. ..- . -.. . . - -.. ... mex8 .-. ... . - - ..T . . - S.. - .G mex9 . S. ..- *-- ..T -.- S.. * -. mexlO ...... a* ,.T a.. *.* ... stirl ... .--. - - GTT . *- C.. ... stir2 ... * - - - - - GTT - - - C-. - - - granl -** ..- .S. -.. ... S.. .S. gran2 -*. .*- .S. ..T . .C C.. .-. yucl . .T . .A -* - GTT ..- C.G *.. yucit . .T . .A *a. GTT *.. C.G a-. yuc3 . .T . -A **. GTT a.. C.G .-. zarl -.. -.. --- S.. * S. ... --. zar2 -.. .--.a. S.. ... S.. . -. guatl ... ..- --- ... S.. ..- . -. guat2 -.. . . - .S. ... S.. -.. . -. gyml ... ..- ... ..T -.. S.. .,G nudl . *T ..- .*. . .T m...... -. nud2 ..- ..- ... ,.T ... *. - . -. nud3 . -T ..* *. . . .T *.. * - - .-. nud4 . S. ..* ... . .T -.. S.. . -. megl . . - . .T ..C GTT . .C ...... ne11 ... ..- . .C G.T ... -.. ... me12 *.. . .T . .C GTT ...... -. ma y i -.. .S. m.. GT . ... -.- . ,G ma y2 ...... GT . ... .--. ,G fur1 . . - . .A . .C GTT S.. C. - . - - f ur2 . . - ..A . .C GTT S.. C.. . . melal S.. -.. ... GT . . .C C.. . - ochl . .T -.- .-.GT . . .C C.. .S. azti . .T *.. a.. GT . . .C ...... leu1 ... . . - .-.GTT . .C ... .-- leu2 ... ..a ... GTT . .C ... . -G a.. levl ... ..- - -C GT . . . - ... . -. lopl ... S. - - -. GTT ..- C.. -*- lep1 ... *. - . .C GT . . .C C.. . S. th01 . .T -.. . .C GT . . .C ... -.- Reithl ..T ... ..T A.A ..T ...... GT...... T ..A ...... Reith2 ...... T T.A ..T ... ..C GT. ..C C...... T ...... T ...... T Bai01 ..T ...... T.A ...... -C GT. .CC C.. .-T ... ..A ... ..T ...... Onycl ..T ...... T -.A ... GT. ..C C...... T ....-. -.T ...... -.T Onyc2 .....*.*...... -.T ... GTT ..C CI. .,G -.T .-T -...... T APPENDIX E-Continued.
222 222 222 222 222 222 222 222 222 222 222 222 222 111 222 222 233 333 444 444 444 555 555 555 5 66 666 666 667 789 012 345 901 5 67 123 456 789 012 345 67 8 901 234 5 67 8 90 mexl ATC GGC CTA CTA GCA GTA TCA AAC TCA TAT GGA ACA GAC TAC GTA
S.. , m.. * mex2 S. - . .G -.. -.- .T --- -.- ... .-. . - .-.
*-- .C S.. **- *-- mex3 S.. .-. . -...... - -. . -A. .-.
S.- .S. *.. *-- mex4 -.. . - - -S. ... *. - . .C -.- .-* ---
S. S.. * a-- mex5 a.- .-...... *.. . - - .---.- . . - .- mex6 ..* . - . S. m.- .-...... - . . * -.-S...... *-- -*- *.a *-. ,.G .S. mex7 S.. . -. . .* ..- . . - . .T .-. - --
.m. * .T *-. mex8 ,.G S.. . - - -.- ... .-. . .C -.- ..* - - mex9 ..- ...... * -. . . - ..- ..G S.. ... -.-. --
S. S.. m.. .S. * * * -* mexlO *.. * S. . . . - . . * * *G ...... stirl T.. . - - . - - ...... *- . .C -.- S.. . . * ..T . .G
S. * stir2 T.. S.. . -.-.*. .-. ..- . .C -.- ...... *T ..G gronl ... T-. . -. a.. a.. ..* . - - . .C - .G ... .S. . .T .-. a.- .-a S.. W.. * .G *T gran2 ..* S.. -...... --...... -.- . yucl ..T ...... T.. . -. ... .-T * ** . - - . .C m. - *.. . .T . .T .-- yuc2 ..T ... -.- T.. . -...... T *. . .--. .C *.. S.. . .T ..T -*- C1 S.. * -* *S. .C .T .T *-- yuc3 ..T ... S.. 1-, . - - ..T . -.- ... . . za r 1 ..- . * . -. ..- .-. .-. --- .-.-A- ... . . **- -S. za r2 -.. .-. ... -.- .-. *-. -Sm . - - -...... -. -.. *-- a. --* a.. guatl ... m.. . ..- .-. .-. - .G ...... T guat2 T...... -.-*-. .-. .--*.. -.- S.. . . - ..T *.*
S.. S.. gyml . - . .G S.. ..- .S. m.. .-- -. --- .S. ..- nudl -.. T-. ..- ..G ...... a - . S. -.- m.. . . - . . - ... nud2 -.. .-. .-- ...... --..*. .---...... a. ..a .S. nud3 ... . - - ... ..G ... . -. ..- ..- -...... - -.. .-. nud4 ...... megl ..T ...... me11 ... ..A ...... T.. me12 .....A ...... mayl ... -.T ...... T.- -.. may2 .....T ...... T-.... fur1 ...... T.G fur2 ...... T-G melal ..T ... T...... T.. ochl ..T ...... -.G aztl ... ..T ...... G ..G leu1 ..T ...... * ..G ... leu2 ..T ...... * ..G ... levl ... ..T ...... lopl ..T ...... T ...... lepl ..T ...... -.G th01 ..T ...... G Reithl -.T ...... T ..C ..G Reich2 -.T ...... T ..T T-. Baiol .....A ...... Onycl .....A . .T . .T . .G . .G Onyc2 ..T ..A ..T ...... G APPENDIX ElContinued.
