DOCSLIB.ORG

The H3.3 Chaperone Hira Complex Orchestrates Oocyte Developmental Competence

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The H3.3 Chaperone Hira Complex Orchestrates Oocyte Developmental Competence bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The H3.3 chaperone Hira complex orchestrates oocyte developmental competence Rowena Smith1, *, Zongliang Jiang2, *, Andrej Susor3, Hao Ming2, Janet Tait1, Marco Conti4, and Chih-Jen Lin1,5 1MRC Centre For Reproductive Health, University oF Edinburgh Queen’s Medical Research Institute 47 Little France Crescent, Edinburgh, United Kingdom, EH16 4TJ 2 School oF Animal Sciences, AgCenter, Louisiana State University, Baton Rouge, LA, 70803, USA 3 Laboratory oF Biochemistry and Molecular Biology oF Germ Cells, Institute oF Animal Physiology and Genetics, CAS, Rumburska 89, 277 21 Libechov, Czech Republic 4Center For Reproductive Sciences, University oF CaliFornia, San Francisco, CA 94143, USA 5To whom correspondence should be addressed. Tel: +44 131 242 6237; Email: [email protected] *equal contribution bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Reproductive success relies on a healthy oocyte competent For Fertilisation and capable of sustaining early embryo development. By the end oF oogenesis, the oocyte is characterised by a transcriptionally silenced state, but the signiFicance oF this state and how it is achieved remains poorly understood. Histone H3.3, one oF the H3 variants, has unique Functions in chromatin structure and gene expression that are cell cycle-independent. We report here a comprehensive characterisation of the roles of the subunits oF the Hira complex (i.e. Hira, Cabin1 and Ubn1), which is primarily responsible For H3.3 deposition during mouse oocyte development. Loss-of- Function oF any component oF the Hira complex led to early embryogenesis Failure. Transcriptome and nascent RNA analyses revealed that mutant oocytes Fail to silence global transcription. Hira complex mutants are unable to establish the H3K4me3 and H3K9me3 repressive marks, resulting in aberrant chromatin accessibility. Among the misregulated genes in mutant oocytes is Zscan4, a 2-cell speciFic gene that is involved in zygote genome activation. Overexpression of Zscan4 recapitulates the phenotypes oF Hira mutants, illustrating that temporal and spatial expression oF Zscan4 is Fine-tuned at the oocyte-to-embryo transition. Thus, the H3.3 chaperone Hira complex has a maternal eFFect Function in oocyte developmental competence and early embryogenesis by modulating chromatin condensation and transcriptional quiescence. bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Introduction Oocytes are key orchestrators oF Fertilisation, initiation of zygotic genome activation and pre-implantation development 1. This potential is deFined as developmental competence. Oocytes deFective in developmental competence are a major cause oF inFertility, a medical condition which aFFects one in six couples. One hallmark Feature oF a competent oocyte is chromatin condensation. During the Final stage oF oocyte growth, oocytes with less condensed chromatin, termed non-surrounded nucleolus (NSN) oocytes, gradually transition to more condensed, surrounded nucleolus (SN) oocytes 2. Transcriptional silencing occurs around this time 3 . However, the molecular components involved have not been deFined and the primary underlying mechanism remains elusive 4. Oocytes enter a protracted meiotic arrest in prophase I and maintain it For a long time, For years in humans, remarkably retaining their competence and genomic integrity. It would then be logical to hypothesise that replication-independent mechanisms oF chromatin regulation may be indispensable to maintain the quality oF oocytes throughout this prolonged meiotic arrest. Histones are the Fundamental blocks oF chromatin that regulate both chromatin compactness and gene transcriptional processes. In addition to canonical histones, histone variants provide additional layers oF regulatory mechanisms in a replication- independent manner. H3.3 is the primary replication-independent histone variant and has been shown to play prominent roles during critical stages oF reproduction, including Fertilisation 5, 6 and early embryonic development 5, 7. However, potential roles oF H3.3 in oocyte transcriptional quiescence remain unexplored. The key chaperone molecules required For H3.3 incorporation into chromatin Form the Hira complex, which comprises Hira, Ubn1, and Cabin1 subunits 8, 9. In this study, we comprehensively dissect the roles oF the Hira complex (Hira, Cabin1, and Ubn1) in establishment and maintainance oF developmental competence in mouse bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. oocytes. We demonstrate that the