Ku DNA End-Binding Activity Promotes Repair Fidelity and Inﬂuences End-Processing During Nonhomologous End-Joining in Saccharomyces Cerevisiae

Home , DNA end resection, Homology directed repair, Ku (protein)

| INVESTIGATION

Ku DNA End-Binding Activity Promotes Repair Fidelity and Inﬂuences End-Processing During Nonhomologous End-Joining in Saccharomyces cerevisiae

Charlene H. Emerson,*,† Christopher R. Lopez,*,1 Albert Ribes-Zamora,*,2 Erica J. Polleys,*,3 Christopher L. Williams,† Lythou Yeo,* Jacques E. Zaneveld,*,4 Rui Chen,* and Alison A. Bertuch*,†,5 *Department of Molecular and Human Genetics and †Department of Pediatrics, Baylor College of Medicine, Houston, Texas 77030 ORCID ID: 0000-0003-1864-8502 (A.A.B.)

ABSTRACT The Ku heterodimer acts centrally in nonhomologous end-joining (NHEJ) of DNA double-strand breaks (DSB). Saccharomyces cerevisiae Ku, like mammalian Ku, binds and recruits NHEJ factors to DSB ends. Consequently, NHEJ is virtually absent in yeast Ku null (yku70D or yku80D) strains. Previously, we unexpectedly observed imprecise NHEJ proficiency in a yeast Ku mutant with impaired DNA end-binding (DEB). However, how DEB impairment supported imprecise NHEJ was unknown. Here, we found imprecise NHEJ proficiency to be a feature of a panel of DEB-impaired Ku mutants and that DEB impairment resulted in a deficiency in precise NHEJ. These results suggest that DEB-impaired Ku specifically promotes error-prone NHEJ. Epistasis analysis showed that classical NHEJ factors, as well as novel and previously characterized NHEJ-specific residues of Ku, are required for the distinct error-prone repair in a Ku DEB mutant. However, sequencing of repair junctions revealed that imprecise repair in Ku DEB mutants was almost exclusively characterized by small deletions, in contrast to the majority of insertions that define imprecise repair in wild-type strains. Notably, while sequencing indicated a lack of Pol4-dependent insertions at the site of repair, Pol2 exonuclease activity, which mediates small deletions in NHEJ, contributed to imprecise NHEJ in a Ku DEB mutant. The deletions were smaller than in Ku-independent microhomology-mediated end- joining (MMEJ) and were neither promoted by Mre11 nuclease activity nor Sae2. Thus, the quality of Ku’s engagement at the DNA end influences end-processing during NHEJ and DEB impairment unmasks a Ku-dependent error-prone pathway of end-joining distinct from MMEJ.

KEYWORDS Ku; nonhomologous end-joining; end-processing; repair ﬁdelity; Saccharomyces cerevisiae

NA double-strand breaks (DSBs) are a major threat to (HDR) pathways, or in a template-independent manner, as in Dgenome integrity. In the absence of effective DSB repair, nonhomologous end-joining (NHEJ). Despite the absence of a cells are at risk of death or aberrant repair that can lead to homologoustemplate,NHEJispredominantlyaccurate(Moore malignant transformation. DSBs are repaired in either a and Haber 1996; Chen et al. 2001; Bahmed et al. 2010; Jiang template-dependent manner, as in homology-directed repair et al. 2013), suggesting that NHEJ factors function to regulate repair ﬁdelity.

Copyright © 2018 Emerson et al. The core NHEJ factors are conserved throughout eukary- doi: https://doi.org/10.1534/genetics.117.300672 otes and, in Saccharomyces cerevisiae, consist of the Ku heter- Manuscript received December 28, 2017; accepted for publication February 25, 2018; odimer, Dnl4, Lif1, and Nej1. Ku attracted early attention as a published Early Online March 2, 2018. Supplemental material is available online at www.genetics.org/lookup/suppl/doi:10. potential regulator of NHEJ ﬁdelity due to its observed effects 1534/genetics.117.300672/-/DC1. on NHEJ efﬁciency and precision (Boulton and Jackson 1Present address: Department of Microbiology and Molecular Genetics, University of Texas Health Science Center at Houston, Houston, TX 77030. 1996; Feldmann et al. 2000; Chen et al. 2001). In particular, 2Present address: Department of Biology, University of St. Thomas, Houston, TX Ku’s quasi-symmetrical ring-shaped structure and stable 77006. 3Present address: Department of Biology, Tufts University, Medford, MA 02155. sequence-independent DNA end-binding (DEB) were cited 4Present address: Lazarus 3D LLC, 2300 Old Spanish Trail #1125, Houston, TX in several early models proposing that Ku supported and 77054. 5Corresponding author: Texas Children’s Hospital, 1102 Bates, FC 1200, Houston, TX aligned DSB ends across the repair junction, promoting repair 77030. E-mail: [email protected] accuracy (Boulton and Jackson 1996; Feldmann et al. 2000;

Genetics, Vol. 209, 115–128 May 2018 115 Walker et al. 2001). Later work revealed two important roles Materials and Methods for Ku in NHEJ. The first is to protect double-stranded DNA Yeast strains and plasmids (dsDNA) ends from the resection required to form single- stranded DNA substrates for HDR (Clerici et al. 2008; All strains used in this study are derivatives of JKM139 (Lee Mimitou and Symington 2010). The second is to recruit and et al. 1998); descriptions are provided in Supplemental stabilize canonical NHEJ (c-NHEJ) factors at the repair syn- Material, Table S1 in File S2. Null mutations were constructed apse (Zhang et al. 2007; Wu et al. 2008; Chen and Tomkinson by one-step allele replacement with the indicated selectable 2011). marker. Integration of mutant alleles was performed as pre- As noted above, Ku’s channel-shaped structure has pro- viously described (Rothstein 1991). YAB974 and YAB975 vided insight to its manifold cellular functions. In addition mre11D strains were generated by one-step allele replace- to protectively binding DNA ends and serving as a scaffold for ment, followed by serial streak-outs to achieve senescence complex assembly in NHEJ, Ku plays other roles in preserving and survivor formation, according to the rationale provided genome integrity, particularly at telomeres. In S. cerevisiae, in the Results section. Plasmids used in this study are de- these roles contribute to telomere length maintenance, tran- scribed in Table S2 in File S2. The previously unpublished scriptional silencing of telomere proximal genes, and nuclear mutants were obtained from a collection of 144 yku70 and positioning of telomeres (Fisher and Zakian 2005). Separation- 123 yku80 mutant alleles, which were mostly novel. The of-function mutants and structural studies of Ku have made residues were chosen for mutagenesis based on predicted important progress in associating specific structural regions surface localization, charge, or potential for post-translational of Ku with its varied biological functions (Driller et al. 2000; modification. Mutations were constructed using single-stranded Bertuch and Lundblad 2003; Stellwagen et al. 2003; Roy mutagenesis as previously described (Ribes-Zamora et al. et al. 2004; Palmbos et al. 2005; Ribes-Zamora et al. 2007; 2007). The entire collection was screened for telomeric Lopez et al. 2011), yet questions remain regarding the con- function and imprecise NHEJ (manuscript in preparation), tributions of Ku to NHEJ. For example, the resulting structure of and those that phenocopied the yku70-R456E mutant the Ku-DNA end complex, with a cradle-like base and a narrow allele and the NHEJ-specific yku70-E304K allele are in- bridge forming the top of the DNA-binding channel (Walker et al. cluded in this study. Strains and plasmids are available 2001), has been suggested to facilitate access of DNA-processing upon request. enzymes(DownsandJackson2004), highlighting a potentially fi underrecognized role for Ku in regulating NHEJ accuracy. NHEJ pro ciency assays NHEJ fidelity cannot be fully understood without consid- The imprecise and precise NHEJ assays have been previously ering the role of end-processing enzymes. End-processing described in detail (Moore and Haber 1996; Lee et al. 1998). factors modify repair junctions with a variety of enzymatic Briefly, for the imprecise NHEJ assays, 2TRP or YPD preinduc- activities, including polymerase gap-filling and exonucleolytic tion cultures for TRP plasmid or integrated mutant strains, trimming, which can result in nucleotide insertions and de- respectively,weredilutedandplatedon2%galactose-or letions, respectively.Regulation of these factors is a key aspect glucose-containing media and incubated for 4 days at 28°. of NHEJ because they have the potential to disrupt nucleotide For the G1 imprecise NHEJ assay, strains were grown over- sequence at the repair junction. Nonetheless, end-processing night in a 2URA preinduction culture to maintain URA plas- regulation in NHEJ is poorly understood, in large part due to mids, then washed in sterile water, diluted, and plated on 2% the redundant and overlapping functions of numerous pro- galactose- or glucose-containing –URA media and incubated cessing factors (Emerson and Bertuch 2016; Rulten and for 4 days at 28°. For precise NHEJ assays, cells were cultured Grundy 2017). in YPD (106 cells/ml), then galactose was added to 2% to We previously characterized a YKU70 mutation, yku70- induce HO for 1.5 hr. After induction, diluted samples were R456E, as severely defective for telomere functions, but pro- plated onto YPD plates to repress HO and incubated for 4 days ficient for error-prone, or imprecise, NHEJ (Lopez et al. at 28°. Uninduced controls were diluted and plated on YPD 2011). In this study, prompted by the imprecise NHEJ pro- plates for 4 days at 28°.Quantification of survival for all NHEJ ficiency observed in the yku70-R456E mutant, we draw a assays was performed as described in the figure legends. direct connection between Ku DEB activity and end-processing Chromatin immunoprecipitation (ChIP) and quantitative during NHEJ in S. cerevisiae.Ourfindings lead us to propose PCR (qPCR) that Ku’s stable and flexible DEB activity regulates end- processing activity and promotes repair fidelity by facilitating We performed ChIP as previously described (Zhang et al. NHEJ complex formation at the DSB. Impairment of Ku’s 2007), with modifications. Briefly, tandem affinity FLAG DEB activity results in a dysfunctional repair synapse that (TAF)-tagged Yku70 strains were grown to log phase in yeast precludes insertions and necessitates flap-trimming before peptone-raffinose media and then HO expression was in- ligation, resulting in a characteristic repair pattern of small duced by addition of 2% galactose. Before break induction deletions. Our results highlight an important role for canonical and 2 hr postinduction, 40 ml of culture were collected. For Ku DEB in repair synapse formation and DSB end-processing in each collection, in vivo cross-linking was performed by addi- NHEJ. tion of 1% formaldehyde. Cross-linking was quenched by

