US0083291 79B2

(12) United States Patent (10) Patent No.: US 8,329,179 B2 Ni et al. (45) Date of Patent: *Dec. 11, 2012

(54) DEATH DOMAIN CONTAINING RECEPTOR 4 5.447,851 A 9, 1995 Beutler et al. ANTIBODIES AND METHODS 5,478,925 A 12/1995 Wallach et al. 5,530,101 A 6/1996 Queen et al. (75) Inventors: Jian Ni, Germantown, MD (US); Craig 5,565,332 A 10/1996 Hoogenboom et al. A. Rosen, Laytonsville, MD (US); 5,763,223. A 6/1998 Wiley et al. 5,807,715 A 9, 1998 Morrison et al. James G. Pan, Toronto (CA); Reiner L. 6,342,363 B1 1/2002 Nietal. Gentz, Belo Horizonte-MG (BR): 6,433,147 B1 8, 2002 Nietal. Vishva M. Dixit, Los Altos Hills, CA 6,461,823 B1 10/2002 Ni et al. (US) 6,902,910 B2 6, 2005 Ni et al. 6,943,020 B2 9, 2005 Ni et al. (73) Assignees: Human Genome Sciences, Inc., 7,060,272 B2 6/2006 Nietal Rockville, MD (US); The Regents of 2002/004.8566 A1 4/2002 El-Deiry et al. the University of Michigan, Ann Arbor, 2002fO155109 A1 10/2002 Lynch MI (US) 2005/O112090 A9 5, 2005 Ni et al. (*) Notice: Subject to any disclaimer, the term of this 2005/0244857 A1 11/2005 Nietal. patent is extended or adjusted under 35 FOREIGN PATENT DOCUMENTS U.S.C. 154(b) by 579 days. CA 2045869 12/1991 This patent is Subject to a terminal dis EP O 239 400 B1 8, 1994 claimer. EP O 401 384 B1 3, 1996 EP O 857 782 A2 8, 1998 (21) Appl. No.: 12/010,108 WO WO91,06570 5, 1991 (22) Filed: Jan. 18, 2008 WO WO91,09967 7, 1991 (65) Prior Publication Data WO WO95/06058 3, 1995 WO WO97/O1633 1, 1997 US 2008/0241155A1 Oct. 2, 2008 WO WO 98.30693 7, 1998 WO WO 98.32856 7, 1998 Related U.S. Application Data WO WO98/41629 9, 1998 (63) Continuation-in-part of application No. 1 1/076,187, WO WO99,02653 1, 1999 WO WO99,11791 3, 1999 filed on Mar. 10, 2005, now Pat. No. 7,476,384, and a WO WO99,37684 7, 1999 continuation-in-part of application No. 10/648,786, WO WOOOf 67793 A1 11, 2000 filed on Aug. 27, 2003, now Pat. No. 7,452,538, and a OTHER PUBLICATIONS continuation-in-part of application No. 09/565,918, Ishioka et al. An autopsy case of diffuse panbronchiolitis associated filed on May 5, 2000, now Pat. No. 6,433,147, and a with lung cancer, Internal Med. 39(5):404–406, May 2000.* continuation-in-part of application No. 09/013,895, Mirhosseini et al., The role of antiboiotics in the management of filed on Jan. 27, 1998, now Pat. No. 6,342,363. infection-related symptoms in advanced cancer patients, J. Palliative Care, 22(2):69-74, 2006.* (60) Provisional application No. 60/990,687, filed on Nov. Delgi-Esposti, M.A. et al., “Cloning and Characterization of TRAIL 28, 2007, provisional application No. 60/885,971, R3, a Novel Member of the Emerging TRAIL Receptor Family.” J. filed on Jan. 22, 2007, provisional application No. Exp. Med. 186: 1165-1170, Rockefeller University Press (Oct. 1997). 60/551,768, filed on Mar. 11, 2004, provisional Locksley, R.M., et al., “The TNF and TNF Receptor Superfamilies: application No. 60/608,469, filed on Sep. 10, 2004, Integrating Mammalian Biology,” Cell 104:487-501, Cell Press (Feb. 2001). provisional application No. 60/413,861, filed on Sep. MacFarlane, M., “Identification and Molecular Cloning of Two 27, 2002, provisional application No. 60/406,922, Novel Receptors for the Cytotoxic Ligand TRAIL. J. Biol. Chem. filed on Aug. 30, 2002, provisional application No. 272:25417-25420, American Society for Biochemistry and Molecu 60/132,922, filed on May 6, 1999, provisional lar Biology (Oct. 1997). application No. 60/035,722, filed on Jan. 28, 1997, Marsters, S.A., et al., “A novel receptor for Apo2L/TRAIL contains provisional application No. 60/037,829, filed on Feb. a truncated death domain.” Curr: Biol. 7:1003-1006, Cell Press (Dec. 5, 1997. 1997). (Continued) (51) Int. Cl. A 6LX39/395 (2006.01) Primary Examiner — Claire Kaufman A6 IK3I/00 (2006.01) (74) Attorney, Agent, or Firm — Human Genome Sciences, C07K 6/30 (2006.01) Inc. (52) U.S. Cl...... 424/143.1; 424/133.1; 424/138.1; (57) ABSTRACT 424/142.1; 424/135.1; 424/141.1; 424/155.1; The present invention relates to novel Death Domain Con 424/1741; 424/178.1; 530/350; 514/1.1; taining Receptor-4 (DR4) proteins which are members of the tumor necrosis factor (TNF) receptor family. In particular, 514/2.3: 514/7.5: 514/18.9; 514/19.3; 540/478 isolated nucleic acid molecules are provided encoding the (58) Field of Classification Search ...... None human DR4 proteins. DR4 polypeptides are also provided as See application file for complete search history. are vectors, host cells and recombinant methods for produc ing the same. The invention further relates to screening meth (56) References Cited ods for identifying agonists and antagonists of DR4 activity and methods for using DR4 polynucleotides and polypep U.S. PATENT DOCUMENTS tides. The invention also relates to the treatment of diseases 4,002,531 A 1/1977 Royer associated with reduced or increased levels of apoptosis using 4,179,337 A 12/1979 Davis et al. antibodies specific for DR4, which may be agonists and/or 4.946,778 A 8, 1990 Ladner et al. antagonists of DR4 activity. 5,349,053 A 9, 1994 Landolfi 64 Claims, 10 Drawing Sheets US 8,329,179 B2 Page 2

OTHER PUBLICATIONS Morpurgo, M., et al., "Covalent Modification of Mushroom Pan, G., et al., “An Antagonist Decoy Receptor and a Death Domain Tyrosinase with Different Amphiphic Polymers for Pharmaceutical Containing Receptor for TRAIL.” Science 277:815-818, American and Biocatalysis Applications.” Appl. Biochem. Biotechnol. 56:59 Association for the Advancement of Science (Aug. 1997). 72, Humana Press (Jan. 1996). Schneider, P. et al., “Characterization of two recpetors for TRAIL.” Morrison, S.L. “Transfectomas Provide Novel Chimeric Antibod FEBS Lett. 416:329-334, Elsevier Science B.V. (Oct. 1997). ies.” Science 229:1202-1207, American Association for the Advance Screaton, G.R., et al., “TRICK2, a new alternatively spliced receptor ment of Science (1985). Pan, G., et al., “The Receptor for the Cytotoxic Ligand Trail.” Science that transduces the cytotoxic signal from TRAIL.” Curr: Biol. 7:693 276:111-113, American Association for Advancement of Science 696, Cell Press (Sep. 1997). (Apr. 1997). Sheridan, J.P. et al., “Control of TRAIL-Induced Apoptosis by a Roguska, M.A., et al., “Humanization of murine monoclonal anti Family of Signaling and Decoy Receptors.” Science 277:818-821, bodies through variable domain resurfacing.” Proc. Natl. Acad. Sci. American Association for the Advancement of Science (Aug. 1997). USA 91:969-973, National Academy of Science (1994). Simonet, W.S., et al., “Osteoprotegerin: A Novel Secreted Protein Ruf. M. and Kossel, H., "Structure and Expression of the Gene Involved in the Regulation of Bone Density.” Cell 89:309-319, Cell Coding for the Alpha-Subunit of DNA-Dependent RNA Polymerase Press (Apr. 1997). from the Chloroplast Genome of Zea mays," Nucl. Acids Res. Tsuda, E., et al., “Isolation of a Novel Cytokine from Human Fibro 16:5741-5754, IRL Press (1988). blasts That Specifically Inhibits Osteoclastogenesis.” Biochem. Sedger, L.M., et al., “IFN-Y Mediates a Novel Antiviral Activity Biophy's. Res. Commun. 234:137-142, Academic Press (May 1997). Through Dynamic Modulation of TRAIL and TRAIL Receptor Wallach. D., et al., “Tumor Necrosis Factor Recpetor and Fas Sig Expression.”.J. Immunol. 163:920-926. The American Association of naling Mechanims,” Annu. Rev. Immunol. 17:331-367, Annual Immunologists (Jul. 1999). Reviews (Apr. 1999). Shaw, J.P. et al., “Cytotoxic properties DAB486EGF and Ware, C.F., et al., “Apoptosis Mediated by the TNF-Related Cytokine DAB389EGF, epidermal growth factor (EGF) receptor-targeted and Receptor Families.”.J. Cell. Biochem. 60:47-55, Wiley-Liss (Jan. fusion toxins.J. Biol. Chem. 266:21 118-21124, The American Soci 1996). ety for Biochemistry and Molecular Biology, Inc. (1991). Shin, E.-C., et al., “IFN-Y Induces Cell Death in Human Hepatoma European Opposition Document for European Patent No. 1 012274. Cells Through a TRAIL/Death Receptor-Mediated Apoptotic Path Communication of a notice of opposition, 1 page, dated Mar. 28, way.” Int. J. Cancer 93:262-268, Wiley-Liss, Inc. (Jul. 2001). 2008. Strader, C.D., et al., “Structural basis of B-adrenergic receptor func European Opposition Document for European Patent No. 1 012274. tion.” FASEB.J. 3:1825-1832, Federation of American Societies for Communication of a notice of opposition, 1 page, datedMar. 7, 2008. Experimental Biology (1989). Opposition to European Patent No. 1 012274 B, filed by Genentech, Walczak, H., et al., "TRAIL-R2: a novel apoptosis-mediating recep Inc. in the European Patent Office, 23 pages, dated Feb. 27, 2008. tor for TRAIL.” EMBO.J. 16:5386-5397, Oxford University Press Chantry, D., "Tumour necrosis factor antagonists.” Exp. Opin, (1997). Emerging Drugs 4:5-13, Ashley Publications Ltd (Jan. 1999). Wiley, S.R., et al., “Identification and Characterization of a New Chinnaiyan, A.M., et al., “Signal Transduction by DR3, a Death Member of the TNF Family that Induces Apoptosis.” Immunity Domain-Containing Receptor Related to TNFR-1 and CD95.” Sci 3:673-682, Cell Press (1995). ence 24:990-992, American Association for the Advancement of Database, EMBL Nucleic Acid DB EBI, Accession No. AA100865, Science (Nov. 1996). Hillier et al., Entry Date Oct. 1996. Delgado, C., et al., “The Uses and Properties of PEG-Linked Pro GenBank Accession No. W65310, Zd33e01.rl Soares fetal heart teins.” Crit. Rev. Thera. Drug Carrier Sys. 9:249-304. Begell House NbHH19W Homo sapiens cDNA clone 3424565" similar to contains (1992). Alu repetitive element, NCBI National Library of Medicine Data Delgado, C., et al., “Quantitative analysis of polyethylene glycol base, Bethesda, MD, USA, accessed Jan. 8, 1999. (Oct. 1996). (PEG) in PEG-modifed proteins/cytokines by aqueous two-phase NCBI Entrez, GenBank Report, Accession No. AA150849, from systems.” J. Biochem. Biophys. Methods 29:237-250, Elsevier Sci Hillier, L., et al., Entry Date Dec. 1996. NCBI Entrez, GenBank Report, Accession No. AA102745, from ence B.V. (1994). Hillier, L., et al., Entry Date Oct. 1996. Dillman, R.O., “Monoclonal Antibodies for Treating Cancer.” Ann. NCBI Entrez, GenBank Report, Accession No. AA102746, from Internal Med. 111:592-603, American College of Physicians (1989). Hillier, L., et al., Entry Date Oct. 1996. Goodman, J.W. “Immunogens & Antigens,” in Basic & Clinical NCBI Entrez, GenBank Report, Accession No. AA102383, from Immunology, Stites et al., eds. Appleton & Lange, Norwalk, CT, pp. Hillier, L., et al., Entry Date Oct. 1996. 20-27 (1988). NBCI Entrez, Genbank Report, Accession No. U90875, Pan, G., et Griffith, T.S., et al., “Monocyte-mediated Tumoricidal Activity via al., Entry Date Apr. 1997. the Tumor Necrosis Factor-related Cytokine, TRAIL. J. Exp. Med. NCBI Entrez, GenBank Report, Accession No. AA639619, 189:1343-1353, The Rockefeller University Press (Apr. 1999). Strausberg, R., National Center for Biotechnolgy Information Huston, J.S., et al., “Protein Engineering of Single-Chain Fv Analogs (1997). and Fusion Proteins.” Methods in Enzymology 203:46-88, Academic U.S. Appl. No. 09/912,292, filed Jul. 26, 2001, Not Published: pp. Press (1991). 1-75 (pp. 1+2 partially redacted); portion of Table 2; and SEQ ID Kayagaki, N., et al., “Type I Interferons (IFNs) Regulate Tumor Nos. 7950 and 52011. Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Alderson, et al., “Fas transduces activation signals in normal human Expression on Human T Cells: A Novel Mechanism for the Antitu T lymphocytes.” J. Exp. Med., 178:2231-2235 (Dec. 1993). mor Effects of Type I IFNs.” J. Exp. Med. 189: 1451-1460, The Alderson, et al., “Regulation of apoptosis and T cell activation by Rockefeller University Press (May 1999). Fas-sepcific mAb.” International Immunology, 6(11): 1799-1806 Kim, K., et. al., “Molecular determinants of response to TRAIL (Aug. 1994). combined with chemotherapy in killing of normal cancer cells.” Boldin, et al., “A novel protein that interacts with the death domain of Proceedings of the American Association for Cancer Research Fas/APO 1 contains a sequence motif related to the death domain.” J. Annual Meeting 40:486,90th Annual Meeting of the American Asso Biol. Chem., 270(14):7795-7798 (Apr. 7, 1995). ciation for Cancer Research (Apr. 1999). Brockhaus, et al., “Identification oftwo types oftumor necrosis factor Lerner, R.A., “Antibodies of Predetermined Specificity in Biology receptors on human cell lines by monoclonal antibodies.” Proc. Natl. and Medicine.” Adv. Immunol. 36:1-44, Academic Press, Inc. (1984). Acad. Sci. USA, 87:3127-3131 (Apr. 1990). Marsters, S.A., et. al., “Control of Apoptosis Signaling by Apo2 Chinnaiyan, et al., “FADD/MORT1 is a common mediator of CD95 Ligand.” Recent Progress in Hormone Research 54:225-234. The (Fast APO-1) and tumor necrosis factor receptor-induced apoptosis.” Endocrine Society (Jan. 1999). J. Biol. Chem., 271 (9):4961-4965 (Mar. 1, 1996). US 8,329,179 B2 Page 3

Chinnaiyan, et al., “FADD, a novel death domain-containing protein, European Opposition Document for European Patent No. 1 012274. interacts with the death domain of Fas and initiates apoptosis.” Cell, Declaration of Robin C. Humphreys, Ph.D., 5 pages, dated Jan. 12, 81:505-512 (May 19, 1995). 2006. Chuntharapai, et al., “Isotype-dependent inhibition of tumor growth European Opposition document for EP Patent No. 1 012 274— in vivo by monoclonal antibodies to death receptor 4.” J. Immunol. Patentee’s Submission in preparation for oral proceedings dated Apr. 166(8):4891-4898 (Apr. 15, 2001). Cifone, et al., “Apoptotic signaling through CD95 (Fast Apo-1) acti 15, 2010. vates an acidic sphingomyelinase” J. Exp. Med., 177:1547-1552 European Opposition document for EP Patent No. 1 012 274— (Oct. 1993). Minutes from the oral proceedings dated Jun. 22, 2010. Cifone, et al., “Multiplepathways originate at the Fas/APO-1 (CD95) Human Genome Sciences press release, “Human Genome Sciences receptor: sequential involvement of phosphatidylcholine-specific Advances Anti-cancer Drug to Phase 2 Clinical Development” (Sep. phospholipase C and acidic sphingomyelinase in the propagation of 8, 2004). the apoptotic signal.” EMBO.J., 14:5859-5868 (Dec. 1995). Human Genome Sciences press release, “Human Genome Sciences Engelmann, et al., “Antibodies to a soluble form of a tumor necrosis Completes Patient Enrollment in a Phase 2 Clinical Trial of HGS factor (TNF) receptor have TNF-like activity.” J. Biol. Chem. ETR1 for the Treatment of Non-Small Cell Lung Cancer' (Nov.30, 265(24): 14497-14504 (Aug. 25, 1990). 2004). Espevik, et al., “Characterization of binding and biological effects of monoclonal antibodies against a human tumor necrosis factor recep Human Genome Sciences press release, “Human Genome Sciences tor.” J. Exp. Med., 171:415-426 (Feb. 1990). Completes Patient Enrollment in a Phase 2 Clinical Trial of HGS Fadeel, et al., “Anti-Fas IgG1 antibodies recognizing the same ETR1 for the Treatment of Colorectal Cancer” (Feb. 23, 2005). epitope of Fas/APO-1 mediate different biological effects in vitro.” Human Genome Sciences press release, “Human Genome Sciences International Immunology, 9(2):201-209 (Feb. 1997). Completes Patient Enrollment in a Phase 2 Clinical Trial of HGS Isaacs, J., “Role of programmed cell death in carcinogenesis. Envi ETR1 for the Treatment of Non-Hodgkin's Lymphoma' (Mar. 3, ronmental Health Perspectives, 101 (Suppl 5):27-34 (1993). 2005). Janeway and Travers, In: Immunobiology, Current Biology, Ltd./ Human Genome Sciences press release, “Human Genome Sciences Garland Publishing, Inc., pp. 2:3 et seq. (1994). Reports Results of Phase 2 Clinical Trial of HGS-ETR1 in Patients Keane, et al., “Fas expression and function in normal and malignant with Non-Small Cell Lung Cancer' (Jul. 5, 2005). breast cell lines.” Cancer Research, 56:4791-4798 (Oct. 15, 1996). Human Genome Sciences press release, “Human Genome Sciences Kischkel, et al., “Cytotoxicity-dependent APO-1 (Fas/CD95)-asso ciated proteins form a death-inducing signaling complex (DISC) Reports Results of Phase 2 Clinical Trial of HGS-ETR1 in Patients with the receptor.” EMBO.J. 14(22):5579-5588 (1995). with Advanced Colorectal Cancer' (Nov. 1, 2005). Mühlenbeck, et al., “The tumor necrosis factor-related apoptosis Human Genome Sciences press release, “Human Genome Sciences inducing ligand receptors TRAIL-R1 and TRAIL-R2 have distinct Reports Interim Results of Phase 1B Clinical Trials of HGS-ETR1 in cross-linking requirements for initiation of apoptosis and are non Combination with Chemotherapy in Patients with Advanced Solid redundant in JNK activation.” J. Biol. Chem., 275(41):32208-32213 Tumors” (Nov. 17, 2005). (Oct. 13, 2000). Human Genome Sciences press release, “Human Genome Sciences Sheehan, et al., “Monoclonal antibodies specific for murine p55 and Reports Results of Phase 2 Clinical Trial of HGS-ETR1 in Patients p75 tumor necrosis factor receptors: identification of a novel in vivo with Advanced Non-Hodgkin's Lymphoma' (Dec. 13, 2005). role for p75.” J. Exp. Med., 181:607-617 (Feb. 1995). Human Genome Sciences press release, “Human Genome Sciences Tartaglia, et al., “The two different receptors for tumor necrosis factor Reports Interim Results of Phase 1B Clinical Trial of HGS-ETR1 mediate distinct cellular responses.” Proc. Natl. Acad. Sci. USA, with Gemcitabine and Cisplatin in Patients with Advanced Solid 88:9292-9296 (Oct. 1991). Tartaglia, et al., “Tumor necrosis factor receptor signaling.” J. Biol. Tumors” (Nov. 8, 2006). Chem., 267(7):4304-4307 (Mar. 1992). Human Genome Sciences press release, “Human Genome Sciences Yonehara, et al., “A cell-killing monoclonal antibody (ANTI-Fas) to Reports Growing Evidence That its Trail Receptor Antibodies have a cell Surface antigen co-downregulated with the receptor of tumor Significant Potential in the Treatment of a Broad Range of Cancers' necrosis factor.” J. Exp. Med., 169: 1747-1756 (May 1, 1989). (Apr. 27, 2007). European Opposition Document for European Patent No. 1 012274. Human Genome Sciences press release, “Human Genome Sciences Summons to Attend Oral Proceedings, dated Jul. 7, 2009. Presents New Data Showing Anti-tumor Activity and Safety of European Opposition Document for European Patent No. 1 012274. TRAIL receptor Antibodies in Combination with Chemotherapy” Patentee's observations to Genentech's opposition of Patentee's (Oct. 24, 2007). patent, 20 pages, dated Oct. 6, 2008. Human Genome Sciences press release, “Human Genome Sciences European Opposition Document for European Patent No. 1 012274 Reports Initial Results of Randomized Phase 2 Trial of HGS-ETR1 in B, filed by Genentech, Inc. in the European Patent Office, 20 pages, Combination with Bortezomib in Advanced Multiple Myeloma” dated Feb. 22, 2008. (Sep. 2, 2008) European Opposition Document for European Patent No. 1 012274. Human Genome Sciences press release, “Human Genome Sciences Patentee's response to European Patent Office Communication dated Announces Results of Randomized Phase 2 Trial of Mapatumumab Jul. 19, 2005, 14 pages, dated Jan. 13, 2006. in Non-Small Cell Lung Cancer” (Mar. 17, 2010). European Opposition Document for European Patent No. 1 012274. Human Genome Sciences press release, “Human Genome Sciences Declaration of Werner Lesslauer, MD, Ph.D., 5 pages, dated Jan. 12, Announces Results of Randomized Phase 2 Trial of Mapatumumab 2006. in Multiple Myeloma” (Jun. 9, 2010). European Opposition Document for European Patent No. 1 012274. Declaration of David H. Lynch, Ph.D., 6 pages, dated Jan. 11, 2006. * cited by examiner U.S. Patent Dec. 11, 2012 Sheet 1 of 10 US 8,329,179 B2

10 30 50 TTCGGGCACGAGGGCAGGATGGCGCCACCACCAGCTAGAGTACATCTAGGTGCGTTCCTG M A P-P - P - A R V H L G A F L 70 90 110 GCAGTGACTCCGAATCCCGGGAGCGCAGCGAGTGGGACAGAGGCAGCCGCGGCCACACCC A W T P N P G S A A S G T E A A A A T P 130 150 170 AGCAAAGTGTGGGGCTCTTCCGCGGGGAGGATTGAACCACGAGGCGGGGGCCGAGGAGCG S K W W G S S A G R T E P R G G G R G A 190 210 230 CTCCCTACCTCCATGGGACAGCACGGACCCAGTGCCCGGGCCCGGGCAGGGCGCGCCCCA P T S M G O H G P S A R A R A G R A P 250 270 290 GGACCCAGGCCGGCGCGGGAAGCCAGCCCTCGGCTCCGGGTCCACAAGACCTTCAAGTTT G P R P A R E A S P R L R W H K T F K F 310 330 350 GTCGTCGTCGGGGCCTGCTGCAGGTCGTACCTAGCTCAGCTGCAACCATCAAACTTCAT V V V G W L L Q V V P S S A A T I K H 370 390 410 GATCAATCAATTGGCACACAGCAATGGGAACATAGCCCTTGGGAGAGTTGTGTCCACCA D Q S I G T Q Q W E H S P L G E L C P P 430 450 470 GGATCTCATAGATCAGAACGTCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTAC G S H R S E R P G A C N R C T E G W G Y 490 510 530 ACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAGATGAA T N A S N N - F A C L P C T A C K S D E 550 570 590 GAAGAGAGAAGTCCCTGCACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACT E E R S P C T T T R N T A C Q C K P G T 610 630 650 TTCCGGAATGACAATTCTGCTGAGATGTGCCGGAAGTGCAGCACAGGGTGCCCCAGAGGG F R N D N S A E M C R K C S T G C P R G 670 690 710 ATGGTCAAGGTCAAGGATTGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCA M V K V K D C T P W S D I E C W H K E S FG 1A

U.S. Patent Dec. 11, 2012 Sheet 3 of 10 US 8,329,179 B2

390 1410 1430 ATCTACTTAGAAGATGGCACAGGCTCTGCCGTGTCCTTGGAGTGAAAGACTCT ACC I Y L E D G T G S A W S L E 1450 1470 1490 AGAGGTTTCCTCTTAGGTGTTAGGAGTTAATACATATTAGGTTTTTTTTTTTTTTAACAT 150 1530 1550 GATACAAAGAAATTCTTAGCCACGTGTATTGGCTCCTGCCTGTAATCCCATCACT TG 1570 1590 1610 GGAGGCTGACGCCGGTGGATCCACTTGAGGTCCGAAGTTCCAAGACCAGCCCTGAACCAA 1630 1650 1670 CATCGTGGAAATGCCCGTCTT TACAAAAAAATACCAAAAA TCAACTGGAATGTGCATG 1690 1710 1730 GTGTGTGCCATCATTTCCTCGGCTAACTACGGGAGGTCTGAGGCCAGGAGAATCCACTTG 1750 1770 1790 AACCCCACGAAGGACAGGTAGACTGCAGATGCACCACTGCACTCCCAGCCTGGGAACA 1810 1830 1850 CAGAGCAAGACTCTGTCTCAAGATAAAATAAAATAAACTTGAAAGAATTATTGCCCGACT 1870 1890 1910 GAGGCTCACATGCCAAAGGAAAATCTGGTTCTCCCCTGAGCTGGCCTCCGTGTGTTTCCT 930 1950 1970 TATCATGGTGGTCAATTGGAGGTGTTAATTTGAATGGATTAAGGAACACCTAGAACACTG 1990 2010 2O3O GTAAGGCATTATTTCTGGGACATTATTTCTGGGCATGTC (CGAGGGTGTTCCAGAGGG 2050 2O70 2090 GA TGGCATGCGATCGGGTGGACTGAGTGGAAAAGACCTACCCTTAATTGGGGGGGCAC 2110 2130 2150 CGTCCGACAGACTGGGGAGCAAGATAGAAGAAAACAAAAAAAAAAAAAAAAA FG1 C

U.S. Patent Dec. 11, 2012 Sheet 7 of 10 US 8,329,179 B2 —L—L—1—1—1————— U.S. Patent Dec. 11, 2012 Sheet 8 of 10 US 8,329,179 B2

HTOIYO7R 1. GGCANAGGTN CGTACCTAGC TCACCTGCAA CCATCAAACT TNATGATCAA 51. TCAATTGGCA CACAGCAATG GGAAACATAG CCCTTTGGAA GANTTGTNTC 101 CACCAGGATC TCATAGATCA AAACATCCTG GGAGCCTGTT AACCGGTGCC 151 CCAAAGGNTG GTCAAGGTCA AGGAATTGT NCGCCCTGGA AGTGAACAC 201 GAGTGTNTCC ACAAAGGATT CAGGCAATGG GACATAAATA TATGGGTGAA 251 TTTTGGTTGT GAACTTGGT TGNTCCCGTT GNTGTTGNTG GCTGTGCTGA 301 TTGTTTGTTG TTGCATCGGC TTCAGGTTNT GGAGGGGGAC CCAAGTGCAT 351 GGACAGGGTG TGTTTCTGGG GTTTGGGTCT CTTAGAGGGC NTGGGTTANG 401 GCANGTTCAC AAGGGTTTTA GCAANG

HTXEY80R 1 TGGGGCTGAG GACAATGCTG ACNACGAGAT TCTGAGCAAC GCAGNACTNG 5l. CTGTCCACTT TCGTCTNTGN GCAGCAAATG GAAAGCCAGG AGCCGGCAGA l01 TTTGACAGGT GTCACTGTAC AGTCCCCAGGGGAGGCACAG TGTCTGCTGG 151 TGAGTTGGGG ACAGGCCCTT GCAAGACCTT GTGAGGCAGGGGGTGAAGGC 201 CATGNCTCGG CTTCNNNTGG TCAAAGGGGA AGTGGAGCCT GAGGGAGATG 25l GGACTTNAGGGGGACGGNGC TGCGTGGGGA AAAAGCAGCC ACCNT TGAC 30 AAGGGGGACA GGCATTTTN CAAATGTGTG CTTNTTGGT FG4

U.S. Patent Dec. 11, 2012 Sheet 10 of 10 US 8,329,179 B2

OOQ STIBOO?|0,100dW% N N

FG.6A

100

ST1300|101d0dW%

O GNON

FG, 6B US 8,329,179 B2 1. 2 DEATH DOMAIN CONTAINING RECEPTOR 4 TNF ligand superfamily have been identified and ten mem ANTIBODIES AND METHODS bers of the TNF-receptor superfamily have been character ized. CROSS-REFERENCE TO RELATED Among the ligands there are included TNF-C, lympho APPLICATIONS toxin-C. (LT-O, also known as TNF-B), LT-B (found in com plex heterotrimer LTC.2-3), FasL, CD40L, CD27L, CD30L, This application claims the benefit of priority under 35 4-IBBL, OX40L and nerve growth factor (NGF). The super U.S.C. S 119(e) of provisional Application Nos. 60/990,687 family of TNF receptors includes the p55TNF receptor, and 60/885,971, filed Nov. 28, 2007 and Jan. 22, 2007, p75TNF receptor, TNF receptor-related protein, FAS antigen respectively. This application is also a Continuation-in-Part 10 or APO-1, CD40, CD27, CD30, 4-IBB, OX40, low affinity and claims benefit of priority under 35 U.S.C. S 120 of non p75 and NGF-receptor (Meager, A., Biologicals, 22:291-295 provisional application Ser. No. 1 1/076,187, filed Mar. 10, (1994)). 2005 (now U.S. Pat. No. 7,476,384), which claims the benefit Many members of the TNF-ligand superfamily are of priority under 35 U.S.C. S 119(e) of provisional Applica expressed by activated T-cells, implying that they are neces tion Nos. 60/551,768 and 60/608,469, filed Mar. 11, 2004 and 15 sary for T-cell interactions with other cell types which under Sep. 10, 2004, respectively. This application is also a Con lie cell ontogeny and functions. (Meager, A., Supra). tinuation-in-Part and claims benefit of priority under 35 Considerable insight into the essential functions of several U.S.C. S 120 of non-provisional application Ser. No. 10/648, members of the TNF receptor family has been gained from 786, filed Aug. 27, 2003 (now U.S. Pat. No. 7,452.538), the identification and creation of mutants that abolish the which claims the benefit of priority under 35 U.S.C. S 119(e) expression of these proteins. For example, naturally occur of provisional Application Nos. 60/413,861 and 60/406,922, ring mutations in the FAS antigen and its ligand cause lym filed Sep. 27, 2002 and Aug. 30, 2002 respectively. Applica phoproliferative disease (Watanabe-Fukunaga, R., et al., tion Ser. No. 10/648,786 is in turn a Continuation-In-Part and Nature 356:314 (1992)), perhaps reflecting a failure of pro claims benefit of priority under 35 U.S.C. S 120 of non-pro grammed cell death. Mutations of the CD40 ligand cause an visional application Ser. No. 09/565,918, filed on May 5, 25 X-linked immunodeficiency state characterized by high lev 2000 (now U.S. Pat. No. 6,433,147), which in turn claims the els of immunoglobulin M and low levels of immunoglobulin benefit of priority under 35 U.S.C. S 119(e) of provisional G in plasma, indicating faulty T-cell-dependent B-cell acti Application No. 60/132,922, filed May 6, 1999, and is a vation (Allen, R. C. et al., Science 259:990 (1993)). Targeted Continuation-In-Part claiming benefit of priority under 35 mutations of the low affinity nerve growth factor receptor U.S.C. S 120 of non-provisional application Ser. No. 09/013, 30 cause a disorder characterized by faulty sensory innovation of 895, filed on Jan. 27, 1998 (now U.S. Pat. No. 6,342.363), peripheral structures (Lee, K. F. et al., Cell 69:737 (1992)). which in turn claims the benefit of priority under 35 U.S.C. TNF and LT-C. are capable of binding to two TNF receptors S119(e) of provisional Application Nos. 60/037.829 and (the 55- and 75-kd TNF receptors). A large number of bio 60/035,722, filed Feb. 5, 1997 and Jan. 28, 1997 respectively. logical effects elicited by TNF and LT-C., acting through their Each of the above-cited applications is hereby incorporated 35 receptors, include hemorrhagic necrosis of transplanted by reference in its entirety. tumors, cytotoxicity, a role in endotoxic shock, inflammation, immunoregulation, proliferation and anti-viral responses, as FIELD OF THE INVENTION well as protection against the deleterious effects of ionizing radiation. TNF and LTC. are involved in the pathogenesis of The present invention relates to a novel member of the 40 a wide range of diseases, including endotoxic shock, cerebral tumor necrosis factor family of receptors. More specifically, malaria, tumors, autoimmune disease, AIDS and graft-host isolated nucleic acid molecules are provided encoding human rejection (Beutler, B. and Von Huffel, C., Science 264:667 Death Domain Containing Receptor 4. Sometimes herein 668 (1994)). Mutations in the p55 Receptor cause increased “DR4'. DR4 polypeptides are also provided, as are vectors, susceptibility to microbial infection. host cells and recombinant methods for producing the same. 45 Moreover, an about 80 amino acid domain near the C-ter The invention relates to the treatment of diseases associated minus of TNFR1 (p55) and Fas was reported as the “death with reduced or increased levels of apoptosis using antibodies domain.” which is responsible for transducing signals for specific for DR4, which may be agonists and/orantagonists of programmed cell death (Tartaglia et al., Cell 74:845 (1993)). DR4 activity. The invention further relates to screening meth Apoptosis, or programmed cell death, is a physiologic ods for identifying agonists and antagonists of DR4 activity 50 process essential to the normal development and homeostasis and methods for using DR4 polynucleotides and polypep of multicellular organisms (H. Steller, Science 267, 1445 tides. 1449 (1995)). Derangements of apoptosis contribute to the pathogenesis of several human diseases including cancer, RELATED ART neurodegenerative disorders, and acquired immune defi 55 ciency syndrome (C. B. Thompson, Science 267, 1456-1462 Many biological actions, for instance, response to certain (1995)). Recently, much attention has focused on the signal stimuli and natural biological processes, are controlled by transduction and biological function of two cell Surface death factors, such as cytokines. Many cytokines act through recep receptors, Fas/APO-1 and TNFR-1 (J. L. Cleveland, et al., tors by engaging the receptor and producing an intra-cellular Cell 81, 479-482 (1995); A. Fraser, et al., Cell 85, 781-784 response. 60 (1996): S. Nagata, et al., Science 267, 1449-56 (1995)). Both For example, tumor necrosis factors (TNF) alpha and beta are members of the TNF receptor family which also include are cytokines which act through TNF receptors to regulate TNFR-2, low affinity NGFR, CD40, and CD30, among others numerous biological processes, including protection against (C.A. Smith, et al., Science 248, 1019-23 (1990); M. Tewari, infection and induction of shock and inflammatory disease. et al., in Modular Texts in Molecular and Cell Biology M. The TNF molecules belong to the "TNF-ligand superfamily, 65 Purton, Heldin, Carl, Ed. (Chapman and Hall, London, 1995). and act together with their receptors or counter-ligands, the While family members are defined by the presence of cys “TNF-receptor superfamily. So far, nine members of the teine-rich repeats in their extracellular domains, Fas/APO-1 US 8,329,179 B2 3 4 and TNFR-1 also share a region of intracellular homology, The invention further provides an isolated DR4 polypep appropriately designated the "death domain', which is dis tide having an amino acid sequence encoded by a polynucle tantly related to the Drosophila suicide gene, reaper (P. Gol otide described herein. stein, et al., Cell 81, 185-6 (1995); K. White et al., Science The present invention also provides diagnostic assays such 264, 677-83 (1994)). This shared death domain suggests that as quantitative and diagnostic assays for detecting levels of both receptors interact with a related set of signal transducing DR4 protein. Thus, for instance, a diagnostic assay in accor molecules that, until recently, remained unidentified. Activa dance with the invention for detecting over-expression of tion of Fas/APO-1 recruits the death domain-containing DR4, or soluble form thereof, compared to normal control adapter molecule, FADD/MORT1 (A. M. Chinnaiyan, et al., tissue samples may be used to detect the presence of tumors. Cell 81,505-12 (1995); M. P. Boldin, et al., J. Biol Chem 270, 10 See, for example, the assays described in Example 29. 7795-8 (1995); F. C. Kischkel, et al., EMBO 14, 5579-5588 Tumor Necrosis Factor (TNF) family ligands are known to (1995)), which in turn binds and presumably activates be among the most pleiotropic cytokines, inducing a large FLICE/MACH1, a member of the ICE/CED-3 family of pro number of cellular responses, including cytotoxicity, anti apoptotic proteases (M. Muzio et al., Cell 85, 817-827 viral activity, immunoregulatory activities, and the transcrip (1996); M. P. Boldin, et al., Cell 85, 803-815 (1996)). While 15 the central role of Fas/APO-1 is to trigger cell death, TNFR-1 tional regulation of several genes. Cellular response to TNF can signal an array of diverse biological activities-many of family ligands include not only normal physiological which stem from its ability to activate NF-kB (L.A. Tartaglia, responses, but also diseases associated with increased apop et al., Immunol Today 13, 151-3 (1992)). Accordingly, tosis or the inhibition of apoptosis. Apoptosis-programmed TNFR-1 recruits the multivalent adapter molecule TRADD, cell death-is a physiological mechanism involved in the dele which like FADD, also contains a death domain (H. Hsu, et tion of peripheral T lymphocytes of the immune system, and al., Cell 81,495-504 (1995); H. Hsu, et al., Cell 84,299-308 its dysregulation can lead to a number of different pathogenic (1996)). Through its associations with a number of signaling processes. Diseases associated with increased cell Survival, or molecules including FADD, TRAF2, and RIP TRADD can the inhibition of apoptosis, include cancers, autoimmune dis signal both apoptosis and NF-kB activation (H. Hsu, et al., 25 orders, viral infections, inflammation, graft V. host disease, Cell 84,299-308 (1996); H. Hsu, et al., Immunity 4,387-396 acute graft rejection, and chronic graft rejection. Diseases (1996)). associated with increased apoptosis include AIDS, neurode Recently a new apoptosis inducing ligand was discovered. generative disorders, myelodysplastic syndromes, ischemic Wiley, S. R. et al., refer to the new molecule as TNF-related injury, toxin-induced liver disease, septic shock, cachexia and apoptosis-inducing ligand or (“TRAIL) (Immunity 3:673 30 anorexia. 682 (1995)). Pitti, R. M. et al., refer to the new molecule as Thus, the invention further provides a method for enhanc Apo-2 ligand or (“Apo-2L). For convenience, it will be ing apoptosis induced by a TNF-family ligand, which referred to herein as TRAIL. involves administering to a cell which expresses the DR4 Unlike FAS ligand whose transcripts appear to be largely polypeptide an effective amount of an agonist capable of restricted to stimulated T-cells, significant levels of TRAIL 35 increasing DR4 mediated signaling. Preferably, DR4 medi are seen in many tissues, and it is constitutively transcribed by ated signaling is increased to treat and/or prevent a disease some cell lines. It has been shown that TRAIL acts indepen wherein decreased apoptosis is exhibited. dently from FAS ligand (Wiley, S. R., et al. (1995)), supra). In a further aspect, the present invention is directed to a Studies by Marsters, S. A. et al., have indicated that TRAIL method for inhibiting apoptosis induced by a TNF-family activates apoptosis rapidly, within a time frame that is similar 40 ligand, which involves administering to a cell which to death signaling by FAS/Apo-1L but much faster than TNF expresses the DR4 polypeptide an effective amount of an induced apoptosis (Current Biology, 6:750-752 (1996)). All antagonist capable of decreasing DR4 mediated signaling. work to date suggest that the receptor for TRAIL is not one of Preferably, DR4 mediated signaling is decreased to treat and/ the many known TNF-receptors. or prevent a disease wherein increased apoptosis is exhibited. The effects of TNF family ligands and TNF family recep 45 The present invention relates to the detection, diagnosis, tors are varied and influence numerous functions, both nor prognosis and/or treatment of diseases and disorders of cell mal and abnormal, in the biological processes of the mam death, including but not limited to cancers, using composi malian system. There is a clear need, therefore, for tions comprising polynucleotides encoding DR4, the identification and characterization of Such receptors and polypeptides encoded by these polynucleotides and antibod ligands that influence biological activity, both normally and 50 ies that immunospecifically bind these polypeptides. The in disease states. In particular, there is a need to isolate and invention further relates to diagnostic and therapeutic meth characterize the receptor for the newly discovered TRAIL ods useful for diagnosing, treating, preventing and/or prog ligand. nosing disorders of cell death, and therapeutic methods for treating such disorders. The invention further relates to SUMMARY OF THE INVENTION 55 screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The inven The present invention provides for isolated nucleic acid tion further relates to methods and/or compositions for inhib molecules comprising, or alternatively consisting of nucleic iting or promoting the production and/or function of the acid sequences encoding the amino acid sequence shown in polypeptides of the invention. The invention is based in part SEQ ID NO:2 or the amino acid sequence encoding the 60 on the ability of DR4 to stimulate apoptosis and thus prevent cDNA clone deposited as ATCC Deposit No. 97853 on Jan. tumor progression, as demonstrated in Examples 5 and 6. 21, 1997. below. The present invention also provides vectors and host cells In accordance with one embodiment of the present inven for recombinant expression of the nucleic acid molecules tion, there is provided an isolated antibody that binds specifi described herein, as well as to methods of making Such vec 65 cally to a DR4 polypeptide, as well as biologically active tors and host cells and for using them for production of DR4 fragments, analogs and derivatives thereof, together with polypeptides or peptides by recombinant techniques. fragments, analogs and derivatives thereof which may be US 8,329,179 B2 5 6 useful in the diagnosis or treatment of diseases or disorders FIG. 2 shows the regions of similarity between the amino associated with decreased levels of cell death. acid sequences of DR4 (SEQID NO:2), human tumor necro In one preferred embodiment of the present invention is sis factor receptor 1 (SEQID NO:3), human Fas protein (SEQ presented an isolated antibody which is an agonist of DR4 ID NO:4), and the death domain containing receptor 3 (DR3) activity and therefore may be useful in the treatment of dis (SEQ ID NO:5). Residues that match the consensus are eases or disorders associated with decreased levels of cell shaded. death including, for example, prostate, pancreatic, hepatic, FIG.3 shows an analysis of the DR4 amino acid sequence. lung, breast, ovarian, colorectal and hematological cancers. Alpha, beta, turn and coil regions; hydrophilicity and hydro In accordance with another embodiment of the present phobicity; amphipathic regions; flexible regions; antigenic invention, there is provided an isolated antibody that binds 10 index and surface probability are shown, as predicted for the specifically to a DR4 polypeptide, as well as biologically amino acid sequence depicted in FIG. 1 (SEQID NO:2) using active fragments, analogs and derivatives thereof, together the default parameters of the recited computer programs. In with fragments, analogs and derivatives thereof which may be the "Antigenic Index Jameson-Wolf graph, amino acid residues 35-92, 114-160, 169-240, 267-298, 330-364, 391 useful in the diagnosis or treatment of diseases or disorders 15 404, and 418-465 in FIG. 1 (SEQID NO:2) correspond to the associated with increased levels of cell death. shown highly antigenic regions of the DR4 protein. In another preferred embodiment of the present invention FIG. 4 shows the nucleotide sequences of related nucleic is presented an isolated antibody which is an antagonist of acid fragments HTOIY07R (SEQID NO:6) and HTXEY80R DR4 activity and therefore may be useful in the treatment of (SEQ ID NO:7). diseases or disorders associated with increased levels of cell FIGS. 5A and 5B show the ability of DR4 to induce apo death including, for example, myelodysplastic syndrome. ptosis in the cell lines MCF7 and 293. FIG. 5C shows the The present invention also provides pharmaceutical com ability of death protease inhibitors Z-VAD-fmk and Crm A to positions comprising DR4 antibodies, as described above, inhibit the apoptotic action of DR4. which may be used for instance, to treat, prevent, prognose FIG. 6A shows the ability of a soluble extracellular DR4 and/or diagnose diseases or disorders associated with abnor 25 Fc fusion to block the apoptotic inducing ability of TRAIL. mal levels of cell death and/or conditions associated with FIG. 6B shows the inability of soluble extracellular DR4 Such diseases or disorders. Fc fusion to block the apoptotic inducing ability of TNF In preferred embodiments the present invention provides alpha. pharmaceutical compositions comprising DR4 agonistic antibodies, which may be used for instance to treat, prevent, 30 DETAILED DESCRIPTION OF THE PREFERRED prognose and/or diagnose diseases or disorders associated EMBODIMENTS with increased or decreased levels of cell death as well as conditions associated with Such diseases or disorders. The present invention provides isolated nucleic acid mol Whether any candidate “agonist' or “antagonist of the ecules comprising?, or alternatively consisting of a nucleic present invention can enhance or inhibit apoptosis can be 35 acid sequence encoding the DR4 polypeptide whose amino determined using art-known TNF-family ligand/receptor cel acid sequence is shown in SEQID NO:2, or a fragment of the lular response assays, including those described in more polypeptide. The DR4 polypeptide of the present invention detail below. Thus, in a further aspect, a screening method is shares sequence homology with human TNFR-I, DR3 and provided for determining whether a candidate agonist or Fas ligand (FIG. 2). The nucleotide sequence shown in SEQ antagonist is capable of enhancing or inhibiting a cellular 40 ID NO:1 was obtained by sequencing cDNA clones such as response to a TNF-family ligand. The method involves con HCUDS60, which was deposited on Jan. 21, 1997 at the tacting cells which express the DR4 polypeptide with a can American Type Culture Collection, 10801 University Boule didate compound and a TNF-family ligand, assaying a cellu vard, Manassas, Va., 20110-2209, and given Accession Num lar response, and comparing the cellular response to a ber 97853. The deposited clone is contained in the pBK standard cellular response, the standard being assayed when 45 plasmid (Stratagene, La Jolla, Calif.). contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the Nucleic Acid Molecules standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased Unless otherwise indicated, all nucleotide sequences deter cellular response compared to the standard indicates that the 50 mined by sequencing a DNA molecule herein were deter candidate compound is an antagonist of the ligand/receptor mined using an automated DNA sequencer (such as the signaling pathway. By the invention, a cell expressing the Model 373 from Applied Biosystems, Inc.), and all amino DR4 polypeptide can be contacted with either an endogenous acid sequences of polypeptides encoded by DNA molecules or exogenously administered TNF-family ligand. determined herein were predicted by translation of a DNA 55 sequence determined as above. Therefore, as is known in the BRIEF DESCRIPTION OF THE FIGURES art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may FIG. 1 shows the nucleotide and deduced amino acid contain some errors. Nucleotide sequences determined by sequence of DR4 (SEQID NOS: 1 and 2, respectively). It is automation are typically at least about 90% identical, more predicted that amino acids from about 1 to about 23 constitute 60 typically at least about 95% to at least about 99.9% identical the signal peptide, amino acids from about 24 to about 238 to the actual nucleotide sequence of the sequenced DNA constitute the extracellular domain, amino acids from about molecule. The actual sequence can be more precisely deter 131 to about 229 constitute the cysteine rich domain, amino mined by other approaches including manual DNA sequenc acids from about 239 to about 264 constitute the transmem ing methods well known in the art. As is also known in the art, brane domain, and amino acids from about 265 to about 468 65 a single insertion or deletion in a determined nucleotide constitute the intracellular domain of which amino acids from sequence compared to the actual sequence will cause a frame about 379 to about 422 constitute the death domain. shift in translation of the nucleotide sequence Such that the US 8,329,179 B2 7 8 predicted amino acid sequence encoded by a determined TNFR1-Fc, CD95-Fc or Fc alone (FIG. 6A). Further, as nucleotide sequence will be completely different from the expected, TNF alpha-induced apoptosis was inhibited by amino acid sequence actually encoded by the sequenced TNFR-1-Fc but not by DR4-Fc, CD95-Fc or Fc alone (FIG. DNA molecule, beginning at the point of such an insertion or 6B). deletion. Taken together, the data described above indicate that DR4 By "isolated polypeptide or protein is intended a polypep is a death domain containing receptor with the ability to tide or protein removed from its native environment. For induce apoptosis and is a receptor for TRAIL a known apo example, recombinantly produced polypeptides and proteins ptosis inducing ligand. expressed in host cells are considered isolated for purposed of As indicated, the present invention also provides the the invention, as are native or recombinant polypeptides 10 mature form(s) of the DR4 protein of the present invention. which have been substantially purified by any suitable tech According to the signal hypothesis, proteins secreted by nique such as, for example, the single-step purification mammalian cells have a signal or secretory leader sequence method disclosed in Smith and Johnson, Gene 67:31-40 which is cleaved from the mature protein once export of the (1988). growing protein chain across the rough endoplasmic reticu Using the information provided herein, such as the nucleic 15 lum has been initiated. Most mammaliancells and even insect acid sequence set out in SEQID NO: 1, a nucleic acid mol cells cleave secreted proteins with the same specificity. How ecule of the present invention encoding a DR4 polypeptide ever, in some cases, cleavage of a secreted protein is not may be obtained using standard cloning and screening pro entirely uniform, which results in two or more mature species cedures, such as those for cloning cDNAS using mRNA as on the protein. Further, it has long been known that the cleav starting material. Illustrative of the invention, the gene of the age specificity of a secreted protein is ultimately determined present invention has also been identified in cDNA libraries by the primary structure of the complete protein, that is, it is of the following tissues: amniotic cells, heart, liver cancer, inherent in the amino acid sequence of the polypeptide. kidney, leukocyte, activated T-cell, K562 plus PMA, W138 Therefore, the present invention provides a nucleotide cells, Th2 cells, human tonsils, and CD34 depleted buffy coat sequence encoding the mature DR4 polypeptide having the (cord blood). 25 amino acid sequence encoded by the cDNA contained in the The DR4 gene contains an open reading frame encoding a host identified as ATCC Deposit No. 97853, and as shown in mature protein of about 445 amino acid residues whose ini SEQID NO:2. By the mature DR4 protein having the amino tiation codon is at position 19-21 of the nucleotide sequence acid sequence encoded by the cDNA contained in the host shown in SEQID NO.1, with a leader sequence of about 23 identified as ATCC Deposit No. 97853, is meant the mature amino acid residues (i.e., a total protein length of 468 amino 30 form(s) of the DR4 protein produced by expression in a acids), and a deduced molecular weight of about 50 kDa. In mammalian cell (e.g., COS cells, as described below) of the this context "about” includes the particularly recited size, complete open reading frame encoded by the human c)NA larger or Smaller by several (5, 4, 3, 2, or 1) amino acid contained in the vector in the deposited host. As indicated residues, at either terminus or at both termini. below, the mature DR4 having the amino acid sequence Of known members of the TNF receptor family, the DR4 35 encoded by the cDNA contained in ATCC Deposit No.97853, polypeptide of the invention shares the greatest degree of may or may not differ from the predicted “mature' DR4 homology with human TNFR1 and DR3 polypeptides shown protein shown in SEQID NO:2 (amino acids from about 24 to in FIG. 2, including significant sequence homology over the about 468 in SEQID NO:2) depending on the accuracy of the multiple Cysteine Rich domains. predicted cleavage site based on computer analysis. In this In addition to the sequence homology exhibited between 40 context “about includes the particularly recited size, larger DR4 and other death domain containing receptors, DR4 has or Smaller by several (5, 4, 3, 2, or 1) amino acid residues, at been shown to bind to TRAIL and to induce apoptosis when either terminus or at both termini. transiently expressed. MCF7 human breast carcinoma cells Methods for predicting whether a protein has a secretory and 293 cells were transiently transfected with a DR4 leader as well as the cleavage point for that leader sequence expressing construct, as described in Example 5. As shown in 45 are available. For instance, the method of McGeoch (Virus FIGS.5A and 5B a substantial proportion of transfected cells Res. 3:271-286 (1985)) and von Heinje (Nucleic Acids Res. underwent the morphological changes characteristic of apo 14:4683-4690 (1986)) can be used. The accuracy of predict ptosis. As anticipated, deletion of the death domain abolished ing the cleavage points of known mammalian secretory pro the ability of DR4 to engage the death pathway. As can be teins for each of these methods is in the range of 75-80%. Von seen in FIG. 5C, DR4-induced apoptosis was efficiently 50 Heinje, Supra. However, the two methods do not always pro blocked by inhibitors of death proteases including Z-VAD duce the same predicted cleavage point(s) for a given protein. fmk, an irreversible broad spectrum caspase inhibitor and In the present case, the predicted amino acid sequence of CrmA, a cowpox virus encoded serpin that preferentially the complete DR4 polypeptide of the present invention was inhibits apical caspases such as FLICE/MACH-1 (caspase analyzed by a computer program (“PSORT). (See K. Nakai 8). Since TNFR-1, CD-95 and DR3-induced apoptosis is also 55 and M. Kanehisa, Genomics 14:897-911 (1992)), which is an attenuated by these same inhibitors, it is likely that the down expert System for predicting the cellular location of a protein stream death effector molecules are similar in nature. based on the amino acid sequence. As part of this computa To determine if DR4 was capable of binding TRAIL, the tional prediction of localization, the methods of McGeoch extracellular ligand binding domain of DR4 was expressed as and von Heinje are incorporated. The analysis by the PSORT a fusion to the Fc region of human IgG (DR4-Fc). TRAIL 60 program predicted the cleavage sites between amino acids 23 selectively bound to DR4-Fc but not to corresponding extra and 24 in SEQID NO:2. Thereafter, the complete amino acid cellular domains of TNFR-1 or CD-95, also expressed as Fc sequences were further analyzed by visual inspection, apply fusions, data not shown. Additionally, DR4-Fc did not bind ing a simple form of the (-1, -3) rule of von Heine. Von either TNF alpha or Fas ligand under conditions where both Heinje, Supra. Thus, the leader sequence for the DR4 protein of these ligands bound their cognate receptors. 65 is predicted to consist of amino acid residues 1-23, underlined The ability of TRAIL to induce apoptosis in MCF7 cells in SEQ ID NO:2, while the predicted mature DR4 protein was specifically blocked by DR4-Fc but not influenced by consists of about residues 24-468. US 8,329,179 B2 9 10 As one of ordinary skill would appreciate, due to the pos course, the genetic code is well known in the art. Thus, it sibility of sequencing errors, as well as the variability of would be routine for one skilled in the art to generate such cleavage sites for leaders in different known proteins, the degenerate variants. predicted DR4 receptor polypeptide encoded by the depos In another aspect, the invention provides isolated nucleic ited cDNA comprises about 468 amino acids, but may be 5 acid molecules encoding the DR4 polypeptide having an anywhere in the range of 458478 amino acids; and the pre amino acid sequence encoded by the cDNA contained in the dicted leader sequence of this protein is about 40 amino acids, plasmid deposited as ATCC Deposit No. 97853 on Jan. 21, but may be anywhere in the range of about 30 to about 50 1997. Preferably, these nucleic acid molecules will encode amino acids. It will further be appreciated that, the domains the mature polypeptide encoded by the above-described described herein have been predicted by computer analysis, 10 deposited cDNA. The invention further provides an isolated and accordingly, that depending on the analytical criteria used nucleic acid molecule having the nucleotide sequence shown for identifying various functional domains, the exact in SEQID NO:1 or the nucleotide sequence of the DR4 cDNA “address’ of for example, the extracellular domain, intracel contained in the above-described deposited plasmid, or a lular domain, death domain, cysteine-rich motifs, and trans nucleic acid molecule having a sequence complementary to membrane domain of DR4 may differ slightly. For example, 15 one of the above sequences. Such isolated DNA molecules the exact location of the DR4 extracellular domain in SEQID and fragments thereof, have uses which include, but are not NO:2 may vary slightly (e.g., the address may “shift” by limited to, as DNA probes for gene mapping by in situ hybrid about 1 to about 20 residues, more likely about 1 to about 5 ization of the DR4 gene in human tissue by Northern blot residues) depending on the criteria used to define the domain. analysis. In this context “about includes the particularly recited size, The present invention is further directed to fragments of the larger or Smaller by several (5, 4, 3, 2, or 1) amino acid isolated nucleic acid molecules described herein. By frag residues, at either terminus or at both termini. In any event, as ments of an isolated DNA molecule having the nucleotide discussed further below, the invention further provides sequence shown in SEQ ID NO:1 or having the nucleotide polypeptides having various residues deleted from the N-ter sequence of the deposited cDNA (the cDNA contained in the minus and/or C-terminus of the complete DR4, including 25 plasmid deposited as ATCC Deposit No. 97853) are intended polypeptides lacking one or more amino acids from the N-ter DNA fragments at least 20 nt, and more preferably at least 30 mini of the extracellular domain described herein, which nt in length, and even more preferably, at least about 40, 50. constitute soluble forms of the extracellular domain of the 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, DR4 polypeptides. 700, 750, 800, 850, 900,950, 1000, 1050, 1100, 1150, 1200, As indicated, nucleic acid molecules of the present inven 30 1250, 1300, 1350, 1400, 1450, or 1500 nt in length, which are tion may be in the form of RNA, such as mRNA, or in the form useful as DNA probes as discussed above. Of course, DNA of DNA, including, for instance, cDNA and genomic DNA fragments corresponding to most, if not all, of the nucleotide obtained by cloning or produced synthetically. The DNA may sequence shown in SEQ ID NO:1 are also useful as DNA be double-stranded or single-stranded. Single-stranded DNA probes. By a fragment about 20 nt in length, for example, is may be the coding strand, also known as the sense Strand, or 35 intended fragments which include 20 or more bases from the it may be the non-coding Strand, also referred to as the anti nucleotide sequence in SEQID NO:1. In this context “about sense Strand. includes the particularly recited size, larger or Smaller by By "isolated nucleic acid molecule(s) is intended a several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at nucleic acid molecule, DNA or RNA, which has been both termini. removed from its native environment For example, recombi 40 Representative examples of DR4 polynucleotide frag nant DNA molecules contained in a vector are considered ments of the invention include, for example, fragments that isolated for the purposes of the present invention. Further comprise, or alternatively consist of a sequence from about examples of isolated DNA molecules include recombinant nucleotide 19 to 87,88 to 732, 88 to 138, 139 to 189, 190 to DNA molecules maintained in heterologous host cells or 240, 241 to 291, 292 to 342, 343 to 705, 343 to 393, 394 to purified (partially or substantially) DNA molecules in solu 45 444, 445 to 495, 496 to 546, 547 to 597, 598 to 648, 649 to tion. 699, 700 to 732,733 to 810, 733 to 771, 772 to 810, 811 to However, a nucleic acid molecule contained in a clone that 1422,811 to 861, 862 to 912,913 to 963, 964 to 1014, 1015 is a member of a mixed clone library (e.g., a genomic or to 1065, 1066 to 1116, 1117 to 1167, 1153 to 1284, 1153 to cDNA library) and that has not been isolated from other 1203, 1204 to 1254, 1255 to 1284, 1168 to 1218, 1219 to clones of the library (e.g., in the form of a homogeneous 50 1269, 1270 to 1320, 1321 to 1371, and 1372 to 1422 of SEQ solution containing the clone without other members of the ID NO:1, or the complementary strand thereto, or the cDNA library) or a chromosome isolated or removed from a cell or contained in the deposited plasmid. In this context “about a cell lysate (e.g., a "chromosome spread’, as in a karyotype), includes the particularly recited ranges, larger or Smaller by is not "isolated for the purposes of this invention. Isolated several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at RNA molecules include in vivo or in vitro RNA transcripts of 55 both termini. the DNA molecules of the present invention. Isolated nucleic The present invention is further directed to polynucleotides acid molecules according to the present invention further comprising, or alternatively consisting of isolated nucleic include Such molecules produced synthetically. acid molecules which encode domains of DR4. In one aspect, Isolated nucleic acid molecules of the present invention the invention provides polynucleotides comprising, or alter include DR4DNA molecules comprising, or alternatively 60 natively consisting of nucleic acid molecules which encode consisting of an open reading frame (ORF) shown in SEQID beta-sheet regions of DR4 protein set out in Table 1. Repre NO:1 and further include DNA molecules which comprise, or sentative examples of Such polynucleotides include nucleic alternatively consist of a sequence Substantially different acid molecules which encode a polypeptide comprising, or than all or part of the ORF whose initiation codon is at alternatively consisting of, one, two, three, four, five or more position 19-21 of the nucleotide sequence shown in SEQID 65 amino acid sequences selected from the group consisting of NO:1 but which, due to the degeneracy of the genetic code, amino acid residues from about 8 to about 17, amino acid still encode the DR4 polypeptide or a fragment thereof. Of residues from about 53 to about 60, amino acid residues from US 8,329,179 B2 11 12 about 87 to about 103, amino acid residues from about 146 to applied to measure the ability of DR4 polypeptides and frag about 155, amino acid residues from about 161 to about 166, ments, variants derivatives, and analogs thereof to elicit DR4 amino acid residues from about 214 to about 221, amino acid related biological activity (e.g., ability to bind TRAIL (see residues from about 240 to about 252, amino acid residues e.g., Example 6), ability to induce apoptosis in cells express from about 257 to about 264, amino acid residues from about ing the polypeptide (see e.g., Example 5) in vitro or in vivo). 274 to about 283, amino acid residues from about 324 to For example, biological activity can routinely be measured about 329, amino acid residues from about 349 to about 354, using the cell death assays performed essentially as previ amino acid residues from about 363 to about 369, amino acid ously described (Chinnaiyan et al., Cell 81:505-512 (1995); residues from about 371 to about 376, amino acid residues Boldin et al., J. Biol. Chem. 270:7795-8 (1995); Kischkelet from about 394 to about 399, and amino acid residues from 10 about 453 to about 458 in SEQ ID NO:2. In this context al., EMBO 14:5579-5588 (1995); Chinnaiyan et al., J. Biol. “about includes the particularly recited value and values Chem. 271:4961-4965 (1996)) and as set forth in Example 5 larger or Smaller by several (5, 4, 3, 2, or 1) amino acids. below. In one embodiment involving MCF7 cells, plasmids Polypeptides encoded by these polynucleotides are also encoding full-length DR4 or a candidate death domain con encompassed by the invention. 15 taining receptor are co-transfected with the plantern reporter In specific embodiments, the polynucleotide fragments of construct encoding green fluorescent protein. Nuclei of cells the invention encode a polypeptide which demonstrates a transfected with DR4 will exhibit apoptotic morphology as DR4 functional activity. By a polypeptide demonstrating a assessed by DAPI staining. DR4“functional activity” is meant, a polypeptide capable of Other methods will be known to the skilled artisan and are displaying one or more known functional activities associated within the scope of the invention. with a complete (full-length) or mature DR4 polypeptide. Preferred nucleic acid fragments of the present invention Such functional activities include, but are not limited to, include a nucleic acid molecule encoding a member selected biological activity (e.g., ability to induce apoptosis in cells from the group: a polypeptide comprising, or alternatively expressing the polypeptide (see, e.g., Example 5), antigenic consisting of the DR4 extracellular domain (amino acid resi ity (ability to bind (or compete with a DR4 polypeptide for 25 dues from about 24 to about 238 in SEQID NO:2); a polypep binding) to an anti-DR4 antibody), immunogenicity (ability tide comprising, or alternatively consisting of the DR4 cys to generate antibody which binds to a DR4 polypeptide), teine rich domain (amino acid residues from about 131 to ability to form multimers, and ability to bind to a receptor or about 229 in SEQ ID NO:2); a polypeptide comprising, or ligand for a DR4 polypeptide (e.g., TRAIL: Wiley et al., alternatively consisting of the DR4 transmembrane domain Immunity 3, 673-682 (1995)). 30 The functional activity of DR4 polypeptides, and frag (amino acid residues from about 239 to about 264 in SEQID ments, variants derivatives, and analogs thereof, can be NO:2); a fragment of the predicted mature DR4 polypeptide, assayed by various methods. wherein the fragment has a DR4 functional activity (e.g., For example, in one embodiment where one is assaying for antigenic activity or biological activity); a polypeptide com the ability to bind or compete with full-length (complete) 35 prising, or alternatively consisting of the DR4 intracellular DR4 polypeptide for binding to anti-DR4 antibody, various domain (amino acid residues from about 265 to about 468 in immunoassays known in the art can be used, including but not SEQ ID NO:2); a polypeptide comprising, or alternatively limited to, competitive and non-competitive assay systems consisting of the DR4 receptor extracellular and intracellular using techniques such as radioimmunoassays, ELISA (en domains with all or part of the transmembrane domain Zyme linked immunosorbent assay), 'sandwich’ immunoas 40 deleted; a polypeptide comprising, or alternatively consisting says, immunoradiometric assays, gel diffusion precipitation of, DR4 receptor death domain (predicted to constitute amino reactions, immunodiffusion assays, in situ immunoassays acid residues from about 379 to about 422 in SEQID NO:2): (using colloidal gold, enzyme or radioisotope labels, for a polypeptide comprising, or alternatively consisting of, one, example), western blots, precipitation reactions, agglutina two, three, four or more, epitope bearing portions of the DR4 tion assays (e.g., gel agglutination assays, hemagglutination 45 receptor protein. In additional embodiments, the polynucle assays), complement fixation assays, immunofluorescence otide fragments of the invention encode a polypeptide com assays, protein A assays, and immunoelectrophoresis assays, prising, or alternatively consisting of any combination of 1. etc. In one embodiment, antibody binding is detected by 2, 3, 4, 5, 6, 7, or all 8 of the above-encoded polypeptide detecting a label on the primary antibody. In another embodi embodiments. As above, with the leader sequence, the amino ment, the primary antibody is detected by detecting binding 50 acid residues constituting the DR4 receptor extracellular, of a secondary antibody or reagent to the primary antibody. In transmembrane and intracellular domains have been pre a further embodiment, the secondary antibody is labeled. dicted by computer analysis. Thus, one of ordinary skill Many means are known in the art for detecting binding in an would appreciate that the amino acid residues constituting immunoassay and are within the scope of the present inven these domains may vary slightly (e.g., by about 1 to 15 resi tion. 55 dues) depending on the criteria used to define the domain. In another embodiment, where a DR4 ligand is identified Polypeptides encoded by these nucleic acid molecules are (e.g., TRAIL), or the ability of a polypeptide fragment, vari also encompassed by the invention. ant or derivative of the invention to multimerize is being It is believed one or both of the extracellular cysteine rich evaluated, binding can be assayed, e.g., by means well-known motifs of the DR4 polypeptide disclosed in SEQID NO:2 is in the art, Such as, for example, reducing and non-reducing 60 important for interactions between DR4 and its ligands (e.g., gel chromatography, protein affinity chromatography, and TRAIL). Accordingly, specific embodiments of the invention affinity blotting. See generally, Phizicky, E., et al., Microbiol. are directed to polynucleotides encoding polypeptides which Rev. 59:94-123 (1995). In another embodiment, physiologi comprise, or alternatively consist of the amino acid sequence cal correlates of DR4 binding to its Substrates (signal trans of one or both of amino acid residues 131 to 183, and/or 184 duction) can be assayed. 65 to 229 of SEQID NO:2. In a specific embodiment the poly In addition, assays described herein (see Examples 5 and nucleotides encoding DR4 polypeptides of the invention 6), and those otherwise known in the art may routinely be comprise, or alternatively consist of both of the extracellular US 8,329,179 B2 13 14 cysteine rich motifs disclosed in SEQID NO:2. Polypeptides alpha-regions, beta-regions, turn-regions, and coil-regions encoded by these polynucleotides are also encompassed by (columns I, III, V, and VII in Table I), Chou-Fasman alpha the invention. regions, beta-regions, and turn-regions (columns II, IV, and In additional embodiments, the polynucleotides of the VI in Table I), Kyte-Doolittle hydrophilic regions (column invention encode functional attributes of DR4. Preferred VIII in Table I), Hopp-Woods hydrophobic regions (column embodiments of the invention in this regard include frag IX in Table I), Eisenberg alpha- and beta-amphipathic regions ments that comprise, or alternatively consist of one, two, (columns X and XI in Table I), Karplus-Schulz flexible three, four, or more of the following functional domains: regions (column XII in Table I), Jameson-Wolf regions of alpha-helix and alpha-helix forming regions ("alpha-re high antigenic index (column XIII in Table I), and Emini gions'), beta-sheet and beta-sheet forming regions ("beta 10 Surface-forming regions (column XIV in Table I). Among regions'), turn and turn-forming regions (“turn-regions'). highly preferred polynucleotides in this regard are those that coil and coil-forming regions ('coil-regions'), hydrophilic encode polypeptides comprising, or alternatively consisting regions, hydrophobic regions, alpha amphipathic regions, of regions of DR4 that combine several structural features, beta amphipathic regions, flexible regions, Surface-forming Such as several (e.g., 1, 2, 3, or 4) of the same or different regions and high antigenic index regions of DR4. 15 region features set out above. Certain preferred regions in these regards are set out in The data representing the structural or functional attributes FIG. 3, but may, as shown in Table I, be represented or of DR4 set forth in FIG.3 and/or Table I, as described above, identified by using tabular representations of the data pre was generated using the various modules and algorithms of sented in FIG. 3. The DNA*STAR computer algorithm used the DNA*STAR set on default parameters. In a preferred to generate FIG.3 (set on the original default parameters) was embodiment, the data presented in columns VIII, XII, and used to present the data in FIG. 3 in a tabular format (See XIII of Table I can be used to determine regions of DR4 which Table I). The tabular format of the data in FIG.3 may be used exhibit a high degree of potential for antigenicity. Regions of to easily determine specific boundaries of a preferred region. high antigenicity are determined from the data presented in The above-mentioned preferred regions set out in FIG. 3 columns VIII, XII, and/or XIII by choosing values which and in Table I include, but are not limited to, regions of the 25 represent regions of the polypeptide which are likely to be aforementioned types identified by analysis of the amino acid exposed on the Surface of the polypeptide in an environment sequence set out in SEQID NO:2. As set out in FIG.3 and in in which antigen recognition may occur in the process of Table I, such preferred regions include Garnier-Robson initiation of an immune response. TABLE I

P O S. I II III IV V VI VII VIII IX X XI XII XIII

B O.12 . -0.1O O.90 C -0.08 * * O.2S 1.08 C 0.42 * * O.10 O.86 T C -0.04 * * . 1.OS 1.69 A. T O.31 * F 1.OO 1.24 A. T O.10 * F 100 110 A. T O.34 : O.10 O.S8 B B -O.O3 : -O.30 O.37 B B -0.52 : -O.30 O.37 1 B B -1.12 : -0.6O O.17 B B -1.12 : -0.6O O.18 B B -2.09 : -0.60 0.14 B B -1.54 : -0.6O O. 12 B B -1.72 -0.6O O.18 B B -0.91 -0.6O O.27 B B -0.78 -0.6O 0.51 B B -0.53 F -0.45 0.95 B - C -0.13 F O.OS 0.93 T C 0.09 F O.6O 1.69 . T C 0.09 F O.6O 1.18 T T . O.64 F 0.65 0.77 er T C 0.61 F 0.45 0.64 C O.S1 F 0.25 0.41 T C 0.51 F 0.45 0.60 e B T O.13 F 0.85 0.78 A. T -0.11 F 0.85 0.78 A. T -0.40 F 0.85 0.78 A. A -0.40 F 0.45 0.58 A. A -0.12 O.30 O.60 A. A -O.O3 O.30 O.60 A. A O.O1 O.30 O.S3 A. A O.37 . -O3O 0.71 A. T -0.49 * F 1.OO 140 A. T -0.19 F 1.OO 103 B T O.O6 F 0.40 1.07 B . T O.34 F 0.25 0.73 B B O.63 F -0.15 O.64 B B O.36 . F -0.15 O.64 B B 0.22 * * F -0.15 0.32 C 0.63 * * F -0.05 0.43 T C -0.30 * * F 0.45 0.80 T C 0.56 * * F 105 0.57

US 8,329,179 B2 25 26 TABLE I-continued

Res Pos. I I III IV V VI VII VIII IX X XI XII XIII

Glu 433 A. A O.80 * * . 0.75 1.11 Arg 434 A. A 1.72 * * F O.90 1.90 Met 435 A. A 1.69 * * F O.90 4.52 Glu 436 A. A 1.69 * * F O.90 3.55 Glu 437 A. A 2.54 * F O.90 1.83 Arg 438 A. A 2.54 * * F O.90 3.70 His 439 A. A 2.48 * * F O.90 3.70 Ala 440 A A 2.19 * * F O.90 4.28 Lys 441 A. A 2.19 * * F O.90 1.53 Glu 442 A. A 2.19 * F O.90 1.9S Lys 443 A. A 1.27 * * F O.90 3.22 Ile 444 A. A 0.49 * * F O.90 1.33 Gln 445 A. A 0.22 * * F 0.75 O.63 Asp 446 A. A 0.18 * * F -0.15 O.23 Leu 447 A. A -0.12 * -O.30 O.S6 Leu 448 A. A -0.51 * 0.55 O.43 Wall 449 A. A 0.42 * O.95 O.26 Asp 450 A . . . . T -O.28 * 1.60 O.62 Ser 451 . . . T T -117 * 2.25 O.65 Gly 452 . . . T T -0.60 * 2.50 O.62 Lys 453 B T -0.60 1.25 O.S8 Phe 454 A B O.26 O.15 O.36 Ile 455 A B O.26 O.20 O.62 Tyr 456 A B O.21 0.55 O.S2 Leu 457 A B O.24 -O.O3 O.S9 Glu 458 A B . . . -0.14 F O.S4 122 Asp 459 . A . . T . . 0.26 F 1.66 0.77 Gly 460 . . . T T . O.56 . F 2.78 1.26 Thr 461 T C -0.06 : F 2.70 0.73 Gly 462 T C 0.46 * F 2.13 O.33 Ser 463 T C -0.36 F 1.26 0.44 Ala 464 A -0.36 O.14 O.25 Wall 465 B -0.40 O.17 0.44 Ser 466 B -0.48 -0.10 O.42 Leu 467 B -0.52 -0.10 O.S3 Glu 468 A -0.61 OSO O.92

