COI Barcoding of the Shorebirds: Rates of Evolution and the Identification of Species

Home , Amami woodcock, Bukidnon woodcock, Dolphin gull, Fuegian snipe, Giant snipe, Green sandpiper

Rebecca Elbourne

A thesis submitted in conformity with the requirements for the degree of Master of Science Ecology and Evolutionary Biology University of Toronto

COI Barcoding of the Shorebirds: Rates of Evolution and the Identification of Species

Rebecca Elbourne

Master of Science

Ecology and Evolutionary Biology University of Toronto

2011 Abstract

This study assembles COI barcodes from 1814 specimens from the shorebird order,

Charadriiformes and examines variation relative to time, rate of evolution and taxonomic level.

In the suborder Scolopaci, 95% of sampled species were identified correctly. COI barcode variation within monotypic species was low (0-1% maximum distance) but showed a wide range within polytypic species (0-5%). Preliminary Charadrii results suggest similar trends but success is reduced in the third suborder, Lari. Rates of COI evolution are found to be lowest in the Lari and this leads to reduced species identification in recently radiated families: just 49% of the

Laridae and 57% of the Stercoraridae are identified but 100% of the older Alcidae. In the faster

Scolopaci, subspecies are at the limit of resolution with some well differentiated subspecies not distinguished by barcodes. The interplay of evolutionary rates, divergence dates and gene flow appears to determine COI barcode differentiation between taxa.

Acknowledgments

I must first thank my supervisor Allan Baker for bringing me into the fascinating world of the Royal Ontario Museum and allowing me to explore the amazing collection of the Department of Ornithology. His passion for his work has been inspiring and his patience as I learned the ropes has been deeply appreciated. I have had the good fortune to have been helped along by many excellent people while completing my degree. Fellow bird barcoder, Erika Sendra Tavares, was always innovative, cheerful and generous. Oliver Haddrath taught me everything I know about lab work and tirelessly guided all of us students over endless hurdles while somehow managing to carry on with his own innovative research. Mark Peck, a fine naturalist who collected and preserved many of the specimens used in this study, was always keen to solve mysteries and help me see the birds behind the barcodes. Sergio Pereira got me hooked on evolutionary rates and answered many late-night emails about crazy software and weird ideas. My lab mates Alison Cloutier, Nichola Chong, Yvonne Verkeuil, Maryann Burbridge, Rosemary Gibson and Pasan Samarisin were always interesting, fun, helpful and a pleasure to work with. Kristen Choffe kept her great sense of humour even while juggling all of our ABI needs. Cathy Dutton and Sue Chopra always knew how to get things done (and organised fine Christmas parties!). Professors Sue Varmuza and Peter Andolfatto opened my eyes to just how exciting biology can be. Doug Currie told me to “Go for it” at a critical time and has been consistently helpful and supportive. The biggest thanks must go to my family: Simon and Alex who make things easy by being decent, caring individuals and my husband Brian who has supported me throughout. Brian, it was your belief in me that pulled me through. Thank-you.

Many thanks to Jan Bolding Christensen of the Zoological Museum of the University of Copenhagen, Sharon Birks of the Burke Museum, Janet Hinshaw of the Museum of Zoology of the University of Michigan, and Robb Brumfield of the Louisiana State University Museum of Zoology for tissue loans. Thanks also to Mark Peck and Erica Sendra Tavares for generously allowing the use of unpublished sequences. Funding for this work was provided by OGS and the Canadian Barcode of Life Network from Genome Canada through the Ontario Genomics Institute, NSERC and other sponsors listed at www.BOLNET.ca.

iii

Table of Contents

Acknowledgments ...... iii Table of Contents ...... iv List of Tables ...... vi List of Figures ...... vii List of Appendices ...... viii CHAPTER ONE Introduction: Barcoding the Birds of the World ...... 1 CHAPTER TWO Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation ...... 12 2.1 Introduction ...... 13 2.2 Methods ...... 16 Taxon sampling ...... 16 DNA amplification and sequencing ...... 17 Analysis ...... 18 2.3 Results ...... 20 Species Identification ...... 20 Subspecies identification and putative new species ...... 30 Preliminary results from the suborder Charadrii ...... 37 2.4 Discussion ...... 44 Scolopaci barcodes support current research findings ...... 44 Deep splits within polytypic species point to new research directions ...... 46 Distances within and between species and subspecies form a continuous spectrum ...... 47 Phenotypes may differentiate faster than COI barcodes ...... 47 Conclusion ...... 51 CHAPTER THREE Barcoding the Lari: Rates of Evolution and the Identification of Species ...... 53 3.1 Introduction ...... 53 3.2 Methods ...... 57 Taxon sampling ...... 57 DNA amplification and sequencing ...... 58

Analysis ...... 59 Substitution rates ...... 60 3.3 Results ...... 62 Species identification in Gulls and skuas ...... 62 Species Indentification in Auks and Terns ...... 76 Poor resolution in Lari matched by low rates of COI substitution ...... 78 3.4 Discussion ...... 81 Reduced rate of COI substitution may slow barcode differentiation ...... 81 Gene flow may slow barcode differentiation ...... 82 Skuas and Masked Gulls: further evidence ...... 84 Alcids: slow substitution rate is overcome by species age ...... 85 Conclusion: interplay of dates, rates and flow determines barcoding success ...... 86 CHAPTER FOUR Conclusion ...... 87 REFERENCES ...... 91 Appendix 1: Charadriiformes specimens used in this study ...... 103

List of Tables

CHAPTER TWO Table 2.1: Barcoding statistics for Scolopaci species...... 21 Table 2.2: Barcodes of Scolopacidae and Thinocoridae subspecies ...... 25 Table 2.3: Barcoding statistics for Charadrii species ...... 41

CHAPTER THREE Table 3.1: Amplification and sequencing primers for COI barcoding of Charadriiiform birds .. 59 Table 3.2: Summary of barcoding statistics for five Lari families...... 63 Table 3.3: Barcoding statistics for five Lari families...... 64

List of Figures

CHAPTER TWO Fig. 2.1a. Maximum intraspecific K2P barcode distances in the Scolopaci...... 27 Fig.2.1b. K2P distances between COI barcodes of nearest-neighbours within the Scolopaci. .... 27 Fig. 2.2. Scolopaci species not distinguished by COI barcodes a. Gallinago gallinago and Gallinago delicata ...... 28 b. Coenocorypha pusilla and C. heugeli ...... 28

Fig. 2.3. Tringa solitaria has subspecies with highly divergent COI barcodes ...... 31 Fig. 2.4. Highly divergent COI barcodes in the North American subspecies of Numenius phaeopus...... 31 Fig. 2.5. Divergence of eastern Limosa limosa is suggested by COI barcodes ...... 32 Fig. 2.6. Calidris alpina has groups of subspecies distinguished by COI barcodes ...... 33 Fig. 2.7. Tringa totanus groups distinguished by COI barcodes ...... 34 Fig. 2.8. Small sample suggests Attagis gayi has subspecies distinguished by COI barcodes ..... 35 Fig. 2.9. Examples of polytypic species with subspecies not distinguished by COI barcodes a. Limosa lapponica ...... 36 b. Calidris canutus ...... 36 c. Arenaria interpres ...... 37

Fig. 2.10. Examples of species in the suborder Charadrii with high maximum intraspecific distances a. Vanellus chilensis displays a deep split between southern and central subspecies of South America...... 40 b. Charadrius alexandrinus: American and Asian specimens are paraphyletic...... 40

