(Htert) Gene Is a Direct Target of the Histone Methyltransferase SMYD3

Research Article

The Telomerase Reverse Transcriptase (hTERT) Gene Is a Direct Target of the Histone Methyltransferase SMYD3

Cheng Liu,1 Xiaolei Fang,2 Zheng Ge,1 Marit Jalink,1 Satoru Kyo,3 Magnus Bjo¨rkholm,1 Astrid Gruber,1 Jan Sjo¨berg,1 and Dawei Xu1

1Department of Medicine, Division of Hematology, Karolinska University Hospital Solna and Karolinska Institutet, Stockholm, Sweden; 2Institute of Urology, The Second Hospital of Shandong University, Jinan, PR China; and 3Department of Obstetrics and Gynecology, School of Medicine, Kanazawa University, Takaramachi, Kanazwa, Ishikawa, Japan

Abstract mechanisms have been proposed for its trans-activating function: Recent evidence has accumulated that the dynamic histone First, SMYD3 recruits RNA polymerase II through RNA helicase, methylation mediated by histone methyltransferases and forming a transcriptional complex to elongate transcription. demethylases plays key roles in regulation of chromatin Second, SMYD3 interacts with its binding motif CCCTCC in the structure and transcription. In the present study, we show promoter region of its target genes and dimethylates or trimethy- that SET and MYND domain-containing protein 3 (SMYD3), a lates H3-K4 (1). The correlation between histone methylation histone methyltransferase implicated in oncogenesis, directly pattern in promoter regions and gene transcriptional activity has telomerase reverse transcriptase hTERT been well established: trimethyl-H3-K4 modification is in general trans-activates the ( ) ¶ gene that is essential for cellular immortalization and trans- enriched at 5 ends of actively transcribed genes and associated with a high transcriptional activity (5–7). The methylated H3-K4 alters formation. SMYD3 occupies its binding motifs on the hTERT promoter and is required for maintenance of histone H3-K4 the chromatin folding, leading to increased accessibility of DNA to trimethylation, thereby contributing to inducible and consti- proteins that mediate transcription. Moreover, trimethyl-H3-K4 tutive hTERT expression in normal and malignant human provides specific binding sites for certain proteins or complexes cells. Knocking down SMYD3 in tumor cells abolished tri- that induce transcription activation (8, 9). methylation of H3-K4, attenuated the occupancy by the trans- However, the mechanism underlying SMYD3-mediated oncogen- activators c-MYC and Sp1, and led to diminished histone H3 esis is incompletely understood and its target genes essential for acetylation in the hTERT promoter region, which was coupled transformation remain to be characterized further. Several lines of with down-regulation of hTERT mRNA and telomerase evidence have recently shown that activation of telomerase, a activity. These results suggest that SMYD3-mediated trimethy- cellular ribonucleoprotein responsible for elongation of telomeres, lation of H3-K4 functions as a licensing element for sub- is prerequisite for cell immortalization and transformation (10, 11). sequent transcription factor binding to the hTERT promoter. Telomerase activity is indeed detectable in up to 90% of human The present findings provide significant insights into regula- malignancies, whereas it is repressed in most normal human cells (10, 11). It has been shown that the transcriptional regulation of the tory mechanisms of hTERT/telomerase expression; moreover, identification of the hTERT gene as a direct target of SMYD3 catalytic component of the telomerase complex, telomerase reverse contributes to a better understanding of SMYD3-mediated transcriptase (hTERT), is a predominant determinant for control- ling telomerase activity (10, 12–14). More recently, roles for histone cellular transformation. [Cancer Res 2007;67(6):2626–31] modification–mediated chromatin remodeling in regulating hTERT transcription have been revealed (15): Increased histone acetylation Introduction and/or phosphorylation at the hTERT promoter leads to trans- SET and MYND domain-containing protein 3 (SMYD3) is a activation of the hTERT gene (16–24). Interestingly, Atkinson et al. histone H3-K4–specific dimethyltransferase and trimethyltransfer- observed that highly trimethylated H3-K4 was associated with the ase and plays an important role in oncogenesis (1, 2). Expression of actively transcribed hTERT gene in telomerase-proficient tumor SMYD3 is undetectable or very weak in many types of normal cells (25). However, it is unclear what is responsible for H3-K4 human tissues whereas significantly up-regulated in the great methylation at the hTERT promoter. Given the above findings, majority of colorectal carcinoma, hepatocellular carcinoma, and together with SMYD3 as a histone H3-K4–specific methyltransfer- breast cancer (1–3). It has been shown that non-transformed cells ase, we sought to determine whether the hTERT gene is a overexpressing SMYD3 exhibit increased capabilities of prolifera- transcriptional target of SMYD3. In the present study, we provide tion and colony formation, whereas suppressing SMYD3 gene evidence that SMYD3-mediated H3-K4 methylation is required for expression by small interference RNA (siRNA) leads to growth inducible and constitutive hTERT expression in both normal inhibition or apoptosis of colorectal carcinoma and hepatocellular human fibroblasts and cancer cell lines. carcinoma cells (1, 2, 4). Evidence has accumulated that SMYD3 elicits its oncogenic effect Materials and Methods via activating transcription of its downstream target genes, and two Cell lines and culture conditions. Human normal foreskin (BJ) fibroblasts and lung fetal fibroblasts (LF1; ref. 20), Saos-2, HCT116, Hep3B, and L1236 tumor cell lines were cultured at 37jC in RPMI 1640 (Life Requests for reprints: Dawei Xu, Hematology Lab, Karolinska University Hospital, Technologies, Paisley, Scotland) containing 10% FCS, 100 units/mL CMM, L8:03, SE-171 76, Stockholm, Sweden. Phone: 46-8-5177-6552; Fax: 46-8-5177- penicillin, and 2mmol/L L-glutamine. 3054; E-mail: [email protected]. I2007 American Association for Cancer Research. Plasmids and transfection. The flag-tagged pcDNA-SMYD3 expression doi:10.1158/0008-5472.CAN-06-4126 plasmid and the corresponding empty vector pcDNA-flag were provided by