Preferred nucleic acid fragments of the invention encode a 35 “about includes the particularly recited size, larger or full-length DR4 polypeptide lacking the nucleotides encod Smaller by several (5, 4, 3, 2, or 1) amino acid residues, at ing the amino-terminal methionine (nucleotides 19-21 in either terminus or at both termini. The inventors have deter mined that the above polypeptide fragments are antigenic SEQID NO: 1) as it is known that the methionine is cleaved regions of the DR4 protein. Methods for determining other naturally and Such sequences maybe useful in genetically 40 Such epitope-bearing portions of the DR4 protein are engineering DR4 expression vectors. Polypeptides encoded described in detail below. Polypeptides encoded by these by Such polynucleotides are also contemplated by the inven nucleic acids are also encompassed by the invention. tion. In specific embodiments, the polynucleotides of the inven Among highly preferred fragments in this regard are those tion are less than 100000 kb, 50000 kb, 10000 kb, 1000 kb, that comprise, or alternatively consist of regions of DR4 that 45 500 kb, 400 kb, 350 kb, 300 kb, 250 kb, 200 kb, 175 kb, 150 combine several structural features, such as several of the kb, 125 kb, 100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb, 20 kb, features set out above. Preferred nucleic acid fragments of the 15 kb, 10 kb, 7.5 kb, or 5 kb in length. present invention further include nucleic acid molecules In further embodiments, polynucleotides of the invention encoding a polypeptide comprising, or alternatively consist comprise, or alternatively consist of, at least 15, at least 30, at ing of one, two, three, four, five, or more epitope-bearing 50 least 50, at least 100, or at least 250, at least 500, or at least portions of the DR4 protein. In particular, Such nucleic acid 1000 contiguous nucleotides of DR4 coding sequence, but fragments of the present invention include nucleic acid mol consist of less than or equal to 1000 kb, 500 kb, 250 kb, 200 ecules encoding: a polypeptide comprising, or alternatively kb, 150 kb, 100 kb, 75 kb, 50 kb, 30 kb, 25 kb, 20 kb, 15 kb, consisting of, amino acid residues from about 35 to about 92 10 kb, or 5 kb of genomic DNA that flanks the 5' or 3' coding in SEQID NO:2; a polypeptide comprising, or alternatively 55 nucleotide set forth in SEQ ID NO: 1. In further embodi consisting of amino acid residues from about 114 to about ments, polynucleotides of the invention comprise, or alterna 160 in SEQID NO:2; a polypeptide comprising, or alterna tively consist of, at least 15, at least 30, at least 50, at least 100, tively consisting of, amino acid residues from about 169 to or at least 250, at least 500, or at least 1000 contiguous about 240 in SEQ ID NO:2; a polypeptide comprising, or nucleotides of DR4 coding sequence, but do not comprise all alternatively consisting of amino acid residues from about 60 or a portion of any DR4 intron. In another embodiment, the 267 to about 298 in SEQID NO:2; a polypeptide comprising, nucleic acid comprising, or alternatively consisting of DR4 or alternatively consisting of amino acid residues from about coding sequence does not contain coding sequences of a 330 to about 364 in SEQID NO:2; a polypeptide comprising, genomic flanking gene (i.e., 5' or 3' to the DR4 gene in the or alternatively consisting of amino acid residues from about genome). In other embodiments, the polynucleotides of the 391 to about 404 in SEQ ID NO:2; and a polypeptide com 65 invention do not contain the coding sequence of more than prising, or alternatively consisting of amino acid residues 1000,500, 250, 100, 50,25, 20, 15, 10,5,4,3,2, or 1 genomic from about 418 to about 465 in SEQID NO:2. In this context flanking gene(s). US 8,329,179 B2 27 28 In addition, the invention provides nucleic acid molecules additional coding sequence which codes for additional amino having nucleotide sequences related to extensive portions of acids, such as those which provide additional functionalities. SEQID NO:1 as follows: HTOIY07R (SEQ ID NO:6) and Thus, for instance, the polypeptide may be fused to a marker HTXEY80R (SEQID NO:7) both shown in FIG. 4. sequence. Such as a peptide, which facilitates purification of Further, the invention includes a polynucleotide compris 5 the fused polypeptide. In certain preferred embodiments of ing, or alternatively consisting of any portion of at least about this aspect of the invention, the marker sequence is a hexa 30 nucleotides, preferably at least about 50 nucleotides, of histidine peptide, Such as the tag provided in a pCE vector SEQ ID NO:1 from residue 365 to 1,422. In this context (Qiagen, Inc.), among others, many of which are commer “about includes the particularly recited size, larger or cially available. As described in Gentzetal. Proc. Natl. Acad. smaller by several (5, 4, 3, 2, or 1) nucleotides, at either 10 Sci. USA 86:821-824 (1989), for instance, hexa-histidine pro terminus or at both termini. vides for convenient purification of the fusion protein. The In another embodiment, the invention provides an isolated HA tag corresponds to an epitope derived of influenza hemag nucleic acid molecule comprising, or alternatively consisting glutinin protein, which has been described by Wilson et al., of a polynucleotide which hybridizes under stringent hybrid Cell 37:767 (1984), for instance. ization conditions to a portion of the polynucleotide in a 15 The present invention further relates to variants of the nucleic acid molecule of the invention described above, for nucleic acid molecules of the present invention, which encode instance, the sequence complementary to the coding and/or for fragments, analogs or derivatives of the DR4 polypeptide. noncoding (i.e., transcribed, untranslated) sequence depicted Variants may occur naturally, such as an allelic variant. By an in SEQID NO:1, the cDNA contained in ATCC Deposit No. “allelic variant' is intended one of several alternate forms of 97853, and the sequence encoding a DR4 domain or a poly a gene occupying a given locus on a chromosome of an nucleotide fragment as described herein. By “stringent organism. Genes II. Lewin, B., ed., John Wiley & Sons, New hybridization conditions” is intended overnight incubation at York (1985). Non-naturally occurring variants may be pro 42°C. in a solution comprising, or alternatively consisting of duced using art-known mutagenesis techniques. 50% formamide, 5xSSC (750 mM. NaCl, 75 mM trisodium Such variants include those produced by nucleotide sub citrate), 50 mM sodium phosphate (pH 7.6), 5xDenhardt's 25 stitutions, deletions or additions which may involve one or solution, 10% dextran sulfate, and 20 g/ml denatured, more nucleotides. The variants may be altered in coding or sheared salmon sperm DNA, followed by washing the filters non-coding regions or both. Alterations in the coding regions in 0.1xSSC at about 65° C. Polypeptides encoded by these may produce conservative or non-conservative amino acid nucleic acids are also encompassed by the invention. substitutions, deletions or additions. Especially preferred By a polynucleotide which hybridizes to a “portion of a 30 among these are silent Substitutions, additions and deletions, polynucleotide is intended a polynucleotide (either DNA or which do not alter the properties and functional activities of RNA) hybridizing to at least about 15 nucleotides (nt), and the DR4 receptor or portions thereof. Also especially pre more preferably at least about 20 nt, still more preferably at ferred in this regard are conservative Substitutions. least about 30 nt, and even more preferably about 30-70 nt of Further embodiments of the invention include isolated the reference polynucleotide. In this context “about includes 35 nucleic acid molecules that are at least 80% identical, and the particularly recited size, larger or smaller by several (5, 4, more preferably at least 85%, 90%, 92%, 95%, 96%, 97%, 3, 2, or 1) nucleotides, at either terminus or at both termini. By 98% or 99% identical, to (a) a nucleotide sequence encoding a portion of a polynucleotide of “at least 20 nt in length.” for the full-length DR4 polypeptide having the complete amino example, is intended 20 or more contiguous nucleotides from acid sequence in SEQ ID NO:2, including the predicted the nucleotide sequence of the reference polynucleotide (e.g., 40 leader sequence; (b) nucleotide sequence encoding the full the deposited cDNA or the nucleotide sequence as shown in length DR4 polypeptide having the complete amino acid SEQ ID NO:1. These have uses, which include, but are not sequence in SEQ ID NO:2, including the predicted leader limited to, as diagnostic probes and primers as discussed sequence but lacking the amino terminal methionine; (c) a above and in more detail below. nucleotide sequence encoding the mature DR4 polypeptide Of course, a polynucleotide which hybridizes only to a 45 (full-length polypeptide with the leader removed) having the poly A sequence (such as the 3 terminal poly(A) tract of the amino acid sequence at positions about 24 to about 468 in DR4 cDNA shown in SEQID NO:1), or to a complementary SEQID NO:2; (d) a nucleotide sequence encoding the full stretch of T (or U) resides, would not be included in a poly length DR4 polypeptide having the complete amino acid nucleotide of the invention used to hybridize to a portion of a sequence including the leader encoded by the cDNA con nucleic acid of the invention, since such a polynucleotide 50 tained in ATCC Deposit No. 97853; (e) a nucleotide sequence would hybridize to any nucleic acid molecule containing a encoding the full-length DR4 polypeptide having the com poly (A) stretch or the complement thereof (e.g., practically plete amino acid sequence including the leader but lacking the any double-stranded cDNA). amino terminal methionine encoded by the cDNA contained As indicated, nucleic acid molecules of the present inven in ATCC Deposit No. 97853; (f) a nucleotide sequence encod tion which encode the DR4 polypeptide may include, but are 55 ing the mature DR4 polypeptide having the amino acid not limited to the coding sequence for the mature polypeptide, sequence encoded by the cDNA contained in ATCC Deposit by itself the coding sequence for the mature polypeptide and No. 97853; (g) a nucleotide sequence that encodes the DR4 additional sequences, such as those encoding a leader or extracellular domain having the amino acid sequence at posi secretary sequence. Such as a pre-, or pro- or prepro-protein tions about 24 to about 238 in SEQ ID NO:2, or the DR4 sequence; the coding sequence of the mature polypeptide, 60 extracellular domain encoded by the cDNA contained in with or without the aforementioned additional coding ATCC Deposit No. 97853: (h) a nucleotide sequence that sequences, together with additional, non-coding sequences, encodes the DR4 transmembrane domain having the amino including for example, but not limited to introns and non acid sequence at positions about 239 to about 264 in SEQID coding 5' and 3' sequences, such as the transcribed, non NO:2, or the DR4 transmembrane domain encoded by the translated sequences that play a role in transcription, mRNA 65 cDNA contained in ATCC Deposit No. 97853: (i) a nucle processing including splicing and polyadenylation signals, otide sequence that encodes the DR4 intracellular domain for example—ribosome binding and stability of mRNA: having the amino acid sequence at positions about 265 to US 8,329,179 B2 29 30 about 468 in SEQID NO:2, or the DR4 intracellular domain Subject sequence, also referred to as a global sequence align encoded by the cDNA contained in ATCC Deposit No. ment, is determined using the FASTDB computer program 97853: (i) a nucleotide sequence that encodes the DR4 death based on the algorithm of Brutlag et al. (Comp. App. BioSci. domain having the amino acid sequence at positions about 6:237-245 (1990)). Preferred parameters used in a FASTDB 379 to about 422 in SEQID NO:2, or the DR4 death domain alignment of DNA sequences to calculate percent identity encoded by the cDNA contained in ATCC Deposit No. are: Matrix Unitary, k-tuple=4, Mismatch Penalty=1, Join 97853; (k) a nucleotide sequence that encodes the DR4 cys ing Penalty=30, Randomization Group Length=0, Cutoff teine rich domain having the amino acid sequence at positions Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window about 131 to about 229 in SEQID NO:2, or the DR4 cysteine Size=500 or the length of the subject nucleotide sequence, rich domain encoded by the cDNA contained in ATCC 10 whichever is shorter. According to this embodiment, if the Deposit No. 97853: (1) a nucleotide sequence that encodes the Subject sequence is shorter than the query sequence because DR4 receptor extracellular and intracellular domains with all of 5" or 3' deletions, not because of internal deletions, a or part of the transmembrane domain deleted; (m) a nucle manual correction is made to the results to take into consid otide sequence that encodes a fragment of the polypeptide of eration the fact that the FASTDB program does not account (c) having DR4 functional activity (e.g., antigenic or biologi 15 for 5' and 3' truncations of the subject sequence when calcu cal activity); or (n) a nucleotide sequence complementary to lating percent identity. For Subject sequences truncated at the any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), 5' or 3' ends, relative to the query sequence, the percent (h), (i), (), (k), (1), or (m) above. In this context “about identity is corrected by calculating the number of bases of the includes the particularly recited size, larger or Smaller by query sequence that are 5' and 3' of the Subject sequence, several (5.4, 3, 2, or 1) amino acid residues, at either terminus which are not matched/aligned, as a percent of the total bases or at both termini. Polypeptides encoded by these nucleic of the query sequence. A determination of whether a nucle acids are also encompassed by the invention. otide is matched/aligned is determined by results of the By a polynucleotide having a nucleotide sequence at least, FASTDB sequence alignment. This percentage is then sub for example, 95% “identical to a reference nucleotide tracted from the percent identity, calculated by the above sequence encoding a DR4 polypeptide is intended that the 25 FASTDB program using the specified parameters, to arrive at nucleotide sequence of the polynucleotide is identical to the a final percent identity score. This corrected score is what is reference sequence except that the polynucleotide sequence used for the purposes of this embodiment. Only bases outside may include up to five mismatches per each 100 nucleotides the 5' and 3' bases of the subject sequence, as displayed by the of the reference nucleotide sequence encoding the DR4 FASTDB alignment, which are not matched/aligned with the polypeptide. In other words, to obtain a polynucleotide hav 30 query sequence, are calculated for the purposes of manually ing a nucleotide sequence at least 95% identical to a reference adjusting the percent identity Score. For example, a 90 base nucleotide sequence, up to 5% of the nucleotides in the ref subject sequence is aligned to a 100 base query sequence to erence sequence may be deleted or substituted with another determine percent identity. The deletions occur at the 5' end of nucleotide, or a number of nucleotides up to 5% of the total the subject sequence and therefore, the FASTDB alignment nucleotides in the reference sequence may be inserted into the 35 does not show a matched/alignment of the first 10 bases at 5' reference sequence. These mismatches of the reference end. The 10 unpaired bases represent 10% of the sequence sequence may occur at the 5' or 3' terminal positions of the (number of bases at the 5' and 3' ends not matched/total reference nucleotide sequence or anywhere between those number of bases in the query sequence) so 10% is subtracted terminal positions, interspersed either individually among from the percent identity score calculated by the FASTDB nucleotides in the reference sequence or in one or more con 40 program. If the remaining 90 bases were perfectly matched tiguous groups within the reference sequence. The reference the final percent identity would be 90%. In another example, (query) sequence may be the entire DR4 nucleotide sequence a 90 base subject sequence is compared with a 100 base query shown in SEQ ID NO:1 or any fragment (e.g., a polynucle sequence. This time the deletions are internal deletions so that otide encoding the amino acid sequence of a DR4 N- and/or there are no bases on the 5' or 3' of the subject sequence which C-terminal deletion described herein) as described herein. 45 are not matched/aligned with the query. In this case the per As a practical matter, whether any particular nucleic acid cent identity calculated by FASTDB is not manually cor molecule is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, rected. Once again, only bases 5' and 3' of the subject 98% or 99% identical to, for instance, the nucleotide sequence which are not matched/aligned with the query sequence shown in SEQ ID NO:1 or to the nucleotide sequence are manually corrected for. No other manual cor sequences of the deposited cDNA can be determined conven 50 rections are made for the purposes of this embodiment. tionally using known computer programs such as the Bestfit The present application is directed to nucleic acid mol program (Wisconsin Sequence Analysis Package, Version 8 ecules at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or for Unix, Genetics Computer Group, University Research 99% identical to the nucleic acid sequence shown in SEQID Park, 575 Science Drive, Madison, Wis. 53711). Bestfit uses NO:1 or to the nucleic acid sequence of the deposited cDNAs, the local homology algorithm of Smith and Waterman, 55 irrespective of whether they encode a polypeptide having Advances in Applied Mathematics 2:482-489 (1981), to find DR4 functional activity. This is because even where a par the best segment of homology between two sequences. When ticular nucleic acid molecule does not encode a polypeptide using Bestfit or any other sequence alignment program to having DR4 functional activity, one of skill in the art would determine whether a particular sequence is, for instance, 95% still know how to use the nucleic acid molecule, for instance, identical to a reference sequence according to the present 60 as a hybridization probe or a polymerase chain reaction invention, the parameters are set, of course, such that the (PCR) primer. Uses of the nucleic acid molecules of the percentage of identity is calculated over the full length of the present invention that do not encode a polypeptide having reference nucleotide sequence and that gaps in homology of DR4 functional activity include, inter alia, (1) isolating the up to 5% of the total number of nucleotides in the reference DR4 gene or allelic variants thereof in a cDNA library; (2) in sequence are allowed. 65 situ hybridization (e.g., “FISH) to metaphase chromosomal In a specific embodiment, the identity between a reference spreads to provide precise chromosomal location of the DR4 (query) sequence (a sequence of the present invention) and a gene, as described in Verma et al., Human Chromosomes. A US 8,329,179 B2 31 32 Manual of Basic Techniques, Pergamon Press, New York as, for example, as a diagnostic reagent. Detection of a (1988); and (3) Northern Blot analysis for detecting DR4 mutated form of DR4 associated with a dysfunction will mRNA expression in specific tissues. provide a diagnostic tool that can add or define a diagnosis of Preferred, however, are nucleic acid molecules having a disease or Susceptibility to a disease which results from sequences at least 80%, 85%, 90%, 92%. 95%, 96%, 97%, under-expression over-expression or altered expression of 98% or 99% identical to the nucleic acid sequence shown in SEQID NO:1 or to the nucleic acid sequence of the deposited DR4 or a soluble form thereof, such as, for example, tumors cDNAs which do, in fact, encode a polypeptide having DR4 or autoimmune disease. protein functional activity. By “a polypeptide having DR4 Individuals carrying mutations in the DR4 gene may be protein functional activity” is intended polypeptides exhibit detected at the DNA level by a variety of techniques. Nucleic ing activity similar, but not necessarily identical, to an activity 10 acids for diagnosis may be obtained from a patient’s cells, of the DR4 protein of the invention (either the full-length Such as from blood, urine, saliva, tissue biopsy and autopsy protein (i.e. complete) or, preferably, the mature protein), as material. The genomic DNA may be used directly for detec measured in a particular functional and/or biological assay. tion or may be amplified enzymatically by using PCR prior to For example, DR4 polypeptide functional activity can be measured by the ability of a polypeptide sequence described 15 analysis. (Saiki et al., Nature 324:163-166 (1986)). RNA or herein to form multimers (e.g., homodimers and homotrim cDNA may also be used in the same ways. As an example, ers) with complete DR4, and to bind a DR4 ligand (e.g., PCR primers complementary to the nucleic acid encoding TRAIL). These functional assays can be routinely performed DR4 can be used to identify and analyze DR4 expression and using techniques described herein and otherwise known in the mutations. For example, deletions and insertions can be art. detected by a change in size of the amplified product in For example, DR4 protein functional activity (e.g., biologi comparison to the normal genotype. Point mutations can be cal activity) can routinely be measured using the cell death identified by hybridizing amplified DNA to radiolabeled assays performed essentially as previously described (A. M. DR4 RNA or alternatively, radiolabeled DR4 antisense DNA Chinnaiyan, et al., Cell 81,505-12 (1995); M. P. Boldin, et al., sequences. Perfectly matched sequences can be distinguished J Biol Chem 270,7795-8 (1995); F. C. Kischkel, et al., EMBO 25 from mismatched duplexes by RNase A digestion or by dif 14, 5579-5588 (1995); A. M. Chinnaiyan, et al., J Biol Chem ferences in melting temperatures. 271,4961-4965 (1996)) or as set forth in Example5, below. In Sequence differences between a reference gene and genes MCF7 cells, plasmids encoding full-length DR4 or a candi having mutations also may be revealed by direct DNA date death domain containing receptors are co-transfected sequencing. In addition, cloned DNA segments may be with the plantern reporter construct encoding green fluores 30 employed as probes to detect specific DNA segments. The cent protein. Nuclei of cells transfected with DR4 will exhibit sensitivity of such methods can be greatly enhanced by appro apoptotic morphology as assessed by DAPI staining. Similar priate use of PCR or another amplification method. For to TNFR-1 and Fas/APO-1 (M. Muzio, et al., Cell 85, 817 example, a sequencing primer is used with double-stranded 827 (1996); M. P. Boldin, et al., Cell 85,803-815 (1996); M. PCR product or a single-stranded template molecule gener Tewari, et al., J Biol Chem 270, 3255-60 (1995)), DR4-in 35 ated by a modified PCR. The sequence determination is per duced apoptosis is blocked by the inhibitors of ICE-like pro formed by conventional procedures with radiolabeled nucle teases, CrmA and Z-VAD-fmk. otide or by automatic sequencing procedures with Ofcourse, due to the degeneracy of the genetic code, one of fluorescent-tags. ordinary skill in the art will immediately recognize that a Genetic testing based on DNA sequence differences may large number of the nucleic acid molecules having a sequence 40 be achieved by detection of alteration in electrophoretic at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% mobility of DNA fragments in gels, with or without denatur identical to, for example, the nucleic acid sequence of the ing agents. Small sequence deletions and insertions can be deposited cDNA or the nucleic acid sequence shown in SEQ visualized by high resolution gel electrophoresis. DNA frag ID NO:1 will encode “a polypeptide having DR4 protein ments of different sequences may be distinguished on dena functional activity.” In fact, since degenerate variants of these 45 turing formamide gradient gels in which the mobilities of nucleotide sequences all encode the same polypeptide, this different DNA fragments are retarded in the gel at different will be clear to the skilled artisan even without performing the positions according to their specific melting or partial melting above described comparison assay. It will be further recog temperatures (see, e.g., Myers et al., Science 230:1242 nized in the art that, for Such nucleic acid molecules that are (1985)). not degenerate variants, areasonable number will also encode 50 Sequence changes at specific locations also may be a polypeptide having DR4 protein functional activity. This is revealed by nuclease protection assays, such as RNase and S1 because the skilled artisan is fully aware of amino acid sub protection or the chemical cleavage method (e.g., Cotton et stitutions that are either less likely or not likely to signifi al., Proc. Natl. Acad. Sci. USA 85: 4397–4401 (1985)). cantly effect protein function (e.g., replacing one aliphatic Thus, the detection of a specific DNA sequence may be amino acid with a second aliphatic amino acid), as further 55 achieved by methods such as hybridization, RNase protec described below. tion, chemical cleavage, direct DNA sequencing or the use of For example, guidance concerning how to make pheno restriction enzymes, (e.g., restriction fragment length poly typically silentamino acid Substitutions is provided in Bowie, morphisms (“RFLP) and Southern blotting of genomic J.U. et al., “Deciphering the Message in Protein Sequences: DNA. Tolerance to Amino Acid Substitutions. Science 247: 1306 60 In addition to more conventional gel-electrophoresis and 1310 (1990), wherein the authors indicate that proteins are DNA sequencing, mutations also can be detected by in situ Surprisingly tolerant of amino acid substitutions. analysis. Polynucleotide Assays Vectors and Host Cells 65 This invention is also related to the use of the DR4 poly The present invention also relates to vectors which include nucleotides to detect complementary polynucleotides Such DNA molecules of the present invention, host cells which are US 8,329,179 B2 33 34 genetically engineered with vectors of the invention and the neomycin resistance for eukaryotic cell culture, and tetracy production of polypeptides of the invention by recombinant cline or amplicillin resistance genes for culturing E. coli and techniques. other bacteria. Host cells can be genetically engineered to incorporate The vector containing the appropriate DNA sequence as nucleic acid molecules and express polypeptides of the described elsewhere herein, as well as an appropriate pro present invention. The polynucleotides may be introduced moter, and other appropriate control sequences, may be intro alone or with other polynucleotides. Such other polynucle duced into an appropriate host using a variety of well known otides may be introduced independently, co-introduced or techniques Suitable to expression therein of a desired introduced joined to the polynucleotides of the invention. polypeptide. Representative examples of appropriate hosts 10 include bacterial cells, such as E. coli, Streptomyces and In accordance with this aspect of the invention the vector Salmonella typhimurium cells; fungal cells, such as yeast may be, for example, a plasmid vector, a single or double cells; insect cells such as Drosophila S2 and Spodoptera Sf9 stranded phage vector, a single or double-stranded RNA or cells; animal cells such as CHO, COS and Bowes melanoma DNA viral vector. Such vectors may be introduced into cells cells; and plant cells. Hosts for of a great variety of expression as polynucleotides, preferably DNA, by well-known tech 15 constructs are well known, and those of skill will be enabled niques for introducing DNA and RNA into cells. Viral vectors by the present disclosure readily to select a host for express may be replication competent or replication defective. In the ing a polypeptides in accordance with this aspect of the latter case viral propagation generally will occur only in present invention. complementing host cells. Among vectors preferred for use in bacteria are pGE70, Preferred among vectors, in certain respects, are those for pOE60 and pGE-9, available from Qiagen; pBS vectors, expression of polynucleotides and polypeptides of the present Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, invention. Generally, Such vectors comprise cis-acting con pNH18A, pNH46A, available from Stratagene; and ptrc99a, trol regions effective for expression in a host operatively pKK223-3, pKK233-3, plDR540, pRIT5 available from Phar linked to the polynucleotide to be expressed. Appropriate macia. Among preferred eukaryotic vectors are pWLNEO, trans-acting factors either are Supplied by the host, Supplied 25 pSV2CAT, pCG44, pXT1 and pSG available from Strat by a complementing vector or supplied by the vector itself agene; and pSVK3, pBPV, pMSG and pSVL available from upon introduction into the host. Pharmacia. These vectors are listed solely by way of illustra A great variety of expression vectors can be used to express tion of the many commercially available and well known a polypeptide of the invention. Such vectors include chromo vectors available to those of skill in the art. Somal, episomal and virus-derived vectors e.g., vectors 30 Selection of appropriate vectors and promoters for expres derived from bacterial plasmids, from bacteriophage, from sion in a host cell is a well-known procedure and the requisite yeast episomes, from yeast chromosomal elements, from techniques for expression vector construction, introduction of viruses Such as baculoviruses, papova viruses, such as SV40. the vector into the host and expression in the host are routine vaccinia viruses, adenoviruses, fowlpox viruses, pseudora skills in the art. bies viruses and retroviruses, and vectors derived from com 35 The present invention also relates to host cells containing binations thereof, such as those derived from plasmid and the above-described vector constructs described herein, and bacteriophage genetic elements, such as cosmids and additionally encompasses host cells containing nucleotide phagemids, all may be used for expression in accordance with sequences of the invention that are operably associated with this aspect of the present invention. Generally, any vector one or more heterologous control regions (e.g., promoter Suitable to maintain, propagate or express polynucleotides to 40 and/or enhancer) using techniques known of in the art. The express a polypeptide in a host may be used for expression in host cell can be a higher eukaryotic cell. Such as a mammalian this regard. cell (e.g., a human derived cell), or a lower eukaryotic cell, The DNA sequence in the expression vector is operatively Such as a yeast cell, or the host cell can be a prokaryotic cell, linked to appropriate expression control sequence(s)), includ such as a bacterial cell. The host strain may be chosen which ing, for instance, a promoter to direct mRNA transcription. 45 modulates the expression of the inserted gene sequences, or Representatives of Such promoters include the phage lambda modifies and processes the gene product in the specific fash PL promoter, the E. colilac, trp and tac promoters, the SV40 ion desired. Expression from certain promoters can be early and late promoters and promoters of retroviral LTRs, to elevated in the presence of certain inducers; thus expression name just a few of the well-known promoters. In general, of the genetically engineered polypeptide may be controlled. expression constructs will contain sites for transcription, ini 50 Furthermore, different host cells have characteristics and spe tiation and termination, and, in the transcribed region, a ribo cific mechanisms for the translational and post-translational Some binding site for translation. The coding portion of the processing and modification (e.g., phosphorylation, cleav mature transcripts expressed by the constructs will include a age) of proteins. Appropriate cell lines can be chosen to translation initiating AUG at the beginning and a termination ensure the desired modifications and processing of the for codon (UAA, UGA or UAG) appropriately positioned at the 55 eign protein expressed. end of the polypeptide to be translated. Introduction of the construct into the host cell can be In addition, the constructs may contain control regions that effected by calcium phosphate transfection, DEAE-dextran regulate as well as engender expression. Generally, Such mediated transfection, cationic lipid-mediated transfection, regions will operate by controlling transcription, such as electroporation, transduction, infection or other methods. repressor binding sites and enhancers, among others. 60 Such methods are described in many standard laboratory Vectors for propagation and expression generally will manuals, such as Davis et al., Basic Methods in Molecular include selectable markers. Such markers also may be Suit Biology (1986). able for amplification or the vectors may contain additional In addition to encompassing host cells containing the vec markers for this purpose. In this regard, the expression vectors tor constructs discussed herein, the invention also encom preferably contain one or more selectable marker genes to 65 passes primary, secondary, and immortalized host cells of provide a phenotypic trait for selection of transformed host Vertebrate origin, particularly mammalian origin, that have cells. Preferred markers include dihydrofolate reductase or been engineered to delete or replace endogenous genetic US 8,329,179 B2 35 36 material (e.g., DR4 coding sequence), and/or to include or by chemical modification techniques which are well genetic material (e.g., heterologous polynucleotide known in the art. It will be appreciated that the same type of sequences) that is operably associated with DR4 polynucle modification may be present in the same or varying degrees at otides of the invention, and which activates, alters, and/or several sites in a given DR4 polypeptide. Also, a given DR4 amplifies endogenous DR4 polynucleotides. For example, polypeptide may contain many types of modifications. DR4 techniques known in the art may be used to operably associate polypeptides may be branched, for example, as a result of heterologous control regions (e.g., promoter and/or ubiquitination, and they may be cyclic, with or without enhancer) and endogenous DR4 polynucleotide sequences branching. Cyclic, branched, and branched cyclic DR4 via homologous recombination (see, e.g., U.S. Pat. No. 5,641, polypeptides may result from posttranslational natural pro 670, issued Jun. 24, 1997: International Publication Number 10 cesses or may be made by synthetic methods. Modifications WO 96/29411, published Sep. 26, 1996: International Publi include acetylation, acylation, ADP-ribosylation, amidation, cation Number WO94/12650, published Aug. 4, 1994: Koller covalent attachment of flavin, covalent attachment of a heme et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and moiety, covalent attachment of a nucleotide or nucleotide Zijlstra et al., Nature 342:435-438 (1989), the disclosures of derivative, covalent attachment of a lipid or lipid derivative, each of which are incorporated by reference in their entire 15 covalent attachment of phosphatidylinositol, cross-linking, ties). cyclization, disulfide bond formation, demethylation, forma The polypeptide may be expressed in a modified form, tion of covalent cross-links, formation of cysteine, formation Such as a fusion protein, and may include not only secretion of pyroglutamate, formylation, gamma-carboxylation, glyco signals but also additional heterologous functional regions. Sylation, GPI anchor formation, hydroxylation, iodination, Such a fusion protein can be made by ligating polynucle methylation, myristoylation, oxidation, pegylation, pro otides of the invention and the desired nucleic acid sequence teolytic processing, phosphorylation, prenylation, racemiza encoding the desired amino acid sequence to each other, by tion, selenoylation, sulfation, transfer-RNA mediated addi methods known in the art, in the proper reading frame, and tion of amino acids to proteins such as arginylation, and expressing the fusion protein product by methods known in ubiquitination. (See, for instance, PROTEINS STRUC the art. Alternatively. Such a fusion protein can be made by 25 TURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. protein synthetic techniques, e.g., by use of a peptide synthe Creighton, W.H. Freeman and Company, New York (1993); sizer. Thus, for instance, a region of additional amino acids, POSTTRANSLATIONAL COVALENT MODIFICATION particularly charged amino acids, may be added to the N-ter OF PROTEINS, B. C. Johnson, Ed., Academic Press, New minus of the polypeptide to improve stability and persistence York, pgs. 1-12 (1983); Seifter et al., Meth Enzymol 182:626 in the host cell, during purification or during Subsequent 30 646 (1990); Rattanet al., Ann NY AcadSci 663:48-62 (1992) handling and storage. Also, region also may be added to the ..) polypeptide to facilitate purification. Such regions may be The DR4 can be recovered and purified from chemical removed prior to final preparation of the polypeptide. For synthesis and recombinant cell cultures by standard methods example, in one embodiment, polynucleotides encoding DR4 which include, but are not limited to, ammonium sulfate or polypeptides of the invention may be fused to the pelBpectate 35 ethanol precipitation, acid extraction, anion or cation lyase signal sequence to increase the efficiency to expression exchange chromatography, phosphocellulose chromatogra and purification of Such polypeptides in Gram-negative bac phy, hydrophobic interaction chromatography, affinity chro teria. See, U.S. Pat. Nos. 5,576,195 and 5,846,818, the con matography, hydroxyapatite chromatography and lectin tents of which are herein incorporated by reference in their chromatography. Most preferably, high performance liquid entireties. 40 chromatography (“HPLC) is employed for purification. The addition of peptide moieties to polypeptides to engen DR4 polynucleotides and polypeptides may be used in der secretion or excretion, to improve stability and to facili accordance with the present invention for a variety of appli tate purification, among others, are familiar and routine tech cations, particularly those that make use of the chemical and niques in the art. A preferred fusion protein comprises a biological properties of DR4. Among these are applications in heterologous region from immunoglobulin that is useful to 45 the treatment and prevention of tumors, parasitic infections, solubilize proteins. For example, EP-A-O 464533 (Canadian bacterial infections, viral infections, restenosis, and graft VS. counterpart 2045869) discloses fusion proteins comprising host disease; to induce resistance to parasites, bacteria and various portions of constant region of immunoglobin mol viruses; to induce proliferation of T-cells, endothelial cells ecules together with another human protein or part thereof. In and certain hematopoietic cells; to regulate anti-viral many cases, the Fc part in a fusion protein is thoroughly 50 responses; and to treat and prevent certain autoimmune dis advantageous for use in therapy and diagnosis and thus eases after stimulation of DR4 by an agonist. Additional results, for example, in improved pharmacokinetic properties applications relate to diagnosis, treatment, and prevention of (EP-A 0232 262). On the other hand, for some uses it would disorders of cells, tissues and organisms. These aspects of the be desirable to be able to delete the Fc part after the fusion invention are discussed further below. protein has been expressed, detected and purified in the 55 advantageous manner described. This is the case when Fc DR4Proteins and Fragments portion proves to be a hindrance to use in therapy and diag nosis, for example when the fusion protein is to be used as The invention further provides for DR4 proteins containing antigen for immunizations. In drug discovery, for example, polypeptide sequences encoded by the polynucleotides of the human proteins, such as, hL5-receptor has been fused with 60 invention. Fc portions for the purpose of high-throughput Screening The DR4 proteins of the invention may be in monomers or assays to identify antagonists of hiL-5. See, D. Bennett et al., multimers (i.e., dimers, trimers, tetramers, and higher multi Journal of Molecular Recognition, Vol. 8:52-58 (1995) and mers). Accordingly, the present invention relates to mono K. Johanson et al. The Journal of Biological Chemistry, Vol. mers and multimers of the DR4 proteins of the invention, their 270, No. 16:9459-9471 (1995). 65 preparation, and compositions (preferably, pharmaceutical As mentioned, DR4 polypeptides may be modified by compositions) containing them. In specific embodiments, the either natural processes, such as posttranslational processing, polypeptides of the invention are monomers, dimers, trimers US 8,329,179 B2 37 38 or tetramers. In additional embodiments, the multimers of the Publication No. WO 98/493.05, the contents of which are invention are at least dimers, at least trimers, or at least tet herein incorporated by reference in its entirety). aS. The multimers of the invention may be generated using Multimers encompassed by the invention may be chemical techniques known in the art. For example, proteins homomers or heteromers. As used herein, the term homomer, desired to be contained in the multimers of the invention may refers to a multimer containing only DR4 proteins of the be chemically cross-linked using linker molecules and linker invention (including DR4 fragments, variants, and fusion molecule length optimization techniques known in the art proteins, as described herein). These homomers may contain (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorpo DR4 proteins having identical or different polypeptide rated by reference in its entirety). Additionally, multimers of sequences. In a specific embodiment, a homomer of the 10 the invention may be generated using techniques known in the invention is a multimer containing only DR4 proteins having art to form one or more inter-molecule cross-links between an identical polypeptide sequence. In another specific the cysteine residues located within the polypeptide sequence embodiment, a homomer of the invention is a multimer con of the proteins desired to be contained in the multimer (see, taining DR4 proteins having different polypeptide sequences. e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by In specific embodiments, the multimer of the invention is a 15 reference in its entirety). Further, proteins of the invention homodimer (e.g., containing DR4 proteins having identical or may be routinely modified by the addition of cysteine or different polypeptide sequences) or a homotrimer (e.g., con biotin to the C-terminus or N-terminus of the polypeptide taining DR4 proteins having identical or different polypep sequence of the protein and techniques known in the art may tide sequences). In additional embodiments, the homomeric be applied to generate multimers containing one or more of multimer of the invention is at least a homodimer, at least a these modified proteins (see, e.g., U.S. Pat. No. 5,478,925, homotrimer, or at least a homotetramer. which is herein incorporated by reference in its entirety). As used herein, the term heteromer refers to a multimer Additionally, techniques known in the art may be applied to containing heterologous proteins (i.e., proteins containing generate liposomes containing the protein components only polypeptide sequences that do not correspond to a desired to be contained in the multimer of the invention (see, polypeptide sequences encoded by the DR4 gene) in addition 25 e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by to the DR4 proteins of the invention. In a specific embodi reference in its entirety). ment, the multimer of the invention is a heterodimer, a het Alternatively, multimers of the invention may be generated erotrimer, or a heterotetramer. In additional embodiments, the using genetic engineering techniques known in the art. homomeric multimer of the invention is at least a homodimer, In one embodiment, proteins contained in multimers of the at least a homotrimer, or at least a homotetramer. 30 invention are produced recombinantly using fusion protein Multimers of the invention may be the result of hydropho technology described herein or otherwise known in the art bic, hydrophilic, ionic and/or covalent associations and/or (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorpo may be indirectly linked, by for example, liposome forma rated by reference in its entirety). In a specific embodiment, tion. Thus, in one embodiment, multimers of the invention, polynucleotides coding for a homodimer of the invention are Such as, for example, homodimers or homotrimers, are 35 generated by ligating a polynucleotide sequence encoding a formed when proteins of the invention contact one another in polypeptide of the invention to a sequence encoding a linker solution. In another embodiment, heteromultimers of the polypeptide and then further to a synthetic polynucleotide invention, such as, for example, heterotrimers or heterotet encoding the translated product of the polypeptide in the ramers, are formed when proteins of the invention contact reverse orientation from the original C-terminus to the N-ter antibodies to the polypeptides of the invention (including 40 minus (lacking the leader sequence) (see, e.g., U.S. Pat. No. antibodies to the heterologous polypeptide sequence in a 5,478,925, which is herein incorporated by reference in its fusion protein of the invention) in solution. In other embodi entirety). In another embodiment, recombinant techniques ments, multimers of the invention are formed by covalent described herein or otherwise known in the art are applied to associations with and/or between the DR4 proteins of the generate recombinant polypeptides of the invention which invention. Such covalent associations may involve one or 45 contain a transmembrane domain and which can be incorpo more amino acid residues contained in the polypeptide rated by membrane reconstitution techniques into liposomes sequence of the protein (e.g., the polypeptide sequence (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorpo recited in SEQID NO: 2 or the polypeptide encoded by the rated by reference in its entirety). deposited cDNA). In one instance, the covalent associations The polypeptides of the present invention are preferably are cross-linking between cysteine residues located within 50 provided in an isolated form, and preferably are substantially the polypeptide sequences of the proteins which interact in purified. Accordingly, in one embodiment, the invention fur the native (i.e., naturally occurring) polypeptide. In another ther provides an isolated DR4 polypeptide having the amino instance, the covalent associations are the consequence of acid sequence encoded by the deposited cDNA, or the amino chemical or recombinant manipulation. Alternatively, Such acid sequence shown in SEQ ID NO:2 or a peptide or covalent associations may involve one or more amino acid 55 polypeptide portion (i.e., fragment) comprising a portion of residues contained in the heterologous polypeptide sequence the above polypeptides. in a DR4 fusion protein. In one example, covalent associa Polypeptide fragments of the present invention include tions are between the heterologous sequence contained in a polypeptides comprising, or alternatively consisting of an fusion protein of the invention (see, e.g., U.S. Pat. No. 5,478, amino acid sequence contained in SEQID NO:2, encoded by 925). In a specific example, the covalent associations are 60 the cDNA contained in the deposited plasmid, or encoded by between the heterologous sequence contained in a DR4-Fc nucleic acids which hybridize (e.g., under stringent hybrid fusion protein of the invention (as described herein). In ization conditions) to the nucleotide sequence contained in another specific example, covalent associations offusion pro the deposited plasmid, or shown in SEQ ID NO:1 or the teins of the invention are between heterologous polypeptide complementary Strand thereto. Protein fragments may be sequences from another TNF family ligand/receptor member 65 “free-standing.” or comprised within a larger polypeptide of that is capable of forming covalently associated multimers, which the fragment forms a part or region, most preferably as Such as for example, oseteoprotegerin (see, e.g., International a single continuous region. Representative examples of US 8,329,179 B2 39 40 polypeptide fragments of the invention, include, for example, Accordingly, in preferred embodiments, polypeptide frag fragments that comprise, or alternatively consisting of from ments of the invention comprise, or alternatively consist of aboutamino acid residues: 1 to 23, 24 to 43,44 to 63, 64 to 83, amino acid residues 131 to 183, and/or 184 to 229 of SEQID 84 to 103, 104 to 123, 124 to 143, 144 to 163, 164 to 183, 184 NO:2. In a specific embodiment the polypeptides of the to 203, 204 to 223, 224 to 238,239 to 264, 265 to 284, 285 to invention comprise, or alternatively consist of, both of the 304, 305 to 324, 325 to 345, 346 to 366, 367 to 387, 388 to extracellular cysteine rich motifs disclosed in SEQID NO:2. 418, 419 to 439, and/or 440 to the end of the coding region of Polynucleotides encoding these polypeptide fragments are SEQ ID NO:2. Additional representative examples of also encompassed by the invention. polypeptide fragments of the invention, include, for example, Among the especially preferred polypeptide fragments of fragments that comprise, or alternatively consisting of from 10 the invention are fragments comprising, or alternatively con sisting of, structural or functional attributes of DR4. Such about amino acid residues: 1-60, 11-70, 21-80, 31-90, fragments includeamino acid residues that comprise, or alter 41-100, 51-1 10, 61-120, 71-130, 81-140, 91-150, 101-160, natively consisting of one, two, three, four or more of the 111-170, 121-180, 131-190, 141-200, 151-210, 161-220, following functional domains: alpha-helix and alpha-helix 171-230, 181-240, 191-250, 201-260, 211-270, 221-280, 15 forming regions ("alpha-regions'), beta-sheet and beta 231-290, 241-300, 251-310, 261-320, 271-330, 281-340, sheet-forming regions ("beta-regions'), turn and turn-form 291-350, 301-360, 311-370, 321-380, 331-390, 341-400, ing regions (“turn-regions'), coil and coil-forming regions 351-410, 361-420, 371-430, 381-440, 391-450, and/or 401 ('coil-regions'), hydrophilic regions, hydrophobic regions, 468 of SEQ ID NO:2, as well as isolated polynucleotides alpha amphipathic regions, beta amphipathic regions, Surface which encode these polypeptides. In this context “about forming regions, and high antigenic index regions (i.e., con includes the particularly recited value, larger or Smaller by taining four or more contiguous amino acids having an anti several (5, 4, 3, 2, or 1) amino acids, at either extreme or at genic index of greater than or equal to 1.5, as identified using both extremes. Moreover, polypeptide fragments can be at the default parameters of the Jameson-Wolfprogram) of com least about 10, 20, 30, 40, 50, 60, 70, 80,90, 100, 110, 120, plete (i.e., full-length) DR4. Certain preferred regions are 130, 140, 150, 175 or 200 amino acids in length. Polynucle 25 those set out in FIG. 3 and Table I and include, but are not otides encoding these polypeptides are also encompassed by limited to, regions of the aforementioned types identified by the invention. analysis of the amino acid sequence depicted in SEQ ID Preferred polypeptide fragments of the present invention NO:2, such preferred regions include; Garnier-Robson pre include a member selected from the group: a polypeptide dicted alpha-regions, beta-regions, turn-regions, and coil-re comprising, or alternatively consisting of the DR4 receptor 30 gions; Chou-Fasman predicted alpha-regions, beta-regions, extracellular domain (predicted to constitute amino acid resi and turn-regions; Kyte-Doolittle predicted hydrophilic dues from about 24 to about 238 in SEQID NO:2); apolypep regions: Eisenberg alpha and beta amphipathic regions: tide comprising, or alternatively consisting of the DR4 cys Emini Surface-forming regions; and Jameson-Wolfhigh anti teine rich domain (predicted to constitute amino acid residues genic index regions, as predicted using the default parameters from about 131 to about 229 in SEQID NO:2); a polypeptide 35 of these computer programs. Polynucleotides encoding these comprising, or alternatively consisting of the DR4 receptor polypeptides are also encompassed by the invention. transmembrane domain (predicted to constitute amino acid The present invention encompasses polypeptides compris residues from about 239 to about 264 in SEQ ID NO:2); a ing, or alternatively consisting of an epitope of the polypep polypeptide comprising, or alternatively consisting of a frag tide having an amino acid sequence of SEQID NO:2, or an ment of the predicted mature DR4 polypeptide, wherein the 40 epitope of the polypeptide sequence encoded by a polynucle fragment has a DR4 functional activity (e.g., antigenic activ otide sequence contained in the cDNA assigned ATCC Acces ity or biological activity); a polypeptide comprising, or alter sion No. 97853, encoded by a polynucleotide that hybridizes natively consisting of the DR4 receptor intracellular domain to the complement of the sequence of SEQ ID NO:1, or (predicted to constitute amino acid residues from about 265 to contained in the cDNA assigned ATCC Accession No. 97853 about 468 in SEQ ID NO:2); a polypeptide comprising, or 45 under stringent hybridization conditions or lower stringency alternatively consisting of the DR4 receptor extracellular and hybridization conditions as defined Supra. The present inven intracellular domains with all or part of the transmembrane tion further encompasses polynucleotide sequences encoding domain deleted; a polypeptide comprising, or alternatively an epitope of a polypeptide sequence of the invention (Such consisting of the DR4 receptor death domain (predicted to as, for example, the sequence disclosed in SEQ ID NO: 1), constitute amino acid residues from about 379 to about 422 in 50 polynucleotide sequences of the complementary Strand of a SEQ ID NO:2); and a polypeptide comprising, or alterna polynucleotide sequence encoding an epitope of the inven tively consisting of one, two, three, four or more, epitope tion, and polynucleotide sequences which hybridize to the bearing portions of the DR4 receptor protein. In additional complementary Strand under Stringent hybridization condi embodiments, the polypeptide fragments of the invention tions or lower stringency hybridization conditions defined comprise, or alternatively consist of any combination of 1, 2, 55 Supra. 3, 4, 5, 6, 7, or all 8 of the above members. As above, with the The term "epitopes, as used herein, refers to portions of a leader sequence, the amino acid residues constituting the polypeptide having antigenic or immunogenic activity in an DR4 receptor extracellular, transmembrane and intracellular animal, preferably a mammal, and most preferably in a domains have been predicted by computer analysis. Thus, as human. In a preferred embodiment, the present invention one of ordinary skill would appreciate, the amino acid resi 60 encompasses a polypeptide comprising an epitope, as well as dues constituting these domains may vary slightly (e.g., by the polynucleotide encoding this polypeptide. An "immuno about 1 to about 15 amino acid residues) depending on the genic epitope, as used herein, is defined as a portion of a criteria used to define each domain. Polynucleotides encod protein that elicits an antibody response in an animal, as ing these polypeptides are also encompassed by the invention. determined by any method known in the art, for example, by As discussed above, it is believed that one or both of the 65 the methods for generating antibodies described infra. (See, extracellular cysteine rich motifs of DR4 is important for for example, Geysen et al., Proc. Natl. Acad. Sci. USA interactions between DR4 and its ligands (e.g., TRAIL). 81:3998-4002 (1983)). The term “antigenic epitope,” as used US 8,329,179 B2 41 42 herein, is defined as a portion of a protein to which an anti vant or any other adjuvant known for stimulating an immune body can immunospecifically bind its antigen as determined response. Several booster injections may be needed, for by any method well known in the art, for example, by the instance, at intervals of about two weeks, to provide a useful immunoassays described herein. Immunospecific binding titer of anti-peptide antibody that can be detected, for excludes non-specific binding but does not necessarily example, by ELISA assay using free peptide adsorbed to a exclude cross-reactivity with other antigens. Antigenic solid surface. The titer of anti-peptide antibodies in serum epitopes need not necessarily be immunogenic. from an immunized animal may be increased by selection of Fragments that function as epitopes may be produced by anti-peptide antibodies, for instance, by adsorption to the any conventional means. (See, e.g., Houghten, Proc. Natl. peptide on a Solid Support and elution of the selected antibod Acad. Sci. USA 82:5131-5135 (1985), further described in 10 ies according to methods well known in the art. U.S. Pat. No. 4,631,211). As to the selection of peptides or polypeptides bearing an Antigenic epitope-bearing peptides and polypeptides of antigenic epitope (i.e., that contain a region of a protein mol the invention are therefore useful to raise antibodies, includ ecule to which an antibody can bind), it is well known in that ing monoclonal antibodies, that bind specifically to a art that relatively short synthetic peptides that mimic part of a polypeptide of the invention. See, for instance, Wilson et al., 15 protein sequence are routinely capable of eliciting an antise Cell 37:767-778 (1984) at 777. rum that reacts with the partially mimicked protein. See, for In the present invention, antigenic epitopes preferably con instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and tain a sequence of at least 4, at least 5, at least 6, at least 7. Learner, R. A. (1983) Antibodies that react with predeter more preferably at least 8, at least 9, at least 10, at least 15, at mined sites on proteins. Science 219:660-666. Peptides least 20, at least 25, and, most preferably, between about 15 to capable of eliciting protein-reactive Sera are frequently rep about 30 amino acids contained within the amino acid resented in the primary sequence of a protein, can be charac sequence of a polypeptide of the invention. Preferred terized by a set of simple chemical rules, and are confined polypeptides comprising immunogenic orantigenic epitopes neither to immunodominant regions of intact proteins (i.e., are at least 10, 15, 20, 25, 30, 35, 40, 45, 50,55, 60, 65,70, 75, immunogenic epitopes) nor to the amino or carboxyl termi 80, 85,90, 95, or 100 amino acid residues in length. Antigenic 25 nals. epitopes are useful, for example, to raise antibodies, includ Non-limiting examples of antigenic polypeptides or pep ing monoclonal antibodies, that specifically bind the epitope. tides that can be used to generate DR4-specific antibodies Antigenic epitopes can be used as the target molecules in include: a polypeptide comprising, or alternatively consisting immunoassays. (See, for instance, Wilson et al., Cell 37:767 of amino acid residues from about 35 to about 92 in SEQID 778 (1984); Sutcliffe et al., Science 219:660-666 (1983)). 30 NO:2; a polypeptide comprising, or alternatively consisting Polynucleotides encoding these polypeptides are also encom of amino acid residues from about 114 to about 160 in SEQ passed by the invention. ID NO:2; a polypeptide comprising, or alternatively consist Similarly, immunogenic epitopes can be used, for example, ing of amino acid residues from about 169 to about 240 in to induce antibodies according to methods well known in the SEQ ID NO:2; a polypeptide comprising, or alternatively art. (See, for instance, Sutcliffe et al., supra; Wilson et al., 35 consisting of amino acid residues from about 267 to about supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; 298 in SEQ ID NO:2; a polypeptide comprising, or alterna and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985). A pre tively consisting of amino acid residues from about 330 to ferred immunogenic epitope includes the secreted protein. about 364 in SEQ ID NO:2; a polypeptide comprising, or The polypeptides comprising one or more immunogenic alternatively consisting of amino acid residues from about epitopes may be presented for eliciting an antibody response 40 391 to about 404 in SEQ ID NO:2; and a polypeptide com together with a carrier protein, such as an albumin, to an prising, or alternatively consisting of amino acid residues animal system (Such as, for example, rabbit or mouse), or, if from about 418 to about 465 in SEQID NO:2. In this context the polypeptide is of sufficient length (at least about 25 amino "about includes the particularly recited range, larger or acids), the polypeptide may be presented without a carrier. Smaller by several (5, 4, 3, 2, or 1) amino acid residues, at However, immunogenic epitopes comprising as few as 8 to 10 45 either terminus or at both termini. As indicated above, the amino acids have been shown to be sufficient to raise anti inventors have determined that the above polypeptide frag bodies capable of binding to, at the very least, linear epitopes ments are antigenic regions of the DR4 protein. Polynucle in a denatured polypeptide (e.g., in Western blotting). otides encoding these polypeptides are also encompassed by Epitope-bearing polypeptides of the present invention may the invention. be used to induce antibodies according to methods well 50 As one of skill in the art will appreciate, and as discussed known in the art including, but not limited to, in vivo immu above, the polypeptides of the present invention comprising nization, in vitro immunization, and phage display methods. an immunogenic or antigenic epitope can be fused to other See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle polypeptide sequences. For example, the polypeptides of the et al., J. Gen. Virol., 66:2347-2354 (1985). If in vivo immu present invention may be fused with the constant domain of nization is used, animals may be immunized with free pep 55 immunoglobulins (IgA, IgE. IgG, IgM), or portions thereof tide; however, anti-peptide antibody titer may be boosted by (CH1, CH2, CH3, or any combination thereof and portions coupling the peptide to a macromolecular carrier, Such as thereof) resulting in chimeric polypeptides. Such fusion pro keyhole limpet hemacyanin (KLH) or tetanus toxoid. For teins may facilitate purification and may increase half-life in instance, peptides containing cysteine residues may be vivo. This has been shown for chimeric proteins consisting of coupled to a carrier using a linker Such as maleimidobenzoyl 60 the first two domains of the human CD4-polypeptide and N-hydroxysuccinimide ester (MBS), while other peptides various domains of the constant regions of the heavy or light may be coupled to carriers using a more general linking agent chains of mammalian immunoglobulins. See, e.g., EP 394. Such as glutaraldehyde. Animals such as, for example, rab 827; Traunecker et al., Nature, 331:84-86 (1988). IgG Fusion bits, rats, and mice are immunized with either free or carrier proteins that have a disulfide-linked dimeric structure due to coupled peptides, for instance, by intraperitoneal and/or 65 the IgG portion disulfide bonds have also been found to be intradermal injection of emulsions containing about 100 more efficient in binding and neutralizing other molecules micrograms of peptide or carrier protein and Freund's adju than monomeric polypeptides or fragments thereof alone. US 8,329,179 B2 43 44 See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 The epitope-bearing peptides and polypeptides of the (1995). Nucleic acids encoding the above epitopes can also be invention may be produced by any conventional means. recombined with a gene of interest as an epitope tag (e.g., the Houghten, R. A., “General method for the rapid solid-phase hemagglutinin ("HA) tag or flag tag) to aid in detection and synthesis of large numbers of peptides: Specificity of antigen purification of the expressed polypeptide. For example, a 5 antibody interaction at the level of individual amino acids.” system described by Janknecht et al. allows for the ready Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985). This purification of non-denatured fusion proteins expressed in “Simultaneous Multiple Peptide Synthesis (SMPS)” process human cell lines (Janknechtet al., 1991, Proc. Natl. Acad. Sci. is further described in U.S. Pat. No. 4,631.211 to Houghtenet USA 88:8972-897). In this system, the gene of interest is al. (1986). Subcloned into a vaccinia recombination plasmid such that 10 To improve or alter the characteristics of DR4 polypep the open reading frame of the gene is translationally fused to tides, protein engineering may be employed. Recombinant an amino-terminal tag consisting of six histidine residues. DNA technology known to those skilled in the art can be used The tag serves as a matrix-binding domain for the fusion to create novel mutant proteins or “muteins’ including single protein. Extracts from cells infected with the recombinant 15 or multiple amino acid Substitutions, deletions, additions or vaccinia virus are loaded onto Ni" nitriloacetic acid-agarose fusion proteins. Such modified polypeptides can show, e.g., column and histidine-tagged proteins can be selectively enhanced activity or increased Stability. In addition, they may eluted with imidazole-containing buffers. be purified in higher yields and show better solubility than the Additional fusion proteins of the invention may be gener corresponding natural polypeptide, at least under certain ated through the techniques of gene-shuffling, motif-shuf purification and storage conditions. fling, exon-shuffling, and/or codon-shuffling (collectively For instance, for many proteins, including the extracellular referred to as “DNA shuffling'). DNA shuffling may be domain of a membrane associated protein or the mature employed to modulate the activities of polypeptides of the form(s) of a secreted protein, it is known in the art that one or invention, such methods can be used to generate polypeptides more amino acids may be deleted from the N-terminus or with altered activity, as well as agonists and antagonists of the 25 C-terminus without substantial loss of biological function. polypeptides. See, generally, U.S. Pat. Nos. 5,605,793; 5,811, For instance, Ron et al., J. Biol. Chem., 268:2984-2988 238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., (1993) reported modified KGF proteins that had heparin Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, binding activity even if3, 8, or 27 amino-terminal amino acid Trends Biotechnol. 16(2):76-82 (1998); Hansson et al., J. residues were missing. In the present case, since the protein of 30 the invention is a member of the death domain containing Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco, Bio receptor (DDCR) polypeptide family, deletions of N-terminal techniques 24(2):308-13 (1998) (each of these patents and amino acids up to the cysteine residue at position 132 in SEQ publications are hereby incorporated by reference in its ID NO:2 may retain some biological activity such as the entirety). In one embodiment, alteration of polynucleotides ability to induce apoptosis. Polypeptides having further corresponding to SEQIDNO:1 and the polypeptides encoded 35 N-terminal deletions including the cysteine residue at posi by these polynucleotides may be achieved by DNA shuffling. tion 132 (C-132) in SEQID NO:2 would not be expected to DNA shuffling involves the assembly of two or more DNA retain Such biological activities because this residue is con segments by homologous or site-specific recombination to served among family members, see FIG. 2, and may be generate variation in the polynucleotide sequence. In another required for forming a disulfide bridge to provide structural embodiment, polynucleotides of the invention, or the 40 stability which is needed for receptor binding. encoded polypeptides, may be altered by being Subjected to However, even if deletion of one or more amino acids from random mutagenesis by error-prone PCR, random nucleotide the N-terminus of a protein results in modification or loss of insertion or other methods prior to recombination. In another one or more biological functions of the protein, other func embodiment, one or more components, motifs, sections, tional activities (e.g., biological activities, ability to multim parts, domains, fragments, etc., of a polynucleotide coding a 45 erize, ability to bind DR4 ligand (e.g., TRAIL)) may still be polypeptide of the invention may be recombined with one or retained. For example, the ability of shortened DR4 muteins more components, motifs, sections, parts, domains, frag to induce and/or bind to antibodies which recognize the com ments, etc. of one or more heterologous molecules. plete or mature forms of the DR4 polypeptides of the inven As one of skill in the art will appreciate, DR4 polypeptides tion (preferably antibodies that bind specifically to DR4) of the present invention and the epitope-bearing fragments 50 generally will be retained when less than the majority of the thereof described herein (e.g., corresponding to a portion of residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lack the extracellular domain Such as, for example, amino acid ing N-terminal residues of a complete polypeptide retains residues 1 to 240 of SEQ ID NO:2) can be combined with Such immunologic activities can readily be determined by parts of the constant domain of immunoglobulins (IgG). 55 routine methods described herein and otherwise known in the resulting in chimeric polypeptides. These fusion proteins art. It is not unlikely that an DR4 mutein with a large number facilitate purification and show an increased half-life in vivo. of deleted N-terminal amino acid residues may retain some This has been shown, e.g., for chimeric proteins consisting of biological or immunogenic activities. In fact, peptides com the first two domains of the human CD4-polypeptide and posed of as few as six DR4 amino acid residues may often various domains of the constant regions of the heavy or light 60 evoke an immune response. chains of mammalian immunoglobulins (EPA 394,827; Trau Accordingly, the present invention further provides necker et al., Nature 331:84-86 (1988)). Fusion proteins that polypeptides having one or more residues deleted from the have a disulfide-linked dimeric structure due to the IgG part amino terminus of the DR4 amino acid sequence shown in can also be more efficient in binding and neutralizing other SEQID NO:2, up to the serine residue at position number 463 molecules than the monomeric DR4 protein or protein frag 65 and polynucleotides encoding Such polypeptides. In particu ment alone (Fountoulakis et al., J Biochem 270:3958-3964 lar, the present invention provides polypeptides comprising, (1995)). or alternatively consisting of the amino acid sequence of

US 8,329,179 B2 47 48 G-460 to E-468; T-461 to E-468; G-462 to E-468; and S-463 T-168 to H-238; A-169 to H-238; C-170 to H-238; K-171 to to E-468 of the DR4 sequence shown in SEQID NO:2. H-238; S-172 to H-238; D-173 to H-238; E-174 to H-238; The present invention is also directed to nucleic acid mol E-175 to H-238; E-176 to H-238; R-177 to H-238; S-178 to ecules comprising, or alternatively consisting of a polynucle H-238; P-179 to H-238; C-180 to H-238; T-181 to H-238; otide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, T-182 to H-238; T-183 to H-238; R-184 to H-238; N-185 to 97%, 98%, or 99% identical to the polynucleotide sequences H-238; T-186 to H-238; A-187 to H-238; C-188 to H-238; encoding the polypeptides described above. The invention is Q-189 to H-238; C-190 to H-238; K-191 to H-238; P-192 to further directed to nucleic acid molecules comprising, or H-238; G-193 to H-238; T-194 to H-238; F-195 to H-238; alternatively consisting of polynucleotide sequences which R-196 to H-238; N-197 to H-238; D-198 to H-238; N-199 to encode polypeptides that are at least 80%, 85%, 90%, 92%, 10 H-238; S-200 to H-238; A-201 to H-238; E-202 to H-238; 95%, 96%, 97%, 98%, or 99% identical to the polypeptides M-203 to H-238; C-204 to H-238; R-205 to H-238; K-206 to described above. The present invention also encompasses the H-238; C-207 to H-238; S-208 to H-238; T-209 to H-238; above polynucleotide sequences fused to a heterologous G-210 to H-238; C-211 to H-238; P-212 to H-238; R-213 to polynucleotide sequence. Polypeptides encoded by these H-238; G-214 to H-238; M-215 to H-238; V-216 to H-238; polynucleotides are also encompassed by the invention. 15 K-2 17 to H-238; V-218 to H-238; K-219 to H-238; D-220 to In another embodiment, N-terminal deletions of the DR4 H-238; C-221 to H-238; T-222 to H-238; P-223 to H-238; polypeptide can be described by the general formulan to 238 W-224 to H-238; S-225 to H-238; D-226 to H-238; 1-227 to where n is a number from 2 to 238 corresponding to the H-238; E-228 to H-238; C-229 to H-238; V-230 to H-238; amino acid sequence identified in SEQID NO:2. In specific H-231 to H-238; K-232 to H-238; and E-233 to H-238 of the embodiments, N-terminal deletions of the DR4 receptors of DR4 extracellular domain sequence shown in SEQID NO:2. the invention provides polynucleotides encoding polypep The present invention is also directed to nucleic acid mol tides comprising, or alternatively consisting of the amino ecules comprising, or alternatively consisting of a polynucle acid sequence of residues: A-2 to H-238; P-3 to H-238; P4 to otide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, H-238; P-5 to H-238; A-6 to H-238; R-7 to H-238; V-8 to 97%, 98%, or 99% identical to the polynucleotide sequences H-238; H-9 to H-238; L-10 to H-238; G-11 to H-238; A-12 to 25 encoding the polypeptides described above. The invention is H-238; F-13 to H-238; L-14 to H-238; A-15 to H-238; V-16 to further directed to nucleic acid molecules comprising, or H-238; T-17 to H-238; P-18 to H-238; N-19 to H-238; P-20 to alternatively consisting of polynucleotide sequences which H-238; G-21 to H-238; S-22 to H-238; A-23 to H-238; A-24 encode polypeptides that are at least 80%, 85%, 90%, 92%, to H-238; S-25 to H-238; G-26 to H-238; T-27 to H-238; E-28 95%, 96%, 97%, 98%, or 99% identical to the polypeptides to H-238; A-29 to H-238; A-30 to H-238; A-31 to H-238; 30 described above. The present invention also encompasses the A-32 to H-238; T-33 to H-238; P-34 to H-238; S-35 to H-238; above polynucleotide sequences fused to a heterologous K-36 to H-238; V-37 to H-238; W-38 to H-238; G-39 to polynucleotide sequence. Polypeptides encoded by these H-238: S-40 to H-238; S41 to H-238; A-42 to H-238; G-43 to polynucleotides are also encompassed by the invention. H-238; R-44 to H-238; 1-45 to H-238; E-46 to H-238; P-47 to Similarly, many examples of functional C-terminal dele H-238; R-48 to H-238; G-49 to H-238; G-50 to H-238; G-51 35 tion muteins are known. For instance, interferon gamma to H-238; R-52 to H-238; G-53 to H-238; A-54 to H-238; shows up to ten times higher activities by deleting 8-10amino L-55 to H-238; P-56 to H-238; T-57 to H-238; S-58 to H-238; acid residues from the carboxy terminus of the protein (Dö M-59 to H-238; G-60 to H-238; Q-61 to H-238; H-62 to beli et al., J. Biotechnology 7: 199-216 (1988). In the present H-238; G-63 to H-238; P-64 to H-238; S-65 to H-238; A-66 to case, since the protein of the invention is a member of the H-238; R-67 to H-238; A-68 to H-238; R-69 to H-238; A-70 40 DDCR polypeptide family, deletions of C-terminal amino to H-238; G-71 to H-238; R-72 to H-238; A-73 to H-238; acids up to the cysteine at position 221 (C-221) of SEQ ID P-74 to H-238; G-75 to H-238; P-76 to H-238; R-77 to H-238; NO:2 may retain some biological activity Such as receptor P-78 to H-238; A-79 to H-238; R-80 to H-238; E-81 to H-238; binding. Polypeptides having further C-terminal deletions A-82 to H-238: S-83 to H-238; P-84 to H-238; R-85 to H-238; including C-221 of SEQID NO:2 would not be expected to L-86 to H-238; R-87 to H-238; V-88 to H-238; H-89 to H-238; 45 retain Such biological activities because this residue is con K-90 to H-238; T-91 to H-238; F-92 to H-238; K-93 to H-238; served among DDCR family members and is required for F-94 to H-238; V-95 to H-238; V-96 to H-238; V-97 to H-238; forming a disulfide bridge to provide structural stability G-98 to H-238; V-99 to H-238; L-100 to H-238; L-101 to which is needed for receptor-ligand binding. H-238; Q-102 to H-238; V-103 to H-238; V-104 to H-238; As mentioned above, even if deletion of one or more amino P-105 to H-238; S-106 to H-238; S-107 to H-238; A-108 to 50 acids from the C-terminus of a protein results in modification H-238; A-109 to H-238; T-110 to H-238; 1-111 to H-238; of loss of one or more biological functions of the protein, K-1 12 to H-238; L-113 to H-238; H-114 to H-238; D-115 to other functional activities (e.g., biological activities, ability to H-238; Q-116 to H-238; S-117 to H-238; 1-118 to H-238; multimerize, ability to bind DR4 ligand (e.g., TRAIL)) may G-119 to H-238; T-120 to H-238; Q-121 to H-238; Q-122 to still be retained. For example the ability of the shortened DR4 H-238; W-123 to H-238; E-124 to H-238; H-125 to H-238; 55 mutein to induce and/or bind to antibodies which recognize S-126 to H-238; P-127 to H-238; L-128 to H-238; G-129 to the complete or mature forms of the polypeptide generally H-238; E-130 to H-238; L-131 to H-238; C-132 to H-238; will be retained when less than the majority of the residues of P-133 to H-238; P-134 to H-238; G-135 to H-238; S-136 to the complete or mature polypeptide are removed from the H-238; H-137 to H-238; R-138 to H-238; S-139 to H-238; C-terminus. Whether a particular polypeptide lacking C-ter E-140 to H-238; R-141 to H-238; P-142 to H-238; G-143 to 60 minal residues of a complete polypeptide retains such immu H-238; A-144 to H-238; C-145 to H-238; N-146 to H-238; nologic activities can readily be determined by routine meth R-147 to H-238; C-148 to H-238; T-149 to H-238; E-150 to ods described herein and otherwise known in the art. It is not H-238; G-151 to H-238; V-152 to H-238; G-153 to H-238; unlikely that a DR4 mutein with a large number of deleted Y-154 to H-238; T-155 to H-238; N-156 to H-238; A-157 to C-terminal amino acid residues may retain some biological or H-238; S-158 to H-238; N-159 to H-238; N-160 to H-238; 65 immunogenic activities. In fact, peptides composed of as few L-161 to H-238; F-162 to H-238; A-163 to H-238; C-164 to as six DR4 amino acid residues may often evoke an immune H-238; L-165 to H-238; P-166 to H-238; C-167 to H-238; response.