222 222 222 222 222 222 222 777 777 888 888 888 899 999 456 789 012 345 67 8 901 234 mexl AAC CTC AAC TTA CTA CAA TGC mex2 . *T ..G mex3 - .G
mex4 ..G S.. mexS mex6 mex7 mex8 mex9 mexlO stirl stir2 granl gran2 yu cl yuc2 yuc3 zarl zar2 guatl guat2 gyml ..-
nual S.. nud2 .--
nud3 a.. S..
nud4 .S.
megl m.. me11 --- .-. me12 ..- C.. ...
S.- T..
may2 - S. T.. fur1 C..
fur2 C.. S.. melal C.. . .T ochl C.. T.. aztl C.. leu1 C.. leu2 C.. levl C.. lopl C.G lepl C.. th01 C,. ... Reithl C.. T.. Reith2 C.. T.. Baiol ... Onycl C..
Onyc2 C.G S.. APPENDIX F
NICOTINAMIDE ADENNE DINUCLEOTIDE DEHYDROGENASE SUBUNIT 4 (ND41
111 111 111 122 222 222 223 333 333 333 444 444 444 455 555 123 456 789 012 345 678 901 234 567 890 123 456 789 012 345 678 901 234 mexl ATG CTA AAA ATC ATC TTC CCC TCT ATT ATA CTA CTT CCA CTA ACC TGA TTA TCA mex2 ...... -G ..a... mex3 ... T...... G ... mex4 ... T...... G ... mex5 mex6 mex7 ...... mex8 ... T...... C.. ... mex9 ...... --GC--... mexl0 ...... C*. ... stizl ... T.. *.*...... *...... T.. ..A ... T...... stir2 ... T-...... A ...... T.. *.A ... T...... granl ... T., ...... *...... C.. ... gran2 ...... T...... C.. ... yucl ..* T...... T ...... T.. T.A ... G...... C.. ... yuc2 ... T...... T ..T ...... T.. T.A ... G...... C.. ... yuc3 ...... T ...... T.. T.A ... G...... C.. ... zarl ... ..G ...... C.. ... zar2 ... ..G ...... C.. ... guati ...... C.. ... guat2 ...... gyml ...... C.. ... nudl ...... C.* ... nua2 ...... C.. ... nud3 ....*...... C.. ... nud4 ...... C.. ... megl ...... C.. ... me11 ... T...... C., ... me12 ...... A ...... C.. ... YI ...... T ..T ... ..C .-C ... T.. T.A ...... C.. ... ma y2 ...... T ..T ... ..C .-C ... T.. T.A ...... C.. ... fur1 ...... T ... ..T ...--...... T.A ...... T ...... fur2 ...... T ... ..T ...... T.A ...... -.T ...... melal ...... T ..T ...... C ..G ...... C ...... ochl ...... T ..T ...... C ... ..C ..A ...... -...... aztt ...... T -.T ..A ..A ... ..C ...... T.A ...... -G C.G ... leu1 ...... T ..T ..T ..A .-C ...... G ..C ...... C.. ... leu2 ...... T ..T ..T ..A ...... G ..C ...... C.. ... levl ...... A ... .CC ... T.. ..A ...... C.. ... lopl ...... T ..T C.T ...... T.. T.A ..C ..T ... ..G .....- lepl ...... T ... ..T ...... C ..A ..T ..T ...... th01 ...... T ..T ...... - ... ..C ..A ...... Reithl ...... T ... .-T ..G ..C ...... T.A ..C ..T ..T .-. C.. ... Reith2 ...... T ...... G ..C ..C ... T...... C .tT --.--.-.--.. Baiol ... T...... T ... ..T ..T .-A .-...... C ..C ..T ...... C Onycl ...... T *.T ..T ...... cc *...... A ..T T...... *....- Onyc2 ... T...... T ..T ..T ... ..C ..C ... ..G T.A ... ..G ...... APPENDIX F. Continued.
111 111 111 555 556 666 666 666 777 777 777 788 888 888 889 999 999 999 000 000 000 5 67 890 123 456 789 012 34s 67 8 901 234 5 67 890 123 456 789 012 345 678 mexl AAT AAT AAA TGA ACC AAT GTA ACC TCT AAC AGC TTT ATG ATT AGC ATG CTC TCT
..a * S.. .A -C ..A ..T .C mex2 S.. ... *T. ... T.T . - ...... mex3 --. ,. . GTT ,*T ..C . .T *.- ..C . .T . -C ... G.A ...... mex4 ...... GTT ,*T ..C . .T .*a ..C . .C ..C ,.. G.A .*. S.. mex5 ... --. * -. .-. ..A ..- mex6 ... S.. -.. *-- .*- ... .--. .A ... mex7 ...... G.. ..T **c .*- . .- ..C ..- . .C mex8 ... .., ,TT .,A ..A . .T - - - - -. ..T . .C mex9 ..* S.. ..C ... . * ..C . - - . .C mexlO ... -*. ..C S.. --- - S. . ,A .*C ...... stirl ... ..G .TT a.. ..C T.. . - - - S. ..A ... ., . C-A A.. stir2 ... ..G .TT --,.-C T., ------.,A ..- . . C.A A,. granl . .C ... G.. ..T ..C . .T -S. .S. ..A .-c -** -.-..T gran2 . .C ..* G.. -S. m.. .T. ..- ..- -*- m.. ..A . *C ...... yucl . .C ... .T* ..C AC. --- *.- Cs- -.- -.. . .A .*. ... G.A ... ..C yuc2 . .C ... .T. . .C AC. m.. ... C.. . - - S.. .-A . -. ... -.A .....C yuc3 . .C ... .T. . .C AC. *. * ... C.. . - - - S. .*A .- - ... G.A ... ..C zarl . .C ... .T...... 1- . -. S.. . *. ..* ... ..A ..A S.. ..A .C zar2 ... . .* .T. m...... T . - - ... . - * . .C ...... * .C .T .C guat l . .C *-• G.. -.. ..C . .T .--- -. . - ......