CHAPTER THREE Fig. 3.1. Stercoraridae species are poorly differentiated by COI barcodes...... 69 Fig. 3.2. Masked gull species are poorly differentiated by COI barcodes ...... 70

vii

Fig. 3.3a. Median joining network of 126 white-headed gull COI barcodes from 17 species ..... 73 b. Regional origin of white-headed gull barcodes ...... 74

Fig. 3.4. COI barcodes of North Pacific murrelets display a 1% split within the endangered Kittlitz Murelet, Brachyramphus brevirostris...... 76 Fig. 3.5. Frequency distribution of estimated rates of COI barcode substitution in shorebird genera reported in Figure 3.6...... 78 Fig. 3.6. Rates of substitution in the COI barcode sequence of shorebird lineages...... 78-79

List of Appendices

Appendix 1: Charadriiformes Specimens used in this Study ...... 102 Part 1: Charadrii specimens ...... 103 Part 2: Lari specimens ...... 114 Part 3: Scolopaci specimens ...... 134

viii

CHAPTER ONE

Introduction: Barcoding the Birds of the World

There are some 10 000 extant species of bird recognized in the world today (Clements et al., 2010). Unlike most other classes of organisms, the discovery of entirely new bird species is rare. Avian systematists may regroup, split or merge taxa as new evidence comes to light, but for the most part the birds in question were previously known. This mature taxonomy and large but manageable number of species make birds an ideal testing ground for a new taxonomic tool, the DNA barcode.

The idea behind DNA barcoding is that the nucleotide sequence of a short, standardized DNA locus should be sufficient to determine the species identity of an organism (Hebert et al., 2003). While variation within a species is to be expected, the right gene should generate clusters of sequences from a single species that are more similar to each other than to the sequences of any other species. If a reference database of representative sequences for a group of species can be compiled, then not only can unknown specimens be identified but this database will double as a catalogue of diversity within the group. Furthermore, the sequencing of new specimens to build such a database will inevitably add to what is known about many groups. This is the beauty of the barcoding concept: the identification tool may be the ultimate goal, but the secondary benefits are every bit as exciting.

A mitochondrial protein-coding gene is an obvious choice for the barcode locus: mitochondrial DNA has been used extensively in phylogeographic and phylogenetic studies since 1979 when it was demonstrated that mitochondrial restriction fragment length polymorphisms could be used to determine relationships between geographic populations of three species of mice (Avise et al., 1979). Twenty years later, sufficient mitochondrial sequence data had accumulated to observe that most congeneric animal species are separated by a certain mitochondrial genetic distance – at least 2% in more than 90% of cases surveyed (Johns and Avise, 1998, Avise and Walker, 1999).

1. Introduction: Barcoding the Birds of the World 2

Properties of mitochondrial protein-coding genes make them well-suited for species identification. These genes encode subunits of enzyme complexes involved in electron transport across the mitochondrial membrane – a key step in cellular respiration in any eukaryote. Since these proteins perform an essential metabolic function while in close contact with other subunits of the same complex, their amino acid sequences are highly constrained. This is particularly true of the cytochrome oxidase sub-unit 1 gene (COI) which codes for a protein that makes up the central core of the cytochrome oxidase enzyme complex (reviewed in Ballard and Whitlock, 2004). At the same time, the substitution rate is generally higher in the mitochondria than in the nucleus. In primates, the typical difference in rate has been estimated to be about ten-fold (Brown et al., 1979) and in fruit flies between two and nine-fold higher in the mitochondria than the nucleus (Moriyama and Powell, 1997). Furthermore because mitochondria are haploid and maternally inherited, the effective population size of the mitochondrial genome may be about a quarter of that of the autosomal nuclear genome, meaning that coalescence is relatively fast. As a result of this combination of factors, synonymous substitutions that do not affect amino acid sequence accumulate rapidly, whereas non-synonymous sites tend to be highly conserved, making sequences from a wide variety of species easy to amplify and align.

The Consortium for the Barcode of Life (CBOL, www.barcodeoflife.org) was formed in 2004 with the mandate of developing and promoting an international DNA barcoding project. Shortly thereafter, the Barcode of Life Database (BOLD, www.boldsystems.org) was launched by the University of Guelph Centre for Biodiversity to provide an online utility for the management and analysis of DNA barcode records (Ratnasingham and Hebert, 2007). A 650 base pair segment of the COI gene has been adopted as the standard barcode site for the animal kingdom, but has not been effective in plants for which chloroplast matK and rbcL genes are emerging as appropriate tools (Hollingsworth et al., 2009). Finally, after six years of preliminary work, the International Barcode of Life project (iBOL, ibol.org) was officially launched in 2010 with 25 participating nations and the objective of barcoding 5 million specimens from half a million species by 2015.

The DNA barcoding project has not been without controversy. Habitat loss, climate change and rising extinction rates have combined to create a sense of crisis within the taxonomic community: both an environmental crisis due to lost biodiversity and a scientific crisis due to lost knowledge as taxa disappear before they can be described and positioned within the evolutionary

1. Introduction: Barcoding the Birds of the World 3 tree of life (Wheeler et al., 2004). Proponents of barcoding see it as an important factor in a new integrative approach to taxonomy that will revitalize and accelerate the process of describing species (Janzen et al., 2009, Padial and de la Riva, 2007, Padial and de la Riva, 2010). Where barcode clusters do not match established taxonomy, taxa are flagged as priorities for in depth study (Janzen et al., 2009, Burns et al., 2008). Where there is little established taxonomy, barcode groupings can sort specimens into independently evolving groups (Pons et al., 2006, Pinzon-Navarro et al., 2010, Stern et al. 2010). The use of a standard tool ensures that data from different studies can be pooled and efficiency maximized (Saunders, 2005). However, some members of the taxonomic community have criticized the project for producing a single character system that they fear will be superficial at best and error-prone at worst, and that will deflect resources from detailed, traditional taxonomic studies (Will and Rubinoff 2004, Will et al., 2005, Ebach and Holdredge, 2005a, Ebach and Holdredge, 2005b, de Carvalho et al., 2008). The issue of funding has been countered with evidence that barcoding has turned around a steady decline in taxonomy funding and publication that has been evident in Canada since the 1980’s (Packer et al., 2009). The issue of error will be addressed throughout this work but in general appears limited and predictable (Baker et al., 2009).

In phylogenetics, the exclusive use of mitochondrial DNA is considered ill advised (Zink & Barrowclough, 2008, Edwards, 2009). Single-sex inheritance, introgression through hybrid zones and selection pressures have the potential to produce a mitochondrial gene tree that fails to reflect either the actual topology or the branch lengths of the species tree (Ballard & Rand, 2005, Edwards, 2009, Galtier et al., 2009). Furthermore, it is becoming clear that paternal mitochondria are occasionally transmitted when an egg is fertilized, potentially leading to heteroplasmy and detectable recombination (White et al., 2008).

Fortunately, the focus of barcoding is not on tree building and historical relationships between species, but rather on species identity. The fixation of barcode substitutions within a group defines the group as a cohesive evolutionary unit and provides diagnostic characters that can be used to identify unknown specimens (Tavares & Baker, 2008, Kerr et al., 2009a). Incomplete lineage sorting between recently diverged taxa may inevitably be seen on occasion, but the high mutation rate and rapid coalescence of mitochondrial DNA should serve to minimize this issue compared to any nuclear marker (Zink & Barrowclough, 2008). Once fixed differences have

1. Introduction: Barcoding the Birds of the World 4 arisen, species identification should be possible in most cases whether or not phylogenetic analysis of barcode sequences produce an accurate phylogenetic tree.