116 C. H. Emerson et al. addition of glycine to 125 mM and samples were washed Valencia, CA) and pooled. The mixture was subjected to Illu- with 1 M sorbitol. Cells were then lysed using glass beads mina HiSequation 100-bp paired-end sequencing at the Human and FA lysis buffer with PMSF (Sigma [Sigma Chemical], Genome Sequencing Center at Baylor College of Medicine. St. Louis, MO) and Set III protease inhibitors (Calbiochem, Reads were aligned to the original uncut sequence at the MAT San Diego, CA), followed by sonication to yield 0.5-kb frag- locus, including 50-bp upstream and 66-bp downstream of ments of DNA (Diagenode Bioruptor). Extracts were divided the cut site (59-aatgattaaaatagcatagtcgggtttttcttttagtttcagctttccg into input and immunoprecipitation (IP) samples, and 100– cAACAGtaaaattttataaaccctggttttggttttgtagagtggttgacgaataat 200 mg of IP-designated protein extract was incubated with tatgctgaagtacgt-39) using blat (Bazinet 2009). Using this region 60 ml magnetic FLAG bead slurry (Sigma), rotating overnight allowed for the ends of the reads, which are less accurate, to not at 4°. After cross-link reversal, proteinase K digestion, and be considered during alignment. Following alignment for each ethanol precipitation (Sugawara et al. 2003), 20 ng DNA sample, the number and percentage of reads matching the un- was amplified by qPCR using a StepOnePlus system (Thermo- cut sequence were segregated. Reads not matching the original Fisher) and Perfecta SYBR Green FastMix, ROX (Quanta Bio- sequence were grouped based on location (upstream, down- sciences), according to the manufacturer’s standard protocol. stream, internal to, or extending beyond the HO recognition site) MAT proximal (59-CCAAGCACGGGCATTTTTAGAACAG-39 and and size (number of nucleotides deleted or inserted) of muta- 59-TATTACATACCCAAACTCTTACTTG-39)andPRE1 primers tion using a custom code (https://github.com/chemersonBCM/ (59-CCCACAAGTCCTCTGATTTACATTCG-39 and 59-GGAATT NHEJseq). Using this analysis, relative frequencies of small inser- CACCGCATGGTTTTCATAAGAG-39) were used to determine re- tion and deletion events were recorded. cruitment of TAF-Yku70 to the DSB locus as previously Southern blot resection assay described (Zhang et al. 2007). The resection assay was performed as previously described Analysis of telomere length (Zhu et al. 2008). Genomic DNA isolated at each time point Telomere length analysis by Southern blot was done as pre- was digested with EcoRI and separated by gel electrophore- viously described using XhoI digestion and a telomere repeat- sis. Southern blots were hybridized with radiolabeled DNA containing radiolabeled probe (Bertuch and Lundblad 2003; probes to MAT, to detect DSB induction and end resection, Lopez et al. 2011). and TRA1, which allowed for normalization of DNA loading. Quantification was performed with ImageQuant (Amersham, Electrophoretic mobility shift assay (EMSA) Piscataway, NJ). Resection for each time point was estimated EMSA was performed as previously described (Lopez et al. as a percentage of signal corresponding to the fragment of 2011). In brief, yeast whole-cell extracts were prepared from interest at 1 hr after DSB induction. 5 ml cultures using glass beads and lysis buffer (420 mM KCl, Data availability 42 mM HEPES, 4.2 mM EDTA, and 0.1 mM DTT). An equiv- alent amount of protein from each lysate (between 10 and All strains (Table S1 in File S2) and plasmids (Table S2 in File 15 mg for a given experiment) was incubated with 1.5 ng of a S2) used in the study are available upon request. Oligonucle- 32P end-labeled 198 linear blunt-ended DNA fragment, de- otide sequences are provided in the Materials and Methods for rived from pcDNA3.1 (Invitrogen, Carlsbad, CA) by BglII and the relevant experiments. NruI digestion and Klenow fragment fill-in, and 1 mg of circular pcDNA3.1 for 15 min at room temperature. Samples Results were run at 30 mA for 45 min on a 5% polyacrylamide gel Identification of a class of Yku70/Yku80 DEB mutants in Tris-glycine buffer. After drying the gel, it was exposed to a proficient for imprecise end-joining phosphorimager screen and analyzed using a Storm865 im- aging system (Molecular Dynamics). The unexpected efficiency of imprecise NHEJ observed in the yku70-R456E mutant led us to question whether this was due Sequencing of NHEJ repair junctions to an anomalous gain-of-function or if it was more generally Galactose media plates generated by the imprecise NHEJ an outcome of impaired Ku DEB function. To address this, we assay, described above, were selected for next-generation interrogated a large yku70 and yku80 mutant collection (see sequencing if they had 400–600 evenly sized colonies. Materials and Methods) for those that phenocopied the Colonies from the plate were pooled and genomic DNA was yku70-R456E mutant with respect to global telomere dys- extracted. Primers containing Illumina paired-end sequenc- function and imprecise NHEJ proficiency (Lopez et al. ing adapters were designed to flank the HO DSB site and used 2011). The telomere defects included short telomeres, loss to PCR amplify genomic DNA (59-ccctacacgacgctcttccgatctG of telomeric silencing, and loss of telomere end protection. TATGAGATCTAAATAAATTCGTTTTC-39 and 59-gtgactggagtt End protection defects were identified by synthetic lethality cagacgtgtgctcttccgatctCACATCTTCCCAATATCCGTCACC-39). with deletion of TLC1, which codes for the telomerase RNA A subsequent PCR using 10 ng amplification products was used subunit (Bertuch and Lundblad 2004). As with our previous to attach unique index sequences to the amplification product. analysis of yku70-R456E (Lopez et al. 2011), imprecise NHEJ Indexed products from all samples were purified (QIAGEN, proficiency was determined using a yeast haploid strain that