.a- .C .S. .T -C guat2 . .C *.- G-. m.. m.. ..C . .T --.. * * ...... C G.A gyml -*. ... .TT . .T ..C . .T ... - *. . .T ...... nudl ...... T. . . - ... T.T .*. * * - . . - . .C . .T . .A .a.... nud2 .-. *. . ..C ..T ... -.- . . - . .C ...... C nud3 ... *.. .*. T.T ... . - - .- - . .C . .T . .A .. * -..
a.. .W. * .T ,C ..C nud4 S...... - ...... *.
S.. .T .C C.A megl . .C S.. S.. -.. . .C C. - ...... ne11 . .C S.. ..C C.. ..- . .C . .A . .C ... C.A ... ..C
S.* S.. a T-A *-c me12 . .C S.. f-. ..- T...... C . .A .*. --.
m.. S.. ma y1 ...... TT a-. a.. .S. ..C T.. -.- . .C ,.A C.A ..A ..A
.S. may2 ...... -TT S.. ..C T.. ..* . .C . .A S.. C.A ..A ..A fur1 . .C ... .TT S.. ..C T.. W...... A . .C ... C.T ..A ..A fur2 . .C ... -TT ... ..C T...... -. ..A . -C S.. C.T ..A ..A melal ...... GT. - *. ..C T.. -...... *A . .C * .. T.. ACT ..A ochl . .C S.. ..C T.T . .T . .C ,*A . .C ... C.A ... ..A , aztl . .C ...... C C.T ..T W. * ,.A .C ..T T.A T.A ..A leu1 . .C ... G.. . .T ..A T.. S.. *. . T-A ..C ... T.. GC. ..A leu2 . .C ... G.. ..T ..A T...... - T.A . .C ... T.. GC. ..A levl -...... T. S. - ..C T.. . . - -.. . ,A ..C ... C.A T.A ..A
S. .C ,.A .C C.A ..A ..A lopl S.. .*. -T- - ..C T.. . . - . . ... T.A lep1 . .A ...... T. --.S.- ..T ..C C.. ... ,.C . .A . .C ... T.A ..A th01 . .C ..C ... ..C ..- ..- ... T.T ..T . .C ..A S.. ... C.A ... ..A Reithl . .C ... CT- . .C AC. *.- ... T.. . - * . .C C.A ..C ... T.. A.. ..A Reith2 -.. .GC CT, ... AC. a.* ..C T...... C C.A . .C ... C.A ACT ..A Baiol ... ..C CT. ..C A.C . .T ..A T.. . .T . . - . .T . *T T.A ..A A. * Onycl .G. . .C TT. ..C ... . .A ... T.T ..T ..C . .T .-. ... C-A T.. . .C Onyc2 . .C ..C CT. ..C ... . .A ... T.T ... . .C . .A ...... C.A ... ..C 111 111 111 111 111 111 111 111 111 111 111 111 111 111 011 111 222 222 222 333 333 333 344 444 445 555 555 666 901 234 123 456 789 012 345 678 901 234 8 90 123 456 012 mex 1 ACC ATA TTT TTA TGA CAA AAT GAC ATA AAC ACT CCA CTA TCA TTA TTC mex2 *.. C.. -.* . .T . .A ... T.. C.. mex3 G.. . *. ..T . .C ... T., C.. mex4 G...... T . .C .-. T.. C..
S.. mex5 -S. mex6 .- - *a* 0.- mex7 C.. S.- a.. mex8 T.. CI. . -. mex9 --.T.. a-. mexlO --- ... T.. srirl A-. C.. stir2 A-. C-- granl -m. --. gran2 . .T - * . a. yu cl T.. C.G A.. yuc2 T.. C.G A.. yuc3 T.. C-G A-. zarl T.. C.. zar2 T.. C.. *. guatl m.. . guat2 ..* S.. m.. gyml G.. T.. C.. S.. nudl C.. T.. nud2 m.. T.. nud3 -.- C.. T.. nud4 T.. .-.T.. meg l .C. A.. me11 ... .S. C.. me12 . .C .T. C.. ma y 1 C.A .T. A.. may2 C.A .T. A.. m.. fur1 C.. .T. C.. fur2 GT . C.. .T. C.. melal G.. . -. TT. C. - ochl G. T C.. ..- .T. C.. aztl G.. C.C C.. TT. C*. leu1 G.. TT. .-. leu2 G. T - * - m.. TT. ... . -. levl G.. C-C C.. .TF C.. T.. lopl G. T C.. C.. TT. C.G T.. lep1 G.? C.C C. - .T. T.C C.. th01 G-T C.. ..- .T. T.C C.. *.. Reithl .TA C-C C.. .-. .S. .T. T.T C.. T.. Reith2 C.A C. - G.. . .T .T. T-C C.. T.. Baiol A.A . -. G.A AT. T.C A.. T.. Onycl ACA CC. ... TT. TCT C.. Onyc2 A.A CC. ... TT. TCT C.. APPENDIX F. Continued.