While this sounds relatively straightforward, a certain amount of variation is expected within a species and so the challenge is to recognize when differences between barcodes are due to species differences and when they are simply intraspecific variation. Genetic distance is easy to calculate and suggests a quick way to screen large data sets for species groupings (Hebert, 2003). Ideally there would be a clear difference (a “barcode gap”) between the range of distances found within a species and that found between species so that a threshold of genetic distance could be established above which divergent barcodes could be said to belong to distinct species (Meyer and Pauley, 2005). In practice, it has been clear from the start that there would be a certain degree of overlap between ranges of inter- and intraspecific distance (Hebert et al. 2003b, Hebert et al., 2004). In particular, the distance between established sister species can vary substantially (Tavares and Baker, 2008) making it difficult to establish a reliable species threshold (Meyer and Pauley 2005, Baker et al., 2009, Kerr et al. 2009a). A threshold set too high results in false negative species diagnoses (i.e. two lineages considered one species when they should be two) and too low results in false positives (i.e. two lineages considered two species when they should be one), and while an optimum value can be sought for a given group of taxa (Meyer and Pauley, 2005, Kerr et al., 2009a), it is unlikely that any substantial data set will yield an error-free threshold.

This lack of a clear species criterion increases the importance of a reference database that is comprehensive and contains a range of specimens for each species. When this is the case, fixed substitutions between species can be identified. These act as diagnostic characters and cause conspecific sequences to cluster in a neighbour-joining tree (Saitou and Nei, 1987), making the identification of unknown specimens to species straightforward in most cases (Tavares and Baker, 2008, Kerr et al., 2009a, Yassin et al., 2010). Occasionally, barcodes of the same established species are seen to form distinct clusters or those of different species are found to cluster together, creating interesting situations that are harder to interpret. The more that is known about typical patterns of inter- and intraspecific variation that occur in established species, the easier it will be to interpret such new-found patterns of barcode variation. Thus comprehensive barcoding of well-studied groups such as birds will be highly informative.

1. Introduction: Barcoding the Birds of the World 5

The first study of avian COI barcodes used 467 specimens of 260 North American birds (Hebert et al., 2004). No two species were found to have identical barcodes and the average Kimura two- parameter corrected distance (K2P; Kimura, 1980) between species was 7.9%. Of the 130 species with more than one specimen, four species were found to have deep intraspecific splits with distances of 3.7 to 7.2%, while the rest had low intraspecific variation averaging just 0.27%. A reasonable distance threshold above which intraspecific distances should be investigated as signs of possible cryptic species was suggested to be 10 times the average intraspecific distance of the group – 2.7% sequence divergence in this case (Hebert et al., 2004). This rule of thumb became known as the “10 times rule” and while lacking in theoretical justification, it empirically fit both the data at hand and earlier studies of mitochondrial cytochrome b in birds (Johns and Avise, 1998, Avise and Walker, 1999).

With these encouraging preliminary results in hand, the project was expanded to include 2590 COI barcodes from 93% of the 643 bird species of Canada and the USA (Kerr et al., 2007). With this improved coverage, 94% of species were found to be distinguished by COI barcodes, thereby demonstrating that barcoding can be a genuinely useful tool since almost all of the members of a class of species in a major geographic area can be identified. Furthermore, 15 species were identified that have a mean intraspecific distance above a 2.5% threshold obtained by the 10 times rule, thereby flagging them as candidates for future taxonomic review. However, 17 groups totalling 42 species, including one group of 10 large white-headed gulls, were found to have species with overlapping barcodes. Each of these groups is made up of closely related congeners and the authors noted that many species that share barcodes also hybridize. This means that though barcodes may not identify specimens from these groups to the species level, they do at least identify the specimen as one of a small cluster of closely related species.

Comparing these two studies of North American birds demonstrates the pitfalls of limited sampling. Five of the large white-headed gulls were included in the first North American bird study (Hebert et al., 2004), but since only one specimen was used of each, the barcode overlap in these species was not observed. At least six other species were wrongly listed as having unique barcodes in the first study but were subsequently found to share barcodes with another species: the Blue-winged teal, Snow goose, Common eider, Greater prairie-chicken, American crow and the White-crowned sparrow. Finally, Wilson’s Snipe (Gallinago delicata), was included in both

1. Introduction: Barcoding the Birds of the World 6 the first and second North American study, but barcode identity with the Eurasian Common snipe, Gallingo gallinago (Kerr et al., 2009a, Baker et al., 2009) was not noted in either since birds outside of North America were excluded from both studies. This can be expected to be a recurring problem with studies delimited by a geographic area since the mobility of birds means that their closest relatives may be on different continents. For example, in the shank family, three sister species pairs (Pereira and Baker, 2005) have one species predominantly in Eurasia and one in the Americas: Actitis hypoleucos and A. macularius, Tringa ochropus and T. solitaria, T. nebularia and T. melanoleuca. However, a considerable benefit of using a standardized DNA sequence is that data from different sources can be easily consolidated so that a series of smaller studies from diverse geographic regions such as that of the birds of South Korea (Yoo et al., 2006) will add up to give a more complete picture than any single study alone.

The next large-scale regional bird study gathered COI barcodes from 1594 specimens of 500 species from Argentina representing 50% of Argentinian species and about 25% of Neotropical species (Kerr et al., 2009b). This is not yet a level of coverage that is adequate to evaluate interspecific distance or develop a trustworthy regional identification system, but it does allow intraspecific variation to be sampled. So far the average intraspecific distance in South American birds is 0.23% which is very similar to the 0.24% of North American birds. Thirteen species are flagged as candidates for splitting when the 10-times rule is used to generate a putative species threshold distance of 2.4%. However another eight have splits greater than 1.5% and are also considered worthy of closer examination by the authors, thereby highlighting the limitations of the 10 times rule. Also noteworthy is the discovery of a group of closely related species, the southern capuchinos (genus Sporophila) with barcodes shared in a pattern similar to that found in the white-headed gulls. In a follow-up study, this capuchino dataset was expanded to include 11 species from throughout South America and of these nine were found to have shared barcodes, suggesting a very recent radiation and perhaps extensive hybridization (Campagna et al., 2010). Finally, certain biogeographic patterns recur in multiple Argentine taxa suggesting that the completion of this dataset may reveal much about the evolutionary history of the region (Kerr et al., 2009b).

Options for identifying species and screening large barcode datasets (Kerr et al., 2009a) are explored in a regional study of birds of the eastern Palearctic. Sixteen hundred specimens from

1. Introduction: Barcoding the Birds of the World 7

398 species from the Eastern Palearctic were compared to congeners from North America with the result that 96% were identifiable with COI barcodes and distinguishable from Nearctic relatives. Gene flow across Beringia is frequently limited, giving rise to deep intraspecific splits or speciation (Zink et al., 1995) and thus this dataset could be expected to contain some interesting sister species pairs and divergent subspecies. Three different barcode screening methods for large datasets were tested. The first simply used the phylogenetics software MEGA (Tamura et al., 2007) to build a K2P corrected neighbour joining tree and to calculate bootstrap support scores for monophyletic clusters. The second relies entirely on an inter-specific distance threshold to group sequences into molecular operational taxonomic units or MOTU (Floyd et al., 2002). The third is a character-based method that uses the Characteristic Attributes Organization System or CAOS (Sarkar et al., 2008) to identify diagnostic characters within the barcode sequence of each species. As might be expected, the distance threshold method lumped closely related species together and split others with high intraspecific variation. The neighbour joining method performed slightly better but bootstrap scores were low for a small number of closely related species (4%), and reciprocally monophyletic clusters within species could not be distinguished from full species. The authors noted that the same species were problematic for both methods but that the neighbour joining method requires at least two sequences per divergent clade to calculate a bootstrap value whereas distance thresholds can be applied to single sequences. The diagnostic character method proved effective for small datasets where groups have been thoroughly sampled so that fixed substitutions can be identified, but was found to be impractical for larger datasets (Kerr et al., 2009a).