Cancer Res 2007; 67: (6). March 15, 2007 2626 www.aacrjournals.org

Drs. Nakamura and Furukawa (1). BJ and LF1 fibroblasts were transfected (Fig. 1A), mock control cells expressed no hTERT mRNA, whereas with either the SMYD3 plasmid or empty control vector using Lipofect- transfection of the SMYD3 expression vector (pcDNA-SMYD3) AMINE 2000 (Invitrogen, Carlsbad, CA) according to manufacturer’s induced hTERT mRNA expression in both BJ and LF1 fibroblasts. protocol, and the cells were then harvested for hTERT mRNA analysis We next determined the effects of SMYD3 overexpression on 48 h after transfection. hTERT expression in the osteosarcoma cell line Saos2in which siRNA treatment. Chemically modified Stealth siRNA targeting SMYD3 (sequence: AAUCCUGUAUGGCUCCAUGGUCCGA) and control siRNA were hTERT is transcriptionally silent. hTERT mRNA was readily A purchased from Invitrogen. siRNA transfection was done using Lipofect- detectable in Saos2cells expressing ectopic SMYD3 (Fig. 1 ). AMINE 2000. These data show that SMYD3 positively regulates hTERT mRNA RNA extraction and reverse transcription-PCR. Total cellular RNA expression in human primary fibroblasts and cancer cells with a was extracted using an RNeasy total RNA isolation kit (Qiagen GmbH, repressed hTERT gene. Hilden, Germany). cDNA synthesis, reverse transcription-PCR primers, and SMYD3 expression is required for constitutive expression of h conditions for hTERT mRNA were described previously (13, 26). 2- hTERT mRNA and telomerase activity in telomerase-proficient Microglobulin mRNA expression was used as a control for RNA loading and cancer cells. SMYD3 is overexpressed in the majority of colorectal reverse transcription efficiency and was amplified with 24 cycles (20). PCR for both hTERT and h2-microglobulin mRNA was optimized to keep amplification in a linear phase, which allowed a semiquantitative evaluation for the level of hTERT transcripts as described (26). The PCR primers for SMYD3 mRNA are 5¶-GACTTCTTGGCAGAGTTGTC-3¶ (forward) and 5¶- GTGAAAGAGTTGCAGATCC-3¶ (reverse) as described (1). Western blot. Total cellular proteins were extracted with SDS lysis buffer, and 20 Ag of the protein were resolved by SDS-PAGE and transferred to an intracellular membrane. The membranes were probed with the antibody against SMYD3 (Abcam, Cambridge, United Kingdom) followed by anti-mouse horseradish peroxidase–conjugated IgG and developed with the enhanced chemiluminescent method (Amersham, Uppsala, Sweden). Telomerase activity assay. TeloTAGGG Telomerase PCR ELISA (Roche, Basel, Switzerland) based on telomeric repeat amplification protocol was used to determine telomerase activity in all samples in duplicate according to manufacturer’s protocol. One microgram of cellular proteins was added into PCR reaction, and 4 AL of products was used for ELISA assay (26). Luciferase activity assay. The hTERT luciferase reporter (hTERT-Luc p181) harbors the core promoter sequence of the hTERT 5¶-flanking region (27, 28). The targeting mutation of the hTERT-Luc p181 was made using a mutagenesis kit (Stratagene, La Jolla, CA). Cells cultured in 24-well plates were transfected with hTERT-Luc p181 or mutant variants and pcDNA- SMYD3 or pcDNA using LipofectAMINE 2000. A Renilla luciferase- containing plasmid, which is driven by thymidine kinase promoter, was always included in transfection to control transfection efficiency. Luciferase activity was determined by using a dual luciferase reporter assay system (Promega, Madison, WI) 48 h after transfection. The hTERT promoter– driven firefly luciferase activity was normalized to the thymidine kinase Renilla activity. Chromatin immunoprecipitation assay. Chromatin immunoprecipitation assay was carried out as described (20). Cells were cross-linked by incubating them in 1% (v/v) formaldehyde-containing medium for 10 min at 37jC and then sonicated to make soluble chromatin with DNA fragments between 200 and 1,000 bp. The antibodies against flag-tag (M2, Sigma, St. Louis, MO), trimethylated H3-K4, acetylated histone H3 (Upstate, Lake Placid, NY), c-MYC, and Sp1 (Santa Cruz Biotechnology, Santa Cruz, CA) were used to precipitate DNA fragments bound by their corresponding elements. The protein-DNA complex was collected with protein A or G- Sepharose beads (Upstate), eluted, and reverse cross-linked. Following a treatment with Protease K (Sigma), the samples were extracted with phenol-chloroform and precipitated with ethanol. The recovered DNA was resuspended in TE buffer and used for PCR amplification as described (20).