111 111 111 111 111 111 111 111 111 111 111 111 122 222 222 222 222 222 666 666 677 777 777 778 888 888 888 999 999 999 900 000 O00 001 111 111 345 678 901 234 567 890 123 456 789 012 345 678 901 234 567 890 123 456 mexl TCA ACT GAC CCC TTA TCA TCC CCC CTC ATC ATC CTA ACC ACA TGA TTA CTA CCA mex2 . -. S.. S.. S.. C.. .-. --- .-T -.. mex3 * .T C...... T T.. mex4 -.. C...... T T.. mex5 - -. mex6 -.a .S. --- mex7 ..- C.. .-. --.*. - mex8 ..T .*. ... C.. mex9 ... C.. ... C.. mexlO ... c...... stirl .*- . .T C., ... T.. . .G C-. stir2 .-- . .T C.. ... T.. . .G C.. T.. granl . -- .** C*, -*- .-- gran2 S.. ... C.. .-. -.- ... C.. -.. yucl .-. T.. C.. S.. . .T T.. ... C.. T.. yuc2 *-- T-. C.. . .T T.. ... C.. T.. yuc3 .-- T-. C.. . .T T.. ... C.. T.. zarl .a* .-.C.. . .T T.. ta r2 .-. ... C.. . .T T.. guatl .a. ... C.. guat2 .a. ... c.- gyml .*...... ---.. nudl .-- ... C.. .,. C.. nud2 . .T C.. ... C.. nud3 ... C.. . .G C.. nud4 .-.C.. .--m.. meg 1 -.-c.. ..- C.. me11 . .T C.. *.* ..* me12 * -T C.. . .G -.G -.. mayl ..T ... ..G S.. T.. ma y2 ,*T ...... -.G ... T.. f url T.A C.. ..T ... . . - ... C.. fur2 T.A C.. .-T *.. ..- .,. C.. melal T*. C.. . .T T.. ..- .S. C.. ochl T.A C.T ..T T.. m.. ... C.. aztl ..A ... . .T T.. ..- ... C.. leu1 T.A ,.. ..T ... -.- leu2 T-A C...... levl T-A C.. ..a .S. a.. ... C.. lopl T-A C.. ..T ...... C,. lep1 T.A C.. ..T . .G .-C --. th01 T.A C.T ..T ...... C.. Reithl .rP, C.. ..T T.. ... C.. Reich2 .AA C.. ..T T.. ... C.. Baiol ..T ... . .T ..T ... C.T Onycl ..A C.. ... T.. ... C-T Onyc2 * .A C.. ... T.. . .G C.T APPENDIX F. Continued-
- - 222 222 222 222 222 222 222 222 222 222 222 222 111 222 222 233 333 333 334 444 555 566 666 666 789 012 345 901 234 567 890 456 678 901 234 5 67 mexl CTA ATG CTA GCC AGC CAA AAC ATA ACA GAA CAA AAC mex2 ...... T.. .-. . *...... T mex3 ... . .A ... .-. . *. -.. ... mex4 ... . .A -.. .-. ... -.* - -. mex5 ... ..* ..- ... -.. .--... mex6 ... ..- -*. .-• .*. -.--.. mex7 ... ..* .*- ... --. .-.. -. mex8 ... . .A *.- ... -.* . * - mex9 ... . .A -** ... -...... *. mexlO ... . .A .- - ...... stir1 ... . .A - -. . .T ... .*. ..* stir2 . ., * .A - * . .T -.. --.... granl - -. *a- - - - ... -*. .-• -.- gran2 ... . .A . . - ... -.. --.. .T yucl ... . .A ...... * -.. ... yuc2 . *. . .A . . - ... . -. -.. ... pc3 ... . .A ...... --.. -. zarl ... . .A -...... --.. .T zar2 ... . .A --...... T guatl ...... - ..- ... . -. ... guat2 ... - --- ...... -.. *.. gym1 ... . .A T...... *. ... nudl ... . .A -.- .*. . *...... T nud2 ... . ,A . - - ...... -.-.-. nud3 ... . .A -.- **. ..- ... . .T nud4 ... .-* ..- - -. .-- .*. ... megl ... . .A T. - .** ... **. . - * me11 ... . .A ..* +-- ...... ** me12 ... . ,A . .G -...... G . -. may1 . .G ..- . . - ...... T may2 ... ..- ..- ...... *.* . .T furl ... . .A T.. . .T ... .T. . .T fcr2 ... . .A T. * . .T .-. .T. . .T melal . .C .CA ..G .-. ... TT . .*. ochl ... . .A -.- ...... azrl ... . .A T. * ..- .-. -.. . .T leu1 ... . .A . . * . .T *. . .T. ... leu2 ... . .A *.- . -T -.. .T. .*. lev1 ... . .A T.. .-- . -...... T. ..T lop1 ... . .A T.. . .T *. . T.. ... TT . ..T lepl ... . .A ..- .-. *-. T.. . .G ... . .T tho1 ... . .A . .C -.- ... .*C . .G -.. .-. Reithl ... . .A *** .-- ... ..C .., .TG C*. Reith2 ... . .F. ..- ...... T ... TTG C.T Baiol ... . .A . .C . .T . .C ... ..G T.T ... Onycl ... . .A * .T . .A ... TT . ... Onyc2 ... . .A T.. . .A ... GTG . .T APPENDIX F. Continued.
222 222 222 222 222 222 222 222 222 223 333 333 333 333 333 333 333 333 777 777 777 888 888 888 899 999 999 990 000 000 000 111 111 111 122 222 123 456 789 012 345 678 901 234 567 890 123 456 789 012 345 678 901 234 mexl AAA ACT TAC ATT TCA ATA TTA GTG CTT CTA CAA ATC CTC CTA GTC ATA ACA TTC
mex 6 ...... mex7 ...... T ...... -.T mex8 .--..-..T ...... A ...... -G ..T ...... mex9 ...... T mex 10 ...... T.C ...... A ...... T stir1 ... .-C ..T ..C ...... -.A ..A T,...... T ..T ... A.T ..G ...... stir2 ... ..C ..T ..C ...... A ..A T.- ... -.T .-T ... A-T .-G ...... granl ...... ,-A ..C ...... A ...... -.T gran2 ...... T ...... C...... -.T yucl ...... A AC. T-G ..G ...... A.T ...... yuc2 ...... -A AC. T.G .-G ...... A.T ...... yuc3 ...... A AC. T-G .-G ...... A.T ...... zarl ...... A ..C ...... A.T ...... -.T zar2 ...... -...... -...... -.A ..C ...... ACT ...... T guat 1 ...... *.*...... A ...... T guat2 ...... A ...... -T gym1 ...... T ...... -A ..C ...... T ...... T nudl ...... A ...... *T nud2 ...... nud3 ...... ,A ...... A...... T nud4 ...... T megl ... ,.C ..T ...... C.. .-A A...... T ..T ... A.T ...... mell ...... C.. A-C ..C ...... A...... T me12 ...... G .-C ..C ...... A...... mayL ...... C ...... C-. ..T ..C ...... T ... A...... T ma y2 ...... C ...... C.- ...... T ... A...... -.T furl ... ..A ..T ..C ...... C.. ..A ...... -T ..T A...... T fur2 ... ..A ..T ..C ...... C., ..A ...... T ..T A...... T melal ... ..C ..T ...... G C-. ..T T.A ...... --T ...... A...... ochl ... ..C ..T G-C ...... C.. .-A ...... A.- ...... aztl ...... -...... C.. ..A TC. T...... T ..T ... A.T ...... leu1 ... .TC ... ..C ...... C.. ACT ..C ...... A.. ... --T ..T leu2 ... .T...... C ... ..G C.. ACC ..C ...... A.- ... ..T ..T lev1 ..G .T. ... .-C ..C ... A-. ..A A...... A ... A*...... lop1 ... TT. ..T ...... -.A ACC ...... A*, ..G ...... lepl ... .TC ..T G...... G ... ..A ACC ...... A...... thol ... .,C ..T G...... C.. .-A ...... A ... A.- ...... Reithl ... .T...... C ...... C.. -.A ACC ..C ...... A T.. A.T ...... T ReFth2 ...... A.. ... C.. .-A TCC ..C ... ..T T.A ... A.T ..G ...... Baiol ... .T. ..T ... ..C ...... -A ACA T...... A ..C A...... Onycl ...... -.C ..C ... C.C A-C AC. -.T ... G.A T.A T.. A.T ...... -T Onyc2 ... ..C ... ..C ...... C.T A.T A.. ,.C ... G-A T.A T,. A...... T APPENDIX F. Continued.