Hira complex is critical For oocyte developmental competence by stabilising a repressive epigenomic status that maintains transcriptional quiescence in preparation For embryogenesis. bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Results The maternal Hira Complex is essential for oocyte developmental competence To investigate the maternal role oF Hira complex during the oocyte-to-embryo transition, we knocked down Ubn1 in oocytes using an antisense morpholino approach and created new conditional knockout mouse lines targeting Hira and Cabin1, respectively (Fig. 1A). Firstly, we adopted the maternal knockdown approach we developed 10 to inhibit Ubn1 translation in Fully-grown, germinal vesicle (GV) oocytes using antisense morpholino microinjection (Fig. S1A). We then rederived oocyte speciFic knockout mouse lines For Hira and Cabin1. We achieved this by crossing a transgenic Zp3-Cre mouse line with a conditional allele oF Hira to deplete exon 6-7 (hereaFter reFerred to as ZH in this study; the previously published Hira knockout was For exon 4; Fig. S1B) and similarly the Cabin1 mutant line was created by depletion oF exon 6 (hereaFter reFerred to as CabZ in this study; Fig. S1C). To investigate whether maternal Ubn1 is involved in oocyte developmental competence, we compared the developmental potential oF oocytes injected with control antisense morpholino (Ctrl MO) to those injected with Ubn1 antisense morpholino (Ubn1 MO). After microinjection into GV oocytes respectively, we performed in vitro maturation. Oocytes that matured to the MII stage were then used For parthenogenesis and pre-implantation development to the morula-to-blastocyst stage (Fig. S1A). Oocyte depletion oF Ubn1 impaired maturation (55%, compared to Ctrl MO group 65%; p=1.7E-04; Fig. S1D). Importantly, it induced a signiFicant decrease in cleavage to 2-cell (47%, compared to Ctrl MO group 78%; p=3.4E-06; Fig. S1E) as well as development to morula-to-blastocyst stage (11%, compared to Ctrl MO group 65%; p=2.4E-51; Fig. 1B). Our new ZH mutant mice, with the exon 6-7 depletion, display the same phenotypes as those previously reported 10. Mice are inFertile and Form abnormal zygotes. CabZ mutant mice also generate abnormal zygotes (the post-Fertilisation roles oF Cabin1 and Ubn1 will be reported in a separate study, manuscript in bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.114124; this version posted May 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. preparation). To examine the developmental potential oF the oocytes depleted oF Cabin1 oF the Hira complex, we Flushed Fertilised zygotes From CabZ heterozygous controls (CabZ Het) and mutants (CabZ KO), monitored their developmental outcomes, and compared the rate oF development to morula-to-blastocyst stage embryos aFter in vitro culture. CabZ KO embryos had signiFicantly reduced ability to Form morula-to-blastocyst stage embryos (25%, compared to CabZ Het group oF 100%; p=4E-16; Fig. 1C), the majority arrested at the 2-4 cell stages (Fig. 1C), which suggests a deFect in zygotic genome activation 11, 12. To Further examine the maternal Cabin1 contribution to development, we performed parthenogenetic activation on in vitro matured MII oocytes From CabZ Het and CabZ KO mice. Parthenogenetic CabZ KO embryos Failed to develop to morula- to-blastocyst stage and arrested at the 2-4 cell
Load more

Recommended publications
  • REPORT Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis
    REPORT Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis Theo J. M. Hulsebos, Astrid S. Plomp, Ruud A. Wolterman, Els C. Robanus-Maandag, Frank Baas, and Pieter Wesseling Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofi- bromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. Schwannomatosis (MIM 162091) is characterized by the 10 Only two families with an INI1 germline mutation, an development of multiple spinal, peripheral, and cranial- exon 4 frameshift mutation,11 and an exon 7 donor splice nerve schwannomas in the absence of vestibular schwan- site mutation12 have been described in which multiple nomas.1 The presence of vestibular schwannomas is di- generations were affected by malignant (rhabdoid) tumors agnostic of neurofibromatosis type 2 (NF2 [MIM 101000]). in infancy. In both of these families, clear cases of no- Molecular analyses identified somatically acquired mu- nexpressing obligate carriers of the INI1 mutation were
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Control Association Analysis of CABIN1 with Schizophrenia in a Japanese Population