US 8,329,179 B2 51 52 above polynucleotide sequences fused to a heterologous encoding the polypeptides described above. The invention is polynucleotide sequence. Polypeptides encoded by these further directed to nucleic acid molecules comprising, or polynucleotides are also encompassed by the invention. alternatively consisting of polynucleotide sequences which In another embodiment, C-terminal deletions of the DR4 encode polypeptides that are at least 80%, 85%, 90%, 92%, polypeptide can be described by the general formula 24-m 5 95%, 96%, 97%, 98%, or 99% identical to the polypeptides where m is a number from 30 to 238 corresponding to the described above. The present invention also encompasses the amino acid sequence identified in SEQID NO:2. In specific above polynucleotide sequences fused to a heterologous embodiments, the invention provides polynucleotides encod polynucleotide sequence. Polypeptides encoded by these ing polypeptides comprising, or alternatively consisting of polynucleotides are also encompassed by the invention. the amino acid sequence of residues: A-24 to G-237; A-24 to 10 The present invention further provides polypeptides hav N-236; A-24 to G-235; A-24 to S-234: A-24 to E-233; A-24 to ing one or more residues from the carboxy terminus of the K-232; A-24 to H-231: A-24 to V-230; A-24 to C-229; A-24 to amino acid sequence of the DR4 shown in SEQID NO:2, up E-228: A-24 to I-227; A-24 to D-226; A-24 to S-225; A-24 to to C-221 of SEQ ID NO:2, and polynucleotides encoding W-224: A-24 to P-223; A-24 to T-222; A-24 to C-221; A-24 to Such polypeptides. In particular, the present invention pro D-220; A-24 to K-2 19: A-24 to V-218: A-24 to K-2 17: A-24 15 vides polypeptides having the amino acid sequence of resi to V-2 16: A-24 to M-215: A-24 to G-214; A-24 to R-213; dues 1-m of the amino acid sequence in SEQID NO:2, where A-24 to P-212: A-24 to C-211; A-24 to G-210; A-24 to T-209; m is any integer in the range of 221-468 and residue C-221 is A-24 to S-208: A-24 to C-207: A-24 to K-206: A-24 to R-205; the position of the first residue from the C-terminus of the A-24 to C-204; A-24 to M-203, A-24 to E-202; A-24 to complete DR4 polypeptide (shown in SEQ ID NO:2) A-201: A-24 to S-200; A-24 to N-199: A-24 to D-198; A-24 to believed to be required for receptor binding activity of the N-197; A-24 to R-196; A-24 to F-195; A-24 to T-194; A-24 to DR4 protein. Polynucleotides encoding these polypeptides G-193: A-24 to P-192: A-24 to K-191; A-24 to C-190; A-24 to also are provided. Q-189: A-24 to C-188: A-24 to A-187: A-24 to T-186: A-24 to The invention also provides polypeptides having one or N-185: A-24 to R-184: A-24 to T-183: A-24 to T-182; A-24 to more amino acids deleted from both the amino and the car T-181; A-24 to C-180; A-24 to P-179; A-24 to S-178: A-24 to 25 boxyl termini of an DR4 polypeptide, which may be R-177; A-24 to E-176: A-24 to E-175; A-24 to E-174: A-24 to described generally as having residues n'-m' and/or n-m of D-173; A-24 to S-172; A-24 to K-171; A-24 to C-170: A-24 to SEQ ID NO:2, where n', n, m', and m are integers as A-169; A-24 to T-168: A-24 to C-167: A-24 to P-166; A-24 to described above. L-165; A-24 to C-164: A-24 to A-163; A-24 to F-162; A-24 to Also included are a nucleotide sequence encoding a L-161: A-24 to N-160; A-24 to N-159; A-24 to S-158: A-24 to 30 polypeptide consisting of a portion of the complete DR4 A-157: A-24 to N-156: A-24 to T-155; A-24 to Y-154: A-24 to amino acid sequence encoded by the cDNA contained in G-153 A-24 to V-152; A-24 to G-151; A-24 to E-150; A-24 to ATCC Deposit No. 97853, where this portion excludes from T-149; A-24 to C-148: A-24 to R-147: A-24 to N-146; A-24 to 1 to about 108 amino acids from the amino terminus of the C-145; A-24 to A-144, A-24 to G-143; A-24 to P-142; A-24 to complete amino acid sequence encoded by the cDNA con R-141; A-24 to E-140; A-24 to S-139; A-24 to R-138: A-24 to 35 tained in ATCC Deposit No. 97853, or from 1 to about 247 H-137; A-24 to S-136: A-24 to G-135; A-24 to P-134: A-24 to amino acids from the carboxy terminus, or any combination P-133: A-24 to C-132: A-24 to L-131: A-24 to E-130; A-24 to of the above amino terminal and carboxy terminal deletions, G-129; A-24 to L-128; A-24 to P-127; A-24 to S-126; A-24 to of the complete amino acid sequence encoded by the cDNA H-125; A-24 to E-124; A-24 to W-123; A-24 to Q-122; A-24 contained in ATCC Deposit No. 97853. Polynucleotides to Q-121; A-24 to T-120: A-24 to G-119; A-24 to I-118: A-24 40 encoding all of the above deletion mutant polypeptide forms to S-1 17: A-24 to Q-116; A-24 to D-115; A-24 to H-114; A-24 also are provided. to L-113: A-24 to K-1 12; A-24 to I-111; A-24 to T-110; A-24 Preferred amongst the N- and C-terminal deletion mutants to A-109; A-24 to A-108; A-24 to S-107; A-24 to S-106; A-24 are those comprising only a portion of the extracellular to P-105: A-24 to V-104; A-24 to V-103: A-24 to Q-102: A-24 domain; i.e., within residues 24-238, since any portion to L-101; A-24 to L-100; A-24 to V-99; A-24 to G-98: A-24 to 45 therein is expected to be soluble. V-97: A-24 to V-96; A-24 to V-95; A-24 to F-94: A-24 to It will be recognized in the art that some amino acid K-93; A-24 to F-92; A-24 to T-91, A-24 to K-90; A-24 to sequence of DR4 can be varied without significant effect of H-89; A-24 to V-88: A-24 to R-87; A-24 to L-86; A-24 to the structure or function of the protein. If such differences in R-85; A-24 to P-84: A-24 to S-83: A-24 to A-82; A-24 to sequence are contemplated, it should be remembered that E-81: A-24 to R-80; A-24 to A-79; A-24 to P-78: A-24 to 50 there will be critical areas on the protein which determine R-77; A-24 to P-76; A-24 to G-75; A-24 to P-74, A-24 to activity. Such areas will usually comprise residues which A-73; A-24 to R-72; A-24 to G-71; A-24 to A-70; A-24 to make up the ligand binding site or the death domain, or which R-69; A-24 to A-68; A-24 to R-67: A-24 to A-66; A-24 to form tertiary structures which affect these domains. S-65; A-24 to P-64; A-24 to G-63; A-24 to H-62; A-24 to Thus, the invention further includes variations of the DR4 Q-61; A-24 to G-60; A-24 to M-59; A-24 to S-58: A-24 to 55 protein which show substantial DR4 protein activity or which T-57: A-24 to P-56: A-24 to L-55; A-24 to A-54: A-24 to include regions of DR4 such as the protein fragments dis G-53: A-24 to R-52; A-24 to G-51; A-24 to G-50; A-24 to cussed below. Such mutants include deletions, insertions, G-49; A-24 to R-48: A-24 to P-47; A-24 to E-46; A-24 to 145; inversions, repeats, and type substitutions. As indicated A-24 to R-44; A-24 to G-43; A-24 to A-42; A-24 to S-41; above, guidance concerning which amino acid changes are A-24 to S40; A-24 to G-39; A-24 to W-38: A-24 to V-37; A-24 60 likely to be phenotypically silent can be found in Bowie, J.U. to K-36; A-24 to S-35; A-24 to P-34; A-24 to T-33; A-24 to et al., Science 247: 1306-1310 (1990). A-32: A-24 to A-31; and A-24 to A-30 of the DR4 extracel Thus, the fragment, derivative, or analog of the polypeptide lular domain sequence shown in SEQID NO:2. of SEQ ID NO:2, or that encoded by the deposited cDNA, The present invention is also directed to nucleic acid mol may be (i) one in which at least one or more of the amino acid ecules comprising, or alternatively consisting of a polynucle 65 residues are Substituted with a conserved or non-conserved otide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, amino acid residue (preferably a conserved amino acid resi 97%, 98%, or 99% identical to the polynucleotide sequences due(s), and more preferably at least one but less than ten US 8,329,179 B2 53 54 conserved amino acid residues) and Such substituted amino known in the art, Such as site-directed mutagenesis oralanine acid residue may or may not be one encoded by the genetic scanning mutagenesis (Cunningham and Wells, Science 244: code, or (ii) one in which one or more of the amino acid 1081-1085 (1989)). The latter procedure introduces single residues includes a Substituent group, or (iii) one in which the alanine mutations at every residue in the molecule. The result mature polypeptide is fused with another compound, such as 5 ing mutant molecules are then tested for biological activity a compound to increase the half-life of the polypeptide (for such as receptor binding or in vitro, or in vitro proliferative example, polyethylene glycol), or (iv) one in which the addi activity. Sites that are critical for ligand-receptor binding can tional amino acids are fused to the mature polypeptide. Such also be determined by structural analysis such as crystalliza as an IgG Fc fusion region peptide or leader or secretory tion, nuclear magnetic resonance or photoaffinity labeling sequence or a sequence which is employed for purification of 1 O (Smith et al., J. Mol. Biol. 224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)). the mature polypeptide or a proprotein sequence. Such frag Additionally, protein engineering may be employed to ments, derivatives and analogs are deemed to be within the improve or alter the characteristics of DR4 polypeptides. scope of those skilled in the art from the teachings herein. Recombinant DNA technology known to those skilled in the Polynucleotides encoding these fragments, derivatives or 15 art can be used to create novel mutant proteins or muteins analogs are also encompassed by the invention. including single or multiple amino acid Substitutions, dele Of particular interest are Substitutions of charged amino tions, additions or fusion proteins. Such modified polypep acids with another charged amino acid and with neutral or tides can show, e.g., enhanced activity or increased stability. negatively charged amino acids. The latter results in proteins In addition, they may be purified in higher yields and show with reduced positive charge to improve the characteristics of 20 better Solubility than the corresponding natural polypeptide, the DR4 protein. The prevention of aggregation is highly at least under certain purification and storage conditions. desirable. Aggregation of proteins not only results in a loss of Non-naturally occurring variants may be produced using activity but can also be problematic when preparing pharma art-known mutagenesis techniques, which include, but are not ceutical formulations, because they can be immunogenic. limited to oligonucleotide mediated mutagenesis, alanine (Pinckard et al., Clin Exp. Immunol. 2:331-340 (1967); Rob- 2s scanning, PCR mutagenesis, site directed mutagenesis (see bins et al., Diabetes 36:838-845 (1987); Cleland et al. Crit. e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and Zoller Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993)). et al., Nucl. Acids Res. 10:6487 (1982)), cassette mutagenesis The replacement of amino acids can also change the selec (see e.g., Wells et al., Gene 34:315 (1985)), restriction selec tivity of binding to cell surface receptors. Ostade et al., Nature tion mutagenesis (see e.g., Wells et al., Philos. Trans. R. Soc. 361:266-268 (1993) describes certain mutations resulting in 30 London SerA 317:415 (1986)). selective binding of TNF-alpha to only one of the two known Thus, the invention also encompasses DR4 derivatives and types of TNF receptors. Thus, the DR4 receptor of the present analogs that have one or more amino acid residues deleted, invention may include one or more amino acid Substitutions, added, or substituted to generate DR4 polypeptides that are deletions or additions, either from natural mutations or better Suited for expression, Scale up, etc., in the host cells human manipulation. 35 chosen. For example, cysteine residues can be deleted or As indicated, changes are preferably of a minor nature, substituted with anotheramino acid residue in order to elimi Such as conservative amino acid Substitutions that do not nate disulfide bridges; N-linked glycosylation sites can be significantly affect the folding or activity of the protein (see altered or eliminated to achieve, for example, expression of a Table II). homogeneous product that is more easily recovered and puri 40 fied from yeast hosts which are known to hyperglycosylate TABLE II N-linked sites. To this end, a variety of amino acid substitu tions at one or both of the first or third amino acid positions on Conservative Amino Acid Substitutions. any one or more of the glycosylation recognitions sequences Aromatic Phenylalanine in the DR4 polypeptides of the invention, and/or an amino Tryptophan 45 Tyrosine acid deletion at the second position of any one or more Such Hydrophobic Leucine recognition sequences will prevent glycosylation of the DR4 Isoleucine at the modified tripeptide sequence (see, e.g., Miyajimo et al., Valine EMBO.J. 5(6):1193-1197). Polar Glutamine Asparagine The polypeptides of the present invention also include a Basic Arginine 50 polypeptide comprising, or alternatively consisting of the Lysine polypeptide encoded by the deposited cDNA (the deposit Histidine having ATCC Accession No. 97853) including the leader; a Acidic Aspartic Acid polypeptide comprising, or alternatively consisting of the Glutamic Acid Small Alanine mature polypeptide encoded by the deposited the cDNA Serine 55 minus the leader (i.e., the mature protein); a polypeptide Threonine comprising, or alternatively consisting of the polypeptide of Methionine SEQID NO:2 including the leader; a polypeptide comprising, Glycine or alternatively consisting of the polypeptide of SEQ ID NO:2 minus the amino terminal methionine; a polypeptide In specific embodiments, the number of substitutions, 60 comprising, or alternatively consisting of the polypeptide of additions or deletions in the amino acid sequence of SEQID SEQID NO:2 minus the leader; a polypeptide comprising, or NO:2 and/or any of the polypeptide fragments described alternatively consisting of the DR4 extracellular domain; a herein (e.g., the extracellular domain or intracellular domain) polypeptide comprising, or alternatively consisting of the is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10,9,8,7,6, 5, 4, 3, DR4 cysteine rich domain; a polypeptide comprising, or 2, 1 or 30-20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3 or 1-2. 65 alternatively consisting of the DR4 transmembrane domain; Amino acids in the DR4 protein of the present invention a polypeptide comprising, or alternatively consisting of the that are essential for function can be identified by methods DR4 intracellular domain; a polypeptide comprising, or alter US 8,329,179 B2 55 56 natively consisting of the DR4 death domain; a polypeptide query sequence, the percent identity is corrected by calculat comprising, or alternatively consisting of soluble polypep ing the number of residues of the query sequence that are N tides comprising all or part of the extracellular and intracel and C-terminal of the Subject sequence, which are not lular domains but lacking the transmembrane domain; as well matched/aligned with a corresponding Subject residue, as a as polypeptides which are at least 80% identical, more pref percent of the total bases of the query sequence. A determi erably at least 90% or 95% identical, still more preferably at nation of whether a residue is matched/aligned is determined least 96%, 97%, 98% or 99% identical to the polypeptides by results of the FASTDB sequence alignment. This percent described above (e.g., the polypeptide encoded by the depos age is then Subtracted from the percent identity, calculated by ited cDNA, the polypeptide of SEQID NO:2, and portions of the above FASTDB program using the specified parameters, Such polypeptides with at least 30 amino acids and more 10 to arrive at a final percent identity score. This final percent preferably at least 50 amino acids. Polynucleotides encoding identity score is what is used for the purposes of this embodi these polypeptides are also encompassed by the invention. ment. Only residues to the N- and C-termini of the subject By a polypeptide having an amino acid sequence at least, sequence, which are not matched/aligned with the query for example, 95% “identical to a reference amino acid sequence, are considered for the purposes of manually adjust sequence of a DR4 polypeptide is intended that the amino 15 ing the percent identity Score. That is, only query residue acid sequence of the polypeptide is identical to the reference positions outside the farthest N- and C-terminal residues of sequence except that the polypeptide sequence may include the Subject sequence. For example, a 90 amino acid residue up to five amino acid alterations per each 100 amino acids of Subject sequence is aligned with a 100 residue query the reference amino acid of the DR4 polypeptide. In other sequence to determine percent identity. The deletion occurs at words, to obtain a polypeptide having an amino acid sequence the N-terminus of the subject sequence and therefore, the at least 95% identical to a reference amino acid sequence, up FASTDB alignment does not show a matching/alignment of to 5% of the amino acid residues in the reference sequence the first 10 residues at the N-terminus. The 10 unpaired resi may be deleted or substituted with another amino acid, or a dues represent 10% of the sequence (number of residues at the number of amino acids up to 5% of the total amino acid N- and C-termini not matched/total number of residues in the residues in the reference sequence may be inserted into the 25 query sequence) So 10% is Subtracted from the percent iden reference sequence. These alterations of the reference tity score calculated by the FASTDB program. If the remain sequence may occur at the amino or carboxy terminal posi ing 90 residues were perfectly matched the final percent iden tions of the reference amino acid sequence or anywhere tity would be 90%. In another example, a 90 residue subject between those terminal positions, interspersed either indi sequence is compared with a 100 residue query sequence. vidually among residues in the reference sequence or in one 30 This time the deletions are internal deletions so there are no or more contiguous groups within the reference sequence. residues at the N- or C-termini of the subject sequence which As a practical matter, whether any particular polypeptide is are not matched/aligned with the query. In this case the per at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% cent identity calculated by FASTDB is not manually cor identical to, for instance, the amino acid sequence shown in rected. Once again, only residue positions outside the N- and SEQID NO:2 or to the amino acid sequence encoded by the 35 C-terminal ends of the Subject sequence, as displayed in the deposited cDNA can be determined conventionally using FASTDB alignment, which are not matched/aligned with the known computer programs such the Bestfit program (Wis query sequence are manually corrected for. No other manual consin Sequence Analysis Package, Version 8 for Unix, corrections are made for the purposes of this embodiment. Genetics Computer Group, University Research Park, 575 The present application is also directed to proteins contain Science Drive, Madison, Wis. 53711). When using Bestfit or 40 ing polypeptides at least 80%, 85%, 90%, 92%, 95%, 96%, any other sequence alignment program to determine whether 97%, 98% or 99% identical to the DR4 polypeptide sequence a particular sequence is, for instance, 95% identical to a set forth herein as n'-m', and/or n°-m. In preferred embodi reference sequence according to the present invention, the ments, the application is directed to proteins containing parameters are set, of course, such that the percentage of polypeptides at least 80%, 85%, 90%, 92%. 95%,96%.97%, identity is calculated over the full length of the reference 45 98% or 99% identical to polypeptides having the amino acid amino acid sequence and that gaps in homology of up to 5% sequence of the specific DR4 N- and C-terminal deletions of the total number of amino acid residues in the reference recited herein. Polynucleotides encoding these polypeptides sequence are allowed. are also encompassed by the invention. In a specific embodiment, the identity between a reference In certain preferred embodiments, DR4 proteins of the (query) sequence (a sequence of the present invention) and a 50 invention comprise fusion proteins as described above Subject sequence, also referred to as a global sequence align wherein the DR4 polypeptides are those described as n'-m', ment, is determined using the FASTDB computer program and/or n°-m herein. In preferred embodiments, the applica based on the algorithm of Brutlag et al. (Comp. App. BioSci. tion is directed to nucleic acid molecules at least 80%, 85%, 6:237-245 (1990)). Preferred parameters used in a FASTDB 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mis 55 nucleic acid sequences encoding polypeptides having the match Penalty=1, Joining Penalty=20, Randomization Group amino acid sequence of the specific N- and C-terminal dele Length=0, Cutoff Score=1, Window Size=sequence length, tions recited herein. Polynucleotides encoding these polypep Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or tides are also encompassed by the invention. the length of the Subject amino acid sequence, whichever is The present inventors have discovered that the DR4 shorter. According to this embodiment, if the subject 60 polypeptide is a 468 residue protein exhibiting three main sequence is shorter than the query sequence due to N- or structural domains. First, the ligand binding domain (extra C-terminal deletions, not because of internal deletions, a cellular domain) was identified within residues from about 24 manual correction is made to the results to take into consid to about 238 in SEQ ID NO:2. Second, the transmembrane eration the fact that the FASTDB program does not account domain was identified within residues from about 239 to for N- and C-terminal truncations of the subject sequence 65 about 264 in SEQ ID NO:2. Third, the intracellular domain when calculating global percent identity. For subject was identified within residues from about 265 to about 468 in sequences truncated at the N- and C-termini, relative to the SEQID NO:2. Importantly, the intracellular domain includes US 8,329,179 B2 57 58 a death domain at residues from about 379 to about 422 in amino acid residues 1 to 240 of SEQID NO:2) can be com SEQID NO:2. Further preferred fragments of the polypeptide bined with parts of the constant domain of immunoglobulins shown in SEQ ID NO:2 include the mature protein from (IgG), resulting in chimeric polypeptides. These fusion pro residues about 24 to about 468 and soluble polypeptides teins facilitate purification and show an increased half-life in comprising all or part of the extracellular and intracellular 5 vivo. This has been shown, e.g., for chimeric proteins con domains but lacking the transmembrane domain. In this con sisting of the first two domains of the human CD4-polypep text “about includes the particularly recited range, larger or tide and various domains of the constant regions of the heavy Smaller by several (5, 4, 3, 2, or 1) amino acid residues, at or light chains of mammalian immunoglobulins (EPA 394, either terminus or at both termini. 827; Traunecker et al., Nature 331:84-86 (1988)). Fusion In another aspect, the invention provides a peptide or 10 proteins that have a disulfide-linked dimeric structure due to polypeptide comprising an epitope-bearing portion of a the IgG part can also be more efficient in binding and neu polypeptide described herein. The epitope of this polypeptide tralizing other molecules than the monomeric DR4 protein or portion is an immunogenic or antigenic epitope of a polypep protein fragment alone (Fountoulakis et al., J Biochem 270: tide of the invention. The number of immunogenic epitopes of 3958-3964 (1995)). a protein generally is less than the number of antigenic 15 Polypeptides of the present invention include naturally epitopes. See, for instance, Geysen et al., Proc. Natl. Acad. purified products, products of chemical synthetic procedures, Sci. USA 81:3998-4002 (1983). and products produced by recombinant techniques from a As to the selection of peptides or polypeptides bearing an prokaryotic or eukaryotic host, including, for example, bac antigenic epitope (i.e., that contain a region of a protein mol terial, yeast, higher plant, insect and mammalian cells. ecule to which an antibody can bind), it is well known in that Depending upon the host employed in a recombinant produc art that relatively short synthetic peptides that mimic part of a tion procedure, the polypeptides of the present invention may protein sequence are routinely capable of eliciting an antise be glycosylated or may be non-glycosylated. In addition, rum that reacts with the partially mimicked protein. See, for polypeptides of the invention may also include an initial instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and modified methionine residue, in Some cases as a result of Learner, R. A. (1983) Antibodies that react with predeter 25 host-mediated processes. mined sites on proteins. Science 219:660-666. Peptides In addition, proteins of the invention can be chemically capable of eliciting protein-reactive Sera are frequently rep synthesized using techniques known in the art (e.g., see resented in the primary sequence of a protein, can be charac Creighton, 1983, Proteins: Structures and Molecular Prin terized by a set of simple chemical rules, and are confined ciples, W.H. Freeman & Co., N.Y., and Hunkapiller, M. et al., neither to immunodominant regions of intact proteins (i.e., 30 Nature 310:105-111 (1984)). For example, a peptide corre immunogenic epitopes) nor to the amino or carboxyl termi sponding to a fragment of the DR4 polypeptides of the inven nals. tion can be synthesized by use of a peptide synthesizer. Fur Non-limiting examples of antigenic polypeptides or pep thermore, if desired, nonclassical amino acids or chemical tides that can be used to generate DR4-specific antibodies amino acid analogs can be introduced as a Substitution or include: a polypeptide comprising, or alternatively consisting 35 addition into the DR4 polypeptide sequence. Non-classical of amino acid residues from about 35 to about 92 in SEQID amino acids include, but are not limited to, to the D-isomers NO:2; a polypeptide comprising, or alternatively consisting of the common amino acids, 2,4-diaminobutyric acid, alpha of amino acid residues from about 114 to about 160 in SEQ amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino ID NO:2; a polypeptide comprising, or alternatively consist butyric acid, alpha-Abu, alpha-Ahx, 6-amino hexanoic acid, ing of amino acid residues from about 169 to about 240 in 40 Aib, 2-amino isobutyric acid, 3-amino propionic acid, orni SEQ ID NO:2; a polypeptide comprising, or alternatively thine, norleucine, norvaline, hydroxyproline, sarcosine, cit consisting of amino acid residues from about 267 to about rulline, homocitruline, cysteic acid, t-butylglycine, t-butyla 298 in SEQID NO:2; a polypeptide comprising, or alterna lanine, phenylglycine, cyclohexylalanine, alpha-alanine, tively consisting of, amino acid residues from about 330 to fluoro-amino acids, designer amino acids such as alpha-me about 364 in SEQ ID NO:2; a polypeptide comprising, or 45 thylamino acids, Ca-methyl amino acids, Na-methyl amino alternatively consisting of amino acid residues from about acids, and amino acid analogs in general. Furthermore, the 391 to about 404 in SEQ ID NO:2; and a polypeptide com amino acid can be D (dextrorotary) or L (levorotary). prising, or alternatively consisting of amino acid residues Non-naturally occurring variants may be produced using from about 418 to about 465 in SEQID NO:2. In this context art-known mutagenesis techniques, which include, but are not "about includes the particularly recited range, larger or 50 limited to oligonucleotide mediated mutagenesis, alanine smaller by several (5, 4, 3, 2, or 1) amino acids, at either scanning, PCR mutagenesis, site directed mutagenesis (see, terminus or at both termini. As indicated above, the inventors e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and Zoller have determined that the above polypeptide fragments are et al., Nucl. Acids Res. 10:6487 (1982)), cassette mutagenesis antigenic regions of the DR4 protein. Polynucleotides encod (see, e.g., Wells et al., Gene 34:315 (1985)), restriction selec ing these polypeptides are also encompassed by the invention. 55 tion mutagenesis (see, e.g., Wells et al., Philos. Trans. R. Soc. The epitope-bearing peptides and polypeptides of the London SerA 317:415 (1986)). invention may be produced by any conventional means. The invention additionally, encompasses DR4 polypep Houghten, R. A., “General method for the rapid solid-phase tides which are differentially modified during or after trans synthesis of large numbers of peptides: Specificity of antigen lation, e.g., by glycosylation, acetylation, phosphorylation, antibody interaction at the level of individual amino acids.” 60 amidation, derivatization by known protecting/blocking Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985). This groups, proteolytic cleavage, linkage to an antibody molecule “Simultaneous Multiple Peptide Synthesis (SMPS)” process or other cellular ligand, etc. Any of numerous chemical modi is further described in U.S. Pat. No. 4,631.211 to Houghtenet fications may be carried out by known techniques, including al. (1986). As one of skill in the art will appreciate, DR4 but not limited to, specific chemical cleavage by cyanogen polypeptides of the present invention and the epitope-bearing 65 bromide, trypsin, chymotrypsin, papain, V8 protease, fragments thereof described herein (e.g., corresponding to a NaBH4, acetylation, formylation, oxidation, reduction, meta portion of the extracellular domain Such as, for example, bolic synthesis in the presence of tunicamycin; etc. US 8,329,179 B2 59 60 Additional post-translational modifications encompassed groups may also be used as a reactive group for attaching the by the invention include, for example, e.g., N-linked or polyethylene glycol molecules. Preferred for therapeutic pur O-linked carbohydrate chains, processing of N-terminal or poses is attachment at an amino group. Such as attachment at C-terminal ends), attachment of chemical moieties to the the N-terminus or lysine group. amino acid backbone, chemical modifications of N-linked or 5 As Suggested above, polyethylene glycol may be attached O-linked carbohydrate chains, and addition or deletion of an to proteins via linkage to any of a number of amino acid N-terminal methionine residue as a result of procaryotic host residues. For example, polyethylene glycol can be linked to a cell expression. The polypeptides may also be modified with proteins via covalent bonds to lysine, histidine, aspartic acid, a detectable label. Such as an enzymatic, fluorescent, isotopic glutamic acid, or cysteine residues. One or more reaction or affinity label to allow for detection and isolation of the 10 chemistries may be employed to attach polyethylene glycol to protein. specific amino acid residues (e.g., lysine, histidine, aspartic Also provided by the invention are chemically modified acid, glutamic acid, or cysteine) of the protein or to more than derivatives of DR4 which may provide additional advantages one type of amino acid residue (e.g., lysine, histidine, aspartic Such as increased solubility, Stability and circulating time of acid, glutamic acid, cysteine and combinations thereof) of the the polypeptide, or decreased immunogenicity (see U.S. Pat. 15 protein. No. 4,179,337). The chemical moieties for derivation may be One may specifically desire proteins chemically modified selected from water soluble polymers such as polyethylene at the N-terminus. Using polyethylene glycol as an illustra glycol, ethylene glycol/propylene glycol copolymers, car tion of the present composition, one may select from a variety boxymethylcellulose, dextran, polyvinyl alcohol and the like. of polyethylene glycol molecules (by molecular weight, The polypeptides may be modified at random positions branching, etc.), the proportion of polyethylene glycol mol within the molecule, or at predetermined positions within the ecules to protein (or peptide) molecules in the reaction mix, molecule and may include one, two, three or more attached the type of pegylation reaction to be performed, and the chemical moieties. method of obtaining the selected N-terminally pegylated pro The polymer may be of any molecular weight, and may be tein. The method of obtaining the N-terminally pegylated branched or unbranched. For polyethylene glycol, the pre 25 preparation (i.e., separating this moiety from other monop ferred molecular weight is between about 1 kDa and about egylated moieties if necessary) may be by purification of the 100 kDa (the term “about indicating that in preparations of N-terminally pegylated material from a population of pegy polyethylene glycol, Some molecules will weigh more, some lated protein molecules. Selective proteins chemically modi less, than the Stated molecular weight) for ease in handling fied at the N-terminus modification may be accomplished by and manufacturing. Other sizes may be used, depending on 30 reductive alkylation which exploits differential reactivity of the desired therapeutic profile (e.g., the duration of Sustained different types of primary amino groups (lysine versus the release desired, the effects, if any on biological activity, the N-terminal) available for derivatization in a particular pro ease in handling, the degree or lack of antigenicity and other tein. Under the appropriate reaction conditions, Substantially known effects of the polyethylene glycol to a therapeutic selective derivatization of the protein at the N-terminus with protein or analog). For example, the polyethylene glycol may 35 a carbonyl group containing polymer is achieved. have an average molecular weight of about 200, 500, 1000, As indicated above, pegylation of the proteins of the inven 1500, 2000, 2500,3000, 3500,4000, 4500, 5000, 5500, 6000, tion may be accomplished by any number of means. For 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, example, polyethylene glycol may be attached to the protein 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, either directly or by an intervening linker. Linkerless systems 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 40 for attaching polyethylene glycol to proteins are described in 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, (1992); Francis et al., Intern. J of Hematol. 68:1-18 (1998); 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa. U.S. Pat. No. 4,002,531; U.S. Pat. No. 5,349,052; WO As noted above, the polyethylene glycol may have a 95/06058; and WO 98/32466, the disclosures of each of branched structure. Branched polyethylene glycols are 45 which are incorporated herein by reference. described, for example, in U.S. Pat. No. 5,643,575; Morpurgo One system for attaching polyethylene glycol directly to et al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev amino acid residues of proteins without an intervening linker et al., Nucleosides Nucleotides 18:2745-2750 (1999); and employs tresylated MPEG, which is produced by the modi Caliceti et al., Bioconjug. Chem. 10:638-646 (1999), the dis fication of monmethoxy polyethylene glycol (MPEG) using closures of each of which are incorporated herein by refer 50 tresylchloride (CISOCHCF). Upon reaction of protein CCC. with tresylated MPEG, polyethylene glycol is directly The polyethylene glycol molecules (or other chemical attached to amine groups of the protein. Thus, the invention moieties) should be attached to the protein with consideration includes protein-polyethylene glycol conjugates produced by of effects on functional or antigenic domains of the protein. reacting proteins of the invention with a polyethylene glycol There are a number of attachment methods available to those 55 molecule having a 2.2.2-trifluoreothane Sulphonyl group. skilled in the art, e.g., EPO 401 384, herein incorporated by Polyethylene glycol can also be attached to proteins using reference (coupling PEG to G-CSF), see also Malik et al., a number of different intervening linkers. For example, U.S. Exp. Hematol. 20:1028-1035 (1992) (reporting pegylation of Pat. No. 5,612,460, the entire disclosure of which is incorpo GM-CSF using tresyl chloride). For example, polyethylene rated herein by reference, discloses urethane linkers for con glycol may be covalently bound through amino acid residues 60 necting polyethylene glycol to proteins. Protein-polyethylene via a reactive group, such as, a free amino or carboxyl group. glycol conjugates wherein the polyethylene glycol is attached Reactive groups are those to which an activated polyethylene to the protein by a linker can also be produced by reaction of glycol molecule may be bound. The amino acid residues proteins with compounds such as MPEG-succinimidylsucci having a free amino group may include lysine residues and nate, MPEG activated with 1,1'-carbonyldiimidazole, the N-terminal amino acid residues; those having a free car 65 MPEG-2,4,5-trichloropenylcarbonate, MPEG-p-nitrophe boxyl group may include aspartic acid residues, glutamic acid nolcarbonate, and various MPEG-succinate derivatives. A residues and the C-terminal amino acid residue. Sulfhydryl number additional polyethylene glycol derivatives and reac US 8,329,179 B2 61 62 tion chemistries for attaching polyethylene glycol to proteins tions, bacterial infections, viral infections, restenosis, and are described in WO 98/32466, the entire disclosure of which graft vs. host disease; to induce resistance to parasites, bac is incorporated herein by reference. Pegylated protein prod teria and viruses; to induce proliferation of T-cells, endothe ucts produced using the reaction chemistries set outherein are lial cells and certain hematopoietic cells; to regulate anti-viral included within the scope of the invention. responses; and to treat and/or prevent certain autoimmune The number of polyethylene glycol moieties attached to diseases after stimulation of DR5 by an agonist. Additional each protein of the invention (i.e., the degree of Substitution) applications relate to diagnosis, treatment, and/or prevention may also vary. For example, the pegylated proteins of the of disorders of cells, tissues and organisms. These aspects of invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9. the invention are discussed further below. 10, 12, 15, 17, 20, or more polyethylene glycol molecules. 10 The present invention encompasses polypeptides compris Similarly, the average degree of Substitution within ranges ing, or alternatively consisting of an epitope of the polypep such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, tide having an amino acid sequence of SEQID NO:2, or an 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 epitope of the polypeptide sequence encoded by a polynucle polyethylene glycol moieties per protein molecule. Methods otide sequence contained in the cDNA deposited as ATCC for determining the degree of Substitution are discussed, for 15 Deposit No. 97853 or encoded by a polynucleotide that example, in Delgado et al., Crit. Rev. Thera. Drug Carrier hybridizes to the complement of the sequence of SEQ ID Sys. 9:249-304 (1992). NO:1 or contained in the cDNA deposited as ATCC Deposit As mentioned, DR4 polypeptides may be modified by No. 97853 under stringent hybridization conditions or lower either natural processes, such as posttranslational processing, stringency hybridization conditions as defined Supra. The or by chemical modification techniques, which are well present invention further encompasses polynucleotide known in the art. It will be appreciated that the same type of sequences encoding an epitope of a polypeptide sequence of modification may be present in the same or varying degrees at the invention (such as, for example, the sequence disclosed in several sites in a given DR4 polypeptide. Also, a given DR4 SEQID NO:1), polynucleotide sequences of the complemen polypeptide may contain many types of modifications. DR4 tary strand of a polynucleotide sequence encoding an epitope polypeptides may be branched, for example, as a result of 25 of the invention, and polynucleotide sequences which hybrid ubiquitination, and they may be cyclic, with or without ize to the complementary Strand under Stringent hybridization branching. Cyclic, branched, and branched cyclic DR4 conditions or lower stringency hybridization conditions polypeptides may result from natural posttranslational pro defined Supra. cesses or may be made by synthetic methods. Modifications In another aspect, the invention provides a peptide or include acetylation, acylation, ADP-ribosylation, amidation, 30 polypeptide comprising an epitope-bearing portion of a covalent attachment of flavin, covalent attachment of a heme polypeptide described herein. The epitope of this polypeptide moiety, covalent attachment of a nucleotide or nucleotide portion is an immunogenic or antigenic epitope of a polypep derivative, covalent attachment of a lipid or lipid derivative, tide of the invention. The term "epitopes, as used herein, covalent attachment of phosphatidylinositol, cross-linking, refers to portions of a polypeptide having antigenic or immu cyclization, disulfide bond formation, demethylation, forma 35 nogenic activity in an animal, preferably a mammal, and most tion of covalent cross-links, formation of cysteine, formation preferably in a human. In a preferred embodiment, the present of pyroglutamate, formylation, gamma-carboxylation, glyco invention encompasses a polypeptide comprising an epitope, Sylation, GPI anchor formation, hydroxylation, iodination, as well as the polynucleotide encoding this polypeptide. An methylation, myristoylation, oxidation, pegylation, pro “immunogenic epitope' is defined as a part of a protein that teolytic processing, phosphorylation, prenylation, racemiza 40 elicits an antibody response when the whole protein is the tion, selenoylation, sulfation, transfer-RNA mediated addi immunogen. On the other hand, a region of a protein molecule tion of amino acids to proteins such as arginylation, and to which an antibody can bind is defined as an “antigenic ubiquitination. (See, for instance, PROTEINS STRUC epitope. The number of immunogenic epitopes of a protein TURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. generally is less than the number of antigenic epitopes. See, Creighton, W.H. Freeman and Company, New York (1993); 45 for instance, Geysen et al., Proc. Natl. Acad. Sci. USA POSTRRANSLATIONAL COVALENT MODIFICATION 81:3998-4002 (1983). OF PROTEINS, B. C. Johnson, Ed., Academic Press, New Fragments that function as epitopes may be produced by York, pgs. 1-12 (1983); Seifter et al., Meth Enzymol 182:626 any conventional means. (See, e.g., Houghten, Proc. Natl. 646 (1990); Rattan et al., Ann NY Acad Sci 663:48-62 Acad. Sci. USA 82:5131-5135 (1985), further described in (1992)). 50 U.S. Pat. No. 4,631,211). The DR4 polypeptides can be recovered and purified from As to the selection of peptides or polypeptides bearing an chemical synthesis and recombinant cell cultures by standard antigenic epitope (i.e., that contain a region of a protein mol methods which include, but are not limited to, ammonium ecule to which an antibody can bind), it is well known in that Sulfate or ethanol precipitation, acid extraction, anion or cat art that relatively short synthetic peptides that mimic part of a ion exchange chromatography, phosphocellulose chromatog 55 protein sequence are routinely capable of eliciting an antise raphy, hydrophobic interaction chromatography, affinity rum that reacts with the partially mimicked protein. See, for chromatography, hydroxyapatite chromatography and lectin instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and chromatography. Most preferably, high performance liquid Learner, R. A., “Antibodies That React With Predetermined chromatography (“HPLC) is employed for purification. Sites on Proteins.” Science 219:660-666 (1983). Peptides Well-known techniques for refolding protein may be 60 capable of eliciting protein-reactive Sera are frequently rep employed to regenerate active conformation when the resented in the primary sequence of a protein, can be charac polypeptide is denatured during isolation and/or purification. terized by a set of simple chemical rules, and are confined DR4 polynucleotides and polypeptides may be used in neither to immunodominant regions of intact proteins (i.e., accordance with the present invention for a variety of appli immunogenic epitopes) nor to the amino or carboxyl termi cations, particularly those that make use of the chemical and 65 nals. biological properties of DR4. Among these are applications in Non-limiting examples of antigenic polypeptides or pep the treatment and/or prevention of tumors, parasitic infec tides that can be used to generate DR4-specific antibodies US 8,329,179 B2 63 64 include: a polypeptide comprising, or alternatively consisting Most preferably the antibodies are human antigen-binding of amino acid residues from about 35 to about 92 in FIG. 1 antibody fragments of the present invention and include, but (about 35 to about 92 in SEQID NO:2); a polypeptide com are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs prising, or alternatively consisting of amino acid residues (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) from about 114 to about 160 in FIG. 1 (about 114 to about 160 and fragments comprising eithera V or V. domain. Antigen in SEQID NO:2); a polypeptide comprising, or alternatively binding antibody fragments, including single-chain antibod consisting of amino acid residues from about 169 to about ies, may comprise the variable region(s) alone or in combi 240 in FIG. 1 (about 169 to about 240 in SEQ ID NO:2); a nation with the entirety or a portion of the following: hinge polypeptide comprising, or alternatively consisting of, amino region, CH1, CH2, and CH3 domains. Also included in the acid residues from about 267 to about 298 in FIG. 1 (about 10 invention are antigen-binding fragments also comprising any 267 to about 298 in SEQID NO:2); a polypeptide comprising, combination of variable region(s) with a hinge region, CH1, or alternatively consisting of amino acid residues from about CH2, and CH3 domains. The antibodies of the invention may 330 to about 364 in FIG. 1 (about 330 to about 364 in SEQID be from any animal origin including birds and mammals. NO:2); a polypeptide comprising, or alternatively consisting Preferably, the antibodies are human, murine, donkey, ship of amino acid residues from about 391 to about 404 in FIG. 15 rabbit, goat, guinea pig, camel, horse, or chicken. As used 1 (about 391 to about 404 in SEQID NO:2); and a polypep herein, “human' antibodies include antibodies having the tide comprising, or alternatively consisting of amino acid amino acid sequence of a human immunoglobulin and residues from about 418 to about 465 in FIG. 1 (about 418 to include antibodies isolated from human immunoglobulin about 465 in SEQID NO:2). As indicated above, the inventors libraries or from animals transgenic for one or more human have determined that the above polypeptide fragments are immunoglobulin and that do not express endogenous immu antigenic regions of the DR4 protein. noglobulins, as described infra and, for example in, U.S. Pat. The epitope-bearing peptides and polypeptides of the No. 5,939,598 by Kucherlapati et al. invention may be produced by any conventional means. The antibodies of the present invention may be monospe Houghten, R.A., “General Method for the Rapid Solid-Phase cific, bispecific, trispecific or of greater multispecificity. Mul Synthesis of Large Numbers of Peptides: Specificity of Anti 25 tispecific antibodies may be specific for different epitopes of gen-Antibody Interaction at the Level of Individual Amino a polypeptide of the present invention or may be specific for Acids.” Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985). both a polypeptide of the present invention as well as for a This “Simultaneous Multiple Peptide Synthesis (SMPS)” heterologous epitope, such as a heterologous polypeptide or process is further described in U.S. Pat. No. 4,631,211 to solid support material. See, e.g., PCT publications WO Houghten et al. (1986). As one of skill in the art will appre 30 93/17715; WO92/08802; WO 91/00360; WO92/05793; Tutt ciate, DR4 polypeptides of the present invention and the et al., J. Immunol. 147:60-69 (1991): U.S. Pat. Nos. 4.474, epitope-bearing fragments thereof described above can be 893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny combined with parts of the constant domain of immunoglo et al., J. Immunol. 148:1547-1553 (1992). bulins (IgG), resulting in chimeric polypeptides. These fusion Antibodies of the present invention may be described or proteins facilitate purification and show an increased half-life 35 specified in terms of the epitope(s) orportion(s) of a polypep in vivo. This has been shown, e.g., for chimeric proteins tide of the present invention that they recognize or specifically consisting of the first two domains of the human CD4 bind. The epitope(s) or polypeptide portion(s) may be speci polypeptide and various domains of the constant regions of fied as described herein, e.g., by N-terminal and C-terminal the heavy or light chains of mammalian immunoglobulins positions, by size in contiguous amino acid residues, or listed (EPA 394,827; Traunecker et al., Nature 331:84-86 (1988)). 40 in the Tables and Figures. Antibodies that specifically bind Fusion proteins that have a disulfide-linked dimeric structure any epitope or polypeptide of the present invention may also due to the IgG part can also be more efficient in binding and be excluded. Therefore, the present invention includes anti neutralizing other molecules than the monomeric DR5 pro bodies that specifically bind polypeptides of the present tein or protein fragment alone (Fountoulakis et al., J. Bio invention, and allows for the exclusion of the same. chem. 270:3958-3964 (1995)). 45 Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that Antibodies do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. Antibodies The present invention further relates to antibodies and that bind polypeptides with at least 95%, at least 90%, at least T-cell antigen receptors (TCR) which immunospecifically 50 85%, at least 80%, at least 75%, at least 70%, at least 65%, at bind a polypeptide, preferably an epitope, of the present least 60%, at least 55%, and at least 50% identity (as calcu invention (as determined by immunoassays well known in the lated using methods known in the art and described herein) to art for assaying specific antibody-antigen binding). Antibod a polypeptide of the present invention are also included in the ies of the invention include, but are not limited to, polyclonal, present invention. Antibodies that do not bind polypeptides monoclonal, multispecific, human, humanized or chimeric 55 with less than 95%, less than 90%, less than 85%, less than antibodies, single chain antibodies, Fab fragments, F(ab') 80%, less than 75%, less than 70%, less than 65%, less than fragments, fragments produced by a Fab expression library, 60%, less than 55%, and less than 50% identity (as calculated anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id using methods known in the art and described herein) to a antibodies to antibodies of the invention), and epitope-bind polypeptide of the present invention are also included in the ing fragments of any of the above. The term “antibody, as 60 present invention. Further included in the present invention used herein, refers to immunoglobulin molecules and immu are antibodies that bind polypeptides encoded by polynucle nologically active portions of immunoglobulin molecules, otides which hybridize to a polynucleotide of the present i.e., molecules that contain an antigenbinding site that immu invention under stringent hybridization conditions (as nospecifically binds an antigen. The immunoglobulin mol described herein). Antibodies of the present invention may ecules of the invention can be of any type (e.g., IgG, IgE, IgM, 65 also be described or specified in terms of their binding affinity IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 to a polypeptide of the invention. Preferred binding affinities and IgA2) or Subclass of immunoglobulin molecule. include those with a dissociation constant or Kd less than US 8,329,179 B2 65 66 5x10M, 10°M, 5x10M, 10M, 5x10M, 10M, In further embodiments, the antibodies of the invention 5x10-M, 10-3M, 5x10M, 10-M, 5x107M, 107M, have a dissociation constant (K) of 107M or less. In pre 5x10-8M, 10-8M, 5x10M, 10M, 5x100M, 100M, ferred embodiments, the antibodies of the invention have a 5x10M, 10M,5x10°M, 10°M,5x10M, 10M, dissociation constant (Ki) of 10 Morless. 5x10M, 10M, 5x10'SM, and 10-5M. The present invention further provides antibodies that Antibodies that bind DR4 receptor polypeptides may bind stimulate apoptosis of DR4 expressing cells better than an them as isolated polypeptides or in their naturally occurring equal concentration of TRAIL polypeptide stimulates apop state. By "isolated polypeptide' is intended a polypeptide tosis of DR4 expressing cells. removed from its native environment. Thus, a polypeptide The present invention further provides antibodies that 10 stimulate apoptosis of DR4 expressing cells equally well in produced and/or contained within a recombinant host cell is the presence or absence of antibody cross-linking reagents; considered isolated for purposes of the present invention. and/or stimulate apoptosis with equal or greater potency as an Also intended as an "isolated polypeptide' are polypeptides equal concentration of TRAIL in the absence of a cross that have been purified, partially or substantially, from a linking antibody or other cross-linking agent. recombinant host cell. For example, a recombinantly pro 15 In further embodiments, antibodies of the invention have duced version of the DR4 polypeptide is substantially puri an offrate (k) of 10/sec or less. In preferred embodiments, fied by the one-step method described in Smith and Johnson, antibodies of the invention have an offrate (k) of 1 0/sec or Gene 67:31-40 (1988). Thus, antibodies of the present inven less. In other preferred embodiments, antibodies of the inven tion may bind recombinantly produced DR4 receptor tion have an off rate (k) of 10/sec or less. polypeptides. The present invention further encompasses methods and In a specific embodiment, antibodies of the present inven compositions for killing of cells expressing DR4 on their tion bind a full-length DR4 receptor expressed on the surface Surface, comprising, or alternatively consisting of contacting of a cell comprising a polynucleotide encoding amino acids 1 anti-DR4 antibodies of the invention with such cells express to 468 of SEQID NO:2 operably associated with a regulatory ing DR4 on their surface. sequence that controls gene expression. In another specific 25 In specific embodiments, the present invention encom embodiment, antibodies of the present invention bind a full passes methods and compositions for inducing apoptosis in length DR4 receptor expressed on the surface of a cell com cells expressing DR4 on their Surface, comprising, or alter prising a polynucleotide encoding the amino acid sequence natively consisting of contacting anti-DR4 antibodies of the encoded by the cDNA contained in ATCC Deposit No.97853, invention with such cells expressing DR4 on their surface. operably associated with a regulatory sequence that controls 30 In further specific embodiments, the present invention gene expression. encompasses methods and compositions for inducing apop In preferred embodiments, antibodies of the present inven tosis in cells expressing a polypeptide comprising amino tion bind the mature DR4 receptor expressed on the surface of acids about 52 to about 184 of SEQID NO:2 on their surface, a cell comprising a polynucleotide encoding amino acids comprising, or alternatively consisting of contacting anti about 24 to about 468 of SEQID NO:2 operably associated 35 DR4 antibodies of the invention with such cells expressing with a regulatory sequence that controls gene expression. In said polypeptide on their surface. other preferred embodiments, antibodies of the present inven In further specific embodiments, the present invention tion bind mature DR4 receptor expressed on the surface of a encompasses methods and compositions for inducing apop cell comprising a polynucleotide encoding the amino acid tosis in cells expressing a polypeptide comprising the extra sequence of the mature polypeptide encoded by the cDNA 40 cellular domain of the polypeptide encoded by the cDNA contained in ATCC Deposit No. 97853, operably associated clone contained in ATCC Deposit No. 97920 on their surface, with a regulatory sequence that controls gene expression. comprising, or alternatively consisting of contacting anti In preferred embodiments, antibodies of the present inven DR4 antibodies of the invention with such cells expressing tion bind the extracellular domain of a DR4 receptor said polypeptide on their surface. expressed on the Surface of a cell comprising a polynucleotide 45 The present invention further encompasses methods and encoding amino acids about 24 to about 238 of SEQID NO:2 compositions for killing of cells expressing DR4 on their operably associated with a regulatory sequence that controls Surface, comprising, or alternatively consisting of adminis gene expression. In other preferred embodiments, antibodies tering to an animal, anti-DR4 antibodies of the invention in an of the present invention bind the extracellular domain of a amount effective to kill such DR4 expressing cells. DR4 receptor expressed on the Surface of a cell comprising a 50 In specific embodiments, the present invention encom polynucleotide encoding the amino acid sequence of the passes methods and compositions for inducing apoptosis in extracellular domain of the polypeptide encoded by the cells expressing DR4 on their Surface, comprising, or alter cDNA contained in ATCC Deposit No. 97853, operably asso natively consisting of administering to an animal, anti-DR4 ciated with a regulatory sequence that controls gene expres antibodies of the invention in an amount effective to induce S1O. 55 apoptosis in Such DR4 expressing cells. The present invention also provides antibodies that bind In further specific embodiments, the present invention DR5 polypeptides that act as either DR4 agonists or DR4 encompasses methods and compositions for inducing apop antagonists. In specific embodiments, the antibodies of the tosis in cells expressing a polypeptide comprising amino invention stimulate apoptosis of DR4 expressing cells. In acids about 52 to about 184 of SEQID NO:2 on their surface, other specific embodiments, the antibodies of the invention 60 comprising, or alternatively consisting of administering to an inhibit TRAIL binding to DR4. In other specific embodi animal, anti-DR4 antibodies of the invention in an amount ments, the antibodies of the invention upregulate DR4 expres effective to induce apoptosis in Such cells expressing said S1O. polypeptide on their Surface. The present invention also provides antibodies that inhibit In further specific embodiments, the present invention apoptosis of DR4 expressing cells. In other specific embodi 65 encompasses methods and compositions for inducing apop ments, the antibodies of the invention downregulate DR4 tosis in cells expressing a polypeptide comprising the extra expression. cellular domain of the polypeptide encoded by the cDNA US 8,329,179 B2 67 68 clone contained in ATCC Deposit No. 97920 on their surface, the antibodies have use in immunoassays for qualitatively and comprising, or alternatively consisting of administering to an quantitatively measuring levels of the polypeptides of the animal, anti-DR4 antibodies of the invention in an amount present invention in biological samples. See, e.g., Example effective to induce apoptosis in Such cells expressing said 29, below, as well as Harlow et al., Antibodies: A Laboratory polypeptide on their Surface. 5 Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. The invention also provides antibodies that competitively 1988) (incorporated by reference herein in its entirety). inhibit binding of an antibody to an epitope of the invention as Furthermore, antibodies of the present invention may be determined by any method known in the art for determining used to cause death of cells which express polypeptides of the competitive binding, for example, the immunoassays present invention, including both in vitro and in vivo diag described herein. In preferred embodiments, the antibody 10 nostic and therapeutic methods. For example, the antibodies competitively inhibits binding to the epitope by at least 90%, have use in immunoassays for qualitatively and quantitatively at least 80%, at least 70%, at least 60%, or at least 50%. measuring levels of the polypeptides of the present invention Antibodies of the present invention may act as agonists or in biological samples. See, e.g., Harlow et al., Antibodies: A antagonists of the polypeptides of the present invention. For Laboratory Manual, (Cold Spring Harbor Laboratory Press, example, the present invention includes antibodies which 15 2nd ed. 1988) (incorporated by reference herein in its disrupt the receptor/ligand interactions with the polypeptides entirety). of the invention either partially or fully. The invention fea As discussed in more detail below, the antibodies of the tures both receptor-specific antibodies and ligand-specific present invention may be used either alone or in combination antibodies. The invention also features receptor-specific anti with other compositions. The antibodies may further be bodies which do not prevent ligand binding but prevent recep recombinantly fused to a heterologous polypeptide at the N tor activation. Receptor activation (i.e., signaling) may be or C-terminus or chemically conjugated (including determined by techniques described herein or otherwise covalently and non-covalently conjugations) to polypeptides known in the art. For example, receptor activation can be or other compositions. For example, antibodies of the present determined by detecting the phosphorylation (e.g., tyrosine invention may be recombinantly fused or conjugated to mol or serine/threonine) of the receptor or its substrate by immu 25 ecules useful as labels in detection assays and effector mol noprecipitation followed by western blot analysis (for ecules Such as heterologous polypeptides, drugs, or toxins. example, as described Supra). In specific embodiments, anti See, e.g., PCT publications WO 92/08495; WO 91/14438: bodies are provided that inhibit ligand or receptor activity by WO 89/12624; U.S. Pat. No. 5,314,995; and EP 396,387. at least 90%, at least 80%, at least 70%, at least 60%, or at The antibodies of the invention include derivatives that are least 50% of the activity in absence of the antibody. 30 modified, i.e., by the covalent attachment of any type of mol The invention also features receptor-specific antibodies ecule to the antibody Such that covalent attachment does not which both prevent ligand binding and receptor activation as prevent the antibody from generating an anti-idiotypic well as antibodies that recognize the receptor-ligand com response. For example, but not by way of limitation, the plex, and, preferably, do not specifically recognize the antibody derivatives include antibodies that have been modi unbound receptor or the unbound ligand. Likewise, included 35 fied, e.g., by glycosylation, acetylation, pegylation, phospho in the invention are neutralizing antibodies which bind the rylation, amidation, derivatization by known protecting/ ligand and prevent binding of the ligand to the receptor, as blocking groups, proteolytic cleavage, linkage to a cellular well as antibodies which bind the ligand, thereby preventing ligand or other protein, etc. Any of numerous chemical modi receptor activation, but do not prevent the ligand from binding fications may be carried out by known techniques, including, the receptor. Further included in the invention are antibodies 40 but not limited to specific chemical cleavage, acetylation, which activate the receptor. These antibodies may act as formylation, metabolic synthesis of tunicamycin, etc. Addi receptor agonists, i.e., potentiate or activate either all or a tionally, the derivative may contain one or more non-classical subset of the biological activities of the ligand-mediated amino acids. receptor activation. The antibodies may be specified as ago The antibodies of the present invention may be generated nists, antagonists or inverse agonists for biological activities 45 by any suitable method known in the art. Polyclonal antibod comprising the specific biological activities of the peptides of ies to an antigen of interest can be produced by various the invention disclosed herein. Thus, the invention further procedures well known in the art. For example, a polypeptide relates to antibodies which act as agonists or antagonists of of the invention can be administered to various host animals the polypeptides of the present invention. The above antibody including, but not limited to, rabbits, mice, rats, etc. to induce agonists can be made using methods known in the art. See, 50 the production of Sera containing polyclonal antibodies spe e.g., PCT publication WO96/40281; U.S. Pat. No. 5,811,097; cific for the antigen. Various adjuvants may be used to Denget al., Blood 92(6):1981-1988 (1998); Chen et al., Can increase the immunological response, depending on the host cer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. species, and include but are not limited to, Freund's (com 161(4):1786-1794 (1998); Zhu et al., Cancer Res. 58(15): plete and incomplete), mineral gels such as aluminum 3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170 55 hydroxide, Surface active Substances Such as lysolecithin, 3179 (1998); Pratet al., J. Cell. Sci. 111 (Pt.2):237-247 (1998); pluronic polyols, polyanions, peptides, oil emulsions, key Pitard et al., J. Immunol. Methods 205(2):177-190 (1997); hole limpet hemocyanins, dinitrophenol, and potentially use Liautard et al., Cytokine 9(4): 233-241 (1997); Carlson et al., ful human adjuvants such as BCG (bacille Calmette-Guerin) J. Biol. Chem. 272(17): 11295-11301 (1997); Taryman et al., and Corynebacterium parvum. Such adjuvants are also well Neuron 14(4):755-762 (1995); Muller et al., Structure 6(9): 60 known in the art. 1153-1167 (1998); Bartunek et al., Cytokine 8(1):14-20 Monoclonal antibodies can be prepared using a wide vari (1996) (which are all incorporated by reference herein in their ety of techniques known in the art including the use of hybri entireties). doma, recombinant, and phage display technologies, or a Antibodies of the present invention may be used, for combination thereof. For example, monoclonal antibodies example, but not limited to, to purify, detect, and target the 65 can be produced using hybridoma techniques including those polypeptides of the present invention, including both in vitro known in the art and taught, for example, in Harlow et al., and in vivo diagnostic and therapeutic methods. For example, Antibodies: A Laboratory Manual, (Cold Spring Harbor US 8,329,179 B2 69 70 Laboratory Press, 2nd ed. 1988); Hammerling et al., in: 24:952-958 (1994); Persic et al., Gene 187:9-18 (1997); Bur Monoclonal Antibodies and T-Cell Hybridomas 563-681 ton et al., Advances in Immunology 57:191-280 (1994); PCT (Elsevier, N.Y., 1981) (said references incorporated by refer application No. PCT/GB91701134; PCT publications WO ence in their entireties). The term “monoclonal antibody” as 90/02809, WO 91/10737; WO92/01047; WO92/18619; WO used herein is not limited to antibodies produced through 5 93/11236: WO95/15982: WO95/20401; and U.S. Pat. Nos. hybridoma technology. The term “monoclonal antibody” 5,698,426; 5,223,409; 5,403,484: 5,580,717: 5,427,908: refers to an antibody that is derived from a single clone, 5,750,753: 5,821,047; 5,571,698; 5,427,908: 5,516,637; including any eukaryotic, prokaryotic, or phage clone, and 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of not the method by which it is produced. Thus, the term which is incorporated herein by reference in its entirety. “monoclonal antibody' is not limited to antibodies produced 10 As described in the above references, after phage selection, through hybridoma technology. Monoclonal antibodies can the antibody coding regions from the phage can be isolated be prepared using a wide variety of techniques known in the and used to generate whole antibodies, including human anti art including the use of hybridoma and recombinant and bodies, or any other desired antigen binding fragment, and phage display technology. expressed in any desired host, including mammalian cells, Methods for producing and screening for specific antibod 15 insect cells, plant cells, yeast, and bacteria, e.g., as described ies using hybridoma technology are routine and well-known in detail below. For example, techniques to recombinantly in the art and are discussed in detail in Example 21. Briefly, produce Fab, Fab' and F(ab')2 fragments can also be mice can be immunized with a polypeptide of the invention or employed using methods known in the art such as those a cell expressing Such peptide. Once an immune response is disclosed in PCT publication WO92/22324; Mullinax et al., detected, e.g., antibodies specific for the antigen are detected BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI in the mouse serum, the mouse spleen is harvested and sple 34:26-34 (1995); and Better et al., Science 240:1041-1043 nocytes isolated. The splenocytes are then fused by well (1988) (said references incorporated by reference in their known techniques to any suitable myeloma cells, for example entireties). cells from cell line SP20 available from the ATCC. Hybrido Examples of techniques which can be used to produce mas are selected and cloned by limited dilution. The hybri 25 single-chain Fvs and antibodies include those described in doma clones are then assayed by methods known in the art for U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Meth cells that secrete antibodies capable of binding a polypeptide ods in Enzymology 203:46-88 (1991); Shu et al., PNAS of the invention. Ascites fluid, which generally contains high 90:7995–7999 (1993); and Skerra et al., Science 240:1038 levels of antibodies, can be generated by immunizing mice 1040 (1988). For some uses, including in vivo use of antibod with positive hybridoma clones. 30 ies in humans and in vitro detection assays, it may be prefer Accordingly, the present invention provides methods of able to use chimeric, humanized, or human antibodies. A generating monoclonal antibodies as well as antibodies pro chimericantibody is a molecule in which different portions of duced by the method comprising culturing a hybridoma cell the antibody are derived from different animal species, such secreting an antibody of the invention wherein, preferably, as antibodies having a variable region derived from a murine the hybridoma is generated by fusing splenocytes isolated 35 monoclonal antibody and a human immunoglobulin constant from a mouse immunized with an antigen of the invention region. Methods for producing chimeric antibodies are with myeloma cells and then screening the hybridomas known in the art. See, e.g., Morrison, Science 229:1202 resulting from the fusion for hybridoma clones that secrete an (1985): Oi et al., BioTechniques 4:214 (1986); Gillies et al., antibody able to bind a polypeptide of the invention. (1989) J. Immunol. Methods 125:191-202; U.S. Pat. Nos. Antibody fragments that recognize specific epitopes may 40 5,807,715; 4,816,567; and 4,816397, which are incorporated be generated by known techniques. For example, Fab and herein by reference in their entireties. Humanized antibodies F(ab')2 fragments of the invention may be produced by pro are antibody molecules from non-human species antibody teolytic cleavage of immunoglobulin molecules, using that binds the desired antigen having one or more comple enzymes Such as papain (to produce Fab fragments) or pepsin mentarity determining regions (CDRs) from the non-human (to produce F(ab')2 fragments). F(ab')2 fragments contain the 45 species and framework regions from a human immunoglobu variable region, the light chain constant region and the CH1 lin molecule. Often, framework residues in the human frame domain of the heavy chain. work regions will be substituted with the corresponding resi For example, the antibodies of the present invention can due from the CDR donor antibody to alter, preferably also be generated using various phage display methods improve, antigenbinding. These framework Substitutions are known in the art. In phage display methods, functional anti 50 identified by methods well known in the art, e.g., by modeling body domains are displayed on the Surface of phage particles of the interactions of the CDR and framework residues to which carry the polynucleotide sequences encoding them. In identify framework residues important for antigen binding a particular, such phage can be utilized to display antigen and sequence comparison to identify unusual framework resi binding domains expressed from a repertoire or combinato dues at particular positions. (See, e.g., Queen et al., U.S. Pat. rial antibody library (e.g., human or murine). Phage express 55 No. 5,585,089; Riechmann et al., Nature 332:323 (1988), ing an antigen binding domain that binds the antigen of which are incorporated herein by reference in their entireties.) interest can be selected or identified with antigen, e.g., using Antibodies can be humanized using a variety of techniques labeled antigen orantigenbound or captured to a solid Surface known in the art including, for example, CDR-grafting (EP or bead. Phage used in these methods are typically filamen 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. tous phage including fa and M13 binding domains expressed 60 5,225,539; 5,530,101; and 5,585,089), veneering or resurfac from phage with Fab, Fv or disulfide stabilized FV antibody ing (EP592,106; EP 519,596: Padlan, Molecular Immunol domains recombinantly fused to either the phage gene III or ogy 28(4/5):489-498 (1991); Studnicka et al., Protein Engi gene VIII protein. Examples of phage display methods that neering 7(6):805-814 (1994); Roguska. et al., PNAS91:969 can be used to make the antibodies of the present invention 973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332). include those disclosed in Brinkman et al., J. Immunol. Meth 65 Completely human antibodies are particularly desirable for ods 182:41-50 (1995); Ames et al., J. Immunol. Methods therapeutic treatment of human patients. Human antibodies 184:177-186 (1995); Kettleborough et al., Eur: J. Immunol. can be made by a variety of methods known in the art includ US 8,329,179 B2 71 72 ing phage display methods described above using antibody Such anti-idiotypes can be used in therapeutic regimens to libraries derived from human immunoglobulin sequences. neutralize polypeptide ligand. For example, Such anti-idio See also, U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT typic antibodies can be used to bind a polypeptide of the publications WO 98/46645, WO 98/50433, WO 98/24893, invention and/or to bind its ligands/receptors, and thereby WO 98/16654, WO 96/34096, WO 96/33735, and WO block its biological activity. 