333 333 333 333 333 3 33 333 333 333 333 333 333 333 333 333 333 333 333 222 223 333 333 333 444 444 444 455 555 555 556 666 666 666 777 777 777 5 67 890 123 456 789 0 12 345 678 901 234 567 890 123 456 789 012 345 678 mexl TCC GCA AAC GAA CTA ATC ATA TTC TAC ATC CTA TTT GAA GCA ACT CTA ATT CCC mex2 . -. ... ,.T . ** .-. * *. ... .,T ..T . S...... C ... .- * -.- ** * mex3 . S. S.. . ,T -.- T.G . .T ... ..T -., .. . .C .., mex4 .-...... T .-a T.. . *T ..- m.. m.. ..C ..A mex5 . -. . . - *-. - * - --- S.- S...... *. . . - mex6 . -. * *.. ..- ... S.. .S. S...... * ..- .-. .. - mer.7 . .T .-* . . -m. . *. S.. -.- .-a . -. ..C S. mex8 .-. T...... A.. . .T . .T ... S.. ..C ... mex9 --• ..- ..- -.* ..- .-. ,.T .-* ... S.. S.. mexlO .-. .-. . *T ... .-. -.. . .T *. . S.. - .C S.. stirl . .T .-. --.-. - ... .-. S.- .S...... C . .T stiz2 . .T .*. . * - - * - --- *.* ,.T ..- m.. ..C . .T granl m...... T -...... - . . - ... ..C ...
S.. m.. g ran2 S.. T.. ..- ...... *. * *T ... ..C yucl . .T . - - . .T --- T., ... * *. .*- . .G -.- *.- yuc2 . .T ... . .T .--T...... a. . .G . .G ...... yuc3 . .T . -. ..T -*- T., . . .S. . .G . .G S..
m.. S.. * zarl ... .,. S.. ... -...... - .C .-- zar2 ... ..- * .T S.. *.. -.. m.. -.- S.* ..C -.* guatl ... -.-, .T .S. -.. ... m.. .-* -.- ..C ... guat2 -.. ... - * * .--... .S. --• . a. ..- ..C S.. gyml ...... T .S. T.. . .T .-. *-.T.. c .C . *T nud l . .T .*. -.. . * - T.. -.- --. . a. . . - .-. S.. ..C .-.
a.. S.. nud2 ...... -.. ... S.. . . - .-T . . . . - ..C . .T nue3 . .T .. - .S. ... T.. S.. . -T .-...... C T.. - .C .-- nud4 ...... --..-* *-- -.. * *T .*. .-. .S. .-. S.. . .C S.. megl . .T ... ,.T .S. T.. . .A ..T ... T...... - . -.* . .T 10 a.. .m. mell ..l m.- -*. . . - ..- .-• .-. . . - . .C me12 . .T ... -.. ... T.. ... S.* .-* -*- --• .-. . . - *.. S.. ..* ... ma yl . .T -.. -.. . -. ..- ... - -- . -T - -. . -. .-. W.. -.. T-* - . . ...
S.- T.. my2 . .T .S. -*. ..- -.-... . -- . .T ...... T furl . .T -.. -.. ... T.. ... ,.T .-T ... ..C ... -.. -.C T.. -.. . .T fur2 . .T *. . .*- ... T.. S.. . .T . .T .....C ... . . - . .C T...... T melal . .T -.. . .T . .G ..* . .T -.. **TT...... - . .C ..C ... . .C .-. ..C ochl +.. .S. . .T ... .*. . .T ..T ... . .C T,. . .C ... aztl . .A -.. -.. .*. T,. -.* ...... S...... T S.. S.. . .C .S. leu1 . .T ... S.. . .G m.. . .T ... ..T ..T . . . .T -.A T.. . .C . .T leu2 . .T ..- --- ... -.. . .T ... ..T . .T ... . .T ..A T.. S.. . .T ..a levl ... -.. ..T .-. .-...... T S.. ..- ..C ... . .C .-- lopl . .T ... . .T ... T.. .*. C.. ..T . .T . *. . .T ..C .-...... T lep1 ... .. - . .T ... T.. . .T .m. ... .S. ..C ...... T ch01 -.. --.. .T .-. S.. .a. -...... T ..C T.. . .C * .* Reithl ...... T*. .*. ,.T S.. . .T ..C ......