Figure 1. SMYD3 regulates hTERT expression in human primary fibroblasts Results and cancer cells. A, BJ,LF1,and Saos2 cells were transfected with pcDNA-SMYD3 or pcDNA vector for 48 h. Cells were harvested for reverse SMYD3 induces hTERT mRNA expression in human primary transcription-PCR using primer sets for hTERT,SMYD3,and h2-microglobulin and cancer cells lacking telomerase activity. Normal human (b2-M). B, reverse transcription-PCR analysis of hTERT mRNA expression in HCT116,Hep3B,and L1236 cells treated with siRNAs targeting SMYD3 or fibroblasts lack detectable telomerase activity due to the stringent control siRNA. The efficient knocking down of SMYD3 expression was hTERT gene repression and do not express endogenous SMYD3 verified by both reverse transcription-PCR and Western blot assessments. (1, 3, 10, 14). In an effort to investigate the effect of SMYD3 on C, semiquantitative telomeric repeat amplification protocol assay on the hTERT indicated cells transfected with SMYD3 siRNA. Columns, percentages of the gene expression, we ectopically expressed SMYD3 in BJ and inhibited telomerase activity in SMYD3 knocked down cells (compared with LF1 fibroblasts. As shown by the reverse transcription-PCR analysis control cells); Bars, SD. www.aacrjournals.org 2627 Cancer Res 2007; 67: (6). March 15, 2007

Figure 2. SMYD3 activates the hTERT promoter. A, sequence of the hTERT core promoter region. Five putative SMYD3 binding sites are underlined. Sequences that were mutated in the transcriptional activity analyses of cis-acting elements are indicated by dots,above which substituted nucleotides are indicated. À1 indicates the first nucleotide upstream of the transcription start site; arrow and 1 indicate the first nucleotide of the first exon. B and C, various amounts of SMYD3 expression vectors pcDNA-SMYD3 were cotransfected with wild-type (WT) hTERT-Luc p181 or mutant reporter plasmid (MT1-MT5) into Saos2 cells. Variation in transfection efficiency was normalized by the thymidine kinase–driven Renilla luciferase activity. Columns, relative luciferase activity; bars, SD. D, wild-type or SMYD3 motif mutant hTERT promoter activity in HCT116, Hep3B,and L1236 cells. Columns, mean; bars, SD.