91/10741; each of which is incorporated herein by reference Antibodies of the invention may also include multimeric in its entirety. forms of antibodies. For example, antibodies of the invention Human antibodies can also be produced using transgenic may take the form of antibody dimers, trimers, or higher mice which are incapable of expressing functional endog order multimers of monomeric immunoglobulin molecules. enous immunoglobulins, but which can express human 10 Dimers of whole immunoglobulin molecules or of F(ab') immunoglobulin genes. For example, the human heavy and fragments are tetravalent, whereas dimers of Fab fragments or light chain immunoglobulin gene complexes may be intro scFv molecules are bivalent. Individual monomers within an duced randomly or by homologous recombination into mouse antibody multimer may be identical or different, i.e., they embryonic stem cells. Alternatively, the human variable may be heteromeric or homomericantibody multimers. For region, constant region, and diversity region may be intro 15 example, individual antibodies within a multimer may have duced into mouse embryonic stem cells in addition to the the same or different binding specificities. human heavy and light chain genes. The mouse heavy and Multimerization of antibodies may be accomplished light chain immunoglobulin genes may be rendered non through natural aggregation of antibodies or through chemi functional separately or simultaneously with the introduction cal or recombinant linking techniques known in the art. For of human immunoglobulin loci by homologous recombina example, some percentage of purified antibody preparations tion. In particular, homozygous deletion of the JH region (e.g., purified IgG1 molecules) spontaneously form protein prevents endogenous antibody production. The modified aggregates containing antibody homodimers, and other embryonic stem cells are expanded and microinjected into higher-order antibody multimers. Alternatively, antibody blastocysts to produce chimeric mice. The chimeric mice are homodimers may be formed through chemical linkage tech then bred to produce homozygous offspring that express 25 niques known in the art. For example, heterobifunctional human antibodies. The transgenic mice are immunized in the crosslinking agents including, but not limited to, SMCC Suc normal fashion with a selected antigen, e.g., all or a portion of cinimidyl 4-(maleimidomethyl)cyclohexane-1-carboxylate a polypeptide of the invention. Monoclonal antibodies and SATAN-succinimidyl S-acethylthio-acetate (available, directed against the antigen can be obtained from the immu for example, from Pierce Biotechnology, Inc. (Rockford, nized, transgenic mice using conventional hybridoma tech 30 Ill.)) can be used to form antibody multimers. An exemplary nology. The human immunoglobulin transgenes harbored by protocol for the formation of antibody homodimers is given in the transgenic mice rearrange during B-cell differentiation, Ghetie et al., Proceedings of the National Academy of Sci and Subsequently undergo class Switching and somatic muta ences USA (1997) 94.7509-7514, which is hereby incorpo tion. Thus, using Such a technique, it is possible to produce rated by reference in its entirety. Antibody homodimers can therapeutically useful IgG, IgA, IgM and IgE antibodies. For 35 be converted to Fab'2 homodimers through digestion with an overview of this technology for producing human antibod pepsin. Alternatively, antibodies can be made to multimerize ies, see Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65 through recombinant DNA techniques. IgM and IgA natu 93). For a detailed discussion of this technology for produc rally form antibody multimers through the interaction with ing human antibodies and human monoclonal antibodies and the J chain polypeptide. Non-IgA or non-IgM molecules, protocols for producing such antibodies, see, e.g., PCT pub 40 Such as IgG molecules, can be engineered to contain the J lications WO 98/24893; WO 96/34096; WO 96/33735; U.S. chain interaction domain of IgA or IgM, thereby conferring Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661, the ability to form higher order multimers on the non-IgA or 016; 5,545,806; 5,814,318; and 5,939,598, which are incor non-IgM molecules. (see, for example, Chintalacharuvu et porated by reference herein in their entirety. In addition, al., (2001) Clinical Immunology 101:21-31. and Frigerio et companies Such as Abgenix, Inc. (Freemont, Calif.) and Gen 45 al., (2000) Plant Physiology 123:1483-94., both of which are Pharm (San Jose, Calif.) can be engaged to provide human hereby incorporated by reference in their entireties.) Sclv antibodies directed against a selected antigen using technol dimers can also be formed through recombinant techniques ogy similar to that described above. known in the art; an example of the construction of ScFV Completely human antibodies which recognize a selected dimers is given in Goel et al., (2000) Cancer Research epitope can be generated using a technique referred to as 50 60:6964-6971, which is hereby incorporated by reference in 'guided selection.” In this approach a selected non-human its entirety. Antibody multimers may be purified using any monoclonal antibody, e.g., a mouse antibody, is used to guide suitable method known in the art, including, but not limited the selection of a completely human antibody recognizing the to, size exclusion chromatography. same epitope. (Jespers et al., Bio/technology 12:899-903 A. Polynucleotides Encoding Antibodies (1988)). 55 The invention further provides polynucleotides compris Further, antibodies to the polypeptides of the invention can, ing a nucleotide sequence encoding an antibody of the inven in turn, be utilized to generate anti-idiotype antibodies that tion and fragments thereof. The invention also encompasses "mimic polypeptides of the invention using techniques well polynucleotides that hybridize under stringent or lower strin known to those skilled in the art. (See, e.g., Greenspan & gency hybridization conditions, e.g., as defined Supra, to Bona, FASEBJ 7(5):437-444 (1989) and Nissinoff, J. Immu 60 polynucleotides that encode an antibody, preferably, that spe mol. 147(8):2429-2438 (1991)). For example, antibodies cifically binds to a polypeptide of the invention, preferably, an which bind to and competitively inhibit polypeptide multim antibody that binds to a polypeptide having the amino acid erization and/or binding of a polypeptide of the invention to a sequence of SEQID NO:2. ligand can be used to generate anti-idiotypes that "mimic” the The polynucleotides may be obtained, and the nucleotide polypeptide multimerization and/or binding domain and, as a 65 sequence of the polynucleotides determined, by any method consequence, bind to and neutralize polypeptide and/or its known in the art. For example, if the nucleotide sequence of ligand. Such neutralizing anti-idiotypes or Fab fragments of the antibody is known, a polynucleotide encoding the anti US 8,329,179 B2 73 74 body may be assembled from chemically synthesized oligo Acad. Sci. 81:851-855; Neuberger et al., 1984, Nature 312: nucleotides (e.g., as described in Kutmeier et al., BioTech 604-608: Takeda et al., 1985, Nature 314:452-454) by splic niques 17:242 (1994)), which, briefly, involves the synthesis ing genes from a mouse antibody molecule of appropriate of overlapping oligonucleotides containing portions of the antigen specificity together with genes from a human anti sequence encoding the antibody, annealing and ligation of 5 body molecule of appropriate biological activity can be used. those oligonucleotides, and then amplification of the ligated As described Supra, a chimeric antibody is a molecule in oligonucleotides by PCR. which different portions are derived from different animal Alternatively, a polynucleotide encoding an antibody may species, such as those having a variable region derived from a be generated from nucleic acid from a suitable source. If a murine monoclonal antibody and a human immunoglobulin clone containing a nucleic acid encoding a particular anti 10 constant region, e.g., humanized antibodies. body is not available, but the sequence of the antibody mol Alternatively, techniques described for the production of ecule is known, a nucleic acid encoding the immunoglobulin single chain antibodies (U.S. Pat. No. 4,694,778; Bird, 1988, may be obtained from a suitable source (e.g., an antibody Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. cDNA library, or a cDNA library generated from, or nucleic Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334: acid, preferably poly A+ RNA, isolated from, any tissue or 15 544-554) can be adapted to produce single chain antibodies. cells expressing the antibody, such as hybridoma cells Single chain antibodies are formed by linking the heavy and selected to express an antibody of the invention) by PCR light chain fragments of the Fv region via an amino acid amplification using synthetic primers hybridizable to the 3' bridge, resulting in a single chain polypeptide. Techniques for and 5' ends of the sequence or by cloning using an oligonucle the assembly of functional Fv fragments in E. coli may also be otide probe specific for the particular gene sequence to iden used (Skerra et al., 1988, Science 242:1038-1041). tify, e.g., a cDNA clone from a cDNA library that encodes the B. Methods of Producing Antibodies antibody. Amplified nucleic acids generated by PCR may The antibodies of the invention can be produced by any then be cloned into replicable cloning vectors using any method known in the art for the synthesis of antibodies, in method well known in the art. particular, by chemical synthesis or preferably, by recombi Once the nucleotide sequence and corresponding amino 25 nant expression techniques. acid sequence of the antibody is determined, the nucleotide Recombinant expression of an antibody of the invention, or sequence of the antibody may be manipulated using methods fragment, derivative or analog thereof, e.g., a heavy or light well known in the art for the manipulation of nucleotide chain of an antibody of the invention, requires construction of sequences, e.g., recombinant DNA techniques, site directed an expression vector containing a polynucleotide that mutagenesis, PCR, etc. (see, for example, the techniques 30 encodes the antibody. Once a polynucleotide encoding an described in Sambrook et al., 1990, Molecular Cloning. A antibody molecule or a heavy or light chain of an antibody, or Laboratory Manual. 2d Ed., Cold Spring Harbor Laboratory, portion thereof (preferably containing the heavy or light Cold Spring Harbor, N.Y. and Ausubel et al., eds., 1998, chain variable domain), of the invention has been obtained, Current Protocols in Molecular Biology, John Wiley & Sons, the vector for the production of the antibody molecule may be NY, which are both incorporated by reference herein in their 35 produced by recombinant DNA technology using techniques entireties), to generate antibodies having a different amino well known in the art. Thus, methods for preparing a protein acid sequence, for example to create amino acid Substitutions, by expressing a polynucleotide containing an antibody deletions, and/or insertions. encoding nucleotide sequence are described herein. Methods In a specific embodiment, the amino acid sequence of the which are well known to those skilled in the art can be used to heavy and/or light chain variable domains may be inspected 40 construct expression vectors containing antibody coding to identify the sequences of the complementarity determining sequences and appropriate transcriptional and translational regions (CDRs) by methods that are well know in the art, e.g., control signals. These methods include, for example, in vitro by comparison to known amino acid sequences of other heavy recombinant DNA techniques, synthetic techniques, and in and light chain variable regions to determine the regions of Vivo genetic recombination. The invention, thus, provides sequence hypervariability. Using routine recombinant DNA 45 replicable vectors comprising a nucleotide sequence encod techniques, one or more of the CDRs may be inserted within ing an antibody molecule of the invention, or a heavy or light framework regions, e.g., into human framework regions to chain thereof, or a heavy or light chain variable domain, humanize a non-human antibody, as described Supra. The operably linked to a promoter. Such vectors may include the framework regions may be naturally occurring or consensus nucleotide sequence encoding the constant region of the anti framework regions, and preferably human framework regions 50 body molecule (see, e.g., PCT Publication WO 86/05807: (see, e.g., Chothia et al., J. Mol. Biol. 278:457-479 (1998) for PCT Publication WO89/01036; and U.S. Pat. No. 5,122,464) a listing of human framework regions). Preferably, the poly and the variable domain of the antibody may be cloned into nucleotide generated by the combination of the framework Such a vector for expression of the entire heavy or light chain. regions and CDRs encodes an antibody that specifically binds The expression vector is transferred to a host cell by con a polypeptide of the invention. Preferably, as discussed Supra, 55 ventional techniques and the transfected cells are then cul one or more amino acid substitutions may be made within the tured by conventional techniques to produce an antibody of framework regions, and, preferably, the amino acid substitu the invention. Thus, the invention includes host cells contain tions improve binding of the antibody to its antigen. Addi ing a polynucleotide encoding an antibody of the invention, or tionally, Such methods may be used to make amino acid a heavy or light chain thereof, operably linked to a heterolo Substitutions or deletions of one or more variable region cys 60 gous promoter. In preferred embodiments for the expression teine residues participating in an intrachain disulfide bond to of double-chained antibodies, vectors encoding both the generate antibody molecules lacking one or more intrachain heavy and light chains may be co-expressed in the host cell for disulfide bonds. Other alterations to the polynucleotide are expression of the entire immunoglobulin molecule, as encompassed by the present invention and within the skill of detailed below. the art. 65 A variety of host-expression vector systems may be uti In addition, techniques developed for the production of lized to express the antibody molecules of the invention. Such "chimeric antibodies' (Morrison et al., 1984, Proc. Natl. host-expression systems represent vehicles by which the cod US 8,329,179 B2 75 76 ing sequences of interest may be produced and Subsequently leader sequence. This chimeric gene may then be inserted in purified, but also represent cells which may, when trans the adenovirus genome by in vitro or in Vivo recombination. formed or transfected with the appropriate nucleotide coding Insertion in a non-essential region of the viral genome (e.g., sequences, express an antibody molecule of the invention in region E1 or E3) will result in a recombinant virus that is situ. These includebut are not limited to microorganisms such 5 viable and capable of expressing the antibody molecule in as bacteria (e.g., E. coli, B. subtilis) transformed with recom infected hosts. (e.g., see Logan & Shenk, 1984, Proc. Natl. binant bacteriophage DNA, plasmid DNA or cosmid DNA Acad. Sci. USA 81:355-359). Specific initiation signals may expression vectors containing antibody coding sequences; also be required for efficient translation of inserted antibody yeast (e.g., Saccharomyces, Pichia) transformed with recom coding sequences. These signals include the ATG initiation binant yeast expression vectors containing antibody coding 10 codon and adjacent sequences. Furthermore, the initiation sequences; insect cell systems infected with recombinant codon must be in phase with the reading frame of the desired virus expression vectors (e.g., baculovirus) containing anti coding sequence to ensure translation of the entire insert. body coding sequences; plant cell systems infected with These exogenous translational control signals and initiation recombinant virus expression vectors (e.g., cauliflower codons can be of a variety of origins, both natural and Syn mosaic virus, CaMV; tobacco mosaic virus, TMV) or trans 15 thetic. The efficiency of expression may be enhanced by the formed with recombinant plasmid expression vectors (e.g., Ti inclusion of appropriate transcription enhancer elements, plasmid) containing antibody coding sequences; or mamma transcription terminators, etc. (see Bittner et al., 1987, Meth lian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) ods in Enzymol. 153:51-544). harboring recombinant expression constructs containing pro In addition, a host cell strain may be chosen which modu moters derived from the genome of mammalian cells (e.g., lates the expression of the inserted sequences, or modifies and metallothionein promoter) or from mammalian viruses (e.g., processes the gene product in the specific fashion desired. the adenovirus late promoter; the vaccinia virus 7.5K pro Such modifications (e.g., glycosylation) and processing (e.g., moter). Preferably, bacterial cells such as Escherichia coli, cleavage) of protein products may be important for the func and more preferably, eukaryotic cells, especially for the tion of the protein. Different host cells have characteristic and expression of whole recombinant antibody molecule, are 25 specific mechanisms for the post-translational processing and used for the expression of a recombinant antibody molecule. modification of proteins and gene products. Appropriate cell For example, mammalian cells such as Chinese hamster lines or host systems can be chosen to ensure the correct ovary cells (CHO), in conjunction with a vector such as the modification and processing of the foreign protein expressed. major intermediate early gene promoter element from human To this end, eukaryotic host cells which possess the cellular cytomegalovirus is an effective expression system for anti 30 machinery for proper processing of the primary transcript, bodies (Foecking et al., 1986, Gene 45:101; Cockett et al., glycosylation, and phosphorylation of the gene product may 1990, Bio/Technology 8:2). be used. Such mammalian host cells include but are not lim In bacterial systems, a number of expression vectors may ited to CHO, VERY, BHK, HeLa, COS, MDCK, 293, 3T3, be advantageously selected depending upon the use intended W138, and in particular, breast cancer cell lines such as, for for the antibody molecule being expressed. For example, 35 example, BT483, Hss78T, HTB2, BT20 and T47D, and nor when a large quantity of such a protein is to be produced, for mal mammary gland cell line such as, for example, CRL7030 the generation of pharmaceutical compositions of an anti and HS578Bst. body molecule, vectors which direct the expression of high For long-term, high-yield production of recombinant pro levels of fusion protein products that are readily purified may teins, stable expression is preferred. For example, cell lines be desirable. Such vectors include, but are not limited, to the 40 which stably express the antibody molecule may be engi E. coli expression vectorpUR278 (Rutheret al., 1983, EMBO neered. Rather than using expression vectors which contain J. 2: 1791), in which the antibody coding sequence may be viral origins of replication, host cells can be transformed with ligated individually into the vector in frame with the lac Z DNA controlled by appropriate expression control elements coding region so that a fusion protein is produced; plN vec (e.g., promoter, enhancer, sequences, transcription termina tors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101 45 tors, polyadenylation sites, etc.), and a selectable marker. 3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503 Following the introduction of the foreign DNA, engineered 5509); and the like. pGEX vectors may also be used to express cells may be allowed to grow for 1-2 days in an enriched foreign polypeptides as fusion proteins with glutathione media, and then are switched to a selective media. The select S-transferase (GST). In general, such fusion proteins are able marker in the recombinant plasmid confers resistance to soluble and can easily be purified from lysed cells by adsorp 50 the selection and allows cells to stably integrate the plasmid tion and binding to a matrix glutathione-agarose beads fol into their chromosomes and grow to form foci which in turn lowed by elution in the presence of free glutathione. The can be cloned and expanded into cell lines. This method may pGEX vectors are designed to include thrombin or factor Xa advantageously be used to engineer cell lines which express protease cleavage sites so that the cloned target gene product the antibody molecule. Such engineered cell lines may be can be released from the GST moiety. 55 particularly useful in screening and evaluation of compounds In an insect system, Autographa Californica nuclear poly that interact directly or indirectly with the antibody molecule. hedrosis virus (AcNPV) is used as a vector to express foreign A number of selection systems may be used, including but genes. The virus grows in Spodoptera frugiperda cells. The not limited to the herpes simplex virus thymidine kinase antibody coding sequence may be cloned individually into (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine non-essential regions (for example the polyhedrin gene) of 60 phosphoribosyltransferase (Szybalska & Szybalski, 192, the virus and placed under control of an AcNPV promoter (for Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphori example the polyhedrin promoter). bosyltransferase (Lowy et al., 1980, Cell 22:817) genes can In mammalian host cells, a number of viral-based expres be employed in tha-, hgprt- or aprt-cells, respectively. Also, sion systems may be utilized. In cases where an adenovirus is antimetabolite resistance can be used as the basis of selection used as an expression vector, the antibody coding sequence of 65 for the following genes: dhfr, which confers resistance to interest may be ligated to an adenovirus transcription/trans methotrexate (Wigler et al., 1980, Natl. Acad. Sci. USA lation control complex, e.g., the late promoter and tripartite 77:357: O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA US 8,329,179 B2 77 78 78:1527); gpt, which confers resistance to mycophenolic acid bodies may be specific for polypeptides (or portion thereof, (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA preferably at least 10, 20 or 50 amino acids of the polypep 78:2072); neo, which confers resistance to the aminoglyco tide) of the present invention. For example, antibodies may be side G-418 Clinical Pharmacy 12:488-505; Wu and Wu, used to target the polypeptides of the present invention to 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Phar- 5 particular cell types, either in vitro or in vivo, by fusing or macol. Toxicol. 32:573-596; Mulligan, 1993, Science 260: conjugating the polypeptides of the present invention to anti 926-932; and Morgan and Anderson, 1993, Ann. Rev. Bio bodies specific for particular cell surface receptors. Alterna chem. 62:191-217; May, 1993, TIBTECH 11(5):155-215): tively, antibodies of the present invention may be used to and hygro, which confers resistance to hygromycin (Santerre target conjugated polypeptides and/or compounds to particu et al., 1984, Gene 30:147). Methods commonly known in the 10 lar cell types, either in vitro or in Vivo, by fusing or conjugat art of recombinant DNA technology which can be used are ing the antibodies of the present invention to the polypeptides described in Ausubel et al. (eds.), 1993, Current Protocols in and/or compounds to be targeted. Molecular Biology, John Wiley & Sons, NY: Kriegler, 1990, Antibodies fused or conjugated to the polypeptides of the Gene Transfer and Expression, A Laboratory Manual, Stock present invention may also be used in in vitro immunoassays ton Press, NY; and in Chapters 12 and 13, Dracopoli et al. 15 and purification methods using methods known in the art. (eds), 1994, Current Protocols in Human Genetics, John Also, antibodies of the present invention fused or conjugated Wiley & Sons, NY.; Colberre-Garapin et al., 1981, J. Mol. to polypeptides and/or compounds may be used in in vitro Biol. 150:1, which are incorporated by reference herein in immunoassays and purification methods using methods their entireties. known in the art. See e.g., Harbor et al., supra, and PCT The expression levels of an antibody molecule can be 20 publication WO 93/21232; EP 439,095; Naramura et al., increased by vector amplification (for a review, see Bebbing Immunol. Lett. 39:91-99 (1994); U.S. Pat. No. 5,474,981; ton and Hentschel. The use of vectors based on gene amplif Gillies et al., PNAS89:1428-1432 (1992); Fellet al., J. Immu cation for the expression of cloned genes in mammalian cells mol. 146:2446-2452 (1991), which are incorporated by refer in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). ence in their entireties. When a marker in the vector system expressing antibody is 25 The present invention further includes compositions com amplifiable, increase in the level of inhibitor present in culture prising the polypeptides, including antibodies, of the present of host cell will increase the number of copies of the marker invention fused or conjugated to antibody domains other than gene. Since the amplified region is associated with the anti the variable regions. Furthermore, the present invention body gene, production of the antibody will also increase includes compositions comprising the antibodies of the (Crouse et al., 1983, Mol. Cell. Biol. 3:257). 30 present invention fused or conjugated to heterologous anti The host cell may be co-transfected with two expression body domains other than variable regions. For example, the vectors of the invention, the first vector encoding a heavy polypeptides including antibodies of the present invention chain derived polypeptide and the second vector encoding a may be fused or conjugated to a heterologous antibody Fc light chain derived polypeptide. The two vectors may contain region, or portion thereof. identical selectable markers which enable equal expression of 35 The antibody portion fused to a polypeptide and/or anti heavy and light chain polypeptides. Alternatively, a single body of the present invention may comprise the constant vector may be used which encodes both heavy and light chain region, hinge region, CH1 domain, CH2 domain, and CH3 polypeptides. In Such situations, the light chain should be domain or any combination of whole domains or portions placed before the heavy chain to avoid an excess of toxic free thereof. The polypeptides, including antibodies, may also be heavy chain (Proudfoot, 1986, Nature 322:52: Kohler, 1980, 40 fused or conjugated to the above antibody portions to form Proc. Natl. Acad. Sci. USA 77:2197). The coding sequences multimers. For example, Fc portions fused to the polypep for the heavy and light chains may comprise cDNA or tides, including antibodies, of the present invention can form genomic DNA. dimers through disulfide bonding between the Fc portions. Once an antibody molecule of the invention has been Higher multimeric forms can be made by fusing the polypep recombinantly expressed, it may be purified by any method 45 tides, including antibodies of the present invention, to por known in the art for purification of an immunoglobulin mol tions of IgA and IgM. Methods for fusing or conjugating the ecule, for example, by chromatography (e.g., ion exchange, polypeptides, including antibodies, of the present invention to affinity, particularly by affinity for the specific antigen after antibody portions are known in the art. See, e.g., U.S. Pat. Protein A, and sizing column chromatography), centrifuga Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053: 5,447,851: tion, differential solubility, or by any other standard technique 50 5,112,946; EP307434; EP 367,166; PCT publications WO for the purification of proteins. 96/04388; WO91/06570; Ashkenazi et al., Proc. Natl. Acad. C. Antibody Conjugates Sci. USA 88:10535-10539 (1991); Zheng et al., J. Immunol. The present invention encompasses antibodies recombi 154:5590-5600 (1995); and Vilet al., Proc. Natl. Acad. Sci. nantly fused or chemically conjugated (including both USA 89:11337-11341 (1992) (said references incorporated covalently and non-covalently conjugations) to a polypeptide 55 by reference in their entireties). (or portion thereof, preferably at least 10, 20 or 50 amino As discussed, Supra, the polypeptides, including antibod acids of the polypeptide) of the present invention to generate ies, of the present invention may be fused or conjugated to the fusion proteins. Also encompassed are antibodies of the above antibody portions to increase the in vivo half life of the invention recombinantly fused or chemically conjugated (in polypeptides or for use in immunoassays using methods cluding both covalently and non-covalently conjugations) to 60 known in the art. Further, the polypeptides, including anti a polypeptide (or portion thereof, preferably at least 10, 20 or bodies, of the present invention may be fused or conjugated to 50 amino acids of the polypeptide) to generate fusion pro the above antibody portions to facilitate purification. One teins. The fusion does not necessarily need to be direct, but reported example describes chimeric proteins consisting of may occur through linker sequences. The antibodies may be the first two domains of the human CD4-polypeptide and specific for antigens other than polypeptides (or portion 65 various domains of the constant regions of the heavy or light thereof, preferably at least 10, 20 or 50 amino acids of the chains of mammalian immunoglobulins. (EP394,827; Trau polypeptide) of the present invention. Furthermore, the anti necker et al., Nature 331:84-86 (1988). US 8,329,179 B2 79 80 The polypeptides, including antibodies, of the present nylamine fluorescein, dansyl chloride or phycoerythrin; an invention fused or conjugated to an antibody having disul example of a luminescent material includes luminol; fide-linked dimeric structures (due to the IgG) may also be examples of bioluminescent materials include luciferase, more efficient in binding and neutralizing, agonizing and/or luciferin, and acquorin; and examples of suitable radioactive antagonizing other molecules, than the monomeric Secreted 5 material include l’I, I, '''In or Tc. antibody, protein, antibody fragment or protein fragment Further, an antibody or fragment thereof may be conju alone. (Fountoulakis et al., J. Biochem. 270:3958-3964 gated to a therapeutic moiety Such as a cytotoxin, e.g., a (1995)). In many cases, the heterologous Fc part in a fusion cytostatic or cytocidal agent, a therapeutic agent or a radio protein is beneficial in therapy and diagnosis, and thus can active metalion. A cytotoxin or cytotoxic agent includes any result in, for example, improved pharmacokinetic properties. 10 (EPA 232.262). Alternatively, deleting the Fc part after the agent that is detrimental to cells. Examples include pacli fusion protein has been expressed, detected, and purified, taxol, cytochalasin B, gramnicidin D, ethidium bromide, would be desired. For example, the Fc portion may hinder emetine, mitomycin, etoposide, tenoposide, Vincristine, Vin therapy and diagnosis if the fusion protein is used as an blastine, colchicin, doxorubicin, daunorubicin, dihydroxy antigen for immunizations. In drug discovery, for example, 15 anthracin dione, mitoxantrone, mithramycin, actinomycin D, human proteins, such as hIL-5 receptor, have been fused with 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, Fc portions for the purpose of high-throughput Screening lidocaine, propranolol, and puromycin and analogs or assays to identify antagonists of hiL-5. (See, D. Bennett et al., homologs thereof. Therapeutic agents include, but are not J Molecular Recognition 8:52-58 (1995); K. Johanson et al., limited to, antimetabolites (e.g., methotrexate, 6-mercap J. Biol. Chem. 270:9459-9471 (1995). topurine, 6-thioguanine, cytarabine, 5-fluorouracil decarba The present invention further includes compositions com Zine), alkylating agents (e.g., mechlorethamine, thioepa prising the antibodies of the present invention fused or con chlorambucil, melphalan, carmustine (BSNU) and lomustine jugated to human serum albuminto increase the in vivo half (CCNU), cyclothosphamide, busulfan, dibromomannitol, life of the antibodies or for use in immunoassays using streptozotocin, mitomycin C, and cis-dichlorodiamine plati methods known in the art. Further, the antibodies of the 25 num (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin present invention may be fused or conjugated to human serum (formerly daunomycin) and doxorubicin), antibiotics (e.g., albumin to facilitate purification. In many cases, the human dactinomycin (formerly actinomycin), bleomycin, mithra serum albumin part in a fusion protein is beneficial in therapy mycin, and anthramycin (AMC)), and anti-mitotic agents and diagnosis, and thus can result in, for example, improved (e.g., Vincristine and vinblastine). pharmacokinetic properties. See e.g., U.S. Pat. No. 5,876, 30 The conjugates of the invention can be used for modifying 969, EP Patent 0413622, and U.S. Pat. No. 5,766,883, herein a given biological response, the therapeutic agent or drug incorporated by reference in their entirety. moiety is not to be construed as limited to classical chemical Moreover, the antibodies or fragments thereof of the therapeutic agents. For example, the drug moiety may be a present invention can be fused to marker sequences, such as a protein or polypeptide possessing a desired biological activ peptide to facilitates their purification. In preferred embodi 35 ity. Such proteins may include, for example, a toxin Such as ments, the marker amino acid sequence is a hexa-histidine abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a peptide, such as the tag provided in a pCE vector (QIAGEN, protein such as tumor necrosis factor, a-interferon, B-inter Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), among feron, nerve growth factor, platelet derived growth factor, others, many of which are commercially available. As tissue plasminogen activator, a thrombotic agent or an anti described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821 40 angiogenic agent, e.g., angiostatin or endostatin; or, biologi 824 (1989), for instance, hexa-histidine provides for conve cal response modifiers such as, for example, lymphokines, nient purification of the fusion protein. Other peptide tags interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 useful for purification include, but are not limited to, the (“IL-6”), granulocyte macrophage colony stimulating factor “HA' tag, which corresponds to an epitope derived from the (“GM-CSF), granulocyte colony stimulating factor (“G- influenza hemagglutinin protein (Wilson et al., Cell 37:767 45 CSF), or other growth factors. (1984)) and the “flag” tag. Antibodies may also be attached to solid Supports, which The present invention further encompasses antibodies or are particularly useful for immunoassays or purification of fragments thereof conjugated to a diagnostic or therapeutic the target antigen. Such solid Supports include, but are not agent. The antibodies can be used diagnostically to, for limited to, glass, cellulose, polyacrylamide, nylon, polysty example, monitor the development or progression of a tumor 50 rene, polyvinyl chloride or polypropylene. as part of a clinical testing procedure to, e.g., determine the Techniques for conjugating Such therapeutic moiety to efficacy of a given treatment and/or prevention regimens. antibodies are well known, see, e.g., Arnon et al., “Mono Detection can be facilitated by coupling the antibody to a clonal Antibodies For Immunotargeting Of Drugs. In Cancer detectable substance. Examples of detectable substances Therapy”, in Monoclonal Antibodies And Cancer Therapy, include various enzymes, prosthetic groups, fluorescent 55 Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); materials, luminescent materials, bioluminescent materials, Hellstrom et al., “Antibodies For Drug Delivery', in Con radioactive materials, positron emitting metals using various trolled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. positron emission tomographies, and nonradioactive para 623-53 (Marcel Dekker, Inc. 1987); Thorpe, “Antibody Car magnetic metal ions. See, for example, U.S. Pat. No. 4,741, riers Of Cytotoxic Agents. In Cancer Therapy: A Review', in 900 for metal ions which can be conjugated to antibodies for 60 Monoclonal Antibodies '84. Biological And Clinical Appli use as diagnostics according to the present invention. cations, Pinchera et al. (eds.), pp. 475-506 (1985): 'Analysis, Examples of Suitable enzymes include horseradish peroxi Results, And Future Prospective Of The Therapeutic Use Of dase, alkaline phosphatase, 3-galactosidase, or acetylcho Radiolabeled Antibody In Cancer Therapy”, in Monoclonal linesterase; examples of suitable prosthetic group complexes Antibodies For Cancer Detection And Therapy, Baldwin et al. include streptavidin/biotin and avidin/biotin; examples of 65 (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., suitable fluorescent materials include umbelliferone, fluores “The Preparation And Cytotoxic Properties Of Antibody cein, fluorescein isothiocyanate, rhodamine, dichlorotriazi Toxin Conjugates. Immunol. Rev. 62:119-58 (1982). US 8,329,179 B2 81 82 Alternatively, an antibody can be conjugated to a second to any of a number of amino acid residues. Furthermore, one antibody to forman antibody heteroconjugate as described by may specifically desire antibodies chemically modified at the Segal in U.S. Pat. No. 4,676.980, which is incorporated N-terminus. herein by reference in its entirety. Polyethylene glycol may be attached to the antibody either An antibody, with or without a therapeutic moiety conju directly or by an intervening linker. Linkerless systems for gated to it, administered alone or in combination with cyto attaching polyethylene glycol to proteins are described in toxic factor(s) and/or cytokine(s) can be used as a therapeutic. Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 Additionally, antibodies of the invention may be modified (1992); Francis et al., Intern. J of Hematol. 68:1-18 (1998); by post-translational modifications encompassed including, U.S. Pat. No. 4,002,531; U.S. Pat. No. 5,349,052; WO 10 95/06058; and WO 98/32466, the disclosures of each of for example, N-linked or O-linked carbohydrate chains, pro which are incorporated herein by reference. cessing of N-terminal or C-terminal ends, attachment of As described Supra, polyethylene glycol can also be chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, attached to antibodies using a number of different intervening and addition or deletion of an N-terminal methionine residue linkers. See e.g., U.S. Pat. No. 5,612,460, the entire disclo 15 sure of which is incorporated herein by reference. as a result of procaryotic host cell expression. The number of polyethylene glycol moieties attached to Also provided by the invention are chemically modified eachantibody of the invention (i.e., the degree of substitution) antibody derivatives, which may provide additional advan may also vary. For example, the pegylated antibodies of the tages such as increased solubility, stability and circulating invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9. time of the antibody, or decreased immunogenicity (see, U.S. 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Pat. No. 4,179,337). The chemical moieties for derivation Similarly, the average degree of Substitution within ranges may be selected from water soluble polymers such as poly such as 1-3, 2-4, 3-5,4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, ethylene glycol, ethylene glycol/propylene glycol copoly 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 mers, carboxymethylcellulose, dextran, polyvinyl alcohol polyethylene glycol moieties per antibody molecule. Meth and the like. The antibodies may be modified at random 25 ods for determining the degree of Substitution are discussed, positions within the molecule, or at predetermined positions for example, in Delgado et al., Crit. Rev. Thera. Drug Carrier within the molecule and may include one, two, three or more Sys. 9:249-304 (1992). attached chemical moieties. As described supra, antibodies may be modified by natural The polymer may be of any molecular weight, and may be processes, such as posttranslational processing, or by chemi 30 cal modification techniques, which are well known in the art. branched or unbranched. For polyethylene glycol, the pre It will be appreciated that the same type of modification may ferred molecular weight is between about 1 kDa and about be present in the same or varying degrees at several sites in a 100 kDa (the term “about indicating that in preparations of given antibody. Also, a given antibody may contain many polyethylene glycol, Some molecules will weigh more, some types of modifications. less, than the Stated molecular weight) for ease in handling 35 Modifications may include acetylation, acylation, ADP and manufacturing. Other sizes may be used, depending on ribosylation, amidation, covalent attachment of flavin, cova the desired therapeutic profile (e.g., the duration of Sustained lent attachment of a heme moiety, covalent attachment of a release desired, the effects, if any on biological activity, the nucleotide or nucleotide derivative, covalent attachment of a ease in handling, the degree or lack of antigenicity and other lipid or lipid derivative, covalent attachment of phosphati known effects of the polyethylene glycol to a therapeutic 40 dylinositol, cross-linking, cyclization, disulfide bond forma protein or analog). For example, the polyethylene glycol may tion, demethylation, formation of covalent cross-links, for have an average molecular weight of about 200, 500, 1000, mation of cysteine, formation of pyroglutamate, formylation, 1500, 2000, 2500,3000, 3500,4000, 4500, 5000, 5500, 6000, gamma-carboxylation, glycosylation, GPI anchor formation, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, hydroxylation, iodination, methylation, myristoylation, oxi 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 45 dation, pegylation, proteolytic processing, phosphorylation, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, prenylation, racemization, selenoylation, Sulfation, transfer 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, RNA mediated addition of amino acids to proteins such as 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, arginylation, and ubiquitination. (See, for instance, PRO 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa. TEINS STRUCTURE AND MOLECULAR PROPER As noted above, the polyethylene glycol may have a 50 TIES, 2nd Ed., T. E. Creighton, W.H. Freeman and Company, branched structure. Branched polyethylene glycols are New York (1993); POSTTRANSLATIONAL COVALENT described, for example, in U.S. Pat. No. 5,643,575; Morpurgo MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Aca et al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev demic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth et al., Nucleosides Nucleotides 18:2745-2750 (1999); and Enzymol 182:626-646 (1990); Rattan et al., Ann NY Acad Caliceti et al., Bioconjug. Chem. 10:638-646 (1999), the dis 55 Sci G63:48-62 (1992)). closures of each of which are incorporated herein by refer D. Assays for Antibody Binding CCC. The antibodies of the invention may be assayed for immu The polyethylene glycol molecules (or other chemical nospecific binding by any method known in the art. The moieties) should be attached to the antibody with consider immunoassays which can be used include but are not limited ation of effects on binding specificity and agonistic and/or 60 to competitive and non-competitive assay systems using tech antagonistic properties of the antibody. niques such as western blots, radioimmunoassays, ELISA As described Supra, there are a number of attachment meth (enzyme linked immunosorbent assay), 'sandwich’ immu ods available to those skilled in the art, e.g., EPO 401 384, noassays, immunoprecipitation assays, precipitin reactions, herein incorporated by reference (coupling PEG to G-CSF), gel diffusion precipitin reactions, immunodiffusion assays, see also Malik et al., Exp. Hematol. 20:1028-1035 (1992) 65 agglutination assays, complement-fixation assays, immuno (reporting pegylation of GM-CSF using tresyl chloride) and radiometric assays, fluorescent immunoassays, protein A polyethylene glycol may be attached to antibodies via linkage immunoassays, to name but a few. Such assays are routine and US 8,329,179 B2 83 84 well known in the art (see, e.g., Ausubel et al., eds, 1994, regarding ELISAS see, e.g., Ausubel et al., eds, 1994, Current Current Protocols in Molecular Biology, Vol. 1, John Wiley & Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Sons, Inc., New York, which is incorporated by reference Inc., New York at 11.2.1. herein in its entirety). Exemplary immunoassays are The binding affinity of an antibody to an antigen and the described briefly below (but are not intended by way of limi 5 off-rate of an antibody-antigen interaction can be determined tation). by competitive binding assays. One example of a competitive Immunoprecipitation protocols generally comprise lysing binding assay is a radioimmunoassay comprising the incuba a population of cells in a lysis buffer such as RIPA buffer (1% tion of labeled antigen (e.g., H or 'I) with the antibody of NP40 or TritonX-100, 1% sodium deoxycholate, 0.1% SDS, interest in the presence of increasing amounts of unlabeled 0.15 MNaCl, 0.01 M sodium phosphate at pH 7.2, 1% Tray 10 slol) Supplemented with protein phosphatase and/or protease antigen, and the detection of the antibody bound to the labeled inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), antigen. The affinity of the antibody of interest for a particular adding the antibody of interest to the cell lysate, incubating antigen and the binding off-rates can be determined from the for a period of time (e.g., 1-4 hours) at 4°C., adding protein data by scatchard plot analysis. Competition with a second A and/or protein G Sepharose beads to the cell lysate, incu 15 antibody can also be determined using radioimmunoassays. bating for about an hour or more at 4°C., washing the beads In this case, the antigen is incubated with antibody of interest in lysis buffer and resuspending the beads in SDS/sample is conjugated to a labeled compound (e.g., H or 'I) in the buffer. The ability of the antibody of interest to immunopre presence of increasing amounts of an unlabeled second anti cipitate a particular antigen can be assessed by, e.g., western body. blot analysis. One of skill in the art would be knowledgeable E. Antibody Based Therapies as to the parameters that can be modified to increase the The present invention is further directed to antibody-based binding of the antibody to an antigen and decrease the back therapies which involve administering antibodies of the ground (e.g., pre-clearing the cell lysate with Sepharose invention to an animal, preferably a mammal, and most pref beads). For further discussion regarding immunoprecipita erably a human, patient for treating and/or preventing one or tion protocols see, e.g., Ausubel et al., eds, 1994, Current 25 more of the disorders or conditions described herein. Thera Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, peutic compounds of the invention include, but are not limited Inc., New York at 10.16.1. to, antibodies of the invention (including fragments, analogs Western blot analysis generally comprises preparing pro and derivatives thereofas described herein) and nucleic acids tein samples, electrophoresis of the protein samples in a poly encoding antibodies of the invention (including fragments, acrylamide gel (e.g., 8%-20% SDS-PAGE depending on the 30 analogs and derivatives thereofas described herein). molecular weight of the antigen), transferring the protein While not intending to be bound to theory, DR4 receptors sample from the polyacrylamide gel to a membrane such as are believed to induce programmed cell death by a process nitrocellulose, PVDF or nylon, blocking the membrane in which involves the association/cross-linking of death blocking solution (e.g., PBS with 3% BSA or non-fat milk), domains between different receptor molecules. Further, DR4 washing the membrane in washing buffer (e.g., PBS-Tween 35 ligands (e.g., TRAIL) which induce DR4 mediated pro 20), blocking the membrane with primary antibody (the anti grammed cell death are believed to function by causing the body of interest) diluted in blocking buffer, washing the association/cross-linking of DR4 death domains. Thus, membrane in washing buffer, blocking the membrane with a agents (e.g., antibodies) which prevent association/cross secondary antibody (which recognizes the primary antibody, linking of DR4 death domains will prevent DR4 mediated e.g., an anti-human antibody) conjugated to an enzymatic 40 programmed cell death, and agents (e.g., antibodies) which Substrate (e.g., horseradish peroxidase or alkaline phos facilitate the association/cross-linking of DR4 death domains phatase) or radioactive molecule (e.g., “P or 'I) diluted in will induce DR4 mediated programmed cell death. blocking buffer, washing the membrane in wash buffer, and As noted above, DR4 receptors have been shown to bind detecting the presence of the antigen. One of skill in the art TRAIL. DR4 receptors are also known to be present in a would be knowledgeable as to the parameters that can be 45 number of tissues and on the surfaces of a number of cell modified to increase the signal detected and to reduce the types. These tissues and cell types include amniotic cells, background noise. For further discussion regarding western heart, liver cancer cells, kidney, leukocytes, activated T-cells, blot protocols see, e.g., Ausubel et al., eds, 1994, Current K562 cells (an erythroleukemia cell line) plus PMA, W138 Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, cells (a human lung fibroblast cell line). Th2 cells (lympho Inc., New York at 10.8.1. 50 cytes), human tonsils, and CD34 depleted buffy coat cells of ELISAS comprise preparing antigen, coating the well of a cord blood. Further, as explained in more detail below, 96 well microtiter plate with the antigen, adding the antibody TRAIL has been shown to induce apoptosis and to inhibit the of interest conjugated to a detectable compound Such as an growth of tumor cells in vivo. Additionally, TRAIL activities enzymatic Substrate (e.g., horseradish peroxidase or alkaline are believed to be modulated, at least in part, through inter phosphatase) to the well and incubating for a period of time, 55 action with DR4 and DR5 receptors. and detecting the presence of the antigen. In ELISAS the TRAIL is a member of the TNF family of cytokines which antibody of interest does not have to be conjugated to a has been shown to induce apoptotic cell death in a number of detectable compound; instead, a second antibody (which rec tumor cell lines and appears to mediate its apoptosis inducing ognizes the antibody of interest) conjugated to a detectable effects through interaction with DR4 and DR5 receptors. compound may be added to the well. Further, instead of 60 These death domain containing receptors are believed to form coating the well with the antigen, the antibody may be coated membrane-bound self-activating signaling complexes which to the well. In this case, a second antibody conjugated to a initiate apoptosis through cleavage of caspases. detectable compound may be added following the addition of In addition to DR4 and DR5 receptors, TRAIL also binds the antigen of interest to the coated well. One of skill in the art to several receptors proposed to be “decoy receptors, DcR2 would be knowledgeable as to the parameters that can be 65 (a receptor with a truncated death domain), DcR1 (a GP1 modified to increase the signal detected as well as other anchored receptor), and OPG (a secreted protein which binds variations of ELISAs known in the art. For further discussion to another member of the TNF family, RANKL). US 8,329,179 B2 85 86 Further, recent studies have shown that the rank-order of the association between DR4 receptor death domains) are affinities of TRAIL for the recombinant soluble forms of its DR4 agonists, and antibodies which inhibit DR4 receptor receptors is strongly temperature dependent. In particular, at activities (e.g., by blocking the binding of TRAIL and/or 37° C., DR5 has the highest affinity for TRAIL and OPG preventing the association between DR4 receptor death having the lowest affinity. domains) are DR4 antagonists. The DR4 and DR5 receptor genes, as well as genes encod Antibodies of the invention which function as agonists and ing two decoy receptors, have been shown to be located on antagonists of DR4 receptors include antigen-binding anti human chromosome 8p21-22. Further, this region of the body fragments such as Fab and F(ab')2 fragments, Fd, single human genome is frequently disrupted in head and neck can chain Fvs (scFv), disulfide-linked Fvs (sdFv) and fragments CS. 10 comprising either a V or V. domain, as well as polyclonal, It has recently been found that the Falu nasopharyngeal monoclonal and humanized antibodies. Divalent antibodies cancer cell line contains an abnormal chromosome 8p21-22 are preferred as agonists. Each of these antigen-binding anti region. (Ozoren et al., Int. J. Oncol. 16:917-925 (2000).) In body fragments and antibodies are described in more detail particular, a homozygous deletion involving DR4, but not elsewhere herein. DR5, has been found in these cells. (Ozoren et al., Int. J. 15 In view of the above, antibodies of the invention, as well as Oncol. 16:917-925 (2000).) The homozygous loss within the other agonists, are useful for stimulating DR4 death domain DR4 receptor gene in these Falu cells encompasses the DR4 activity to promote apoptosis in cells which express DR4 receptor death domain. This disruption of the DR4 receptor receptors (e.g., cancer cells). Antibodies of this type are use death domain is associated with resistance to TRAIL-medi ful for prevention and/or treating diseases and conditions ated cytotoxicity. Further, re-introduction of a wild-type DR4 associated with increased cell survival and/or insensitivity to receptor gene has been shown to both lead to apoptosis and apoptosis-inducing agents (e.g., TRAIL), Such as Solid tissue restoration of TRAIL sensitivity of Falu cells. (Ozoren et al., cancers (e.g., skin cancer, head and neck tumors, breast Int. J. Oncol. 16:917-925 (2000).) These data indicate that the tumors, endothelioma, lung cancer, osteoblastoma, osteo DR4 receptor gene may be inactivated in human cancers and clastoma, and Kaposi's sarcoma) and leukemias. DR4 receptor gene disruption may contribute to resistance to 25 Antagonists of the invention (e.g., anti-DR4 antibodies) TRAIL therapy. It is expected that similar results would be function by preventing DR4 mediated apoptosis and are use found in cells having analogous deletions in the DR5 gene. ful for preventing and/or treating diseases associated with It has also been shown that overexpression of the cytoplas increased apoptotic cell death. Examples of Such diseases mic domain of the DR4 receptor in human breast, lung, and include diabetes mellitus, AIDS, neurodegenerative disor colon cancer cell lines leads to p53-independent apoptotic 30 ders, myelodysplastic syndromes, ischemic injury, toxin-in cell death which involves the cleavage of caspases. (Xu et al., duced liver disease, septic shock, cachexia and anorexia. Biochem. Biophys. Res. Commun. 269: 179-190 (2000).) Fur As noted above, DR4 receptors are present on the surfaces ther, DR4 cytoplasmic domain overexpression has also been of T-cells. Thus, agonists of the invention (e.g., anti-DR4 shown to result in cleavage of both poly(ADP-ribose) poly receptor antibodies) are also useful for inhibiting T-cell medi merase (PARP) and a DNA fragmentation factor (i.e., ICAD 35 ated immune responses, as well as preventing and/or treating DFF45). (Xu et al., Biochem. Biophys. Res. Commun. 269: diseases and conditions associated with increased T-cell pro 179-190 (2000).) In addition, despite similar levels of DR4 liferation. Diseases and conditions associated with T-cell cytoplasmic domain protein as compared to cancer cells mediated immune responses and increased T-cell prolifera tested, normal lung fibroblasts have been shown to be resis tion include graft-V-host responses and diseases, osteoarthri tant to DR4 cytoplasmic domain overexpression and show no 40 tis, psoriasis, septicemia, inflammatory bowel disease, evidence of caspase-cleavage. (Xu et al., Biochem. Biophys. inflammation in general, autoimmune diseases, and T-cell Res. Commun. 269: 179-190 (2000).) Again, similar results leukemias. are expected with cells that overexpress the cytoplasmic When an agonist of the invention is administered to an domain of DR5. Thus, the cytoplasmic domains of the DR4 individual for the treatment and/or prevention of a disease or and DR5 receptors are useful as agents for inducing apopto 45 condition associated with increased T-cell populations or sis, for example, in cancer cells. increased cell proliferation (e.g., cancer), the antagonist may Further, overexpression of the cyclin-dependent kinase be co-administered with another agent which induces apop inhibitor p21(WAF1/CIP1), as well as the N-terminal 91 tosis (e.g., TRAIL) or otherwise inhibits cell proliferation amino acids of this protein, has cell cycle-inhibitory activity (e.g., an anti-cancer drug). Combination therapies of this and inhibits DR4 cytoplasmic domain-dependent caspase 50 nature, as well as other combination therapies, are discussed cleavage. Thus, DR4 receptors are also involved in the regu below in more detail. lation of cell cycle progression. As above, similar results are Further, antagonists of the invention (e.g., anti-DR4 recep expected with the DR5 receptor. Thus, the DR4 and DR5 tor antibodies) are also useful for enhancing T-cell mediated receptors, as well as agonists and antagonists of these recep immune responses, as well as preventing and/or treating dis tors, are useful for regulating cell cycle progression. 55 eases and conditions associated with decreased T-cell prolif Antibodies which bind to DR4 receptors are useful for eration. Antibodies of the invention which block the binding treating and/or preventing diseases and conditions associated of DR4 receptor ligands to DR4 receptors or interfere with with increased or decreased DR4-induced apoptotic cells DR4 receptor conformational changes associated with mem death. Further, these antibodies vary in the effect they have on brane signal transduction can inhibit DR4 mediated T-cell DR4 receptors. These effects differ based on the specific 60 apoptosis. The inhibition of DR4-mediated apoptosis can, for portions of the DR4 receptor to which the antibodies bind, the examples, either result in an increase in the expansion rate of three-dimensional conformation of the antibody molecules in vivo T-cell populations or prevent a decrease in the size of themselves, and/or the manner in which they interact with the Such populations. Thus, antagonists of the invention can be DR4 receptor. Thus, antibodies which bind to the extracellu used to prevent and/or treat diseases or conditions associated lar domain of a DR4 receptor can either stimulate or inhibit 65 with decreased or decreases in T-cell populations. Examples DR4 activities (e.g., the induction of apoptosis). Antibodies of Such diseases and conditions included acquired immune which stimulate DR4 receptor activities (e.g., by facilitating deficiency syndrome (AIDS) and related afflictions (e.g., US 8,329,179 B2 87 88 AIDS related complexes), T-cell immunodeficiencies, radia Therapeutic agents, useful in the treatment, prevention, tion sickness, and T-cell depletion due to radiation and/or amelioration and/or cure of cancers and premalignant condi chemotherapy. tions, with which antibodies of the present invention may be When an antagonist of the invention is administered to an administered, include, for example, biological agents (e.g., individual for the treatment and/or prevention of a disease or inhibitors of signaling pathways, inhibitors of gene transcrip condition associated with decreased T-cell populations, the tion, inhibitors of multi-drug resistance (MDR) mechanisms, antagonist may be co-administered with an agent which acti inhibitors of angiogenesis, inhibitors of matrix metallopro Vates and/or induces lymphocyte proliferation (e.g., a cytok teinases, hormones and hormone antagonists, and com ine). Combination therapies of this nature, as well as other pounds of unknown mechanism), chemotherapeutic agents combination therapies, are discussed below in more detail. 10 (e.g., alkylating agents, antimetabolites, farnesyl transferase Similarly, agonists and antagonists of the invention (e.g., inhibitors, mitotic spindle inhibitors (plant-derived alka anti-DR5 receptor antibodies) are also useful when adminis loids), nucleotide analogs, platinum analogs, and topoi tered alone or in combination with another therapeutic agent Somerase inhibitors), corticosteroids, gene therapies, immu for either inhibiting or enhancing B-cell mediated immune notherapeutic agents (e.g., monoclonal antibodies, cytokines responses, as well as preventing and/or treating diseases and 15 and vaccines), phototherapy, radiosensitizing agents, treat conditions associated with increased or decreased B-cell pro ment Support agents (e.g., anti-emetic agents, analgesic liferation. agents and hematopoietic agents), and other miscellaneous Anti-DR4 antibodies are thus useful for treating and/or drug types. Therapeutic procedures, useful in the treatment, preventing malignancies, premalignant conditions, abnor prevention, amelioration and/or cure of cancers and prema malities, diseases and/or conditions involving tissues and cell lignant conditions, with which agonistic antibodies of the types which express DR4 receptors. Further, malignancies, present invention may be administered, include, for example, premalignant conditions, abnormalities, diseases and/or con but are not limited to, Surgical procedures and radiation thera ditions which can be treated and/or prevented by the induc p1es. tion of programmed cell death in cells which express DR4 In preferred embodiments, agonistic antibodies of the receptors can be treated and/or prevented using DR4 receptor 25 invention are administered in combination with one or more agonists of the invention. Similarly, malignancies, premalig of the above-described therapeutic agents in the treatment, nant conditions, abnormalities, diseases and/or conditions prevention, amelioration and/or cure of cancers and prema which can be treated and/or prevented by inhibiting pro lignant conditions. grammed cell death in cells which express DR4 receptors can In specific embodiments, antibodies of the present inven be treated and/or prevented using DR4 receptorantagonists of 30 tion may be administered in combination with one or more the invention. therapeutic agents useful in the treatment, prevention, ame A number of additional malignancies, premaligant condi lioration and/or cure of cancers and premalignant conditions tions, abnormalities, diseases and/or conditions which can be including, but not limited to, 81 C6 (Anti-tenascin mono treated using the agonists and antagonists of the invention are clonal antibody), 2-chlorodeoxyadenosine, A007 (4-4'-dihy set out elsewhere herein, for example, in the section below 35 droxybenzophenone-2, 4-dinitrophenylhydraZone), entitled “Therapeutics”. Abarelixg (Abarelix-Depot-Mg, PPI-149, R-3827); Abirater The antibodies of the present invention may be used thera one acetates (CB-7598, CB-7630), ABT-627 (ET-1 inhibi peutically in a number of ways. For example, antibodies tor), ABX-EGF (anti-EGFr MAb), Acetyldinaline (CI-994, which bind polynucleotides or polypeptides of the present GOE-5549, GOR-5549, PD-130636), AG-2034 (AG-2024, invention can be administered to an individual (e.g., a human) 40 AG-2032, GARFT glycinamide ribonucleoside transformy either locally or systemically. Further, these antibodies can be lase inhibitor), Alanosine, Aldesleukin (IL-2, Proleukin R), administered alone, in combination with another therapeutic Alemtuzumab(R) (Campath(R), Alitretinoin (Panretin R, LGN agent, or associated with or bound to a toxin. 1057), Allopurinol (AloprimRD, ZyloprimR), Altretamine The present invention provides antibodies, which may be (Hexylen R, hexamethylmelamine, Hexastat(R), Amifostine administered in combination with one or more therapeutic 45 (Ethyol(R), Aminocaminptothecin (9-AC, 9-Aminocamptoth agents and/or procedures in the treatment, prevention, ame ecin, NSC 603071), Aminoglutethimide (Cytadren(R), Ami lioration and/or cure of cancers. In preferred embodiments, nolevulinic acid (Levulan R. Kerastick(R), Aminopterin, agonistic antibodies of the invention may be administered in Amsacrine, AnastroZole (ArimideX(R), Angiostatin, Anna combination with one or more therapeutic agents and/or pro mycin (AR-522, annamycin LF, AroneXOR), Anti-idiotype cedures in the treatment, prevention, amelioration and/or cure 50 therapy (BSAb), Anti-CD 19/CD3 MAb (anti-CD 19/CD3 of cancers and premalignant conditions. scEv, anti-NHL MAb), APC-8015 (Provenge R., Dendritic In a specific embodiment, antibodies or antibody compo cell therapy), Aplidine (Aplidin R, AplidinaR), Arabino sitions of the invention are administered in combination with sylguanine (Ara-G, GW506U78, Nelzarabine(R), Compound DABEGF, a diphtheria toxin fused to Epidermal Growth 506U78), Arsenic trioxide (Trisenox R, ATO, AtriveX(R), Factor. DABs. EGF is described in Shaw et al., (1991) The 55 Avorelin R (Meterelin(R), MF-6001, EP-23904), B43 Journal of Biological Chemistry, 266:21 118-24, which is Genistein (anti-CD19 Ab/genistein conjugate), B43-PAP hereby incorporated by reference in its entirety. In a specific (anti-CD19 Ab/pokeweed antiviral protein conjugate), B7 embodiment, antibodies or antibody compositions of the antibody conjugates, BAY 43-9006 (Raf kinase inhibitor), invention are administered in combination with DABs. EGF BBR 3464, Betathine (Beta-LT), Bevacizumab(R) (Anti for the treatment of cancer, Such as brain cancers and epithe 60 VEGF monoclonal antibody, rhuMAb-VEGF), Bexarotene lial cancers. In a specific embodiment, antibodies orantibody (Targreting, LGD1069), BIBH-1 (Anti-FAP MAb), BIBX compositions of the invention are administered in combina 1382, Biclutamide (Casodex(R), Biricodar dicitrate (Incel(R), tion with DABs. EGF for the treatment of astrocytomas. In a Incel MDR Inhibitor), Bleomycin (BlenoxaneR), BLP-25 specific embodiment, antibodies orantibody compositions of (MUC-1 peptide), BLySantagonists, BMS-214662 (BMS the invention are administered in combination with 65 192331, BMS-193269, BMS-206635), BNP-1350 (BNPI DABs. EGF for the treatment of glioblastyoma multiforme 1100, Karenitecins), Boronated Protoporphyrin Compound (GBM). (PDIT, Photodynarnic Immunotherapy), Bryostatin-1 US 8,329,179 B2 89 90 (Bryostatin Rg, BMY-45618, NSC-339555), Budesonide mustard, D19575, INN), Goserelinacetate (Zoladex(R)), Gra (RhinocortR), Busulfan (Busulfex(R), Myleran R), C225 nisetrori (KytrilTM)), GVAX (GM-CSF gene therapy), Her-2/ (IMC-225, EGFR inhibitor, Anti-EGFr MAb, Cetuximab(R), Neu vaccine, Herceptin R (Trastuzumab(R), Anti-HER-2 C242-DM1 (huC242-DM1), Cabergoline (Dostinex(R), monoclonal antibody, Anti-EGFR-2 MAb), HSPPC-96 (HSP Capecitabine (Xeloda(R), Doxifluridine(R), oral 5-FU), Car cancer vaccine, gp96 heat shock protein-peptide complex), bendazin R (FB-642), Carboplatin (Paraplatin R, CBDCA), HullDiO (anti-HLA-DR MAb, SMART ID10), HumaLYM Carboxyamidotriazole (NSC 609974, CAI, L-651582), Can (anti-CD20 MAb), Hydrocortisone, Hydroxyurea (Hy nustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), CC49 dreaR), Hypericing (VIMRXyn R.), 1-131 Lipidiol R, Ibritu Zeta gene therapy, CEA-cide(R) (Labetuzumab(R), Anti-CEA momab(R) tiuxetan (Zevalin R), Idarubicin (Idamycin R, monoclonal antibody, hMN-14), CeaVacR (MAb 3H1), 10 DMDR, IDA), Ifosfamide (IFEX(R), Imatinib mesylate (STI Celecoxib (Celebrex(R), CEP-701 (KT-5555), Cereport(R) 571, Imatinib.R., Glivece, Gleevec R, Ab1 tyrosine kinase (LobradimilR, RMP-7), Chlorambucil (Leukeran R), CHML inhibitor), INGN-101 (p53 gene therapy/retrovirus), INGN (Cytotropic Heterogeneous Molecular Lipids), Cholecalif 201 (p53 gene therapy/adenovirus), Interferon alpha (Alfaf erol, CI-1033 (Pan-erbB RTK inhibitor), Cilengitide (EMD erone(R), Alpha-IF(R), Interferon alpha 2a (Intron A(R), Inter 12 1974, integrin alphavbeta3 antagonist), Cisplatin (Plati 15 feron gamma (Gamma-interferon, Gamma 1000, Gamma nol R, CDDP), Cisplatin-epinephrine gel (Intral DoseR), IF), Interleukin-2 (ProleiukinR(R), Intoplicine (RP 60475), FocaCist(R), Cisplatin-liposomal (SPI-077), 9-cis retinoic Irinotecan (Camptosar.R, CPT-11, Topotecin R. CaptoCPT acid (9-cRA), Cladribine (2-CdA, LeustatinR), Clofarabine 1), Irofulven (MGI-114, Ivofulvan, Acylfulvene analogue), (chloro-fluoro-ara A), Clonadine hydrochloride (Dura ISIS-2053 (PKC-alpha antisense), ISIS-2503 (Ras anti clon(R), CMB-401 (Anti-PEMMAb?calicheamycin), CMT-3 sense), ISIS-3521 (PKC-alpha antisense), ISIS-5132 (K-ras/ (COL-3, Metastat(R), Cordycepin, Cotara R (chTNT-1/B, raf antisense), Isotretinoin (13-CRA, 13-cis retinoic acid, ''Il-chTNT-1/B), CN-706, CP-358774 (Tarceva(R, OSI AccutaneR), Ketoconazole (NiZoral R), KRN-8602 (MX, 774, EGFR inhibitor), CP-609754, CP IL-4-toxin (IL-4 MY-5. NSC-619003, MX-2), L-778123 (Ras inhibitors), fusion toxin), CS-682, CT-2584 (Apra R, CT-2583, CT-2586, L-asparaginase (Elspar R, Crastinin R, Asparaginase CT-3536), CTP-37 (Avicine(R), hCG blocking vaccine), 25 Medac(R), Kidrolase R), Leflunomide (SU-101, SU-0200), Cyclophosphamide (Cytoxan R. Neosar(R, CTX), Cytarabine Letrozole (Femara(R), Leucovorin (LeucovorinR, Wellcov (Cytosar-US, ara-C, cytosine arabinoside, DepoCyte), D-li orinR), Leuprolide acetate (Viadur R. Lupron(R), Leuprogel(R), monene, DAB389-EGF (EGF fusion toxin), Dacarbazine EligardR), LeuvectinR (cytofectin-i-IL-2 gene, IL-2 gene (DTIC), Daclizumab(R) (Zenapax(R), Dactinomycin (Cos therapy), Levamisole (Ergamisol(R), LiaroZole (Liazal, Lia megenR), Daunomycin (Daunorubicin R, Cerubidine(R). 30 Zol, R-75251, R-85246, Ro-85264), Limb-2 immunotoxin Daunorubicin (DaunoXome(R), Daunorubicin R, Cerubi (anti-CD25 recombinant immuno toxin, anti-TacCFV)-PE38), dine(R), DeaVacR (CEA anti-idiotype vaccine), Decitabine Lometrexol (T-64, T-904064), Lomustine (CCNUR), (5-aza-2'-deoxyytidine), Declopramide (Oxi-104), Denileu CeeNUR), LY-335979, Lym-1 (131-I LYM-1), Lymphoma kin diftitox (Ontak(R), Depsipeptide (FR901228, FK228), vaccine (Genitope), Mannan-MUC1 vaccine, Marimastat(R) Dexamethasone (Decadron(R), Dexrazoxane (Zinecard(R). 35 (BB-2516, TA-2516, MMP inhibitor), MDX447 (MDX-220, Diethylnorspennine (DENSPM), Diethylstilbestrol (DES), BAB-447, EMD-82633, H447, anti-EGFr/FcGammaR1r), Dihydro-5-azacytidine, Docetaxel (Taxotere?R), Taxane(R). Mechlorethamine (Nitrogen Mustard, HN MustargenR), Dolasetron mesylate (AnzemetR), Dolastatin-10 (DOLA-10, Megestrol acetate (Megace(R), Pallace(R), Melphalan NSC-376128), Doxorubicin (Adriamycin R, Doxil R, (L-PAM, Alkeran R, Phenylalanine mustard), Mercaptopu Rubex(R), DPPE, DX-8951f (DX-8951), Edatrexate, EGF 40 rine (6-mercaptopurine, 6-MP), Mesna (MesneXR), Methotr P64kVaccine, Elliott's B Solution(R), EMD-121974, Endosta exate R (MTX, Mexate(R), Folex(R), Methoxsalen (Uvadex(R), tin, Eniluracil (776c85), EO9 (EO1, EO4, EO68, EO70, 2-Methoxyestradiol (2-ME, 2-ME2), Methylprednisolone EO72), Epirubicin (Ellence(R), EPI, 4 epi-doxorubicin), (SolumedrolR), Methyltestosterone (Android-10R, Epratuzumab(R) (Lymphocide(R), humanized anti-CD22, Testred R, Virilon(R), MGV, Mitomycin C (Mitomycin R, HAT), Erythropoietin (EPOR), EpogenR), ProcritR), Estra 45 Mutamycin R, Mito Extra(R), Mitoxantrone (Novantrone.R., mustine (EmcytR), Etanidazole (Radinyl(R), Etoposide phos DHAD), Mitumomab(R) (BEC-2, EMD-60205), Mivobulin phate (Etopophos(R), Etoposide (VP-16, Vepesider), isethionate (CI-980), MN-14 (Anti-CEA immunoradio Exemestane (Aromasin(R), Nikidess.(R), Exetecan mesylate therapy, 'I-MN-14, "Re-MN-14), Motexafin Lutetium (DX-8951, DX-8951f), Exisulind (SAAND, AptosynR), (Lutrin R, Optrin R, Lu-Tex R, lutetium texaphyrin, Lucyn R. cGMP-PDE2 and 5 inhibitor), F19 (Anti-FAP monoclonal 50 Antrin(R), MPV-2213ad (Finrozole(R), MS-209, Muc-1 vac antibody, iodinated anti-FAP MAb), Fadrozole (Afema(R), cine, NaPro Paclitaxel, Nelarabine (Compound 506, U78), Fadrozole hydrochloride, Arensin(R), Fenretinideg (4HPR). Neovastat(R) (AE-941, MMP inhibitor), Neugene compounds Fentanyl citrate (ActiqR), Filgrastim (Neupogen R, G-CSF), (Oncomyc-NG, Resten-NG, mycantisense), Nilutamide (Ni FK-317 (FR-157471, FR-70496), Flavopiridol (HMR-1275), landron(R), NovoMAb-G2 sclv (NovoMAb-G2 IgM), NPI Fly3/flk2 ligand (MobistaR), Fluasterone, Fludarabine (Flu 55 0052 (proteasome inhibitor), O6-benzylguanine (BG, Pro dara R, FAMP), Fludeoxyglucose (F-18(R), Fluorouracil cept(R), Octreotide acetate (Sandostatin LAR(R) Depot), (5-FU, Adrucil(R), Fluoroplex(R), Efudex(R), Flutamide (Eu Odansetron (ZofranR). Onconase (Ranpirinase(R). Onco lexin R), FMdC (KW-2331, MDL-101731), Formestane VAX-CL. OncoVAX-CL Jenner (GA-733-2 vaccine). Onco (Lentaron(R), Fotemustine (Muphoran R, Mustophoran R), VAX-P (OncoVAX-PrPSA), Onyx-015 (p53 gene therapy), FUDR (Floxuridine(R), Fulvestrant (Faslodex(R), G3139 60 Oprelvekin (Neumageo), Orzel (Tegafur--Uracil-Leucov (Genasense(R), GentaAnticode(R), Bcl-2 antisense), Gado orin), Oxaliplatin (Eloxatine(R), EloxatinR), Pacis(R) (BCG, linium texaphyrin (Motexafin gadolinium, Gd-Tex R, live), Paclitaxel (Paxene R, Taxol.R.), Paclitaxel-DHA (Taxo XcytrinR), Galarubicin hydrochloride (DA-125), GBC-590, prexin R), Pamidronate (ArediaR), PC SPES, Pegademase Gastrimmune.R. (Anti-gastrin-17 immunogen, anti-gl7), (Adagen R, Pegademase bovine), Pegaspargase RV (On Gemcitabine (GemtoR), Gemzar R), Gentuzumab-ozogami 65 cospar R), Peldesine (BCX-34, PNP inhibitor), Pemetrexed cin (Mylotargr), GL331, Globo H hexasaccharide (Globo disodium (Alimta R, MTA, multitargeted antifolate, LY H-KLHR), Glufosfamide R& (O-D-glucosyl-isofosfamide 231514), Pentostatin (Nipent(R), 2-deoxycoformycin), Per US 8,329,179 B2 91 92 fosfamide (4-hydroperoxycyclophosphamide, 4-HC), Peril In one embodiment, agonistic antibodies of the present lyl alcohol (perilla alcohol, perillic alcohol, perillol, NSC invention may be administered in combination with a taxane. 64 1066), Phenylbutyrate, Pirarubicin (THP), In another embodiment, agonistic antibodies of the present Pivaloyloxymethyl butyrate (AN-9, Pivanex(R), Porfimer invention may be administered in combination with a taxane sodium (PhotofrinR), Prednisone, Prinomastat(R) (AG-3340, 5 for the treatment of cancers and premalignant conditions that MMP inhibitor), Procarbazine (MatulaneR), PROSTVAC, are resistant to individual chemotherapies. In a specific Providence Portland Medical Center Breast Cancer Vaccine, embodiment, agonistic antibodies of the present invention PS-341 (LDP-341, 26S proteasome inhibitor), PSMA MAb may be administered in combination with Docetaxel (Taxo (Prostate Specific Membrane Antigen monoclonal antibody), tereR). In a specific embodiment, agonistic antibodies of the 10 present invention may be administered in combination with Pyrazoloacridine (NSC-366140, PD-115934), Quinine, Docetaxel (Taxotere?R) for the treatment of cancers and pre R115777 (Zarnestra(R), Raloxifene hydrochloride (Evista R, malignant conditions that are resistant to individual chemo Keoxifene hydrochloride), Raltitrexed (Tomudex(R), therapies ZD-1694), Rebeccamycin, Retinoic acid, R-flurbiprofen In one embodiment, antibodies of the present invention (Flurizan R, E-7869, MPC-7869), RFS-2000 (9-nitrocamp 15 may be administered in combination with a platinum-based tothecan, 9-NC, Rubitecan R), Rituximab(R) (Rituxan R, anti chemotherapeutic. In another embodiment, antibodies of the CD, MAb), RSR-13 (GSJ-61), Satraplatin (BMS-182751, present invention may be administered in combination with a JM-216), SCH 6636, SCH-66336, Sizofilan R (SPG, Sizofu platinum-based chemotherapeutic for the treatment of can ran R., Schizophyllan R, Sonifilan R), SKI-2053R(NSC cers and premalignant conditions that are resistant to indi D644591), Sobuzoxane (MST-16, Perazolin R), Squalamine vidual chemotherapies. In another specific embodiment, anti (MSI-1256F), SR-49059 (vasopressin receptor inhibitor, bodies of the invention may be administered in combination Vla), Streptozocin (ZanosarR), SU5416 (Semaxanib.R., with Carboplatin (Paraplatin R, CBDCA). In another specific VEGF inhibitor), SU6668 (PDGF-TK inhibitor), T-67 embodiment, antibodies of the present invention may be (T-138067, T-607), Talc (Sclerosol.R.), Tamoxifen (Nolva administered in combination with Carboplatin (Paraplatin R, dex(R), Taurolidine (Taurolin R.), Temozolamide (Temodar R, 25 CBDCA) for the treatment of cancers that are resistant to NSC 362856), Teniposide (VM-26, Vumon(R), TER-286, individual chemotherapies. Testosterone (Andro(R), Androderm(R), Testoderm TTSR), In one embodiment, agonistic antibodies of the present Testoderm(R), Depo-Testosterone(R), Androgel(R), depoAn invention may be administered in combination with a plati dro(R), Tf-CRM107 (Transferrin-CRM-107), Thalidomide num-based chemotherapeutic. In another embodiment, ago 30 nistic antibodies of the present invention may be administered and thalidomide analogs, including but not limited to, lenali in combination with a platinum-based chemotherapeutic for domide (CC-5013, REVLIMIDR) and CC-4047 (AC the treatment of cancers and premalignant conditions that are TIMIDTM). Theratope. Thioguanine (6-thioguanine, 6-TG), resistant to individual chemotherapies. In another specific Thiotepa (triethylenethiophosphaoramide. Thioplex(R), Thy embodiment, agonistic antibodies of the invention may be mosin alpha I (Zadaxin R, Thymalfasin(R), Tiazofurin (Thia 35 administered in combination with Carboplatin (Paraplatin R, zole(R), Tirapazamine (SR-259075, SR-4233, Tirazone.R., CBDCA). In another specific embodiment, agonistic anti Win-59075), TNP-470 (AGM-1470, Fumagillin), bodies of the present invention may be administered in com Tocladesine (8-C1-cAMP), Topotecan (Hycamtin R, SK&F- bination with Carboplatin (Paraplatin R, CBDCA) for the 104864, NSC-609699, Evotopin(R), Toremifene (Estrimex(R), treatment of cancers that are resistant to individual chemo Fareston(R), Tositumomab R (BexxarR), Tretinoin (Retin 40 therapies. AR, AtragenR), ATRA, VesanoidR), TriAb(R) (anti-idiotype In one embodiment, antibodies of the present invention antibody immune stimulator), Trilostane (Modre?enR), Trip may be administered in combination with a topoisomerase torelin pamoate (Treistar Depot(R), Decapeptyl(R), Trimetrex inhibitor. In another embodiment, antibodies of the present ate (Neutrexin R.), Troxacitabine (BCH-204, BCH-4556, invention may be administered in combination with a topoi TroxatylR), TS-1, UCN-01 (7-hydroxystaurosporine), Valru 45 Somerase inhibitor for the treatment of cancers and premalig bicin (Valstar(R), Vaispodar (PSC 833), Vapreotide(R) (BMY nant conditions that are resistant to individual chemothera 41606), Vaxid (B-cell lymphoma DNA vaccine), Vinblastine pies. In a specific embodiment, antibodies of the present (Velban(R),VLB), Vincristine (OncovinR, Onco TCS(R), VCR, invention may be administered in combination with Irinote Leurocristine(R), Vindesine (Eldisine(R, Fildesin(R), Vinorel can (Camptosar.R, CPT-11, Topotecin.R., CaptoCPT-1). In a bine (Navelbine(R), Vitaxin R. (LM-609, integrin alphavbeta3 50 specific embodiment, antibodies of the present invention may antagonistic MAb), WF10 (macrophage regulator), WHI be administered in combination with Irinotecan (Camp tosar(R), CPT-11, Topotecin.R., CaptoCPT-1) for the treatment P131, WT1 Vaccine, XR-5000 (DACA), XR-9576 (XR of cancers that are resistant to individual chemotherapies. 