DOCSLIB.ORG

Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2014 Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders Hannah Schoch University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Schoch, Hannah, "Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders" (2014). Publicly Accessible Penn Dissertations. 1435. https://repository.upenn.edu/edissertations/1435 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1435 For more information, please contact [email protected]. Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders Abstract Neurodevelopmental and neuropsychiatric disorders are a significant and expanding global health crisis. Many individuals affected by these disorders have social and cognitive symptoms represent significant sources of ongoing disability that are refractory to available treatment options. The search for cures and therapies for disorders fundamentally requires an understanding of the core neuropathology and insight into the underlying molecular mechanisms at work. In this dissertation, I describe experiments that we performed to explore molecular and genetic mechanisms underlying memory impairment and enhancement in mice. Synaptic structural proteins form a critical and adjustable framework that supports recruitment of neurotransmitter receptors and facilitates signal transduction. In Chapter 2, we explored a role for the autism-related gene Protocadherin 10 (Pcdh10) as a key regulator of dendritic spine morphology and synapse elimination. We found that mice with reduced PCDH10 have deficits in amygdala function, including impairments in conditioned fear, social interactions and gamma synchrony, as well as increased density of immature filopodia-type spines. In the second part of this dissertation, we showed that the co-repressor SIN3A is a negative regulator of memory formation. In Chapter 3, we demonstrated that reducing levels of SIN3A enhances in long-term memory and hippocampal synaptic plasticity, and increases expression of Homer1, a gene encoding a post-synaptic density protein that regulates signaling through metabotropic glutamate receptors. In Chapter 4, we identified contextual earf deficits in transgenic mice expressing Cre recombinase in forebrain neurons. These results expand our understanding of molecular mechanisms of memory formation, and identify new therapeutic targets for improving cognitive function. Degree Type Dissertation Degree Name Doctor of Philosophy (PhD) Graduate Group Cell & Molecular Biology First Advisor Ted Abel Keywords epigenetics, Homer1, memory formation, mouse models, Pcdh10, Sin3a Subject Categories Neuroscience and Neurobiology This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/1435 MOLECULAR-GENETIC MECHANISMS OF MEMORY FORMATION IN MOUSE MODELS OF NEURODEVELOPMENTAL AND NEUROPSYCHIATRIC DISORDERS Hannah Schoch A DISSERTATION in Cell and Molecular Biology Presented to the Faculties of the University of Pennsylvania in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy 2014 Supervisor of Dissertation _______________ __________ Ted Abel, Ph.D. Brush Family Professor of Biology Graduate Group Chairperson _________________________ Dan Kessler, Ph.D. Associate Professor of Cell and Developmental Biology Dissertation Committee Marisa Bartolomei, Ph.D. Professor of Cell and Developmental Biology Teresa Reyes, Ph.D. Assistant Professor of Pharmacology Peter Klein, MD, Ph.D. Professor of Medicine Tracy Bale, Ph.D. Professor of Neuroscience in Psychiatry ACKNOWLEDGMENT This journey entailed many thousand miles, yet it did not start with one particular step. It was only through the careful guidance of many that I found myself on this path, and only through the patient support of a hundred more was able to reach this point in my journey. Truly, this is not the end of the journey, but only a pause at the top of a hill to look back and appreciate the magnificence of the forest that I may have missed in my scramble to reach the next tree. Much of my success I owe to the support and guidance of Ted Abel. He stuck with me through my early years when I broke everything that I touched (RIP Gs alpha mice) and opened new doors for me to follow my obsession with developmental disorders. Ted taught me so many important life lessons- how to stop doing experiments and THINK, how to peel back the fancy tools to expose the soft center of what is actually being measured, and how to stand tall and be confident in my understanding and interpretation of my results. I will go on to my next adventure well prepared for the challenges