Role of Ku DNA Binding in DNA Repair 117 Figure 1 Identification of a class of Ku DEB mutants that are proficient for imprecise end-joining and defective for telomere function. (A) Serial dilutions of DEB mutants in tlc1D synthetic lethality and imprecise NHEJ assays. Plasmids (CEN TRP1) containing WT YKU70 or YKU80, the indicated yku70 or yku80 mutations, or empty vector, were trans- formed into a yku70D or yku80D NHEJ assay strain that also con- tained tlc1D/pTLC1 URA3 (see Ta- ble S1 in File S2). The strains were spotted onto –Trp –Ura plates to determine plating efficiency (TLC1 –HO), -Trp 5FOA plates to assay synthetic lethality in the absence of telomerase (tlc1D), and –Trp –Ura plus galactose plates to assay error-prone NHEJ (+HO). (B) Quantitative imprecise NHEJassaywithYku80DEBmutants, using strains of the designated genotypes with HO endonuclease under control of a galactose- inducible promoter, a single HO cleavage site that can only be repaired by NHEJ, and constitutive galactose exposure. Survival was calculated as colony counts from galactose plates divided by counts from parallel glucose control plates. Values represent three independent experiments. Errors bars indicate SD. The significance of the difference of the mean relative to WT is indicated above each mutant. P-value was determined by one-way ANOVA followed by Tukey’s honest significant difference post hoc testing (* P , 0.05). (C) Electro- phoretic mobility shift assays to assess Ku-dependent DEB. Whole cell extracts from indicated genotypes were incubated with radiolabeled 198-bp linear DNA fragment and 1000-fold excess cold circular DNA, then run on a nondenaturing polyacrylamide gel. DEB, DNA end-binding; NHEJ, nonhomologous end-joining; ns, nonsignificant; WT, wild-type. contains a single chromosomal HO endonuclease recognition parable to wild-type (WT) or, in the case of yku80-L50S,signif- site, no sequence homology for the locus elsewhere in the icantly greater than WT, similar to the yku70-R456E mutant genome, and expression of HO under the control of a galactose- (Figure 1B and Figure 2A; Lopez et al. 2011). inducible promoter (Lee et al. 1998). Incorporation of deletions We then assayed these telomere-defective and imprecise or insertions at the site of repair alters the HO recognition site NHEJ-proficient mutants for DEB activity by EMSAwith whole- and ceases further cleavage events. Thus, only imprecise NHEJ cell extracts. Using this qualitative assessment, we found that results in colony formation on galactose-containing media. each of the mutants was impaired for DEB (Figure 1C). These Survival in this assay depends on Ku (Lee et al. 1998; Figure 1A, results indicated that proficiency in imprecise end-joining was compare left and right panels]. not unique to the yku70-R456E mutation but was associated We identified several yku70 and yku80 mutant alleles that with a diverse set of mutations that impact DEB. phenocopied the yku70-R456E mutation. The mutated resi- DEB mutant yku70-R456E specifically facilitates dues distributed throughout the structure of the heterodimer imprecise NHEJ and is not detected at a DSB (Figure S1 in File S1). Comparable to the yku70-R456E mutant strain, serial dilutions of these mutants demonstrated a We previously found that the yku70-R456E DEB mutation marked synthetic phenotype in the absence of TLC1 (Figure resulted in imprecise NHEJ proficiency (Lopez et al. 2011; 1A, compare left and middle panels) and imprecise NHEJ Figure 2A), but the effect of Ku DEB impairment on precise proficiency (Figure 1A compare left and right panels). Fur- NHEJ was unknown. To measure precise repair frequency, we ther, quantification of imprecise NHEJ in the yku80 mutants modified the imprecise NHEJ assay protocol to include tran- demonstrated frequencies of error-prone repair that were com- sient, rather than constitutive, galactose exposure, and

118 C. H. Emerson et al. plated cells on glucose-containing media. Due to the short half-life of HO endonuclease and rapid repression of HO expression upon exposure to glucose, further cleavage events cease and cells with accurately repaired breaks sur- vive and form colonies under these conditions (Lee et al. 1998). As with the imprecise NHEJ assay (Figure 1, A and B and Figure 2A), survival in this assay depends on Ku (Milne et al. 1996; Lee et al. 1998; Figure 2B). We found that survival of the yku70-R456E strain was reduced (Figure 2B), indicating that Ku DEB impairment results in a precise repair defect. These results suggest that the DEB-impaired mutant Yku70-R456E speciﬁcally facilitates an error-prone NHEJ pathway. The Yku70-R456E/Yku80 heterodimer’s DEB activity has been studied in vitro (Lopez et al. 2011; Krasner et al. 2015). To determine whether the yku70-R456E mutation affected Ku’s association with the HO-induced DSB in vivo, we performed formaldehyde cross-linking and ChIP assays of C-terminally TAF-tagged Yku70 and Yku70-R456E 2 hr after DSB induction, when WT Yku has been shown to be readily detected at the break (Zhang et al. 2007; Wu et al. 2008). Subsequent qPCR detection of a fragment 161 bp from the HO site indicated enrichment of Yku at the DSB site in the WT strain, but not in the yku70-R456E strain, which was comparable to a yku70D strain (Figure 2C). Thus, similar to impaired binding of Yku70-R456E/Yku80 to DNA ends that has been observed in vitro (Lopez et al. 2011; Krasner et al. 2015), the Yku70-R456E DEB mutant could not be readily detected at a DSB in vivo.

Imprecise repair with DEB-impaired Ku requires NHEJ-specific regions of Yku70, including a novel bridge residue Although the Yku70-R456E DEB mutant could not be readily detected at a DSB in vivo, our other findings are consistent with DEB-impaired Ku mediating the formation of an NHEJ Figure 2 DEB mutant yku70-R456E specifically facilitates error-prone complex at the site of a DSB. Importantly, we found that two NHEJ and is not detected at a DSB. (A) Quantitative imprecise NHEJ assay different NHEJ-specific regions of Ku were required for im- using strains of the designated genotypes, as described in Figure 1B. precise NHEJ in the yku70-R456E mutant. Mutation of the Values based on four independent experiments. (B) Quantitative precise previously identified NHEJ-specific Yku70 a5 helix (yku70- NHEJ assay, using the same strains as the imprecise assay, but with tran- a b sient galactose exposure. Mating type testing to detect mutation of the D195R), which localizes to the Yku70 / domain and is repair site at the MAT locus found . 90% precise repair. Survival was remote from the DNA-binding channel (Figure S1A in File calculated as colony counts from glucose plates after transient galactose S1), abolished imprecise NHEJ proficiency in a yku70- exposure divided by counts from parallel glucose control plates with no R456E strain (Figure 3A). galactose exposure. Values based on three independent experiments. (C) We also examined the effect of mutation of a novel NHEJ- TAF-tagged Yku70 was immunoprecipitated from sheared chromatin pre- fi pared from formaldehyde cross-linked cells containing Yku70-TAF or speci c residue adjacent to the Ku bridge structure (yku70- Yku70-R456E-TAF 2 hr after in vivo DSB induction. A yku70-D strain E304K) (Figure S2 in File S1) on imprecise NHEJ in the served as a negative control. The associated DNA was analyzed by qPCR yku70-R456E mutant. The yku70-E304K mutation resulted using primers that amplified a locus adjacent to the HO cleavage site in loss of imprecise NHEJ (Figure 3A), as well as precise (depicted in inset). Values based on four independent experiments. For P NHEJ (Figure S2 in File S1). Similar to the yku70-D195R all experiments, -value was determined by one-way ANOVA followed by ’ Tukey’s honest significant difference post hoc testing (** P , 0.01) and mutation, Ku s telomere function in a yku70-E304K mutant error bars indicate SD. DEB, DNA end-binding; DSB, double-strand break; was unaffected, such that the yku70-E304K mutant survived NHEJ, nonhomologous end-joining; ns, nonsignificant; qPCR, quantitative in the absence of Tlc1 (Figure 3B) and mutants of this novel PCR. residue exhibited normal telomere length (Figure 3C). Im- portantly, the NHEJ defect in the yku70-E304K mutant was not due to dysfunctional DEB (Figure 3D).

Role of Ku DNA Binding in DNA Repair 119 Figure 3 DEB-impaired imprecise repair requires NHEJ- specific regions of Yku70, including a novel bridge- adjacent residue. (A) Serial dilutions of indicated genotypes were spotted onto complete media to determine plating efficiency (2HO) and galactose-containing media (+HO) to assay for imprecise NHEJ. (B) Serial dilutions of tlc1D synthetic lethality assay, as described in Figure 1A. (C) Southern blot to assay telomere length. Genomic DNA from indicated genotypes was digested with XhoI. Telomeric DNA was detected using a radiolabeled telomere-specificDNA probe. NR indicates a lane that is not relevant. (D) EMSA to detect DNA end-binding of Yku, as described in Figure 1C. (E) Co-IP assay to detect heterodimerization ability of Yku. Whole-cell lysates prepared from strain expressing the indicated FLAG-tagged alleles of Yku70 and Myc-tagged alleles of Yku80 were subjected to IP with FLAG-conjugated magnetic beads. After IP, FLAG and Myc tags were detected by western blot. IP and input fractions of the experiment are shown. DEB, DNA end-binding; DSB, double-strand break; EMSA, electrophoretic mobility shift assay; IP, immunoprecipitation; NHEJ, nonhomologous end-joining.