carcinoma and hepatocellular carcinoma (1), whereas constitutive (Fig. 1B and C). Collectively, SMYD3 is required for constitutive expression of hTERT and telomerase is also observed in most of hTERT expression and telomerase activity in colorectal carcinoma, these tumors (29). Thus, we further asked whether SMYD3 was hepatocellular carcinoma, and Hodgkin’s lymphoma cell lines required for constitutive hTERT mRNA expression. For this examined. purpose, we knocked down SMYD3 expression with specific SMYD3 activates the hTERT promoter. To determine SMYD3 siRNAs in human colorectal carcinoma HCT116 and whether SMYD3 up-regulates hTERT expression at the transcrip- hepatocellular carcinoma Hep3B cell lines. The efficient silencing tional level, we examined the effect of SMYD3 on the hTERT of SMYD3 expression was verified by both reverse transcription- promoter activity. SMYD3 is known to bind to a putative motif PCR and Western blot analyses, and a significant reduction in CCCTCC in its target promoters (1). Interestingly, we identified hTERT mRNA was seen following the inhibition of SMYD3 five potential SMYD3 binding sites CCCTCC within the hTERT expression in these cells (Fig. 1B). Consistent with down-regulation core promoter region (Fig. 2A). Cotransfection of the SMYD3 of hTERT expression, telomerase activity decreased substantially in expression vector with a luciferase reporter driven by the hTERT HCT116 and Hep3B cells treated with SMYD3 siRNA, as determined core promoter sequence (hTERT-Luc p181) into the telomerase- using a semiquantitative, telomeric repeat amplification protocol– negative cell line Saos2led to f100% increase in reporter gene based telomerase ELISA kit (Fig. 1C). activity in a dose-dependent manner (Fig. 2B). Through In addition, because the transcription factor E2F-1 is involved in substitution mutation of each SMYD3 binding site (MT1–MT5), the transcriptional activation of SMYD3, and because Hodgkin’s we found that two of them (MT3 and MT5) were important for lymphoma cell lines have high E2F-1 expression (3, 30), we sought the transcriptional activity of the hTERT gene, and disruption of to define the relationship between expression of SMYD3 and them did not only abolish SMYD3-mediated increases in hTERT- hTERT in a Hodgkin’s cell line L1236. As expected, SMYD3 mRNA Luc p181 activity but also resulted in a significant reduction in and protein was detected in L1236 cells (Fig. 1B). Knocking down baseline of the hTERT promoter activity (Fig. 2C). In contrast, the SMYD3 expression similarly resulted in diminished hTERT mutation of remaining three CCCTCC motifs (MT1, MT2, and expression accompanied by a decline in telomerase activity MT4) affected neither the response of hTERT-Luc p181 to SMYD3