S.. Reith2 . -. S.. ..- ... .-. . *T -.. . . - . .T ..C ... .-. Bai01 . .A -.. . .T . .G T.. . .T ..T .*. . .C ..C ... . .C . .T Onycl ... a.- . .T S.. . .T -.. .*- . .T ... T.. . .C . .T Onyc2 .*. -*- . .T S.. . .C m.. -.. . . * . .T ... S.. APPENDIX F. Continued-
333 333 333 333 333 333 333 444 444 444 444 444 444 444 444 444 444 788 888 888 889 999 999 999 000 000 000 011 111 112 222 222 222 333 501 234 5 67 890 123 456 789 012 345 67 8 901 567 890 123 456 789 012 nexl ACC CTC ATT ATC ATT ACT CGG TGA GGC AAT CAA GAA CGA TTA AAC GCA GGA .G .A. C.. mex2 ..a S.. . .C . .T . .C ..C ..A .....T ..C - ..-
* .*- m.- * .C mex3 .S. S.. .C ..C ..A ... ..T .-- mex4 . .C -.-..- * -c . -A . -. .*T ..C .-- mexS +-* ..- m...... a.. .-. mex6 S...... mex7 ...... -.C ..A .-G ..T ..C .-- mex8 *...... C . .C .....G ..T ... ..* mex9 **- ...... -.C .,A .,G ..T ..C .-- .---.. m..
.** -*- m.. mexlO S...... C ..A ..G ..T ... .-- stirl . .C ... ..C ..C -.A ... ..T ... .-. ..G S.. C.. stir2 ,-C ... ..C ..C ..A ... -.T ... .-- - -G --.c.. granl ..C ...... *.A ..A .,G ..* *.C -** -..,..C.. gran2 . . - ...... G.C -,A ... ..T ... .-- yucl S.* ..T ... G.. ..A ... ..T ... ..- yuc2 ... ..T ... G.. ..A ..G ..T ... ..- yuc3 ..+ ..T ... G-C -.A ... -.T ... . -.
zarl S...... -A ..G ..-... - - zar2 -...... A .-G ..T ... S.. guatl *...... A ..A .....T . .C .-. quat2 ...... ,A ..A ..G ... ..C .-. gyml . .C ...... C ..A ..G ..T ..C ... nudl S...... A ... ..T ..C ... nud2 -a* ...... C .,A ..G ..T ..C S.. nud3 . -. ..- nud4 ... m.. meg 1 ...... a.. --.S..
S.. C.. me11 m...... me12 ..- S.. ma y l . .C .-- may2 . .C ... fur1 .-• ... fur2 -.. ..- melal ... -.. ochl -.. ... aztl ... .-. leu1 .-• . S. leu2 *. . a.. levl ..- .-. lop1 .-. m.. lep1 - * - .*. th01 -.- .*- Reithl . -C .-- -.-m.. S.. Reith2 ...... C.. Baiol . -. -.- ...... C.. Onycl -.* ..- Onyc2 ... -.. APPENDIX F. Continued.
444 444 444 444 444 444 444 444 444 444 444 444 444 444 333 333 344 444 555 55s 555 666 666 777 777 778 888 888 34 5 678 901 234 123 456 789 012 678 234 567 890 123 456 mex 1 CTT TAC TTC CTA TTC TAT ACT CTA ATC GGA ATC CTA TTA ATT GCC CTC
mex2 . .C .*T . .C .--.-. . .T -.. *-. S.. C.. . .C .....T mex3 ... ..T ..C . .C a-. . .T ... . - - ... C.. S... .T ..T mex4 -.. ..T ... ..C .-. . .T . . - *-...... T S.. mex5 -.- - - - ...... -*- .a* mex6 -.. .--*S...... - mex7 *. - - - * . .G ... *.* . - - mex8 . . * ,*C .-. . .T ... . - - mex9 . . - -. ... -.* -.. *.- rnexlO ..- * -. . . * m.. ..- stirl ... * .C .-. ..T S.* . .T
S.. m.- stir2 --- S.. *.. --* . .C ..T . .T granl -*- . -. ... . * * ... -.* gran2 ..- * -. ... -.. -.. . ,T yucl . .C ..* T...... a- yuc2 . .C ... T.. S...... - - yuc3 . .C ...... T.. S.. *.- *m. zarl ...... C.. ..* ,-C ... .S. -.. . .T zar2 ...... C...... C S.. -.* ..- ..T
gi;atl ... S.. -.- .-* . S. ..- ... W. - ..- qua t 2 ... -.. T.. m.. ..- . . - gyml ... - .C ..- ..T -.. ..- nudl -.. --- .S. S.. ..G .a. nud2 ...... S.. -.. *.. ..* .*- S.. nud3 ..- ... ..* a.* ..G .*- nud4 ... .m. S.. a...... - megl ...... -* .-. . .T *.. . - - me11 ... . *T ... T...... -...... - - me12 ..- . .T ...... -.. - -. . - - ...... ma yl S.. ..T ...... C T.. . .T * *. . - - .*G ..- ma y2 ... . .T ...... C T.. . .T -.. . * - .*G ..- f uzl ... . ,C a*. . .T -.. .-- ... C.. f ur2 -...... C a*. . .T m.- ..- ... C.. melal . .A . .T . .T -.. . .C . . - . .T -.- . a * ... C.. ochl ...... T.. . .C m.. ..T ..G ...... C.. aztl . .C ..- a.. ..T -.. ... T.. C.. leu1 . .C . .C ..- . .T - . . ..* S.. C.. leu2 . .C . .C .** . .T ... . . * S.. C.. levl ..- ... ..a . .T -.. .-- ... C.. lopl a.. . .C .-. . .T S.. . . - ... C,. lepl ...... C . .G -.. -.. - - - *.. ce. th01 ...... -T.. . .C S.. ... -.. ..- ... CI. Reithl A.. ..T ... ..C . .C S.. - .T -.. . . * ..T C-T Reith2 A.. ..T ..- . .C . .C ... . .T -. . .T ..T C-C Bai01 ... ..T ... -.C . .C S.. - .T S...... C C.. Onycl -...... T-. .-.T.. S.. . . * -.. ..C C.C Onyc2 -...... T.. . .C ..- G.T a.. - -. . .C C.C APPENDIX F. Continued.