Analysis of the yku70-E304K + R456E double mutant (Chiruvella et al. 2013), also showed dramatic reductions revealed that, like the yku70-R456E mutation alone, the dou- in imprecise NHEJ in both WT and yku70-R456E strains (Fig- ble mutant had a synthetic growth defect in the absence of ure S3 in File S1), demonstrating that Dnl4’s ligase activity Tlc1 (Figure 3B), shortened telomeres (Figure 3C), and DEB was responsible for repairing the induced DSB in both strains. dysfunction (Figure 3D), despite proficiency for heterodime- As expected, given the requirement for DNL4, deletions of rization (Figure 3E). Notably, the addition of the R456E mu- LIF1 and NEJ1 also resulted in markedly reduced imprecise tation did not confer increased imprecise NHEJ activity in a NHEJ frequency in the yku70-R456E strain (Figure 4, B and yku70-E304K mutant (Figure 3A), further arguing against a C). Together, these data show that error-prone NHEJ in the gain-of-function model for the yku70-R456E mutation. context of DEB-impaired Ku is mediated by c-NHEJ factors. Rather, the requirement for NHEJ-specific regions in Yku70- Repair junctions in Yku DEB mutants are distinct from R456E-mediated repair is consistent with a model in which repair junctions in WT NHEJ DEB impairment alters an intrinsic and separable function of Ku in NHEJ, and in which DEB-impaired Ku physically asso- Although the same NHEJ-specific regions of Ku and c-NHEJ ciates, albeit unstably, with the DSB repair synapse. factors were required for DEB-impaired imprecise NHEJ as in WT (Figure 3 and Figure 4), we found significant differences Imprecise NHEJ in the yku70-R456E DEB mutant requires in the processing of repair junctions between the two. Impre- Dnl4, Lif1, and Nej1 cise NHEJ is typically defined by small insertions or deletions In addition to requiring specific regions of Ku known to be at the repair junction (Emerson and Bertuch 2016; Rulten crucial for imprecise NHEJ, we found that other essential and Grundy 2017). To characterize the imprecise repair components of the c-NHEJ pathway—Dnl4, Lif1 and Nej1 events, we sequenced the site of repair using both Sanger (Emerson and Bertuch 2016)—were required for repair in and next-generation sequencing platforms. For Sanger se- the context of Ku DEB dysfunction. Deletion of DNL4 abol- quencing, single colonies that formed from individual impre- ished imprecise NHEJ activity in the yku70-R456E strain (Fig- cise repair events in the imprecise NHEJ assay were selected ure 4A). A catalytically dead allele of DNL4, dnl4-K282A and the PCR-amplified repair site was sequenced. We found

120 C. H. Emerson et al. Figure 4 Imprecise NHEJ in DEB mutant yku70-R456E requires Dnl4, Lif1,andNej1.(A–C) Serial dilutions of indicated genotypes were spotted onto complete media to determine plating efficiency (2HO) and galactose-containing media (+HO) to assay for imprecise NHEJ. DEB, DNA end-binding; NHEJ, nonhomologous end-joining. that, although imprecise repair in the WT (YKU70) strain typically resulted in insertion events as previously reported (Moore and Haber 1996), repair in strains expressing yku70- Figure 5 Repair junctions in Yku DEB mutants are distinct from repair junc- R456E or yku80-L50S was dominated by small 1–3-bp deletions in WT. (A) Sequencing of imprecise NHEJ junctions by Sanger sequencing. Genomic DNA was isolated from single colonies generated in the tion events (Figure 5A). We then applied a next-generation imprecise NHEJ assay for the indicated genotypes. The repaired DSB locus sequencing platform to simultaneously analyze 400–600 in- was PCR amplified and the resulting product sequenced. (B) Next-generation dependent imprecise repair events, using colonies generated sequencing of imprecise NHEJ junctions. For each genotype, genomic DNA in the imprecise NHEJ assay (Figure 5B). In this larger sam- was isolated from 400 to 600 single colonies, which were pooled together pling, we found that small insertions still dominated WT re- from plates generated in the imprecise NHEJ assay. The repair junctions were sequenced on an Illumina platform and analysis determined the percentage pair, occurring in 59% of repair events, although small of total reads that were made up of small (, 5 bp) insertions and deletions. deletions were observed in 35% of all imprecise repair events. The remaining percentage of reads that are not represented on the graph As seen with Sanger sequencing, Yku70-R456E-mutant repair were primarily deletions . 5 bp and some junctions that had the same resulted in primarily small deletions (88% of repair events), sequence as the original cleavage site, implying they had not been cleaved. while very few small insertions were observed (3% of repair (C) Same data as (B) but corrected to account for survival in each strain by fi multiplying the relative value in (B) by the average survival in the imprecise events). The de ciency of small insertions was also found NHEJ assay. DEB, DNA end-binding; DSB, double-strand break; NHEJ, non- when the increase in survival was taken into account (Figure homologous end-joining; ns, nonsignificant; WT, wild-type. 5C), indicating that DEB does not simply suppress deletion events. Additional Sanger sequencing of strains with inte- Efficient imprecise repair in a Ku DEB-impaired mutant grated mutations (Table 1), as opposed to centromeric, plasmid- does not result from inhibition of end resection borne alleles (Figure 5A), corroborated these results. These results suggest a characteristic mechanism of repair We next performed epistasis analyses to determine if resection in the absence of canonical DEB by Ku. In further support of factors contributed to imprecise end-joining in the context of this, inspection of the repair junctions with respect to the ends impaired Ku DEB. Absence of Sae2, a protein important to the created by HO cleavage indicates that gap-filling must occur early stages of end resection, is reported to increase imprecise on both strands in the majority of repair events in WT cells, NHEJ (Matsuzaki et al. 2012). Consistent with this finding, we whereas gap-filling is either not required or is required for found increased imprecise NHEJ in the sae2D strain to a fre- just one to two nucleotides on a single strand in the DEB quency similar to that seen in the yku70-R456E strain (Figure mutants (Figure 6). 7A). Notably though, imprecise NHEJ of the yku70-R456E

Role of Ku DNA Binding in DNA Repair 121 Table 1 Sanger sequencing results of imprecise NHEJ junctions yku70-R456E yku70-R456E Mutation Wild-type (%) yku70-R456E (%) pol2-4 (%) pol2-4 (%) sae2D (%) sae2D (%)

CGCAACA(+CA)GT 19 (38.8) 0 20 (48.8) 3 (7.3) 11 (25) 0 GCAA(+CAA)CAGT or GCAACA(+ACA)GT 16 (32.7) 1 (2.1) 13 (31.7) 0 14 (31.8) 0 GCAACA(+A)GT 3 (6.1) 0 0 0 0 1 (2.2) GCAAC(+C)AGT 0 2 (4.2) 0 0 0 0 GCAACA(+CACA)GT 0 0 1 (2.4) 0 1 (2.3) 0 GCAA(+AA)CAGT 0 0 3 (7.3) 0 0 0 . 5 bp deletion 4 (8.2) 0 0 6 (14.6) 11 (25) 11 (22) GCA(2ACA)GT or G(2CAA)CAGT 3 (6.1) 19 (39.6) 0 22 (53.7) 5 (11.4) 10 (22.2) GC(2AACA)GT 2 (4.1) 0 0 0 0 0 GC(2A)ACAGT 1 (2) 3 (6.3) 0 0 0 5 (11.1) GC(2AA)CAGT 1 (2) 0 0 1 (2.4) 0 0 GCAA(2CA)GT or GCA(2AC)AGT 0 15 (31.3) 0 4 (9.8) 0 11 (24.4) GCAA(2CAG)T 0 4 (8.3) 0 2 (4.9) 0 2 (4.4) (2GC)AACAGT 0 2 (4.2) 0 0 0 0 GCAACA(2G)T 0 0 0 1 (2.4) 1 (2.3) 0 GCAACACA(2GT) 0 0 1 (2.4) 0 1 (2.3) 1 (2.2) GCAA(2CAGTA) 0 0 0 0 0 2 (4.4) Unique events, , 5 bp 0 2 (4.2) 3 (7.2) 2 (4.8) 0 2 (4.4) strain remained increased relative to a WT Ku strain when HO HR, bypassing the requirement for these proteins for viability. induction and consequent NHEJ were restricted to G1 of the cell As previously observed (Moore and Haber 1996), deletion of cycle (Figure S4 in File S1), a time in the cell cycle when Sae2 MRE11 dramatically reduced imprecise NHEJ in a WT strain activity is inhibited (Huertas et al. 2008). Moreover, the sae2D (Figure 7C). A comparable loss of imprecise NHEJ was seen yku70-R456E double mutant had an additive increase in impre- in the context of DEB-impaired mutant Yku (Figure 7C), in- cise NHEJ frequency (Figure 7A). Together, these results sug- dicating a strong requirement for the MRX complex in the gest that the promotion of imprecise repair by DEB-impaired Ku DEB dysfunctional mode of repair. was not due to Sae2 inhibition, and conversely, that the in- Mre11’s separable nuclease function is thought to help ini- creased imprecise NHEJ observed in a sae2D mutant was not tiate resection by facilitating the removal of Ku from a DSB end due to effects on Ku DEB. Consistent with the latter point, anal- (Balestrini et al. 2013). To test whether Mre11 resection-asso- ysis of repair events by Sanger sequencing of individual colonies ciated nuclease activity was dispensable for imprecise NHEJ in showed that the hallmarks of sae2D and DEB-mutant Yku- a Ku DEB-impaired mutant, we used a nuclease dead allele of mediated repair, . 5-bp and , 5-bp deletions, respectively, were Mre11, mre11-H125N. As expected, the mre11-H125N allele both maintained in the double mutant (Figure 7B and Table 1). did not decrease the frequency of imprecise NHEJ in a yku70- These data further support the conclusion that two distinct error- R456E strain (Figure 7D), indicating that Mre11 nuclease ac- prone repair pathways are simultaneously active in the double tivity was dispensable for imprecise NHEJ mediated by a Ku mutant and that imprecise NHEJ in a Ku DEB-impaired mutant is DEB-impaired mutant. Indeed, as we found when combining not mediated by inhibition of Sae2. yku70-R456E with a sae2D mutation, there was a significant We next examined the role of the MRX complex in Ku DEB- additive increase in imprecise NHEJ frequency in the yku70- impaired imprecise NHEJ. The MRX complex—composed of R456E mre11-H125N double mutant (Figure 7D). Interestingly, Mre11, Rad50, and Xrs2 subunits—contributes to several a Southern blot to measure the rate of resection at the DSB processes in S. cerevisiae, including initiating resection, ho- locus showed that Ku DEB impairment resulted in a moderate mologous recombination (HR), NHEJ efficiency and fidelity, increase in the resection rate, indicating that the Ku DEB- and telomere maintenance (Zhang and Paull 2005; Dewar impaired mutant is nonetheless partially defective for pro- and Lydall 2012; Balestrini et al. 2013; Gobbini et al. 2016; tection of DSB ends (Figure S5 in File S1). Iwasaki et al. 2016). To determine whether MRX is required Ku DEB impairment promotes Pol2 flap-trimming and for error-prone repair with DEB-impaired mutant Ku, we an- precludes insertions, yet requires Pol4 for repair alyzed imprecise NHEJ in mre11D yku70-R456E double- mutant strains. The double mutant created by disruption of Having found that error-prone NHEJ in a Ku DEB-impaired Mre11 and Ku results in a strain that is synthetically sick mutant is promoted by a mechanism distinct from the in- due to telomere dysfunction (Nugent et al. 1998). A similar hibition of resection, we speculated that the small deletions synthetically sick phenotype was observed in the yku70- that characterize imprecise NHEJ in a Ku DEB mutant were R456E mre11D (data not shown). Therefore, to analyze these due to altered end-processing during NHEJ. Pol2, an essential genotypes in the imprecise NHEJ assay, we first performed leading-strand DNA polymerase, functions in NHEJ end- serial streak-outs of newly isolated double mutants to gener- processing by utilizing a separable exonuclease activity to trim ate survivor strains, in which telomeres are maintained by 39 flaps, which generates small deletions like those seen in a