9351, P-glycoprotein/MDR inhibitor), ZD-9331, ZD-1839 In one embodiment, agonistic antibodies of the present (IRESSAR), and Zoledronate (Zometa(R). 55 invention may be administered in combination with a topoi In one embodiment, antibodies of the present invention Somerase inhibitor. In another embodiment, agonistic anti may be administered in combination with a taxane. In another bodies of the present invention may be administered in com embodiment, antibodies of the present invention may be bination with a topoisomerase inhibitor for the treatment of administered in combination with a taxane for the treatment cancers and premalignant conditions that are resistant to indi of cancers and premalignant conditions that are resistant to 60 vidual chemotherapies. In a specific embodiment, agonistic individual chemotherapies. In a specific embodiment, anti antibodies of the present invention may be administered in bodies of the present invention may be administered in com combination with Irinotecan (Camptosar.R, CPT-11, Topote bination with Docetaxel (TaxotereR). In a specific embodi cin R., CaptoCPT-1). In a specific embodiment, agonistic anti ment, antibodies of the present invention may be bodies of the present invention may be administered in com administered in combination with Docetaxel (TaxotereR) for 65 bination with Irinotecan (Camptosar R., CPT-11, Topotecin R, the treatment of cancers and premalignant conditions that are CaptoCPT-1) for the treatment of cancers and premalignant resistant to individual chemotherapies. conditions that are resistant to individual chemotherapies. US 8,329,179 B2 93 94 In one embodiment, antibodies of the present invention rated by reference in their entirety. Exemplary IAP inhibitors may be administered in combination with a fluoropyrimidine. that may be administered in combination with an antibody In another embodiment, antibodies of the present invention compound of the invention also include one, two, three, or may be administered in combination with a fluoropyrimidine more of the IAP inhibitors described in U.S. Patent Publica for the treatment of cancers and premalignant conditions that tion Nos. 20070003535; 20060264379; 20060194741; are resistant to individual chemotherapies. In another specific 20060167066: 20060128632; 20060084611; 20060025347; embodiment, antibodies of the invention may be adminis 20060014700; 20050261203; 20050197403; 20040077542: tered in combination with Fluorouracil (5-FU, Adrucil(R). In 2003.0143579; 20020177557; and International Publication another specific embodiment, antibodies of the present inven Nos. WO 05/094818: WO 05/097791; WO 06/014361; WO tion may be administered in combination with Fluorouracil 10 2006/069063: WO 2006/091972: WO 2006/113376; WO (5-FU, Adrucil(R) for the treatment of cancers and premalig 05/092326; WO 05/069894; and WO 05/069888; each of nant conditions that are resistant to individual chemothera which are hereby incorporated by reference in their entirety. p1es. In one embodiment, an antibody composition of the inven In one embodiment, agonistic antibodies of the present tion is administered in combination with a histone deacety invention may be administered in combination with a fluoro 15 lase inhibitor (e.g., trichostatin A, trapoxins, depsipeptide pyrimidine. In another embodiment, agonistic antibodies of (e.g., FK-288 and FR901228), MS-275, and the triterpenoid the present invention may be administered in combination 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO) or with a fluoropyrimidine for the treatment of cancers and other molecules related to CDDO, valproic acid, suberoyla premalignant conditions that are resistant to individual che nilide hydroxamic acid (SAHA), pyroxamide, trapoxin, (dep motherapies. In another specific embodiment, agonistic anti sipeptide), and N-acetyl dinaline (CI-994). In additional bodies of the invention may be administered in combination embodiments an antibody composition of the invention is with Fluorouracil (5-FU, Adrucil(R). In another specific administered in combination with one, two, three, or more embodiment, agonistic antibodies of the present invention histone deacytelase inhibitors selected from APHA Com may be administered in combination with Fluorouracil pound 8 (3-(1-Methyl-4-phenylacetyl-1H-2-pyrrolyl)-N-hy (5-FU, Adrucil(R) for the treatment of cancers and premalig 25 droxy-2-propenamide); Apicidin (Cyclo(2S)-2-amino-8- nant conditions that are resistant to individual chemothera oXodecanoyl-1-methoxy-L-tryptophyl-L-isoleucyl-(2R)-2- p1es. piperidinexcarbonyl); Sodium Butyrate (Butyric Acid In one embodiment, the antibody compositions of the Sodium salt); (-)-Depudecin (4.5:8,9-Dianhydro-1,2.6.7.11 invention are administered in combination with apoptosis pentadeoxy-D-threo-D-ido-undeca-1,6-dienitol); Scriptaid inducing polypeptides. In a specific embodiment, antibodies 30 (6-(1,3-Dioxo-1H.3H-benzodeisoquinolin-2-yl)-hexanoic of the invention are administered in combination with Smac acid hydroxyamide); Sirtinol (2-(2-Hydroxynaphthalen-1- (second mitochondria-derived activator of caspases) pro ylmethylene)amino-N-(1-phenethyl)benzamide); Trichos teins, also known as DIABLO (direct IAP (inhibitor of apo tatin A (R-(E.E)-7-4-(Dimethylamino)phenyl-N-hy ptosis) binding protein with low p) (GenBank Accession droxy-4,6-dimethyl-7-oxo-2,4-heptadienamide); and histone No.: NP 063940 which is hereby incorporated by reference 35 deacetylase inhibitors described in US Patent Publication in its entirety). Smac is a 239 amino acid protein. The N-ter Nos. 20050131018: 20050124679; 20050222414; minal 55 amino acids serve as a mitochondrial targeting 200501 19250; 20050171103; 20070004806; 20060235012: sequence which is cleaved after import to the mitochondria. 20050026907; 20050148613; 20060052599; 20030216345; Apoptosis inducing polypeptides may be delivered using 20060235231: 20070015809; 20040224991: 20060264415; techniques known in the art. For example, one way to deliver 40 20020103.192: 20060047123; 2003.0134865; 20060030543: Smac protein would be through the delivery of a nucleic acid 20050107384; 20060058553; 20070010669; 20050176686; encoding either the full length or mature form of Smac (amino 20060030554; 20050165016; 20060122234; 20050171347; acids 56-239 of GenBank Accession No.: NP 063940, a 20050113373; 20040077698; and 20040087652; and Inter cytosolic form that bypasses mitochondrial processing). national Publication No. WO 05/025619; each of which are Alternatively, antibody compositions of the invention may be 45 hereby incorporated by reference in their entirety. administered in combination with cell permeable, synthetic In one embodiment, an antibody composition of the inven Smac peptides which are capable of inhibiting IAP proteins tion is administered in combination with a nitric oxide donor (e.g., those containing amino acid residues 56-62 of GenBank (e.g., sodium nitroprusside, GEA 3175 (1,2,3,4-oxatriazo Accession No.: NP 063940; AVPIAQK as described in Chai lium, 3-(3-chloro-2-methylphenyl)-5-[(methylphenyl)sul et al., (2000) Nature 406:855-862 and Fulda et al., (2002) 50 phonylamino), isosorbide dinitrate, and nitroglycerin). Nature Medicine 8:808-815, both of which are hereby incor In one embodiment, an antibody composition of the inven porated by reference in their entireties. Alternatively, an anti tion is administered in combination with curcumin (diferu body composition of the invention may be administered in loylmethane). combination with a small molecule IAP inhibitor compound. In one embodiment an antibody composition of the inven In specific embodiments, the IAP inhibitor compound mim 55 tion is administered in combination with resveratrol (3,5,4'- ics the activity of SMAC by binding to one or more IAPs and trihydroxy stilbene). blocking IAP-mediated caspase inhibition. The IAP inhibitor In another embodiment, an antibody composition of the may be a monomer, a dimer, a trimer, or a higher-order mul invention is administered in combination with a protein timer. In specific embodiments the small molecule IAP kinase inhibitor. In particular embodiments, the protein inhibitor binds to and inhibits the activity of X-linked inhibi 60 kinase inhibitor is a multi-target kinase inhibitor, including tor of apoptosis (XIAP). In further embodiments, an antibody but not limited to ZactimaTM (ZD6474), AMG706, MP-412, composition of the invention is administered with one, two, Sorafenib, dasatinib, CEP-701 (lestaurtinib), XL647, XL999, three, or more of the IAP inhibitors described in Li et al. lapatinib, MLN518 (CT53518), PKC412, ST1571, Science. 2004305(5689): 1471-4 (2004) (e.g., “Compound AMN107, AEE788, OSI-930, OSI-817, sunitinib (SUI 3); Schimmer et al., Cancer Cell. 5(1):25-35 (2004) (e.g., 65 1248), and AG-013736. compounds 1396-12 and 1396-34); and Zobel et al., ACS In another embodiment, an antibody composition of the Chem. Biol. 1 (8):525-33 (2006); which are hereby incorpo invention is administered in combination with a Heat Shock US 8,329,179 B2 95 96 Protein (HSP) Inhibitor. In a specific embodiment the HSP Cyclophosphamide+Adriamycing--Vincristine--Prednisone inhibitor is an HSP90 inhibitor, such as geldanamycin; (CHOP), Cyclophosphamide--Novantrone(R) (Mitox geldanamycin analogs (e.g. 17-allylamino-17-demethoxy antrone)+Vincristine (Oncovorin)+Prednisone (CNOP), geldanamycin (17AAG) and 17-aminogeldanamycin Cyclophosphamide+Adriamycin R+Vincristine--Pred (17-AG)); and radicicol. 5 nisone--Rituximab (CHOP+Rituximab), Cyclophospha In another embodiment, an antibody composition of the mide+Adriamycin R+Vincristine--Teniposide (CAV-T), invention is administered in combination with a peroxisome Cyclophosphamide+Adriamycin R+Vincristine alternating proliferator-activated receptor-gamma (PPAR-gamma) with Platinol R+Etoposide (CAV/PE), Cyclophosphamide-- antagonist, such as, but not limited to, GW9662 and BCNU (Carmustine)+VP-16 (Etoposide) (CBV), Cyclo TOO70907. 10 phosphamide--Vincristine--Prednisone (CVP), Cyclophos In another embodiment, an antibody composition of the phamide--OncovinR+Methotrexate--Fluorouracil (COMF), invention is administered in combination with a AKT/mTOR Cytarabine--Methotrexate, Cytarabine+Bleomycin--Vincris signaling pathway inhibitor, Such as, but not limited to, rapa tine--Methotrexate (CytaBOM), Dactinomycin--Vincristine, mycin, temsirolimus (CCI-779), AP23573, everolimus Dexamethasone+Cytarabine--Cisplatin (DHAP), Dexam (RAD001) and MKC-1. 15 ethasone--Ifosfamide+Cisplatin--Etoposide (DICE), Doc In another embodiment, an antibody composition of the etaxel--Gemcitabine, Docetaxel--Vinorelbine, Doxorubicin-- invention is administered in combination with a BCL-2 Vinblastine--Mechlorethamine--Vincristine--Bleomycin-- inhibitor, such as, but not limited to, HA14-1, GX15-070, and Etoposide+Prednisone (Stanford V), Epirubicin-- ABT-263. Gemcitabine, Estramustine--Docetaxel, Estramustine-- In preferred embodiments, agonistic antibodies of the Navelbine, Estramustine--Paclitaxel, Estramustine-- invention are administered in combination with one or more Vinblastine, Etoposide (Vepesider)+Ifosfamide+Cisplatin of the above-described therapeutic agents in the treatment, (Platinol R) (VIP), Etoposide--Vinblastine-Adriamycin prevention, amelioration and/or cure of cancers and prema (EVA), Etoposide (Vepesider)+Ifosfamide+Cisplatin--Epiru lignant conditions. bicin (VIC-E), Etoposide--Methylprednisone--Cytarabine-- In further specific embodiments, antibodies of the present 25 Cisplatin (ESHAP), Etoposide+Prednisone+Ifosfamide-- invention may be administered in combination with one or Cisplatin (EPIC), Fludarabine--Mitoxantrone-- more combinations of therapeutic agents useful in the treat Dexamethasone (FMD). Fludarabine--Dexamethasone-- ment, prevention, amelioration and/or cure of cancers and Cytarabine (ara-C)+Cisplatin (Platinol R) (FluDAP), premalignant conditions including, but not limited to, 9-ami Fluorouracil--Bevacizumab R, Fluorouracil--CeaVaccR), Fluo nocamptothecin--G-CSF, Adriamycing--Blenoxane--Vin 30 rouracil-Leucovorin, Fluorouracil-Levamisole, Fluorou blastine+Dacarbazine (ABVD). BCNU (Carmustine)+Eto racil--Oxaliplatin, Fluorouracil--Raltitrexed, Fluorouracil poside--Ara-C (Cytarabine)+Melphalen (BEAM), SCH 6636, Fluorouracil--Trimetrexate, Fluorouracil Bevacizumab(R+Leucovorin, Bleomycin--Etoposide--Plati Leucovorin-i-BevacizumabR), Fluorouracil-Leucovorin-- nolg (Cisplatin) (BEP), Bleomycin--Etoposide+Adriamy Oxaliplatin, Fluorouracil-Leucovorin-Trimetrexate, cin-i-Cyclophosphamide--Vincristine--Procarbazine--Pred 35 Fluorouracil--OncovinR+Mitomycin C (FOMi), Hydrazine-- nisone (BEACOPP), Bryostatin--Vincristine, Busulfan Adriamycin R+Methotrexate (HAM), Ifosfamide--Doc Melphalan, Carboplatin-i-Cereport(R), Carboplatin-- etaxel, Ifosfamide--Etoposide, Ifosfamide+Gemcitabine, Cyclophosphamide, Carboplatin--Paclitaxel, Carboplatin-- Ifosfamide--Paclitaxel, Ifosfamide--Vinorelbine, Ifosfa Etoposide+Bleomycin (CEB), Carboplatin-Etoposide-- mide--Carboplatin--Etoposide (ICE), Ifosfamide--Cisplatin-- Thiotepa, Cisplatin-i-Cyclophosphamide, Cisplatin-- 40 Doxorubicin, Irinotecan+C225 (Cetuximab(R), Irinotecan+ Docetaxel, Cisplatin--Doxorubicin, Cisplatin-Etoposide, Docetaxel, Irinotecan+Etoposide, Irinotecan+Fluorouracil, Cisplatin--Gemcitabine, Cisplatin-i-Interferon alpha, Cispl Irinotecan--Gemcitabine, Mechlorethamine--Oncovin R atin-i-Irinotecan, Cisplatin--Paclitaxel, Cisplatin-Teniposide, (Vincristine)+Procarbazine (MOP), Mechlorethamine--On Cisplatin--Vinblastine, Cisplatin--Vindesine, Cisplatin-i-Vi covinR (Vincristine)+Procarbazine--Prednisone (MOPP), norelbine, Cisplatin-i-Cytarabine--Ifosfamide, Cisplatin-i-If 45 Mesna--Ifosfamide--Idarubicin--Etoposide (MIZE), Methotr osfamide--Vinblastine, Cisplatin--Vinblastine--Mitomycin C, exate--Interferon alpha, Methotrexate--Vinblastine, Methotr Cisplatin--Vincristine--Fluorouracil, Cisplatin--Vincristine-- exate--Cisplatin, Methotrexate with leucovorin rescue--Bleo Lomustine, Cisplatin--Vinorelbine--Gemcitabine, Cisplatin-- mycin-i-Adriamycin-i-Cyclophosphamide--Oncovorin-- Carmustine--Dacarbazine--Tamoxifen, Cisplatin-i-Cyclo Dexamethasone (m-BACOD), Mitomycin C+Ifosfamide-- phosphamide--Etoposide+Vincristine, Cisplatin 50 Cisplatin (Platinol R) (MIP), Mitomycin C+Vinblastine-- (Platinol R)+OncovinR+Doxorubicin (Adriamycin R)+Eto Paraplatin R (MVP), Mitoxantrone--Hydrocortisone, poside (CODE), Cisplatin-i-Cytarabine--Ifosfamide+Etopo Mitoxantrone--Prednisone. OncovinR+SCH 6636, Oxalipl side+Methotrexate, Cyclophosphamide+Adriamycin R atin-i-Leucovorin, Paclitaxel--Doxorubicin, Paclitaxel--SCH (Doxorubicin), Cyclophosphamide--Melphalan, Cyclophos 6636, Paraplatin R+Docetaxel, ParaplatinR+Etoposide, phamide--SCH 6636, Cyclophosphamide-Adriamycing+ 55 ParaplatinR+Gemcitabine, ParaplatinR+Interferon alpha, Cisplatin (Platinol R) (CAP), Cyclophosphamide+Adriamy ParaplatinR+Irinotecan, ParaplatinR)+Paclitaxel, Parapl cinr+Vincristine (CAV), Cyclophosphamide--Doxorubicin-- atinR+Vinblastine, Carboplatin (ParaplatinR)+Vincristine, Teniposide--Prednisone, Cyclophosphamide--Doxorubicin-- ParaplatinR+Vindesine, ParaplatinR+Vinorelbine, Pemetr Teniposide--Prednisone--Interferon alpha, exed disodium+Gemcitabine, Platinolg (Cisplatin)--Vinblas Cyclophosphamide+Epirubicin-i-Cisplatin (PlatinolR) 60 tine--Bleomycin (PVB), Prednisone--Methotrexate-Adria (CEP), Cyclophosphamide+Epirubicin-Fluorouracil, mycin-i-Cyclophosphamide--Etoposide (ProMACE), Cyclophosphamide+Methotrexate--Fluoruracil (CMF), Procarbazine+Lomustine, Procarbazine+Lomustine--Vinc Cyclophosphamide+Methotrexate--Vincristine (CMV), ristine, Procarbazine--Lomustine--Vincristine--Thioguanine, Cyclophosphamide+Adriamycing-i-Methotrexate--Fluorou Procarbazine--OncovinR+CCNU(R+Cyclophosphamide racil (CAMF), Cyclophosphamide-Adriamycin R+Methotr 65 (POCC), Quinine--Doxorubicin, Quinine--Mitoxantrone-- exate--Procarbazine (CAMP), Cyclophosphamide+Adria Cytarabine. Thiotepa+Etoposide. Thiotepa+Busulfan-i-Cy mycin R+Vincristine--Etoposide (CAV-E), clophosphamide. Thiotepa+Busulfan-i-Melphalan, Thiotepa+ US 8,329,179 B2 97 98 Etoposide+Carmustine. Thiotepa+Etoposide--Carboplatin, invention may be administered in combination with Irinote Topotecan+Paclitaxel, Trimetrexate--Leucovorin, Vinblas can (Camptosar(R), CPT-11, Topotecin R., CaptoCPT-1) and tine--Doxorubicin--Thiotepa, Vinblastine--Bleomycin--Eto Fluorouracil (5-FU, Adrucil(R) for the treatment of cancers poside--Carboplatin, Vincristine--Lomustine+Prednisone, and premalignant conditions that are resistant to individual Vincristine (OncovinR)+Adriamycin R+Dexamethasone chemotherapies. (VAD), Vincristine (OncovinR)+Adriamycin R+Procarba In preferred embodiments, agonistic antibodies of the zine (VAP), Vincristine--Dactinomycin-i-Cyclophosphamide, invention are administered in combination with one or more and Vinorelbine--Gemcitabine. of the above-described combinations of therapeutic agents in In one embodiment, antibodies of the present invention the treatment, prevention, amelioration and/or cure of cancers may be administered in combination with a taxane and a 10 and premalignant conditions. platinum-based chemotherapeutic. In another embodiment, Antibodies of the present invention may be administered in antibodies of the present invention may be administered in combination with one or more therapeutic agents described combination with a taxane and a platinum-based chemothera above to treat, prevent, ameliorate and/or cure cancers and peutic for the treatment of cancers and premalignant condi premalignant conditions of any tissue known to express DR4 tions that are resistant to individual chemotherapies. In a 15 receptor. In preferred embodiments, agonistic antibodies of specific embodiment, antibodies of the present invention may the present invention are administered in combination with be administered in combination with Docetaxel (TaxotereR) one or more therapeutic agents described above to treat, pre and Carboplatin (Paraplatin R, CBDCA). In another specific vent, ameliorate and/or cure cancers and premalignant con embodiment, antibodies of the present invention may be ditions of any tissue known to express DR4 receptor. administered in combination with Docetaxel (Taxotere?R) and Tissues known to express DR4 receptor include, but are not Carboplatin (Paraplatin R, CBDCA) for the treatment of can limited to, heart, placenta, liver, pancreas, spleen, thymus, cers and premalignant conditions that are resistant to indi prostate, testis, ovary, stomach, Small intestine, colon, kidney, vidual chemotherapies. bone marrow, skin, blood, tonsil and palate. In one embodiment, agonistic antibodies of the present In specific embodiments antibodies of the present inven invention may be administered in combination with a taxane 25 tion may be administered in combination with one or more and a platinum-based chemotherapeutic. In another embodi therapeutic agents, as described above, in the treatment, pre ment, agonistic antibodies of the present invention may be vention, amelioration and/or cure of Solid tissue cancers and administered in combination with a taxane and a platinum premalignant conditions (e.g., skin cancer, prostate cancer, based chemotherapeutic for the treatment of cancers and pre pancreatic cancer, hepatic cancer, lung cancer, ovarian can malignant conditions that are resistant to individual chemo 30 cer, colorectal cancer, head and neck tumors, breast tumors, therapies. In a specific embodiment, agonistic antibodies of endothelioma, osteoblastoma, osteoclastoma, Ewing's sar the present invention may be administered in combination coma, and Kaposi's sarcoma), as well as hematological can with Docetaxel (TaxotereR) and Carboplatin (ParaplatinR), cers (e.g., leukemia, acute lymphocytic leukemia, chronic CBDCA). In another specific embodiment, agonistic anti lymphocytic leukemia, non-Hodgkin’s lymphoma, multiple bodies of the present invention may be administered in com 35 myeloma). bination with Docetaxel (TaxotereR) and Carboplatin (Para In preferred embodiments, agonistic antibodies of the platin R, CBDCA) for the treatment of cancers and invention are administered in combination with one or more premalignant conditions that are resistant to individual che therapeutic agents, as described above, in the treatment, pre motherapies. vention, amelioration and/or cure of Solid tissue cancers and In one embodiment, antibodies of the present invention 40 premalignant conditions (e.g., skin cancer, prostate cancer, may be administered in combination with a topoisomerase pancreatic cancer, hepatic cancer, lung cancer, ovarian can inhibitor and a fluoropyrimidine. In another embodiment, cer, colorectal cancer, head and neck tumors, breast tumors, antibodies of the present invention may be administered in endothelioma, osteoblastoma, osteoclastoma, Ewing's sar combination with a topoisomerase inhibitor and a fluoropy coma, and Kaposi's sarcoma), as well as hematological can rimidine for the treatment of cancers and premalignant con 45 cers (e.g., leukemia, acute lymphocytic leukemia, chronic ditions that are resistant to individual chemotherapies. In a lymphocytic leukemia, non-Hodgkin’s lymphoma, multiple specific embodiment, antibodies of the present invention may myeloma). be administered in combination with Irinotecan (Camp In specific embodiments antibodies of the present inven tosar(R), CPT-11, Topotecin.R., CaptoCPT-1) and Fluorouracil tion are used to treat, ameliorate and/or prevent skin cancers (5-FU, Adrucil(R). In another specific embodiment, antibod 50 and premalignant conditions including basal cell carcinoma, ies of the present invention may be administered in combina squamous cell carcinoma and malignant melanoma. Antibod tion with Irinotecan (Camptosar(R), CPT-11, Topotecin R, ies of the present invention may be used in combination with CaptoCPT-1) and Fluorouracil (5-FU, Adrucil(R) for the one or more Surgical and/or radiological procedures and/or treatment of cancers and premalignant conditions that are therapeutic agents to treat, ameliorate and/or prevent skin resistant to individual chemotherapies. 55 cancers and premalignant conditions. In one embodiment, agonistic antibodies of the present In preferred embodiments agonistic antibodies of the invention may be administered in combination with: a topoi present invention are used to treat, ameliorate and/or prevent Somerase inhibitor and a fluoropyrimidine. In another skin cancers and premalignant conditions including basal cell embodiment, agonistic antibodies of the present invention carcinoma, squamous cell carcinoma and malignant mela may be administered in combination with a topoisomerase 60 noma. Agonistic antibodies of the present invention may be inhibitor and a fluoropyrimidine for the treatment of cancers used in combination with one or more Surgical and/or radio and premalignant conditions that are resistant to individual logical procedures and/or therapeutic agents to treat, amelio chemotherapies. In a specific embodiment, agonistic antibod rate and/or prevent skin cancers and premalignant conditions. ies of the present invention may be administered in combina Antibodies of the present invention may be administered in tion with Irinotecan (Camptosar(R), CPT-11, Topotecin R, 65 combination with one or more therapeutic agents useful in the CaptoCPT-1) and Fluorouracil (5-FU, Adrucil(R). In another treatment of skin cancers and premalignant conditions specific embodiment, agonistic antibodies of the present including, but not limited to, Bleomycin (Blenoxane(R). Car US 8,329,179 B2 99 100 mustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), Cispl U(R), ara-C, cytosine arabinoside, DepoCytR), Dacarbazine atin (Platinol R, CDDP), Dacarbazine (DTIC), Interferon (DTIC(R), Dactinomycin (CosmegenR), Daunorubicin alpha2b (Intron A(R), Interleukin-2 (ProleiukinRR), Tamox (Daunomycin, DaunoXome(R), Daunorubicin R, Cerubi ifen (Nolvadex(R), Temozolamide (Temodar R, NSC dine(R), Docetaxel (Taxotere?R, Taxane(R). Dexamethasone 362856), Vinblastine (Velban R, VLB), Vincristine (On (Decadron(R), Etoposide phosphate (Etopophos(R), Etopo covinR), Onco TCSR), VCR, Leurocristine(R), and Vindesine side (VP-16, VepesidR), Fluorouracil (5-FU, Adrucil(R), (Eldisine(R), Fildesin(R). Combinations of therapeutic agents Hydroxyurea (HydreaR), Ifosfamide (IFEXR), Lomustine useful in the treatment of skin cancers include, but are not (CCNUR), CeeNUR), Melphalan (L-PAM, Alkeran R., Phe limited to, Cisplatin--Carmustine--Dacarbazine--Tamoxifen. nylalanine mustard), Mercaptopurine (6-mercaptopurine, In preferred embodiments, agonistic antibodies of the 10 6-MP), Methchlorethamine (Nitrogen Mustard, HN Mus invention are administered in combination with one or more targenR), Methotrexate R (MTX, Mexate R, Folex(R), Pacli of the above-described therapeutic agents in the treatment, taxel (Paxene.R.), Taxol.R.), Paclitaxel-DHA (Taxoprexin R), amelioration and/or prevention of skin cancers and premalig Procarbazine (Matulane(R)), Temozolamide (Temodar R, nant conditions. NSC 362856), Teniposide (VM-26, Vumon(R). Thioguanine In further particular embodiments, antibodies of the 15 (6-thioguanine, 6-TG). Thiotepa (triethylenethiophosphaora present invention are used to treat, ameliorate and/or prevent mide), Topotecan (Hycamtin R, SK&F-104864, NSC head and neck cancers including brain cancers, and prema 609699, Evotopin(R), and Vincristine (Oncovin(R), Onco lignant conditions. Antibodies of the present invention may TCS(R), VCR, Leurocristine(R). be used in combination with one or more Surgical and/or In preferred embodiments, agonistic antibodies of the radiological procedures and/or therapeutic agents to treat, invention are administered in combination with one or more ameliorate and/or prevent head and neck cancers including of the above-described therapeutic agents in the treatment, brain cancers, and premalignant conditions. Brain cancers amelioration and/or prevention of brain cancers and prema which may be treated using antibodies of the present inven lignant conditions. tion include, but are not limited to, gliomas such as astrocy Further examples of therapeutic agents useful in the treat tomas and oligodendromas, non-glial tumors such as neu 25 ment of brain cancers which may be administered in combi ronal, meningeal, ependymal and choroid plexus cell tumors, nation with antibodies of the present invention include, but and metastatic brain tumors such as those originating as are not limited to, 81 C6 (Anti-tenascin monoclonal anti breast, lung, prostate and skin cancers. body), BIBX-1382, Cereport R. (LobradimilR, RMP-7), In further preferred embodiments, agonistic antibodies of Cilengitide(R) (EMD-12 1974, integrin alphavbeta3 antago the present invention are used to treat, ameliorate and/or 30 nist), CMT-3 (Metastat(R), Cotara(R) (chTNT-1/B, ''I- prevent head and neck cancers including brain cancers, and chTNT-1/B), CPIL-4-toxin (IL-4 fusion toxin), Fenretinideg premalignant conditions. Agonistic antibodies of the present (4HPR), Fotemustine (Muphoran R, Mustophoran R), Gem invention may be used in combination with one or more citabine (Gemto(R), Gemzar.R.), Hypericinr) (VIMRXynR), Surgical and/or radiological procedures and/or therapeutic Imatinib mesylate (STI-571, Imatinib R, Glivec R, Gleevec R, agents to treat, ameliorate and/or prevent head and neck can 35 Ab1 tyrosine kinase inhibitor), Irinotecan (Camptosar R, cers including brain cancers, and premalignant conditions. CPT-11, Topotecin(R), CaptoCPT-1), Leflunomide (SU-101, Brain cancers which may be treated using agonistic antibod SU-0200), Mivobulin isethionate (CI-980), O6-benzylgua ies of the present invention include, but are not limited to, nine (BG, Procept(R), Prinomastat(R) (AG-3340, MMP inhibi gliomas Such as astrocytomas and oligodendromas, non-glial tor), R115777 (Zamestra(R), SU6668 (PDGF-TK inhibitor), tumors such as neuronal, meningeal, ependymal and choroid 40 T-67 (T-138067, T-607), Tamoxifen (Nolvadex(R), plexus cell tumors, and metastatic brain tumors such as those Tf-CRM107 (Transferrin-CRM-107), Thalidomide and tha originating as breast, lung, prostate and skin cancers. lidomide analogs, including but not limited to, lenalidomide In one preferred embodiment, agonistic antibodies of the (CC-5013, REVLIMIDR) and CC-4047 (ACTIMIDTM), Tia invention are used to treat brain tumors. In a further preferred zofurin (Thiazole(R), Vapreotide(R) (BMY-41606), Vinorel embodiment, agonistic antibodies of the invention are used to 45 bine (Navelbine(R), and XR-5000 (DACA). treat glioblastoma multiforme. In preferred embodiments, agonistic antibodies of the Antibodies of the present invention may be administered in invention are administered in combination with one or more combination with one or more radiological procedures useful of the above-described therapeutic agents in the treatment, in the treatment of brain cancers including, but not limited to, amelioration and/or prevention of brain cancers and prema external beam radiation therapy, stereotactic radiation 50 lignant conditions. therapy, conformal radiation therapy, intensity-modulated Preferred combinations of therapeutic agents useful in the radiation therapy (IMRT), and radiosurgery. treatment of brain cancers which may be administered in In preferred embodiments, agonistic antibodies of the combination with antibodies of the present invention include, invention are administered in combination with one or more but are not limited to, Busulfan--Melphalan, Carboplatin-- radiological procedures useful in the treatment of brain can 55 Cereport(R), Carboplatin--Etoposide, Carboplatin-Etopo cers including, but not limited to, external beam radiation side--Thiotepa, Cisplatin-Etoposide, Cisplatin--Cytarabine-- therapy, stereotactic radiation therapy, conformal radiation Ifosfamide, Cisplatin--Vincristine--Lomustine, Cisplatin-- therapy, intensity-modulated radiation therapy (IMRT), and Cyclophosphamide+Etoposide--Vincristine, Cisplatin-- radioSurgery. Cytarabine--Ifosfamide+Etoposide--Methotrexate, Antibodies of the present invention may be administered in 60 Cyclophosphamide--Melphalan, Cytarabine--Methotrexate, combination with one or more therapeutic agents useful in the Dactinomycin--Vincristine, Mechlorethamine--OncovinR) treatment of brain cancers including, but not limited to, Bleo (Vincristine)+Procarbazine (MOP), Mechlorethamine--On mycin (Blenoxane(R), Busulfan (BusulfeXR), Myleran R), covinR (Vincristine)+Procarbazine--Prednisone (MOPP), Carboplatin (Paraplatin R, CBDCA), Carmustine (DTI-015, Carboplatin (ParaplatinR)+Etoposide, Carboplatin (Parapl BCNU, BiCNU, Gliadel WaferR), Cisplatin (Platinol R, 65 atinR)--Vincristine, Procarbazine--Lomustine, Procarba CDDP), Cisplatin-epinephrine gel (Intral Dose(R), FocaCist(R), Zine--Lomustine--Vincristine, Procarbazine--Lomustine-- Cyclophosphamide (Cytoxan R, CTX), Cytarabine (Cytosar Vincristine--Thioguanine. Thiotepa+Etoposide. Thiotepa+ US 8,329,179 B2 101 102 Etoposide+Carmustine. Thiotepa+Etoposide--Carboplatin, VLB), Vincristine (Oncovin(R), Onco TCS(R), VCR, Leuroc Vinblastine--Bleomycin--Etoposide--Carboplatin, and Vinc ristine(R), and Vinorelbine (Navelbine(R). ristine-Lomustine--Prednisone. In preferred embodiments, agonistic antibodies of the In preferred embodiments, agonistic antibodies of the invention are administered in combination with one or more invention are administered in combination with one or more of the above-described therapeutic agents in the treatment, of the above-described combinations of therapeutic agents in amelioration and/or prevention of breast cancers and prema the treatment, amelioration and/or prevention of brain can lignant conditions. cers and premalignant conditions. Further examples of therapeutic agents useful in the treat In further particular embodiments, antibodies of the ment of breast cancer and premalignant conditions which present invention are used to treat, ameliorate and/or prevent 10 breast cancer and premalignant conditions. Antibodies of the may be administered in combination with antibodies of the present invention may be used in combination with one or present invention include, but are not limited to, Aldesleukin more Surgical and/or radiological procedures and/or thera (IL-2, Proleukin R), Altretamine (Hexylen R, hexameth peutic agents to treat, ameliorate and/or prevent breast cancer ylmelamine, Hexastat(R), Angiostatin, Annamycin (AR-522. and premalignant conditions. Breast cancers which may be 15 annamycin LF, AronexR), Biricodar dicitrate (Incel(R), Incel treated using antibodies of the present invention include, but MDR Inhibitor), Boronated Protoporphyrin Compound are not limited to, ductal carcinoma, stage I, stage II, stage III (PDIT, Photodynamic Immunotherapy), Bryostatin-1 (Bry and stage IV breast cancers as well as invasive breast cancer ostatin, BMY-45618, NSC-339555), Busulfan (Busulfex(R), and metastatic breast cancer. Myleran R), Carmustine (DTI-015, BCNU, BiCNU, Gliadel In preferred embodiments, agonistic antibodies of the WaferR), D-limonene, Dacarbazine (DTIC), Daunorubicin present invention are used to treat, ameliorate and/or prevent (Daunomycin, DaunoXome(R), Daunorubicin R, Cerubi breast cancer and premalignant conditions. Agonistic anti dineR), Dolastatin-10 (DOLA-10, NSC-376128), DPPE, bodies of the present invention may be used in combination DX-8951f (DX-8951), EMD-121974, Endostatin, EO9 with one or more Surgical and/or radiological procedures (EO1, EO4, EO68, EO70, EO72), Etoposide phosphate (Eto and/or therapeutic agents to treat, ameliorate and/or prevent 25 pophos(R), Etoposide (VP-16, VepesiderV), Fluasterone, Flu breast cancer and premalignant conditions. Breast cancers darabine (Fludara R, FAMP), Flutamide (Eulexin(R), Form which may be treated using agonistic antibodies of the estane (Lentaron(R), Fulvestrant (Faslodex(R), Galarubicin present invention include, but are not limited to, ductal car hydrochloride (DA-125), Gemcitabine (GemtoR, cinoma, stage I, stage II, stage III and stage IVbreast cancers Gemzar R), Her-2/Neu vaccine, Hydroxyurea (HydreaR), as well as invasive breast cancer and metastatic breast cancer. 30 Idarubicin (Idamycin R, DMDR, IDA), Interferon alpha 2a In one preferred embodiment, agonistic antibodies of the (Intron A(R), Interferon gamma (Gamma-interferon, Gamma invention are used to treat metastatic breast cancer. 100R, Gamma-IF), Irinotecan (Camptosar R, CPT-11, Topo Antibodies of the present invention may be administered in tecin R., CaptoCPT-1), Ketoconazole (Nizoral R), KRN-8602 combination with one or more Surgical and/or radiological (MX, MY-5. NSC-619003, MX-2), L-asparaginase (El procedures useful in the treatment of breast cancer and pre 35 spar R), Leuprolide acetate (Viadur R. Lupron(R), Lomustine malignant conditions. (CCNUR), CeeNUR), LY-335979, Mannan-MUC1 vaccine, In preferred embodiments, agonistic antibodies of the 2-Methoxyestradiol (2-ME, 2-ME2), Mitoxantrone (No present invention may be administered in combination with Vantrone(R), DHAD), Motexafin Lutetium (Lutrin R, OptrinR), one or more Surgical and/or radiological procedures useful in Lu-Tex R, lutetium texaphyrin, LucynR), AntrinR), MPV the treatment of breast cancer and premalignant conditions. 40 2213ad (Finrozole(R), MS-209, Muc-1 vaccine, NaPro Pacli Antibodies of the present invention may be administered in taxel, Perillyl alcohol (perilla alcohol, perillic alcohol, peril combination with one or more therapeutic agents useful in the lol, NSC-641066), Pirarubicin (THP), Procarbazine treatment of breast cancer and premalignant conditions (Matulane(R), Providence Portland Medical Center Breast including, but not limited to, Amifostine (Ethyol(R), Amino Cancer Vaccine, Pyrazoloacridine (NSC-366140, glutethimide (Cytadren(R), Anastrozole (Arimidex(R), Bleo 45 PD-115934), Raloxifene hydrochloride (Evista R, Keoxifene mycin (Blenoxane(R), Capecitabine (XelodaR), Doxifluri hydrochloride), Raltitrexed (Tomudex R, ZD-1694), Rebec dine(R), oral 5-FU), Cisplatin (Platinol R, CDDP), Cisplatin camycin, Streptozocin (Zanosar.R.), Temozolamide (Temo epinephrine gel (Intral Dose(R), FocaCist(R), dar R, NSC 362856), Theratope. Thiotepa (triethylenethio Cyclophosphamide (Cytoxan R. Neosar.R, CTX), Docetaxel phosphaoramide. Thioplex(R), Topotecan (Hycamtin R, (Taxotere?R, Taxane(R). Doxorubicin (Adriamycin R, 50 SK&F-104864, NSC-609699, Evotopin(R), Toremifene (Es Doxil R, Rubex(R), Epirubicin (Ellence(R), EPI, 4 epi-doxo trimex(R, Fareston(R), Trilostane (ModrefenR), and XR-9576 rubicin), Exemestane (Aromasin(R), Nikidess.(R), Fadrozole (XR-9351, P-glycoprotein/MDR inhibitor). (Afema(R, Fadrozole hydrochloride, Arensin(R), Fluorouracil In preferred embodiments, agonistic antibodies of the (5-FU, Adrucil(R), Fluoroplex(R), Efudex(R), Herceptin(R) invention are administered in combination with one or more (Trastuzumab(R), Anti-HER-2 monoclonal antibody, Anti 55 of the above-described therapeutic agents in the treatment, EGFR-2 MAb), Ifosfamide (IFEX(R), Letrozole (Femara(R), amelioration and/or prevention of breast cancers and prema Leucovorin (LeucovorinR), WellcovorinR), Mechlore lignant conditions. thamine (Nitrogen Mustard, HN MustargenR), Megestrol Preferred combinations of therapeutic agents useful in the acetate (Megace(R), Pallace(R), Melphalan (L-PAM, Alke treatment of breast cancer which may be administered in ran R, Phenylalanine mustard), Methotrexate R (MTX, Mex 60 combination with antibodies of the present invention include, ate(R). Folex(R), Methyltestosterone (Android-108, TestredR), but are not limited to, Cyclophosphamide+Adriamycin R Virilon(R), Mitomycin C (Mitomycin R, Mutamycin R, Mito (Doxorubicin), Cyclophosphamide+Epirubicin-i-Fluorou Extra(R), Orzel(R) (Tegafur--Uracil-Leucovorin), Paclitaxel racil, Cyclophosphamide--Methotrexate--Fluorouracil (Paxene R, Taxol.R.), Sobuzoxane (MST-16, Perazolin R), (CMF), Paclitaxel--Doxorubicin, and Vinblastine--Doxorubi Tamoxifen (Nolvadex(R), Testosterone (Andro(R), Andro 65 cin+Thiotepa. derm(R, Testoderm TTSR, Testoderm(R), Depo-Testoster In preferred embodiments, agonistic antibodies of the one(R), Androgel(R), depo AndroR), Vinblastine (Velban R, invention are administered in combination with one or more US 8,329,179 B2 103 104 of the above-described therapeutic agent combinations in the be administered in combination with antibodies of the present treatment, amelioration and/or prevention of breast cancers invention include, but are not limited to, ABX-EGF (anti and premalignant conditions. EGFr MAb), Acetyldinaline (CI-994), AG-2034 (AG-2024, In further particular embodiments, antibodies of the AG-2032, GARFT glycinamide ribonucleoside transformy present invention are used to treat, ameliorate and/or prevent lase inhibitor), Alanosine, Aminocamptothecin (9-AC, lung cancer and premalignant conditions. Antibodies of the 9-Aminocamptothecin, NSC 603071), Angiostatin, Aplidine present invention may be used in combination with one or (Aplidin R, AplidinaR), BBR 3464, Bexarotene (Targretin R, more Surgical and/or radiological procedures and/or thera LGD1069), BIBH-1 (Anti-FAP MAb), BIBX-1382, BLP-25 peutic agents to treat, ameliorate and/or prevent lung cancer (MUC-1 peptide), Bryostatin-1 (Bryostatin R, BMY-45618, and premalignant conditions. Lung cancer which may be 10 treated using antibodies of the present invention includes, but NSC-339555), Budesonide (Rhinocort(R), C225 (IMC-225, is not limited to, non-small cell lung cancer (NSCLC) includ EGFR inhibitor, Anti-EGFr MAb, Cetuximab(R), Capecitab ing early stage NSCLC (i.e., Stage IA/IB and Stage IIA/IIB), ine (Xeloda R., Doxifluridine(R), oral 5-FU), Carboxyamidot Stage IIIA NSCLC, Stage IIA (unresectable)/IIIB NSCLC riazole (NSC 609974, CAI, L-651582), CEA-cideR (Labetu and Stage IV NSCLC, small cell lung cancer (SCLC) includ 15 Zumab(R), Anti-CEA monoclonal antibody, hMN-14), ing limited stage SCLC and extensive stage SCLC as well as Cereport(R) (LobradimilR, RMP-7), CI-1033 (Pan-erbB RTK Malignant Pleural Mesothelioma. inhibitor), Cilengitide(R) (EMD-12 1974, integrin alphavbeta3 In preferred embodiments, agonistic antibodies of the antagonist), 9-cis retinoic acid (9-cRA), Cisplatin-liposomal present invention are used to treat, ameliorate and/or prevent (SPI-077), CMB-401 (Anti-PEM MAb?calicheamycin), lung cancer and premalignant conditions. Agonistic antibod CMT-3 (Metastat(R), CP-358774 (Tarceva(R, OS1-774, ies of the present invention may be used in combination with EGFR inhibitor), CT-2584 (Apra(R), DAB389-EGF (EGF one or more Surgical and/or radiological procedures and/or fusion toxin), DeaVacR) (CEA anti-idiotype vaccine), Decit therapeutic agents to treat, ameliorate and/or prevent lung abine (5-aza-2'-deoxyytidine), Diethylnorspermine cancer and premalignant conditions. Lung cancer which may (DENSPM), Dihydro-5-azacytidine, EGF-P64k Vaccine, be treated using agonistic antibodies of the present invention 25 Endostatin, Etanidazole (Radinyl(R), Exetecan mesylate includes, but is not limited to, non-Small cell lung cancer (DX-8951, DX-8951f), Exisulind (SAAND, AptosynR), (NSCLC) including early stage NSCLC (i.e., Stage IA/IB and cGMP-PDE2 and 5 inhibitor), FK-317 (FR-157471, Stage IIA/IIB), Stage IIIANSCLC, Stage IIA (unresectable)/ FR-70496), Flavopiridol (HMR-1275), Fotemustine (Mu IIIB NSCLC and Stage IV NSCLC, small cell lung cancer phoran R. Mustophoran R), G3139 (Genasense(R), GentaAn (SCLC) including limited stage SCLC and extensive stage 30 ticode(R), Bcl-2 antisense), Gadolinium texaphyrin (Motexa SCLC as well as Malignant Pleural Mesothelioma. fin gadolinium, Gd-Tex R, Xcytrin(R), GBC-590, GL331, In one preferred embodiment, agonistic antibodies of the Galarubicin hydrochloride (DA-125), GlufosfamideRS(O- invention are used to treat non-Small cell lung cancers. D-glucosyl-isofosfamide mustard, D19575, INN), GVAX Antibodies of the present invention may be administered in (GM-CSF gene therapy), INGN-101 (p53 gene therapy/ret combination with one or more therapeutic agents useful in the 35 rovirus), INGN-201 (p53 gene therapy/adenovirus), Iroful treatment of lung cancer and premalignant conditions includ ven (MGI-114), ISIS-2053, ISIS-3521 (PKC-alpha anti ing, but not limited to, BAY 43-9006 (Raf kinase inhibitor), sense), ISIS-5132 (K-ras/raf antisense), Isotretinoin Carboplatin (Paraplatin R, CBDCA), Chlorambucil (Leuke (13-CRA, 13-cis retinoic acid, Accutane(R), Lometrexol ran R), Cisplatin (Platinol R, CDDP), Cisplatin-epinephrine (T-64, T-904064), Marimastat(R) (BB-2516, TA-2516, MMP gel (Intral Dose(R), FocaCist(R), Cyclophosphamide (Cy 40 inhibitor), MDX-447 (BAB-447, EMD-82633, H-447, anti toxan R, Neosar.R, CTX), Docetaxel (TaxotereR), Taxane(R). EGFr/FcGammaR1r), MGV, Mitumomab R (BEC-2, EMD Doxorubicin (Adriamycin R, Doxil R, Rubex.R.), Edatrexate, 60205), Mivobulin isethionate (CI-980), Neovastat(R) (AE Epirubicin (Ellence(R), EPI, 4 epi-doxorubicin), Etoposide 941, MMP inhibitor), NPI-0052 (proteasome inhibitor), phosphate (Etopophos(R), Etoposide (VP-16, Vepesider), Onconase (Ranpimase(R), Onyx-015 (p53 gene therapy), Gemcitabine (GemtoR), Gemzar R), HerceptinR (Trastu 45 Pemetrexed disodium (Alimta R, MTA, multitargeted anti Zumab(R), Anti-HER-2 monoclonal antibody, Anti-EGFR-2 folate, LY 231514), Pivaloyloxymethylbutyrate (AN-9, Piv MAb), Ifosfamide (IFEX(R), Irinotecan (Camptosar R., CPT anex(R), Prinomastat(R) (AG-3340, MMP inhibitor), PS-341 11, Topotecin R., CaptoCPT-1), Lomustine (CCNUR), (LDP-341, 26S proteasome inhibitor), Pyrazoloacridine CeeNUR), Mechlorethamine (Nitrogen Mustard, HN Mus (NSC-366140, PD-115934), R115777 (Zarnestra(R), Raltitr targenR), Melphalan (L-PAM, Alkeran R, Phenylalanine 50 exed (Tomudex R, ZD-1694), R-flurbiprofen (Flurizan(R), mustard), Methotrexate R (MTX, Mexate R, Folex(R), Mito E-7869, MPC-7869), RFS-2000 (9-nitrocamptothecan, mycin C (Mitomycin R, Mutarnycin R, Mito Extra(R), Pacli 9-NC, Rubitecan R), RSR-13 (GSJ-61), Satraplatin (BMS taxel (Paxene R, TaxolR), Paclitaxel-DHA (Taxoprexin R), 182751, JM-216), SCH-66336, Sizofilan R (SPG, Sizofu Porfimer sodium (PhotofrinR), Procarbazine (Matulane(R). ran R. Schizophyllan R, Sonifilan R), Squalamine (MSI SKI-2053R(NSC-D644591), Teniposide (VM-26, 55 1256F), SR-49059 (vasopressin receptor inhibitor, V1a), Vumon(R), Topotecan (Hycamtin(R), SK&F-104864, NSC SU5416 (Semaxanib R, VEGF inhibitor), Taurolidine (Tau 609699, Evotopin(RV), Vinblastine (Velban R, VLB), Vinc rolin(R), Temozolamide (Temodar R, NSC 362856), Thalido ristine (Oncovin R, Onco TCS(R), VCR, Leurocristine(R), Vin mide and thalidomide analogs, including but not limited to, desine (Eldisine(R), Fildesin(R), and Vinorelbine lenalidomide (CC-5013, REVLIMIDR) and CC-4047 (AC (Navelbine(R). 60 TIMIDTM) Thymosin alpha I (Zadaxin(R), Thymalfasin(R), In preferred embodiments, agonistic antibodies of the Tirapazamine (SR-259075, SR-4233, Tirazone.R., Win invention are administered in combination with one or more 59075), TNP-470 (AGM-1470), TriAb(R) (anti-idiotype anti of the above-described therapeutic agents in the treatment, body immune stimulator), Tretinoin (Retin-AR, AtragenR), amelioration and/or prevention of lung cancers and prema ATRA, VesanoidR), Troxacitabine (BCH-204, BCH-4556, lignant conditions. 65 TroxatylR), Vitaxin R. (LM-609, integrin alphavbeta3 antago Further examples of therapeutic agents useful in the treat nistic MAb), XR-9576 (P-glycoprotein/MDR inhibitor), and ment of lung cancer and premalignant conditions which may ZD-1839 (IRESSAR). US 8,329,179 B2 105 106 In preferred embodiments, agonistic antibodies of the blastine+Mitomycin C, Cisplatin--Vinorelbine--Gemcitab invention are administered in combination with one or more ine, Cisplatin (Platinol R)+Oncovin R+Doxorubicin (Adria of the above-described therapeutic agents in the treatment, mycin R)+Etoposide (CODE), Cyclophosphamide+ amelioration and/or prevention of lung cancers and prema Adriamycin R+Cisplatin (PlatinolR) (CAP), lignant conditions. Cyclophosphamide+Adriamycin R+Vincristine (CAV), In one embodiment, antibodies of the present invention Cyclophosphamide+Epirubicin-i-Cisplatin (PlatinolR) may be administered in combination with a taxane. In another (CEP), Cyclophosphamide+Methotrexate--Vincristine embodiment, antibodies of the present invention may be (CMV), Cyclophosphamide-Adriamycin R, Methotrexate-- administered in combination with a taxane for the treatment Fluorouracil (CAMF), Cyclophosphamide-Adriamycin R, of lung cancers, such as non-Small cell lung cancer, that are 10 Methotrexate--Procarbazine (CAMP), Cyclophosphamide-- resistant to individual chemotherapies. In a specific embodi Adriamycin R, Vincristine--Etoposide (CAV-E), Cyclophos ment, antibodies of the present invention may be adminis phamide-Adriamycin R, Vincristine--Teniposide (CAV-T), tered in combination with Docetaxel (TaxotereR). In a spe Cyclophosphamide--OncovinR), Methotrexate--Fluorouracil cific embodiment, antibodies of the present invention may be (COMF), Cyclophosphamide+Adriamycin R+Vincristine, administered in combination with Docetaxel (TaxotereR) for 15 alternating with Cisplatin-Etoposide (CAV/PE), Docetaxel the treatment of lung cancers, such as non-small cell lung Gemcitabine, Docetaxel--Vinorelbine, Etoposide (Ve cancer, that are resistant to individual chemotherapies. pesider)+Ifosfamide--Cisplatin (Platinol R) (VIP), Etoposide In one embodiment, agonistic antibodies of the present (Vepesider)+Ifosfamide, Cisplatin--Epirubicin (VIC-E), invention may be administered in combination with a taxane. Fluorouracil--OncovinR+Mitomycin C (FOMi), Hydrazine-- In another embodiment, agonistic antibodies of the present Adriamycin R+Methotrexate (HAM), Ifosfamide--Doc invention may be administered in combination with a taxane etaxel, Ifosfamide--Etoposide, Ifosfamide+Gemcitabine, for the treatment of lung cancers, such as non-Small cell lung Ifosfamide--Paclitaxel, Ifosfamide--Vinorelbine, Ifosfa cancer, that are resistant to individual chemotherapies. In a mide--Carboplatin--Etoposide (ICE), Irinotecan+Docetaxel, specific embodiment, agonistic antibodies of the present Irinotecan+Etoposide, Irinotecan+Gemcitabine, Methotrex invention may be administered in combination with Doc 25 ate+Cisplatin, Methotrexate--Interferon alpha, Methotrex etaxel (TaxotereR). In a specific embodiment, agonistic anti ate+Vinblastine, Mitomycin C+Ifosfamide+Cisplatin (Plati bodies of the present invention may be administered in com nolR) (MIP), Mitomycin C+Vinblastine--ParaplatinR) bination with Docetaxel (TaxotereR) for the treatment of lung (MVP), Paraplatin R+Docetaxel, ParaplatinR+Etoposide, cancers, such as non-Small cell lung cancer, that are resistant ParaplatinR+Gemcitabine, ParaplatinR+Interferon alpha, to individual chemotherapies. 30 ParaplatinR+Irinotecan, ParaplatinR)+Paclitaxel, Parapl In one embodiment, antibodies of the present invention atinR+Vinblastine, ParaplatinR+Vindesine, ParaplatinR)+ may be administered in combination with a platinum-based Vinorelbine, Procarbazine--Oncovin R+CCNUR) (Lomus chemotherapeutic. In another embodiment, antibodies of the tine)+Cyclophosphamide (POCC), Vincristine (OncovinR)+ present invention may be administered in combination with a Adriamycin R+Procarbazine (VAP), and Vinorelbine-- platinum-based chemotherapeutic for the treatment of lung 35 Gemcitabine. cancers, such as non-Small cell lung cancer, that are resistant In preferred embodiments, agonistic antibodies of the to individual chemotherapies. In another specific embodi invention are administered in combination with one or more ment, antibodies of the invention may be administered in of the above-described therapeutic agent combinations in the combination with Carboplatin (Paraplatin R, CBDCA). In treatment, amelioration and/or prevention of lung cancers and another specific embodiment, antibodies of the present inven 40 premalignant conditions. tion may be administered in combination with Carboplatin In one embodiment, antibodies of the present invention (Paraplatin R, CBDCA) for the treatment of lung cancers, may be administered in combination with a taxane and a Such as non-Small cell lung cancer, that are resistant to indi platinum-based chemotherapeutic. In another embodiment, vidual chemotherapies. antibodies of the present invention may be administered in In one embodiment, agonistic antibodies of the present 45 combination with a taxane and a platinum-based chemothera invention may be administered in combination with a plati peutic for the treatment of lung cancers, such as non-small num-based chemotherapeutic. In another embodiment, ago cell lung cancer, that are resistant to individual chemothera nistic antibodies of the present invention may be administered pies. In a specific embodiment, antibodies of the present in combination with a platinum-based chemotherapeutic for invention may be administered in combination with Doc the treatment of lung cancers, such as non-small cell lung 50 etaxel (Taxotere?R) and Carboplatin (Paraplatin R, CBDCA). cancer, that are resistant to individual chemotherapies. In In another specific embodiment, antibodies of the present another specific embodiment, agonistic antibodies of the invention may be administered in combination with Doc invention may be administered in combination with Carbo etaxel (Taxotere?R) and tin (Paraplatin R, CBDCA) for the platin (Paraplatin R, CBDCA). In another specific embodi treatment of lung cancers, such as non-Small cell lung cancer, ment, agonistic antibodies of the present invention may be 55 that are resistant to chemotherapies. administered in combination with Carboplatin (ParaplatinR), In one embodiment, agonistic antibodies of the present CBDCA) for the treatment of lung cancers, such as non-small invention may be administered in combination with a taxane cell lung cancer, that are resistant to individual chemothera and a platinum-based chemotherapeutic. In another embodi pies. ment, agonistic antibodies of the present invention may be Preferred combinations of therapeutic agents useful in the 60 administered in combination with a taxane and a platinum treatment of lung cancer and premalignant conditions which based chemotherapeutic for the treatment of lung cancers, may be administered in combination with antibodies of the Such as non-Small cell lung cancer, that are resistant to indi present invention include, but are not limited to, Cisplatin-- vidual chemotherapies. In a specific embodiment, agonistic Docetaxel, Cisplatin--Etoposide, Cisplatin--Gemcitabine, antibodies of the present invention may be administered in Cisplatin-i-Interferon alpha, Cisplatin-i-Irinotecan, Cisplatin-- 65 combination with Docetaxel (Taxotere?R) and Carboplatin Paclitaxel, Cisplatin--Teniposide, Cisplatin--Vinblastine, (Paraplatin R, CBDCA). In another specific embodiment, Cisplatin--Vindesine, Cisplatin--Vinorelbine, Cisplatin--Vin agonistic antibodies of the present invention may be admin US 8,329,179 B2 107 108 istered in combination with Docetaxel (TexatereR) and Car In another embodiment, antibodies of the present invention boplatin (Paraplatin R, CBDCA) for the treatment of lung may be administered in combination with a fluoropyrimidine cancers, such as non-Small cell lung cancer, that are resistant for the treatment of colon cancer that is resistant to individual to individual chemotherapies. chemotherapies. In another specific embodiment, antibodies In further particular embodiments, antibodies of the of the invention may be administered in combination with present invention are used to treat, ameliorate and/or prevent Fluorouracil (5-FU, Adrucil(R). In another specific embodi colorectal cancer and premalignant conditions. Antibodies of ment, antibodies of the present invention may be adminis the present invention may be used in combination with one or tered in combination with Fluorouracil (5-FU, Adrucil(R) for more Surgical and/or radiological procedures and/or thera the treatment of colon cancer that is resistant to individual peutic agents to treat, ameliorate and/or prevent colorectal 10 chemotherapies. cancer and premalignant conditions. Colorectal cancers which may be treated using antibodies of the present inven In one embodiment, agonistic antibodies of the present tion include, but are not limited to, colon cancer (e.g., early invention may be administered in combination with a fluoro stage colon cancer (stage I and II), lymph node positive colon pyrimidine. In another embodiment, agonistic antibodies of cancer (stage 111), metastatic colon cancer (stage IV)) and 15 the present invention may be administered in combination rectal cancer. with a fluoropyrimidine for the treatment of colon cancer that In preferred embodiments, agonistic antibodies of the is resistant to individual chemotherapies. In another specific present invention are used to treat, ameliorate and/or prevent embodiment, agonistic antibodies of the invention may be colorectal cancer and premalignant conditions. Agonistic administered in combination with Fluorouracil (5-FU, Adru antibodies of the present invention may be used in combina cil(R). In another specific embodiment, agonistic antibodies tion with one or more Surgical and/or radiological procedures of the present invention may be administered in combination and/or therapeutic agents to treat, ameliorate and/or prevent with Fluorouracil (5-FU, Adrucil(R) for the treatment of colon colorectal cancer and premalignant conditions. Colorectal cancer that is resistant to individual chemotherapies. cancers which may be treated using agonistic antibodies of In preferred embodiments, agonistic antibodies of the the present invention include, but are not limited to, colon 25 invention are administered in combination with one or more cancer (e.g., early stage colon cancer (stage I and II), lymph of the above-described therapeutic agents in the treatment, node positive colon cancer (stage III), metastic colon cancer amelioration and/or prevention of colorectal cancers and pre (stage 1 V)) and rectal cancer. malignant conditions. In one preferred embodiment, agonistic antibodies of the Preferred combinations of therapeutic agents useful in the invention are used to treat colon cancer. 30 treatment of colorectal cancer and premalignant conditions Antibodies of the present invention may be administered in which may be administered in combination with antibodies of combination with one or more therapeutic agents useful in the the present invention include, but are not limited to, Fluorou treatment of colorectal cancer and premalignant conditions racil-Leucovorin, and Fluorouracil-i-Levamisole. including, but not limited to, Capecitabine (Xeloda R. Doxi In one embodiment, antibodies of the present invention fluridine(R), oral 5-FU), Fluorouracil (5-FU, Adrucil(R, Fluo 35 may be administered in combination with a topoisomerase roplex(R), Efudex(R), Irinotecan (Camptosar.R, CPT-11, Topo inhibitor and a fluoropyrimidine. In another embodiment, tecin.R., CaptoCPT-1), Leucovorin (LeucovorinR), antibodies of the present invention may be administered in WellcovorinR), and Levamisole (ErgamisolR). combination with a topoisomerase inhibitor and a fluoropy In one embodiment, antibodies of the present invention rimidine for the treatment of colon cancer, that are resistant to may be administered in combination with a topoisomerase 40 individual chemotherapies. In a specific embodiment, anti inhibitor. In another embodiment, antibodies of the present bodies of the present invention may be administered in com invention may be administered in combination with a topoi bination with Irinotecan (Camptosar R., CPT-11, Topotecin R, somerase inhibitor for the treatment of colon cancer that is CaptoCPT-1) and Fluorouracil (5-FU, Adrucil(R). In another resistant to individual chemotherapies. In a specific embodi specific embodiment, antibodies of the present invention may ment, antibodies of the present invention may be adminis 45 be administered in combination with Irinotecan (Camp tered in combination with Irinotecan (Camptosar.R, CPT-11, tosar(R), CPT-11, Topotecin.R., CaptoCPT-1) and Fluorouracil Topotecin R., CaptoCPT-1). In a specific embodiment, anti (5-FU, Adrucil(R) for the treatment of colon cancer that is bodies of the present invention may be administered in com resistant to individual chemotherapies. bination with Irinotecan (Camptosar R., CPT-11, Topotecin R, In one embodiment, agonistic antibodies of the present CaptoCPT-1) for the treatment of colon cancer that is resistant 50 invention may be administered in combination with a topoi to individual chemotherapies. Somerase inhibitor and a fluoropyrimidine. In another In one embodiment, agonistic antibodies of the present embodiment, agonistic antibodies of the present invention invention may be administered in combination with a topoi may be administered in combination with a topoisomerase Somerase inhibitor. In another embodiment, agonistic anti inhibitor and a fluoropyrimidine for the treatment of colon bodies of the present invention may be administered in com 55 cancer, that are resistant to individual chemotherapies. In a bination with a topoisomerase inhibitor for the treatment of specific embodiment, agonistic antibodies of the present colon cancer that is resistant to individual chemotherapies. In invention may be administered in combination with Irinote a specific embodiment, agonistic antibodies of the present can (Camptosar(R), CPT-11, Topotecin R., CaptoCPT-1) and invention may be administered in combination with Irinote Fluorouracil (5-FU, Adrucil(R). In another specific embodi can (Camptosar.R, CPT-11, Topotecin.R., CaptoCPT-1). In a 60 ment, agonistic antibodies of the present invention may be specific embodiment, agonistic antibodies of the present administered in combination with Irinotecan (Camptosar R, invention may be administered in combination with Irinote CPT-11, Topotecin(R), CaptoCPT-1) and Fluorouracil (5-FU, can (Camptosar(R), CPT-11, Topotecin.R., CaptoCPT-1) for the Adrucil(R) for the treatment of colon cancer, that are resistant treatment of colon cancer that is resistant to individual che to individual chemotherapies. motherapies. 65 In preferred embodiments, agonistic antibodies of the In one embodiment, antibodies of the present invention invention are administered in combination with one or more may be administered in combination with a fluoropyrimidine. of the above-described therapeutic agent combinations in the US 8,329,179 B2 109 110 treatment, amelioration and/or prevention of colorectal can with one or more Surgical and/or radiological procedures cers and premalignant conditions. and/or therapeutic agents to treat, ameliorate and/or prevent Further examples of therapeutic agents useful in the treat prostate cancer and premalignant conditions. Prostate cancer ment of colorectal cancer which may be administered in which may be treated using agonistic antibodies of the combination with antibodies of the present invention include, present invention includes, but is not limited to, benign pro but are not limited to, Aminocamptothecin (9-AC, 9-Ami Static hyperplasia, malignant prostate cancer (e.g., stage I. nocamptothecin, NSC 603071), Aplidine (Aplidin R, stage II, stage III or stage IV) and metastatic prostate cancer. AplidinaR), Bevacizumab(R) (Anti-VEGF monoclonal anti In one preferred embodiment, agonistic antibodies of the body, rhuMAb-VEGF), C225 (IMC-225, EGFR inhibitor, invention are used to treat malignant prostate cancer. In a Anti-EGFr MAb, Cetuximab(R), C242-DM1 (huC242 10 further preferred embodiment, agonistic antibodies of the DM1), CC49-Zeta gene therapy, CEA-cideR (Labetu invention are used to treat metastatic prostate cancer. Zumab(R), Anti-CEA monoclonal antibody, hMN-14), Antibodies of the present invention may be administered in CeaVac(R) (MAb3H1), CP-609754, CTP-37 (Avicine(R), hCG combination with one or more Surgical, radiological and/or blocking vaccine), Declopramide (Oxi-104), Eniluracil hormonal procedures useful in the treatment of prostate can (776c85), F19 (Anti-FAP monoclonal antibody, iodinated 15 cer and premalignant conditions including, but not limited to, anti-FAP MAb), FMdC (KW-2331, MDL-101731), FUDR prostatectomy (e.g., radical retropubic prostatectomy), exter (Floxuridine(R), Gemcitabine (Gemto(R), Gemzar(R), Hercep nal beam radiation therapy, brachytherapy, orchiectomy and tin R (Trastuzumab(R), Anti-HER-2 monoclonal antibody, hormone treatment (e.g., LHRH agonists, androgen receptor Anti-EGFR-2 MAb), Intoplicine (RP60475), L-778123 (Ras inhibitors). inhibitors), Leuvectin R. (cytofectin-i-IL-2 gene, IL-2 gene In preferred embodiments, agonistic antibodies of the therapy), MN-14 (Anti-CEA immunoradiotherapy, 131I present invention may be administered in combination with MN-14, Re-MN-14), OncoVAX-CL, OncoVAX-CL-Jen one or more Surgical, radiological and/or hormonal proce ner (GA-733-2 vaccine) Orzel(R) (Tegafur--Uracil-Leucov dures useful in the treatment of prostate cancer including, but orin), Oxaliplatin (Eloxatine(R), EloxatinR), Paclitaxel-DHA not limited to, prostatectomy (e.g., radical retropubic pros (Taxoprexin R), Pemetrexed disodium (Alimta R, MTA, mul 25 tatectomy), external beam radiation therapy, brachytherapy, titargeted antifolate, LY 231514), R115777 (Zamestra(R), orchiectomy and hormone treatment (e.g., LHRH agonists, Raltitrexed (Tomudex R, ZD-1694), SCH 66336, SU5416 androgen receptor inhibitors). (Semaxanib(R, VEGF inhibitor), Tocladesine (8-C1-cAMP), Antibodies of the present invention may be administered in Trimetrexate (Neutrexin R.), TS-1, and ZD-9331. combination with one or more therapeutic agents useful in the In preferred embodiments, agonistic antibodies of the 30 treatment of prostate cancer including, but not limited to, invention are administered in combination with one or more Aminoglutethimide (Cytadren(R), Biclutamide (Casodex(R), of the above-described therapeutic agents in the treatment, Cyclophosphamide (Cytoxan(R), Neosar R, CTX), Diethyl amelioration and/or prevention of colorectal cancers and pre stilbestrol (DES), Doxorubicin (Adriamycin R, Doxil R. malignant conditions. RubexcR). Flutamide (Eulexin R), Hydrocortisone, Ketocona Further exemplary combinations of therapeutic agents use 35 Zole (NiZoral(R), Leuprolide acetate (Viadur R. Lupron(R), ful in the treatment of colorectal cancer and premalignant Leuprogel(R), Eligard(R), Mitoxantrone (Novantrone.R., conditions which may be administered in combination with DHAD), Nilutamide (Nilandron(R), Paclitaxel (Paxene R, antibodies of the present invention include, but are not limited TaxolR), Paclitaxel-DHA (Taxoprexin R), PC SPES, Pred to, Aminocamptothecin--G-CSF, Bevacizumab R+Fluorou nisone, Triptorelin pamoate (Trelstar Depot(R), Decapep racil, Bevacizumab R+Leucovorin, Bevacizumab R+Fluo 40 tyl(R), and Vinblastine (Velban R, VLB). rouracil-Leucovorin, Cyclophosphamide--SCH 6636, Fluo In preferred embodiments, agonistic antibodies of the rouracil--CeaVacR), Fluorouracil--Oxaliplatin, Fluorouracil invention are administered in combination with one or more Raltitrexed, Fluorouracil--SCH 6636, Fluorouracil of the above-described therapeutic agents in the treatment, Trimetrexate, Fluorouracil-Leucovorin--Oxaliplatin, amelioration and/or prevention of prostate cancers and pre Fluorouracil-Leucovorin-Trimetrexate, Irinotecan+C225 45 malignant conditions. (Cetuximab(R), OncovinR+SCH 6636, Oxaliplatin-i-Leucov Further examples of therapeutic agents useful in the treat orin, Paclitaxel--SCH 6636, Pemetrexed disodium+Gemcit ment of prostate cancer which may be administered in com abine, and Trimetrexate--Leucovorin. bination with antibodies of the present invention include, but In preferred embodiments, agonistic antibodies of the are not limited to, Abarelix R (Abarelix-Depot-MR), PPI-149, invention are administered in combination with one or more 50 R-3827); Abiraterone Acetate R (CB-7598, CB-7630), ABT of the above-described therapeutic agent combinations in the 627 (ET-1 inhibitor), APC-8015 (ProvengeR), Dendritic cell treatment, amelioration and/or prevention of colorectal can therapy), Avorelin R (Meterelin R, MF-6001, EP-23904), cers and premalignant conditions. CEP-701 (KT-5555), CN-706, CT-2584 (Apra(R, CT-2583, In further particular embodiments, antibodies of the CT-2586, CT-3536), GBC-590, Globo H hexasaccharide present invention are used to treat, ameliorate and/or prevent 55 (Globo H-KLHR), Interferon alpha 2a (Intron A(R), Liaro prostrate cancer and premalignant conditions. Antibodies of zole (Liazal, Liazol, R-75251, R-85246, Ro-85264), MDX the present invention may be used in combination with one or 447 (MDX-220, BAB-447, EMD-82633, H-447, anti-EGFr/ more Surgical and/or radiological procedures and/or thera FcGammaR1r), NPI-0052 (proteasome inhibitor), peutic agents to treat, ameliorate and/or prevent prostate can OncoVAX-P (OncoVAX-PrPSA), PROSTVAC, PS-341 cer. Prostate cancer which may be treated using antibodies of 60 (LDP-341,26S proteasome inhibitor), PSMA MAb (Prostate the present invention includes, but is not limited to, benign Specific Membrane Antigen monoclonal antibody), and prostatic hyperplasia, malignant prostate cancer (e.g., stage I. R-flurbiprofen (Flurizan R, E-7869, MPC-7869). stage II, stage III or stage IV) and metastatic prostate cancer. In preferred embodiments, agonistic antibodies of the In preferred embodiments, agonistic antibodies of the invention are administered in combination with one or more present invention are used to treat, ameliorate and/or prevent 65 of the above-described therapeutic agents in the treatment, prostate cancer and premalignant conditions. Agonistic anti amelioration and/or prevention of prostate cancers and pre bodies of the present invention may be used in combination malignant conditions. US 8,329,179 B2 111 112 Preferred combinations of therapeutic agents useful in the Gemcitabine, Docetaxel--Gemcitabine, Irinotecan+Fluorou treatment of prostate cancer which may be administered in racil, Irinotecan+Gemcitabine, and Paclitaxel--Gemcitabine. combination with antibodies of the present invention include, In preferred embodiments, agonistic antibodies of the but are not limited to, Docetaxel--Estramustine, Mitox invention are administered in combination with one or more antrone--Hydrocortisone, Mitoxantrone--Prednisone, Navel of the above-described therapeutic agent combinations in the bine--Estramustine, Paclitaxel--Estramustine, and Vinblas treatment, amelioration and/or prevention of pancreatic can tine--Estramustine. cers and premalignant conditions. In preferred embodiments, agonistic antibodies of the Further examples of therapeutic agents useful in the treat invention are administered in combination with one or more ment of pancreatic cancer which may be administered in of the above-described therapeutic agent combinations in the 10 combination with antibodies of the present invention include, treatment, amelioration and/or prevention of prostate cancers but are not limited to, ABX-EGF (anti-EGFr MAb), Acetyl and premalignant conditions. dinaline (CI-994, GOE-5549, GOR-5549, PD-130636), In further particular embodiments, antibodies of the BMS-214662 (BMS-192331, BMS-193269, BMS-206635), present invention are used to treat, ameliorate and/or prevent BNP-1350 (BNPI-1100, Karenitecins), C225 (IMC-225, pancreatic cancer and premalignant conditions. Antibodies of 15 EGFR inhibitor, Anti-EGFr MAb, Cetuximab(R), C242-DM1 the present invention may be used in combination with one or (huC242-DM1, SB-408075), Carbendazin R) (FB-642), Can more Surgical and/or radiological procedures and/or thera nustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), CMT-3 peutic agents to treat, ameliorate and/or prevent pancreatic (COL-3, Metastat(R), CP-358774 (Tarceva(R, OSI-774, cancer and premalignant conditions. Pancreatic cancers EGFR inhibitor), Docetaxel (Taxotere?R), Taxane.(R), Exete which may be treated using antibodies of the present inven can mesylate (DX-8951, DX-8951f), Flavopiridol (HMR tion include, but are not limited to, adenocarcinoma, endo 1275), GastrimmuneR (Anti-gastrin-17 immunogen, anti crine (islet cell) tumors, tumors confined to the pancreas, g17), GBC-590, Herceptin R (Trastuzumab(R), Anti-HER-2 locally advanced pancreatic cancer and metastatic pancreatic monoclonal antibody, Anti-EGFR-2 MAb), HSPPC-96 (HSP CaCC. cancer vaccine, gp96 heat shock protein-peptide complex), In preferred embodiments, agonistic antibodies of the 25 Irofulven (MGI-114), ISIS-2503 (Ras antisense), Onyx-015 present invention are used to treat, ameliorate and/or prevent (p53 gene therapy), Paclitaxel (Paxene.R., Taxol.R.), Pemetr pancreatic cancer and premalignant conditions. Agonistic exed disodium (Alimta R, MTA, multitargeted antifolate, LY antibodies of the present invention may be used in combina 231514), Perillyl alcohol (perilla alcohol, perillic alcohol, tion with one or more Surgical and/or radiological procedures perillol, NSC-641066), RFS-2000 (9-nitrocamptothecan, and/or therapeutic agents to treat, ameliorate and/or prevent 30 9-NC, Rubitecan R), and Rituximab.R. (Rituxan R, anti-CD20 pancreatic cancer and premalignant conditions. Pancreatic MAb). cancers which may be treated using agonistic antibodies of In preferred embodiments, agonistic antibodies of the the present invention include, but are not limited to, adeno invention are administered in combination with one or more carcinoma, endocrine (islet cell) tumors, tumors confined to of the above-described therapeutic agents in the treatment, the pancreas, locally advanced pancreatic cancer and meta 35 amelioration and/or prevention of pancreatic cancers and pre static pancreatic cancer. malignant conditions. In one preferred embodiment, agonistic antibodies of the In further particular embodiments, antibodies of the invention are used to treat locally advanced pancreatic cancer. present invention are used to treat, ameliorate and/or prevent In a further preferred embodiment, agonistic antibodies of the hepatic cancer and premalignant conditions. Antibodies of invention are used to treat metastatic pancreatic cancer. 40 the present invention may be used in combination with one or Antibodies of the present invention may be administered in more Surgical and/or radiological procedures and/or thera combination with one or more Surgical and/or radiological peutic agents to treat, ameliorate and/or prevent hepatic can procedures useful in the treatment of pancreatic cancer cer and premalignant conditions. Hepatic cancers which may including, but not limited to, pancreaticoduodenumectomy be treated using antibodies of the present invention include, (Whipple resection). 45 but are not limited to, hepatocellular carcinoma, malignant In preferred embodiments, agonistic antibodies of the hepatoma, cholangiocarcinoma, mixed hepatocellular cho present invention may be administered in combination with langiocarcinoma or hepatoblastoma. one or more Surgical and/or radiological procedures useful in In preferred embodiments, agonistic antibodies of the the treatment of pancreatic cancer including, but not limited present invention are used to treat, ameliorate and/or prevent to, pancreaticoduodenumectomy (Whipple resection). 