A final large regional barcoding study of 296 Scandinavian birds allowed trans-Atlantic comparisons to be made with North American birds (Johnsen et al., 2010). Overall 94% of Scandinavian species have COI barcodes that form distinct clusters on a neighbour joining tree very similar to the success rate in North America. Of the 78 species with populations in both Scandinavia and North America, 24% showed evidence of intraspecific trans-Atlantic differentiation. These authors found the use of a distance threshold to be less effective as a means of delimiting species than the use of neighbour joining clusters and diagnostic characters, though no attempt was made to apply screening tools such as CAOS. As in other studies, groups of

1. Introduction: Barcoding the Birds of the World 8 species with shared barcodes were made up of closely related congeners, and included several white-headed gulls (Johnsen et al., 2010).

This set of four large regional studies clearly establishes the potential of a comprehensive barcoding system in birds. The statistics are remarkably constant across the four regions studied: in all cases, 90% of species form easily diagnosable clusters of COI barcode sequences and a further 3 to 6% are clearly distinct upon inspection, though they might not be caught by rapid screening techniques. The use of a standardized DNA sequence has greatly enhanced the value of any one of these studies by allowing comparisons between regional projects and expanding the breadth of sampling of individual species found in multiple regions. Furthermore, the pool of available data will continue to grow, generating new hypotheses of evolution and biodiversity.

Nevertheless, important issues remain that are not well addressed by a regional study, not least of which is the relationship between nominate species that share COI barcodes. The regional studies demonstrate that those that overlap are typically congeneric but does this mean that closely related species will always be problematic? A survey of 60 sister species pairs (Tavares and Baker, 2008) was the first barcode study to use previously published multi-gene phylogenies to establish relationships among species and to identify sister-species pairs i.e. the most recently diverged pair in a clade. All the pairs presented are clearly distinguished by fixed differences in their barcode sequences that cause them to cluster in reciprocally monophyletic groups on a neighbour joining tree. Even the 12% that were separated by a distance of just 1% or less were still easy to identify in this way (Tavares and Baker, 2008). The authors concluded that as long as there are sufficient specimens, COI barcodes can distinguish most sister species even though these may fall below typical distance thresholds derived either empirically or by the 10 times rule. In this case, 20 out of 60 species were separated by a distance of less than a 10 times rule threshold of 2.7% (Tavares and Baker, 2008). It should be noted that a fully resolved phylogeny was required for all species pairs included in this study and this may have reduced the probability of finding pairs that could not be distinguished with mitochondrial DNA. This means that the study does not address the frequency with which sister species have shared barcodes, but does still establish the principle that barcoding can work in sister-species pairs and provides a dataset for exploring barcodes in this context.

1. Introduction: Barcoding the Birds of the World 9

One of the interesting ideas explored in this study of sister-species pairs is the variation in rates of barcode evolution found between groups of birds. The relationship between sister-species divergence dates and barcode distance appears to differ between the shank family and other groups including alcids, terns, kiwis and penguins (Tavares and Baker 2008) A study of bird mitochondrial genomes also found variable rates of evolution (Pereira and Baker 2006) and together these studies underline that generalizations about barcode distance data may not hold up across a wide range of species.

A phylogenetic approach to barcoding in which all the species of a substantial clade are included in a single analysis would allow all species to be compared to their closest relatives and the full range of possible variation to be established for the group. Where reliable phylogenetic trees and node dates can be obtained, the extent of evolutionary rate variation can be examined too. With several such studies, a comprehensive picture of variation at different taxonomic levels should emerge. A recent study of three bird families, Phasianidae, Accipitridae, and Strigidae (Cai et al., 2010) is a step in the right direction, though with specimens from only 66 species in total out of a possible 241 Accipitridae, 155 Phasianidae and 199 Strigidae species, the coverage is clearly still inadequate. Similarly, a study of tyrant-flycatchers (family Tyrannidae) presents barcodes for 71 species out of the 374 that make up the family (Chaves, 2008).

Finally, large scale barcode studies often reveal research questions about particular species that require detailed follow-up and this can be expected to engender an increasing number of new taxonomic studies. For example, the Australian population of the Painted Snipe was once considered a subspecies Rostratula benghalenis australis but was recently assigned to full species status, Rostratula australis (Clements, 2007). COI barcodes show a 7.9% uncorrected distance between Australian and other Painted Snipe populations and this is matched by an overall 10% distance across five different mitochondrial genes and significant differences in morphology (Baker et al., 2007a). In another example, the Sandwich Tern Thalasseus sandvicensis sandvicensis of Europe was identified by barcodes as both divergent from (3.8% K2P-corrected distance) and paraphyletic to the North and South American subspecies of T. sandvicensis (Kerr et al., 2009a). An in-depth study has confirmed this finding with new specimens, additional mitochondrial and nuclear genes and morphological data, and therefore the splitting of this species has been proposed (Efe et al., 2009). Similarly, splitting of the Brown-

1. Introduction: Barcoding the Birds of the World 10 cheeked Rail of eastern Asia from the Water Rail of the rest of Eurasia has been proposed based not only on barcodes which show a 3% genetic distance between these taxa, but also on two nuclear loci and clear morphological differences (Tavares et al., 2010). In all three cases, deep splits in COI sequences have not been taken as sufficient evidence for taxonomic revision but rather have served as springboards for new work.

The present study focuses on the shorebird order, Charadriiformes and provides the best coverage to date of a substantial monophyletic group. This order includes 356 species in 19 families (Clements 2007) which fall into three sub-clades: the Scolopaci, the Charadrii and the Lari (Paton et al., 2003, Paton & Baker, 2006, Baker et al., 2007b, Mayr 2011). The common ancestor of this order has been estimated to have occurred 93 million years ago with a 95% credible interval of 84 to 102 Mya (Baker et al. 2007b). It follows that division into the three subclades and the origin of a number of families occurred during the late Cretaceous, before the K/T boundary 65 million years ago, followed by extensive radiation through to recent times (Baker et al., 2007b). Known for their long-distance migrations, shorebirds are found throughout the world from the Antarctic to the Arctic and most fresh and salt water shorelines in between. The Scolopaci are waders including the sandpipers, shanks, godwits, curlews, snipes, seedsnipes, painted snipes and jacanas. The Charadrii include the plovers, dotterels, lapwings, oystercatchers, stilts, avocets, thick-knees and the ibisbill. The Lari include the gulls, terns, alcids and skuas.

Barcodes of specimens from the collection of the Royal Ontario Museum are combined with published shorebird barcodes from other sources to give a total dataset of 1814 barcodes covering 77% of charadriiiform species overall and up to 100% of a number of families within the order. Of these, 670 barcodes were generated by the author. This rich dataset is presented and analysed with the following objectives:

1. Rigorously test the power of COI barcodes to correctly distinguish and identify closely related species. 2. Document inter- and intraspecific COI barcode variation within a clade across its range of species ages, structure and demographic history. 3. Identify factors that influence differentiation of COI barcodes.