ahead. T-6 years to the RO1. I also want to express my sincere appreciation for all the help and guidance I received from my thesis committee members, Marisa, Teresa, Peter and Tracy. Through the rocky start of my dissertation research, and the continual struggles with the Sin3a mouse, you provided constant support and encouragement along the way. As a result of your guidance, I’ve gained a wealth of perspective on how terrible quadruple transgenic mice are, an appreciation of the importance of properly controlled experiments, and a newfound respect for the horrifying effects of nuclease activity on the brain. I will carry this with me always. To the Abel lab- you have had my back for the past 7 years and it’s been one heck of a ride. Through all of the frustration and heartbreak of science, it’s the community of fellow travelers that gets you through. Whether you need another soul who understands how it is to emerge from the ii mouse facility after your 1,068th trial of water maze, or the sympathetic ear of someone who has also watched their research project crash and burn, they always know that what you really need is a funny video or a strategic application of tape to the back of your shirt. By maintaining a high level of foolishness and camaraderie in the lab, the p values of 0.06 are a little easier to accept. Thank you. I want to especially thank Jen and Nicola for their help with building this dissertation your faith in my abilities may not have entirely been misplaced. I am especially grateful for the help and support of my buddy Morg. You’ve stuck with me through the ups and downs, and further downs of the Sin3a project. Together we tamed the devil mouse and extracted his dark secrets. Thanks, buddy. Finally, I am incredibly grateful for my family. For my mom, who encouraged me to go into science, my dad who piqued my interest in the natural world, my brothers and sisters and sister- in-law and nieces and aunts uncles and grandparents who support me on this crazy path that I’m on, and also my cat Bill who stays up with me when I’m trying to hit a deadline. For my archnemesis, Dave, who stuck with me through all the late nights and crazy weeks. He always knew that I would make it here someday. Thank you for your patience and understanding. iii ABSTRACT MOLECULAR-GENETIC MECHANISMS OF MEMORY FORMATION IN MOUSE MODELS OF NEURODEVELOPMENTAL AND NEUROPSYCHIATRIC DISORDERS Hannah Schoch Ted Abel Neurodevelopmental and neuropsychiatric disorders are a significant and expanding global health crisis. Many individuals affected by these disorders have social and cognitive symptoms represent significant sources of ongoing disability that are refractory to available treatment options. The search for cures and therapies for disorders fundamentally requires an understanding of the core neuropathology and insight into the underlying molecular mechanisms at work. In this dissertation, I describe experiments that we performed to explore molecular and genetic mechanisms underlying memory impairment and enhancement in mice. Synaptic structural proteins form a critical and adjustable framework that supports recruitment of neurotransmitter receptors and facilitates signal transduction. In Chapter 2 , we explored a role for the autism-related gene Protocadherin 10 ( Pcdh10 ) as a key regulator of dendritic spine morphology and synapse elimination. We found that mice with reduced PCDH10 have deficits in amygdala function, including impairments in conditioned fear, social interactions and gamma synchrony, as well as increased density of immature filopodia-type spines. In the second part of this dissertation, we showed that the co-repressor SIN3A is a negative regulator of memory formation. In Chapter 3, we demonstrated that reducing levels of SIN3A enhances in long-term memory and hippocampal synaptic plasticity, and iv increases expression of Homer1 , a gene encoding a post-synaptic density protein that regulates signaling through metabotropic glutamate receptors. In Chapter 4 , we identified contextual fear deficits in transgenic mice expressing Cre recombinase in forebrain neurons. These results expand our understanding of molecular mechanisms of memory formation, and identify new therapeutic targets for improving cognitive function. v TABLE OF CONTENTS Contents ACKNOWLEDGMENT ............................................................................................................... II ABSTRACT .................................................................................................................................