122 C. H. Emerson et al. Figure 6 Comparison of repair junctions in WT and DEB-mutant cells. (A) The HO cleavage site and ends created upon cleavage. (B and C) Repair junctions and number of events obtained in WT, and yku70-R456E and yku80-L50S mutant cells, respectively, compiled from Figure 5 and Table 1. Star indicates microhomology of base pairs originating from the initial overhangs created by HO cleavage. Light blue and gray shade: sequences upstream and downstream of cleavage, respectively. Blue and red letters: bases added or deleted at the repair junction, respectively. Orange shade: bases added via gap-filling. In some cases, there appears to be a lack of microhomology involving preexisting bases. In these cases, there is presumably microhomology involving preexisting bases followed by limited gap-filling, then realignment followed by completion of gap-filling. In additional infrequent cases, there appears to be loss of all bases in initial overhang (=) and either direct blunt end to blunt end ligation or single-strand ligation to blunt end followed by gap-filling, as previously suggested in monkey cells (Roth and Wilson, 1986). DEB, DNA end-binding; NHEJ, nonhomologous end-joining; WT, wild-type.

Role of Ku DNA Binding in DNA Repair 123 Figure 7 Efficient imprecise repair in a Yku DNA end-binding-impaired mutant does not result from inhibition of end resection activities that initiate homologous recombination. (A, C, and D) Quantitative imprecise NHEJ assay, as described in Fig- ure 1B. Results for each figure represent four independent experiments. For all experiments, P-values were determined by one-way ANOVA followed by Tukey’s honest significant difference post hoc testing (** P , 0.01) and error bars indicate SD. (B) Distribution of small insertions and deletions at repaired imprecise NHEJ junctions as determined by Sanger sequencing, as described in Figure 5A. NHEJ, nonhomologous end- joining; ns, nonsignificant.

DEB-impaired Ku strain (Tseng et al. 2008). To determine Discussion whether the increased frequency of deletion-prone NHEJ in In this study, we show that Ku’s canonical DEB activity influ- a DEB-impaired mutant requires Pol2 flap-trimming, we com- ences repair fidelity and end-processing activity during bined an exonuclease-dead allele of Pol2, pol2-4 (Tseng et al. NHEJ. Whereas Ku DEB proficiency is required for precise 2008), with yku70-R456E and assayed for imprecise NHEJ and imprecise NHEJ with sequence insertions, we found NHEJ. Loss of Pol2 exonuclease activity reduced imprecise that Ku DEB impairment creates an optimal substrate for nu- NHEJ frequency in the yku70-R456E strain but did not sig- clease activity, as evidenced by the loss of small insertions and nificantly alter repair frequency in a WT strain (Figure 8A), suggesting that Pol2 exonuclease function is responsible for the increased frequency of small deletions at the site of impre- ’ the increased error-prone repair in a yku70-R456E strain. cise NHEJ repair in Ku DEB mutants. Considering Ku s critical Sanger sequencing of individual repair events confirmed role in NHEJ factor recruitment, which necessitates Ku DEB for the previous finding that pol2-4 nearly eliminates small de- both precise and imprecise NHEJ mechanisms, it seems most letions at the repaired DSB in a WT strain (Figure 8B and likely that Ku DEB mutants bind DNA in a limited capacity,but Table 1; Tseng et al. 2008). Interestingly, in the Ku DEB- lack the canonical stability of WT Ku DEB. Our data suggest ’ fl impaired mutant context, pol2-4 did not restore the small that Ku s stable and exible DEB facilitates synapse formation fi insertion events observed in YKU70 and pol2-4 strains, with during the annealing process to promote NHEJ delity. repair junctions remaining predominantly characterized by Previous observations support the idea that Ku functions ’ small deletions (Figure 8B and Table 1), suggesting that im- in synapse formation and end alignment in NHEJ. Ku sring- paired DEB in the yku70-R456E mutant precludes events in shaped structure and DEB activity have been proposed to the error-prone repair mechanism that results in insertions. play a vital role in NHEJ repair complex assembly and re- Pol4, an error-prone gap-filling polymerase, generates pair fidelity by bridging and supporting DNA ends while small insertions in imprecise NHEJ (Wilson and Lieber 1999). allowing enzyme access (Feldmann et al. 2000; Walker Additionally, Pol4 functions in NHEJ by stabilizing 39 overhang et al. 2001; Downs and Jackson 2004; Spagnolo et al. 2006). ends and stimulating Dnl4 activity (Tseng and Tomkinson In this study, we used S. cerevisiae, a well-characterized model 2002; Daley et al. 2005). To test whether Pol4 contributed to for eukaryotic DNA repair, to study the impact of impairment of imprecise NHEJ with DEB-impaired Ku, we deleted POL4 in WT Ku’s DEB activity. Our identification of additional DEB-defective and yku70-R456E strains and performed the imprecise NHEJ missense mutants with the same phenotype as yku70-R456E assay. Both pol4D and yku70-R456E pol4D strains showed dras- (Figure 1) suggests that the error-prone NHEJ mediated by tic reductions in imprecise NHEJ frequency (Figure 8C), indi- Ku DEB mutants results from disrupting a fundamental role of cating a strong contribution by Pol4 to repairing an HO-induced Ku in NHEJ, which we propose is the facilitation of synapse DSB in both WT and Ku DEB-impaired contexts. formation to promote repair fidelity.