Cancer Res 2007; 67: (6). March 15, 2007 2628 www.aacrjournals.org

(Fig. 2C) nor its basic activity, indicating that they were nonfunctional motifs for SMYD3. The wild-type hTERT-Luc p181 and its mutant variants were then transfected into HCT116, Hep3B, and L1236 cells for further evaluation. The MT3 mutant reporters exhibited significantly lower luciferase activity compared with wild-type hTERT-Luc p181 in all the three cell lines (Fig. 2D). The activity of the reporter with MT5 also declined although varying from cell line to cell line (Fig. 2D). These results were highly consistent with inhibitory effects of SMYD3 knocking down on constitutive hTERT mRNA expression in HCT116, Hep3B, and L1236 cells. However, cotransfection with pcDNA-SMYD3 only slightly increased the wild-type hTERT-Luc p181 activity in HCT116 and Hep3B cells, whereas it had no effects in L1236 cells (Fig. 2D). This was not surprising because all the three cell lines expressed endogenous SMYD3 that may already be saturated. SMYD3 is associated with the hTERT promoter. Having shown the presence of two functional SMYD3 binding sites on the hTERT core promoter, we next examined the ability of this region to in vivo interact directly with SMYD3 using chromatin Figure 4. SMYD3 knocking down abolished the trimethylation of H3-K4 in the immunoprecipitation assay. Because the commercially available hTERT promoter region that was accompanied by impaired Sp1 and c-MYC binding and diminished histone H3 acetylation at the hTERT promoter. The SMYD3 antibody was not qualified for chromatin immunoprecip- chromatin immunoprecipitation assay for histone H3 trimethylation,acetylation, itation analysis (data not shown), we transiently transfected Saos2 Sp1 and c-MYC occupancy at the hTERT promoter was done on HCT116 and cells with the Flag-tagged SMYD3 expression vector and did L1236 cells treated with the SMYD3 siRNA or control siRNA. chromatin immunoprecipitation assay using an anti-Flag antibody (M2). The primers encompassing the two functional SMYD3 transcriptional activation of its target genes by dimethylating or binding elements in the hTERT proximal promoter were used for trimethylating H3-K4 in their promoter regions (1), we sough to PCR amplification as described (20). As shown in Fig. 3, Flag-tagged determine whether the level of SMYD3 expression affected SMYD3 was bound to the hTERT promoter containing the SMYD3 methylation patterns of H3-K4 at the hTERT promoter. We binding motifs. This specific interaction was verified by the knocked down SMYD3 expression in HCT116 and L1236 cells absence of specific sequence amplifications when omission of using siRNA and then examined alterations in H3-K4 trimethyla- antibodies was applied for chromatin immunoprecipitation, or tion in the hTERT promoter region by chromatin immunoprecip- when primers for the unrelated GAPDH gene were used in the PCR itation assay. As shown in Fig. 4, H3-K4 trimethylation was reaction. abolished in the hTERT core promoter region when SMYD3 SMYD3 inhibition leads to diminished trimethylation of expression was inhibited. Similar reduction of trimethylated H3-K4 histone H3-K4 in the hTERT promoter. Because SMYD3 induces at the hTERT promoter was observed in Hep3B cells treated with SMYD3 siRNA (data not shown). These data suggest that SMYD3 is responsible for trimethylation of H3-K4 in the hTERT promoter region. Hypo-trimethylated H3-K4 at the hTERT promoter leads to defects in binding the transcription factors c-MYC and Sp1 and in maintaining histone H3 acetylation. Because H3-K4 methylation alters chromatin folding that in turn contributes to increased accessibility of DNA to transcription factors and provides specific binding sites for certain proteins including histone acetyltransferases, we wanted to determine whether the abolished H3-K4 trimethylation affected the occupancy of the transcription factors c-MYC and Sp1, two essential trans- activators for the hTERT gene, on the hTERT promoter in the SMYD3-silent cells. The chromatin immunoprecipitation assay showed that both c-MYC and Sp1 were present at the hTERT promoter in control HCT116 cells, whereas they absent in the same cells with SMYD3 knocking down (Fig. 4). Moreover, histone H3 acetylation at the hTERT promoter was detected in the control cells but not in the cells treated with SMYD3 siRNA. The diminished or abolished Sp1 occupancy and histone H3 acetyla- Figure 3. In vivo interaction between SMYD3 and the hTERT promoter. tion at the hTERT promoter were similarly observed in L1236 cells A, schematic presentation of the hTERT promoter and PCR primer locations treated with the SMYD3 siRNA. However, we failed to detect the (relative to ATG) for chromatin immunoprecipitation assay. E-boxes and SMYD3 presence of c-MYC on the hTERT promoter in L1236 cells, likely motifs are indicated. B, in vivo binding of SMYD3 to the hTERT promoter in Saos2 cells overexpressing SMYD3. Chromatin immunoprecipitation assay was because these cells predominantly express L-MYC that competes done as described in Materials and Methods. for E-boxes with c-MYC (31). www.aacrjournals.org 2629 Cancer Res 2007; 67: (6). March 15, 2007