50 hepatic cancer and premalignant conditions. Agonistic anti Antibodies of the present invention may be administered in bodies of the present invention may be used in combination combination with one or more therapeutic agents useful in the with one or more Surgical and/or radiological procedures treatment of pancreatic cancer including, but not limited to, and/or therapeutic agents to treat, ameliorate and/or prevent Capecitabine (Xeloda(R), Doxifluridine(R), oral 5-FU), Cispl hepatic cancer and premalignant conditions. Hepatic cancers atin (Platinol R, CDDP), Fluorouracil (5-FU, Adrucil(R), Fluo 55 which may be treated using agonistic antibodies of the roplex(R), Efudex(R), Gemcitabine (Gemto(R), Gemzar(R), and present invention include, but are not limited to, hepatocellu Irinotecan (Camptosar(R), CPT-11, Topotecin R. CaptoCPT lar carcinoma, malignant hepatoma, cholangiocarcinoma, 1). mixed hepatocellular cholangiocarcinoma or hepatoblas In preferred embodiments, agonistic antibodies of the tOma. invention are administered in combination with one or more 60 In one preferred embodiment, agonistic antibodies of the of the above-described therapeutic agents in the treatment, invention are used to treat hepatoblastoma. In one further amelioration and/or prevention of pancreatic cancers and pre preferred embodiment, agonistic antibodies of the invention malignant conditions. are used to treat hepatocellular carcinoma. Preferred combinations of therapeutic agents useful in the Antibodies of the present invention may be administered in treatment of pancreatic cancer which may be administered in 65 combination with one or more Surgical and/or radiological combination with antibodies of the present invention include, procedures useful in the treatment of hepatic cancers includ but are not limited to, Cisplatin--Gemcitabine, CP-358774+ ing, but not limited to, partial hepatectomy, liver transplant, US 8,329,179 B2 113 114 radiofrequency ablation, laser therapy, microwave therapy, premalignant conditions including, but not limited to, hyster cryoSurgery, percutaneous ethanol injection, hepatic arterial ectomy, oophorectomy, hysterectomy with bilateral salpingo infusion, hepatic artery ligation, chemoembolization and oophorectomy, omentectomy, tumor debulking, external external beam radiation therapy. beam radiation therapy and intraperitoneal radiation therapy. In preferred embodiments, agonistic antibodies of the 5 In preferred embodiments, agonistic antibodies of the present invention may be administered in combination with present invention may be administered in combination with one or more Surgical and/or radiological procedures useful in one or more Surgical and/or radiological procedures useful in the treatment of hepatic cancers and premalignant conditions the treatment of ovarian cancer and premalignant conditions including, but not limited to, partial hepatectomy, liver trans including, but not limited to, hysterectomy, oophorectomy, plant, radiofrequency ablation, laser therapy, microwave 10 hysterectomy with bilateral salpingo-oophorectomy, oment therapy, cryoSurgery, percutaneous ethanol injection, hepatic ectomy, tumor debulking, external beam radiation therapy arterial infusion, hepatic artery ligation, chemoembolization and intraperitoneal radiation therapy. and external beam radiation therapy. Antibodies of the present invention may be administered in Antibodies of the present invention may be administered in combination with one or more therapeutic agents useful in the combination with one or more therapeutic agents useful in the 15 treatment of ovarian cancer and premalignant conditions treatment of hepatic cancer and premalignant conditions including, but not limited to. Altretamine (Hexylen R, hexam including, but not limited to, Aldesleukin (IL-2, Proleukin R), ethylmelamine, Hexastat(R), Bleomycin (Blenoxane(R). Car Cisplatin (Platinol R, CDDP), Doxorubicin (Adriamycin R, boplatin (Paraplatin R, CBDCA), Cisplatin (Platinol R, Doxil R. Rubex.R.), Etoposide phosphate (Etopophos(R), Eto CDDP), Cyclophosphamide (Cytoxan R, Neosar.R, CTX), poside (VP-16, VepesidR), Fluorouracil (5-FU, Adrucil(R, 20 Dactinomycin (CosmegenR), Doxorubicin (Adriamycin R, Fluoroplex(R), Efudex(R), 1-131 Lipidiol R, Ifosfamide Doxil R. Rubex.R.), Etoposide phosphate (Etopophos(R), Eto (IFEXR), Megestrol acetate (Megace(R), Pallace(R), Pravasta poside (VP-16, VepesidR), Fluorouracil (5-FU, Adrucil(R), tin sodium (PravacholR), and Vincristine (OncovinR), Onco Fluoroplex(R), Efudex(R), Gemcitabine (Gemto(R), Gemzar R), TCS(R), VCR, LeurocristineR). Ifosfamide (IFEXR), Irinotecan (Camptosar.R, CPT-11, In preferred embodiments, agonistic antibodies of the 25 Topotecin R., CaptoCPT-1), Leucovorin (LeucovorinR), Weli invention are administered in combination with one or more covorinR), Melphalan (L-PAM, Alkeran R, Phenylalanine of the above-described therapeutic agents in the treatment, mustard), Paclitaxel (Paxene.R., Taxol.R.), Tamoxifen (Nolva amelioration and/or prevention of hepatic cancers and prema dex(R), Vinblastine (Velban R, VLB) and Vincristine (On lignant conditions. covinR, Onco TCS(R), VCR, LeurocristineR). Preferred combinations of therapeutic agents useful in the 30 In preferred embodiments, agonistic antibodies of the treatment of hepatic cancer and premalignant conditions invention are administered in combination with one or more which may be administered in combination with antibodies of of the above-described therapeutic agents in the treatment, the present invention include, but are not limited to, Cispl amelioration and/or prevention of ovcarian cancers and pre atin--Doxorubicin, Cisplatin-Etoposide, Cisplatin--Vincris malignant conditions. tine--Fluorouracil, and Ifosfamide--Cisplatin--Doxorubicin. 35 Preferred combinations of therapeutic agents useful in the In preferred embodiments, agonistic antibodies of the treatment of ovarian cancer and premalignant conditions invention are administered in combination with one or more which may be administered in combination with antibodies of of the above-described therapeutic agent combinations in the the present invention include, but are not limited to, Bleomy treatment, amelioration and/or prevention of hepatic cancers cin--Etoposide+Platinol R (Cisplatin) (BEP), Carboplatin-- and premalignant conditions. 40 Cyclophosphamide, Carboplatin--Paclitaxel, Carboplatin-- In further particular embodiments, antibodies of the Etoposide+Bleomycin (CEB), Cisplatin-- present invention are used to treat, ameliorate and/or prevent Cyclophosphamide, Cisplatin--Etoposide, Cisplatin-- ovarian cancer. Antibodies of the present invention may be Paclitaxel, Cisplatin-i-Ifosfamide--Vinblastine, Fluorouracil used in combination with one or more Surgical and/or radio Leucovorin, Platinolg (Cisplatin)+Vinblastine--Bleomycin logical procedures and/or therapeutic agents to treat, amelio- 45 (PVB), and Vincristine--Dactinomycin-Cyclophosphamide. rate and/or prevent ovarian cancer. Ovarian cancers which In preferred embodiments, agonistic antibodies of the may be treated using antibodies of the present invention invention are administered in combination with one or more include, but are not limited to, epithelial carcinoma, germ cell of the above-described therapeutic agent combinations in the tumors and stromal tumors. treatment, amelioration and/or prevention of ovarian cancers In preferred embodiments, agonistic antibodies of the 50 and premalignant conditions. present invention are used to treat, ameliorate and/or prevent In further particular embodiments, antibodies of the ovarian cancer and premalignant conditions. Agonistic anti present invention are used to treat, ameliorate and/or prevent bodies of the present invention may be used in combination Ewing's sarcoma. Antibodies of the present invention may be with one or more Surgical and/or radiological procedures used in combination with one or more Surgical and/or radio and/or therapeutic agents to treat, ameliorate and/or prevent 55 logical procedures and/or therapeutic agents to treat, amelio ovarian cancer and premalignant conditions. Ovarian cancers rate and/or prevent Ewing's sarcoma. Ewing's sarcoma fam which may be treated using agonistic antibodies of the ily tumors which may be treated using antibodies of the present invention include, but are not limited to, epithelial present invention include, but are not limited to, Ewings carcinoma, germ cell tumors and stromal tumors. tumor of bone (ETB), extraosseus Ewings (EOE), primitive In one preferred embodiment, agonistic antibodies of the 60 neuroectodermal tumors (PNET or peripheral neuroepithe invention are used to treat germ cell tumors and premalignant lioma) and Askin's tumor. conditions. In one further preferred embodiment, agonistic In preferred embodiments, agonistic antibodies of the antibodies of the invention are used to treat epithelial carci present invention are used to treat, ameliorate and/or prevent Oa. Ewing's sarcoma. Agonistic antibodies of the present inven Antibodies of the present invention may be administered in 65 tion may be used in combination with one or more Surgical combination with one or more Surgical and/or radiological and/or radiological procedures and/or therapeutic agents to procedures useful in the treatment of ovarian cancer and treat, ameliorate and/or prevent Ewing's sarcoma. Ewings US 8,329,179 B2 115 116 sarcoma family tumors which may be treated using agonistic bination with one or more Surgical and/or radiological proce antibodies of the present invention include, but are not limited dures and/or therapeutic agents to treat, ameliorate and/or to, Ewings tumor of bone (ETB), extraosseus Ewings prevent hematological cancers and premalignant conditions. (EOE), primitive neuroectodermal tumors (PNET or periph Hematological cancers which may be treated using agonistic eral neuroepithelioma) and Askin's tumor. antibodies of the present invention include, but are not limited In one preferred embodiment, agonistic antibodies of the to, non-Hodgkin’s lymphoma (e.g., Small lymphocytic lym invention are used to treat Ewings tumor of bone. In one phoma, follicular center cell lymphoma, lymphoplasmacy further referred embodiment, agonistic antibodies of the toid lymphoma, marginal Zone lymphoma, mantle cell lym invention are used to treat peripheral neuroepithelioma. phoma, immunoblastic lymphoma, burkitt's lymphoma, Antibodies of the present invention may be administered in 10 lymphoblastic lymphoma, peripheral T-cell lymphoma, ana combination with one or more Surgical and/or radiological plastic large cell lymphoma and intestinal T-cell lymphoma), procedures useful in the treatment of Ewings sarcoma family leukemia, acute lymphocytic leukemia, chronic lymphocytic tumors. leukemia and plasma cell neoplasms including multiple In preferred embodiments, agonistic antibodies of the myeloma. invention are administered in combination with one or more 15 In one preferred embodiment, agonistic antibodies of the Surgical and/or radiological procedures useful in the treat invention are used to treat plasma cell neoplasms. In a specific ment of Ewing's sarcoma family tumors. embodiment, that plasma cell neoplasm is multiple myeloma. Antibodies of the present invention may be administered in In another preferred embodiment, agonistic antibodies of combination with one or more therapeutic agents useful in the the invention are used to treat non-Hodgkin’s lymphoma. treatment of Ewing's sarcoma family tumors including, but In another preferred embodiment, agonistic antibodies of not limited to, Cyclophosphamide (Cytoxan R, Neosar R, the invention are used to treat leukemia. In a specific embodi CTX), Doxorubicin (Adriamycin R, Doxil R, Rubex.R.), Eto ment, that leukemia is acute lymphocytic leukemia. In poside phosphate (Etopophos(R), Etoposide (VP-16, another specific embodiment, that leukemia is chronic lym Vepesider), Filgrastim (Neupogen R, G-CSF), Ifosfamide phocytic leukemia. (IFEX(R), Topotecan (Hycamtin R, SK&F-104864, NSC 25 Antibodies of the present invention may be administered in 609699, Evotopin(R), and Vincristine (OncovinR, Onco combination with one or more Surgical and/or radiological TCS(R), VCR, LeurocristineR). procedures useful in the treatment of hematological cancer In preferred embodiments, agonistic antibodies of the and premalignant conditions including, but not limited to, invention are administered in combination with one or more bone marrow transplantation, external beam radiation and of the above-described therapeutic agents in the treatment, 30 total body irradiation. amelioration and/or prevention of Ewing's sarcoma family In preferred embodiments, agonistic antibodies of the tumors. invention are administered in combination with one or more Preferred combinations of therapeutic agents useful in the Surgical and/or radiological procedures useful in the treat treatment of Ewing's sarcoma family tumors which may be ment of hematological cancer and premalignant conditions administered in combination with antibodies of the present 35 including, but not limited to, bone marrow transplantation, invention include, but are not limited to, Cyclophosphamide-- external beam radiation and total body irradiation. Topotecan, Cyclophosphamide--Doxorubicin--Vincristine, In one preferred embodiment, agonistic antibodies of the Cyclophosphamide+Doxorubicin--Vincristine, alternating present invention may be administered in combination with with Ifosfamide+Etoposide andcyclophosphamide+Doxoru one or more Surgical and/or radiological procedures useful in bicin--Vincristine, alternating with Filgrastim+Ifosfamide-- 40 the treatment of multiple myeloma including, but not limited Etoposide. to, allogeneic bone marrow transplantation and peripheral In preferred embodiments, agonistic antibodies of the stem cell Support. invention are administered in combination with one or more In another preferred embodiment, agonistic antibodies of of the above-described therapeutic agent combinations in the the present invention may be administered in combination treatment, amelioration and/or prevention of Ewings sar 45 with one or more Surgical and/or radiological procedures coma family tumors. useful in the treatment of non-Hodgkin’s lymphoma includ In further particular embodiments, antibodies of the ing, but not limited to, allogeneic bone marrow transplanta present invention are used to treat, ameliorate and/or prevent tion and peripheral stem cell Support. hematological cancers and premalignant conditions. Anti In further specific embodiments, agonistic antibodies of bodies of the present invention may be used in combination 50 the present invention may be administered in combination with one or more Surgical and/or radiological procedures with one or more Surgical and/or radiological procedures and/or therapeutic agents to treat, ameliorate and/or prevent useful in the treatment of leukemia including, but not limited hematological cancers and premalignant conditions. Hema to, allogeneic bone marrow transplantation and peripheral tological cancers which may be treated using antibodies of stem cell Support. In one specific preferred embodiment, ago the present invention include, but are not limited to, non 55 nistic antibodies of the invention are used to treat acute lym Hodgkin’s lymphoma (e.g., Small lymphocytic lymphoma, phocytic leukemia (ALL). In another specific preferred follicular center cell lymphoma, lymphoplasmacytoid lym embodiment, agonistic antibodies of the invention are used to phoma, marginal Zone lymphoma, mantle cell lymphoma, treat chronic lymphocytic leukemia (CLL). immunoblastic lymphoma, burkitt's lymphoma, lymphoblas Antibodies of the present invention may be administered in tic lymphoma, peripheral T-cell lymphoma, anaplastic large 60 combination with one or more therapeutic agents useful in the cell lymphoma and intestinal T-cell lymphoma), leukemia, treatment of multiple myeloma including, but not limited to, acute lymphocytic leukemia, chronic lymphocytic leukemia Alkylating agents, Anthracyclines, Carmustine (DTI-015. and plasma cell neoplasms including multiple myeloma. BCNU, BiCNU, Gliadel WaferR), Cyclophosphamide (Cy In preferred embodiments, agonistic antibodies of the toxan R, Neosar.R, CTX), Dexamethasone (Decadron(R), present invention are used to treat, ameliorate and/or prevent 65 Doxorubicin (Adriamycin R, Doxil R. RubeXR), Melphalan hematological cancers and premalignant conditions. Agonis (L-PAM, Alkeran R, Phenylalanine mustard), Prednisone, tic antibodies of the present invention may be used in com Thalidomide and thalidomide analogs, including but not lim US 8,329,179 B2 117 118 ited to, lenalidomide (CC-5013, REVLIMIDR) and CC-4047 (BSAb)+Chlorambucil, Anti-idiotype therapy (BSAb)+Inter (ACTIMIDTM), and Vincristine (Oncovorin R, Onco TCS(R), leukin-2, BCNU (Carmustine)+Etoposide--Ara-C (Cytara VCR, LeurocristineR). bine)+Melphalen (BEAM), Bleomycin--Etoposide-Adria In preferred embodiments, agonistic antibodies of the mycin-i-Cyclophosphamide--Vincristine--Procarbazine-- invention are administered in combination with one or more Prednisone (BEACOPP), Bryostatin--Vincristine, of the above-described therapeutic agents in the treatment, Cyclophosphamide+BCNU (Carmustine)+VP-16 (Etopo amelioration and/or prevention of multiple myeloma. side) (CBV), Cyclophosphamide--Vincristine--Prednisone Preferred combinations of therapeutic agents useful in the (CVP), Cyclophosphamide+Adriamycin R. (Hydroxyldauno treatment of multiple myeloma which may be administered in mycin)+Vincristine (Oncovorin)+Prednisone (CHOP), combination with antibodies of the present invention include, 10 Cyclophosphamide+Novantrone(R) (Mitoxantrone)+Vincris but are not limited to, Cyclophosphamide--Prednisone, Mel tine (Oncovorin)+Prednisone (CNOP), Cyclophosphamide-- phalan+Prednisone (MP), Vincristine-Adriamycin R+Dex Doxorubicin--Teniposide+Prednisone, Cyclophosphamide-- amethasone (VAD), Vincristine--Carmustine--Melphalan+ Adriamycin R (Hydroxyldaunomycin)+Vincristine Cyclophosphamide+Prednisone (VBMCP; the M2 protocol), (Oncovorin)+Prednisone+Rituximab (CHOP+Rituximab), and Vincristine--Melphalan+Cyclophosphamide+Pred 15 Cyclophosphamide+Doxorubicin--Teniposide--Prednisone-- nisone alternating with Vincristine--Carmustine--Doxorubi Interferon alpha, Cytarabine--Bleomycin--Vincristine--Meth cin--Prednisone (VMCP/VBAP). otrexate (CytaBOM), Dexamethasone+Cytarabine--Cispl In preferred embodiments, agonistic antibodies of the atin (DHAP), Dexamethasone+Ifosfamide--Cisplatin-- invention are administered in combination with one or more Etoposide (DICE), Doxorubicin--Vinblastine-- of the above-described therapeutic agent combinations in the Mechlorethamine--Vincristine--Bleomycin--Etoposide+ treatment, amelioration and/or prevention of multiple Prednisone (Stanford V), Etoposide+Vinblastine-- myeloma. Adriamycin (EVA), Etoposide+Methylprednisone+ Antibodies of the present invention may be administered in Cytarabine--Cisplatin (ESHAP), Etoposide--Prednisone-- combination with one or more therapeutic agents useful in the Ifosfamide--Cisplatin (EPIC), Fludarabine, Mitoxantrone-- treatment of non-Hodgkin’s lymphoma including, but not 25 Dexamethasone (FMD). Fludarabine, Dexamethasone, limited to, 2-chlorodeoxyadenosine, Amifostine (Ethyol(R), Cytarabine (ara-C), +Cisplatin (Platinol R) (FluDAP), Ifosfa Ethiofos(R), WR-272), Bexarotene (Targretin R, Targretin mide+Cisplatin-Etoposide (ICE), Mechlorethamine--On Gel R., Targretin Oral R, LGD1069), Bleomycin (Blenox covinR (Vincristine)+Procarbazine--Prednisone (MOPP), ane(R), Busulfan (BusulfeXR), Myleran R), Carboplatin (Para Mesna--Ifosfamide--Idarubicin--Etoposide (MIZE), Methotr platin R, CBDCA), Carmustine (DTI-015, BCNU, BiCNU, 30 exate with leucovorin rescue--Bleomycin-i-Adriamycin-i-Cy Gliadel WaferR), Chloranbucil (Leukeran R), Cisplatin clophosphamide--Oncovorin-i-Dexamethasone (m-BACOD), (Platinol R, CDDP), Cladribine (2-CdA, Leustatin(R), Cyclo Prednisone+Methotrexate-Adriamycin-i-Cyclophospha phosphamide (Cytoxan R, Neosar.R, CTX), Cytarabine (Cy mide+Etoposide (ProMACE). Thiotepa+Busulfan-i-Cyclo tosar-UR), ara-C, cytosine arabinoside, DepoCytR), Dacar phosphamide. Thiotepa+BuSulfan-i-Melphalan, Topotecan bazine (DTIC), Daunorubicin (Daunomycin, DaunoXomeR), 35 Paclitaxel, and Vincristine (OncovinR)+Adriamycin R+ Daunorubicinr), Cerubidine(R), Denileukin diftitox (On Dexamethasone (VAD). takR), Dexamethasone (Decadron(R), Dolasetron mesylate In preferred embodiments, agonistic antibodies of the (Anzemet(R), Doxorubicin (Adriamycin R, Doxil(R), invention are administered in combination with one or more Rubex(R), Erythropoietin (EPOR, Epogen R, ProcritR), Eto of the above-described therapeutic agent combinations in the poside phosphate (Etopophos(R), Etoposide (VP-16, 40 treatment, amelioration and/or prevention of non-Hodgkin’s VepesidR), Fludarabine (Fludara R, FAMP), Granisetron lymphoma. (Kytril.R.), Hydrocortisone, Idarubicin (Idamycin R, DMDR, Further examples of therapeutic agents useful in the treat IDA), Ifosfamide (IFEX(R), Interferon alpha (Alfaferone(R), ment of non-Hodgkin’s lymphoma which may be adminis Alpha-IFR), Interferon alpha 2a (Intron A(R), Mechlore tered in combination with antibodies of the present invention thamine (Nitrogen Mustard, HN MustargenR), Melphalan 45 include, but are not limited to, A007 (4-4'-dihydroxyben (L-PAM, Alkeran R, Phenylalanine mustard), Methotrexate R Zophenone-2,4-dinitrophenylhydrazone), AG-2034 (AG (MTX, Mexate R, Folex(R), Methylprednisolone (Sol 2024, AG-2032, GARFT glycinamide ribonucleoside trans umedrolR), Mitoxantrone (Novantrone(R), DHAD), formylase inhibitor), Aldesleukin (IL-2, Proleukin R), Ondansetron (ZofranR), Pentostatin (Nipent(R), 2-deoxyco Alemtuzumab (Campath(R), Alitretinoin (Panretin R, LGN formycin), Perfosfamide (4-hydroperoxycyclophosphamide, 50 1057), Altretamine (Hexylen R, hexamethylmelamine, Hex 4-HC), Prednisone, Procarbazine (Matulane(R), Rituximab(R) astat(R), Aminocamptothecin (9-AC, 9-Aminocamptothecin, (Rituxan R, anti-CD20 MAb), Thiotepa (triethylenethiophos NSC 603071), Anti-CD19/CD3 MAb (anti-CD19/CD3 scFv, phaoramide. Thioplex(R), Topotecan (Hycamtin R, SK&F- anti-NHL MAb), Anti-idiotype therapy (BSAb), Arabino 104864, NSC-609699, Evotopin(R), Vinblastine (Velban(R), sylguanine (Ara-G, GW506U78), Arsenic trioxide (Trise VLB), Vincristine (Oncovin(R), Onco TCS(R), VCR, Leuroc 55 nox R, ATO), B43-Genistein (anti-CD19 Ab/genistein conju ristine(R) and Vindesine (Eldisine(R), Fildesin(R)). gate), B7 antibody conjugates, Betathine (Beta-LT). BLyS In preferred embodiments, agonistic antibodies of the antagonists, Bryostatin-1 (BryostatinR), BMY-45618, NSC invention are administered in combination with one or more 339555), CHML (Cytotropic Heterogeneous Molecular Lip of the above-described therapeutic agents in the treatment, ids), Clofarabine (chloro-fluoro-araA), Daclizumab (Zena amelioration and/or prevention of non-Hodgkin’s lym 60 pax(R), Depsipeptide (FR901228, FK228), Dolastatin-10 phoma. (DOLA-10, NSC-376128), Epirubicin (Ellence R, EPI, 4 epi Preferred combinations of therapeutic agents useful in the doxorubicin), EpratuZumab (Lymphocide(R), humanized anti treatment of non-Hodgkin’s lymphoma which may be admin CD22, HAT), Fly3/flk2 ligand (MobistaR), G3139 (Gena istered in combination with antibodies of the present inven sense(R), Genta Anticode(R), Bcl-2 antisense), HulD10 (anti tion include, but are not limited to, Adriamycin R+Blenox 65 HLA-DR MAb, SMART ID10), HumaLYM (anti-CD20 ane+Vinblastine--Dacarbazine (ABVD), Anti-idiotype MAb), Ibritumomab tiuxetan (Zevalin R), Interferon gamma therapy (BSAb)+Interferon alpha, Anti-idiotype therapy (Gamma-interferon, Gamma 1000, Gamma-IF), Irinotecan US 8,329,179 B2 119 120 (Camptosar R, CPT-11, Topotecin(R), CaptoCPT-1), ISIS sense), Irofulven (MGI-114, Ivofulvan, Acylfulvene ana 2053, ISIS-3521 (PKC-alpha antisense), Limb-2 immuno logue), MS-209, Phenylbutyrate, Quinine, TNP-470 (AGM toxin (anti-CD25 recombinant immuno toxin, anti-TacCFV)- 1470, Fumagillin), Trimetrexate (Neutrexin(R), PE38), Leuvectin R. (cytofectin-i-IL-2 gene, IL-2 gene Troxacitabine (BCH-204, BCH-4556, Troxatyl(R), UCN-01 therapy), Lym-1 (131-I LYM-I), Lymphoma vaccine (Geni (7-hydroxystaurosporine), WHI-P131 and WT1 Vaccine. tope), Nelarabine (Compound 506, U78), Neugene com In preferred embodiments, agonistic antibodies of the pounds (Oncomyc-NG(R), Resten-NG(R), myc antisense), invention are administered in combination with one or more NovoMAb-G2 schv (NovoMAb-G2 IgM),06-benzylguanine of the above-described therapeutic agents in the treatment, (BG, Procept(R), Oxaliplatin (Eloxatine(R), EloxatinR), Pacli amelioration and/or prevention of acute lymphocytic leuke taxel (Paxene R, TaxolR), Paclitaxel-DHA (Taxoprexin R), 10 18. Peldesine (BCX-34, PNP inhibitor), Rebeccamycin and Preferred combinations of therapeutic agents useful in the Rebeccamycin analogues, SCH-66336, Sobuzoxane (MST treatment of acute lymphocytic leukemia which may be 16, Perazolin R), SU5416 (Semaxanib R, VEGF inhibitor), administered in combination with antibodies of the present TER-286, Thalidomide and thalidomide analogs, including invention include, but are not limited to, Carboplatin--Mitox but not limited to, lenalidomide (CC-5013, REVLIMIDR) 15 antrone, Carmustine--Cyclophosphamide+Etoposide, Cyt and CC-4047 (ACTIMIDTM), TNP-470 (AGM-1470), Tosi arabine--Daunorubicin, Cytarabine--Doxorubicin, Cytara tumomab (Bexxar R), Valspodar (PSC 833), Vaxid (B-cell bine--Idarubicin, Cytarabine--Interferon gamma, lymphoma DNA vaccine), Vinorelbine (NavelbineR), WF10 Cytarabine--L-asparaginase, Cytarabine--Mitoxantrone, Cyt (macrophage regulator) and XR-9576 (XR-9351, P-glyco arabine--Fludarabine and Mitoxantrone, Etoposide+Cytara protein/MDR inhibitor). bine, Etoposide+Ifosfamide, Etoposide--Mitoxantrone, Ifos In preferred embodiments, agonistic antibodies of the famide+Etoposide--Mitoxantrone, Ifosfamide--Teniposide, invention are administered in combination with one or more Methotrexate--Mercaptopurine, Methotrexate--Mercaptopu of the above-described therapeutic agents in the treatment, rine--Vincristine--Prednisone, Phenylbutyrate+Cytarabine, amelioration and/or prevention of non-Hodgkin’s lym Phenylbutyrate+Etoposide, Phenylbutyrate--Topotecan, Phe phoma. 25 nylbutyrate--Tretinoin, Quinine--Doxorubicin, Quinine--Mi Antibodies of the present invention may be administered in toxantrone--Cytarabine. Thioguanine--Cytarabine-Amsa combination with one or more therapeutic agents useful in the crine. Thioguanine-Etoposide+Idarubicin, Thioguanine-- treatment of acute lymphocytic leukemia including, but not Retinoic acid-i-Cholecaliferol, Vincristine--Prednisone, limited to, Amsacrine, Carboplatin (Paraplatin R, CBDCA), Vincristine--Prednisone and L-asparaginase, Vincristine-- Carmustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), 30 Dexamethasone/Prednisone+Asparaginase--Daunorubicin/ Cholecaliferol, Cyclophosphamide (Cytoxan R, Neosar(R), Doxorubicin, Vincristine--Dexamethasone/Prednisone-As CTX), Cytarabine (Cytosar-UR), ara-C, cytosine arabinoside, paraginase--Daunorubicin/Doxorubicin--Filgrastim, DepoCytR), Daunorubicin (Daunomycin, DaunoXomeR, Vincristine--Dexamethasone/Prednisone+Asparaginase-- Daunorubicinr), Cerubidine(R). Dexamethasone (Decad Daunorubicin/Doxorubicin-i-Cyclophosphamide--Methotr ronR), Doxorubicin (Adriamycin R, Doxil(R), Rubex.R.), Eto 35 exate, and Vincristine--Dexamethasone/Prednisone+Aspara poside (VP-16, Vepesider), Filgrastam(R) (NeupogenR), ginase--Daunorubicin/Doxorubicin--Cyclophosphamide-- G-CSF, Leukine(R), Fludarabine (Fludara R, FAMP), Idaru Methotrexate--Filgrastim. bicin (Idamycin R, DMDR, IDA), Ifosfamide (IFEX(R), Ima In preferred embodiments, agonistic antibodies of the tinib mesylate (STI-571, Imatinib R, Glivec R, Gleevec(R), invention are administered in combination with one or more Ab1 tyrosine kinase inhibitor), Interferon gamma (Gamma 40 of the above-described therapeutic agent combinations in the interferon, Gamma 1000, Gamma-IF), L-asparaginase (El treatment, amelioration and/or prevention of acute lympho spar R. Crastinin R, Asparaginase Medac(R), Kidrolase(R). cytic leukemia. Mercaptopurine (6-mercaptopurine, 6-MP), MethotrexateR) Antibodies of the present invention may be administered in (MTX, Mexate R, Folex(R), Mitoxantrone (Novantrone(R), combination with one or more therapeutic agents useful in the DHAD), Pegaspargase? R. (Oncospar(R), Prednisone, Retinoic 45 treatment of chronic lymphocytic leukemia including, but not acid, Teniposide (VM-26, VumonR). Thioguanine limited to, Chlorambucil (Leukeran R), Cladribine (2-CdA, (6-thioguanine, 6-TG), Topotecan (Hycamtin R, SK&F- LeustatinR), Cyclophosphamide (Cytoxan R, Neosar R, 104864, NSC-609699, Evotopin(R), Tretinoin (Retin-AR), CTX), Cytarabine (Cytosar-U(R), ara-C, cytosine arabinoside, AtragenR), ATRA, VesanoidR) and Vincristine (OncovorinR), DepoCytR), cytarabine ocfosfate, ara-CMP), Doxorubicin Onco TCSR), VCR, Leurocristine(R). 50 (Adriamycin R, Doxil R, RubeXR), Fludarabine (Fludara R, In preferred embodiments, agonistic antibodies of the FAMP), Pentostatin (Nipent(R), 2-deoxycoformycin), Pred invention are administered in combination with one or more nisone and Vincristine (OncovorinR), Onco TCSR), VCR, of the above-described therapeutic agents in the treatment, Leurocristine(R). amelioration and/or prevention of acute lymphocytic leuke In preferred embodiments, agonistic antibodies of the 18. 55 invention are administered in combination with one or more Further examples of therapeutic agents useful in the treat of the above-described therapeutic agents in the treatment, ment of acute lymphocytic leukemia which may be adminis amelioration and/or prevention of chronic lymphocytic leu tered in combination with antibodies of the present invention kemia. include, but are not limited to, Aminocamptothecin (9-AC, Further examples of therapeutic agents useful in the treat 9-Aminocamptothecin, NSC 603071), Aminopterin, Anna 60 ment of chronic lymphocytic leukemia which may be admin mycin (AR-522, annamycin LF, AroneXR), Arabinosylgua istered in combination with antibodies of the present inven nine (Ara-G, GW506U78, NelzarabineR), Arsenic trioxide tion include, but are not limited to, Alemtuzumab (Trisenox R, ATO, AtriveXRV), B43-Genistein (anti-CD19 (Campath(R), Aminocamptothecin (9-AC, 9-Aminocamp Ab/genistein conjugate), B43-PAP (anti-CD19 Ab/pokeweed tothecin, NSC 603071), Aminopterin, Annamycin (AR-522, antiviral protein conjugate), Cordycepin, CS-682, Decitabine 65 annamycin LF, AroneXOR), Arabinosylguanine (Ara-G, (5-aza-2'-deoxyytidine), Dolastatin-10 (DOLA-10, NSC GW506U78, Nelzarabine(R), Compound 506U78), Arsenic 376128), G3139 (Genasense(R), GentaAnticodeR, Bcl-2 anti trioxide (Trisenox R, ATO, AtriveX(R), Bryostatin-1 (Bryosta US 8,329,179 B2 121 122 tin(R), BMY-45618, NSC-339555), CS-682, Dolastatin-10 form thereof, compared to normal control tissue samples may (DOLA-10, NSC-376128), Filgrastim (Neupogen(R), G-CSF, be used to detect the presence of tumors, for example. Assay Leukine), Flavopiridol (NSC-649890, HMR-1275), G3139 techniques that can be used to determine levels of a protein, (Genasense(R), GentaAnticode(R), Bcl-2 antisense), Irofulven such as a DR4 protein of the present invention, or a soluble (MGI-114, Ivofulvan, Acylfulvene analogue), MS-209, Phe form thereof, in a sample derived from a host are well-known nylbutyrate, Rituximab(R) (Rituxan R, anti-CD20 MAb), Tha to those of skill in the art. Such assay methods include radio lidomide and thalidomide analogs, including but not limited immunoassays, competitive-binding assays, Western Blot to, lenalidomide (CC-5013, REVLIMIDR) and CC-4047 analysis and ELISA assays. (ACTIMIDTM), Theophylline, TNP-470 (AGM-1470, Fum Assaying DR4 protein levels in a biological sample can agillin), UCN-01 (7-hydroxystaurosporine) and WHI-P131. 10 occur using any art-known method. By “biological sample' is In preferred embodiments, agonistic antibodies of the intended any biological sample obtained from an individual, invention are administered in combination with one or more cell line, tissue culture, or other source containing DR4 recep of the above-described therapeutic agents in the treatment, tor protein or mRNA. Preferred for assaying DR4 protein amelioration and/or prevention of chronic lymphocytic leu levels in a biological sample are antibody-based techniques. kemia. 15 For example, DR4 protein expression in tissues can be studied Preferred combinations of therapeutic agents useful in the with classical immunohistological methods. (Jalkanen, M., et treatment of chronic lymphocytic leukemia which may be al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. administered in combination with antibodies of the present Cell. Biol. 105:3087-3096 (1987)). Other antibody-based invention include, but are not limited to, Fludarabine--Pred methods useful for detecting DR4 protein gene expression nisone, and Cyclophosphamide+Doxorubicin--Vincristine-- include immunoassays, such as the enzyme linked immun Prednisone (CHOP). osorbent assay (ELISA) and the radioimmunoassay (RIA). In preferred embodiments, agonistic antibodies of the Suitable labels are known in the art and include enzyme invention are administered in combination with one or more labels, such as glucose oxidase, radioisotopes, such as iodine of the above-described therapeutic agent combinations in the (*I, 'I), carbon (''C), sulphur (S), tritium (H), indium treatment, amelioration and/or prevention of chronic lympho 25 ('''In), and technetium ("Tc), and fluorescent labels, such cytic leukemia. as fluorescein and rhodamine, and biotin. Anti-DR4 antibodies may be utilized in combination with Transgenics and “Knock-Outs' other monoclonal or chimeric antibodies, or with lymphok The proteins of the invention can also be expressed in ines, tumor necrosis factors or TNF-related molecules (e.g., transgenic animals. Animals of any species, including, but not TNF-C., TNF-B, TNF-y, TNF-y-B, TNF-y-B, and TRAIL), or 30 limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, hematopoietic growth factors (e.g., IL-2, IL-3 and IL-7). For micro-pigs, goats, sheep, cows and non-human primates, e.g., example, agonistic anti-DR4 antibodies may be administered baboons, monkeys, and chimpanzees may be used to generate in conjunction with TRAIL when one seeks to induce DR4 transgenic animals. In a specific embodiment, techniques mediated cell death in cells which express DR4 receptors of described herein or otherwise known in the art, are used to the invention. Combination therapies of this nature, as well as 35 express polypeptides of the invention in humans, as part of a other combination therapies, are discussed below in more gene therapy protocol. detail. Any technique known in the art may be used to introduce The antibodies of the invention may be administered alone the transgene (i.e., nucleic acids of the invention) into animals or in combination with other types of treatments (e.g., radia to produce the founder lines of transgenic animals. Such tion therapy, chemotherapy, hormonal therapy, immuno 40 techniques include, but are not limited to, pronuclear micro therapy and anti-tumor agents). Generally, administration of injection (Paterson et al., Appl. Microbiol. Biotechnol. products of a species origin or species reactivity (in the case 40.691-698 (1994); Carver et al., Biotechnology (NY) of antibodies) that is the same species as that of the patient is 11:1263-1270 (1993); Wright et al., Biotechnology (NY) preferred. Thus, in a preferred embodiment, human antibod 9:830-834 (1991); and Hoppe et al., U.S. Pat. No. 4,873,191 ies, fragments derivatives, analogs, or nucleic acids, are 45 (1989)); retrovirus mediated gene transfer into germ lines administered to a human patient for therapy or prophylaxis. (Van der Putten et al., Proc. Natl. Acad. Sci., USA 82:6148 It is preferred to use high affinity and/or potent in vivo 6152 (1985)), blastocysts or embryos; gene targeting in inhibiting and/or neutralizing antibodies against polypep embryonic stem cells (Thompson et al., Cell 56:313-321 tides or polynucleotides of the present invention, fragments or (1989)); electroporation of cells or embryos (Lo, Mol. Cell. regions thereof, for both immunoassays directed to and 50 Biol. 3:1803-1814 (1983)); introduction of the polynucle therapy of disorders related to polynucleotides or polypep otides of the invention using a gene gun (see, e.g., Ulmer et tides, including fragments thereof, of the present invention. al., Science 259:1745 (1993); introducing nucleic acid con Such antibodies, fragments, or regions, will preferably have structs into embryonic pluripotent stem cells and transferring an affinity for polynucleotides or polypeptides, including the stem cells back into the blastocyst; and sperm-mediated fragments thereof. Preferred binding affinities include those 55 gene transfer (Lavitrano et al., Cell 57:717-723 (1989); etc. with a dissociation constant or Kdless than 5x10M, 10M, For a review of Such techniques, see Gordon, “Transgenic 5x107M, 107M, 5x10M, 10M, 5x10M, 10M, Animals.” Intl. Rev. Cytol. 115:171-229 (1989), which is 5x100M, 10M,5x10''M, 10M, 5x10'’M, 10°M, incorporated by reference herein in its entirety. Further, the 5x10-13M, 10-3M, 5x10M, 10M, 5x10M, and contents of each of the documents recited in this paragraph is 10.M. 60 herein incorporated by reference in its entirety. See also, U.S. Polypeptide Assays Pat. No. 5,464,764 (Capecchi et al., Positive-Negative Selec The present invention also relates to diagnostic assays such tion Methods and Vectors); U.S. Pat. No. 5,631,153 (Capec as quantitative and diagnostic assays for detecting levels of chi et al., Cells and Non-Human Organisms Containing Pre DR4 protein, or the soluble form thereof, in cells and tissues, determined Genomic Modifications and Positive-Negative including determination of normal and abnormal levels. 65 Selection Methods and Vectors for Making Same); U.S. Pat. Thus, for instance, a diagnostic assay in accordance with the No. 4.736,866 (Leder et al., Transgenic Non-Human Ani invention for detecting over-expression of DR4, or soluble mals); and U.S. Pat. No. 4,873,191 (Wagner et al., Genetic US 8,329,179 B2 123 124 Transformation of Zygotes); each of which is hereby incor gous lines; and breeding to place the transgene on a distinct porated by reference in its entirety. background that is appropriate for an experimental model of Any technique known in the art may be used to produce interest. transgenic clones containing polynucleotides of the inven Transgenic and "knock-out' animals of the invention have tion, for example, nuclear transfer into enucleated oocytes of 5 uses which include, but are not limited to, animal model nuclei from cultured embryonic, fetal, or adult cells induced systems useful in elaborating the biological function of DR4 to quiescence (Campbell et al., Nature 380:64-66 (1996); polypeptides, studying conditions and/or disorders associ Wilmut et al., Nature 385:810-813 (1997)), each of which is ated with aberrant DR4 expression, and in screening for com herein incorporated by reference in its entirety). pounds effective in ameliorating such conditions and/or dis The present invention provides for transgenic animals that 10 orders. carry the transgene in all their cells, as well as animals which In further embodiments of the invention, cells that are carry the transgene in some, but not all their cells, i.e., mosaic genetically engineered to express the proteins of the inven animals or chimeric animals. The transgene may be inte tion, or alternatively, that are genetically engineered not to grated as a single transgene or as multiple copies such as in express the proteins of the invention (e.g., knockouts) are 15 administered to a patient in vivo. Such cells may be obtained concatamers, e.g., head-to-head tandems or head-to-tail tan from the patient (i.e., animal, including human) or an MHC dems. The transgene may also be selectively introduced into compatible donor and can include, but are not limited to and activated in a particular cell type by following, for fibroblasts, bone marrow cells, blood cells (e.g., lympho example, the teaching of Lasko et al. (Proc. Natl. Acad. Sci. cytes), adipocytes, muscle cells, endothelial cells, etc. The USA 89:6232-6236 (1992)). The regulatory sequences cells are genetically engineered in vitro using recombinant required for Such a cell-type specific activation will depend DNA techniques to introduce the coding sequence of upon the particular cell type of interest, and will be apparent polypeptides of the invention into the cells, or alternatively, to to those of skill in the art. When it is desired that the poly disrupt the coding sequence and/or endogenous regulatory nucleotide transgene be integrated into the chromosomal site sequence associated with the polypeptides of the invention, of the endogenous gene, gene targeting is preferred. Briefly, 25 e.g., by transduction (using viral vectors, and preferably vec when such a technique is to be utilized, vectors containing tors that integrate the transgene into the cell genome) or Some nucleotide sequences homologous to the endogenous transfection procedures, including, but not limited to, the use gene are designed for the purpose of integrating, via homolo of plasmids, cosmids, YACs, naked DNA, electroporation, gous recombination with chromosomal sequences, into and liposomes, etc. The coding sequence of the polypeptides of disrupting the function of the nucleotide sequence of the 30 the invention can be placed under the control of a strong endogenous gene. The transgene may also be selectively constitutive or inducible promoter or promoter/enhancer to introduced into a particular cell type, thus inactivating the achieve expression, and preferably secretion, of the polypep tides of the invention. The engineered cells which express and endogenous gene in only that cell type, by following, for preferably secrete the polypeptides of the invention can be example, the teaching of Gu et al. (Science 265:103-106 35 introduced into the patient systemically, e.g., in the circula (1994)). The regulatory sequences required for such a cell tion, or intraperitoneally. Alternatively, the cells can be incor type specific inactivation will depend upon the particular cell porated into a matrix and implanted in the body, e.g., geneti type of interest, and will be apparent to those of skill in the art. cally engineered fibroblasts can be implanted as part of a skin The contents of each of the documents recited in this para graft; genetically engineered endothelial cells can be graph is herein incorporated by reference in its entirety. 40 implanted as part of a lymphatic or vascular graft. (See, for Once transgenic animals have been generated, the expres example, Anderson et al. U.S. Pat. No. 5,399,349; and Mul sion of the recombinant gene may be assayed utilizing stan ligan & Wilson, U.S. Pat. No. 5,460.959, each of which is dard techniques. Initial screening may be accomplished by incorporated by reference herein in its entirety). Southern blot analysis or PCR techniques to analyze animal When the cells to be administered are non-autologous or tissues to Verify that integration of the transgene has taken 45 non-MHC compatible cells, they can be administered using place. The level of mRNA expression of the transgene in the well-known techniques which prevent the development of a tissues of the transgenic animals may also be assessed using host immune response against the introduced cells. For techniques which include, but are not limited to, Northern example, the cells may be introduced in an encapsulated form blot analysis of tissue samples obtained from the animal, in that, while allowing for an exchange of components with the situ hybridization analysis, and reverse transcriptase-PCR 50 immediate extracellular environment, does not allow the (rt-PCR). Samples of transgenic gene-expressing tissue may introduced cells to be recognized by the host immune system. also be evaluated immunocytochemically or immunohis tochemically using antibodies specific for the transgene prod Therapeutics uct. Once the founder animals are produced, they may be bred, 55 The Tumor Necrosis Factor (TNF) family ligands are inbred, outbred, or crossbred to produce colonies of the par known to be among the most pleiotropic cytokines, inducing ticular animal. Examples of such breeding strategies include, a large number of cellular responses, including cytotoxicity, but are not limited to: outbreeding of founder animals with anti-viral activity, immunoregulatory activities, and the tran more than one integration site in order to establish separate Scriptional regulation of several genes (Goeddel, D. V. et al., lines; inbreeding of separate lines in order to produce com 60 “Tumor Necrosis Factors: Gene Structure and Biological pound transgenics that express the transgene at higher levels Activities.” Symp. Ouant. Biol. 51:597-609 (1986), Cold because of the effects of additive expression of each trans Spring Harbor; Beutler, B., and Cerami, A., Annu. Rev. Bio gene; crossing of heterozygous transgenic animals to produce chem. 57:505-518 (1988); Old, L. J., Sci. Am. 258:59-75 animals homozygous for a given integration site in order to (1988); Fiers, W., FEBS Lett. 285:199-224 (1991)). The TNF both augment expression and eliminate the need for Screening 65 family ligands induce Such various cellular responses by of animals by DNA analysis; crossing of separate homozy binding to TNF-family receptors, including the DR4 recep gous lines to produce compound heterozygous or homozy tors of the present invention. US 8,329,179 B2 125 126 DR4 polynucleotides and polypeptides of the invention different pathogenic processes (Ameisen, J. C., AIDS8: 1197– may be used in developing treatments and/or prevention 1213 (1994); Krammer, P. H. et al., Curr. Opin. Immunol. methods for any disorder mediated (directly or indirectly) by 6:279-289 (1994)). defective, or insufficient amounts of DR4. DR4 polypeptides Diseases associated with increased cell survival, or the may be administered to a patient (e.g., mammal, preferably inhibition of apoptosis, include cancers (such as follicular human) afflicted with Such a disorder. Alternatively, a gene lymphomas, carcinomas with p53 mutations, and hormone therapy approach may be applied to treat and/or prevent Such dependent tumors, including, but not limited to colon cancer, disorders. Disclosure herein of DR4 nucleotide sequences cardiac tumors, pancreatic cancer, melanoma, retinoblas permits the detection of defective DR4 genes, and the replace toma, glioblastoma, lung cancer, intestinal cancer, testicular 10 cancer, stomach cancer, neuroblastoma, myxoma, myoma, ment thereof with normal DR4-encoding genes. Defective lymphoma, endothelioma, osteoblastoma, osteoclastoma, genes may be detected in in vitro diagnostic assays, and by osteosarcoma, chondrosarcoma, adenoma, breast cancer, comparison of the DR4 nucleotide sequence disclosed herein prostrate cancer, Kaposi's sarcoma and ovarian cancer); with that of a DR4 gene derived from a patient suspected of autoimmune disorders (such as multiple Sclerosis, Sjogren's harboring a defect in this gene. Defective genes may be 15 syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Beh replaced with normal DR4-encoding genes using techniques cet’s disease, Crohn's disease, polymyositis, systemic lupus known to one skilled in the art. erythematosus and immune-related glomerulonephritis rheu In another embodiment, the polypeptides of the present matoid arthritis) and viral infections (such as herpes viruses, invention are used as a research tool for studying the biologi pox viruses and adenoviruses), information graft V. host dis cal effects that result from inhibiting TRAIL/DR4 interac ease, acute graft rejection, and chronic graft rejection. In tions on different cell types. DR4 polypeptides also may be preferred embodiments, DR4 polynucleotides, polypeptides, employed in in vitro assays for detecting TRAIL or DR4 or and/orantagonists of the invention are used to inhibit growth, the interactions thereof. progression, and/or metastasis of cancers, in particular those In another embodiment, a purified DR4 polypeptide or listed above or in the paragraph that follows. DR4 antagonist of the invention is used to inhibit binding of 25 Additional diseases or conditions associated with TRAIL to endogenous cell surface TRAIL receptors. Certain increased cell Survival include, but are not limited to, progres ligands of the TNF family (of which TRAIL is a member) Sion, and/or metastases of malignancies and related disorders have been reported to bind to more than one distinct cell Such as leukemia (including acute leukemias (e.g., acute lym surface receptor protein. TRAIL likewise is believed to bind phocytic leukemia, acute myelocytic leukemia (including multiple cell surface proteins. By binding TRAIL, soluble 30 myeloblastic, promyelocytic, myelomonocytic, monocytic, DR4 polypeptides and/or DR4 antagonists of the present and erythroleukemia)) and chronic leukemias (e.g., chronic invention may be employed to inhibit the binding of TRAIL myelocytic (granulocytic) leukemia and chronic lymphocytic not only to cell surface DR4, but also to TRAIL receptor leukemia)), polycythemia Vera, lymphomas (e.g., Hodgkin’s proteins that are distinct from DR4. Thus, in another embodi disease and non-Hodgkin’s disease), multiple myeloma, ment, a DR4 polypeptide and/or antagonist is used to inhibit 35 Waldenstrom's macroglobulinemia, heavy chain disease, and a biological activity of TRAIL, in in vitro or in vivo proce Solid tumors including, but not limited to, sarcomas and car dures. By inhibiting binding of TRAIL to cell surface recep cinomas Such as fibrosarcoma, myxosarcoma, liposarcoma, tors, a DR4 polypeptide and antagonist also inhibits biologi chondrosarcoma, osteogenic sarcoma, chordoma, angiosar cal effects that result from the binding of TRAIL to coma, endotheliosarcoma, lymphangiosarcoma, lymphan endogenous receptors. Various forms of DR4 polypeptides 40 gioendotheliosarcoma, synovioma, mesothelioma, Ewings may be employed, including, for example, the above-de tumor, leiomyosarcoma, rhabdomyosarcoma, colon carci scribed DR4 fragments, derivatives, and variants that are noma, pancreatic cancer, breast cancer, ovarian cancer, pros capable of binding TRAIL. In a preferred embodiment, a tate cancer, Squamous cell carcinoma, basal cell carcinoma, soluble DR4 is employed to inhibit a biological activity of adenocarcinoma, Sweat gland carcinoma, sebaceous gland TRAIL, e.g., to inhibit TRAIL-mediated apoptosis of cells 45 carcinoma, papillary carcinoma, papillary adenocarcinomas, Susceptible to such apoptosis. cystadenocarcinoma, medullary carcinoma, bronchogenic In a further embodiment, DR4 compositions (e.g., DR4 carcinoma, renal cell carcinoma, hepatoma, bile duct carci polynucleotides, polypeptides, agonists and/or antagonists) noma, choriocarcinoma, seminoma, embryonal carcinoma, of the invention are administered to a mammal (e.g., a human) Wilm's tumor, cervical cancer, testicular tumor, lung carci to treat and/or prevent a TRAIL-mediated disorder. Such 50 noma, Small cell lung carcinoma, bladder carcinoma, epithe TRAIL-mediated disorders include conditions caused (di lial carcinoma, glioma, astrocytoma, medulloblastoma, cran rectly or indirectly) or exacerbated by TRAIL. iopharyngioma, ependymoma, pinealoma, Cells which express the DR4 polypeptide and are believed hemangioblastoma, acoustic neuroma, oligodendroglioma, to have a potent cellular response to DR4 ligands include menangioma, melanoma, neuroblastoma, and retinoblas amniotic cells, heart, liver cancer, kidney, peripheral blood 55 tOma. leukocytes, activated T-cells, tissue corresponding to Th2 Additional diseases or conditions associated with cells, human tonsils, and CD34 depleted buffy coat (cord increased cell Survival include, but are not limited to, prema blood). By “a cellular response to a TNF-family ligand is lignant conditions. Such conditions are known or Suspected intended any genotypic, phenotypic, and/or morphologic of preceding progression to neoplasia or cancer, in particular, change to a cell, cell line, tissue, tissue culture or patient that 60 where non-neoplastic cell growth consisting of hyperplasia, is induced by a TNF-family ligand. As indicated, such cellular metaplasia, or most particularly, dysplasia has occurred (for responses include not only normal physiological responses to review of such abnormal growth conditions, see Robbins and TNF-family ligands, but also diseases associated with Angell, 1976, Basic Pathology, 2d Ed., W.B. Saunders Co., increased apoptosis or the inhibition of apoptosis. Apoptosis Philadelphia, pp. 68-79.) programmed cell death-is a physiological mechanism 65 Hyperplasia is a form of controlled cell proliferation, involved in the deletion of peripheral T lymphocytes of the involving an increase in cell number in a tissue or organ, immune system, and its dysregulation can lead to a number of without significant alteration in structure or function. Hyper US 8,329,179 B2 127 128 plastic disorders which can be diagnosed, prognosed, pre Additional pre-neoplastic disorders include, but are not vented, and/or treated with compositions of the invention limited to, benign dysproliferative disorders (e.g., benign (including polynucleotides, polypeptides, agonists orantago tumors, fibrocystic conditions, tissue hypertrophy, intestinal nists) include, but are not limited to, angiofollicular medias polyps, colon polyps, and esophageal dysplasia), leuko tinal lymph node hyperplasia, angiolymphoid hyperplasia plakia, keratoses, Bowen's disease, Farmer's Skin, Solar with eosinophilia, atypical melanocytic hyperplasia, basal cheilitis, and Solar keratosis. cell hyperplasia, benign giant lymph node hyperplasia, Polynucleotides and/or polypeptides of the invention and/ cementum hyperplasia, congenital adrenal hyperplasia, con or agonists and/orantagonists thereofmay be administered in genital sebaceous hyperplasia, cystic hyperplasia, cystic combination with one or more therapeutic agents and/or pro 10 cedures in the treatment, prevention, amelioration and/or cure hyperplasia of the breast, denture hyperplasia, ductal hyper of cancers and premalignant conditions. plasia, endometrial hyperplasia, fibromuscular hyperplasia, In preferred embodiments, agonists and/or antagonists of focal epithelial hyperplasia, gingival hyperplasia, inflamma the invention may be administered in combination with one or tory fibrous hyperplasia, inflammatory papillary hyperplasia, more therapeutic agents and/or procedures in the treatment, intravascular papillary endothelial hyperplasia, nodular 15 prevention, amelioration and/or cure of cancers and prema hyperplasia of prostate, nodular regenerative hyperplasia, lignant conditions. pseudoepitheliomatous hyperplasia, senile sebaceous hyper Therapeutic agents, useful in the treatment, prevention, plasia, and verrucous hyperplasia. amelioration and/or cure of cancers and premalignant condi Metaplasia is a form of controlled cell growth in which one tions, with which polynucleotides and/or polypeptides of the type of adult or fully differentiated cell substitutes for another invention and/or agonists and/or antagonists thereof may be type of adult cell. Metaplastic disorders which can be diag administered, include, for example, biological agents (e.g., nosed, prognosed, prevented, and/or treated with composi inhibitors of signaling pathways, inhibitors of gene transcrip tions of the invention (including polynucleotides, polypep tion, inhibitors of multi-drug resistance (MDR) mechanisms, tides, agonists or antagonists) include, but are not limited to, inhibitors of angiogenesis, inhibitors of matrix metallopro agnogenic myeloid metaplasia, apocrine metaplasia, atypical 25 teinases, hormones and hormone antagonists, and com metaplasia, autoparenchymatous metaplasia, connective tis pounds of unknown mechanism), chemotherapeutic agents Sue metaplasia, epithelial metaplasia, intestinal metaplasia, (e.g., alkylating agents, antimetabolites, farnesyl transferase metaplastic anemia, metaplastic ossification, metaplastic pol inhibitors, mitotic spindle inhibitors (plant-derived alka yps, myeloid metaplasia, primary myeloid metaplasia, sec loids), nucleotide analogs, platinum analogs, and topoi ondary myeloid metaplasia, squamous metaplasia, squamous 30 Somerase inhibitors), corticosteroids, gene therapies, immu metaplasia of amnion, and symptomatic myeloid metaplasia. notherapeutic agents (e.g., monoclonal antibodies, cytokines Dysplasia is frequently a forerunner of cancer, and is found and vaccines), phototherapy, radiosensitizing agents, treat mainly in the epithelia; it is the most disorderly form of ment Support agents (e.g., anti-emetic agents, analgesic non-neoplastic cell growth, involving a loss in individual cell agents and hematopoietic agents), and other miscellaneous uniformity and in the architectural orientation of cells. Dys 35 drug types. Therapeutic procedures, useful in the treatment, plastic cells often have abnormally large, deeply stained prevention, amelioration and/or cure of cancers and prema nuclei, and exhibit pleomorphism. Dysplasia characteristi lignant conditions, with which polynucleotides and/or cally occurs where there exists chronic irritation or inflam polypeptides of the invention and/or agonists and/or antago mation. Dysplastic disorders which can be diagnosed, prog nists thereof may be administered, include, for example, but nosed, prevented, and/or treated with compositions of the 40 are not limited to, Surgical procedures and radiation therapies. invention (including polynucleotides, polypeptides, agonists In preferred embodiments, agonists and/or antagonists of or antagonists) include, but are not limited to, anhidrotic the invention are administered in combination with one or ectodermal dysplasia, anterofacial dysplasia, asphyxiating more of the above-described therapeutic agents and/or thera thoracic dysplasia, atriodigital dysplasia, bronchopulmonary peutic procedures in the treatment, prevention, amelioration dysplasia, cerebral dysplasia, cervical dysplasia, chondroec 45 and/or cure of cancers and premalignant conditions. todermal dysplasia, cleidocranial dysplasia, congenital ecto In specific embodiments, polynucleotides and/or polypep dermal dysplasia, craniodiaphysial dysplasia, craniocarpo tides of the invention and/or agonists and/or antagonists tarsal dysplasia, craniometaphysial dysplasia, dentin thereof may be administered in combination with one or more dysplasia, diaphysial dysplasia, ectodermal dysplasia, therapeutic agents useful in the treatment, prevention, ame enamel dysplasia, encephalo-ophthalmic dysplasia, dyspla 50 lioration and/or cure of cancers and premalignant conditions, sia epiphysialis hemimelia, dysplasia epiphysialis multiplex, including, but not limited to, 81 C6 (Anti-tenascin mono dysplasia epiphysialis punctata, epithelial dysplasia, facio clonal antibody), 2-chlorodeoxyadenosine, A007 (4-4'-dihy digitogenital dysplasia, familial fibrous dysplasia of jaws, droxybenzophenone-2,4-dinitrophenylhydraZone), Abarelix familial white folded dysplasia, fibromuscular dysplasia, ((Abarelix-Depot-Me, PPI-149, R-3827); Abiraterone fibrous dysplasia of bone, florid osseous dysplasia, hereditary 55 Acetate R (CB-7598, CB-7630), ABT-627 (ET-1 inhibitor), renal-retinal dysplasia, hidrotic ectodermal dysplasia, hypo ABX-EGF (anti-EGFr MAb), Acetyldinaline (CI-994, GOE hidrotic ectodermal dysplasia, lymphopenic thymic dyspla 5549, GOR-5549, PD-130636), AG-2034 (AG-2024, sia, mammary dysplasia, mandibulofacial dysplasia, meta AG-2032, GARFT glycinamide ribonucleoside transformy physial dysplasia, Mondini dysplasia, monostotic fibrous lase inhibitor), Alanosine, Aldesleukin (IL-2, Proleukin R), dysplasia, mucoepithelial dysplasia, multiple epiphysial dys 60 Alemtuzumab(R) (Campath(R), Alitretinoin (Panretin R, LGN plasia, oculoauriculovertebral dysplasia, oculodentodigital 1057), Allopurinol (AloprimR), ZyloprimR). Altretamine dysplasia, oculovertebral dysplasia, odontogenic dysplasia, (Hexylen R, hexamethylmelamine, Hexastat(R), Amifostine opthalmomandibulomelic dysplasia, periapical cemental (Ethyol(R), Aminocamptothecin (9-AC, 9-Aminocamptoth dysplasia, polyostotic fibrous dysplasia, pseudoachondro ecin, NSC 603071), Aminoglutethimide (Cytadren(R), Ami plastic spondyloepiphysial dysplasia, retinal dysplasia, 65 nolevulinic acid (Levulan R. Kerastick(R), Aminopterin, septo-optic dysplasia, spondyloepiphysial dysplasia, and Amsacrine, AnastroZole (ArimideX(R), Angiostatin, Anna Ventriculoradial dysplasia. mycin (AR-522, annamycin LF, AroneXOR), Anti-idiotype US 8,329,179 B2 129 130 therapy (BSAb), Anti-CD19/CD3 MAb (anti-CD19/CD3 syn R., c6MP-PDE2 and 5 inhibitor), F19 (Anti-FAP mono scEv, anti-NHL MAb), APC-8015 (Provenge R., Dendritic clonal antibody, iodinated anti-FAP MAb), Fadrozole cell therapy), Aplidine (Aplidin R, AplidinaR), Arabino (Afema(R, Fadrozole hydrochloride, Arensin R), Fenretin sylguanine (Ara-G, GW506U78, Nelzarabine(R), Compound ide(R) (4HPR), Fentanyl citrate (ActiqR), Filgrastim (Neupo 506U78), Arsenic trioxide (Trisenox R, ATO, AtriveX(R), gen R, G-CSF), FK-317 (FR-157471, FR-70496), Flavopiri Avorelin(R) (Meterelin(R), MF-6001, EP-23904), B43 dol (HMR-1275), Fly3/flk2 ligand (MobistaR), Fluasterone, Genistein (anti-CD19 Ab/genistein conjugate), B43-PAP Fludarabine (Fludara R, FAMP), Fludeoxyglucose (F-18(R), (anti-CD19 Ab/pokeweed antiviral protein conjugate), B7 Fluorouracil (5-FU, Adrucil(R), Fluoroplex(R), Efudex(R), antibody conjugates, BAY 43-9006 (Raf kinase inhibitor), Flutamide (Eulexin(R), FMdC (KW-2331, MDL-101731), BBR 3464, Betathine (Beta-LT), Bevacizumab(R) (Anti 10 Formestane (Lentaron(R), Fotemustine (Muphoran R. Musto VEGF monoclonal antibody, rhuMAb-VEGF), Bexarotene phoran R), FUDR (Floxuridine.R.), Fulvestrant (Faslodex(R), (Targretin R, LGD1069), BIBH-1 (Anti-FAP MAb), BIBX G3139 (Genasense(R), GentaAnticode(R), Bcl-2 antisense), 1382, Biclutamide (Casodex(R), Biricodar dicitrate (Incel(R), Gadolinium texaphyrin (Motexafin gadolinium, Gd-Tex(R), Incel MDR Inhibitor), Bleomycin (Blenoxane(R). BLP-25 XcytrinR), Galarubicin hydrochloride (DA-125), GBC-590, (MUC-1 peptide), BLySantagonists, BMS-214662 (BMS 15 Gastrimmune.R. (Anti-gastrin-17 immunogen, anti-gl7), 192331, BMS-193269, BMS-206635), BNP-1350 (BNPI Gemcitabine (GemtoR), Gemzar R), Gentuzumab-ozogami 1100, Karenitecins), Boronated Protoporphyrin Compound cin (Mylotargr), GL331, Globo H hexasaccharide (Globo (PDIT, Photodynamic Immunotherapy), Bryostatin-1 (Bry H-KLHR), Glufosfamide(R) (B-D-glucosyl-isofosfamide ostatin R, BMY-45618, NSC-339555), Budesonide (Rhi mustard, D19575, INN), Goserelin acetate (Zoladex(R), Gra nocort(R), Busulfan (Busulfex R, Myleran R), C225 (IMC nisetron (Kytril.R.), GVAX (GM-CSF gene therapy), Her-2/ 225, EGFR inhibitor, Anti-EGFr MAb, Cetuximab(R), C242 Neu vaccine, Herceptin R (Trastuzumab(R), Anti-HER-2 DM1 (buC242-DM1), Cabergoline (Dostinex(R), monoclonal antibody, Anti-EGFR-2 MAb), HSPPC-96 (HSP Capecitabine (Xeloda(R), Doxifluridine(R), oral 5-FU), Car cancer vaccine, gp96 heat shock protein-peptide complex), bendazin R (FB-642), Carboplatin (Paraplatin(R), CBDCA), Hu1D10 (anti-HLA-DR MAb, SMART 1D10), HumaLYM Carboxyamidotriazole (NSC 609974, CAI, L-651582), Car 25 (anti-CD20 MAb), Hydrocortisone, Hydroxyurea (Hy mustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), CC49 dreaR), Hypericin R (VIMRxynR), I-131 Lipidiol R, Ibritu Zeta gene therapy, CEA-cide(R) (Labetuzumab(R), Anti-CEA momab(R) tiuxetan (Zevalin R), Idarubicin (Idamycin R, monoclonal antibody, hMN-14), CeaVacR (MAb 3H1), DMDR, IDA), Ifosfamide (IFEX(R), Imatinib mesylate (STI Celecoxib (Celebrex(R), CEP-701 (KT-5555), Cereport(R) 571, Imatinib(R), Glivec R, Gleevec R, Ab1 tyrosine kinase (LobradimilR, RMP-7), Chlorambucil (Leukeran R), CHML 30 inhibitor), INGN-101 (p53 gene therapy/retrovirus), INGN (Cytotropic Heterogeneous Molecular Lipids), Cholecalif 201 (p53 gene therapy/adenovirus), Interferon alpha (Alfaf erol, CI-1033 (Pan-erbB RTK inhibitor), Cilengitide (EMD erone(R), Alpha-IFR), Interferon alpha2a (Intron A(R), Inter 12 1974, integrin alphavbeta3 antagonist), Cisplatin (Plati feron gamma (Gamma-interferon, Gamma 100R, Gamma nol R, CDDP), Cisplatin-epinephrine gel (Intral DoseR), IF), Interleukin-2 (ProleiukinR(R), Intoplicine (RP 60475), FocaCist(R), Cisplatin-liposomal (SPI-077), 9-cis retinoic 35 Irinotecan (Camptosar(R), CPT-11, Topotecin RV. CaptoCPT acid (9-cRA), Cladribine (2-CdA, LeustatinR), Clofarabine 1), Irofulven (MGI-114, Ivofulvan, Acylfulvene analogue), (chloro-fluoro-ara A), Clonadine hydrochloride (Dura ISIS-2053 (PKC-alpha antisense), ISIS-2503 (Ras anti clon(R), CMB-401 (Anti-PEMMAb?calicheamycin), CMT-3 sense), ISIS-3521 (PKC-alpha antisense), ISIS-5132 (K-ras/ (COL-3, Metastat(R), Cordycepin, Cotara R (chTNT-1/B, raf antisense), Isotretinoin (13-CRA, 13-cis retinoic acid, ''Il-chTNT-1/B), CN-706, CP-358774 (Tarceva(R, OSI 40 AccutaneR), Ketoconazole (NiZoral R), KRN-8602 (MX, 774, EGFR inhibitor), CP-609754, CP IL-4-toxin (IL-4 MY-5. NSC-619003, MX-2), L-778123 (Ras inhibitors), fusion toxin), CS-682, CT-2584 (Apra R, CT-2583, CT-2586, L-asparaginase (Elspar R, Crastinin R, Asparaginase CT-3536), CTP-37 (Avicine(R), hCG blocking vaccine), Medac(R), Kidrolase R), Leflunomide (SU-101, SU-0200), Cyclophosphamide (Cytoxan R. Neosar(R, CTX), Cytarabine Letrozole (Femara(R), Leucovorin (LeucovorinR, Welicov (Cytosar-U(R), ara-C, cytosine arabinoside, DepoCytR), D-li 45 orinR), Leuprolide acetate (Viadur R. Lupron(R), Leuprogel(R), monene, DAB389-EGF (EGF fusion toxin), Dacarbazine EligardR), LeuvectinR (cytofectin-i-IL-2 gene, IL-2 gene (DTIC), Daclizumab(R) (Zenapax(R), Dactinomycin (Cos therapy), Levamisole (Ergamisol(R), LiaroZole (Liazal, Lia megenR), Daunomycin (Daunorubicin R, Cerubidine(R). Zol, R-75251, R-85246, Ro-85264), Limb-2 immunotoxin Daunorubicin (DaunoXomeR), Daunorubicin R, (anti-CD25 recombinant immuno toxin, anti-TacCFV)-PE38), Cerubidine(RV), DeaVacR) (CEA anti-idiotype vaccine), 50 Lometrexol (T-64, T-904064), Lomustine (CCNUR), Decitabine (5-aza-2'-deoxyytidine), Declopramide (Oxi CeeNUR), LY-335979, Lym-1 (131-I LYM-1), Lymphoma 104), Denileukin diftitox (OntakR), Depsipeptide vaccine (Genitope), Mannan-MUC1 vaccine, Marimastat(R) (FR901228, FK228), Dexamethasone (Decadron(R), Dexra (BB-2516, TA-2516, MMP inhibitor), MDX-447 (MDX Zoxane (Zinecard(R), Diethylnorspermine (DENSPM), 220, BAB-447, EMD-82633, H-447, anti-EGFr/ Diethylstilbestrol (DES), Dihydro-5-azacytidine, Docetaxel 55 FcGammaR1r), Mechlorethamine (Nitrogen Mustard, HN, (Taxotere?R, Taxane(R), Dolasetron mesylate (Anzemet(R), MustargenR), Megestrol acetate (Megace(R), Pallace(R), Mel Dolastatin-10 (DOLA-10, NSC-376128), Doxorubicin phalan (L-PAM, Alkeran R, Phenylalanine mustard), Mer (Adriamycin R, Doxil R, Rubex(R), DPPE, DX-8951f (DX captopurine (6-mercaptopurine, 6-MP), Mesna (MesneXOR), 8951), Edatrexate, EGF-P64kVaccine, Elliott’s B Solution(R), Methotrexate(R) (MTX, Mexate R, Folex(R), Methoxsalen EMD-121974, Endostatin, Eniluracil (776c85), EO9 (EO1, 60 (Uvadex(R), 2-Methoxyestradiol (2-ME, 2-ME2), Methyl EO4, EO68, EO70, EO72), Epirubicin (Ellence R, EPI, 4' prednisolone (SolumedrolR), Methyltestosterone (Android epi-doxorubicin), Epratuzumab(R) (Lymphocide(R), human 10R, Testred R, Virilon(R), MGV, Mitomycin C (Mitomy ized anti-CD22, HAT), Erythropoietin (EPOR), Epogen R, cinr), Mutamycin R, Mito Extra(R), Mitoxantrone Procrit(R), Estramustine (EmcytR), Etanidazole (Radinyl(R), (Novantrone(R), DHAD), Mitumomab(R) (BEC-2, EMD Etoposide phosphate (Etopophos(R), Etoposide (VP-16, 65 60205), Mivobulin isethionate (CI-980), MN-14 (Anti-CEA Vepesider), Exemestane (Aromasin(R), Nikidess(R), Exetecan immunoradiotherapy, ''I-MN-14, "Re-MN-14), Motexa mesylate (DX-8951, DX-8951f. Exisulind (SAAND, Apto fin Lutetium (LutrinR), OptrinR), Lu-Tex R, lutetium texaphy US 8,329,179 B2 131 132 rin, Lucyn R, AntrinR), MPV-2213ad (Finrozole(R), MS-209, tor), WHI-P131, WT1 Vaccine, XR-5000 (DACA), XR-9576 Muc-1 vaccine, NaPro Paclitaxel, Nelarabine (Compound (XR-9351, P-glycoprotein/MDR inhibitor), ZD-9331, 506, U78), Neovastat(R) (AE-941, MMP inhibitor), Neugene ZD-1839 (IRESSAR), and Zoledronate (Zometa(R). compounds (Oncomyc-NG, Resten-NG, myc antisense), In preferred embodiments, agonists and/or antagonists of Nilutamide (Nilandron(R), NovoMAb-G2 sclv (NovoMAb the invention are administered in combination with one or G2 IgM), NPI-0052 (proteasome inhibitor), O6-benzylgua more of the above-described therapeutic agents in the treat nine (BG, Procept(R), Octreotide acetate (Sandostatin LAR(R) ment, prevention, amelioration and/or cure of cancers and Depot), Odansetron (Zofran RR). Onconase (Ranpimase(R). premalignant conditions. OncoVAX-CL. OncoVAX-CL Jenner (GA-733-2 vaccine), In further specific embodiments, polynucleotides and/or OncoVAX-P (OncoVAX-PrPSA), Onyx-015 (p53 gene 10 polypeptides of the invention and/or agonists and/or antago therapy), Oprelvekin (Neumage(R), Orzel (Tegafur--Uracil nists thereof may be administered in combination with one or Leucovorin), Oxaliplatin (Eloxatine(R), EloxatinR), Pacis(R) more combinations of therapeutic agents useful in the treat (BCG, live), Paclitaxel (Paxene(R), Taxol.R.), Paclitaxel-DHA ment, prevention, amelioration and/or cure of cancers and (Taxoprexin R), Pamidronate (ArediaR), PC SPES, Pegade premalignant conditions including, but not limited to, 9-ami mase (Adagen R, Pegademase bovine), Pegaspargase R. (On 15 nocamptothecin--G-CSF, Adriamycin R+Blenoxane--Vin cospar R), Peldesine (BCX-34, PNP inhibitor), Pemetrexed blastine+Dacarbazine (ABVD). BCNU (Carmustine)+Eto disodium (Alimta R, MTA, multitargeted antifolate, LY poside--Ara-C (Cytarabine)+Melphalen (BEAM), 231514), Pentostatin (Nipent(R), 2-deoxycoformycin), Per Bevacizumab(R+Leucovorin, Bleomycin--Etoposide--Plati fosfamide (4-hydroperoxycyclophosphamide, 4-HC), Peril nolR (Cisplatin) (BEP), Bleomycin--Etoposide+Adriamy lyl alcohol (perilla alcohol, perillic alcohol, perillol, NSC cin-i-Cyclophosphamide--Vincristine--Procarbazine--Pred 64 1066), Phenylbutyrate, Pirarubicin (THP), nisone (BEACOPP), Bryostatin--Vincristine, Busulfan Pivaloyloxymethyl butyrate (AN-9, Pivanex(R), Porfimer Melphalan, Carboplatin-i-Cereport(R), Carboplatin-- sodium (PhotofrinR), Prednisone, Prinomastat(R) (AG-3340, Cyclophosphamide, Carboplatin--Paclitaxel, Carboplatin-- MMP inhibitor), Procarbazine (MatulaneR), PROSTVAC, Etoposide+Bleomycin (CEB), Carboplatin--Etoposide-- Providence Portland Medical Center Breast Cancer Vaccine, 25 Thiotepa, Cisplatin-i-Cyclophosphamide, Cisplatin-- PS-341 (LDP-341, 26S proteasome inhibitor), PSMA MAb Docetaxel, Cisplatin--Doxorubicin, Cisplatin-Etoposide, (Prostate Specific Membrane Antigen monoclonal antibody), Cisplatin--Gemcitabine, Cisplatin-i-Interferon alpha, Cispl Pyrazoloacridine (NSC-366140, PD-115934), Quinine, atin-i-Irinotecan, Cisplatin--Paclitaxel, Cisplatin-Teniposide, R115777 (Zarnestra(R), Raloxifene hydrochloride (Evista R, Cisplatin--Vinblastine, Cisplatin--Vindesine, Cisplatin-i-Vi Keoxifene hydrochloride), Raltitrexed (Tomudex(R), 30 norelbine, Cisplatin-i-Cytarabine--Ifosfamide, Cisplatin-i-If ZD-1694), Rebeccamycin, Retinoic acid, R-flurbiprofen osfamide--Vinblastine, Cisplatin--Vinblastine--Mitomycin C, (Flurizan(R), E-7869, MPC-7869), RFS-2000 (9-nitrocamp Cisplatin--Vincristine--Fluorouracil, Cisplatin--Vincristine-- tothecan, 9-NC, Rubitecan R), Rituximab(R) (Rituxan R, anti Lomustine, Cisplatin--Vinorelbine--Gemcitabine, Cisplatin-- CD20 MAb), RSR-13 (GSJ-61), Satraplatin (BMS-182751, Carmustine--Dacarbazine--Tamoxifen, Cisplatin-i-Cyclo JM-216), SCH 6636, SCH-66336, Sizofilan R (SPG, Sizofu 35 phosphamide+Etoposide+Vincristine, Cisplatin ran R., Schizophyllan R, Sonifilan R), SKI-2053R(NSC (Platinol R)+OncovinR+Doxorubicin (Adrianycin R)+Eto D644591), Sobuzoxane (MST-16, Perazolin R), Squalamine poside (CODE), Cisplatin-i-Cytarabine--Ifosfamide+Etopo (MSI-1256F), SR-49059 (vasopressin receptor inhibitor, side+Methotrexate, Cyclophosphamide+Adriamycin R Vla), Streptozocin (ZanosarR), SU5416 (Semaxanib.R., (Doxorubicin), Cyclophosphamide--Melphalan, Cyclophos VEGF inhibitor), SU6668 (PDGF-TK inhibitor), T-67 40 phamide--SCH 6636, Cyclophosphamide-Adriamycin R+ (T-138067, T-607), Talc (Sclerosol.R.), Tamoxifen (Nolva Cisplatin (Platinol R) (CAP), Cyclophosphamide+Adriamy dex(R), Taurolidine (Taurolin R.), Temozolamide (Temodar R, cinr+Vincristine (CAV), Cyclophosphamide--Doxorubicin-- NSC 362856), Teniposide (VM-26, Vumon(R), TER-286, Teniposide--Prednisone, Cyclophosphamide--Doxorubicin-- Testosterone (Andro(R), Androderm(R), Testoderm TTSR), Teniposide--Prednisone+Interferon alpha, Testoderm(R), Depo-Testosterone(R), Androgel(R), depoAn 45 Cyclophosphamide+Epirubicin-i-Cisplatin (PlatinolR) dro(R), Tf-CRM107 (Transferrin-CRM-107), Thalidomide (CEP), Cyclophosphamide+Epirubicin-Fluorouracil, and thalidomide analogs, including but not limited to, lenali Cyclophosphamide--Methotrexate+Fluoruracil (CMF), domide (CC-5013, REVLIMIDR) and CC-4047 (AC Cyclophosphamide--Methotrexate--Vincristine (CMV), TIMIDTM). Theratope. Thioguanine (6-thioguanine, 6-TG), Cyclophosphamide+Adriamycing-i-Methotrexate--Fluorou Thiotepa (triethylenethiophosphaoramide. Thioplex(R), Thy 50 racil (CAMF), Cyclophosphamide-Adriamycin R+Methotr mosin alpha I (Zadaxin R, Thymalfasin(R), Tiazofurin (Thia exate--Procarbazine (CAMP), Cyclophosphamide--Adria zole(R), Tirapazamine (SR-259075, SR-4233, Tirazone.R., mycin R+Vincristine--Etoposide (CAV-E), Win-59075), TNP-470 (AGM-1470, Fumagillin), Cyclophosphamide+Adriamycing--Vincristine--Prednisone Tocladesine (8-C1-cAMP), Topotecan (Hycamtin R, SK&F- (CHOP), Cyclophosphamide--Novantrone(R) (Mitox 104864, NSC-609699, Evotopin(R), Toremifene (Estrimex(R), 55 antrone)+Vincristine (Oncovorin)+Prednisone (CNOP), Fareston(R), Tositumomab R (BexxarR), Tretinoin (Retin Cyclophosphamide+Adriamycin R+Vincristine--Pred AR, AtragenR), ATRA, VesanoidR), TriAb(R) (anti-idiotype nisone--Rituximab (CHOP+Rituximab), Cyclophospha antibody immune stimulator), Trilostane (Modre?enR), Trip mide+Adriamycin R+Vincristine--Teniposide (CAV-T), torelin pamoate (Trelstar Depots, Decapeptyl(R), Trimetrex Cyclophosphamide+Adriamycin R+Vincristine alternating ate (Neutrexin R.), Troxacitabine (BCH-204, BCH-4556, 60 with Platinol R+Etoposide (CAV/PE), Cyclophosphamide-- TroxatylR), TS-1, UCN-01 (7-hydroxystaurosporine), Valru BCNU (Carmustine)+VP-16 (Etoposide) (CBV), Cyclo bicin (Valstar(R), Valspodar (PSC 833), Vapreotide(R) (BMY phosphamide--Vincristine--Prednisone (CVP), Cyclophos 41606), Vaxid (B-cell lymphoma DNA vaccine), Vinblastine phamide--OncovinR+Methotrexate--Fluorouracil (COMF), (Velban(R), VLB), Vincristine (OncovinR), Onco TCSR), Cytarabine--Methotrexate, Cytarabine+Bleomycin--Vincris VCR, Leurocristine(R), Vindesine (Eldisine(R, Fildesin(RV), 65 tine--Methotrexate (CytaBOM), Dactinomycin--Vincristine, Vinorelbine (NavelbineR), Vitaxin R. (LM-609, integrin Dexamethasone+Cytarabine--Cisplatin (DHAP), Dexam alphavbeta3 antagonistic MAb), WF10 (macrophage regula ethasone--Ifosfamide+Cisplatin--Etoposide (DICE), Doc US 8,329,179 B2 133 134 etaxel--Gemcitabine, Docetaxel--Vinorelbine, Doxorubicin-- combination with one or more therapeutic agents described Vinblastine--Mechlorethamine--Vincristine--Bleomycin-- above to treat, prevent, ameliorate and/or cure cancers and Etoposide+Prednisone (Stanford V), Epirubicin-- premalignant conditions of any tissue known to express DR5 Gemcitabine, Estramustine--Docetaxel, Estramustine-- receptor. Navelbine, Estramustine--Paclitaxel, Estramustine-- In preferred embodiments, agonists and/or antagonists of Vinblastine, Etoposide (Vepesider)+Ifosfamide+Cisplatin the invention are administered in combination with one or (Platinol R) (VIP), Etoposide--Vinblastine-Adriamycin more therapeutic agents described above to treat, prevent, (EVA), Etoposide (Vepesider)+Ifosfamide--Cisplatin-Epiru ameliorate and/or cure cancers and premalignant conditions bicin (VIC-E), Etoposide--Methylprednisone--Cytarabine-- of any tissue known to express DR5 receptor. Cisplatin (ESHAP), Etoposide+Prednisone+Ifosfamide-- 10 Tissues known to express DR5 receptor include, but are not Cisplatin (EPIC), Fludarabine--Mitoxantrone-- limited to, heart, placenta, lung, liver, skeletal muscle, pan Dexamethasone (FMD). Fludarabine--Dexamethasone-- creas, spleen, thymus, prostate, testis, uterus, ovary, Small Cytarabine (ara-C)+Cisplatin (Platinol R) (FluldAP), intestine, colon, brain kidney, bone marrow, skin, pituitary, Fluorouracil--Bevacizumab R, Fluorouracil--CeaVac(R), Fluo cartilage and blood. rouracil--Leucovorin, Fluorouracil-i-Levamnisole, Fluorou 15 In specific embodiments polynucleotides and/or polypep racil--Oxaliplatin, Fluorouracil--Raltitrexed, Fluorouracil tides of the invention and/or agonists and/or antagonists SCH 6636, Fluorouracil--Trimetrexate, Fluorouracil thereof may be administered in combination with one or more Leucovorin-Bevacizumab(R), Fluorouracil-Leucovorin-- therapeutic agents, as described above, in the treatment, pre Oxaliplatin, Fluorouracil-Leucovorin-i-Trimetrexate, vention, amelioration and/or cure of solid tissue cancers (e.g., Fluorouracil--OncovinR+Mitomycin C (FOMi), Hydrazine-- skin cancer, prostate cancer, pancreatic cancer, hepatic can Adriamycin R+Methotrexate (HAM), Ifosfamide--Doc cer, lung cancer, ovarian cancer, colorectal cancer, head and etaxel, Ifosfamide--Etoposide, Ifosfamide+Gemcitabine, neck tumors, breast tumors, endothelioma, osteoblastoma, Ifosfamide--Paclitaxel, Ifosfamide--Vinorelbine, Ifosfa osteoclastoma, Ewing's sarcoma, and Kaposi's sarcoma), as mide--Carboplatin--Etoposide (ICE), Ifosfamide+Cisplatin-- well as hematological cancers (e.g., leukemia, acute lympho Doxorubicin, Irinotecan+C225 (Cetuximab(R), Irinotecan+ 25 cytic leukemia, chronic lymphocytic leukemia, non Docetaxel, Irinotecan+Etoposide, Irinotecan+Fluorouracil, Hodgkin’s lymphoma, multiple myeloma). Irinotecan--Gemcitabine, Mechlorethamine--Oncovin R In preferred embodiments, agonists and/or antagonists of (Vincristine)+Procarbazine (MOP), Mechlorethamine--On the invention are administered in combination with one or covinR (Vincristine)+Procarbazine--Prednisone (MOPP), more therapeutic agents, as described above, in the treatment, Mesna--Ifosfamide+Idarubicin--Etoposide (MIZE), Methotr 30 prevention, amelioration and/or cure of Solid tissue cancers exate--Interferon alpha, Methotrexate--Vinblastine, Methotr (e.g., skin cancer, prostate cancer, pancreatic cancer, hepatic exate--Cisplatin, Methotrexate with leucovorin rescue--Bleo cancer, lung cancer, ovarian cancer, colorectal cancer, head mycin-i-Adriamycin-i-Cyclophosphamide--Oncovorin-- and neck tumors, breast tumors, endothelioma, osteoblas Dexamethasone (m-BACOD), Mitomycin C+Ifosfamide-- toma, osteoclastoma, Ewing's sarcoma, and Kaposi's Sar Cisplatin (Platinol R) (MIP), Mitomycin C+Vinblastine-- 35 coma), as well as hematological cancers (e.g., leukemia, Paraplatin R (MVP), Mitoxantrone--Hydrocortisone, acute lymphocytic leukemia, chronic lymphocytic leukemia, Mitoxantrone--Prednisone. OncovinR+SCH 6636, Oxalipl non-Hodgkin’s lymphoma, multiple myeloma). atin-i-Leucovorin, Paclitaxel--Doxorubicin, Paclitaxel--SCH In specific embodiments polynucleotides and/or polypep 6636, Paraplatin R+Docetaxel, Paraplatin RV+Etoposide, tides of the invention and/or agonists and/or antagonists ParaplatinR+Gemcitabine, ParaplatinR+Interferon alpha, 40 thereof may be used to treat, ameliorate and/or prevent skin ParaplatinR+Irinotecan, ParaplatinR)+Paclitaxel, Parapl cancers including, but not limited to, basal cell carcinoma, atinR)+Vinblastine, Carboplatin (ParaplatinR)+Vincristine, squamous cell carcinoma and malignant melanoma. Poly ParaplatinR+Vindesine, ParaplatinR+Vinorelbine, Pemetr nucleotides and/or polypeptides of the invention and/or ago exed disodium+Gemcitabine, Platinol R (Cisplatin)+Vin nists and/or antagonists thereof may be used in combination blastine+Bleomycin (PVB), Prednisone+Methotrexate-- 45 with one or more Surgical and/or radiological procedures Adriamycin-i-Cyclophosphamide+Etoposide (ProMACE), and/or therapeutic agents to treat, ameliorate and/or prevent Procarbazine+Lomustine, Procarbazine+Lomustine--Vinc skin cancers. ristine, Procarbazine--Lomustine--Vincristine--Thioguanine, In preferred embodiments agonists and/or antagonists of Procarbazine--OncovinR+CCNUR)+Cyclophosphamide the present invention are used to treat, ameliorate and/or (POCC), Quinine--Doxorubicin, Quinine--Mitoxantrone-- 50 prevent skin cancers including, but not limited to, basal cell Cytarabine. Thiotepa+Etoposide. Thiotepa+Busulfan-i-Cy carcinoma, squamous cell carcinoma and malignant mela clophosphamide. Thiotepa+Busulfan-i-Melphalan, Thiotepa+ noma. Agonists and/or antagonists of the present invention Etoposide+Carmustine. Thiotepa+Etoposide--Carboplatin, may be used in combination with one or more Surgical and/or Topotecan+Paclitaxel, Trimetrexate--Leucovorin, Vinblas radiological procedures and/or therapeutic agents to treat, tine--Doxorubicin--Thiotepa, Vinblastine--Bleomycin--Eto 55 ameliorate and/or prevent skin cancers. poside--Carboplatin, Vincristine--Lomustine+Prednisone, Polynucleotides and/or polypeptides of the invention and/ Vincristine (OncovinR)+Adriamycin R+Dexamethasone or agonists and/orantagonists thereofmay be administered in (VAD), Vincristine (OncovinR)+Adriamycing+Procarba combination with one or more therapeutic agents useful in the zine (VAP), Vincristine--Dactinomycin-i-Cyclophosphamide, treatment of skin cancers and premalignant conditions and Vinorelbine--Gemcitabine. 