Load more

Recommended publications
  • REPORT Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis
    REPORT Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis Theo J. M. Hulsebos, Astrid S. Plomp, Ruud A. Wolterman, Els C. Robanus-Maandag, Frank Baas, and Pieter Wesseling Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofi- bromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. Schwannomatosis (MIM 162091) is characterized by the 10 Only two families with an INI1 germline mutation, an development of multiple spinal, peripheral, and cranial- exon 4 frameshift mutation,11 and an exon 7 donor splice nerve schwannomas in the absence of vestibular schwan- site mutation12 have been described in which multiple nomas.1 The presence of vestibular schwannomas is di- generations were affected by malignant (rhabdoid) tumors agnostic of neurofibromatosis type 2 (NF2 [MIM 101000]). in infancy. In both of these families, clear cases of no- Molecular analyses identified somatically acquired mu- nexpressing obligate carriers of the INI1 mutation were
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The H3.3 Chaperone Hira Complex Orchestrates Oocyte Developmental Competence
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The H3.3 chaperone Hira complex orchestrates oocyte developmental competence Rowena Smith1, *, Zongliang Jiang2, *, Andrej Susor3, Hao Ming2, Janet Tait1, Marco Conti4, and Chih-Jen Lin1,5 1MRC Centre For Reproductive Health, University oF Edinburgh Queen’s Medical Research Institute 47 Little France Crescent, Edinburgh, United Kingdom, EH16 4TJ 2 School oF Animal Sciences, AgCenter, Louisiana State University, Baton Rouge, LA, 70803, USA 3 Laboratory oF Biochemistry and Molecular Biology oF Germ Cells, Institute oF Animal Physiology and Genetics, CAS, Rumburska 89, 277 21 Libechov, Czech Republic 4Center For Reproductive Sciences, University oF CaliFornia, San Francisco, CA 94143, USA 5To whom correspondence should be addressed. Tel: +44 131 242 6237; Email: [email protected] *equal contribution bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Reproductive success relies on a healthy oocyte competent For Fertilisation and capable of sustaining early embryo development. By the end oF oogenesis, the oocyte is characterised by a transcriptionally silenced state, but the signiFicance oF this state and how it is achieved remains poorly understood.
    [Show full text]
  • Control Association Analysis of CABIN1 with Schizophrenia in a Japanese Population
    Journal of Human Genetics (2010) 55, 179–181 & 2010 The Japan Society of Human Genetics All rights reserved 1434-5161/10 $32.00 www.nature.com/jhg SHORT COMMUNICATION A case–control association analysis of CABIN1 with schizophrenia in a Japanese population Yuichiro Watanabe1,2, Ayako Nunokawa1, Naoshi Kaneko1 and Toshiyuki Someya1 Calcineurin (CN) is a calcium/calmodulin-dependent serine/threonine protein phosphatase and regulates neuronal structure, neurotransmission and activity-dependent gene expression. Several studies have indicated that CN signaling is likely to be involved in the pathogenesis of schizophrenia. The gene encoding CN-binding protein 1 (CABIN1) is located on 22q11.23, one of the common susceptibility loci for schizophrenia. Therefore, CABIN1 is a promising functional and positional candidate gene for schizophrenia. To assess whether CABIN1 is implicated in vulnerability to schizophrenia, we conducted a case–control association study between CABIN1 and schizophrenia. The results showed no evidence of an association between CABIN1 and schizophrenia using 11 tagging single nucleotide polymorphisms in 1193 Japanese subjects. Our results suggest that CABIN1 may not confer increased susceptibility for schizophrenia in the Japanese population. Journal of Human Genetics (2010) 55, 179–181; doi:10.1038/jhg.2009.136; published online 15 January 2010 Keywords: CABIN1; case–control study; schizophrenia; tagging SNP Schizophrenia is a complex genetic disorder that affects approximately one study. Fallin et al.10 examined seven polymorphisms in CABIN1 1% of the global population. The pathogenesis of schizophrenia is with an average density of one marker per 20.9 kb and failed to find currently unclear, but there is cumulative evidence that calcineurin any association with schizophrenia.