444 444 444 444 455 555 555 555 555 555 555 555 555 555 555 555 555 555 888 999 999 999 900 000 000 001 111 111 111 222 222 222 233 333 333 334 789 012 345 678 901 234 567 890 123 456 789 012 345 678 901 234 567 890 mexl ATC TAT ATC CAA AAC CTA ATA GGA ACA TTA AAC TTC TTA CTA TTT CCC ATT ACA mex2 ,,T .....*... ..T ... ,C...... ,.T ...... T,, -.C ,,T ,.C ... mex3 ..T ..C ...... T T,. .C...... *.C...... C .,T ..C ... mex4 ..T ..C ...... T TI, -C...... C,. ... -.C ..T ..C ... mex5 ...... ,C...... ,,C ...... mex6 ...... C...... mex7 ...... C...... ,T ...... C .A...... mexe ..T ...... T ... ,C...... T ..A ...... mex9 ... ..C ...... -T ... .C...... C ... ..C ... mexlO ...... T ... .C...... ,T ...... *.. ..C ...... stir1 ..T ...... T ... .C...... --T ..C ..C stir2 ...... ,T ... ,C...... T ..C ..C granl ...... T ... ,C...... ,,T .*...... ,,C ...... gran2 ...... T ... ..T ... ,C...... T ...... yucl ...... A.. GC, ,,T ...... C.. T...... A ..C ... yuc2 ...... A,, GC- ..T ...... C.- T...... A ..C ... yuc3 ...... A.. GC. ..T ...... C.. T...... A ..C .*. zarl ...... T ... ,C...... C., ..T ...... -.C ... ..C .T. zar2 ...... T ... .C. ....*. C.. ,.T ...... C ... ..C ... guarl ...... T ... .C...... T ...... -.C ..T ...... guat2 ...... T ... .C, ...... T ...... C ..T ...... gym1 ..T ...... T T.. .C, ..*...... T ...... ,.C .*. ..C ... nudl ... ..C ...... ? ... .C...... C ...... nud2 ... ..C ...... T ... .C...... C ...... nud3 ..T ,.C ...... T ... .C...... GT ...... -.C .....-... nud4 ... ..C ...... ,T ... .C, ...... C -.A ...... megl ... ..C ...... C, ...... ,.C ..T ..C -.C mell ... ..C ..T ...... C,, ...... C.. ... ,-C ...-..... me12 ...... T ... ..T ... .C...... T ...... C ... ..C ... may1 ..T ..C ..T ... ..T ... .C...... ,.T ...... C ... C.. ..C may2 ..T ..C -.T ... ..T ... .C...... C ... C.. ..C furl ...... T ... ..T TCT .C...... T C., T...... -T C.C ..C fur2 ...... T ... ..T TCT .C...... T C.- T...... T C-C ..C melal ...... T ...... AC, .A...... T ... C.T ... ..C ..A C-C .-C ocnl ... ..C ..T ... .,T ... .A...... C.. ..T ...... T.. ..C ... C.. ..C aztl ... .,C ..T ... ..T ... .C...... C.. ..T ...... C ... C-. .-C leu1 ... .TC ...... TC, .A...... C...... C.T ... ..C ..A C.A ..T leu2 ... .TC ...... TC. .A...... C...... C.T ... ..C ..A T-A ..T lev1 T ...... T AC...... G ...... T C.T ... ..C ..A C.C ..C lop1 ...... T ...... ,.T .C...... *. ,.T C...... C ..T C.. .,T lepl ...... T ACC .C...... ,.C ... C.C ..C tho1 ... ..C ..T ... ..T ... ,A. ..G ... C-. ..T C.T C.. T.. ..C ... C.. ..C Reithl ...... T ,C...... C.T C...... C.. CT. Reith2 ...... -.T ... ..T .A...... C.. ..T ... C.. ..T ...... C.. ... Baiol ..T ... ..T ... ..T TC...... T C...... C.C ... ..C ..T ..A .AT Onycl ... ..C ...... C. ... .C...... C...... G ..C ..T ... T.. Onyc2 ...... C. ... .C...... G C.- ...... C.. ... ,.C ... ..C T.. 555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 555 44 4 44 4 444 555 555 555 566 666 666 667 777 777 777 888 888 888 899 999 123 456 789 0 12 345 678 901 234 567 890 123 456 789 012 345 678 901 234 mexl TTT ATA CCA CTA AAT CAA ACA TGA TCC AAT AAC ATT CTA TGA TTA GCA TGC ATA mex2 . .C GC . ... .C* a...... a.. -.. -*. -.T .a- mex3 . .C TC. . - *.a S.- .--.S. S.. ..C . .- .-* .*. mex4 . .C TC...... - *. - ...... C *.* *.- .S.
*. * .S. a.. -*- mex5 S.. .*. 6.. ..- ...... mex6 **. S. . .- S.. S.. ..C ... -.. --...- mex7 ... . . - .*- A-. ..- .*. .a. ..G C.. -se mexi) . .C TC. *-- ... *.- .-. .S. -.. S.. S.- mex9 . .C .C. ... *.- *.- ...... C.. . . - mexlO . -. .C...... C.. ... stirl ... .C. .-. ..- G...... G ... srir2 -.. -C, ..* . * - G,. **. .*...... G *-- granl ... .c* . .* **------.*. ... C.. *- - gran2 . .C ..a .a. . . - . .C ...... -. -** *.. C.. ..-
m.. yucl S.. .C. T.. -.-.G...... ,.. T.. ... C.. yuc2 -.- .C- T.. ..- .G...... -.. T-. ... C.. . . -
ÿuc3 S.. .C- T.. .-* .G...... --.T-. ... C.. . . - zarl C-C .C, . -. ..- ...... S.. S.. ... T.. . - - za z2 C. C GC ...... - ...... ,.. T...... * qua t 1 ..- .C. .S. .--..- ...... m.. m.. ... C.- ..- guat2 -.* .C. . -. .-* . .C .*. .-. ..- S.. ... C.. ... cr'fll .CC TC. ... .-• . .C ... ..C . . - nudl C.C .C...... G...... * .S. -.. nud2 . .C .C. . -. -.. a...... -.. C*. * *. nud3 C-C .Ce * -. .-.G.. -.* *.- -.. S.. ... nud4 ..C .C. .-. ... W.. ..* ..- ..- .*. .*. C.. .-- megl ..C .C. ... T.. ..C ...... *.. a.. ..C . .T ..G me11 .-.TC. T.. ... G.C ...... T ..C ..T - -. * me12 . -. TC. TT. S.. G.C ...... T ..C ..T . . mayl ..C .C. * -. T.. . .C ...... C ...... ma y2 . .C .C. ... T.. ,.C ...... C .*...... - fur1 .-. .C. T.. ..- -.. ..- S...... -T ... T.. ... C.. S.. fur2 ... .C. T.. ... -.. .-..S. .., ..T .., T.. ... C.. . *.
a.. melal .-. S.. . .T .-.G...... T ...... ochl S.. .C. G. - a-. ... .*- S...... T ..C ......