60 including, but not limited to, Bleomycin (Blenoxane(R), Can In preferred embodiments, agonists and/or antagonists of nustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), Cispl the invention are administered in combination with one or atin (Platinol R, CDDP), Dacarbazine (DTIC), Interferon more of the above-described combinations of therapeutic alpha2b (Intron A(R), Interleukin-2 (Proleiukin R(R), Tamox agents in the treatment, prevention, amelioration and/or cure ifen (Nolvadex(R, Temozolamide (Temodar R, NSC 362856), of cancers and premalignant conditions. 65 Vinblastine (Velban R, VLB), Vincristine (OncovinR), Onco Polynucleotides and/or polypeptides of the invention and/ TCS(R), VCR, Leurocristine(R), and Vindesine (EldisineR), or agonists and/orantagonists thereofmay be administered in Fildesin(R). US 8,329,179 B2 135 136 In preferred embodiments, agonists and/or antagonists of treatment of brain cancers and premalignant conditions, the invention are administered in combination with one or including, but not limited to, Bleomycin (Blenoxane(R). more of the above-described therapeutic agents in the treat Busulfan (Busulfex(R), Myleran R), Carboplatin (Paraplatin R, ment, amelioration and/or prevention of skin cancers and CBDCA), Carmustine (DTI-015, BCNU, BiCNU, Gliadel premalignant conditions. WaferR), Cisplatin (Platinol R, CDDP), Cisplatin-epineph Preferred combinations of therapeutic agents useful in the rine gel (Intral Dose R, FocaCist(R), Cyclophosphamide (Cy treatment of skin cancers and premalignant conditions which toxan R, CTX), Cytarabine (Cytosar-U(R), ara-C, cytosine ara may be administered in combination with polynucleotides binoside, DepoCytR), Dacarbazine (DTICR), Dactinomycin and/or polypeptides of the invention and/or agonists and/or (CosmegenR), Daunorubicin (Daunomycin, DaunoXomeR), antagonists thereof include, but are not limited to, Cisplatin-- 10 Daunorubicinr), Cerubidine(R), Docetaxel (TaxotereR), Tax Carmustine--Dacarbazine--Tamoxifen. ane(R), Dexamethasone (Decadron(R), Etoposide phosphate In preferred embodiments, agonists and/or antagonists of (Etopophos(R), Etoposide (VP-16, Vepesider), Fluorouracil the invention are administered in combination with one or (5-FU, Adrucil(R), Hydroxyurea (HydreaR), Ifosfamide more of the above-described therapeutic agent combinations (IFEX(R), Lomustine (CCNUR), CeeNUR), Melphalan in the treatment, amelioration and/or prevention of skin can 15 (L-PAM, Alkeran R, Phenylalanine mustard), Mercaptopu cers and premalignant conditions. rine (6-mercaptopurine, 6-MP), Methchlorethamine (Nitro In further specific embodiments, polynucleotides and/or gen Mustard, HN MustargenR), Methotrexate R(MTX, polypeptides of the invention and/or agonists and/or antago Mexate R, Folex(R), Paclitaxel (Paxene.R., Taxol.R.), Pacli nists thereofare used to treat, ameliorate and/or prevent head taxel-DHA (Taxoprexin R), Procarbazine (Matulane(R). and neck cancers including brain cancers. Polynucleotides Temozolamide (Temodar R, NSC 362856), Teniposide (VM and/or polypeptides of the invention and/or agonists and/or 26, VumonR). Thioguanine (6-thioguanine, 6-TG). Thiotepa antagonists thereof may be used in combination with one or (triethylenethiophosphaoramide), Topotecan (Hycamtin R, more Surgical and/or radiological procedures and/or thera SK&F-104864, NSC-609699, Evotopin(R), and Vincristine peutic agents to treat, ameliorate and/or prevent head and (Oncovin R, Onco TCS(R), VCR, Leurocristine(R). neck cancers including brain cancers. Brain cancers which 25 In preferred embodiments, agonists and/or antagonists of may be treated using polynucleotides and/or polypeptides of the invention are administered in combination with one or the invention and/or agonists and/or antagonists thereof more of the above-described therapeutic agents in the treat include, but are not limited to, gliomas Such as astrocytomas ment, amelioration and/or prevention of brain cancers and and oligodendromas, non-glial tumors such as neuronal, premalignant conditions. meningeal, ependymal and choroid plexus cell tumors, and 30 Further examples of therapeutic agents useful in the treat metastatic brain tumors such as those originating as breast, ment of brain cancers and premalignant conditions which lung, prostate and skin cancers. may be administered in combination with polynucleotides In preferred embodiments, agonists and/or antagonists of and/or polypeptides of the invention and/or agonists and/or the present invention are used to treat, ameliorate and/or antagonists thereof include, but are not limited to, 81C6 prevent head and neck cancers including brain cancers. Ago 35 (Anti-tenascin monoclonal antibody), BIBX-1382, Cere nists and/or antagonists of the present invention may be used port(R) (LobradimilR, RMP-7), CilengitideR (EMD-121974, in combination with one or more Surgical and/or radiological integrin alphavbeta3 antagonist), CMT-3 (Metastat(R), Cot procedures and/or therapeutic agents to treat, ameliorate and/ ara R (chTNT-1/B, ''Il-chTNT-1/B), CP IL-4-toxin (IL-4 or prevent head and neck cancers including brain cancers. fusion toxin), Fenretinide(R) (4HPR), Fotemustine (Mupho Brain cancers which may be treated using agonists and/or 40 ran R, Mustophoran R), Gemcitabine (Gemto(R), Gemzar(R), antagonists of the present invention include, but are not lim Hypericin R (VIMRxynR), Imatinib mesylate (STI-571, ited to, gliomas Such as astrocytomas and oligodendromas, Imatinib R, Glivec(R), Gleevec R, Ab1 tyrosine kinase inhibi non-glial tumors such as neuronal, meningeal, ependymal tor), Irinotecan (Camptosar.R, CPT-11, Topotecin.R., Cap and choroid plexus cell tumors, and metastatic brain tumors toCPT-1), Leflunomide (SU-101, SU-0200), Mivobulin Such as those originating as breast, lung, prostate and skin 45 isethionate (CI-980), O6-benzylguanine (BG, Procept(R), Pri CaCCS. nomastat(R) (AG-3340, MMP inhibitor), R115777 (Zar In preferred embodiments, agonists and/or antagonists of nestra(R), SU6668 (PDGF-TK inhibitor), T-67 (T-138067, the invention are used to treat brain tumors. In one preferred T-607), Tamoxifen (Nolvadex(R), Tf-CRM107 (Transferrin embodiment, agonists of the invention are used to treat glio CRM-107), Thalidomide and thalidomide analogs, including blastoma multiforme. 50 but not limited to, lenalidomide (CC-5013, REVLIMIDR) Polynucleotides and/or polypeptides of the invention and/ and CC-4047 (ACTIMIDTM), Tiazofurin (Thiazole(R), Vap or agonists and/orantagonists thereofmay be administered in reotide(R) (BMY-41606), Vinorelbine (Navelbine(R), and combination with one or more radiological procedures useful XR-5000 (DACA). in the treatment of brain cancers including, but not limited to, In preferred embodiments, agonists and/or antagonists of external beam radiation therapy, stereotactic radiation 55 the invention are administered in combination with one or therapy, conformal radiation therapy, intensity-modulated more of the above-described therapeutic agents in the treat radiation therapy (IMRT), and radiosurgery. ment, amelioration and/or prevention of brain cancers and In preferred embodiments, agonists and/or antagonists of premalignant conditions. the invention are administered in combination with one or Preferred combinations of therapeutic agents useful in the more radiological procedures useful in the treatment of brain 60 treatment of brain cancers and premalignant conditions cancers including, but not limited to, external beam radiation which may be administered in combination with polynucle therapy, stereotactic radiation therapy, conformal radiation otides and/or polypeptides of the invention and/or agonists therapy, intensity-modulated radiation therapy (IMRT), and and/or antagonists thereof include, but are not limited to, radioSurgery. Busulfan-i-Melphalan, Carboplatin- Cereport(R), Carbopl Polynucleotides and/or polypeptides of the invention and/ 65 atin-- Etoposide, Carboplatin-- Etoposide-- Thiotepa, Cispl or agonists and/orantagonists thereofmay be administered in atin-- Etoposide, Cisplatin- Cytarabine-- Ifosfamide, Cispl combination with one or more therapeutic agents useful in the atin-- Vincristine--Lomustine, Cisplatin-- US 8,329,179 B2 137 138 Cyclophosphamide+Etoposide+Vincristine, Cisplatin-- EGFR-2 MAb), Ifosfamide (IFEX(R), Letrozole (Femara(R), Cytarabine--Ifosfamide--Etoposide--Methotrexate, Leucovorin (LeucovorinR), WellcovorinR), Mechlore Cyclophosphamide--Melphalan, Cytarabine--Methotrexate, thamine (Nitrogen Mustard, HN MustargenR), Megestrol Dactinomycin--Vincristine, Mechlorethamine--OncovinR) acetate (Megace(R), Pallace(R), Melphalan (L-PAM, Alke (Vincristine)+Procarbazine (MOP), Mechlorethamine--On ran R, Phenylalanine mustard), Methotrexate R (MTX, Mex covinR (Vincristine)+Procarbazine--Prednisone (MOPP), ate(R). Folex(R), Methyltestosterone (Android-10R, TestredR, Carboplatin (ParaplatinR)+Etoposide, Carboplatin (Parapl Virilon(R), Mitomycin C (Mitomycin R, Mutamycin R, Mito atinR)--Vincristine, Procarbazine--Lomustine, Procarba Extra(R), Orzel(R) (Tegafur--Uracil-Leucovorin), Paclitaxel Zine--Lomustine--Vincristine, Procarbazine+Lomustine-- (Paxene.R., Taxol.R.), Sobuzoxane (MST-16, Perazolin R), Vincristine--Thioguanine. Thiotepa+Etoposide. Thiotepa+ 10 Etoposide+Carmustine. Thiotepa+Etoposide--Carboplatin, Tamoxifen (Nolvadex(R), Testosterone (Andro(R), Andro Vinblastine--Bleomycin--Etoposide--Carboplatin, and Vinc derm(R, Testoderm TTSR, Testoderm(R), Depo-Testoster ristine-Lomustine--Prednisone. one(R), Androgel(R), depo AndroR), Vinblastine (Velban R, In preferred embodiments, agonists and/or antagonists of VLB), Vincristine (Oncovin(R), Onco TCS(R), VCR, Leuroc the invention are administered in combination with one or 15 ristine(R), and Vinorelbine (Navelbine(R). more of the above-described combinations of therapeutic In preferred embodiments, agonists and/or antagonists of agents in the treatment, amelioration and/or prevention of the invention are administered in combination with one or brain cancers and premalignant conditions. more of the above-described therapeutic agents in the treat In further particular embodiments, polynucleotides and/or ment, amelioration and/or prevention of breast cancers and polypeptides of the invention and/or agonists and/or antago premalignant conditions. nists thereofare used to treat, ameliorate and/or prevent breast Further examples of therapeutic agents useful in the treat cancer and premalignant conditions. Polynucleotides and/or ment of breast cancer and premalignant conditions which polypeptides of the invention and/or agonists and/or antago may be administered in combination with polynucleotides nists thereof may be used in combination with one or more and/or polypeptides of the invention and/or agonists and/or Surgical and/or radiological procedures and/or therapeutic 25 antagonists thereof include, but are not limited to, Aldesleu agents to treat, ameliorate and/or prevent breast cancer. kin (IL-2, Proleukin R), Altretamine (Hexylen R, hexameth Breast cancers which may be treated using polynucleotides ylmelamine, Hexastat(R), Angiostatin, Annamycin (AR-522. and/or polypeptides of the invention and/or agonists and/or annamycin LF, AronexR)), Biricodar dicitrate (Incel(R), Incel antagonists thereof include, but are not limited to, ductal MDR Inhibitor), Boronated Protoporphyrin Compound carcinoma, stage 1, stage 11, stage III and stage 1 V breast 30 (PDIT, Photodynamic Immunotherapy), Bryostatin-1 (Bry cancers as well as invasive breast cancer and metastatic breast ostatin, BMY-45618, NSC-339555), Busulfan (Busulfex(R), CaC. Myleran R), Carmustine (DTI-015, BCNU, BiCNU, Gliadel In preferred embodiments, agonists and/or antagonists of WaferR), D-limonene, Dacarbazine (DTIC), Daunorubicin the present invention are used to treat, ameliorate and/or (Daunomycin, DaunoXome(R), Daunorubicin R, Cerubi prevent breast cancer and premalignant conditions. Agonists 35 dineR), Dolastatin-10 (DOLA-10, NSC-376128), DPPE, and/or antagonists of the present invention may be used, in DX-8951f (DX-8951), EMD-121974, Endostatin, EO9 combination with one or more Surgical and/or radiological (EO1, EO4, EO68, EO70, EO72), Etoposide phosphate (Eto procedures and/or therapeutic agents to treat, ameliorate and/ pophos(R), Etoposide (VP-16, Vepesider), Fluasterone, Flu or prevent breast cancer and premalignant conditions. Breast darabine (Fludara R.V. FAMP), Flutamide (Eulexin R), Form cancers which may be treated using agonists and/or antago 40 estane (Lentaron(R), Fulvestrant (Faslodex(R), Galarubicin nists of the present invention include, but are not limited to, hydrochloride (DA-125), Gemcitabine (GemtoR, ductal carcinoma, stage I, stage 11, stage III and stage 1 V Gemzar R), Her-2/Neu vaccine, Hydroxyurea (HydreaR), breast cancers as well as invasive breast cancer and metastatic Idarubicin (Idamycin R, DMDR, IDA), Interferon alpha 2a breast cancer. (Intron A(R), Interferon gamma (Gamma-interferon, Gamma In preferred embodiment, agonists and/or antagonists of 45 100R, Gamma-IF), Irinotecan (Camptosar.R, CPT-11, Topo the invention are used to treat metastatic breast cancer. tecin R., CaptoCPT-1), Ketoconazole (Nizoral R), KRN-8602 In other preferred embodiments, agonists and/or antago (MX, MY-5. NSC-619003, MX-2), L-asparaginase (El nists of the present invention are administered in combination spar R), Leuprolide acetate (Viadur R. Lupron(R), Lomustine with one or more Surgical and/or radiological procedures (CCNUR), CeeNUR), LY-335979, Mannan-MUC1 vaccine, useful in the treatment of breast cancer and premalignant 50 2-Methoxyestradiol (2-ME, 2-ME2), Mitoxantrone (No conditions. Vantrone(R), DHAD), Motexafin Lutetium (Lutrin R, OptrinR), Polynucleotides and/or polypeptides of the invention and/ Lu-Tex R, lutetium texaphyrin, LucynR), AntrinR), MPV or agonists and/orantagonists thereofmay be administered in 2213ad (Finrozole(R), MS-209, Muc-1 vaccine, NaPro Pacli combination with one or more therapeutic agents useful in the taxel, Perillyl alcohol (perilla alcohol, perillic alcohol, peril treatment of breast cancer and premalignant conditions, 55 lol, NSC-641066), Pirarubicin (THP), Procarbazine including, but not limited to, Amifostine (Ethyol(R), Amino (Matulane(R), Providence Portland Medical Center Breast glutethimide (Cytadren(R), Anastrozole (Arimidex(R), Bleo Cancer Vaccine, Pyrazoloacridine (NSC-366140, mycin (Blenoxane(R), Capecitabine (XelodaR), Doxifluri PD-115934), Raloxifene hydrochloride (Evista R, Keoxifene dine(R), oral 5-FU), Cisplatin (Platinol R, CDDP), Cisplatin hydrochloride), Raltitrexed (Tomudex R, ZD-1694), Rebec epinephrine gel (Intral Dose(R), FocaCist(R), 60 camycin, Streptozocin (Zanosar.R.), Temozolamide (Temo Cyclophosphamide (Cytoxan R. Neosar.R, CTX), Docetaxel dar R, NSC 362856), Theratope. Thiotepa (triethylenethio (Taxotere?R, Taxane(R). Doxorubicin (Adriamycin R, phosphaoramide. Thioplex(R), Topotecan (Hycamtin R, Doxil R, Rubex(R), Epirubicin (Ellence(R), EPI, 4 epi-doxo SK&F-104864, NSC-609699, Evotopin(R), Toremifene (Es rubicin), Exemestane (Aromasin(R), Nikidess(RR), Fadrozole trimex(R, Fareston(R), Trilostane (ModrefenR), and XR-9576 (Afema(R, Fadrozole hydrochloride, Arensin(R), Fluorouracil 65 (XR-9351, P-glycoprotein/MDR inhibitor). (5-FU, Adrucil(R), Fluoroplex(R), Efudex(R), Herceptin(R) In preferred embodiments, agonists and/or antagonists of (Trastuzumab(R), Anti-HER-2 monoclonal antibody, Anti the invention are administered in combination with one or US 8,329,179 B2 139 140 more of the above-described therapeutic agents in the treat (CCNUR), CeeNUR), Mechlorethamine (Nitrogen Mustard, ment, amelioration and/or prevention of breast cancers and HN, MustargenR), Melphalan (L-PAM, Alkeran R, Pheny premalignant conditions. lalanine mustard), MethotrexateR (MTX, Mexate R, Preferred combinations of therapeutic agents useful in the Folex(R), Mitomycin C (Mitomycin R, Mutamycin R, Mito treatment of breast cancer which may be administered in Extra(R), Paclitaxel (Paxene.R., Taxol.R.), Paclitaxel-DHA combination with polynucleotides and/or polypeptides of the (Taxoprexin R), Porfimer sodium (PhotofrinR), Procarbazine invention and/or agonists and/or antagonists thereof include, (Matulane(R), SKI-2053R(NSC-D644591), Teniposide but are not limited to, Cyclophosphamide+Adriamycin R (VM-26, Vumon R.), Topotecan (Hycamtin R, SK&F-104864, (Doxorubicin), Cyclophosphamide+Epirubicin-i-Fluorou NSC-609699, Evotopin(R), Vinblastine (Velban(R), VLB), racil, Cyclophosphamide--Methotrexate--Fluorouracil 10 Vincristine (Oncovin R, Onco TCSR, VCR, Leurocristine(R), (CMF), Paclitaxel--Doxorubicin, and Vinblastine--Doxorubi Vindesine (Eldisine(R, Fildesin(R), and Vinorelbine (Navel cin+Thiotepa. bine(R). In preferred embodiments, agonists and/or antagonists of In preferred embodiments, agonists and/or antagonists of the invention are administered in combination with one or the invention are administered in combination with one or more of the above-described therapeutic agent combinations 15 more of the above-described therapeutic agents in the treat in the treatment, amelioration and/or prevention of breast ment, amelioration and/or prevention of lung cancers and cancers and premalignant conditions. premalignant conditions. In further specific embodiments, polynucleotides and/or Further examples of therapeutic agents useful in the treat polypeptides of the invention and/or agonists and/or antago ment of lung cancer and premalignant conditions which may nists thereof are used to treat, ameliorate and/or prevent lung be administered in combination with polynucleotides and/or cancer and premalignant conditions. Polynucleotides and/or polypeptides of the invention and/or agonists and/or antago polypeptides of the invention and/or agonists and/or antago nists thereof include, but are not limited to, ABX-EGF (anti nists thereof may be used in combination with one or more EGFr MAb), Acetyldinaline (CI-994), AG-2034 (AG-2024, Surgical and/or radiological procedures and/or therapeutic AG-2032, GARFT glycinamide ribonucleoside transformy agents to treat, ameliorate and/or prevent lung cancer. Lung 25 lase inhibitor), Alanosine, Aminocamptothecin (9-AC, cancer which may be treated using polynucleotides and/or 9-Aminocamptothecin, NSC 603071), Angiostatin, Aplidine polypeptides of the invention and/or agonists and/or antago (Aplidin R, AplidinaR), BBR 3464, Bexarotene (Targretin R, nists thereof includes, but is not limited to, non-small cell LGD1069), BIBH-1 (Anti-FAP MAb), BIBX-1382, BLP-25 lung cancer (NSCLC) including early stage NSCLC (i.e., (MUC-1 peptide), Bryostatin-1 (Bryostatin RV. BMY-45618, Stage IA/IB and Stage IIA/IIB), Stage IIIA NSCLC, Stage 30 NSC-339555), Budesonide (Rhinocort(R), C225 (IMC-225, IIA (unresectable)/IIIB NSCLC and Stage IV NSCLC, small EGFR inhibitor, Anti-EGFr MAb, Cetuximab(R), Capecitab cell lung cancer (SCLC) including limited stage SCLC and ine (Xeloda R, Doxifluridine(R), oral 5-FU), Carboxyamidot extensive stage SCLC as well as Malignant Pleural Mesothe riazole (NSC 609974, CAI, L-651582), CEA-cide(R) (La lioma. betuzumab(R), Anti-CEA monoclonal antibody, hMN-14), In preferred embodiments, agonists and/or antagonists of 35 Cereport(R) (LobradimilR, RMP-7), CI-1033 (Pan-erbB RTK the present invention are used to treat, ameliorate and/or inhibitor), Cilengitide(R) (EMD-12 1974, integrin alphavbeta3 prevent lung cancer and premalignant conditions. Agonists antagonist), 9-cis retinoic acid (9-cRA), Cisplatin-liposomal and/or antagonists of the present invention may be used in (SPI-077), CMB-401 (Anti-PEM MAb?calicheamycin), combination with one or more Surgical and/or radiological CMT-3 (Metastat(R), CP-358774 (Tarceva(R, OSI-774, procedures and/or therapeutic agents to treat, ameliorate and/ 40 EGFR inhibitor), CT-2584 (Apra(R), DAB389-EGF (EGF or prevent lung cancer and premalignant conditions. Lung fusion toxin), DeaVacR) (CEA anti-idiotype vaccine), Decit cancer which may be treated using agonists and/or antago abine (5-aza-2'-deoxyytidine), Diethylnorspermine nists of the present invention includes, but is not limited to, (DENSPM), Dihydro-5-azacytidine, EGF-P64k Vaccine, non-Small cell lung cancer (NSCLC) including early stage Endostatin, Etanidazole (Radinyl(R), Exetecan mesylate NSCLC (i.e., Stage IA/IB and Stage IIA/IIB), Stage IIIA 45 (DX-8951, DX-8951f), Exisulind (SAAND, AptosynR), NSCLC, Stage IIA (unresectable)/IIIB NSCLC and Stage IV cGMP-PDE2 and 5 inhibitor), FK-317 (FR-157471, NSCLC, small cell lung cancer (SCLC) including limited FR-70496), Flavopiridol (HMR-1275), Fotemustine (Mu stage SCLC and extensive stage SCLC as well as Malignant phoran R. Mustophoran R), G3139 (Genasense(R), GentaAn Pleural Mesothelioma. ticode(R), Bcl-2 antisense), Gadolinium texaphyrin (Motexa In preferred embodiments, agonists and/or antagonists of 50 fin gadolinium, Gd-Tex R, Xcytrin(R), GBC-590, GL331, the invention are used to treat non-Small cell lung cancers. Galarubicin hydrochloride (DA-125), Glufosfamide(R) (O-D- Polynucleotides and/or polypeptides of the invention and/ glucosyl-isofosfamide mustard, D19575, INN), GVAX(GM or agonists and/orantagonists thereofmay be administered in CSF genetherapy), INGN-101 (p53 genetherapy/retrovirus), combination with one or more therapeutic agents useful in the INGN-201 (p53 gene therapy/adenovirus), Irofulven (MGI treatment of lung cancer and premalignant conditions, 55 114), ISIS-2053, ISIS-3521 (PKC-alpha antisense), ISIS including, but not limited to, BAY 43-9006 (Raf kinase 5132 (K-ras?raf antisense), Isotretinoin (13-CRA, 13-cis ret inhibitor), Carboplatin (Paraplatin R, CBDCA), Chloram inoic acid, Accutane(R), Lometrexol (T-64, T-904064), bucil (Leukeran R), Cisplatin (Platinol R, CDDP), Cisplatin Marimastat(R) (BB-2516, TA-2516, MMP inhibitor), MDX epinephrine gel (Intral Dose(R), FocaCist(R), Cyclophospha 447 (BAB-447, EMD-82633, H-447, anti-EGFr/ mide (Cytoxan R, Neosar(R, CTX), Docetaxel (Taxotere?R), 60 FcGammaR1r), MGV, Mitumomab R (BEC-2, EMD Taxane(R). Doxorubicin (Adriamycin R, Doxil R. RubexR), 60205), Mivobulin isethionate (CI-980), Neovastat(R) (AE Edatrexate, Epirubicin (Ellence(R), EPI, 4 epi-doxorubicin), 941, MMP inhibitor), NPI-0052 (proteasome inhibitor), Etoposide phosphate (Etopophos(R), Etoposide (VP-16, Onconase (Ranpirinase(R), Onyx-015 (p53 gene therapy), Vepesider), Gemcitabine (Gemto(R), Gemzar(R), HerceptinR) Pemetrexed disodium (Alimta R, MTA, multitargeted anti (Trastuzumab(R), Anti-HER-2 monoclonal antibody, Anti 65 folate, LY 231514), Pivaloyloxymethylbutyrate (AN-9, Piv EGFR-2 MAb), Ifosfamide (IFEX(R), Irinotecan (Camp anex(R), Prinomastat(R) (AG-3340, MMP inhibitor), PS-341 tosar(R), CPT-11, Topotecin.R., CaptoCPT-1), Lomustine (LDP-341, 26S proteasome inhibitor), Pyrazoloacridine US 8,329,179 B2 141 142 (NSC-366140, PD-115934), R115777 (Zamestra(R), Raltitr tine)+Cyclophosphamide (POCC), Vincristine (OncovinR)+ exed (Tomudex R, ZD-1694), R-flurbiprofen (Flurizan(R), Adriamycin R+Procarbazine (VAP), and Vinorelbine-- E-7869, MPC-7869), RFS-2000 (9-nitrocamptothecan, Gemcitabine. 9-NC, Rubitecan R), RSR-13 (GSJ-61), Satraplatin (BMS In preferred embodiments, agonists and/or antagonists of 182751, JM-216), SCH-66336, Sizofilan R (SPG, Sizofu the invention are administered in combination with one or ran R. Schizophyllan R, Sonifilan R), Squalamine (MSI more of the above-described therapeutic agent combinations 1256F), SR-49059 (vasopressin receptor inhibitor, Vla), in the treatment, amelioration and/or prevention of lung can SU5416 (Semaxanib.R.), VEGF inhibitor), Taurolidine (Tau cers and premalignant conditions. rolin(R), Temozolamide (Temodar R, NSC 362856), Thalido In further particular embodiments, polynucleotides and/or 10 polypeptides of the invention and/or agonists and/or antago mide and thalidomide analogs, including but not limited to, nists thereof are used to treat, ameliorate and/or prevent col lenalidomide (CC-5013, REVLIMIDR) and CC-4047 (AC orectal cancer and premalignant conditions. Polynucleotides TIMIDTM), Thymosin alpha I (Zadaxin(R), Thymalfasin(R), and/or polypeptides of the invention and/or agonists and/or Tirapazamine (SR-259075, SR-4233, Tirazone.R., Win antagonists thereof may be used in combination with one or 59075), TNP-470 (AGM-1470), TriAb(R) (anti-idiotype anti 15 more Surgical and/or radiological procedures and/or thera body immune stimulator), Tretinoin (Retin-AR, AtragenR), peutic agents to treat, ameliorate and/or prevent colorectal ATRA, VesanoidR), Troxacitabine (BCH-204, BCH-4556, cancer and premalignant conditions. Colorectal cancers TroxatylRD), Vitaxin RD (LM-609, integrin alphavbeta3 which may be treated using polynucleotides and/or polypep antagonistic MAb), XR-9576 (P-glycoprotein/MDR inhibi tides of the invention and/or agonists and/or antagonists tor), and ZD-1839 (IRESSAR). thereof include, but are not limited to, colon cancer (e.g., early In preferred embodiments, agonists and/or antagonists of stage colon cancer (stage I and II), lymph node positive colon the invention are administered in combination with one or cancer (stage III), metastatic colon cancer (stage 1 V)) and more of the above-described therapeutic agents in the treat rectal cancer. ment, amelioration and/or prevention of lung cancers and In preferred embodiments, agonists and/or antagonists of premalignant conditions. 25 the present invention are used to treat, ameliorate and/or Preferred combinations of therapeutic agents useful in the prevent colorectal cancer and premalignant conditions. Ago treatment of lung cancer and premalignant conditions which nists and/or antagonists of the present invention may be used may be administered in combination with polynucleotides in combination with one or more Surgical and/or radiological and/or polypeptides of the invention and/or agonists and/or procedures and/or therapeutic agents to treat, ameliorate and/ antagonists thereof include, but are not limited to, Cisplatin-- 30 or prevent colorectal cancer and premalignant conditions. Docetaxel, Cisplatin--Etoposide, Cisplatin+Gemcitabine, Colorectal cancers which may be treated using agonists and/ Cisplatin-i-Interferon alpha, Cisplatin-i-Irinotecan, Cisplatin-- or antagonists of the present invention include, but are not Paclitaxel, Cisplatin--Teniposide, Cisplatin--Vinblastine, limited to, colon cancer (e.g., early stage colon cancer (stage Cisplatin--Vindesine, Cisplatin--Vinorelbine, Cisplatin--Vin I and II), lymph node positive colon cancer (stage III), meta 35 static colon cancer (stage 1 V)) and rectal cancer. blastine+Mitomycin C, Cisplatin--Vinorelbine--Gemcitab In preferred embodiments, agonists and/or antagonists of ine, Cisplatin (Platinol R)+Oncovin R+Doxorubicin (Adria the invention are used to treat colon cancer and premalignant mycin R)+Etoposide (CODE), Cyclophosphamide+ conditions. Adriamycing--Cisplatin (PlatinolR) (CAP), Polynucleotides and/or polypeptides of the invention and/ Cyclophosphamide+Adriamycing--Vincristine (CAV), 40 or agonists and/orantagonists thereofmay be administered in Cyclophosphamide+Epirubicin-i-Cisplatin (PlatinolR) combination with one or more therapeutic agents useful in the (CEP), Cyclophosphamide--Methotrexate--Vincristine treatment of colorectal cancer and premalignant conditions, (CMV), Cyclophosphamide+Adriamycin R, Methotrexate-- including, but not limited to, Capecitabine (Xeloda R., Doxi Fluorouracil (CAMF), Cyclophosphamide+Adriamycin R, fluridine(R), oral 5-FU), Fluorouracil (5-FU, Adrucil(R, Fluo Methotrexate--Procarbazine (CAMP), Cyclophosphamide-- 45 roplex(R), Efudex(R), Irinotecan (Camptosar.R, CPT-11, Topo Adriamycin R, Vincristine--Etoposide (CAV-E), Cyclophos tecin.R., CaptoCPT-1), Leucovorin (LeucovorinR), phamide-Adriamycin R, Vincristine--Teniposide (CAV-T), WelicovorinR), and Levamisole (ErgamisolR). Cyclophosphamide--OncovinR), Methotrexate--Fluorouracil In preferred embodiments, agonists and/or antagonists of (COMF), Cyclophosphamide+Adriamycin R+Vincristine, the invention are administered in combination with one or alternating with Cisplatin--Etoposide (CAV/PE), Docetaxel 50 more of the above-described therapeutic agents in the treat Gemcitabine, Docetaxel--Vinorelbine, Etoposide (Ve ment, amelioration and/or prevention of colorectal cancers pesider)+Ifosfamide+Cisplatin (Platinol R) (VIP), Etoposide and premalignant conditions. (Vepesider)+Ifosfamide, Cisplatin-Epirubicin (VIC-E), Preferred combinations of therapeutic agents useful in the Fluorouracil--OncovinR+Mitomycin C (FOMi), Hydrazine-- treatment of colorectal cancer and premalignant conditions Adriamycin R+Methotrexate (HAM), Ifosfamide--Doc 55 which may be administered in combination with polynucle etaxel, Ifosfamide--Etoposide, Ifosfamide+Gemcitabine, otides and/or polypeptides of the invention and/or agonists Ifosfamide--Paclitaxel, Ifosfamide--Vinorelbine, Ifosfa and/or antagonists thereof include, but are not limited to, mide--Carboplatin--Etoposide (ICE), Irinotecan+Docetaxel, Fluorouracil-Leucovorin and Fluorouracil-Levamisole. Irinotecan+Etoposide, Irinotecan+Gemcitabine, Methotrex In preferred embodiments, agonists and/or antagonists of ate+Cisplatin, Methotrexate--Interferon alpha, Methotrex 60 the invention are administered in combination with one or ate+Vinblastine, Mitomycin C+Ifosfamide+Cisplatin (Plati more of the above-described therapeutic agent combinations nolR) (MIP), Mitomycin C+Vinblastine--ParaplatinR) in the treatment, amelioration and/or prevention of colorectal (MVP), Paraplatin R+Docetaxel, ParaplatinR+Etoposide, cancers and premalignant conditions. ParaplatinR+Gemcitabine, ParaplatinR+Interferon alpha, Further examples of therapeutic agents useful in the treat ParaplatinR+Irinotecan, ParaplatinR)+Paclitaxel, Parapl 65 ment of colorectal cancer and premalignant conditions which atinR)+Vinblastine, ParaplatinR+Vindesine, ParaplatinR)+ may be administered in combination with polynucleotides Vinorelbine, Procarbazine--OncovinR+CCNUR (Lomus and/or polypeptides of the invention and/or agonists and/or US 8,329,179 B2 143 144 antagonists thereof include, but are not limited to, Ami nists and/or antagonists of the present invention may be used nocamptothecin (9-AC, 9-Aminocamptothecin, NSC in combination with one or more Surgical and/or radiological 603071), Aplidine (Aplidin R, AplidinaR), Bevacizumab(R) procedures and/or therapeutic agents to treat, ameliorate and/ (Anti-VEGF monoclonal antibody, rhuMAb-VEGF), C225 or prevent prostate cancer and premalignant conditions. Pros (IMC-225, EGFR inhibitor, Anti-EGFr MAb, Cetuximab(R), tate cancer which may be treated using polynucleotides and/ C242-DM1 (huC242-DM1), CC49-Zeta gene therapy, CEA or polypeptides of the invention and/or agonists and/or cideR (Labetuzumab(R), Anti-CEA monoclonal antibody, antagonists thereof includes, but is not limited to, benign hMN-14), CeaVac(R) (MAb3H1), CP-609754, CTP-37 (Avi prostatic hyperplasia, malignant prostate cancer (e.g., stage 1, cine.R., hCG blocking vaccine), Declopramide (Oxi-104), stage 11, stage III or stage 1 V) and metastatic prostate cancer. Eniluracil (776c85), F19 (Anti-FAP monoclonal antibody, 10 In preferred embodiments, agonists and/or antagonists of iodinated anti-FAP MAb), FMdC (KW-2331, MDL the invention are used to treat malignant prostate cancer. In 101731), FUDR (Floxuridine(R), Gemcitabine (Gemto(R), other preferred embodiments, agonists and/or antagonists of Gemzar(R), HerceptinR(Trastuzumab(R), Anti-HER-2 mono the invention are used to treat metastatic prostate cancer. clonal antibody, Anti-EGFR-2 MAb), Intoplicine (RP Polynucleotides and/or polypeptides of the invention and/ 60475), L-778123 (Ras inhibitors), Leuvectin(R) (cytofectin-- 15 or agonists and/orantagonists thereofmay be administered in IL-2 gene, IL-2 gene therapy), MN-14 (Anti-CEA immuno combination with one or more Surgical, radiological and/or radiotherapy, 'I-MN-14, Re-MN-14), OncoVAX-CL, hormonal procedures useful in the treatment of prostate can OncoVAX-CL-Jenner (GA-733-2 vaccine) Orzel(R) cer and premalignant conditions including, but not limited to, (Tegafur--Uracil-Leucovorin), Oxaliplatin (Eloxatine(R), prostatectomy (e.g., radical retropubic prostatectomy), exter EloxatinR), Paclitaxel-DHA (TaxoprexinR), Pemetrexed nal beam radiation therapy, brachytherapy, orchiectomy and disodium (Alimta R, MTA, multitargeted antifolate, LY hormone treatment (e.g., LHRH agonists, androgen receptor 231514), R115777 (Zarnestra(R), Raltitrexed (Tomudex R, inhibitors). ZD-1694), SCH 66336, SU5416 (Semaxanib{R, VEGF In preferred embodiments, agonists and/or antagonists of inhibitor), Tocladesine (8-C1-cAMP), Trimetrexate (Neutr the present invention may be administered in combination exin(R), TS-1, and ZD-9331. 25 with one or more Surgical, radiological and/or hormonal pro In preferred embodiments, agonists and/or antagonists of cedures useful in the treatment of prostate cancer and prema the invention are administered in combination with one or lignant conditions including, but not limited to, prostatec more of the above-described therapeutic agents in the treat tomy (e.g., radical retropubic prostatectomy), external beam ment, amelioration and/or prevention of colorectal cancers radiation therapy, brachytherapy, orchiectomy and hormone and premalignant conditions. 30 treatment (e.g., LHRH agonists, androgen receptor inhibi Further exemplary combinations of therapeutic agents use tors). ful in the treatment of colorectal cancer and premalignant Polynucleotides and/or polypeptides of the invention and/ conditions which may be administered in combination with or agonists and/orantagonists thereofmay be administered in polynucleotides and/or polypeptides of the invention and/or combination with one or more therapeutic agents useful in the agonists and/or antagonists thereof include, but are not lim 35 treatment of prostate cancer and premalignant conditions ited to, Aminocamptothecin--G-CSF, Bevacizumab(R+Fluo including, but not limited to, Aminoglutethimide (Cyta rouracil, Bevacizumab(R+Leucovorin, Bevacizumab R+ dren(R), Biclutamide (Casodex(R), Cyclophosphamide Fluorouracil-Leucovorin, Cyclophosphamide--SCH 6636, (Cytoxan(Rg, Neosar.R, CTX), Diethylstilbestrol (DES), Fluorouracil--CeaVacR, Fluorouracil--Oxaliplatin, Fluorou Doxorubicin (Adriamycin R, Doxil R, RubeXR), Flutamide racil--Raltitrexed, Fluorouracil--SCH 6636, Fluorouracil 40 (Eulexin R), Hydrocortisone, Ketoconazole (NiZoral(R), Leu Trimetrexate, Fluorouracil-Leucovorin-Oxaliplatin, Fluo prolide acetate (Viadur R. Lupron(R), Leuprogel(R), Eligard R). rouracil--Leucovorin-i-Trimetrexate, Irinotecan+C225 Mitoxantrone (Novantrone(R), DHAD), Nilutamide (Nilan (Cetuximab(R), OncovinR+SCH 6636, Oxaliplatin-i-Leucov dron(R), Paclitaxel (Paxene.R., Taxol.R.), Paclitaxel-DHA orin, Paclitaxel--SCH 6636, Pemetrexed disodium+Gemcit (Taxoprexin R), PC SPES, Prednisone, Triptorelin pamoate abine, and Trimetrexate--Leucovorin. 45 (Trelstar Depot(R), Decapeptyl(R), and Vinblastine (Velban R, In preferred embodiments, agonists and/or antagonists of VLB). the invention are administered in combination with one or In preferred embodiments, agonists and/or antagonists of more of the above-described therapeutic agent combinations the invention are administered in combination with one or in the treatment, amelioration and/or prevention of colorectal more of the above-described therapeutic agents in the treat cancers and premalignant conditions. 50 ment, amelioration and/or prevention of prostate cancers and In further specific embodiments, polynucleotides and/or premalignant conditions. polypeptides of the invention and/or agonists and/or antago Further examples of therapeutic agents useful in the treat nists thereofare used to treat, ameliorate and/or prevent pros ment of prostate cancer and premalignant conditions which tate cancer and premalignant conditions. Polynucleotides may be administered in combination with polynucleotides and/or polypeptides of the invention and/or agonists and/or 55 and/or polypeptides of the invention and/or agonists and/or antagonists thereof may be used in combination with one or antagonists thereof include, but are not limited to, Abarelix(R) more Surgical and/or radiological procedures and/or thera (Abarelix-Depot-MR), PPI-149, R-3827); Abiraterone peutic agents to treat, ameliorate and/or prevent prostate can Acetate R (CB-7598, CB-7630), ABT-627 (ET-1 inhibitor), cer and premalignant conditions. Prostate cancer which may APC-8015 (Provenge R, Dendritic cell therapy), Avorelin(R) be treated using polynucleotides and/or polypeptides of the 60 (Meterelin R, MF-6001, EP-23904), CEP-701 (KT-5555), invention and/oragonists and/orantagonists thereof includes, CN-706, CT-2584 (Apra R, CT-2583, CT-2586, CT-3536), but is not limited to, benign prostatic hyperplasia, malignant GBC-590, Globo Hhexasaccharide (Globo H-KLHR), Inter prostate cancer (e.g., stage 1, stage 11, stage III or stage 1 V) feron alpha 2a (Intron A(R), LiaroZole (Liazal, LiaZol. and metastatic prostate cancer. R-75251, R-85246, Ro-85264), MDX-447 (MDX-220, In preferred embodiments, agonists and/or antagonists of 65 BAB-447, EMD-82633, H-447, anti-EGFr/FcGammaR1r), the present invention are used to treat, ameliorate and/or NPI-0052 (proteasome inhibitor), OncoVAX-P (OncoVAX prevent prostate cancer and premalignant conditions. Ago PrPSA), PROSTVAC, PS-341 (LDP-341, 26S proteasome US 8,329,179 B2 145 146 inhibitor), PSMA MAb (Prostate Specific Membrane Anti combination with one or more therapeutic agents useful in the gen monoclonal antibody), and R-flurbiprofen (Flurizan(R), treatment of pancreatic cancer and premalignant conditions E-7869, MPC-7869). including, but not limited to, Capecitabine (Xeloda R., Doxi In preferred embodiments, agonists and/or antagonists of fluridine(R), oral 5-FU), Cisplatin (Platinol R, CDDP), Fluo the invention are administered in combination with one or 5 rouracil (5FU, Adrucil(R), Fluoroplex(R), Efudex(R), Gemcit more of the above-described therapeutic agents in the treat abine (Gemto(R), Gemzar(R), and Irinotecan (Camptosar R, ment, amelioration and/or prevention of prostate cancers and CPT-11, Topotecin R., CaptoCPT-1). premalignant conditions. In preferred embodiments, agonists and/or antagonists of Preferred combinations of therapeutic agents useful in the the invention are administered in combination with one or treatment of prostate cancer and premalignant conditions 10 which may be administered in combination with polynucle more of the above-described therapeutic agents in the treat otides and/or polypeptides of the invention and/or agonists ment, amelioration and/or prevention of pancreatic cancers. and/or antagonists thereof include, but are not limited to, Preferred combinations of therapeutic agents useful in the Docetaxel--Estramustine, Mitoxantrone--Hydrocortisone, treatment of pancreatic cancer and premalignant conditions Mitoxantrone--Prednisone, Navelbine--Estramustine, Pacli 15 which may be administered in combination with polynucle taxel--Estramustine, and Vinblastine--Estramustine. otides and/or polypeptides of the invention and/or agonists In preferred embodiments, agonists and/or antagonists of and/or antagonists thereof include, but are not limited to, the invention are administered in combination with one or Cisplatin--Gemcitabine, CP-358774+Gemcitabine, Doc more of the above-described therapeutic agent combinations etaxel--Gemcitabine, Irinotecan+Fluorouracil, Irinotecan in the treatment, amelioration and/or prevention of prostate Gemcitabine, and Paclitaxel--Gemcitabine. cancers and premalignant conditions. In preferred embodiments, agonists and/or antagonists of In further specific embodiments, polynucleotides and/or the invention are administered in combination with one or polypeptides of the invention and/or agonists and/or antago more of the above-described therapeutic agent combinations nists thereof are used to treat, ameliorate and/or prevent pan in the treatment, amelioration and/or prevention of pancreatic creatic cancer and premalignant conditions. Polynucleotides 25 cancers and premalignant conditions. and/or polypeptides of the invention and/or agonists and/or Further examples of therapeutic agents useful in the treat antagonists thereof may be used in combination with one or ment of pancreatic cancer and premalignant conditions which more Surgical and/or radiological procedures and/or thera may be administered in combination with polynucleotides peutic agents to treat, ameliorate and/or prevent pancreatic and/or polypeptides of the invention and/or agonists and/or cancer and premalignant conditions. Pancreatic cancers 30 antagonists thereof include, but are not limited to, ABX-EGF which may be treated using polynucleotides and/or polypep (anti-EGFr MAb), Acetyldinaline (CI-994, GOE-5549, tides of the invention and/or agonists and/or antagonists GOR-5549, PD-130636), BMS-214662 (BMS-192331, thereof include, but are not limited to, adenocarcinoma, endo BMS-193269, BMS-206635), BNP-1350 (BNPI-1100, crine (islet cell) tumors, tumors confined to the pancreas, Karenitecins), C225 (IMC-225, EGFR inhibitor, Anti-EGFr locally advanced pancreatic cancer and metastatic pancreatic 35 MAb, Cetuximab(R), C242-DM1 (huC242-DM1, CaCC. SB-408075), CarbendazinR(FB-642), Carmustine (DTI In preferred embodiments, agonists and/or antagonists of 015, BCNU, BiCNU, Gliadel WaferR), CMT-3 (COL-3, the present invention are used to treat, ameliorate and/or Metastat(R), CP-358774 (Tarceva(R, OSI-774, EGFR inhibi prevent pancreatic cancer and premalignant conditions. Ago tor), Docetaxel (Taxotere?R), Taxane.R.), Exetecan mesylate nists and/or antagonists of the present invention may be used 40 (DX-8951, DX-8951f), Flavopiridol (HMR-1275), Gastrim in combination with one or more Surgical and/or radiological mune(R) (Anti-gastrin-17 immunogen, anti-gl7), GBC-590, procedures and/or therapeutic agents to treat, ameliorate and/ Herceptin R (Trastuzumab(R), Anti-HER-2 monoclonal anti or prevent pancreatic cancer and premalignant conditions. body, Anti-EGFR-2 MAb), HSPPC-96 (HSP cancer vaccine, Pancreatic cancers which may be treated using agonists and/ gp96 heat shock protein-peptide complex), Irofulven (MGI or antagonists of the present invention include, but are not 45 114), ISIS-2503 (Ras antisense), Onyx-015 (p53 gene limited to, adenocarcinoma, endocrine (islet cell) tumors, therapy), Paclitaxel (Paxene.R.), Taxol.R.), Pemetrexed diso tumors confined to the pancreas, locally advanced pancreatic dium (Alimta R, MTA, multitargeted antifolate, LY231514), cancer and metastatic pancreatic cancer. Perillyl alcohol (perilla alcohol, perillic alcohol, perillol, In preferred embodiments, agonists and/or antagonists of NSC-641066), RFS-2000 (9-nitrocamptothecan, 9-NC, the invention are used to treat locally advanced pancreatic 50 Rubitecan R), and Rituximab R (Rituxan R, anti-CD20 MAb). cancer. In other preferred embodiments, agonists and/or In preferred embodiments, agonists and/or antagonists of antagonists of the invention are used to treat metastatic pan the invention are administered in combination with one or creatic cancer and premalignant conditions. more of the above-described therapeutic agents in the treat Polynucleotides and/or polypeptides of the invention and/ ment, amelioration and/or prevention of pancreatic cancers or agonists and/or antagonists thereof may be administered: 55 and premalignant conditions. in combination with one or more Surgical and/or radiological In further particular embodiments, polynucleotides and/or procedures useful in the treatment of pancreatic cancer and polypeptides of the invention and/or agonists and/or antago premalignant conditions including, but not limited to, pan nists thereof are used to treat, ameliorate and/or prevent creaticoduodenumectomy (Whipple resection). hepatic cancer and premalignant conditions. Polynucleotides In preferred embodiments, agonists and/or antagonists of 60 and/or polypeptides of the invention and/or agonists and/or the present invention may be administered in combination antagonists thereof may be used in combination with one or with one or more Surgical and/or radiological procedures more Surgical and/or radiological procedures and/or thera useful in the treatment of pancreatic cancer and premalignant peutic agents to treat, ameliorate and/or prevent hepatic can conditions including, but not limited to, pancreaticoduodenu cer and premalignant conditions. Hepatic cancers which may mectomy (Whipple resection). 65 be treated using polynucleotides and/or polypeptides of the Polynucleotides and/or polypeptides of the invention and/ invention and/or agonists and/or antagonists thereof include, or agonists and/orantagonists thereofmay be administered in but are not limited to, hepatocellular carcinoma, malignant US 8,329,179 B2 147 148 hepatoma, cholangiocarcinoma, mixed hepatocellular cho In further particular embodiments, polynucleotides and/or langiocarcinoma or hepatoblastoma. polypeptides of the invention and/or agonists and/or antago In preferred embodiments, agonists and/or antagonists of nists thereof are used to treat, ameliorate and/or prevent ova the present invention are used to treat, ameliorate and/or rian cancer and premalignant conditions. Polynucleotides prevent hepatic cancer and premalignant conditions. Agonists 5 and/or polypeptides of the invention and/or agonists and/or and/or antagonists of the present invention may be used in antagonists thereof may be used in combination with one or combination with one or more Surgical and/or radiological more Surgical and/or radiological procedures and/or thera procedures and/or therapeutic agents to treat, ameliorate and/ peutic agents to treat, ameliorate and/or prevent ovarian can or prevent hepatic cancer and premalignant conditions. cer and premalignant conditions. Ovarian cancers which may Hepatic cancers which may be treated using agonists and/or 10 be treated using polynucleotides and/or polypeptides of the antagonists of the present invention include, but are not lim invention and/or agonists and/or antagonists thereof include, ited to, hepatocellular carcinoma, malignant hepatoma, cho but are not limited to, epithelial carcinoma, germ cell tumors langiocarcinoma, mixed hepatocellular cholangiocarcinoma and stromal tumors. or hepatoblastoma. In preferred embodiments, agonists and/or antagonists of 15 the present invention are used to treat, ameliorate and/or In preferred embodiments, agonists and/or antagonists of prevent ovarian cancer and premalignant conditions. Ago the invention are used to treat hepatoblastoma. In other pre nists and/or antagonists of the present invention may be used ferred embodiments, agonists and/orantagonists of the inven in combination with one or more Surgical and/or radiological tion are used to treat hepatocellular carcinoma. procedures and/or therapeutic agents to treat, ameliorate and/ Polynucleotides and/or polypeptides of the invention and/ or prevent ovarian cancer and premalignant conditions. Ova or agonists and/orantagonists thereofmay be administered in rian cancers which may be treated using agonists and/or combination with one or more Surgical and/or radiological antagonists of the present invention include, but are not lim procedures useful in the treatment of hepatic cancers and ited to, epithelial carcinoma, germ cell tumors and stromal premalignant conditions including, but not limited to, partial tumors. hepatectomy, liver transplant, radiofrequency ablation, laser 25 In preferred embodiments, agonists and/or antagonists of therapy, microwave therapy, cryoSurgery, percutaneous etha the invention are used to treat germ cell tumors and prema nolinjection, hepatic arterial infusion, hepatic artery ligation, lignant conditions. In other preferred embodiments, agonists chemoembolization and external beam radiation therapy. and/or antagonists of the invention are used to treat epithelial In preferred embodiments, agonists and/or antagonists of carcinoma and premalignant conditions. the present invention may be administered in combination 30 Polynucleotides and/or polypeptides of the invention and/ with one or more Surgical and/or radiological procedures or agonists and/orantagonists thereofmay be administered in useful in the treatment of hepatic cancers and premalignant combination with one or more surgical and/or radiological conditions including, but not limited to, partial hepatectomy, procedures useful in the treatment of ovarian cancer and liver transplant, radiofrequency ablation, laser therapy, premalignant conditions including, but not limited to, hyster microwave therapy, cryoSurgery, percutaneous ethanol injec 35 ectomy, oophorectomy, hysterectomy with bilateral salpingo tion, hepatic arterial infusion, hepatic artery ligation, oophorectomy, omentectomy, tumor debulking, external chemoembolization and external beam radiation therapy. beam radiation therapy and intraperitoneal radiation therapy. Polynucleotides and/or polypeptides of the invention and/ In preferred embodiments, agonists and/or antagonists of or agonists and/orantagonists thereofmay be administered in the invention are administered in combination with one or combination with one or more therapeutic agents useful in the 40 more of the above-described Surgical and/or radiological pro treatment of hepatic cancer and premalignant conditions cedures in the treatment, amelioration and/or prevention of including, but not limited to, Aldesleukin (IL-2, Proleukin R), ovarian cancers and premalignant conditions. Cisplatin (Platinol R, CDDP), Doxorubicin (Adriamycin R, Polynucleotides and/or polypeptides of the invention and/ Doxil R. Rubex.R.), Etoposide phosphate (Etopophos(R), Eto or agonists and/orantagonists thereofmay be administered in poside (VP-16, VepesidR), Fluorouracil (5-FU, Adrucil(R), 45 combination with one or more therapeutic agents useful in the Fluoroplex(R), Efudex(R), I-131 Lipidiol R, Ifosfamide treatment of ovarian cancer and premalignant conditions (IFEXR), Megestrol acetate (Megace(R), Pallace(R), Pravasta including, but not limited to. Altretamine (Hexylen R, hexam tin sodium (PravacholR), and Vincristine (OncovinR), Onco ethylmelamine, Hexastat(R), Bleomycin (Blenoxane(R). Car TCS(R), VCR, LeurocristineR). boplatin (Paraplatin R, CBDCA), Cisplatin (Platinol R, In preferred embodiments, agonists and/or antagonists of 50 CDDP), Cyclophosphamide (Cytoxan R, Neosar.R, CTX), the invention are administered in combination with one or Dactinomycin (CosmegenR), Doxorubicin (Adriamycin R, more of the above-described therapeutic agents in the treat Doxil R. Rubex.R.), Etoposide phosphate (Etopophos(R), Eto ment, amelioration and/or prevention of hepatic cancers and poside (VP-16, VepesidR), Fluorouracil (5-FU, Adrucil(R), premalignant conditions. Fluoroplex(R), Efudex(R), Gemcitabine (Gemto(R), Gemzar R), Preferred combinations of therapeutic agents useful in the 55 Ifosfamide (IFEXR), Irinotecan (Camptosar.R, CPT-11, treatment of hepatic cancer and premalignant conditions Topotecin R., CaptoCPT-1), Leucovorin (LeucovorinR), Well which may be administered in combination with polynucle covorinR), Melphalan (L-PAM, Alkeran R, Phenylalanine otides and/or polypeptides of the invention and/or agonists mustard), Paclitaxel (Paxene.R., Taxol.R.), Tamoxifen (Nolva and/or antagonists thereof include, but are not limited to, dex R, Vinblastine (Velban R, VLB) and Vincristine (On Cisplatin--Doxorubicin, Cisplatin-Etoposide, Cisplatin-- 60 covinR, Onco TCS(R), VCR, LeurocristineR). Vincristine--Fluorouracil, and Ifosfamide--Cisplatin--Doxo In preferred embodiments, agonists and/or antagonists of rubicin. the invention are administered in combination with one or In preferred embodiments, agonists and/or antagonists of more of the above-described therapeutic agents in the treat the invention are administered in combination with one or ment, amelioration and/or prevention of ovarian cancers and more of the above-described therapeutic agent combinations 65 premalignant conditions. in the treatment, amelioration and/or prevention of hepatic Preferred combinations of therapeutic agents useful in the cancers and premalignant conditions. treatment of ovarian cancer and premalignant conditions US 8,329,179 B2 149 150 which may be administered in combination with polynucle more of the above-described therapeutic agents in the treat otides and/or polypeptides of the invention and/or agonists ment, amelioration and/or prevention of Ewings sarcoma and/or antagonists thereof include, but are not limited to, family tumors. Bleomycin--Etoposide--Platinol R (Cisplatin) (BEP), Carbo Preferred combinations of therapeutic agents useful in the platin-i-Cyclophosphamide, Carboplatin--Paclitaxel, Carbo 5 treatment of Ewing's sarcoma family tumors which may be platin--Etoposide--Bleomycin (CEB), Cisplatin-i-Cyclophos administered in combination with polynucleotides and/or phamide, Cisplatin-Etoposide, Cisplatin--Paclitaxel, polypeptides of the invention and/or agonists and/or antago Cisplatin-i-Ifosfamide--Vinblastine, Fluorouracil-Leucov nists thereof include, but are not limited to, Cyclophospha orin, Platinol R (Cisplatin)+Vinblastine--Bleomycin (PVB), mide--Topotecan, Cyclophosphamide+Doxorubicin--Vinc and Vincristine--Dactinomycin-i-Cyclophosphamide. 10 In preferred embodiments, agonists and/or antagonists of ristine, Cyclophosphamide+Doxorubicin--Vincristine, the invention are administered in combination with one or alternating with Ifosfamide--Etoposide andcyclophospha more of the above-described therapeutic agent combinations mide+Doxorubicin--Vincristine, alternating with Filgrastim-- in the treatment, amelioration and/or prevention of ovarian Ifosfamide--Etoposide. cancers and premalignant conditions. 15 In preferred embodiments, agonists and/or antagonists of In further particular embodiments, polynucleotides and/or the invention are administered in combination with one or polypeptides of the invention and/or agonists and/or antago more of the above-described therapeutic agent combinations nists thereof are used to treat, ameliorate and/or prevent in the treatment, amelioration and/or prevention of Ewings Ewing's sarcoma. Polynucleotides and/or polypeptides of the sarcoma family tumors. invention and/or agonists and/or antagonists thereof may be In further specific embodiments, polynucleotides and/or used in combination with one or more Surgical and/or radio polypeptides of the invention and/or agonists and/or antago logical procedures and/or therapeutic agents to treat, amelio nists thereof are used to treat, ameliorate and/or prevent rate and/or prevent Ewing's sarcoma. Ewing's sarcoma fam hematological cancers and premalignant conditions. Poly ily tumors which may be treated using polynucleotides and/or nucleotides and/or polypeptides of the invention and/or ago polypeptides of the invention and/or agonists and/or antago 25 nists and/or antagonists thereof may be used in combination nists thereof include, but are not limited to, Ewing's tumor of with one or more Surgical and/or radiological procedures bone (ETB), extraosseus Ewing's (EOE), primitive neuroec and/or therapeutic agents to treat, ameliorate and/or prevent todermal tumors (PNET or peripheral neuroepithelioma) and hematological cancers and premalignant conditions. Hema Askin's tumor. tological cancers which may be treated using polynucleotides In preferred embodiments, agonists and/or antagonists of 30 and/or polypeptides of the invention and/or agonists and/or the present invention are used to treat, ameliorate and/or antagonists thereof include, but are not limited to, non prevent Ewing's sarcoma. Agonists and/or antagonists of the Hodgkin’s lymphoma (e.g., small lymphocytic lymphoma, present invention may be used in combination with one or follicular center cell lymphoma, lymphoplasmacytoid lym more Surgical and/or radiological procedures and/or thera phoma, marginal Zone lymphoma, mantle cell lymphoma, peutic agents to treat, ameliorate and/or prevent Ewings 35 immunoblastic lymphoma, burkitt's lymphoma, lymphoblas sarcoma. Ewings sarcoma family tumors which may be tic lymphoma, peripheral T-cell lymphoma, anaplastic large treated using agonists and/orantagonists of the present inven cell lymphoma and intestinal T-cell lymphoma), leukemia, tion include, but are not limited to, Ewing's tumor of bone acute lymphocytic leukemia, chronic lymphocytic leukemia (ETB), extraosseus Ewings (EOE), primitive neuroectoder and plasma cell neoplasms including multiple myeloma. mal tumors (PNET or peripheral neuroepithelioma) and 40 In preferred embodiments, agonists and/or antagonists of Askin's tumor. the present invention are used to treat, ameliorate and/or In preferred embodiments, agonists and/or antagonists of prevent hematological cancers and premalignant conditions. the invention are used to treat Ewing's tumor of bone. In other Agonists and/or antagonists of the present invention may be preferred embodiments, agonists and/or antagonists of the used in combination with one or more Surgical and/or radio invention are used to treat peripheral neuroepithelioma. 45 logical procedures and/or therapeutic agents to treat, amelio Polynucleotides and/or polypeptides of the invention and/ rate and/or preventhematological cancers and premalignant or agonists and/orantagonists thereofmay be administered in conditions. Hematological cancers which may be treated combination with one or more Surgical and/or radiological using agonists and/or antagonists of the present invention procedures useful in the treatment of Ewings sarcoma family include, but are not limited to, non-Hodgkin’s lymphoma tumors. 50 (e.g., Small lymphocytic lymphoma, follicular center cell In preferred embodiments, agonists and/or antagonists of lymphoma, lymphoplasmacytoid lymphoma, marginal Zone the invention are administered in combination with one or lymphoma, mantle cell lymphoma, immunoblastic lym more Surgical and/or radiological procedures useful in the phoma, burkitt's lymphoma, lymphoblastic lymphoma, treatment of Ewing's sarcoma family tumors. peripheral T-cell lymphoma, anaplastic large cell lymphoma Polynucleotides and/or polypeptides of the invention and/ 55 and intestinal T-cell lymphoma), leukemia, acute lympho or agonists and/orantagonists thereofmay be administered in cytic leukemia, chronic lymphocytic leukemia and plasma combination with one or more therapeutic agents useful in the cell neoplasms including multiple myeloma. treatment of Ewing's sarcoma family tumors including, but In preferred embodiments, agonists and/or antagonists of not limited to, Cyclophosphamide (Cytoxan R, Neosar R, the invention are used to treat plasma cell neoplasms. In CTX), Doxorubicin (Adriamycin R, Doxil R, Rubex.R.), Eto 60 certain preferred embodiments, that plasma cell neoplasm is poside phosphate (Etopophos(R), Etoposide (VP-16, multiple myeloma. Vepesider), Filgrastim (Neupogen R, G-CSF), Ifosfamide In other preferred embodiment, agonists and/or antago (IFEX(R), Topotecan (Hycamtin R, SK&F-104864, NSC nists of the invention are used to treat non-Hodgkin’s lym 609699, Evotopin(R), and Vincristine (OncovinR, Onco phoma. TCS(R), VCR, LeurocristineR). 65 In other preferred embodiments, agonists and/or antago In preferred embodiments, agonists and/or antagonists of nists of the invention are used to treat leukemia. In certain the invention are administered in combination with one or preferred embodiments, that leukemia is acute lymphocytic US 8,329,179 B2 151 152 leukemia. In certain preferred embodiments, that leukemia is more of the above-described therapeutic agent combinations chronic lymphocytic leukemia. in the treatment, amelioration and/or prevention of multiple Polynucleotides and/or polypeptides of the invention and/ myeloma. or agonists and/orantagonists thereofmay be administered in Polynucleotides and/or polypeptides of the invention and/ combination with one or more Surgical and/or radiological 5 or agonists and/orantagonists thereofmay be administered in procedures useful in the treatment of hematological cancer combination with one or more therapeutic agents useful in the and premalignant conditions including, but not limited to, treatment of non-Hodgkin’s lymphoma including, but not bone marrow transplantation, external beam radiation and limited to, 2-chlorodeoxyadenosine, Amifostine (Ethyol(R), total body irradiation. Ethiofos(R), WR-272), Bexarotene (Targretin R, Targretin In specific embodiments, agonists and/orantagonists of the 10 Gel R., Targretin Oral R, LGD1069), Bleomycin (Blenox invention are administered in combination with one or more ane(R), Busulfan (BusulfeXR), Myleran R), Carboplatin (Para Surgical and/or radiological procedures useful in the treat platin R, CBDCA), Carmustine (DTI-015, BCNU, BiCNU, ment of hematological cancer and premalignant conditions Gliadel WaferR), Chlorambucil (Leukeran R), Cisplatin including, but not limited to, bone marrow transplantation, (Platinol R, CDDP), Cladribine (2-CdA, Leustatin(R), Cyclo external beam radiation and total body irradiation. 15 phosphamide (Cytoxan R. Neosar(R, CTX), Cytarabine (Cy In preferred embodiments, agonists and/or antagonists of tosar-U(R), ara-C, cytosine arabinoside, DepoCytR), Dacar the present invention may be administered in combination bazine (DTIC), Daunorubicin (Daunomycin, DaunoXomeR), with one or more Surgical and/or radiological procedures Daunorubicinr), Cerubidine(R), Denileukin diftitox (On useful in the treatment of multiple myeloma including, but takR), Dexamethasone (Decadron(R), Dolasetron mesylate not limited to, allogeneic bone marrow transplantation and (Anzemet(R), Doxorubicin (Adriamycin R, Doxil R. peripheral stem cell Support. Rubex(R), Erythropoietin (EPOR, Epogen R, ProcritR), Eto In other preferred embodiments, agonists and/or antago poside phosphate (Etopophos(R), Etoposide (VP-16, nists of the present invention may be administered in combi VepesidR), Fludarabine (Fludara R, FAMP), Granisetron nation with one or more Surgical and/or radiological proce (Kytril.R.), Hydrocortisone, Idarubicin (Idamycin R, DMDR, dures useful in the treatment of non-Hodgkin’s lymphoma 25 IDA), Ifosfamide (IFEX(R), Interferon alpha (Alfaferone.R., including, but not limited to, allogeneic bone marrow trans Alpha-IFR), Interferon alpha 2a (Intron A(R), Mechlore plantation and peripheral stem cell Support. thamine (Nitrogen Mustard, HN MustargenR), Melphalan In other preferred embodiments, agonists and/or antago (L-PAM, Alkeran R, Phenylalanine mustard), Methotrexate R nists of the present invention may be administered in combi (MTX, Mexate R, Folex(R), Methylprednisolone (Sol nation with one or more Surgical and/or radiological proce 30 umedrolR), Mitoxantrone (Novantrone(R), DHAD), dures useful in the treatment of leukemia including, but not Ondansetron (ZofranR), Pentostatin (Nipent(R), 2-deoxyco limited to, allogeneic bone marrow transplantation and formycin), Perfosfamide (4-hydroperoxycyclophosphamide, peripheral stem cell Support. In specific embodiments, ago 4-HC), Prednisone, Procarbazine (Matulane(R), Rituximab(R) nists and/orantagonists of the invention are used to treat acute (Rituxan R, anti-CD20 MAb). Thiotepa (triethylenethiophos lymphocytic leukemia (ALL). In other specific embodiments, 35 phaoramide. Thioplex(R), Topotecan (Hycamtin R, SK&F- agonists and/or antagonists of the invention are used to treat 104864, NSC-609699, Evotopin(R), Vinblastine (Velban(R), chronic lymphocytic leukemia (CLL). VLB), Vincristine (Oncovin(R), Onco TCS(R), VCR, Leuroc Polynucleotides and/or polypeptides of the invention and/ ristine(R) and Vindesine (Eldisine(R), Fildesin(R). or agonists and/orantagonists thereofmay be administered in In preferred embodiments, agonists and/or antagonists of combination with one or more therapeutic agents useful in the 40 the invention are administered in combination with one or treatment of multiple myeloma including, but not limited to, more of the above-described therapeutic agents in the treat Alkylating agents, Anthracyclines, Carmustine (DTI-015. ment, amelioration and/or prevention of non-Hodgkin’s lym BCNU, BiCNU, Gliadel WaferR), Cyclophosphamide (Cy phoma. toxan R, Neosar.R, CTX), Dexamethasone (Decadron(R), Preferred combinations of therapeutic agents useful in the Doxorubicin (Adriamycin R, Doxil R. Rubex.R.), Melphalan 45 treatment of non-Hodgkin’s lymphoma which may be admin (L-PAM, Alkeran R, Phenylalanine mustard), Prednisone, istered in combination with polynucleotides and/or polypep Thalidomide and thalidomide analogs, including but not lim tides of the invention and/or agonists and/or antagonists ited to, lenalidomide (CC-5013, REVLIMIDR) and CC-4047 thereof include, but are not limited to, Adriamycin R+Blenox (ACTIMIDTM), and Vincristine (Oncovorin R, Onco TCS(R), ane+Vinblastine--Dacarbazine (ABVD), Anti-idiotype VCR, LeurocristineR). 50 therapy (BSAb)+Interferon alpha, Anti-idiotype therapy In preferred embodiments, agonists and/or antagonists of (BSAb)+Chlorambucil, Anti-idiotype therapy (BSAb)+Inter the invention are administered in combination with one or leukin-2, BCNU (Carmustine)+Etoposide--Ara-C (Cytara more of the above-described therapeutic agents in the treat bine)+Melphalen (BEAM), Bleomycin--Etoposide-Adria ment, amelioration and/or prevention of multiple myeloma. mycin-i-Cyclophosphamide--Vincristine--Procarbazine-- Preferred combinations of therapeutic agents useful in the 55 Prednisone (BEACOPP), Bryostatin--Vincristine, treatment of multiple myeloma which may be administered in Cyclophosphamide+BCNU (Carmustine)+VP-16 (Etopo combination with polynucleotides and/or polypeptides of the side) (CBV), Cyclophosphamide--Vincristine--Prednisone invention and/or agonists and/or antagonists thereof include, (CVP), Cyclophosphamide+Adriamycin R. (Hydroxyldauno but are not limited to, Cyclophosphamide--Prednisone, Mel mycin)+Vincristine (Oncovorin)+Prednisone (CHOP), phalan+Prednisone (MP), Vincristine-Adriamycin R+Dex 60 Cyclophosphamide+Novantrone(R) (Mitoxantrone)+Vincris amethasone (VAD), Vincristine--Carmustine--Melphalan+ tine (Oncovorin)+Prednisone (CNOP), Cyclophosphamide-- Cyclophosphamide+Prednisone (VBMCP; the M2 protocol), Doxorubicin--Teniposide+Prednisone, Cyclophosphamide-- and Vincristine--Melphalan+Cyclophosphamide+Pred Adriamycin R (Hydroxyldaunomycin)+Vincristine nisone alternating with Vincristine--Carmustine--Doxorubi (Oncovorin)+Prednisone+Rituximab (CHOP+Rituximab), cin--Prednisone (VMCP/VBAP). 65 Cyclophosphamide+Doxorubicin--Teniposide--Prednisone-- In preferred embodiments, agonists and/or antagonists of Interferon alpha, Cytarabine--Bleomycin--Vincristine--Meth the invention are administered in combination with one or otrexate (CytaBOM), Dexamethasone+Cytarabine--Cispl US 8,329,179 B2 153 154 atin (DHAP), Dexamethasone+Ifosfamide--Cisplatin-- momab (Bexxar R), Valspodar (PSC833), Vaxid (B-cell lym Etoposide (DICE), Doxorubicin--Vinblastine-- phoma DNA vaccine), Vinorelbine (Navelbine(R), WF10 Mechlorethamine--Vincristine--Bleomycin--Etoposide-- (macrophage regulator) and XR-9576 (XR-9351, P-glyco Prednisone (Stanford V), Etoposide+Vinblastine-- protein/MDR inhibitor). Adriamycin (EVA), Etoposide+Methylprednisone+ In preferred embodiments, agonists and/or antagonists of Cytarabine--Cisplatin (ESHAP), Etoposide--Prednisone-- the invention are administered in combination with one or Ifosfamide--Cisplatin (EPIC), Fludarabine, Mitoxantrone-- more of the above-described therapeutic agents in the treat Dexamethasone (FMD). Fludarabine, Dexamethasone, ment, amelioration and/or prevention of non-Hodgkin’s lym Cytarabine (ara-C), +Cisplatin (Platinol R) (FluDAP), Ifosfa phoma. mide+Cisplatin--Etoposide (ICE), Mechlorethamine--On 10 Polynucleotides and/or polypeptides of the invention and/ covinR (Vincristine)+Procarbazine--Prednisone (MOPP), or agonists and/orantagonists thereofmay be administered in Mesna--Ifosfamide+Idarubicin--Etoposide (MIZE), Methotr combination with one or more therapeutic agents useful in the exate with leucovorin rescue+Bleomycin-i-Adriamycin-i-Cy treatment of acute lymphocytic leukemia including, but not clophosphamide--Oncovorin-i-Dexamethasone (m-BACOD), limited to, Amsacrine, Carboplatin (Paraplatin R, CBDCA), Prednisone+Methotrexate-Adriamycin-i-Cyclophospha 15 Carmustine (DTI-015, BCNU, BiCNU, Gliadel WaferR), mide+Etoposide (ProMACE). Thiotepa+Busulfan-i-Cyclo Cholecaliferol, Cyclophosphamide (Cytoxan R, Neosar R, phosphamide. Thiotepa+BuSulfan-i-Melphalan, Topotecan CTX), Cytarabine (Cytosar-U(R), ara-C, cytosine arabinoside, Paclitaxel, and Vincristine (OncovinR)+Adriamycin R+ DepoCytR), Daunorubicin (Daunomycin, DaunoXomeR, Dexamethasone (VAD). Daunorubicinr), Cerubidine(R). Dexamethasone (Decad In preferred embodiments, agonists and/or antagonists of ronR), Doxorubicin (Adriamycin R, Doxil(R), Rubex(R), Eto the invention are administered in combination with one or poside (VP-16, Vepesider), Filgrastam(R) (NeupogenR), more of the above-described therapeutic agent combinations G-CSF, LeukineR), Fludarabine (Fludara R, FAMP), Idaru in the treatment, amelioration and/or prevention of non bicin (Idamycin R, DMDR, IDA), Ifosfamide (IFEX(R), Ima Hodgkin’s lymphoma. tinib mesylate (STI-571, Imatinib R), Glivec(R), Gleevec(R), Further examples of therapeutic agents useful in the treat 25 Ab1 tyrosine kinase inhibitor), Interferon gamma (Gamma ment of non-Hodgkin’s lymphoma which may be adminis interferon, Gamma 100R, Gamma-IF), L-asparaginase (El tered in combination with polynucleotides and/or polypep spar R. Crastinin R, Asparaginase Medac(R), Kidrolase(R). tides of the invention and/or agonists and/or antagonists Mercaptopurine (6-mercaptopurine, 6-MP), MethotrexateR) thereof include, but are not limited to, A007 (4-4'-dihydroxy (MTX, Mexate R, Folex(R), Mitoxantrone (NovantroneR), benzophenone-2,4-dinitrophenylhydrazone), AG-2034 (AG 30 DHAD), Pegaspargase? R. (Oncospar(R), Prednisone, Retinoic 2024, AG-2032, GARFT glycinamide ribonucleoside trans acid, Teniposide (VM-26, VumonR). Thioguanine formylase inhibitor), Aldesleukin (IL-2, Proleukin R), (6-thioguanine, 6-TG), Topotecan (Hycamtin R, SK&F- Alemtuzumab (Campath(R), Alitretinoin (Panretin R, LGN 104864, NSC-609699, Evotopin(R), Tretinoin (Retin-AR), 1057), Altretamine (Hexylen R, hexamethylmelamine, Hex AtragenR), ATRA, VesanoidR) and Vincristine (Oncov astat(R), Aminocamptothecin (9-AC, 9-Aminocamptothecin, 35 orin(R), Onco TCS(R), VCR, LeurocristineR). NSC 603071), Anti-CD19/CD3 MAb (anti-CD19/CD3 scFv, In preferred embodiments, agonists and/or antagonists of anti-NHL MAb), Anti-idiotype therapy (BSAb), Arabino the invention are administered in combination with one or sylguanine (Ara-G, GW506U78), Arsenic trioxide (Trise more of the above-described therapeutic agents in the treat noXR), ATO), B43-Genistein (anti-CD19 Ab/genistein conju ment, amelioration and/or prevention of acute lymphocytic gate), B7 antibody conjugates, Betathine (Beta-LT). BLyS 40 leukemia. antagonists, Bryostatin-1 (BryostatinR), BMY-45618, NSC Further examples of therapeutic agents useful in the treat 339555), CHML (Cytotropic Heterogeneous Molecular Lip ment of acute lymphocytic leukemia which may be adminis ids), Clofarabine (chloro-fluoro-araA), Daclizumab (Zena tered in combination with polynucleotides and/or polypep pax(R), Depsipeptide (FR901228, FK228), Dolastatin-10 tides of the invention and/or agonists and/or antagonists (DOLA-10, NSC-376128), Epirubicin (Ellence(R), EPI, 4 epi 45 thereof include, but are not limited to, Aminocamptothecin doxorubicin), EpratuZumab (Lymphocide(R), humanized anti (9-AC, 9-Aminocamptothecin, NSC 603071), Aminopterin, CD22, HAT), Fly3/flk2 ligand (MobistaR), G3139 (Gena Annamycin (AR-522, annamycin LF, AroneXOR), Arabino sense(R), Genta Anticode(R), Bcl-2 antisense), HullD10 (anti sylguanine (Ara-G, GW506U78, Nelzarabine(R), Arsenic tri HLA-DR MAb, SMART ID 10), HumaLYM (anti-CD20 oxide (Trisenox R, ATO, AtriveX(R), B43-Genistein (anti MAb), Ibritumomab tiuxetan (Zevalin R), Interferon gamma 50 CD19 Ab/genistein conjugate), B43-PAP (anti-CD19 (Gamma-interferon, Gamma 100R, Gamma-IF), Irinotecan Ab/pokeweed antiviral protein conjugate), Cordycepin, (Camptosar R, CPT-11, Topotecin(R), CaptoCPT-1), ISIS CS-682, Decitabine (5-aza-2'-deoxyytidine), Dolastatin-10 2053, ISIS-3521 (PKC-alpha antisense), Limb-2 immuno (DOLA-10, NSC-376128), G3139 (Genasense(R), GentaAn toxin (anti-CD25 recombinant immuno toxin, anti-TacCFV)- ticode(R), Bcl-2 antisense), Irofulven (MGI-114, Ivofulvan, PE38), LeuvectinR(cytofectin-i-IL-2 gene, IL-2 gene 55 Acylfulvene analogue), MS-209, Phenylbutyrate, Quinine, therapy), Lym-1 (131-I LYM-1), Lymphoma vaccine (Geni TNP-470 (AGM-1470, Fumagillin), Trimetrexate (Neutr tope), Nelarabine (Compound 506, U78), Neugene com exin(R), Troxacitabine (BCH-204, BCH-4556, Troxaty1R), pounds (Oncomyc-NG(R), Resten-NG(R), myc antisense), UCN-01 (7-hydroxystaurosporine), WHI-P131 and WT1 NovoMAb-G2 schv (NovoMAb-G2 IgM),06-benzylguanine Vaccine. (BG, Procept(R), Oxaliplatin (Eloxatine(R), EloxatinR), Pacli 60 In preferred embodiments, agonists and/or antagonists of taxel (Paxene R, TaxolR), Paclitaxel-DHA (Taxoprexin R), the invention are administered in combination with one or Peldesine (BCX-34, PNP inhibitor), Rebeccamycin and more of the above-described therapeutic agents in the treat Rebeccamycin analogues, SCH-66336, Sobuzoxane (MST ment, amelioration and/or prevention of acute lymphocytic 16, Perazolin R), SU5416 (Semaxanib R, VEGF inhibitor), leukemia. TER-286, Thalidomide and thalidomide analogs, including 65 Preferred combinations of therapeutic agents useful in the but not limited to, lenalidomide (CC-5013, REVLIMIDR) treatment of acute lymphocytic leukemia which may be and CC4047 (ACTIMIDTM), TNP-470 (AGM-1470), Tositu administered in combination with polynucleotides and/or US 8,329,179 B2 155 156 polypeptides of the invention and/or agonists and/or antago In preferred embodiments, agonists and/or antagonists of nists thereof include, but are not limited to, Carboplatin-- the invention are administered in combination with one or Mitoxantrone, Carmustine--Cyclophosphamide--Etoposide, more of the above-described therapeutic agents in the treat Cytarabine--Daunorubicin, Cytarabine--Doxorubicin, Cyt ment, amelioration and/or prevention of chronic lymphocytic arabine--Idarubicin, Cytarabine--Interferon gamma, Cytara leukemia. bine--L-asparaginase, Cytarabine+Mitoxantrone, Cytara Preferred combinations of therapeutic agents useful in the bine--Fludarabine and Mitoxantrone, Etoposide+Cytarabine, treatment of chronic lymphocytic leukemia which may be Etoposide+Ifosfamide, Etoposide--Mitoxantrone, Ifosfa administered in combination with polynucleotides and/or mide+Etoposide--Mitoxantrone, Ifosfamide--Teniposide, polypeptides of the invention and/or agonists and/or antago Methotrexate--Mercaptopurine, Methotrexate--Mercaptopu 10 nists thereof include, but are not limited to, Fludarabine-- rine--Vincristine--Prednisone, Phenylbutyrate+Cytarabine, Prednisone, and Cyclophosphamide--Doxorubicin--Vincris Phenylbutyrate+Etoposide, Phenylbutyrate+Topotecan, Phe tine--Prednisone (CHOP). nylbutyrate+Tretinoin, Quinine--Doxorubicin, Quinine--Mi In preferred embodiments, agonists and/or antagonists of toxantrone--Cytarabine. Thioguanine--Cytarabine-Amsa the invention are administered in combination with one or crine. Thioguanine--Etoposide+Idarubicin, Thioguanine-- 15 more of the above-described therapeutic agent combinations Retinoic acid-i-Cholecaliferol, Vincristine--Prednisone, in the treatment, amelioration and/or prevention of chronic Vincristine--Prednisone and L-asparaginase, Vincristine-- lymphocytic leukemia. Dexamethasone/Prednisone+Asparaginase--Daunorubicin/ Diseases associated with increased apoptosis include Doxorubicin, Vincristine--Dexamethasone/Prednisone-As AIDS; neurodegenerative disorders (such as Alzheimer's dis paraginase--Daunorubicin/Doxorubicin--Filgrastim, ease, Parkinson's disease, Amyotrophic lateral Sclerosis, Vincristine--Dexamethasone/Prednisone+Asparaginase-- Retinitis pigmentosa, Cerebellar degeneration); and brain Daunorubicin/Doxorubicin-i-Cyclophosphamide--Methotr tumor or prior associated disease); autoimmune disorders exate, and Vincristine--Dexamethasone/Prednisone+Aspara (such as, multiple Sclerosis, Sjogren's syndrome, Hashimo ginase--Daunorubicin/Doxorubicin--Cyclophosphamide-- to's thyroiditis, biliary cirrhosis, Behcet’s disease, Crohn's Methotrexate--Filgrastim. 