124 C. H. Emerson et al. deletions (5–20 bp), typically associated with MMEJ (Ma et al. 2003). Lastly, whereas MMEJ is promoted by the activity of resection factors Mre11 and Sae2 (Ma et al. 2003; Lee and Lee 2007), end-joining with DEB-mutant Ku does not (Figure 7). Thus, a Ku-dependent error-prone pathway of end-joining distinct from MMEJ has been revealed. The MRX complex is thought to promote NHEJ in S. cerevisiae, not via its nuclease activity (Ghodke and Muniyappa 2013; Figure 7D), but rather by bridging DSB ends (Moore and Haber 1996; Hopfner et al. 2002). We found that, while Mre11 was required for imprecise NHEJ in the yku70-R456E mutant (Figure7C),itsnucleaseactivitywasdispensable(Figure7D), suggesting that MRX also acts in the DEB-impaired mutant error-prone NHEJ mechanism by bridging DSB ends. Because Mre11 nuclease activity and Sae2 both function in early-stage resection (Mimitou and Symington 2008; Balestrini et al. 2013), we interpret our finding that the nuclease dead Mre11 mutant, mre11-H125N,andasae2D mutant resulted in significant additive increases in imprecise NHEJ with the yku70-R456E mutation (Figure 7, A and D) to mean that imprecise NHEJ in a Ku DEB-impaired mutant does not result from the inhibition of early-stage resection. This conclusion is additionally supported by sequencing of the repair site in a sae2D yku70-R456E strain, which showed end-processing patterns that indicated the activity of two different repair pathways (Figure 7B). Our results suggest a multifunctional role for Ku in NHEJ by showingthatKuDEB-impairedmutantsinfluence the activity of end-processing factors after a DSB has been committed to NHEJ. Regulation of end-processing in NHEJ is poorly understood, because it involves many accessory factors with redundant and overlapping functions (Emerson and Bertuch 2016; Rulten and Grundy 2017). Pol2 mediates small deletion events in S. cerevisiae NHEJ end-processing via a separable exonuclease activity (Tseng et al. 2008). Introducing an exonuclease dead allele (pol2-4)into aDEB-mutantyku70-R456E strain pol2-4 abolished the increased Figure 8 Ku DNA end-binding impairment promotes Pol2 flap-trimming imprecise repair frequency originally seen with yku70-R456E mu- and precludes insertions generated by Pol4 . However, POL4 is still tation (Figure 8A), though deletion-mediated repair still com- required for repair. (A and C) Quantitative imprecise NHEJ assay, as prised the majority of repair events (Figure 8B and Table 1). described in Figure 1B. Results for each figure represent four independent This finding supports previous observations of redundancy in P experiments. For all experiments, -values were determined by one-way NHEJ end-processing (Emerson and Bertuch 2016; Rulten and ANOVA followed by Tukey’s honest significant difference post hoc testing (** P , 0.01) and error bars indicate SD. (B) Distribution of small insertions Grundy 2017), and indicates that the repair substrate formed by and deletions at repaired imprecise NHEJ junctions as determined by Sanger the DEB-impaired mutant Ku is more efficiently processed by sequencing, as described in Figure 5A. NHEJ, nonhomologous end-joining; Pol2 than by unidentified redundant nucleases. Relatively little ns, nonsignificant. is known about Pol2’s role in NHEJ, other than that it performs 39 exonucleolytic end-processing (Tseng et al. 2008). However, it is Microhomology-mediated end-joining (MMEJ) is an alter- interesting to note that Pol2 functions in proof-reading during native, Ku-independent pathway of DSB repair (Sinha et al. DNA replication and that loss of Pol2 exonuclease activity is as- 2016) and, therefore, could potentially be mediating end- sociated with a mutator phenotype (Williams et al. 2015). This joining in the context of Ku DEB impairment. However, end- exonuclease-promoted accuracy in DNA replication is in contrast joining in the DEB mutants is distinguishable from MMEJ. First to our imprecise NHEJ system in which Pol2 exonuclease activity and foremost, end-joining in the DEB mutants requires specific promoted error-prone DNA repair. regions of Ku (Figure 3), thus, is not Ku-independent. In Pol4 mediates small insertion events at an HO-induced addition, in contrast to MMEJ, end-joining in the context of chromosomal DSB (Daley et al. 2005; Tseng et al. 2008). DEB-impaired Ku requires c-NHEJ factors, including Dnl4 The predominance of small deletions in Ku DEB mutants (Fig- (Figure 4). Also, the junctions in the DEB mutants contain ure 5, Figure 7B, Figure 8B, and Table 1) suggests that Pol4 small (, 5 bp) (Figure 5 and Table 1) rather than larger activity at the repair synapse is sensitive to disruption of Ku

Role of Ku DNA Binding in DNA Repair 125 DEB activity.Notably, pol2-4 mutation did not restore insertion exposure to a DSB-inducing agent such as phleomycin) or events (Figure 8B and Table 1), further supporting the conclu- when HDR is comprised remains to be determined. sion that the structure of the Ku DEB mutant repair complex A previous study found that DEB mutants generated by precludes insertions generated by Pol4, rather than the Pol2- deletion of amino acids in the DNA-binding channel were dependent pathway outcompeting a Pol4-dependent pathway. imprecise NHEJ-defective (Pfingsten et al. 2012), in striking Consistent with this, Pol4 has been shown to not be required contrast to the DEB mutants described in this study, which were when only one strand requires gap-filling (Daley et al. 2005), imprecise NHEJ-proficient. The identification of a Yku70 resi- as is predicted to be the case for nearly all of the synapses due adjacent to the narrow bridge of the DNA-binding channel requiring gap-filling in the DEB mutants (Figure 6). that is specifically required for Ku’s NHEJ function reconciles Interestingly, POL4 deletion decreased the imprecise this difference. Comparison of the locations of the cognate res- NHEJ frequency in a yku70-R456E strain (Figure 8C), sug- idues of this NHEJ-specific residue and those deleted by gesting that in a Ku DEB-impaired mutant, Pol4, while unable Pfingsten et al. (2012) on the crystal structure of human Ku to generate insertions, still performs its function of stabilizing suggests that they colocalize in the conserved yeast heterodimer the 39 overhang at the DSB (Daley et al. 2005). Additionally, (Figure S2 in File S1). The proximity of this NHEJ-specificres- it indicates that a redundant enzyme is unable to compensate idue to the deleted residues in the Pfingsten et al. (2012) DEB for Pol4 functions at the 39 overhang, although Pol3 has been mutants thus provides a likely explanation for the observed observed to fulfill this role in other systems (Chan et al. imprecise NHEJ defect in the deletion mutants, which is that 2008). Polymerase-mediated synaptic complex formation is the deletion of 20 nearby amino acids in the bridge distorts the a widely conserved phenomenon, also observed in mamma- structural position of this critical residue. Two other NHEJ- lian cells (Mahajan et al. 2002) and bacteria (Brissett et al. specific regions of Yku have been previously identified: the 2007). Our findings contribute to the understanding of Pol4’s Yku80 C-terminus, which recruits Dnl4 (Palmbos et al. 2005, role in the structure of the NHEJ synaptic complex, though 2008), and the Yku70 a5 helix, which is of unknown function additional study will be required to better characterize Pol4’s (Ribes-Zamora et al. 2007). In human cells, the conserved Ku70 specific role in Ku DEB-impaired NHEJ. a5 helix has been implicated in DSB end synapsis via heterote- Our proposed model requires that DEB mutant Ku engages tramerization of the Ku heterodimers (Ribes-Zamora et al. the DSB in some fashion to recruit NHEJ factors to the site. 2013), though this function has not been demonstrated in yeast. However, we were unable to detect DEB-impaired Ku at a DSB Future work will be necessary to determine the function of these by ChIP, although WT Ku was readily detected (Figure 2C). It NHEJ-specific Yku70 regions. Because Yku70-E304 is required is likely that Yku70-R456E has a weak or transient associa- for both precise and imprecise NHEJ (Figure 3, C and D), it is tion with the DSB that cannot be detected in the ChIP exper- plausible that it is required for interaction with core NHEJ fac- iments despite cross-linking. Consistent with this notion, tors, such as Lif1 or Dnl4. in vitro studies of heterodimers’ DEB activity have revealed Interestingly,the DEB-impaired Ku mutants presented here a range of binding of activities depending on the type of DNA differ from many previously described yeast Ku mutants, end (Lopez et al. 2011; Krasner et al. 2015). Another possi- which phenocopy the Ku null with marked defects in both bility, given that imprecise repair is a rare event, is that DEB- precise and imprecise NHEJ (Palmbos et al. 2005; Pfingsten mutant Ku associates with a small subset of broken DNA et al. 2012). The DEB-impaired mutants are, instead, defec- ends, below the threshold of ChIP-qPCR detection, creating tive for precise NHEJ and proficient for imprecise NHEJ, and, a repair substrate that is prone to imprecise repair. Alterna- therefore, can be viewed as having a mutator effect. There- tively, these data could suggest a different model of imprecise fore, Ku DEB mutants may serve to provide insight into causes NHEJ in a DEB-impaired Ku mutant, in which Ku is com- of imprecise repair in the c-NHEJ mechanism. Mapping of the pletely absent from the break, and imprecise NHEJ results Yku70 and Yku80 mutants on the crystal structure of human from DEB-mutant Ku titrating c-NHEJ factors away from Ku shows that DEB-impairing mutations occur in several dis- the break and allowing a back-up repair pathway to act. Fu- parate locations in both subunits (Figure S1 in File S1). Fu- ture biochemical studies of protein recruitment will be re- ture work is required to determine the specific cause of DEB quired to address this alternative model. impairment in these mutants. We have studied rare repair events that follow HO cleavage In conclusion, our data show that canonical DEB activity at the MAT locus, a naturally occurring system of DSB induc- influences repair fidelity and end-processing activity during tion in yeast. HO induces a DSB with a 39 overhang and at a NHEJ, and contribute to an existing body of evidence that unique and single site. It remains to be determined whether suggests that Ku promotes NHEJ repair by bridging and sup- Ku DEB regulates end-processing activity at DSBs with 59 porting DNA ends while allowing enzyme access (Feldmann overhangs, blunt ends, or complex ends. Differences using et al. 2000; Walker et al. 2001; Downs and Jackson 2004; other repair substrates would not be surprising, given the Spagnolo et al. 2006). Future work, especially biochemical observation that variation in DSB overhangs influences repair and structural studies of factor recruitment to the DSB site, kinetics and accuracy (Liang et al. 2016). Additionally, will be required to fully characterize formation of the NHEJ whether Ku DEB impairment influences repair efficiency repair synapse and to demonstrate how the physical structure when there are numerous, site nonspecific DSBs (e.g., upon of the annealed DSB influences NHEJ.