S.. .** aztl . .C . - * S.. -...... GGT -.C T.. leu1 . ,C .C. .*C . . - ... .*. *.. ..C ... .S. S.. . .G leu2 . .C .C, . .C A.. -.- ...... -.G ... . .G levl ... TC - ..- -.. ,.C ...... C.. T. - lopl *-. ... . * T.C ..a ...... S. .-. -m. *.. ..G ... ..- lep1 m.. .C. -.- T.. . .C ..- .m. ..C ... . .C T.. S.. CI. ..G ch01 . .c ...... -.. . .C ...... C ..T -.a Reithl . .C .CT .A. . .T G.C .-. .-. ... C...... * * Reich2 . .C .CC .AG . .T . .C --- W.. ... C.. ... C.. . . Baiol . .C CAC T., . .T G.C .T...... ,A -.. C.. . . - Onycl . .C TCC ... T.C . .C .--T.. .--m.. ... C.. . . * Onyc2 -.-TCC ... . .T -.- ... T.. -*- a.. *.. CI. .*. APPENDIX F. Continued.
555 556 666 666 666 666 666 666 666 666 666 666 666 666 666 666 666 666 999 990 000 000 000 111 111 111 122 222 222 223 333 333 333 444 444 444 567 890 123 456 789 012 345 678 901 234 567 890 123 456 789 012 345 678 mexl ATA CCA TTC CTA ATT AAA ATA CCA ATA TAT GGA GTT CAC CTA TGG CTC CCC AAA mex2 ... G...... C ...... A ...... mex3 ... G...... C ...... A ...... mex4 ... G...... -C ...... A ...... mex5 ... G...... A...... G ...... mex 6 ... G...... *-. mex7 ... G.. ..T ...... mex 8 ... G-...... C ...... A ..A ...... mex9 ... G.. ..T ...... A ...... mexlO ... G.. ..T ...... stirl ... G,. ..T ... ..C ... .C...... A ...... s~ir2 ... G.. ..T ... ..C ...... --G...... ,,A -.T ,,T ... granl ... G.. ..T T...... *,T m.. gran2 ... G.. ..T -...... -.C ...... A ..T ...... yuc 1 ... G...... G ...... G ,.C ...... A ..T ..A ... yuc2 ... T...... G ..C ...... A ..T -.A ... yuc3 ... G...... G ...... G -.C ...... A ..T ..A ... zarl ... G...... G ...... ,.A ... zar2 ... G...... -.C ... ..G ...... A ... guatl ... G.. ..T ...... C ...... A ...... guat2 ... G.. ..T ... ..C ...... gyml ... G...... -C ...... C ...... A ...... nudl ... G...... C ... T.. ..A ...... nud2 ... G.. ..T ...... A ...... nud3 ... G...... C ... T.. ..A G...... nud4 ... G.. ..T ...... CC...... A ...... megl ... G...... C ...... A ..T ...... inel 1 ... G...... C ...... A ...... me12 ... G...... -C ...... G ,.C ..T ... ..A ..T ...... nay1 ... G.. ..T ...... -.C ...... A ... ..T ... ma y2 ... G.. ..T ...... C ...... A ... ..T ... fur1 ... G.. ..T ...... -.A ... T.. ..A ..T ..A ... fur2 ... G.. ..T ...... -.A ... T.. ..A ..T ..A ... melal ..G G.. ... A...... C.. ..C ... ..C ... T., ..A a.. .,T ... ochl ... G.. **T ...... * -*A ...... A ...... aztl ... G., -.T T...... G .-C -.C ..A T.. T.. ..A ... -.T ... leu1 ..G G.. ... A...... C.. ..C ..G -.C ...... A ...... leu2 ..G G.. ... A...... C...... G ..C ...... A ...... levl ... G.T ..T ...... C ... ..A ...... A ...... lopl ... G.* ..T T...... A ..T ... .-A ..T ..T ... lep1 ... G.. ..T T...... ,G .-C ... ..A ...... A ..T ...... th01 ... G.. ..T ...... ,.C ... ..A ... .-. ..A ...... Reithl ... G.- ... T.. ..C ...... C ... ..C ..G ..A ...... A ..T ..T ... Reith2 ... G.. ..T T...... G ..C .,G ..C ... -.C ..T T.. ..A ..T ..A ... Bai01 ... G.T ... ..C .,C ...... C...... G ..C ...... A ..T ..A ... On yc l ... G.. ... A...... ,.C C...... AC...... A ..T ..A ... Onyc2 ... G.. ... A...... C C...... AC. T., .,A ..G T.T ... APPENDU F. Continued.
666 666 666 455 555 555 901 234 567 mexl GCC CAC GTA mex2 ...... mex3 ...... mex4 ...... mex5 ...... mex6 . . . - * . - mex7 ...... mex8 ...... mex9 ...... mexl0 ...... stirl ...... stir2 ...... granl ...... gran2 ...... yucl ...... yuc2 ...... yuc3 ...... zarl ...... zar2 ...... guatl ...... guat2 ...... gyml ...... nudl ...... nud2 ...... nud3 ...... nud4 ...... megl ...... me11 ...... me12 ...... ma y 1 ...... may2 ...... fur1 ...... fur2 ...... melal ...... ochl ...... aztl .... .T ... leu1 ...... leu2 ...... - levl ...... lopl ...... lep1 ...... th01 ...... Reithl ...... ReithS ...... Bai01 ...... Onyc f ...... Onyc2 ......