Discussion Recent identification of histone methylases and demethylases has led to the conclusion that histone methylation is a dynamic process and, like other histone modifications, governs chromatin structure and transcription of the cell (5, 6, 9). There are a number of lysine residuals in the histone NH2 termini that are prominently methylated, and the methylation of different residuals leads to either repression or activation of genes (5, 6, 9). For instance, H3-K4 methylation is a prevalent mark associated with transcription activation. Several mammalian SET-domain containing proteins are capable of methylating H3-K4. However, compared with all other histone methyltransferases, SMYD3 is unique because it not only has methyltransferase activity but also specifically binds to a DNA sequence CCCTCC in its target promoters as do transcription factors (1). In the study presented here, we have observed that SMYD3 induces hTERT transcription by directly binding to the hTERT promoter and affecting abundance of trimethylated H3-K4 associated with the hTERT chromatin. This finding thus reveals the hTERT gene as a direct target of SMYD3. Given the fact that Figure 5. A model for the SMYD3-mediated histone H3 methylation functioning hTERT/telomerase plays key parts in cellular immortalization and as a licensing factor for the hTERT gene transcription. In hTERT-silent cells,the hTERT chromatin is hypomethylated/acetylated,and its transcription is thus transformation, the identification of hTERT as a target of SMYD3 repressed. SMYD3 binding to the hTERT promoter leads to increased H3 might gain new insights into SMYD3-mediated oncogenic activity. trimethylation,a critical event that recruits histone acetyltransferases ( HAT)and Interestingly, the disruption of the functional SMYD3 binding promotes Sp1 and c-MYC access to the hTERT promoter. Sp1 and c-MYC further recruit more histone acetyltransferases that in turn catalyze more H3 motifs in the hTERT core promoter led to a significant reduction in acetylation. These sequential events finally lead to transcriptional activation of promoter activity. This, together with down-regulation of hTERT the hTERT gene. mRNA caused by silencing SMYD3 expression in tumor cells, strongly suggests that the basic or constitutive hTERT expression when SMYD3 was knocked down, hTERT expression and telomerase depends heavily on the presence of SMYD3 in the examined cells. activity were inhibited in these cells. Maintenance of H3-K4 trimethylation by SMYD3 should be crucial It is evident from the present study that SMYD3 increases for the constitutive transcription of the hTERT gene. It has been trimethylation of H3-K4 in the hTERT promoter, thereby trans- proposed that methylated H3-K4 affects chromatin folding through activating the hTERT gene. However, SMYD3 is unlikely the sole a non-electrostatic mechanism (5, 32). More importantly, methyl- histone methyltransferase responsible for the trimethylation of H3-K4 ated H3-K4 could serve as a specific binding site of proteins or at the hTERTchromatin because certain cells such as HEK293 express protein complexes mediating transcription activation. Furthermore, undetectable SMYD3 but contain high levels of hTERT mRNA and a recent study showed that high H3-K4 methylation was one of the telomerase activity (1).4 It thus remains to be determined whether strict prerequisites for recognition of any target site by the c-Myc different histone methyltransferases are associated with the hTERT oncoprotein (33). Consistent with these observations, we found chromatin in different types of cells. In addition, H3-K4 methylation impaired occupancy of the transcription factors c-MYC and Sp1 on and demethylation are associated with transcriptional activation and the hTERT promoter and diminished histone H3 acetylation repression of the hTERT gene, respectively (25). It will be highly following SMYD3 silencing and subsequent inhibition of H3-K4 interesting to elucidate which demethylases occupy the hTERT trimethylation in the examined cancer cells. It is well established promoter and maintain H3-K4 demethylation in normal somatic cells that the transcription factors c-MYC and Sp1 play a key role in lacking hTERT expression. Our preliminary results showed that activation of the hTERT gene transcription (10, 14). Thus, by inhibition of LSD1, a newly identified histone demethylase, indeed governing the access of positive transcription factors to and histone induced hTERT expression and activated the hTERT promoter in acetylation at the hTERT promoter, SMYD3-mediated H3-K4 human fibroblasts and cancer cells. Collectively, delineation of the methylation may function as a critical licensing element through relationship between H3-K4 methylation/demethylation and hTERT which the trans-activation of the hTERT gene is initiated (Fig. 5). expression might contribute to profound insights into mechanisms Deregulation of the E2F family members occurs in most human underlying telomerase activation during the oncogenic process. cancers through different mechanisms (34), and it has been shown that E2F-1 represses the hTERT transcription in tumor cells (35, 36). Acknowledgments Not withstanding this, up to 90% of human malignancies express high hTERT Received 11/8/2006; revised 12/11/2006; accepted 12/28/2006. levels of telomerase activity (10, 14, 29). It is unclear how the Grant support: Swedish Cancer Society, Cancer Society in Stockholm, Swedish gene escapes from E2F1-mediated repression in cancer cells with Research Council, Swedish Medical Society, Karolinska Institute Funds (D. Xu), high E2F1 activity. A recent study showed that E2F-1 was involved National Natural Science Foundation of China grant 30540009 (X. Fang), and Dutch Cancer Foundation (M. Jalink). in the transcriptional activation of SMYD3, and a variable number The costs of publication of this article were defrayed in part by the payment of page of tandem repeat polymorphism in an E2F-1 binding element in the charges. This article must therefore be hereby marked advertisement in accordance 5¶ flanking region of SMYD3 was a risk factor for human cancers (3). with 18 U.S.C. Section 1734 solely to indicate this fact. We thank Drs. Nakamura and Furukawa (University of Tokyo) for providing the It is thus likely that E2F-1 drives a higher expression of SMYD3 that SMYD3 expression plasmid. in turn compensates for an inhibitory effect of E2F-1 on the hTERT transcription. Indeed, we found abundant amounts of SMYD3 in the E2F1-overexpressing Hodgkin’s lymphoma cell line L1236, and 4 C. Liu and D. Xu, unpublished data.