126 C. H. Emerson et al. Acknowledgments strand break processing and checkpoint activation during the cell cycle. EMBO Rep. 9: 810–818. https://doi.org/10.1038/ We thank Grzegorz Ira (Baylor College of Medicine) for embor.2008.121 stimulating discussion and critical review of the manuscript, Daley, J. M., R. L. Laan, A. Suresh, and T. E. Wilson, 2005 DNA James Haber (Brandeis University) for the gift of strains and joint dependence of pol X family polymerase action in nonho- – helpful input, Jaime Nagy (Baylor College of Medicine) for mologous end joining. J. Biol. Chem. 280: 29030 29037. https://doi.org/10.1074/jbc.M505277200 technical assistance, and the Baylor Research Advocates for Dewar, J. M., and D. Lydall, 2012 Similarities and differences Student Scientists for equipment and reagent support. This between “uncapped” telomeres and DNA double-strand breaks. work was supported by the National Institutes of Health Chromosoma 121: 117–130. https://doi.org/10.1007/s00412- (NIH) (grants R01 GM-077509 and GM-077509-03S1 to 011-0357-2 A.A.B., T32 GM-084897 to A.R.-Z., T32 GM-008231 to E.J.P., Downs, J. A., and S. P. Jackson, 2004 A means to a DNA end: the many roles of Ku. Nat. Rev. Mol. Cell Biol. 5: 367–378. https:// T32 GM-008307 to L.Y., and T15 LM-007093 to J.E.Z.] and doi.org/10.1038/nrm1367 the National Science Foundation [DGE 1255980 to C.H.E.]. Driller, L., R. J. Wellinger, M. Larrivee, E. Kremmer, S. Jaklin et al., Funding for open access charge: NIH (grant R01 GM-077509). 2000 A short C-terminal domain of Yku70p is essential for The authors have no conflicts of interest to declare. telomere maintenance. J. Biol. Chem. 275: 24921–24927. https://doi.org/10.1074/jbc.M002588200 Emerson, C. H., and A. A. Bertuch, 2016 Consider the workhorse: nonhomologous end-joining in budding yeast. Biochem. Cell Literature Cited Biol. 94: 396–406. https://doi.org/10.1139/bcb-2016-0001 Feldmann, E., V. Schmiemann, W. Goedecke, S. Reichenberger, and P. Bahmed, K., K. C. Nitiss, and J. L. Nitiss, 2010 Yeast Tdp1 regu- Pfeiffer, 2000 DNA double-strand break repair in cell-free extracts fi lates the delity of nonhomologous end joining. Proc. Natl. from Ku80-deficient cells: implications for Ku serving as an align- – Acad. Sci. USA 107: 4057 4062. https://doi.org/10.1073/ ment factor in non-homologous DNA end joining. Nucleic Acids pnas.0909917107 Res. 28: 2585–2596. https://doi.org/10.1093/nar/28.13.2585 Balestrini, A., D. Ristic, I. Dionne, X. Z. Liu, C. Wyman et al., Fisher, T. S., and V. A. Zakian, 2005 Ku: a multifunctional protein 2013 The Ku heterodimer and the metabolism of single-ended involved in telomere maintenance. DNA Repair (Amst.) 4: – DNA double-strand breaks. Cell Rep. 3: 2033 2045. https://doi. 1215–1226. https://doi.org/10.1016/j.dnarep.2005.04.021 org/10.1016/j.celrep.2013.05.026 Ghodke, I., and K. Muniyappa, 2013 Processing of DNA double- Bazinet, A., 2009 The Lattice Project a Multi-Model Grid Computing stranded breaks and intermediates of recombination and repair System. University of Maryland, College Park, MD. by Saccharomyces cerevisiae Mre11 and its stimulation by Bertuch, A. A., and V. Lundblad, 2003 The Ku heterodimer per- Rad50, Xrs2, and Sae2 proteins. J. Biol. Chem. 288: 11273– forms separable activities at double-strand breaks and chromo- 11286. https://doi.org/10.1074/jbc.M112.439315 some termini. Mol. Cell. Biol. 23: 8202–8215. https://doi.org/ Gobbini, E., C. Cassani, M. Villa, D. Bonetti, and M. P. Longhese, 10.1128/MCB.23.22.8202-8215.2003 2016 Functions and regulation of the MRX complex at DNA Bertuch, A. A., and V. Lundblad, 2004 EXO1 contributes to telo- double-strand breaks. Microb. Cell 3: 329–337. https://doi.org/ mere maintenance in both telomerase-proficient and telomerase- 10.15698/mic2016.08.517 deficient Saccharomyces cerevisiae. Genetics 166: 1651–1659. Hopfner, K. P., L. Craig, G. Moncalian, R. A. Zinkel, T. Usui et al., https://doi.org/10.1534/genetics.166.4.1651 2002 The Rad50 zinc-hook is a structure joining Mre11 com- Boulton, S. J., and S. P. Jackson, 1996 Identification of a Saccha- plexes in DNA recombination and repair. Nature 418: 562–566. romyces cerevisiae Ku80 homologue: roles in DNA double strand https://doi.org/10.1038/nature00922 break rejoining and in telomeric maintenance. Nucleic Acids Res. Huertas, P., F. Cortes-Ledesma, A. A. Sartori, A. Aguilera, and S. P. 24: 4639–4648. https://doi.org/10.1093/nar/24.23.4639 Jackson, 2008 CDK targets Sae2 to control DNA-end resection Brissett, N. C., R. S. Pitcher, R. Juarez, A. J. Picher, A. J. Green et al., and homologous recombination. Nature 455: 689–692. https:// 2007 Structure of a NHEJ polymerase-mediated DNA synaptic doi.org/10.1038/nature07215 complex. Science 318: 456–459. https://doi.org/10.1126/science. Iwasaki,D.,K.Hayashihara,H.Shima,M.Higashide,M.Terasawaet al., 1145112 2016 The MRX complex ensures NHEJ fidelity through multiple Chan, C. Y., A. Galli, and R. H. Schiestl, 2008 Pol3 is involved in non- pathways including Xrs2-FHA-dependent Tel1 activation. PLoS Genet. homologous end-joining in Saccharomyces cerevisiae. DNA Repair 12: e1005942. https://doi.org/10.1371/journal.pgen.1005942 (Amst.) 7: 1531–1541. https://doi.org/10.1016/j.dnarep.2008.05.008 Jiang, G., I. Plo, T. Wang, M. Rahman, J. H. Cho et al., Chen, S., K. V. Inamdar, P. Pfeiffer, E. Feldmann, M. F. Hannah et al., 2013 BRCA1-Ku80 protein interaction enhances end-joining 2001 Accurate in vitro end joining of a DNA double strand fidelity of chromosomal double-strand breaks in the G1 phase break with partially cohesive 39-overhangs and 39-phosphoglyco- of the cell cycle. J. Biol. Chem. 288: 8966–8976. https://doi. late termini: effect of Ku on repair fidelity. J. Biol. Chem. 276: org/10.1074/jbc.M112.412650 24323–24330. https://doi.org/10.1074/jbc.M010544200 Krasner, D. S., J. M. Daley, P. Sung, and H. Niu, 2015 Interplay Chen, X., and A. E. Tomkinson, 2011 Yeast Nej1 is a key partic- between Ku and replication protein A in the restriction of Exo1- ipant in the initial end binding and final ligation steps of non- mediated DNA break end resection. J. Biol. Chem. 290: 18806– homologous end joining. J. Biol. Chem. 286: 4931–4940. 18816. https://doi.org/10.1074/jbc.M115.660191 https://doi.org/10.1074/jbc.M110.195024 Lee, K., and S. E. Lee, 2007 Saccharomyces cerevisiae Sae2- and Chiruvella, K. K., Z. Liang, S. R. Birkeland, V. Basrur, and T. E. Tel1-dependent single-strand DNA formation at DNA break pro- Wilson, 2013 Saccharomyces cerevisiae DNA ligase IV motes microhomology-mediated end joining. Genetics 176: supports imprecise end joining independently of its catalytic 2003–2014. https://doi.org/10.1534/genetics.107.076539 activity. PLoS Genet. 9: e1003599. https://doi.org/10.1371/ Lee, S. E., J. K. Moore, A. Holmes, K. Umezu, R. D. Kolodner et al., journal.pgen.1003599 1998 Saccharomyces Ku70, mre11/rad50 and RPA proteins Clerici, M., D. Mantiero, I. Guerini, G. Lucchini, and M. P. Longhese, regulate adaptation to G2/M arrest after DNA damage. Cell 2008 The Yku70-Yku80 complex contributes to regulate double- 94: 399–409. https://doi.org/10.1016/S0092-8674(00)81482-8