1. Introduction: Barcoding the Birds of the World 11

4. Identify issues in charadriiform taxonomy that merit further study.

In Chapter Two, the focus is on the Scolopaci. This suborder includes a number of well-studied polytypic species, some of which have subspecies that can be resolved by barcodes. It is these polytypic species whose subspecies form distinct barcode clusters that have the highest levels of intraspecific variation. Between species, a continuous spectrum of variation is observed which overlaps both with levels of variation found between subspecies and with levels found within either monotypic or polytypic species. Analyses of the Charadrii are less complete but suggest similar trends. Nevertheless, fixed differences between species allow for resolution by barcodes of all but two species pairs in the Scolopaci and all species tested so far in the Charadrii.

In Chapter Three, the focus is on the suborder Lari. Here three different groups of species have similar overlapping COI barcodes: the white-headed gulls, the masked gulls and the southern hemisphere skuas. The barcode data is valuable for its biological insights into these groups but not for species-level identification. The relationship between species identification by COI barcodes and both time since divergence and rate of substitution is explored. The Lari are estimated to have the slowest rates of substitution on average of all the Charadriiformes and this can be expected to increase the time since divergence required for resolution by COI barcodes. White-headed gulls are believed to be young species and so this slow rate makes a difference. On the other hand, the older species of the auk family, the Alcidae, are perfectly resolved, despite an equally slow rate of evolution.

In the final chapter, lessons from each suborder are brought together to better understand what limits resolution by COI barcodes. The interplay between time, substitution rate and gene flow is a key factor. Mode of speciation may also be important as it is observed that some genetically unresolved sets of shorebird species or subspecies are differentiated by traits under strong selection pressure suggestive of rapid adaptive speciation.

CHAPTER TWO

Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation

Abstract: For the first time, COI barcode variation is examined at a variety of levels throughout a substantial avian clade. Species in the shorebird suborder Scolopaci are generally well identified by barcodes. Analysis of sequence variation in 780 new and previously barcoded specimens from 86 of the 106 species in this clade shows that 95% of species have distinct DNA barcodes. Just two species-pairs, Common and Wilson’s Snipes and Chatham Island and Snare’s Island Snipes, cannot be distinguished by COI barcodes. Nearest-neighbour distances within genera where all extant species were sampled average 7% K2P-corrected distance, with a range of 0 to 14%. Within-species variation ranges from 0 to 5%, but the highest levels occur in polytypic species in which barcodes from subspecies form distinct genetic clusters. These taxa include the Whimbrel, Black-tailed Godwit, Rufous-bellied Seedsnipe and Solitary Sandpiper, all of which contain substantial genetic splits between subspecies. Morphologically distinguishable subspecies in long distance migrants such as the Red Knot, Bar-tailed Godwit and Ruddy Turnstone have almost invariant COI sequences, suggesting subspecies differences in migration strategy and morphology have evolved in less time than barcode substitutions can be fixed. Within monotypic species, genetic distances among individuals range from 0 to 1.2%. Similar results were obtained in the suborder Charadrii, despite uneven coverage of species. A total of 370 barcodes obtained for 68 of 100 Charadrii species suggest excellent identification of species. Barcodes of 29 of the 35 species in the clade of dotterels and typical plovers identified all sampled species correctly and all have nearest-neighbour distances > 1%. On the other hand, all of the stilts and avocets barcoded so far (8 of 10 species) have nearest-neighbour distances <1%, but identification to species is straightforward due to negligible within-species variation.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 13

2.1 Introduction

Most species of the suborder Scolopaci are migratory waders that forage along the world’s shorelines. Along with the suborders Charadrii and Lari, this suborder makes up one of the three major clades of the shorebird order Charadriiformes (Paton et al., 2003, Paton & Baker, 2006, Baker et al., 2007b), and has been estimated to have originated some 80 million years ago (Baker et al., 2007b). The Scolopaci consists of five families with a total of 106 species. The largest of these families is the Scolopacidae with 90 extant species (Clements et al., 2010) including the sandpipers, shanks, snipes, godwits and curlews. The remaining four families, the Jacanidae (Jacanas), Rostratulidae (Painted-snipes), Thinocoridae (Seed Snipes) and the Plains-wanderer in the monotypic family Pedionomidae of the Scolopaci, contain a total of just 16 species and together make up a sister clade to the Scolopacidae. .

The presence of structured polytypic species in the Scolopaci makes this a particularly valuable group in which to test the limits of a species identification system. Twenty-two of the 90 species of the Scolopacidae have recognized subspecies (Clements et al., 2010), even though most are strong fliers and should be able to disperse freely between breeding grounds. Migration routes often reach thousands of kilometres between arctic or sub-arctic breeding grounds and southern wintering grounds. An extreme example is the Bar-tailed Godwit of Alaska that makes a nonstop 10 000 km journey every fall from Alaska to New Zealand (Gill et al., 2005). Others such as Red Knots (Buehler, 2008), Red-necked Stints (Milton, 2005) and Black-tailed Godwits (Milton, 2005) travel similar long distances, though typically stops are made at staging grounds along the way. Despite this mobility, distinct populations appear to be maintained in a number of species by members returning to the same breeding grounds year after year, as in the highly structured Dunlin, Calidris alpina (Wenink et al., 1996).

Mitochondrial DNA sequence is a convenient tool frequently used in the study of avian systematics (Avise & Walker, 1999, Zink & Barrowclough, 2008). Recently it has also been shown to be useful for DNA-based identification as exemplified by the success of COI barcoding in birds (Hebert et al., 2004, Baker et al., 2009; Kerr et al., 2009). The barcode is an approximately 600 base pair sequence from the mitochondrial protein-coding gene Cytochrome oxidase I which can be used to identify a species when compared to a reference database (Hebert

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 14 et al., 2004). The building of the avian reference database is well underway (All Birds Barcoding Initiative: www.barcodingbirds.org) and it has been shown that barcodes can successfully identify over 90% of North American birds (Kerr et al., 2007), 96% of Eastern Palearctic birds (Kerr et al., 2009a), and can reliably distinguish avian sister species from a variety of orders (Tavares & Baker, 2008). However this is the first time that barcodes have been used to focus on a single avian clade.

DNA barcoding relies on the fixation of sequence substitutions within a set of co-evolving lineages to produce diagnostic characters unique to that taxon (Tavares & Baker, 2008, Kerr et al., 2009a). A single fragment of mitochondrial DNA is inadequate for establishing historical relationships and building phylogenetic trees (Zink & Barrowclough, 2008, Edwards, 2009, Galtier et al., 2009) but these attributes are not required to simply establish species identity in most animals.

A reference database for COI barcoding necessitates the collection of representative specimens from throughout the range of each species and this has huge potential to contribute to the cataloguing of biodiversity. Unfortunately, there is still no formula that reliably predicts whether monophyletic groups of barcodes are divisions within one species (i.e. subspecies or divergent populations) or represent two nascent species (Baker et al., 2009). The problem is two-fold: first the rate of evolution of COI and other mitochondrial genes is not constant across taxa in birds (Pereira & Baker, 2006) and second, there is no consensus on how much divergence can occur within a single species. These issues are equally problematic for the recently proposed “Mixed Yule Coalescent” approach (Pons et al., 2006, Papadopoulou et al., 2008).