Cancer Res 2007; 67: (6). March 15, 2007 2630 www.aacrjournals.org

References viral oncogenic mechanisms. Carcinogenesis 2003;24: lengthening of telomere cells is associated with 1167–76. chromatin remodeling of the hTR and hTERT gene 1. Hamamoto R, Furukawa Y, Morita M, et al. SMYD3 15. Lai SR, Phipps SM, Liu L, Andrews LG, Tollefsbol TO. promoters. Cancer Res 2005;65:7585–90. encodes a histone methyltransferase involved in the Epigenetic control of telomerase and modes of telomere 26. Xu D, Gruber A, Peterson C, Pisa P. Telomerase proliferation of cancer cells. Nat Cell Biol 2004;6:731–40. maintenance in aging and abnormal systems. Front activity and the expression of telomerase components in 2. Hamamoto R, Silva FP, Tsuge M, et al. Enhanced Biosci 2005;10:1779–96. acute myelogenous leukaemia. Br J Haematol 1998;102: SMYD3 expression is essential for the growth of breast 16. Xu D, Popov N, Hou M, et al. Switch from Myc/Max 1367–75. cancer cells. Cancer Sci 2006;97:113–8. to Mad1/Max binding and decrease in histone acetyla- 27. Takakura M, Kyo S, Kanaya T, et al. Cloning of human 3. Tsuge M, Hamamoto R, Silva FP, et al. A variable tion at the telomerase reverse transcriptase promoter telomerase catalytic subunit (hTERT) gene promoter number of tandem repeats polymorphism in an E2F-1 during differentiation of HL60 cells. Proc Natl Acad Sci and identification of proximal core promoter sequences binding element in the 5¶ flanking region of SMYD3 is a U S A 2001;98:3826–31. essential for transcriptional activation in immortalized risk factor for human cancers. Nat Genet 2005;37:1104–7. 17. Cong YS, Bacchetti S. Histone deacetylation is and cancer cells. Cancer Res 1999;59:551–7. 4. Xu JY, Chen LB, Yang Z, Wei HY, Xu RH. Inhibition of involved in the transcriptional repression of hTERT in 28. Kyo S, Takakura M, Taira T, et al. Sp1 cooperates with SMYD3 gene expression by RNA interference induces normal human cells. J Biol Chem 2000;275:35665–8. c-Myc to activate transcription of the human telomerase apoptosis in human hepatocellular carcinoma cell line 18. Hou M, Wang X, Popov N, et al. The histone reverse transcriptase gene (hTERT). Nucleic Acids Res HepG2. Ai Zheng 2006;25:526–32. deacetylase inhibitor trichostatin A derepresses the 2000;28:669–77. 5. Martin C, Zhang Y. The diverse functions of histone telomerase reverse transcriptase (hTERT) gene in 29. Shay JW, Bacchetti S. A survey of telomerase activity lysine methylation. Nat Rev Mol Cell Biol 2005;6:838–49. human cells. Exp Cell Res 2002;274:25–34. in human cancer. Eur J Cancer 1997;33:787–91. 6. Strahl BD, Allis CD. The language of covalent histone 19. Takakura M, Kyo S, Sowa Y, et al. Telomerase 30. Nagel S, Scherr M, Quentmeier H, et al. HLXB9 modifications. Nature 2000;403:41–5. activation by histone deacetylase inhibitor in normal activates IL6 in Hodgkin lymphoma cell lines and is 7. Pokholok DK, Harbison CT, Levine S, et al. Genome- cells. Nucleic Acids Res 2001;29:3006–11. regulated by PI3K signalling involving E2F3. Leukemia wide map of nucleosome acetylation and methylation in 20. Ge Z, Liu C, Bjorkholm M, Gruber A, Xu D. Mitogen- 2005;19:841–6. yeast. Cell 2005;122:517–27. activated protein kinase cascade-mediated histone H3 31. Schwering I, Brauninger A, Distler V, et al. Profiling of 8. Pray-Grant MG, Daniel JA, Schieltz D, Yates JR, Grant phosphorylation is critical for telomerase reverse Hodgkin’s lymphoma cell line L1236 and germinal PA. Chd1 chromodomain links histone H3 methylation transcriptase expression/telomerase activation induced center B cells: identification of Hodgkin’s lymphoma- with SAGA- and SLIK-dependent acetylation. Nature by proliferation. Mol Cell Biol 2006;26:230–7. specific genes. Mol Med 2003;9:85–95. 