    [Show full text]
  • Whole-Exome Sequencing of 81 Individuals from 27 Multiply Affected Bipolar Disorder Families Andreas J
    Forstner et al. Translational Psychiatry (2020) 10:57 https://doi.org/10.1038/s41398-020-0732-y Translational Psychiatry ARTICLE Open Access Whole-exome sequencing of 81 individuals from 27 multiply affected bipolar disorder families Andreas J. Forstner1,2,3,4, Sascha B. Fischer 3,5,LorenaM.Schenk2,JanaStrohmaier 6,7, Anna Maaser-Hecker2, Céline S. Reinbold3,5,8, Sugirthan Sivalingam 2, Julian Hecker9,FabianStreit 6, Franziska Degenhardt2, Stephanie H. Witt 6, Johannes Schumacher1,2, Holger Thiele10, Peter Nürnberg10, José Guzman-Parra11, Guillermo Orozco Diaz12, Georg Auburger13,MargotAlbus14, Margitta Borrmann-Hassenbach14,MariaJoséGonzaleź 11, Susana Gil Flores15, Francisco J. Cabaleiro Fabeiro16, Francisco del Río Noriega17, Fermin Perez Perez18, Jesus Haro González19,FabioRivas20, Fermin Mayoral20,MichaelBauer 21, Andrea Pfennig21, Andreas Reif 22, Stefan Herms 2,3,5, Per Hoffmann2,3,5,23, Mehdi Pirooznia24, Fernando S. Goes 24, Marcella Rietschel 6, Markus M. Nöthen2 and Sven Cichon2,3,5,23 Abstract Bipolar disorder (BD) is a highly heritable neuropsychiatric disease characterized by recurrent episodes of depression and mania. Research suggests that the cumulative impact of common alleles explains 25–38% of phenotypic variance, and that rare variants may contribute to BD susceptibility. To identify rare, high-penetrance susceptibility variants for BD, whole-exome sequencing (WES) was performed in three affected individuals from each of 27 multiply affected families from Spain and Germany. WES identified 378 rare, non-synonymous, and potentially functional variants. These spanned 368 genes, and were carried by all three affected members in at least one family. Eight of the 368 genes harbored rare variants that were implicated in at least two independent families.
    [Show full text]
  • Ubinuclein-1 Confers Histone H3.3-Specific-Binding by the HIRA
    ARTICLE Received 22 Apr 2015 | Accepted 1 Jun 2015 | Published 10 Jul 2015 DOI: 10.1038/ncomms8711 OPEN Ubinuclein-1 confers histone H3.3-specific-binding by the HIRA histone chaperone complex M. Daniel Ricketts1,2, Brian Frederick3, Henry Hoff3, Yong Tang3, David C. Schultz3, Taranjit Singh Rai4,5, Maria Grazia Vizioli4, Peter D. Adams4 & Ronen Marmorstein1,2,6 Histone chaperones bind specific histones to mediate their storage, eviction or deposition from/or into chromatin. The HIRA histone chaperone complex, composed of HIRA, ubinuclein-1 (UBN1) and CABIN1, cooperates with the histone chaperone ASF1a to mediate H3.3-specific binding and chromatin deposition. Here we demonstrate that the conserved UBN1 Hpc2-related domain (HRD) is a novel H3.3-specific-binding domain. Biochemical and biophysical studies show the UBN1-HRD preferentially binds H3.3/H4 over H3.1/H4. X-ray crystallographic and mutational studies reveal that conserved residues within the UBN1-HRD and H3.3 G90 as key determinants of UBN1–H3.3-binding specificity. Comparison of the structure with the unrelated H3.3-specific chaperone DAXX reveals nearly identical points of contact between the chaperone and histone in the proximity of H3.3 G90, although the mechanism for H3.3 G90 recognition appears to be distinct. This study points to UBN1 as the determinant of H3.3-specific binding and deposition by the HIRA complex. 1 Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA. 2 Graduate Group in Biochemistry and Molecular Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA.