Role of Ku DNA Binding in DNA Repair 127 Liang, Z., S. Sunder, S. Nallasivam, and T. E. Wilson, 2016 Overhang Roth, D. B., and J. H. Wilson, 1986 Nonhomologous recombina- polarity of chromosomal double-strand breaks impacts kinetics and tion in mammalian cells: role for short sequence homologies in fidelity of yeast non-homologous end joining. Nucleic Acids Res. the joining reaction. Mol. Cell Biol. 6: 4295–4304. 44: 2769–2781. https://doi.org/10.1093/nar/gkw013 Rothstein, R., 1991 Targeting, disruption, replacement, and allele Lopez,C.R.,A.Ribes-Zamora,S.M.Indiviglio,C.L.Williams, rescue: integrative DNA transformation in yeast. Methods Enzymol. S. Haricharan et al., 2011 Ku must load directly onto the chro- 194: 281–301. https://doi.org/10.1016/0076-6879(91)94022-5 mosome end in order to mediate its telomeric functions. PLoS Genet. Roy, R., B. Meier, A. D. McAinsh, H. M. Feldmann, and S. P. Jackson, 7: e1002233. https://doi.org/10.1371/journal.pgen.1002233 2004 Separation-of-function mutants of yeast Ku80 reveal a Ma, J. L., E. M. Kim, J. E. Haber, and S. E. Lee, 2003 Yeast Mre11 Yku80p-Sir4p interaction involved in telomeric silencing. J. Biol. and Rad1 proteins define a Ku-independent mechanism to re- Chem. 279: 86–94. https://doi.org/10.1074/jbc.M306841200 pair double-strand breaks lacking overlapping end sequences. Rulten, S. L., and G. J. Grundy, 2017 Non-homologous end joining: Mol. Cell. Biol. 23: 8820–8828. https://doi.org/10.1128/ common interaction sites and exchange of multiple factors in the MCB.23.23.8820-8828.2003 DNA repair process. BioEssays DOI: 10.1002/bies.201600209. Mahajan, K. N., S. A. Nick McElhinny, B. S. Mitchell, and D. A. Sinha, S., D. Villarreal, E. Y. Shim, and S. E. Lee, 2016 Risky Ramsden, 2002 Association of DNA polymerase mu (pol mu) business: microhomology-mediated end joining. Mutat. Res. with Ku and ligase IV: role for pol mu in end-joining double- 788: 17–24. https://doi.org/10.1016/j.mrfmmm.2015.12.005 strand break repair. Mol. Cell. Biol. 22: 5194–5202. https://doi. Spagnolo, L., A. Rivera-Calzada, L. H. Pearl, and O. Llorca, 2006 Three- org/10.1128/MCB.22.14.5194-5202.2002 dimensional structure of the human DNA-PKcs/Ku70/Ku80 complex Matsuzaki, K., M. Terasawa, D. Iwasaki, M. Higashide, and assembled on DNA and its implications for DNA DSB repair. Mol. Cell M. Shinohara, 2012 Cyclin-dependent kinase-dependent 22: 511–519. https://doi.org/10.1016/j.molcel.2006.04.013 phosphorylation of Lif1 and Sae2 controls imprecise nonho- Stellwagen, A. E., Z. W. Haimberger, J. R. Veatch, and D. E. Gottsch- mologous end joining accompanied by double-strand break ling, 2003 Ku interacts with telomerase RNA to promote telo- resection. Genes Cells 17: 473–493. https://doi.org/10.1111/ mere addition at native and broken chromosome ends. Genes j.1365-2443.2012.01602.x Dev. 17: 2384–2395. https://doi.org/10.1101/gad.1125903 Milne,G.T.,S.Jin,K.B.Shannon,andD.T.Weaver,1996 Mutations Sugawara, N., X. Wang, and J. E. Haber, 2003 In vivo roles of Rad52, in two Ku homologs define a DNA end-joining repair pathway in Rad54, and Rad55 proteins in Rad51-mediated recombination. Mol. Saccharomyces cerevisiae. Mol. Cell. Biol. 16: 4189–4198. https:// Cell 12: 209–219. https://doi.org/10.1016/S1097-2765(03)00269-7 doi.org/10.1128/MCB.16.8.4189 Tseng, H. M., and A. E. Tomkinson, 2002 A physical and functional Mimitou, E. P., and L. S. Symington, 2008 Sae2, Exo1 and Sgs1 interaction between yeast Pol4 and Dnl4-Lif1 links DNA synthesis collaborate in DNA double-strand break processing. Nature 455: and ligation in nonhomologous end joining. J. Biol. Chem. 277: 770–774. https://doi.org/10.1038/nature07312 45630–45637. https://doi.org/10.1074/jbc.M206861200 Mimitou, E. P., and L. S. Symington, 2010 Ku prevents Exo1 and Tseng, S. F., A. Gabriel, and S. C. Teng, 2008 Proofreading activ- Sgs1-dependent resection of DNA ends in the absence of a func- ity of DNA polymerase Pol2 mediates 39-end processing during tional MRX complex or Sae2. EMBO J. 29: 3358–3369. https:// nonhomologous end joining in yeast. PLoS Genet. 4: e1000060. doi.org/10.1038/emboj.2010.193 https://doi.org/10.1371/journal.pgen.1000060 Moore, J. K., and J. E. Haber, 1996 Cell cycle and genetic require- Walker, J. R., R. A. Corpina, and J. Goldberg, 2001 Structure of ments of two pathways of nonhomologous end-joining repair of the Ku heterodimer bound to DNA and its implications for double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. double-strand break repair. Nature 412: 607–614. https://doi. Biol. 16: 2164–2173. https://doi.org/10.1128/MCB.16.5.2164 org/10.1038/35088000 Nugent, C. I., G. Bosco, L. O. Ross, S. K. Evans, A. P. Salinger et al., Williams,L.N.,L.Marjavaara,G.M.Knowels,E.M.Schultz,E.J.Fox 1998 Telomere maintenance is dependent on activities re- et al., 2015 dNTP pool levels modulate mutator phenotypes of error- quired for end repair of double-strand breaks. Curr. Biol. 8: prone DNA polymerase epsilon variants. Proc. Natl. Acad. Sci. USA 657–660. https://doi.org/10.1016/S0960-9822(98)70253-2 112: E2457–E2466. https://doi.org/10.1073/pnas.1422948112 Palmbos, P. L., J. M. Daley, and T. E. Wilson, 2005 Mutations of Wilson, T. E., and M. R. Lieber, 1999 Efficient processing of DNA the Yku80 C terminus and Xrs2 FHA domain specifically block ends during yeast nonhomologous end joining. Evidence for a yeast nonhomologous end joining. Mol. Cell. Biol. 25: 10782– DNA polymerase beta (Pol4)-dependent pathway. J. Biol. Chem. 10790. https://doi.org/10.1128/MCB.25.24.10782-10790.2005 274: 23599–23609. https://doi.org/10.1074/jbc.274.33.23599 Palmbos,P.L.,D.Wu,J.M.Daley,andT.E.Wilson,2008 Recruitment Wu, D., L. M. Topper, and T. E. Wilson, 2008 Recruitment and of Saccharomyces cerevisiae Dnl4-Lif1 complex to a double- dissociation of nonhomologous end joining proteins at a DNA strand break requires interactions with Yku80 and the Xrs2 double-strand break in Saccharomyces cerevisiae. Genetics 178: FHA domain. Genetics 180: 1809–1819. https://doi.org/10.1534/ 1237–1249. https://doi.org/10.1534/genetics.107.083535 genetics.108.095539 Zhang, X., and T. T. Paull, 2005 The Mre11/Rad50/Xrs2 complex Pfingsten,J.S.,K.J.Goodrich,C.Taabazuing,F.Ouenzar,P.Chartrand and non-homologous end-joining of incompatible ends in et al., 2012 Mutually exclusive binding of telomerase RNA and S. cerevisiae. DNA Repair (Amst.) 4: 1281–1294. https://doi. DNA by Ku alters telomerase recruitment model. Cell 148: 922– org/10.1016/j.dnarep.2005.06.011 932. https://doi.org/10.1016/j.cell.2012.01.033 Zhang, Y., M. L. Hefferin, L. Chen, E. Y. Shim, H. M. Tseng et al., Ribes-Zamora, A., I. Mihalek, O. Lichtarge, and A. A. Bertuch, 2007 Role of Dnl4-Lif1 in nonhomologous end-joining repair com- 2007 Distinct faces of the Ku heterodimer mediate DNA repair plex assembly and suppression of homologous recombination. Nat. and telomeric functions. Nat. Struct. Mol. Biol. 14: 301–307. Struct.Mol.Biol.14:639–646. https://doi.org/10.1038/nsmb1261 https://doi.org/10.1038/nsmb1214 Zhu, Z., W. H. Chung, E. Y. Shim, S. E. Lee, and G. Ira, 2008 Sgs1 Ribes-Zamora, A., S. M. Indiviglio, I. Mihalek, C. L. Williams, and A. helicase and two nucleases Dna2 and Exo1 resect DNA double- A. Bertuch, 2013 TRF2 interaction with Ku heterotetrameriza- strand break ends. Cell 134: 981–994. https://doi.org/ tion interface gives insight into c-NHEJ prevention at 10.1016/j.cell.2008.08.037 human telomeres. Cell Rep. 5: 194–206. https://doi.org/ 10.1016/j.celrep.2013.08.040 Communicating editor: J. Surtees

128 C. H. Emerson et al.