Occasionally, a group of bird specimens have barcodes that are sufficiently distant from conspecifics that they do seem likely to represent a “cryptic” species (Hebert et al., 2004, Tavares & Baker, 2008, Kerr et al., 2009a). A handful of these cases have been included in more complete taxonomic studies resulting in proposals to split the bird species in question, as was the case for the Painted Snipe (Baker et al., 2007a) and the Sandwich Tern (Efe et al., 2009). As for the rest, interpretation of within-species barcode variation will be easier with a good understanding of the typical range of variation found within established species. To this end, studies that include estimates of intraspecific barcode variation between known divergent

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 15 populations will be particularly useful. An interesting start is a recent study of Scandinavian birds that compares barcodes of Scandinavian populations with those of conspecific populations from North America: 24% of these “trans-Atlantic” species have barcodes that cluster by continent (Johnsen et al., 2010).

Even with an improved understanding of intraspecific barcode variation, can barcodes really be expected to play a role in the detection of new species? The biological species concept allows for polytypic species, meaning that divergent populations or groups of populations can still be conspecific as long as they retain the potential to interbreed (Mayr, 1942, Mayr, 1963). Since mitochondrial genetic distance does not appear to be a reliable predictor of hybrid compatibility between taxa (Price & Bouvier, 2002), it follows that barcodes would be of limited use for defining species under such a concept.

On the other hand, more recent phylogenetic species concepts based on diagnostic characters and reciprocal monophyly (Dequiroz & Donoghue, 1988, Cracraft, 1992) tend to view reproductive isolation as a probable outcome of divergence, but not a necessary precursor to species status (Mallet, 2008). The extent of gene flow and divergence between populations, subspecies and hybridizing species is expected to fall somewhere along a continuous spectrum (Mallet, 2008), given that divergence seems to be possible in the presence of gene flow (Emelianov et al., 2004, Hey, 2006, Nosil, 2008) and that some ongoing gene flow is common between recently evolved species (Price & Bouvier, 2002). In this context, degree of differentiation is key to defining species and thus barcode data may be useful when combined with other lines of evidence.

A major objective of this study is to elucidate patterns of barcode divergence between species and subspecies within a substantial and well-known clade of birds. The subspecies concept has been criticized for uneven application and limited concordance with genetic data (Zink, 2004), but it does help to identify species with observable phenotypic differences between allopatric populations (Phillimore et al., 2007). There is no expectation that all subspecies can be distinguished by barcodes: a meta-analysis of 259 avian subspecies from 67 species world-wide found that subspecies form monophyletic groups using mitochondrial sequence data in just 36% of cases (Phillimore & Owens, 2006). However, it is expected that the highest intraspecific distances seen will be in polytypic species where phenotypic divergence is also evident. If so,

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 16 the relatively fast-evolving COI barcodes can be leading indicators of genetic divergence between lineages.

Barcode data is presented here for the five families of the Scolopaci. New sequences generated at the Royal Ontario Museum are combined with previously published sequences to give as complete a picture as possible of the efficacy of DNA barcodes in identifying species in this clade of birds. With a total dataset of 780 barcodes covering 81% of the species in the suborder, this is the first avian barcoding study to provide wide coverage within a large clade. In addition, comparisons are made with exemplars from a second suborder of the Charadriiformes, the Charadrii. The objectives of the study are three-fold. First, the efficacy of DNA barcodes in identifying Scolopaci species from their sister species or nearest relatives will be determined. Second, the extent to which barcodes differ between subspecies will be examined, both to inform the limits of resolution of taxa by COI barcodes, and to characterize patterns of intraspecific variation. Finally, insights into the taxonomy of the Scolopaci will be sought and research needs considered, including the identification of putative new species.

2.2 Methods

Taxon sampling

Barcodes are presented for 259 new specimens of the suborder Scolopaci from the frozen tissue collection of the Royal Ontario Museum. These sequences are combined with 521 previously published barcodes (Hebert et al., 2004, Yoo et al. 2006, Baker et al., 2007a, Kerr et al., 2007, Tavares & Baker, 2008, Baker et al., 2009, Baker et al., 2010, Kerr et al., 2009a, Kerr et al. 2009b, Johnsen et al., 2010) to give a total dataset of 780 barcodes from the Scolopaci. These include all barcodes publically available at the time of writing from the five families of the Scolopaci: Scolopacidae, Rostratulidae, Thinocoridae, Jacanidae and Pedionomidae.

In addition, barcodes are presented for 206 new specimens of the suborder Charadrii from the frozen tissue collection of the Royal Ontario Museum. These include 21 unpublished COI sequences generated as part of earlier work on the phylogenetics of the genus Charadrius (Mark

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 17

Peck, unpublished data). These sequences were combined with 164 previously published barcodes (Hebert et al., 2004; Yoo et al. 2006; Baker et al., 2007a; Kerr et al., 2007; Tavares & Baker, 2008; Baker et al., 2009; Kerr et al., 2009a; Kerr et al. 2009b; Johnsen et al., 2010) to give a total dataset of 370 barcodes from the Charadrii.

A complete list of specimens used is given in Appendix 1. Collection dates and geographic locations are provided, along with BOLD accession numbers. Complete specimen and sequence records including traces and primers for all barcodes used in this study are available on the Barcode of Life Data Systems website (www.boldsystems.org). Records for previously unpublished specimen barcodes will be publicly available in the ABBI project: AROME Royal Ontario Museum – Shorebirds.

Taxonomy in this paper follows Clements Checklist of Birds of the World, 6th edition (Clements, 2007) which is the standard currently used by the All Birds Barcoding Initiative (www.barcodingbirds.org). However taxonomic changes within the genus Coenocorypha in recent updates to the 6th edition, Clements 6.4 (Clements et al., 2009) are also adopted here: two subspecies of the Subantarctic Snipe, Coenocorypha aucklandica heugeli and the extinct C. a. iredalei, are considered separate species, Coenocorypha heugeli and Coenocorypha iredalei following recent research (Worthy et al., 2002; Baker et al., 2010). The only other change to taxonomy of the Scolopaci in this revision is the reassignment of Rostratula semicollaris to Nycticryphes semicollaris, and this is also adopted.

DNA amplification and sequencing

New specimens were from the collection of the Royal Ontario Museum and took the form of frozen organ tissue, frozen blood samples or frozen tissue preserved in alcohol. Most DNA extractions were performed using a glass-fibre filter and chaotropic salt technique developed for the high volume demands of DNA barcoding (Ivanova et al., 2006). The manual protocol was followed using 96 well Acroprep 1.0 μm glass filter plates (PALL Corporation, East Hills, New York, USA). Additional extractions were performed using the standard phenol-chloroform technique (Sambrook et al., 1989).

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 18

PCR amplification of the barcode region of the COI gene was performed by combining 1μl of DNA extract (target 20-25 ng DNA) with 0.2μM of each amplification primer, 1U Taq polymerase (Invitrogen), 0.4mmol dNTPs and buffer solution (after Hagelberg (Hagelberg, 1994): 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.01% gelatin, and 160mg/mL BSA.) to make up a 12.5 μL reaction. Amplification primers have been reported in Tavares & Baker (2008), and targeted the first 900 base pairs of the COI gene, starting just upstream in the tRNA Tyrosine gene: LTyr – TGTAAAAAGGWCTACAGCCTAACGC, (Oliver Haddrath, pers. comm.) and COI907aH2 – GTRGCNGAYGTRAARTATGCTCG. This primer combination reliably amplified COI in all species and provided a high quality template that was somewhat longer than the standard barcode region. However, sequencing primers described below were also used for amplification in some cases. The PCR thermocycler protocol was as follows: initial denaturation at 94°C for 5 min; 36 cycles of 94°C for 40 sec, 50°C for 40sec, and 72°C for 1 min; and a final extension at 72°C for 7 min. The amplification product was run out on a 1% agarose gel containing ethidium bromide. Bands were cut out and the amplified DNA separated from the gel by centrifugation through a filter tip.