    [Show full text]
  • Discovery and Systematic Characterization of Risk Variants and Genes For
    medRxiv preprint doi: https://doi.org/10.1101/2021.05.24.21257377; this version posted June 2, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . 1 Discovery and systematic characterization of risk variants and genes for 2 coronary artery disease in over a million participants 3 4 Krishna G Aragam1,2,3,4*, Tao Jiang5*, Anuj Goel6,7*, Stavroula Kanoni8*, Brooke N Wolford9*, 5 Elle M Weeks4, Minxian Wang3,4, George Hindy10, Wei Zhou4,11,12,9, Christopher Grace6,7, 6 Carolina Roselli3, Nicholas A Marston13, Frederick K Kamanu13, Ida Surakka14, Loreto Muñoz 7 Venegas15,16, Paul Sherliker17, Satoshi Koyama18, Kazuyoshi Ishigaki19, Bjørn O Åsvold20,21,22, 8 Michael R Brown23, Ben Brumpton20,21, Paul S de Vries23, Olga Giannakopoulou8, Panagiota 9 Giardoglou24, Daniel F Gudbjartsson25,26, Ulrich Güldener27, Syed M. Ijlal Haider15, Anna 10 Helgadottir25, Maysson Ibrahim28, Adnan Kastrati27,29, Thorsten Kessler27,29, Ling Li27, Lijiang 11 Ma30,31, Thomas Meitinger32,33,29, Sören Mucha15, Matthias Munz15, Federico Murgia28, Jonas B 12 Nielsen34,20, Markus M Nöthen35, Shichao Pang27, Tobias Reinberger15, Gudmar Thorleifsson25, 13 Moritz von Scheidt27,29, Jacob K Ulirsch4,11,36, EPIC-CVD Consortium, Biobank Japan, David O 14 Arnar25,37,38, Deepak S Atri39,3, Noël P Burtt4, Maria C Costanzo4, Jason Flannick40, Rajat M 15 Gupta39,3,4, Kaoru Ito18, Dong-Keun Jang4,
    [Show full text]
  • UNIVERSITY of CALIFORNIA, SAN DIEGO Measuring
    UNIVERSITY OF CALIFORNIA, SAN DIEGO Measuring and Correlating Blood and Brain Gene Expression Levels: Assays, Inbred Mouse Strain Comparisons, and Applications to Human Disease Assessment A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences by Mary Elizabeth Winn Committee in charge: Professor Nicholas J Schork, Chair Professor Gene Yeo, Co-Chair Professor Eric Courchesne Professor Ron Kuczenski Professor Sanford Shattil 2011 Copyright Mary Elizabeth Winn, 2011 All rights reserved. 2 The dissertation of Mary Elizabeth Winn is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2011 iii DEDICATION To my parents, Dennis E. Winn II and Ann M. Winn, to my siblings, Jessica A. Winn and Stephen J. Winn, and to all who have supported me throughout this journey. iv TABLE OF CONTENTS Signature Page iii Dedication iv Table of Contents v List of Figures viii List of Tables x Acknowledgements xiii Vita xvi Abstract of Dissertation xix Chapter 1 Introduction and Background 1 INTRODUCTION 2 Translational Genomics, Genome-wide Expression Analysis, and Biomarker Discovery 2 Neuropsychiatric Diseases, Tissue Accessibility and Blood-based Gene Expression 4 Mouse Models of Human Disease 5 Microarray Gene Expression Profiling and Globin Reduction 7 Finding and Accessible Surrogate Tissue for Neural Tissue 9 Genetic Background Effect Analysis 11 SPECIFIC AIMS 12 ENUMERATION OF CHAPTERS
    [Show full text]
  • MEF2I JCI-Final-5-30