    Journal of Human Genetics (2010) 55, 179–181 & 2010 The Japan Society of Human Genetics All rights reserved 1434-5161/10 $32.00 www.nature.com/jhg SHORT COMMUNICATION A case–control association analysis of CABIN1 with schizophrenia in a Japanese population Yuichiro Watanabe1,2, Ayako Nunokawa1, Naoshi Kaneko1 and Toshiyuki Someya1 Calcineurin (CN) is a calcium/calmodulin-dependent serine/threonine protein phosphatase and regulates neuronal structure, neurotransmission and activity-dependent gene expression. Several studies have indicated that CN signaling is likely to be involved in the pathogenesis of schizophrenia. The gene encoding CN-binding protein 1 (CABIN1) is located on 22q11.23, one of the common susceptibility loci for schizophrenia. Therefore, CABIN1 is a promising functional and positional candidate gene for schizophrenia. To assess whether CABIN1 is implicated in vulnerability to schizophrenia, we conducted a case–control association study between CABIN1 and schizophrenia. The results showed no evidence of an association between CABIN1 and schizophrenia using 11 tagging single nucleotide polymorphisms in 1193 Japanese subjects. Our results suggest that CABIN1 may not confer increased susceptibility for schizophrenia in the Japanese population. Journal of Human Genetics (2010) 55, 179–181; doi:10.1038/jhg.2009.136; published online 15 January 2010 Keywords: CABIN1; case–control study; schizophrenia; tagging SNP Schizophrenia is a complex genetic disorder that affects approximately one study. Fallin et al.10 examined seven polymorphisms in CABIN1 1% of the global population. The pathogenesis of schizophrenia is with an average density of one marker per 20.9 kb and failed to find currently unclear, but there is cumulative evidence that calcineurin any association with schizophrenia.
    [Show full text]
  • Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2014 Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders Hannah Schoch University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Schoch, Hannah, "Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders" (2014). Publicly Accessible Penn Dissertations. 1435. https://repository.upenn.edu/edissertations/1435 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1435 For more information, please contact [email protected]. Molecular-Genetic Mechanisms of Memory Formation in Mouse Models of Neurodevelopmental and Neuropsychiatric Disorders Abstract Neurodevelopmental and neuropsychiatric disorders are a significant and expanding global health crisis. Many individuals affected by these disorders have social and cognitive symptoms represent significant sources of ongoing disability that are refractory to available treatment options. The search for cures and therapies for disorders fundamentally requires an understanding of the core neuropathology and insight into the underlying molecular mechanisms at work. In this dissertation, I describe experiments that we performed to explore molecular and genetic mechanisms underlying memory impairment and enhancement
    [Show full text]
  • Whole-Exome Sequencing of 81 Individuals from 27 Multiply Affected Bipolar Disorder Families Andreas J
    Forstner et al. Translational Psychiatry (2020) 10:57 https://doi.org/10.1038/s41398-020-0732-y Translational Psychiatry ARTICLE Open Access Whole-exome sequencing of 81 individuals from 27 multiply affected bipolar disorder families Andreas J. Forstner1,2,3,4, Sascha B. Fischer 3,5,LorenaM.Schenk2,JanaStrohmaier 6,7, Anna Maaser-Hecker2, Céline S. Reinbold3,5,8, Sugirthan Sivalingam 2, Julian Hecker9,FabianStreit 6, Franziska Degenhardt2, Stephanie H. Witt 6, Johannes Schumacher1,2, Holger Thiele10, Peter Nürnberg10, José Guzman-Parra11, Guillermo Orozco Diaz12, Georg Auburger13,MargotAlbus14, Margitta Borrmann-Hassenbach14,MariaJoséGonzaleź 11, Susana Gil Flores15, Francisco J. Cabaleiro Fabeiro16, Francisco del Río Noriega17, Fermin Perez Perez18, Jesus Haro González19,FabioRivas20, Fermin Mayoral20,MichaelBauer 21, Andrea Pfennig21, Andreas Reif 22, Stefan Herms 2,3,5, Per Hoffmann2,3,5,23, Mehdi Pirooznia24, Fernando S. Goes 24, Marcella Rietschel 6, Markus M. Nöthen2 and Sven Cichon2,3,5,23 Abstract Bipolar disorder (BD) is a highly heritable neuropsychiatric disease characterized by recurrent episodes of depression and mania. Research suggests that the cumulative impact of common alleles explains 25–38% of phenotypic variance, and that rare variants may contribute to BD susceptibility. To identify rare, high-penetrance susceptibility variants for BD, whole-exome sequencing (WES) was performed in three affected individuals from each of 27 multiply affected families from Spain and Germany. WES identified 378 rare, non-synonymous, and potentially functional variants. These spanned 368 genes, and were carried by all three affected members in at least one family. Eight of the 368 genes harbored rare variants that were implicated in at least two independent families.