Sequencing was performed using an Applied Biosystems ABI3100 sequencer following the manufacturer’s recommended protocols. Primers were designed for the Scolopacidae and have been reported previously (Baker et al., 2007a). The forward sequencing primer used was COI50L-cal (TCAACCAACCAYAAAGAYATCGG) which sits down at site 50 from the 5’ end of the COI gene, and the reverse was COI746H-cal (GCTACAAARTGNGARATGATTCC). These primers were successfully used in most Scolopaci and Charadrii species though additional primers listed in Table 3.1 were used in some cases. Actual primers used for each sequence can be found in sequence records of the BOLD database. Sequences were edited using ChromasPro version 1.33 (Technelysium Pty Ltd).

Analysis

Sequences were aligned using ClustalW as implemented in MEGA 4.0 and then trimmed to give a uniform length of 603 base pairs starting at position 100 and finishing at position 702 from the 5’ end of the COI gene. Distance calculations were performed and Neighbour-Joining trees built in MEGA 4.0 (Tamura et al., 2007) using a Kimura two parameter (K2P) evolutionary model of

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 19 correction that allows for different rates of transition and transversion, but assumes equal nucleotide frequencies (Kimura, 1980). This is the standard model used for analyses performed by the Barcode of Life Data Management System (Ratnasingham & Hebert, 2007) and has been used extensively in avian barcoding publications (for example: Hebert et al., 2004, Yoo et al., 2006, Kerr et al., 2007, Kerr et al., 2009a, Kerr et al., 2009b). Consequently it is used here to allow for comparison with other datasets, even though nucleotide frequencies may not always be equal. However, since barcodes are used for identification and not for phylogenetic purposes, and analyses presented here are exclusively of small sets of closely related species, the impact of the model is minimal. Frequency distribution statistics, graphs and tests of normality were prepared using Minitab 15 Statistical Software (2007 Minitab Inc). A median-joining network (Bandelt et al., 1999) of Coenocorypha barcodes was prepared using Network 4.5.1.0 (2008 Fluxus Technology Ltd.). No differential weights were applied.

The nearest-neighbour distance is the smallest distance to another species within a defined group (Kerr et al., 2007). Unlike other distance values reported here, these values are calculated one family at a time using the BOLD Management System (Ratnasingham & Hebert, 2007) and a K2P correction for multiple hits at sites. Values are reported only where all or most congeneric relatives are included in the dataset so as to avoid overestimating the true value of this parameter. Species excluded from this analysis are indicated in Table 2.1.

When sample sizes are very small, specimens can appear to cluster into reciprocally monophyletic groups simply because the sample does not include any of the individuals that fall between the two groups. Rosenberg has proposed a method of estimating the probability of such a chance occurrence from the number of lineages that fall into reciprocally monophyletic groups (Rosenberg and Harrison, 2007). Lineages can be represented by specimen barcodes and the test has been used to evaluate the results of barcode surveys (Tavares & Baker, 2008). The method does not take into consideration the genetic distance between the groups observed or the appropriateness of the sampling strategy, but it is a useful starting point for the interpretation of observed clusters of barcodes.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 20

2.3 Results

Species Identification

Barcodes were obtained for 74 of 90 species or 82% of the Family Scolopacidae. Missing species are largely from just three genera: Gallinago (7 species missing), Scolopax (5 species missing) and Numenius (2 species missing). Also missing is a single endangered species of the genus Tringa, Tringa guttifer and the equally endangered Prosobonia cancellata. The remaining 16 genera in the Scolopacidae are complete, including the species-rich genus, Calidris. Also complete are the Thinocoridae, Rostratulidae and Pedionomidae with barcodes for all eight species of these families; however, the Jacanidae are missing barcodes for four of eight species. Overall, the dataset of 780 barcodes covers 86 of 106 species or 81% of the suborder Scolopaci (Table 2.1).

The distribution of maximum intraspecific distances found in species with four or more barcoded specimens is presented in Figure 2.1a. Of 69 species included, 71% show a maximum intraspecific distance of less than 0.5%, and 86% less than 1%. Not surprisingly, most species with larger intraspecific distances are polytypic and have recognized subspecies (Clements et al., 2010); nine of the 11 species with intraspecific distances of 1% or higher are polytypic. The two exceptions are Tringa nebularia and Tringa ochropus, neither of which has described subspecies and which are found to have a maximum intraspecific distance of 1.0% and 1.2% respectively. All other instances of maximum intraspecific distance greater than 1% occur between described subspecies (Table 2.2).

All but two pairs of recognized species are represented by a unique cluster of barcodes. Distance to the nearest-neighbour of Scolopaci species is summarized in Figure 2.1b. As indicated in Table 2.1, most species from incompletely sampled genera or groups are excluded from the summary analysis to prevent overestimating nearest-neighbour distances where closest relatives are absent from the dataset. Excluded are the species in Numenius and Scolopax and most species of Gallinago, though the G. delicata/G. gallinago pair is included as they are nearest-neighbours. Also species in the Jacanidae other than in the genus Jacana are excluded. Tringa species are included in the analysis since only one of 13 is missing. The final 68 species included show a mean genetic distance to their nearest-neighbour of 7% with a range of 0 to 14%. The

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 21 distribution of genetic distances shows a clear central tendency within the Scolopaci with mean and mode both about 7%, though the distribution is significantly different from normal (Kolmogorov-Smirnov test of normality: p=0.023; Anderson-Darling p=0.038).

Table 2.1: Barcoding statistics for Scolopaci species. Nearest-neighbour distances marked with an asterix are excluded from the analysis in Figure 2.1, due to missing congeneric species. Species where no specimens are available are shaded grey. n=number of specimens barcoded; NN = nearest-neighbour (see text); %D= percent K2P genetic distance.

TABLE 2.1... Intraspecific %D %D n Mean Max to NN

SCOLOPACIDAE Actitis hypoleucos Common Sandpiper 15 0.04 0.33 11.04 Actitis macularius Spotted Sandpiper 9 0.04 0.16 11.04 Aphriza virgata Surfbird 3 0 0 7.16 Arenaria interpres Ruddy Turnstone 18 0.11 0.33 6.2 Arenaria melanocephala Black Turnstone 3 0 0 6.2 Bartramia longicauda Upland Sandpiper 6 0.12 0.33 11.62 Calidris acuminata Sharp-tailed Sandpiper 4 0.08 0.17 8.57 Calidris alba Sanderling 16 0.39 0.84 6.12 Calidris alpina Dunlin 25 0.75 1.3 6.84 Calidris bairdii Baird's Sandpiper 11 0 0 6.51 Calidris canutus Red Knot 21 0.05 0.17 6.85 Calidris ferruginea Curlew Sandpiper 10 0.17 0.5 7.9 Calidris fuscicollis White-rumped Sandpiper 8 0.30 0.67 7.59 Calidris himantopus Stilt Sandpiper 7 0.10 0.33 6.74 Calidris maritima Purple Sandpiper 8 0.04 0.17 1.4 Calidris mauri Western Sandpiper 9 0 0 3.91 Calidris melanotos Pectoral Sandpiper 8 0 0 6.74 Calidris minuta Little Stint 9 0.11 0.50 6.12 Calidris minutilla Least Sandpiper 9 0.35 0.84 7.21 Calidris ptilocnemis Rock Sandpiper 2 0 0 1.4 Calidris pusilla Semipalmated Sandpiper 8 0.04 0.16 3.91 Calidris ruficollis Rufous-necked Stint 4 0.08 0.17 7.66 Calidris subminuta Long-toed Stint 3 0 0 9.14