    Supplemental Materials. 1. Extended Experimental Procedures 2. Supplemental Figure 1. qPCR of cardiac growth-associated genes. 3. Supplemental Figure 2. Echocardiographic measurements - TAC prevention model. 4. Supplemental Figure 3. Additional echocardiographic measurements - reversal model. 5. Supplemental Figure 4. HDAC5 nuclear localization. 6. Supplemental Table 1. Human clinical samples. 7. Supplemental Table 2. Blood chemistries of 8MI treated mice. 8. Supplemental Table 3. Annotations of hypertrophy-associated genes normalized by 8MI. 9. Supplemental Table 4. Ingenuity pathways and networks. 10.Supplemental Table 5. Gene Set Enrichment Analysis. Extended Experimental Procedures Reagents Antibodies were obtained from the following vendors: anti-MEF2 and anti-HDAC4 from Santa Cruz Biotechnology (Santa Cruz, California, USA), anti-GATA4 and anti-acetyl-lysine from Upstate (Charlottesville, Virginia, USA), anti-actin from Chemicon (Danvers, Massachusetts, USA), anti-HDAC5 and anti–p(S498)-HDAC5 were from Millipore and Abcam respectively. Trichostatin A (TSA) was purchased from Selleck Chemicals and MC1568 was provided by Sigma. The Amersham ECL Western detection system (GE Healthcare Bio-Sciences, Piscataway, New Jersey, USA) was used for chemiluminescence visualization of immunoblots. Reagents for real-time polymerase chain reaction (PCR) including Master Mix® and primers with TaqMan® probes were obtained from Applied Biosystems (Foster City, California, USA). RNA extraction was performed using Trizol (Molecular Research Center, Inc, Cincinnati, Ohio, USA). Rhodamine-conjugated phalloidin and wheat germ agglutinin (WGA) were purchased from Invitrogen (Carlsbad, California, USA). Myocyte cell culture Primary neonatal rat ventricular cardiomyocyte cultures were prepared from the hearts of 1- 3 day-old neonatal rat pups (Charles River, Wilmington, Massachusetts, USA) as previously described {Bishopric, 1991 #920}, by sequential digestion in a trypsin-containing calcium- free buffer and trituration.
    [Show full text]
  • Transcriptome Profiling Reveals the Complexity of Pirfenidone Effects in IPF
    ERJ Express. Published on August 30, 2018 as doi: 10.1183/13993003.00564-2018 Early View Original article Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska, Anna Gungl, Jochen Wilhelm, Leigh M. Marsh, Helene Thekkekara Puthenparampil, Katharina Sinn, Miroslava Didiasova, Walter Klepetko, Djuro Kosanovic, Ralph T. Schermuly, Lukasz Wujak, Benjamin Weiss, Liliana Schaefer, Marc Schneider, Michael Kreuter, Andrea Olschewski, Werner Seeger, Horst Olschewski, Malgorzata Wygrecka Please cite this article as: Kwapiszewska G, Gungl A, Wilhelm J, et al. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF. Eur Respir J 2018; in press (https://doi.org/10.1183/13993003.00564-2018). This manuscript has recently been accepted for publication in the European Respiratory Journal. It is published here in its accepted form prior to copyediting and typesetting by our production team. After these production processes are complete and the authors have approved the resulting proofs, the article will move to the latest issue of the ERJ online. Copyright ©ERS 2018 Copyright 2018 by the European Respiratory Society. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska1,2, Anna Gungl2, Jochen Wilhelm3†, Leigh M. Marsh1, Helene Thekkekara Puthenparampil1, Katharina Sinn4, Miroslava Didiasova5, Walter Klepetko4, Djuro Kosanovic3, Ralph T. Schermuly3†, Lukasz Wujak5, Benjamin Weiss6, Liliana Schaefer7, Marc Schneider8†, Michael Kreuter8†, Andrea Olschewski1,