    [Show full text]
  • Ubinuclein-1 Confers Histone H3.3-Specific-Binding by the HIRA
    ARTICLE Received 22 Apr 2015 | Accepted 1 Jun 2015 | Published 10 Jul 2015 DOI: 10.1038/ncomms8711 OPEN Ubinuclein-1 confers histone H3.3-specific-binding by the HIRA histone chaperone complex M. Daniel Ricketts1,2, Brian Frederick3, Henry Hoff3, Yong Tang3, David C. Schultz3, Taranjit Singh Rai4,5, Maria Grazia Vizioli4, Peter D. Adams4 & Ronen Marmorstein1,2,6 Histone chaperones bind specific histones to mediate their storage, eviction or deposition from/or into chromatin. The HIRA histone chaperone complex, composed of HIRA, ubinuclein-1 (UBN1) and CABIN1, cooperates with the histone chaperone ASF1a to mediate H3.3-specific binding and chromatin deposition. Here we demonstrate that the conserved UBN1 Hpc2-related domain (HRD) is a novel H3.3-specific-binding domain. Biochemical and biophysical studies show the UBN1-HRD preferentially binds H3.3/H4 over H3.1/H4. X-ray crystallographic and mutational studies reveal that conserved residues within the UBN1-HRD and H3.3 G90 as key determinants of UBN1–H3.3-binding specificity. Comparison of the structure with the unrelated H3.3-specific chaperone DAXX reveals nearly identical points of contact between the chaperone and histone in the proximity of H3.3 G90, although the mechanism for H3.3 G90 recognition appears to be distinct. This study points to UBN1 as the determinant of H3.3-specific binding and deposition by the HIRA complex. 1 Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA. 2 Graduate Group in Biochemistry and Molecular Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA.
    [Show full text]
  • Discovery and Systematic Characterization of Risk Variants and Genes For
    medRxiv preprint doi: https://doi.org/10.1101/2021.05.24.21257377; this version posted June 2, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . 1 Discovery and systematic characterization of risk variants and genes for 2 coronary artery disease in over a million participants 3 4 Krishna G Aragam1,2,3,4*, Tao Jiang5*, Anuj Goel6,7*, Stavroula Kanoni8*, Brooke N Wolford9*, 5 Elle M Weeks4, Minxian Wang3,4, George Hindy10, Wei Zhou4,11,12,9, Christopher Grace6,7, 6 Carolina Roselli3, Nicholas A Marston13, Frederick K Kamanu13, Ida Surakka14, Loreto Muñoz 7 Venegas15,16, Paul Sherliker17, Satoshi Koyama18, Kazuyoshi Ishigaki19, Bjørn O Åsvold20,21,22, 8 Michael R Brown23, Ben Brumpton20,21, Paul S de Vries23, Olga Giannakopoulou8, Panagiota 9 Giardoglou24, Daniel F Gudbjartsson25,26, Ulrich Güldener27, Syed M. Ijlal Haider15, Anna 10 Helgadottir25, Maysson Ibrahim28, Adnan Kastrati27,29, Thorsten Kessler27,29, Ling Li27, Lijiang 11 Ma30,31, Thomas Meitinger32,33,29, Sören Mucha15, Matthias Munz15, Federico Murgia28, Jonas B 12 Nielsen34,20, Markus M Nöthen35, Shichao Pang27, Tobias Reinberger15, Gudmar Thorleifsson25, 13 Moritz von Scheidt27,29, Jacob K Ulirsch4,11,36, EPIC-CVD Consortium, Biobank Japan, David O 14 Arnar25,37,38, Deepak S Atri39,3, Noël P Burtt4, Maria C Costanzo4, Jason Flannick40, Rajat M 15 Gupta39,3,4, Kaoru Ito18, Dong-Keun Jang4,
    [Show full text]
  • UNIVERSITY of CALIFORNIA, SAN DIEGO Measuring
    UNIVERSITY OF CALIFORNIA, SAN DIEGO Measuring and Correlating Blood and Brain Gene Expression Levels: Assays, Inbred Mouse Strain Comparisons, and Applications to Human Disease Assessment A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences by Mary Elizabeth Winn Committee in charge: Professor Nicholas J Schork, Chair Professor Gene Yeo, Co-Chair Professor Eric Courchesne Professor Ron Kuczenski Professor Sanford Shattil 2011 Copyright Mary Elizabeth Winn, 2011 All rights reserved. 