25 disease, polymyositis, Systemic lupus erythematosus and In preferred embodiments, agonists and/or antagonists of immune-related glomerulonephritis and rheumatoid arthritis) the invention are administered in combination with one or myelodysplastic syndromes (such as aplastic anemia), graft V. more of the above-described therapeutic agent combinations host disease, ischemic injury (such as that caused by myocar in the treatment, amelioration and/or prevention of acute lym dial infarction, stroke and reperfusion injury), liver injury phocytic leukemia. 30 (e.g., hepatitis related liver injury, ischemia/reperfusion Polynucleotides and/or polypeptides of the invention and/ injury, cholestosis (bile duct injury) and liver cancer); toxin or agonists and/or antagonists thereof may be administered in induced liver disease (such as that caused by alcohol), septic combination with one or more therapeutic agents useful in the shock, cachexia and anorexia. In preferred embodiments, treatment of chronic lymphocytic leukemia including, but not DR4 polynucleotides, polypeptides and/or agonists are used limited to, Chlorambucil (Leukeran R), Cladribine (2-CdA, 35 to treat the diseases and disorders listed above. LeustatinR), Cyclophosphamide (Cytoxan R, Neosar(R), Many of the pathologies associated with HIV are mediated CTX), Cytarabine (Cytosar-U(R), ara-C, cytosine arabinoside, by apoptosis, including HIV-induced nephropathy and HIV DepoCytR), cytarabine ocfosfate, ara-CMP), Doxorubicin encephalitis. Thus, in additional preferred embodiments, (Adriamycin R, Doxil R, RubeXR), Fludarabine (Fludara R, DR4 polynucleotides, polypeptides, and/or DR4 agonists of FAMP), Pentostatin (Nipent(R), 2-deoxycoformycin), Pred 40 the invention are used to treat and/or prevent AIDS and nisone and Vincristine (OncovorinR), Onco TCSR), VCR, pathologies associated with AIDS. Another embodiment of Leurocristine(R). the present invention is directed to the use of DR4 to reduce In preferred embodiments, agonists and/or antagonists of TRAIL-mediated death of T-cells in HIV-infected patients. the invention are administered in combination with one or The state of immunodeficiency that defines AIDS is sec more of the above-described therapeutic agents in the treat 45 ondary to a decrease in the number and function of CD4" ment, amelioration and/or prevention of chronic lymphocytic T-lymphocytes. Recent reports estimate the daily loss of leukemia. CD4"T-cells to be between 3.5x107 and 2x10 cells (Wei X. Further examples of therapeutic agents useful in the treat et al., Nature 373:117-122 (1995)). One cause of CD4"T-cell ment of chronic lymphocytic leukemia which may be admin depletion in the setting of HIV infection is believed to be istered in combination with polynucleotides and/or polypep 50 HIV-induced apoptosis (see, for example, Meyaard et al., tides of the invention and/or agonists and/or antagonists Science 257:217-219, (1992); Groux et al., J Exp. Med., 175: thereof include, but are not limited to, Alemtuzumab (Cam 331, (1992); and Oyaizu et al., in Cell Activation and Apop path(R), Aminocamptothecin (9-AC, 9-Aminocamptothecin, tosis in HIV Infection, Andrieu and Lu, Eds. Plenum Press, NSC 603071), Aminopterin, Annamycin (AR-522, annamy New York, 1995, pp. 101-114). Indeed, HIV-induced apop cin LF, AroneXR), Arabinosylguanine (Ara-G, GW506U78, 55 totic cell death has been demonstrated not only in vitro but Nelzarabine(R), Compound 506U78), Arsenic trioxide (Trise also, more importantly, in infected individuals (Ameisen, J. nox R, ATO, AtriveXR), Bryostatin-1 (Bryostatin(R), BMY C., AIDS 8:1197-1213 (1994); Finkel, T. H., and Banda, N. 45618, NSC-339555), CS-682, Dolastatin-10 (DOLA-10, K., Curr. Opin. Immunol. 6:605-615 (1995); Muro-Cacho, C. NSC-376128), Filgrastim (Neupogen R, G-CSF, Leukine), A. et al., J. Immunol. 154:5555-5566 (1995)). Furthermore, Flavopiridol (NSC-649890, HMR-1275), G3139 (Gena 60 apoptosis and CD4 T-lymphocyte depletion is tightly corre sense(R), GentaAnticode(R), Bcl-2 antisense), Irofulven (MGI lated in different animal models of AIDS (Brunner, T., et al., 114, Ivofulvan, Acylfulvene analogue), MS-209, Phenylbu Nature 373:441-444 (1995); Gougeon, M. L., et al., AIDS tyrate, Rituximab(R(Rituxan R, anti-CD20 MAb), Res. Hum. Retroviruses 9:553-563 (1993)) and, apoptosis is Thalidomide and thalidomide analogs, including but not lim not observed in those animal models in which viral replica ited to, lenalidomide (CC-5013, REVLIMIDR) and CC-4047 65 tion does not result in AIDS (Gougeon, M. L. et al., AIDS Res. (ACTIMIDTM), Theophylline, TNP-470 (AGM-1470, Fum Hum. Retroviruses 9:553-563 (1993)). Further data indicates agillin), UCN-01 (7-hydroxystaurosporine) and WHI-P131. that uninfected but primed or activated T lymphocytes from US 8,329,179 B2 157 158 HIV-infected individuals undergo apoptosis after encounter blocking Fas-ligand/Fas interactions, including blocking ing the TNF-family ligand FasL. Using monocytic cell lines anti-Fas monoclonal antibodies, are described in Interna that result in death following HIV infection, it has been dem tional application publication number WO95/10540, hereby onstrated that infection of U937 cells with HIV results in the incorporated by reference. de novo expression of FasL and that FasL mediates HIV Suitable agents, which also block binding of TRAIL to a induced apoptosis (Badley, A. D. et al., J. Virol. 70: 199-206 TRAIL receptor that may be administered with the poly (1996)). Further the TNF-family ligand was detectable in nucleotides and/or polypeptides of the present invention uninfected macrophages and its expression was upregulated include, but are not limited to, soluble TRAIL receptor following HIV infection resulting in selective killing of unin polypeptides (e.g., a soluble form of OPG, TR5 (International fected CD4 T-lymphocytes (Badley, A. D et al., J. Virol. 10 application publication number WO 98/30693); DR5 (Inter 70:199-206 (1996)). Further, additional studies have impli national application publication number WO98/41629); and cated Fas-mediated apoptosis in the loss of T-cells in HIV TR10 (International application publication number WO individuals (Katsikis et al., J. Exp. Med. 181:2029-2036 98/54202)); multimeric forms of soluble TRAIL receptor (1995)). It is also possible that T-cell apoptosis occurs polypeptides; and TRAIL receptor antibodies that bind the through multiple mechanisms. Further, at least some of the 15 TRAIL receptor without transducing the biological signal T-cell death seen in HIV patients may be mediated by TRAIL. that results in apoptosis, anti-TRAIL antibodies that block Thus, by the invention, a method for treating and/or pre binding of TRAIL to one or more TRAIL receptors, and venting HIV individuals is provided which involves admin muteins of TRAIL that bind TRAIL receptors but do not istering DR4, DR4 polypeptides, polynucleotides, antago transduce the biological signal that results in apoptosis. Pref nists, and/or agonists of the present invention to reduce erably, the antibodies employed according to this method are selective killing of CD4 T-lymphocytes. While not wanting monoclonal antibodies. to be bound by theory, activated human T-cells are believed to In rejection of an allograft, the immune system of the be induced to undergo programmed cell death (apoptosis) recipient animal has not previously been primed to respond upon triggering through the CD3/T-cell receptor complex, a because the immune system for the most part is only primed process termed activated-induced cell death (AICD). AICD 25 by environmental antigens. Tissues from other members of of CD4 T-cells isolated from HIV-Infected asymptomatic the same species have not been presented in the same way individuals has been reported (Groux et al., Supra). Thus, that, for example, viruses and bacteria have been presented. In AICD may play a role in the depletion of CD4 T-cells and the the case of allograft rejection, immunosuppressive regimens progression to AIDS in HIV-infected individuals. Thus, the are designed to prevent the immune system from reaching the present invention provides a method of inhibiting TRAIL 30 effector stage. However, the immune profile of xenograft mediated T-cell death in HIV patients, comprising adminis rejection may resemble disease recurrence more that allograft tering a DR4 polypeptide of the invention (preferably, a rejection. In the case of disease recurrence, the immune sys soluble DR4 polypeptide) and/or DR4 antagonist of the tem has already been activated, as evidenced by destruction of invention to the patients. Modes of administration and dos the native islet cells. Therefore, in disease recurrence the ages are discussed in detail below. In one embodiment, the 35 immune system is already at the effector stage. DR4 poly patient is asymptomatic when treatment with DR4 com nucleotides, polypeptides and/or agonists of the present mences. If desired, prior to treatment, peripheral blood T-cells invention are able to Suppress the immune response to both may be extracted from an HIV patient, and tested for suscep allografts and Xenografts because lymphocytes activated and tibility to TRAIL-mediated cell death by procedures known differentiated into effector cells will express the DR4 in the art. In one embodiment, a patient’s blood or plasma is 40 polypeptide, and thereby are susceptible to compounds which contacted with DR4 polypeptides of the invention ex vivo. enhance apoptosis. Thus, the present invention further pro The DR4 polypeptides of the invention may be bound to a vides a method for creating immune privileged tissues. Suitable chromatography matrix by procedures known in the Antagonist of the invention can further be used in the treat art. The patient's blood or plasma flows through a chroma ment and/or prevention of Inflammatory Bowel-Disease. tography column containing DR4 bound to the matrix, before 45 DR4 antagonists or agonists of the invention may be useful being returned to the patient. The immobilized DR4 polypep for treating and/or preventing inflammatory diseases, such as tide binds TRAIL, thus removing TRAIL protein from the rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and patient’s blood. inflammatory bowel disease. In additional embodiments a DR4 polypeptide and/or In addition, due to lymphoblast expression of DR4, soluble antagonist of the invention is administered in combination 50 DR4, agonist or antagonist monoclonal antibodies may be with other inhibitors of T-cell apoptosis. For example, as used to treat and/or prevent this form of cancer. Further, discussed above, Fas-mediated apoptosis also has been impli soluble DR4 or neutralizing monoclonal antibodies may be cated in loss of T-cells in HIV individuals (Katsikis et al., J. used to treat and/or prevent various chronic and acute forms Exp. Med. 181:2029-2036, 1995). Thus, a patient susceptible of inflammation Such as rheumatoid arthritis, osteoarthritis, to both Fasligand mediated and TRAIL mediated T-cell death 55 psoriasis, septicemia, and inflammatory bowel disease. may be treated with both an agent that blocks TRAIL/TRAIL In one embodiment, DR4 polypeptides, polynucleotides, receptor interactions and an agent that blocks Fas-ligand/Fas and/orantagonists of the invention may be used to treat and/or interactions. Suitable agents for blocking binding of Fas prevent cardiovascular disorders, including peripheral artery ligand to Fas include, but are not limited to, soluble Fas disease. Such as limb ischemia. polypeptides; multimeric forms of soluble Fas polypeptides 60 Cardiovascular disorders include cardiovascular abnor (e.g., dimers of sRas/Fc); anti-Fas antibodies that bind Fas malities, such as arterio-arterial fistula, arteriovenous fistula, without transducing the biological signal that results in apo cerebral arteriovenous malformations, congenital heart ptosis; anti-Fas-ligand antibodies that block binding of Fas defects, pulmonary atresia, and Scimitar Syndrome. Con ligand to Fas; and muteins of Fas-ligand that bind Fas but do genital heart defects include aortic coarctation, cor triatria not transduce the biological signal that results in apoptosis. 65 tum, coronary vessel anomalies, crisscross heart, dextrocar Preferably, the antibodies employed according to this method dia, patent ductus arteriosus, Ebstein's anomaly, are monoclonal antibodies. Examples of Suitable agents for Eisenmenger complex, hypoplastic left heart syndrome, levo US 8,329,179 B2 159 160 cardia, tetralogy of fallot, transposition of great vessels, Aneurysms include dissecting aneurysms, false aneu double outlet right ventricle, tricuspidatresia, persistent trun rysms, infected aneurysms, ruptured aneurysms, aortic aneu cus arteriosus, and heart septal defects, such as aortopulmo rysms, cerebral aneurysms, coronary aneurysms, heart aneu nary septal defect, endocardial cushion defects, Lutembach rysms, and iliac aneurysms. er's Syndrome, trilogy of Fallot, ventricular heart septal Arterial occlusive diseases include arteriosclerosis, inter defects. mittent claudication, carotid Stenosis, fibromuscular dyspla Cardiovascular disorders also include heart disease. Such sias, mesenteric vascular occlusion, Moyamoya disease, as arrhythmias, carcinoid heart disease, high cardiac output, renal artery obstruction, retinal artery occlusion, and throm low cardiac output, cardiac tamponade, endocarditis (includ boangiitis obliterans. ing bacterial), heart aneurysm, cardiac arrest, congestive 10 Cerebrovascular disorders include carotid artery diseases, heart failure, congestive cardiomyopathy, paroxysmal dysp cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous mal nea, cardiac edema, heart hypertrophy, congestive cardiomy formation, cerebral artery diseases, cerebral embolism and opathy, left ventricular hypertrophy, right ventricular hyper thrombosis, carotid artery thrombosis, sinus thrombosis, trophy, post-infarction heart rupture, Ventricular septal 15 Wallenberg's syndrome, cerebral hemorrhage, epidural rupture, heart valve diseases, myocardial diseases, myocar hematoma, Subdural hematoma, Subaraxhnoid hemorrhage, dial ischemia, pericardial effusion, pericarditis (including cerebral infarction, cerebral ischemia (including transient), constrictive and tuberculous), pneumopericardium, postperi Subclavian steal syndrome, periventricular leukomalacia, cardiotomy syndrome, pulmonary heart disease, rheumatic vascular headache, cluster headache, migraine, and verte heart disease, Ventricular dysfunction, hyperemia, cardiovas brobasilar insufficiency. cular pregnancy complications, Scimitar Syndrome, cardio Embolisms include air embolisms, amniotic fluid embo vascular syphilis, and cardiovascular tuberculosis. lisms, cholesterol embolisms, blue toe syndrome, fat embo Arrhythmias include sinus arrhythmia, atrial fibrillation, lisms, pulmonary embolisms, and thromboembolisms. atrial flutter, bradycardia, extrasystole, Adams-Stokes Syn Thrombosis include coronary thrombosis, hepatic vein drome, bundle-branch block, sinoatrial block, long QT syn 25 thrombosis, retinal vein occlusion, carotidartery thrombosis, drome, parasystole, Lown-Ganong-Levine Syndrome, sinus thrombosis, Wallenberg's syndrome, and thrombophle Mahaim-type pre-excitation syndrome, Wolff-Parkinson bitis. White syndrome, sick sinus syndrome, tachycardias, and ven Ischemia includes cerebral ischemia, ischemic colitis, tricular fibrillation. Tachycardias include paroxysmal tachy compartment syndromes, anterior compartment syndrome, cardia, Supraventricular tachycardia, accelerated 30 myocardial ischemia, reperfusion injuries, and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet’s idioventricular rhythm, atrioventricular nodal reentry tachy Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph cardia, ectopic atrial tachycardia, ectopic junctional tachycar node syndrome, thromboangiitis obliterans, hypersensitivity dia, sinoatrial nodal reentry tachycardia, sinus tachycardia, vasculitis, Schoenlein-Henoch purpura, allergic cutaneous Torsades de Pointes, and ventricular tachycardia. 35 vasculitis, and Wegener's granulomatosis. Heart valve disease include aortic valve insufficiency, aor In one embodiment, DR4 polynucleotides, polypeptides tic valve Stenosis, hear murmurs, aortic valve prolapse, mitral and/or antagonists of the invention is used to treat and/or valve prolapse, tricuspid valve prolapse, mitral valve insuffi prevent thrombotic microangiopathies. One Such disorder is ciency, mitral valve Stenosis, pulmonary atresia, pulmonary thrombotic thrombocytopenic purpura (TTP) (Kwaan, H. C., valve insufficiency, pulmonary valve Stenosis, tricuspidatre 40 Semin. Hematol. 24:71 (1987); Thompson et al., Blood sia, tricuspid valve insufficiency, and tricuspid valve Stenosis. 80: 1890 (1992)). Increasing TTP-associated mortality rates Myocardial diseases include alcoholic cardiomyopathy, have been reported by the U.S. Centers for Disease Control congestive cardiomyopathy, hypertrophic cardiomyopathy, (Torok et al., Am. J. Hematol. 50:84 (1995)). Plasma from aortic Subvalvular Stenosis, pulmonary Subvalvular Stenosis, patients afflicted with TTP (including HIV+ and HIV restrictive cardiomyopathy, Chagas cardiomyopathy, 45 patients) induces apoptosis of human endothelial cells of endocardial fibroelastosis, endomyocardial fibrosis, Kearns dermal microvascular origin, but not large vessel origin (Lau Syndrome, myocardial reperfusion injury, and myocarditis. rence et al., Blood 87:3245 (1996)). Plasma of TTP patients Myocardial ischemias include coronary disease, such as thus is thought to contain one or more factors that directly or angina pectoris, coronary aneurysm, coronary arteriosclero indirectly induce apoptosis. As described in International sis, coronary thrombosis, coronary vasospasm, myocardial 50 patent application number WO 97/01633 (hereby incorpo infarction and myocardial stunning. rated by reference), TRAIL is present in the serum of TTP Cardiovascular diseases also include vascular diseases patients, and is likely to play a role in inducing apoptosis of Such as aneurysms, angiodysplasia, angiomatosis, bacillary microvascular endothelial cells. Another thrombotic angiomatosis, Hippel-Lindau Disease, Klippel-Trenaunay microangiopathy is hemolytic-uremic syndrome (HUS) Weber Syndrome, Sturge-Weber Syndrome, angioneurotic 55 (Moake, J. L., Lancet, 343:393 (1994); Melnyk et al., (Arch. edema, aortic diseases, Takayasu's Arteritis, aortitis, Ler Intern. Med., 155:2077 (1995); Thompson et al., supra). iche's Syndrome, arterial occlusive diseases, arteritis, enar Thus, in one embodiment, the invention is directed to use of teritis, polyarteritis nodosa, cerebrovascular disorders, dia DR4 to treat and/or prevent the condition that is often referred betic angiopathies, diabetic retinopathy, embolisms, to as “adult HUS (even though it can strike children as well). thrombosis, erythromelalgia, hemorrhoids, hepatic veno-Oc 60 A disorder known as childhood/diarrhea-associated HUS dif clusive disease, hypertension, hypotension, ischemia, periph fers in etiology from adult HUS. In another embodiment, eral vascular diseases, phlebitis, pulmonary veno-occlusive conditions characterized by clotting of small blood vessels disease, Raynaud's disease, CREST syndrome, retinal vein may be treated and/or prevented using DR4. Such conditions occlusion, Scimitar syndrome, Superior vena cava syndrome, include, but are not limited to, those described herein. For telangiectasia, atacia telangiectasia, hereditary hemorrhagic 65 example, cardiac problems seen in about 5-10% of pediatric telangiectasia, varicocele, varicose veins, varicose ulcer, Vas AIDS patients are believed to involve clotting of small blood culitis, and venous insufficiency. vessels. Breakdown of the microvasculature in the heart has US 8,329,179 B2 161 162 been reported in multiple sclerosis patients. As a further accumulated which suggest that the growth of Solid tumors is example, treatment and/or prevention of systemic lupus dependent on angiogenesis. Folkman and Klagsbrun, Science erythematosus (SLE) is contemplated. In one embodiment, a 235:442-447 (1987). patient’s blood or plasma is contacted with DR4 polynucle The present invention provides for treatment and/or pre otides and/or polypeptides of the invention ex vivo. The DR4 5 vention of diseases or disorders associated with neovascular polynucleotides and/or polypeptides of the invention may be ization by administration of the DR4 polynucleotides and/or bound to a suitable chromatography matrix by procedures polypeptides of the invention (including DR4 agonists and/or known in the art. According to this embodiment, the patients antagonists). Malignant and metastatic conditions which can blood or plasma flows through a chromatography column be treated and/or prevented with the polynucleotides and containing DR4 polynucleotides and/or polypeptides of the polypeptides of the invention include, but are not limited to those malignancies, Solid tumors, and cancers described invention bound to the matrix, before being returned to the herein and otherwise known in the art (for a review of such patient. The immobilized DR4 binds TRAIL, thus removing disorders, see Fishman et al., Medicine, 2d Ed., J. B. Lippin TRAIL protein from the patient’s blood. Alternatively, DR4 cott Co., Philadelphia (1985)). polynucleotides and/or polypeptides of the invention may be 15 Additionally, ocular disorders associated with neovascu administered in vivo to a patient afflicted with a thrombotic larization which can be treated and/or prevented with the DR4 microangiopathy. In one embodiment, a soluble form of DR4 polynucleotides and polypeptides of the present invention polypeptide of the invention is administered to the patient. (including DR4 agonists and DR4 antagonists) include, but Thus, the present invention provides a method for treating are not limited to: neovascular glaucoma, diabetic retinopa and/or preventing a thrombotic microangiopathy, involving thy, retinoblastoma, retrolental fibroplasia, uveitis, retinopa use of an effective amount of DR4. A DR4 polypeptide may thy of prematurity macular degeneration, corneal graft be employed in in vivo or ex vivo procedures, to inhibit neovascularization, as well as other eye inflammatory dis TRAIL-mediated damage to (e.g., apoptosis of) microvascu eases, ocular tumors and diseases associated with choroidal lar endothelial cells. or iris neovascularization. See, e.g., reviews by Waltman et DR4 polynucleotides and/or polypeptides of the invention 25 al., Am. J. Ophthal. 85:704-710 (1978) and Gartner et al., may be employed in combination with other agents useful in Surv. Ophthal. 22:291-312 (1978). treating and/or preventing a particular disorder. For example, Additionally, disorders which can be treated and/or pre in an invitro study reported by Laurence et al. (Blood 87:3245 vented with the DR4 polynucleotides and polypeptides of the (1996)), some reduction of TTP plasma-mediated apoptosis present invention (including DR4 agonists and DR4 antago of microvascular endothelial cells was achieved by using an 30 nists) include, but are not limited to, hemangioma, arthritis, anti-Fas blocking antibody, aurintricarboxylic acid, or nor psoriasis, angiofibroma, atherosclerotic plaques, delayed mal plasma depleted of cryoprecipitate. Thus, a patient may wound healing, granulations, hemophilic joints, hypertrophic be treated with a polynucleotide and/or polypeptide of the Scars, nonunion fractures, Osler-Weber syndrome, pyogenic invention in combination with an agent that inhibits Fas granuloma, Scleroderma, trachoma, and vascular adhesions. ligand-mediated apoptosis of endothelial cells, such as, for 35 Polynucleotides and/or polypeptides of the invention and/ example, an agent described above. In one embodiment, DR4 or agonists and/or antagonists thereof are useful in the diag polynucleotides and/or polypeptides of the invention and an nosis, prognosis, treatment and/or prevention of a wide range anti-FAS blocking antibody are both administered to a patient of diseases and/or conditions. Such diseases and conditions afflicted with a disorder characterized by thrombotic include, but are not limited to, cancer (e.g., immune cell microangiopathy, such as TTP or HUS. Examples of blocking 40 related cancers, breast cancer, prostate cancer, ovarian cancer, monoclonal antibodies directed against Fas antigen (CD95) follicular lymphoma, cancer associated with mutation or are described in International patent application publication alteration of p53, brain tumor, bladder cancer, uterocervical number WO95/10540, hereby incorporated by reference. cancer, colon cancer, colorectal cancer, non-small cell carci The naturally occurring balance between endogenous noma of the lung, Small cell carcinoma of the lung, stomach stimulators and inhibitors of angiogenesis is one in which 45 cancer, etc.), lymphoproliferative disorders (e.g., lymphad inhibitory influences predominate (Rastinejad et al., Cell enopathy), microbial (e.g., viral, bacterial, etc.) infection 56:345-355 (1989)). In those rare instances in which neovas (e.g., HIV-1 infection, HIV-2 infection, herpesvirus infection cularization occurs under normal physiological conditions, (including, but not limited to, HSV-1, HSV-2, CMV, VZV. Such as wound healing, organ regeneration, embryonic devel HHV-6, HHV-7, EBV), adenovirus infection, poxvirus infec opment, and female reproductive processes, angiogenesis is 50 tion, human papilloma virus infection, hepatitis infection stringently regulated and spatially and temporally delimited. (e.g., HAV, HBV. HCV, etc.), Helicobacter pylori infection, Under conditions of pathological angiogenesis Such as that invasive Staphylococcia, etc.), parasitic infection, nephritis, characterizing Solid tumor growth, these regulatory controls bone disease (e.g., osteoporosis), atherosclerosis, pain, car fail. Unregulated angiogenesis becomes pathologic and Sus diovascular disorders (e.g., neovascularization, hypovascu tains progression of many neoplastic and non-neoplastic dis 55 larization or reduced circulation (e.g., ischemic disease (e.g., eases. A number of serious diseases are dominated by abnor myocardial infarction, stroke, etc.))), AIDS, allergy, inflam mal neovascularization including Solid tumor growth and mation, neurodegenerative disease (e.g., Alzheimer's dis metastases, arthritis, Some types of eye disorders, and psoria ease, Parkinson's disease, amyotrophic lateral Sclerosis, pig sis. See, e.g., reviews by Moses et al., Biotech. 9:630-634 mentary retinitis, cerebellar degeneration, etc.), graft (1991); Folkman et al., N. Engl. J. Med., 333:1757-1763 60 rejection (acute and chronic), graft vs. host disease, diseases (1995); Auerbach et al., J Microvasc. Res. 29:401–411 due to osteomyelodysplasia (e.g., aplastic anemia, etc.), joint (1985); Folkman, Advances in Cancer Research, eds. Klein tissue destruction in rheumatism, liver disease (e.g., acute and and Weinhouse, Academic Press, New York, pp. 175-203 chronic hepatitis, liver injury, and cirrhosis), autoimmune (1985); Patz, Am. J. Opthalmol. 94:715–743 (1982); and disease (e.g., multiple Sclerosis, rheumatoid arthritis, sys Folkman et al., Science 221:719-725 (1983). In a number of 65 temic lupus erythematosus, immune complex glomerulone pathological conditions, the process of angiogenesis contrib phritis, autoimmune diabetes, autoimmune thrombocy utes to the disease state. For example, significant data have topenic purpura, Grave's disease, Hashimoto's thyroiditis, US 8,329,179 B2 163 164 etc.), cardiomyopathy (e.g., dilated cardiomyopathy), diabe Bacteria include, but are not limited to Actinomyces, Bacillus tes, diabetic complications (e.g., diabetic nephropathy, dia (e.g., B. anthracis), Bacteroides, Bordetella, Bartonella, Bor betic neuropathy, diabetic retinopathy), influenza, asthma, relia (e.g., B. burgdorferi), Brucella, Campylobacter, Capno psoriasis, glomerulonephritis, septic shock, and ulcerative cytophaga, Chlamydia, Clostridium, Corynebacterium, Cox colitis. iella, Dermatophilus, Enterococcus, Ehrlichia, Escherichia Polynucleotides and/or polypeptides of the invention and/ (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E. coli), or agonists and/orantagonists thereofare useful in promoting Francisella, Fusobacterium, Haemobartonella, Haemophi angiogenesis, wound healing (e.g., wounds, burns, and bone lus (e.g., H. influenzae type b), Helicobacter; Klebsiella, fractures). L-form bacteria, Legionella, Leptospira, Listeria, Mycobac DR4 polynucleotides or polypeptides, or agonists of DR4, 10 teria (e.g., M. leprae and M. tuberculosis), Mycoplasma, can be used in the treatment and/or prevention of infectious Neisseria (e.g., N. gonorrheae and N. meningitidis), Neorick agents. For example, by increasing the immune response, ettsia, Nocardia, Pasteurella, Peptococcus, Peptostreptococ particularly increasing the proliferation and differentiation of cus, Pneumococcus, Proteus, Pseudomonas, Rickettsia, B-cells in response to an infectious agent, infectious diseases Rochalimaea, Salmonella (e.g., S. typhimurium and S. typhi), may be treated and/or prevented. The immune response may 15 Serratia, Shigella, Staphylococcus (e.g., S. aureus), Strepto be increased by either enhancing an existing immune coccus (e.g., S. pyogenes, S. pneumoniae, and Group B strep response, or by initiating a new immune response. Alterna tococcus), Streptomyces, Treponema, Vibrio (e.g., Vibrio tively, DR4 polynucleotides or polypeptides, or agonists or cholerae) and Yersinia (e.g., Y. pestis). Fungi include, but are antagonists of DR4, may also directly inhibit the infectious not limited to: Absidia, Acremonium, Alternaria, Aspergillus, agent, without necessarily eliciting an immune response. Basidiobolus, Bipolaris, Blastomyces, Candida (e.g., C. albi Viruses are one example of an infectious agent that can cans), Coccidioides, Conidiobolus, Cryptococcus (e.g., C. cause disease or symptoms that can be treated and/or pre neoformans), Curvalaria, Erysipelothrix, Epidermophyton, vented by DR4 polynucleotides or polypeptides, or agonists Exophiala, Geotrichum, Histoplasma, Madurella, Malasse of DR4. Examples of viruses, include, but are not limited to zia, Microsporum, Moniliella, Mortierella, Mucor, Paecilo the following DNA and RNA viruses and viral families: 25 myces, Penicillium, Phialemonium, Phialophora, Prototh Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Bima eca, Pseudallescheria, Pseudomicrodochium, Pythium, viridae, Bunyaviridae, Caliciviridae, Circoviridae, Coro Rhinosporidium, Rhizopus, Scolecobasidium, Sporothrix, naviridae, Dengue virus, HIV-1, HIV-2. Flaviviridae, Hepad Stemphylium, Trichophyton, TrichospOron, and Xylohypha. naviridae (e.g., hepatitis B virus), Herpesviridae (e.g., These and other bacteria or fungi can cause diseases or symp cytomegalovirus, herpes simplex viruses 1 and 2, varicella 30 toms including, but not limited to: bacteremia, endocarditis, Zoster virus, Epstein-Barr virus (EBV), herpes B virus, and eye infections (conjunctivitis, uveitis), gingivitis, opportunis human herpesviruses 6, 7, and 8), Morbillivirus, Rhabdoviri tic infections (e.g., AIDS related infections), paronychia, dae (e.g., rabies virus), Orthomyxoviridae (e.g., influenza A prosthesis-related infections, Reiter's Disease, respiratory virus, and influenza B), Paramyxoviridae (e.g., parainfluenza tract infections, such as whooping cough or emphysema, virus), papilloma virus, Papovaviridae, Parvoviridae, Picor 35 sepsis, Lyme Disease, cat-scratch disease, dysentery, paraty naviridae (e.g., EMCV and poliovirus), Poxyiridae (e.g., are phoid fever, food poisoning, typhoid, pneumonia, gonorrhea, ola or vaccinia virus), Reoviridae (e.g., rotavirus), Retroviri meningitis, chlamydia, syphilis, diphtheria, leprosy, paratu dae (HTLV-I, HTLV-II, Lentivirus), and Togaviridae (e.g., berculosis, tuberculosis, lupus, botulism, gangrene, tetanus, Rubivirus). These viruses and virus families can cause a impetigo, rheumatic fever, Scarlet fever, sexually transmitted variety of diseases or symptoms, including, but not limited to: 40 diseases, skin diseases (e.g., cellulitis, dermatocycoses), tox arthritis, bronchiolitis, respiratory diseases, encephalitis, eye emia, urinary tract infections, and wound infections. DR4 infections (e.g., conjunctivitis, keratitis), chronic fatigue Syn polynucleotides or polypeptides, or agonists orantagonists of drome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese DR4, can be used to treat, prevent and/or detect any of these Bencephalitis, Junin, Chikungunya, Rift Valley fever, yellow symptoms or diseases. fever, meningitis, Smallpox, opportunistic infections (e.g., 45 In specific embodiments, DR4 polynucleotides, polypep AIDS, Kaposi's sarcoma), pneumonia, Burkitt's lymphoma, tides, or agonists and/or antagonists thereof are used to treat chickenpox, Zoster, hemorrhagic fever, measles, mumps, and/or prevent: tetanus, diphtheria, botulism, and/or menin parainfluenza, rabies, the common cold, polio, leukemia, gitis type B. rubella, sexually transmitted diseases, skin diseases (e.g., Moreover, parasites causing parasitic diseases or symp Kaposis, warts), and viremia. DR4 polynucleotides or 50 toms that can be treated and/or prevented by DR4 polynucle polypeptides, or agonists or antagonists of DR4, can be used otides or polypeptides, or agonists of DR4, include, but are to treat, prevent, and/or detect any of these symptoms or not limited to: protozoan parasites including, but not limited diseases. to, Babesia, Balantidium, Besnoitia, Cryptosporidium, Eime In specific embodiments, DR4 polynucleotides, polypep ria, Encephalitozoon, Entamoeba, Giardia, Hammondia, tides, or agonists and/or antagonists are used to treat and/or 55 Hepatozoon, Isospora, Leishmania, Microsporidia, prevent: meningitis, Dengue, EBV, and/or hepatitis. Neospora, Nosema, Pentatrichomonas, Plasmodium (e.g., In an additional specific embodiment DR4 polynucle Plasmodium virax, Plasmodium falciparium, Plasmodium otides, polypeptides, or agonists and/or antagonists are used malariae and Plasmodium ovale), Pneumocystis, Sarcocys to treat patients non-responsive to one or more other commer tis, Schistosoma, Theileria, Toxoplasma, and Trypanosoma; cially available hepatitis vaccines. 60 and helminth parasites including, but not limited to, Acan In a further specific embodiment, DR4 polynucleotides, thocheilonema, Aelurostrongylus, Ancylostoma, Angios polypeptides, or agonists and/or antagonists are used to treat trongylus, Ascaris, Brugia, Bunostomum, Capillaria, Chab AIDS. ertia, Cooperia, Crenosoma, Dictyocaulus, Dioctophyme, Similarly, bacteria and fungi that can cause disease or Dipetalonema, Diphyllobothrium, Diplvdium, Dirofilaria, symptoms and that can be treated and/or prevented by DR4 65 Dracunculus, Enterobius, Filaroides, Haemonchus, Lagochi polynucleotides or polypeptides, or agonists orantagonists of lascaris, Loa, Mansonella, Muellerius, Nanophyetus, Neca DR4, include, but are not limited to the following organisms. tor; Nematodirus, Oesophagostomum, Onchocerca, US 8,329,179 B2 165 166 Opisthorchis, Ostertagia, Parafilaria, Paragonimus, Paras Surgery, trauma, radiation therapy, chemotherapy, and trans caris, Physaloptera, Protostrongylus, Setaria, Spirocerca, plantation, or may be used to boost immune response and/or Spirometra, Stephanofilaria, Strongyloides, Strongylus, recovery in the elderly and immunocompromised individu Thelazia, Toxascaris, Toxocara, Trichinella, Trichostrongy als. Alternatively, polynucleotides and/or polypeptides of the lus, Trichuris, Uncinaria, and Wuchereria. These parasites invention and/or agonists and/or antagonists thereof are use can cause a variety of diseases or symptoms, including, but ful as immunosuppressive agents, for example in the treat not limited to: Scabies, trombiculiasis, eye infections (e.g., ment and/or prevention of autoimmune disorders. In specific river blindness), elephantiasis, intestinal disease (e.g., dysen embodiments, polynucleotides and/or polypeptides of the tery, giardiasis), liver disease, lung disease, opportunistic invention are used to treat and/or prevent chronic inflamma infections (e.g., AIDS related), malaria, pregnancy complica 10 tory, allergic or autoimmune conditions, such as those tions, and toxoplasmosis. DR4 polynucleotides or polypep described herein or are otherwise known in the art. tides, or agonists or antagonists of DR4, can be used to treat, In one embodiment, DR4 polynucleotides and/or polypep prevent and/or detect any of these symptoms or diseases. tides of the invention and/or agonists or antagonists thereof In specific embodiments, DR4 polynucleotides, polypep may be used as an immune system enhancer prior to, during, tides, or agonists and/or antagonists thereof are used to treat 15 or after bone marrow transplant and/or other transplants (e.g., and/or prevent malaria. allogenic or Xenogenic organ transplantation). With respect to Polynucleotides and/or polypeptides of the invention and/ transplantation, compositions of the invention may be admin or agonists and/or antagonists thereof are also useful as an istered prior to, concomitant with, and/or after transplanta adjuvant to enhance immune responsiveness to specific anti tion. In a specific embodiment, compositions of the invention gen, tumor-specific responses, and/or anti-viral immune are administered after transplantation, prior to the beginning responses. of recovery of T-cell populations. In another specific embodi An adjuvant to enhance anti-viral immune responses. Anti ment, compositions of the invention are first administered viral immune responses that may be enhanced using the com after transplantation after the beginning of recovery of T-cell positions of the invention as an adjuvant, include virus and populations, but prior to full recovery of B-cell populations. virus associated diseases or symptoms described herein or 25 In another embodiment, DR4 polynucleotides and/or otherwise known in the art. In specific embodiments, the polypeptides of the invention and/or agonists or antagonists compositions of the invention are used as an adjuvant to thereof may be used as an agent to boost immunoresponsive enhance an immune response to a virus, disease, or symptom ness among B-cell immunodeficient individuals. B-cell selected from the group consisting of AIDS, meningitis, immunodeficiencies that may be ameliorated or treated and/ Dengue, EBV, and hepatitis (e.g., hepatitis B). In another 30 or prevented by administering the DR4 polypeptides or poly specific embodiment, the compositions of the invention are nucleotides of the invention, or agonists or antagonists used as an adjuvant to enhance an immune response to a virus, thereof, include, but are not limited to, severe combined disease, or symptom selected from the group consisting of immune deficiency (SCID), congenital agammaglobuline HIV/AIDS, Respiratory syncytial virus, Dengue, Rotavirus, mia, common variable immunodeficiency, Wiskott-Aldrich Japanese B encephalitis, Influenza A and B, Parainfluenza, 35 Syndrome, and X-linked immunodeficiency with hyper IgM. Measles, Cytomegalovirus, Rabies, Junin, Chikungunya, Rift Additionally, DR4 polynucleotides and/or polypeptides of Valley fever, Herpes simplex virus, and yellow fever. the invention and/or agonists or antagonists thereof may be Anti-bacterial or anti-fungal immune responses that may used as an agent to boost immunoresponsiveness among indi be enhanced using the compositions of the invention as an viduals having an acquired loss of B-cell function. Conditions adjuvant, include bacteria or fungus and bacteria or fungus 40 resulting in an acquired loss of B-cell function that may be associated diseases or symptoms described herein or other ameliorated, treated, and/or prevented by administering the wise known in the art. In specific embodiments, the compo DR4 polypeptides or polynucleotides of the invention, or sitions of the invention are used as an adjuvant to enhance an agonists orantagonists thereof, include, but are not limited to, immune response to a bacterium or fungus, disease, or symp HIV Infection, AIDS, bone marrow transplant, and B-cell tom selected from the group consisting of tetanus, diphthe 45 chronic lymphocytic leukemia (CLL). ria, botulism, and meningitis type B. In another specific Furthermore, DR4 polynucleotides and/or polypeptides of embodiment, the compositions of the invention are used as an the invention and/or agonists or antagonists thereof may be adjuvant to enhance an immune response to a bacteria used as an agent to boost immunoresponsiveness among indi selected from the group consisting of Vibrio cholerae, Myco viduals having a temporary immune deficiency. Conditions bacterium leprae, Salmonella typhi, Salmonella paratyphi, 50 resulting in a temporary immune deficiency that may beame Neisseria meningitidis, Streptococcus pneumoniae, Group B liorated, treated, and/or prevented by administering the DR4 streptococcus, Shigella spp., Enterotoxigenic E. coli, Entero polypeptides or polynucleotides of the invention, and/or ago hemorrhagic E. coli, and Borrelia burgdorferi. nists or antagonists thereof, include, but are not limited to, Anti-parasitic immune responses that may be enhanced recovery from viral infections (e.g., influenza), conditions using the compositions of the invention as an adjuvant, 55 associated with malnutrition, recovery from infectious mono include parasite and parasite associated diseases or symptoms nucleosis, or conditions associated with stress, recovery from described herein or otherwise known in the art. In specific measles, recovery from blood transfusion, recovery from Sur embodiments, the compositions of the invention are used as gery. an adjuvant to enhance an immune response to a parasite. In DR4 polynucleotides and/or polypeptides of the invention another specific embodiment, the compositions of the inven 60 and/or agonists or antagonists thereof may also be used as a tion are used as an adjuvant to enhance an immune response regulator of antigen presentation by monocytes, dendritic to Plasmodium spp. (malaria). cells, and/or B-cells. In one embodiment, DR4 (in soluble, More generally, polynucleotides and/or polypeptides of membrane-bound or transmembrane forms) enhances anti the invention and/or agonists and/or antagonists thereof are gen presentation or antagonizes antigen presentation in vitro useful in regulating (i.e., elevating or reducing) immune 65 or in vivo. response. For example, polynucleotides and/or polypeptides In related embodiments, said enhancement or antagoniza of the invention may be useful in preparation or recovery from tion of antigen presentation may be useful as an anti-tumor US 8,329,179 B2 167 168 treatment or to modulate the immune system. For example, enous antibody molecules or having an otherwise compro DR4 polynucleotides and/or polypeptides of the invention mised endogenous immune system, but which is capable of and/or agonists orantagonists thereofmay be used as an agent producing human immunoglobulin molecules by means of a to direct an individual’s immune system towards develop reconstituted or partially reconstituted immune system from ment of a humoral response (i.e. TH2) as opposed to a TH1 another animal (see, e.g., published PCT Application Nos. cellular response. Also, DR4 polynucleotides and/or WO98/24893, WO96/34096, WO96/33735, and WO91/ polypeptides of the invention and/or agonists or antagonists 10741. thereof may be used as a stimulator of B-cell production in Antagonists of DR4 include binding and/or inhibitory anti pathologies Such as AIDS, chronic lymphocyte disorder and/ bodies, antisense nucleic acids, ribozymes or soluble forms of or Common Variable Immunodeficiency. 10 In another embodiment, DR4 polynucleotides and/or the DR4 receptor(s). These would be expected to reverse polypeptides of the invention and/or agonists or antagonists many of the activities of herein, as well as find clinical or thereof may be used as a means to induce tumor proliferation practical application including, but not limited to the follow and thus make the tumor more Susceptible to anti-neoplastic ing applications. DR4 antagonists may be used as a means of agents. For example, multiple myeloma is a slowly dividing 15 blocking various aspects of immune responses to foreign disease and is thus refractory to virtually all anti-neoplastic agents or self, for example, autoimmune disorders such as regimens. If these cells were forced to proliferate more rap lupus, and arthritis, as well as immunoresponsiveness to skin idly their susceptibility profile would likely change. allergies, inflammation, bowel disease, injury and pathogens. Other embodiments where DR4 polynucleotides and/or Although our current data speaks directly to the potential role polypeptides of the invention and/or agonists or antagonists of DR4 in B-cell and T-cell related pathologies, it remains thereof may be used include, but are not limited to: as a possible that other cell types may gain expression or respon stimulator of B-cell production in pathologies such as AIDS, siveness to DR4. Thus, DR4 may, like CD40 and its ligand, chronic lymphocyte disorder and/or Common Variable may be regulated by the status of the immune system and the Immunodeficiency; as a therapy for generation and/or regen microenvironment in which the cell is located. DR4 antago eration of lymphoid tissues following Surgery, trauma or 25 nists may be used as a therapy for preventing the B-cell genetic defect; as a gene-based therapy for genetically inher proliferation and Ig secretion associated with autoimmune ited disorders resulting in immuno-incompetence Such as diseases such as idiopathic thrombocytopenic purpura, sys observed among SCID patients; as an antigen for the genera temic lupus erythematosus and; as an inhibitor of graft versus tion of antibodies to inhibit or enhance DR5 mediated host disease or transplant rejection; as a therapy for B-cell responses; as a means of activating T-cells; as pretreatment of 30 malignancies such as ALL, Hodgkin’s disease, non bone marrow samples prior to transplant (Such treatment Hodgkin’s lymphoma, Chronic lymphocyte leukemia, plas would increase B-cell representation and thus accelerate macytomas, multiple myeloma, Burkitt's lymphoma, and recovery); as a means of regulating secreted cytokines that are EBV-transformed diseases; as a therapy for chronic hyper elicited by DR4; to modulate IgE concentrations in vitro or in gammaglobulinemeia evident in Such diseases as monoclon vivo; and to treat and/or prevent IgE-mediated allergic reac 35 algammopathy of undetermined significance (MGUS), tions including, but are not limited to, asthma, rhinitis, and Waldenstrom's disease, related idiopathic monoclonalgam CCZCa. mopathies, and plasmacytomas; as a therapy for decreasing Alternatively, DR4 polynucleotides and/or polypeptides of cellular proliferation of Large B-cell Lymphomas; as a means the invention and/or agonists and/or antagonists thereof are of decreasing the involvement of B-cells and Ig associated useful as immunosuppressive agents, for example in the treat 40 with Chronic Myelogenous Leukemia; or as an immunosup ment and/or prevention of autoimmune disorders. In specific pressive agent. embodiments, polynucleotides and/or polypeptides of the Furthermore, DR4 polypeptides or polynucleotides of the invention are used to treat and/or prevent chronic inflamma invention, orantagonists thereofmay be used to modulate IgE tory, allergic or autoimmune conditions, such as those concentrations in vitro or in vivo, or to treat and/or prevent described herein or are otherwise known in the art. 45 IgE-mediated allergic reactions including, but not limited to, Preferably, treatment using DR4 polynucleotides or asthma, rhinitis, and eczema. polypeptides, or agonists or antagonists of DR4, could either All of the therapeutic applications of DR4 polynucleotides be by administering an effective amount of DR4 polypeptide and/or polypeptides of the invention and/or agonists and/or to the patient, or by removing cells from the patient, Supply antagonists thereof described herein may, in addition to their ing the cells with DR4 polynucleotide, and returning the 50 uses in human medicine, be used in Veterinary medicine. The engineered cells to the patient (ex vivo therapy). Moreover, as present invention includes treatment of companion animals, further discussed herein, the DR4 polypeptide or polynucle including, but not limited to dogs, cats, ferrets, birds, and otide can be used as an adjuvant in a vaccine to raise an horses; food animals, including, but not limited to cows, pigs, immune response against infectious disease. chickens, and sheep; and exotic animals, e.g., Zoo animals. Additional preferred embodiments of the invention 55 The above-recited applications have uses in a wide variety include, but are not limited to, the use of DR4 polypeptides of hosts. Such hosts include, but are not limited to, human, and functional agonists orantagonists in the following appli murine, rabbit, goat, guinea pig, camel, horse, mouse, rat, cations: administration to an animal (e.g., mouse, rat, rabbit, hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat, hamster, guinea pig, pigs, micro-pig, chicken, camel, goat, non-human, primate, and human. In specific embodiments, horse, cow, sheep, dog, cat, non-human primate, and human, 60 the host is a mouse, rabbit, goat, guinea pig, chicken, rat, most preferably human) to boost the immune system to pro hamster, pig, sheep, dog or cat. In preferred embodiments, the duce increased quantities of one or more antibodies (e.g., host is a mammal. In most preferred embodiments, the host is IgG, IgA, IgM, and IgE), to induce higher affinity antibody a human. production (e.g., IgG, IgA, IgM, and IgE), and/or to increase DR4 polynucleotides and/or polypeptides of the invention an immune response; or administration to an animal (includ 65 and/or agonists and/or antagonists thereof described herein ing, but not limited to, those listed above, and also including may be employed in a composition with a pharmaceutically transgenic animals) incapable of producing functional endog acceptable carrier, e.g., as described herein. US 8,329,179 B2 169 170 In one aspect, the present invention is directed to a method tosis in cells expressing a polypeptide comprising the extra for enhancing apoptosis induced by a TNF-family ligand, cellular domain of the polypeptide encoded by the cDNA which involves administering to a cell which expresses the clone contained in ATCC Deposit No. 97920 on their surface, DR4 polypeptide an effective amount of DR4 ligand, analog comprising, or alternatively consisting of contacting ago or an agonist capable of increasing DR4 mediated signaling. nists of the invention with Such cells expressing said polypep Preferably, DR4 mediated signaling is increased to treat and/ tide on their surface. or prevent a disease wherein decreased apoptosis or In preferred embodiments, the present invention encom decreased cytokine and adhesion molecule expression is passes methods and compositions for inducing apoptosis in exhibited. An agonist can include soluble forms of DR4 and cells expressing a polypeptide comprising the extracellular monoclonal antibodies directed against the DR4 polypeptide. 10 domain of the polypeptide encoded by the cDNA clone con In a further aspect, the present invention is directed to a tained in ATCC Deposit No. 97920 on their surface, compris method for inhibiting apoptosis induced by a TNF-family ing, or alternatively consisting of contacting agonistic anti ligand, which involves administering to a cell which DR4 antibodies of the invention with such cells expressing expresses the, DR4 polypeptide an effective amount of an said polypeptide on their surface. antagonist capable of decreasing DR4 mediated signaling. 15 The present invention further encompasses methods and Preferably, DR4 mediated signaling is decreased to treat and/ compositions for killing of cells expressing DR4 on their or prevent a disease wherein increased apoptosis or NF-kB Surface, comprising, or alternatively consisting of adminis expression is exhibited. An antagonist can include soluble tering to an animal, agonists of the invention in an amount forms of DR4 (e.g., polypeptides containing all or a portion of effective to kill such DR4 expressing cells. the DR4 extracellular domain) and monoclonal antibodies In preferred embodiments, the present invention further directed against the DR4 polypeptide. encompasses methods and compositions for killing of cells By "agonist' is intended naturally occurring and synthetic expressing DR4 on their surface, comprising, or alternatively compounds capable of enhancing or potentiating apoptosis consisting of administering to an animal, agonistic anti-DR4 (e.g., stimulating DR4 activities). By “antagonist’ is intended antibodies of the invention in an amount effective to kill such naturally occurring and synthetic compounds capable of 25 DR4 expressing cells. inhibitingapoptosis (e.g., inhibiting DR4 activities). Whether In specific embodiments, the present invention encom any candidate “agonist' or “antagonist of the present inven passes methods and compositions for inducing apoptosis in tion can enhance or inhibit apoptosis can be determined using cells expressing DR4 on their Surface, comprising, or alter art-known TNF-family ligand/receptor cellular response natively consisting of administering to an animal, agonists of assays, including those described in more detail below. 30 the invention in an amount effective to induce apoptosis in The present invention further encompasses methods and Such DR4 expressing cells. compositions for killing of cells expressing DR4 on their In preferred embodiments, the present invention encom Surface, comprising, or alternatively consisting of contacting passes methods and compositions for inducing apoptosis in agonists of the invention with Such cells expressing DR4 on cells expressing DR4 on their Surface, comprising, or alter their surface. 35 natively consisting of administering to an animal, agonistic In preferred embodiments, the present invention further anti-DR4 antibodies of the invention in an amount effective to encompasses methods and compositions for killing of cells induce apoptosis in Such DR4 expressing cells. expressing DR4 on their surface, comprising, or alternatively In further specific embodiments, the present invention consisting of contacting agonistic anti-DR4 antibodies of the encompasses methods and compositions for inducing apop invention with such cells expressing DR4 on their surface. 40 tosis in cells expressing a polypeptide comprising amino In specific embodiments, the present invention encom acids about 52 to about 184 of SEQID NO:2 on their surface, passes methods and compositions for inducing apoptosis in comprising; or alternatively consisting of administering to an cells expressing DR4 on their Surface, comprising, or alter animal, agonists of the invention in an amount effective to natively consisting of contacting agonists of the invention induce apoptosis in Such cells expressing said polypeptide on with such cells expressing DR4 on their surface. 45 their surface. In preferred embodiments, the present invention encom In preferred embodiments, the present invention encom passes methods and compositions for inducing apoptosis in passes methods and compositions for inducing apoptosis in cells expressing DR4 on their Surface, comprising, or alter cells expressing a polypeptide comprising amino acids about natively consisting of contacting agonistic anti-DR4 anti 52 to about 184 of SEQID NO:2 on their surface, comprising, bodies of the invention with such cells expressing DR4 on 50 or alternatively consisting of administering to an animal, their surface. agonistic anti-DR4 antibodies of the invention in an amount In further specific embodiments, the present invention effective to induce apoptosis in Such cells expressing said encompasses methods and compositions for inducing apop polypeptide on their Surface. tosis in cells expressing a polypeptide comprising amino In further specific embodiments, the present invention acids about 52 to about 184 of SEQID NO:2 on their surface, 55 encompasses methods and compositions for inducing apop comprising, or alternatively consisting of contacting ago tosis in cells expressing a polypeptide comprising the extra nists of the invention with Such cells expressing said polypep cellular domain of the polypeptide encoded by the cDNA tide on their surface. clone contained in ATCC Deposit No. 97920 on their surface, In preferred embodiments, the present invention encom comprising, or alternatively consisting of administering to an passes methods and compositions for inducing apoptosis in 60 animal, agonists of the invention in an amount effective to cells expressing a polypeptide comprising amino acids about induce apoptosis in Such cells expressing said polypeptide on 52 to about 184 of SEQID NO:2 on their surface, comprising, their surface. or alternatively consisting of contacting agonistic anti-DR4 In preferred embodiments, the present invention encom antibodies of the invention with Such cells expressing said passes methods and compositions for inducing apoptosis in polypeptide on their Surface. 65 cells expressing a polypeptide comprising the extracellular In further specific embodiments, the present invention domain of the polypeptide encoded by the cDNA clone con encompasses methods and compositions for inducing apop tained in ATCC Deposit No. 97920 on their surface, compris US 8,329,179 B2 171 172 ing, or alternatively consisting of administering to an animal, indicates that the candidate compound is an agonist of the agonistic anti-DR4 antibodies of the invention in an amount ligand/receptor signaling pathway and a decreased cellular effective to induce apoptosis in Such cells expressing said response compared to the standard indicates that the candi polypeptide on their Surface. date compound is an antagonist of the ligand/receptor signal One Such screening procedure involves the use of melano ing pathway. By “assaying a cellular response' is intended phores which are transfected to express the receptor of the qualitatively or quantitatively measuring a cellular response present invention. Such a screening technique is described in to a candidate compound and/or a TNF-family ligand (e.g., PCT WO92/01810, published Feb. 6, 1992. Such an assay determining or estimating an increase or decrease in T-cell may be employed, for example, for Screening for a compound proliferation or tritiated thymidine labeling). By the inven which inhibits (or enhances) activation of the receptor 10 tion, a cell expressing the DR4 polypeptide can be contacted polypeptide of the present invention by contacting the mel with either an endogenous or exogenously administered anophore cells which encode the receptor with both a TNF TNF-family ligand. family ligand and the candidate antagonist (or agonist). Inhi Agonist according to the present invention include natu bition or enhancement of the signal generated by the ligand rally occurring and synthetic compounds such as, for indicates that the compound is an antagonist or agonist of the 15 example, TNF family ligand peptide fragments, transforming ligand/receptor signaling pathway. growth factor, neurotransmitters (such as glutamate, dopam Other screening techniques include the use of cells which ine, N-methyl-D-aspartate), tumor Suppressors (p53), express the receptor (for example, transfected CHO cells) in cytolytic T-cells and antimetabolites. Preferred agonist a system which measures extracellular pH changes caused by include chemotherapeutic drugs such as, for example, cispl receptor activation, for example, as described in Science 246: atin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen 181-296 (October 1989). For example, compounds may be mustard, methotrexate and Vincristine. Others include etha contacted with a cell which expresses the receptor polypep nol and B-amyloid peptide. (Science 267:1457-1458 (1995)). tide of the present invention and a second messenger Further preferred agonist include polyclonal and monoclonal response, e.g., signal transduction or pH changes, may be antibodies raised against the DR4 polypeptide, or a fragment measured to determine whether the potential compound acti 25 thereof. Such agonistantibodies raised against a TNF-family vates or inhibits the receptor. receptor are disclosed in Tartaglia, L. A., et al., Proc. Natl. Another such screening technique involves introducing Acad. Sci. USA 88:9292-9296 (1991); and Tartaglia, L.A., RNA encoding the receptor into Xenopus oocytes to tran and Goeddel, D.V., J. Biol. Chem. 267 (7):4304-4307 (1992). siently express the receptor. The receptor oocytes may then be See also, PCT Application WO94/09137. contacted with the receptor ligand and a compound to be 30 Antagonist according to the present invention include natu screened, followed by detection of inhibition or activation of rally occurring and synthetic compounds such as, for a calcium signal in the case of screening for compounds example, the CD40 ligand, neutral amino acids, zinc, estro which are thought to inhibit activation of the receptor. gen, androgens, viral genes (such as Adenovirus ElB, Bacu Another screening technique involves expressing in cells a lovirus p35 and IAP Cowpox virus crimA, Epstein-Barr virus construct wherein the receptor is linked to a phospholipase C 35 BHRF1, LMP-1, African swine fever virus LMW5-HL, and or D. Such cells include endothelial cells, smooth muscle Herpesvirus y1 34.5), calpain inhibitors, cysteine protease cells, embryonic kidney cells, etc. The screening may be inhibitors, and tumor promoters (such as PMA, Phenobar accomplished as herein above described by detecting activa bital, and hexachlorocyclohexanes (e.g., W-, -, or tion of the receptor or inhibition of activation of the receptor (-hexachlorocyclohexane). from the phospholipase signal. 40 Other potential antagonists include antisense molecules. Another method involves Screening for compounds which Antisense technology can be used to control gene expression inhibit activation of the receptor polypeptide of the present through antisense DNA or RNA or through triple-helix for invention antagonists by determining inhibition of binding of mation. Antisense techniques are discussed, for example, in labeled ligand to cells which have the receptor on the surface Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucle thereof. Such a method involves transfecting a eukaryotic cell 45 otides as Antisense Inhibitors of Gene Expression, CRC with DNA encoding the receptor such that the cell expresses Press, Boca Raton, Fla. (1988). Triple helix formation is the receptor on its Surface and contacting the cell with a discussed in, for instance Lee et al., Nucleic Acids Research compound in the presence of a labeled form of a known 6:3073 (1979); Cooney et al., Science 241:456 (1988); and ligand. The ligand can be labeled, e.g., by radioactivity. The Dervan et al., Science 251:1360 (1991). The methods are amount of labeled ligand bound to the receptors is measured, 50 based on binding of a polynucleotide to a complementary e.g., by measuring radioactivity of the receptors. If the com DNA or RNA pound binds to the receptor as determined by a reduction of For example, the 5' coding portion of a polynucleotide that labeled ligand which binds to the receptors, the binding of encodes the mature polypeptide of the present invention may labeled ligand to the receptor is inhibited. be used to design an antisense RNA oligonucleotide of from Further screening assays for agonist and antagonist of the 55 about 10 to 40 base pairs in length. A DNA oligonucleotide is present invention are described in Tartaglia, L.A., and Goed designed to be complementary to a region of the gene del, D. V., J. Biol. Chem. 267(7):4304-4307 (1992). involved in transcription thereby preventing transcription and Thus, in a further aspect, a screening method is provided the production of the receptor. The antisense RNA oligo for determining whether a candidate agonist or antagonist is nucleotide hybridizes to the mRNA in vivo and blocks trans capable of enhancing or inhibiting a cellular response to a 60 lation of the mRNA molecule into receptor polypeptide. The TNF-family ligand. The method involves contacting cells oligonucleotides described above can also be delivered to which express the DR4 polypeptide with a candidate com cells such that the antisense RNA or DNA may be expressed pound and a TNF-family ligand, assaying a cellular response, in vivo to inhibit production of the DR4 receptor. and comparing the cellular response to a standard cellular In one embodiment, the DR4 antisense nucleic acid of the response, the standard being assayed when contact is made 65 invention is produced intracellularly by transcription from an with the ligand in absence of the candidate compound, exogenous sequence. For example, a vector or a portion whereby an increased cellular response over the standard thereof, is transcribed, producing an antisense nucleic acid US 8,329,179 B2 173 174 (RNA) of the invention. Such a vector would contain a transport across the cell membrane (see, e.g., Letsinger et al., sequence encoding the DR4 antisense nucleic acid. Such a Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556 (1989); Lemaitre vector can remain episomal or become chromosomally inte et al., Proc. Nail. Acad. Sci. 84:648-652 (1987); PCT Publi grated, as long as it can be transcribed to produce the desired cation No. WO88/09810, published Dec. 15, 1988) or the antisense RNA. Such vectors can be constructed by recom blood-brain barrier (see, e.g., PCT Publication No. WO89/ binant DNA technology methods standard in the art. Vectors 10134, published Apr. 25, 1988), hybridization-triggered can be plasmid, viral, or others know in the art, used for cleavage agents. (See, e.g., Krol et al., BioTechniques 6:958 replication and expression in vertebrate cells. Expression of 976 (1988)) or intercalating agents. (See, e.g., Zon, Pharm. the sequence encoding DR4, or fragments thereof, can be by Res. 5:539-549 (1988)). To this end, the oligonucleotide may any promoter known in the art to act in vertebrate, preferably 10 be conjugated to another molecule, e.g., a peptide, hybridiza human cells. Such promoters can be inducible or constitutive. tion triggered cross-linking agent, transportagent, hybridiza Such promoters include, but are not limited to, the SV40 early tion-triggered cleavage agent, etc. promoter region (Bernoist and Chambon, Nature 29:304-310 The antisense oligonucleotide may comprise at least one (1981), the promoter contained in the 3' long terminal repeat modified base moiety which is selected from the group of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 15 including, but not limited to, 5-fluorouracil, 5-bromouracil, (1980), the herpes thymidine promoter (Wagner et al., Proc. 5-chlorouracil, 5-iodouracil, hypoxanthine, Xantine, 4-ace Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory tylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxym sequences of the metallothionein gene (Brinster et al., Nature ethylaminomethyl-2-thiouridine, 5-carboxymethylaminom 296:39-42 (1982)), etc. ethyluracil, dihydrouracil, beta-D-galactosylqueosine, The antisense nucleic acids of the invention comprise a inosine, N6-isopentenyladenine, 1-methylguanine, 1-meth sequence complementary to at least a portion of an RNA ylinosine, 2.2-dimethylguanine, 2-methyladenine, 2-meth transcript of a DR4 gene. However, absolute complementar ylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, ity, although preferred, is not required. A sequence “comple 7-methylguanine, 5-methylaminomethyluracil, 5-meth mentary to at least a portion of an RNA referred to herein, oxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, means a sequence having Sufficient complementarity to be 25 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-meth able to hybridize with the RNA, forming a stable duplex; in ylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid (v), the case of double stranded DR4 antisense nucleic acids, a Wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-me single strand of the duplex DNA may thus be tested, or triplex thyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, formation may be assayed. The ability to hybridize will uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid depend on both the degree of complementarity and the length 30 (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N2-carboxypropyl) of the antisense nucleic acid. Generally, the larger the hybrid uracil, (acp3)w, and 2,6-diaminopurine. izing nucleic acid, the more base mismatches with a The antisense oligonucleotide may also comprise at least DR4RNA it may contain and still form a stable duplex (or one modified Sugar moiety selected from the group including, triplex as the case may be). One skilled in the art can ascertain but not limited to, arabinose, 2-fluoroarabinose, Xylulose, and a tolerable degree of mismatch by use of standard procedures 35 hexose. to determine the melting point of the hybridized complex. In yet another embodiment, the antisense oligonucleotide Oligonucleotides that are complementary to the 5' end of comprises at least one modified phosphate backbone selected the message, e.g., the 5' untranslated sequence up to and from the group including, but not limited to, a phosphorothio including the AUG initiation codon, should work most effi ate, a phosphorodithioate, a phosphoramidothioate, a phos ciently at inhibiting translation. However, sequences comple 40 phoramidate, a phosphordiamidate, a methylphosphonate, an mentary to the 3' untranslated sequences of mRNAs have alkyl phosphotriester, and a formacetal or analog thereof. been shown to be effective at inhibiting translation of mRNAs In yet another embodiment, the antisense oligonucleotide as well. See generally, Wagner, R., Nature 372:333-335 is an O-anomeric oligonucleotide. An O-anomeric oligo (1994). Thus, oligonucleotides complementary to either the nucleotide forms specific double-stranded hybrids with 5'- or 3'-non-translated, non-coding regions of the DR4 45 complementary RNA in which, contrary to the usual D-units, shown in SEQ ID NO:1 could be used in an antisense the strands run parallel to each other (Gautier et al., Nucl. approach to inhibit translation of endogenous DR4 mRNA. Acids Res. 15:6625-6641 (1987)). The oligonucleotide is a Oligonucleotides complementary to the 5' untranslated 2'-O-methylribonucleotide (Inoue et al., Nucl. Acids Res. region of the mRNA should include the complement of the 15:6131-6148 (1987)), or a chimeric RNA-DNA analogue AUG start codon. Antisense oligonucleotides complementary 50 (Inoue et al., FEBS Lett. 215:327-330 (1987)). to mRNA coding regions are less efficient inhibitors of trans Polynucleotides of the invention may be synthesized by lation but could be used in accordance with the invention. standard methods known in the art, e.g. by use of an auto Whether designed to hybridize to the 5'-3'- or coding region mated DNA synthesizer (such as are commercially available of DR4 mRNA, antisense nucleic acids should be at least six from BioSearch, Applied Biosystems, etc.). As examples, nucleotides in length, and are preferably oligonucleotides 55 phosphorothioate oligonucleotides may be synthesized by ranging from 6 to about 50 nucleotides in length. In specific the method of Stein et al. (Nucl. Acids Res. 16:3209 (1988)), aspects the oligonucleotide is at least 10 nucleotides, at least methylphosphonate oligonucleotides can be prepared by use 17 nucleotides, at least 25 nucleotides or at least 50 nucle of controlled pore glass polymer Supports (Sarin et al., Proc. otides. Natl. Acad. Sci. U.S.A. 85:7448-7451 (1988)), etc. The polynucleotides of the invention can be DNA or RNA 60 While antisense nucleotides complementary to the DR4 or chimeric mixtures or derivatives or modified versions coding region sequence could be used, those complementary thereof, single-stranded or double-stranded. The oligonucle to the transcribed untranslated region are most preferred. otide can be modified at the base moiety, Sugar moiety, or Potential antagonists according to the invention also phosphate backbone, for example, to improve stability of the include catalytic RNA, or a ribozyme (See, e.g., PCT Inter molecule, hybridization, etc. The oligonucleotide may 65 national Publication WO 90/11364, published Oct. 4, 1990; include other appended groups such as peptides (e.g., for Sarveretal, Science 247: 1222-1225 (1990). While ribozymes targeting host cell receptors in vivo), or agents facilitating that cleave mRNA at site specific recognition sequences can