    [Show full text]
  • A Systems Immunology Approach Identifies the Collective Impact of Five Mirs in Th2 Inflammation Supplementary Information
    A systems immunology approach identifies the collective impact of five miRs in Th2 inflammation Supplementary information Ayşe Kılıç, Marc Santolini, Taiji Nakano, Matthias Schiller, Mizue Teranishi,Pascal Gellert, Yuliya Ponomareva, Thomas Braun, Shizuka Uchida, Scott T. Weiss, Amitabh Sharma and Harald Renz Corresponding Author: Harald Renz, MD Institute of Laboratory Medicine Philipps University Marburg 35043 Marburg, Germany Phone +49 6421 586 6235 [email protected] 1 Kılıç A et. al. 2018 A B C D PBS OVA chronic PAS PAS (cm H2O*s/ml (cm Raw Sirius Red Sirius Supplementary figure 1: Characteristic phenotype of the acute and chronic allergic airway inflammatory response in the OVA-induced mouse model. (a) Total and differential cell counts determined in BAL and cytospins show a dominant influx of eosinophils. (b) Serum titers of OVA-specific immunoglobulins are elevated. (c) Representative measurement of airway reactivity to increasing methacholine (Mch) responsiveness measured by head-out body plethysmography. (d) Representative lung section staining depicting airway inflammation and mucus production (PAS, original magnification x 10) and airway remodeling (SiriusRed; original magnification x 20). Data are presented as mean ± SEM and are representative for at least 3 independent experiments with n=8-10 animals per group. Statistical analyses have been performed with one-way ANOVA and Tukey’s post-test and show *p<0.05, **p<0.01 and ***p<0.001. 2 Kılıç A et. al. 2018 lymphocytes A lung activated CD4+-cells CD4+-T-cell-subpopulations SSC FSC ST2 live CD69 CD4 CXCR3 B spleen Naive CD4+- T cells DAPI FSC single cells SSC CD62L CD4 CD44 FSC FSC-W Supplementary figure 2.
    [Show full text]
  • (CABIN1) (NM 012295) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC211750 CAIN (CABIN1) (NM_012295) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CAIN (CABIN1) (NM_012295) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CABIN1 Synonyms: CAIN; KB-318B8.7; PPP3IN Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC211750 representing NM_012295 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATTCGAATTGCAGCCTTAAATGCCAGCTCCACCATTGAGGATGATCATGAAGGAAGCTTTAAAAGTC ACAAAACCCAGACAAAGGAGGCTCAGGAAGCAGAGGCTTTTGCATTGTACCACAAGGCCCTTGATCTGCA GAAACATGACCGGTTTGAGGAGTCTGCCAAAGCCTACCATGAGCTCTTGGAGGCGAGCCTGCTGCGGGAG GCAGTTTCATCCGGTGATGAGAAAGAGGGGTTGAAACACCCTGGGCTGATACTGAAATATTCCACTTATA AGAACTTGGCCCAGCTGGCAGCCCAGCGGGAGGATCTGGAGACAGCCATGGAGTTCTACTTAGAGGCAGT GATGCTGGACTCCACAGATGTCAACCTCTGGTATAAGATTGGACATGTGGCCCTGAGGCTCATCCGGATC CCCCTGGCTCGCCATGCTTTTGAGGAAGGGCTGCGGTGCAATCCTGACCACTGGCCCTGTTTGGATAACC TAATCACTGTCCTGTACACCCTCAGTGATTACACAACATGTCTGTACTTCATCTGCAAAGCTTTGGAGAA GGATTGCCGGTACAGCAAAGGGCTGGTCCTCAAGGAGAAGATTTTTGAGGAGCAGCCTTGTCTCCGGAAG GACTCTCTCAGAATGTTCCTCAAATGTGACATGTCGATTCACGATGTTTCGGTGAGTGCAGCTGAGACAC AGGCGATTGTAGATGAGGCCTTGGGGCTGCGAAAAAAGAGGCAAGCGCTGATTGTGCGGGAGAAGGAGCC GGACCTGAAACTTGTGCAGCCCATTCCTTTCTTCACCTGGAAGTGCCTCGGAGAGAGCTTGCTGGCCATG
    [Show full text]