2005;433:434–8. 21. Kumakura S, Tsutsui TW, Yagisawa J, Barrett JC, 32. Hansen JC. Conformational dynamics of the chro- 9. Wysocka J, Swigut T, Milne TA, et al. WDR5 associates Tsutsui T. Reversible conversion of immortal human matin fiber in solution: determinants, mechanisms, and with histone H3 methylated at K4 and is essential for H3 cells from telomerase-positive to telomerase-negative functions. Annu Rev Biophys Biomol Struct 2002;31: K4 methylation and vertebrate development. Cell 2005; cells. Cancer Res 2005;65:2778–86. 361–92. 121:859–72. 22. Liu L, Saldanha SN, Pate MS, Andrews LG, Tollefsbol 33. Guccione E, Martinato F, Finocchiaro G, et al. Myc- 10. Cong YS, Wright WE, Shay JW. Human telomerase and TO. Epigenetic regulation of human telomerase reverse binding-site recognition in the human genome is its regulation. Microbiol Mol Biol Rev 2002;66:407–25. transcriptase promoter activity during cellular differen- determined by chromatin context. Nat Cell Biol 2006;8: 11. Shay JW, Zou Y, Hiyama E, Wright WE. Telomerase tiation. Genes Chromosomes Cancer 2004;41:26–37. 764–70. and cancer. Hum Mol Genet 2001;10:677–85. 23. Wang S, Zhu J. The hTERT gene is embedded in a 34. Bell LA, Ryan KM. Life and death decisions by E2F-1. 12. Meyerson M, Counter CM, Eaton EN, et al. hEST2, the nuclease-resistant chromatin domain. J Biol Chem 2004; Cell Death Differ 2004;11:137–42. putative human telomerase catalytic subunit gene, is 279:55401–10. 35. Won J, Yim J, Kim TK. Opposing regulatory roles of up-regulated in tumor cells and during immortalization. 24. Won J, Chang S, Oh S, Kim TK. Small-molecule-based E2F in human telomerase reverse transcriptase (hTERT) Cell 1997;90:785–95. identification of dynamic assembly of E2F-pocket gene expression in human tumor and normal somatic 13. Nakamura TM, Morin GB, Chapman KB, et al. protein-histone deacetylase complex for telomerase cells. FASEB J 2002;16:1943–5. Telomerase catalytic subunit homologs from fission regulation in human cells. Proc Natl Acad Sci U S A 36. Crowe DL, Nguyen DC, Tsang KJ, Kyo S. E2F-1 yeast and human. Science 1997;277:955–9. 2004;101:11328–33. represses transcription of the human telomerase 14. Horikawa I, Barrett JC. Transcriptional regulation of 25. Atkinson SP, Hoare SF, Glasspool RM, Keith WN. reverse transcriptase gene. Nucleic Acids Res 2001;29: the telomerase hTERT gene as a target for cellular and Lack of telomerase gene expression in alternative 2789–94.

www.aacrjournals.org 2631 Cancer Res 2007; 67: (6). March 15, 2007

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2007 American Association for Cancer Research. The Telomerase Reverse Transcriptase (hTERT) Gene Is a Direct Target of the Histone Methyltransferase SMYD3

Cheng Liu, Xiaolei Fang, Zheng Ge, et al.

Cancer Res 2007;67:2626-2631.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/67/6/2626

Cited articles This article cites 36 articles, 10 of which you can access for free at: http://cancerres.aacrjournals.org/content/67/6/2626.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/67/6/2626.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/67/6/2626. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.