2 The dissertation of Mary Elizabeth Winn is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2011 iii DEDICATION To my parents, Dennis E. Winn II and Ann M. Winn, to my siblings, Jessica A. Winn and Stephen J. Winn, and to all who have supported me throughout this journey. iv TABLE OF CONTENTS Signature Page iii Dedication iv Table of Contents v List of Figures viii List of Tables x Acknowledgements xiii Vita xvi Abstract of Dissertation xix Chapter 1 Introduction and Background 1 INTRODUCTION 2 Translational Genomics, Genome-wide Expression Analysis, and Biomarker Discovery 2 Neuropsychiatric Diseases, Tissue Accessibility and Blood-based Gene Expression 4 Mouse Models of Human Disease 5 Microarray Gene Expression Profiling and Globin Reduction 7 Finding and Accessible Surrogate Tissue for Neural Tissue 9 Genetic Background Effect Analysis 11 SPECIFIC AIMS 12 ENUMERATION OF CHAPTERS
    [Show full text]
  • MEF2I JCI-Final-5-30
    Supplemental Materials. 1. Extended Experimental Procedures 2. Supplemental Figure 1. qPCR of cardiac growth-associated genes. 3. Supplemental Figure 2. Echocardiographic measurements - TAC prevention model. 4. Supplemental Figure 3. Additional echocardiographic measurements - reversal model. 5. Supplemental Figure 4. HDAC5 nuclear localization. 6. Supplemental Table 1. Human clinical samples. 7. Supplemental Table 2. Blood chemistries of 8MI treated mice. 8. Supplemental Table 3. Annotations of hypertrophy-associated genes normalized by 8MI. 9. Supplemental Table 4. Ingenuity pathways and networks. 10.Supplemental Table 5. Gene Set Enrichment Analysis. Extended Experimental Procedures Reagents Antibodies were obtained from the following vendors: anti-MEF2 and anti-HDAC4 from Santa Cruz Biotechnology (Santa Cruz, California, USA), anti-GATA4 and anti-acetyl-lysine from Upstate (Charlottesville, Virginia, USA), anti-actin from Chemicon (Danvers, Massachusetts, USA), anti-HDAC5 and anti–p(S498)-HDAC5 were from Millipore and Abcam respectively. Trichostatin A (TSA) was purchased from Selleck Chemicals and MC1568 was provided by Sigma. The Amersham ECL Western detection system (GE Healthcare Bio-Sciences, Piscataway, New Jersey, USA) was used for chemiluminescence visualization of immunoblots. Reagents for real-time polymerase chain reaction (PCR) including Master Mix® and primers with TaqMan® probes were obtained from Applied Biosystems (Foster City, California, USA). RNA extraction was performed using Trizol (Molecular Research Center, Inc, Cincinnati, Ohio, USA). Rhodamine-conjugated phalloidin and wheat germ agglutinin (WGA) were purchased from Invitrogen (Carlsbad, California, USA). Myocyte cell culture Primary neonatal rat ventricular cardiomyocyte cultures were prepared from the hearts of 1- 3 day-old neonatal rat pups (Charles River, Wilmington, Massachusetts, USA) as previously described {Bishopric, 1991 #920}, by sequential digestion in a trypsin-containing calcium- free buffer and trituration.
    [Show full text]
  • Transcriptome Profiling Reveals the Complexity of Pirfenidone Effects in IPF
    ERJ Express. Published on August 30, 2018 as doi: 10.1183/13993003.00564-2018 Early View Original article Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska, Anna Gungl, Jochen Wilhelm, Leigh M. Marsh, Helene Thekkekara Puthenparampil, Katharina Sinn, Miroslava Didiasova, Walter Klepetko, Djuro Kosanovic, Ralph T. Schermuly, Lukasz Wujak, Benjamin Weiss, Liliana Schaefer, Marc Schneider, Michael Kreuter, Andrea Olschewski, Werner Seeger, Horst Olschewski, Malgorzata Wygrecka Please cite this article as: Kwapiszewska G, Gungl A, Wilhelm J, et al. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF. Eur Respir J 2018; in press (https://doi.org/10.1183/13993003.00564-2018). This manuscript has recently been accepted for publication in the European Respiratory Journal. It is published here in its accepted form prior to copyediting and typesetting by our production team. After these production processes are complete and the authors have approved the resulting proofs, the article will move to the latest issue of the ERJ online. Copyright ©ERS 2018 Copyright 2018 by the European Respiratory Society. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska1,2, Anna Gungl2, Jochen Wilhelm3†, Leigh M. Marsh1, Helene Thekkekara Puthenparampil1, Katharina Sinn4, Miroslava Didiasova5, Walter Klepetko4, Djuro Kosanovic3, Ralph T. Schermuly3†, Lukasz Wujak5, Benjamin Weiss6, Liliana Schaefer7, Marc Schneider8†, Michael Kreuter8†, Andrea Olschewski1,
    [Show full text]
  • A Systems Immunology Approach Identifies the Collective Impact of Five Mirs in Th2 Inflammation Supplementary Information
    A systems immunology approach identifies the collective impact of five miRs in Th2 inflammation Supplementary information Ayşe Kılıç, Marc Santolini, Taiji Nakano, Matthias Schiller, Mizue Teranishi,Pascal Gellert, Yuliya Ponomareva, Thomas Braun, Shizuka Uchida, Scott T. Weiss, Amitabh Sharma and Harald Renz Corresponding Author: Harald Renz, MD Institute of Laboratory Medicine Philipps University Marburg 35043 Marburg, Germany Phone +49 6421 586 6235 [email protected] 1 Kılıç A et. al. 2018 A B C D PBS OVA chronic PAS PAS (cm H2O*s/ml (cm Raw Sirius Red Sirius Supplementary figure 1: Characteristic phenotype of the acute and chronic allergic airway inflammatory response in the OVA-induced mouse model. (a) Total and differential cell counts determined in BAL and cytospins show a dominant influx of eosinophils. (b) Serum titers of OVA-specific immunoglobulins are elevated. (c) Representative measurement of airway reactivity to increasing methacholine (Mch) responsiveness measured by head-out body plethysmography. (d) Representative lung section staining depicting airway inflammation and mucus production (PAS, original magnification x 10) and airway remodeling (SiriusRed; original magnification x 20). Data are presented as mean ± SEM and are representative for at least 3 independent experiments with n=8-10 animals per group. Statistical analyses have been performed with one-way ANOVA and Tukey’s post-test and show *p<0.05, **p<0.01 and ***p<0.001. 2 Kılıç A et. al. 2018 lymphocytes A lung activated CD4+-cells CD4+-T-cell-subpopulations SSC FSC ST2 live CD69 CD4 CXCR3 B spleen Naive CD4+- T cells DAPI FSC single cells SSC CD62L CD4 CD44 FSC FSC-W Supplementary figure 2.
    [Show full text]
  • (CABIN1) (NM 012295) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC211750 CAIN (CABIN1) (NM_012295) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CAIN (CABIN1) (NM_012295) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CABIN1 Synonyms: CAIN; KB-318B8.7; PPP3IN Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC211750 representing NM_012295 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATTCGAATTGCAGCCTTAAATGCCAGCTCCACCATTGAGGATGATCATGAAGGAAGCTTTAAAAGTC ACAAAACCCAGACAAAGGAGGCTCAGGAAGCAGAGGCTTTTGCATTGTACCACAAGGCCCTTGATCTGCA GAAACATGACCGGTTTGAGGAGTCTGCCAAAGCCTACCATGAGCTCTTGGAGGCGAGCCTGCTGCGGGAG GCAGTTTCATCCGGTGATGAGAAAGAGGGGTTGAAACACCCTGGGCTGATACTGAAATATTCCACTTATA AGAACTTGGCCCAGCTGGCAGCCCAGCGGGAGGATCTGGAGACAGCCATGGAGTTCTACTTAGAGGCAGT GATGCTGGACTCCACAGATGTCAACCTCTGGTATAAGATTGGACATGTGGCCCTGAGGCTCATCCGGATC CCCCTGGCTCGCCATGCTTTTGAGGAAGGGCTGCGGTGCAATCCTGACCACTGGCCCTGTTTGGATAACC TAATCACTGTCCTGTACACCCTCAGTGATTACACAACATGTCTGTACTTCATCTGCAAAGCTTTGGAGAA GGATTGCCGGTACAGCAAAGGGCTGGTCCTCAAGGAGAAGATTTTTGAGGAGCAGCCTTGTCTCCGGAAG GACTCTCTCAGAATGTTCCTCAAATGTGACATGTCGATTCACGATGTTTCGGTGAGTGCAGCTGAGACAC AGGCGATTGTAGATGAGGCCTTGGGGCTGCGAAAAAAGAGGCAAGCGCTGATTGTGCGGGAGAAGGAGCC GGACCTGAAACTTGTGCAGCCCATTCCTTTCTTCACCTGGAAGTGCCTCGGAGAGAGCTTGCTGGCCATG
    [Show full text]