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 22

TABLE 2.1... Intraspecific %D %D n Mean Max to NN

Calidris temminckii Temminck's Stint 5 0 0 9.38 Calidris tenuirostris Great Knot 10 0.11 0.33 6.85 Scolopacidae continued Coenocorypha aucklandica Subantarctic Snipe 52 0.09 0.33 0.48 Coenocorypha heugeli Snares Island Snipe 28 0.08 0.16 0.06 Coenocorypha pusilla Chatham Islands Snipe 24 0 0 0.06 Eurynorhynchus pygmeus Spoonbill Sandpiper 2 0 0 7.66 Gallinago delicata Wilson's snipe 8 0.08 0.33 0.09 Gallinago gallinago Common Snipe 14 0.07 0.30 0.09 Gallinago hardwickii Latham's Snipe 1 N/A N/A *1.01 Gallinago imperialis Imperial Snipe 1 N/A N/A *12.10 Gallinago jamesoni Andean Snipe 1 N/A N/A *8.95 Gallinago media Great Snipe 6 0.06 0.017 *6.09 Gallinago megala Swinhoe's Snipe 2 0 0 *1.01 Gallinago nigripennis African Snipe 2 0 0 *2.02 Gallinago paraguaiae South American Snipe 5 0 0 *3.57 Gallinago stenura Pintail Snipe 10 0.10 0.50 *0.73 Gallinago andina Puna Snipe 0 Gallinago macrodactyla Madagascar Snipe 0 Gallinago nemoricola Wood Snipe 0 Gallinago nobilis Noble Snipe 0 Gallinago solitaria Solitary Snipe 0 Gallinago stricklandii Fuegian Snipe 0 Gallinago undulata Giant Snipe 0 Limicola falcinellus Broad-billed Sandpiper 9 0 0 8.7 Limnodromus griseus Short-billed Dowitcher 11 0.09 0.34 9.25 Limnodromus scolopaceus Long-billed Dowitcher 7 0 0 9.25 Limnodromus semipalmatus Asian Dowitcher 2 0 0 11.73 Limosa fedoa Marbled Godwit 7 0.05 0.17 5.51 Limosa haemastica Hudsonian Godwit 10 0.03 0.17 5.51 Limosa lapponica Bar-tailed Godwit 17 0.22 0.67 8.91 Limosa limosa Black-tailed Godwit 21 1.17 2.42 8.24 Lymnocryptes minimus Jack Snipe 6 0.14 0.33 12.56 Numenius americanus Long-billed Curlew 4 0.17 0.31 *6.55 Numenius arquata Eurasian Curlew 7 0.08 0.17 *4.24

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 23

TABLE 2.1... Intraspecific %D %D n Mean Max to NN

N. madagascariensis Eskimo Curlew 8 0.17 0.5 *4.24 Numenius minutus Far Eastern Curlew 5 0.10 0.17 *9.71 Scolopacidae continued Numenius phaeopus Little Curlew 18 1.84 3.79 *5.47 Numenius tahitiensis Whimbrel 6 0.07 0.17 *5.47 Numenius tenuirostris Bristle-thighed Curlew 0 Numenius borealis Slender-billed Curlew 0 Phalaropus fulicarius Red Phalarope 8 0 0 5.84 Phalaropus lobatus Red-necked Phalarope 18 0.04 0.33 5.84 Phalaropus tricolor Wilson's Phalarope 7 0.27 0.67 10.57 Philomachus pugnax Ruff 17 0.11 0.33 8.61 Prosobonia cancellata Tuamotu Sandpiper 0 Scolopax minor American Woodcock 9 0.04 0.17 N/A Scolopax rusticola Eurasian Woodcock 11 0.03 0.17 N/A Scolopax bukidnonensis Bukidnon Woodcock 0 Scolopax celebensis Sulawesi Woodcock 0 Scolopax mira Amami Woodcock 0 Scolopax rochussenii Moluccan Woodcock 0 Scolopax saturata Dusky Woodcock 0 Tringa brevipes Grey-tailed Tattler 4 0 0 6.7 Tringa erythropus Spotted Redshank 10 0.23 0.50 7.76 Tringa flavipes Lesser Yellowlegs 13 0.12 0.33 7.19 Tringa glareola Wood Sandpiper 16 0.04 0.33 6.56 Tringa incana Wandering Tattler 3 0 0 6.7 Tringa melanoleuca Greater Yellowlegs 9 0 0 4.21 Tringa nebularia Common Greenshank 12 0.40 1.01 4.21 Tringa ochropus Green Sandpiper 10 0.36 1.18 9.14 Tringa semipalmata Willet 9 0.33 1.01 6.6 Tringa solitaria Solitary Sandpiper 12 2.76 5.45 11.8 Tringa stagnatilis Marsh Sandpiper 6 0.09 0.17 6.38 Tringa totanus Common Redshank 17 0.43 1.01 6.38 Tringa guttifer Nordmann's Greenshank 0 Tryngites subruficollis Buff-breasted Sandpiper 4 0 0 6.51 Xenus cinereus Terek Sandpiper 8 0.09 0.35 13.42

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 24

TABLE 2.1... Intraspecific %D %D n Mean Max to NN

JACANIDAE Actophilornis africanus African Jacana 4 0.08 0.16 *13.5 Actophilornis albinucha Madagascar Jacana 0 Irediparra gallinacea Comb-crested Jacana 2 0 0 *14.52 Jacana jacana Wattled Jacana 6 0 0 1.36 Jacana spinosa Northern Jacana 2 0 0 1.36 Hydrophasianus chirurgis Pheasant-tailed Jacana 0 Metopidius indicus Bronze-winged Jacana 0 Microparra capensis Lesser Jacana 0

THINOCORIDAE Attagis gayi Rufous-bellied Seedsnipe 5 0.88 1.50 3.37 Attagis malouinus White-bellied Seedsnipe 2 0 0 3.37 Thinocorus orbignyianus Gray-breasted Seedsnipe 12 0.03 0.17 5.21 Thinocorus rumicivorus Least Seedsnipe 5 0 0 5.21

ROSTRATULIDAE Rostratula australis Australian Painted-snipe 6 0 0 8.61 Rostratula benghalensis Greater Painted-snipe 1 N/A N/A 8.61 Nycticryphes semicollaris S. American Painted-snipe 5 0.27 0.50 13.86

PEDIONOMIDAE Pedionomus torquatus Plains-wanderer 2 0 0 14.12

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 25

Table 2.2: Barcodes of subspecies in the Families Scolopacidae and Thinocoridae. Subsp=subspecies. %D= % genetic distance between COI barcodes calculated with a K2P model. Prob. not RM= probability that observed reciprocal monophyly is due to error calculated by the method of Rosenberg and Harrison (2007). Shading clarifies clusters of subspecies.

Diagnostic Prob. not Intra- Inter- Species Subspecies # Specimens Sites RM subsp %D subsp %D

T.solitaria cinnamomea 7 0.1% Tringa 12 28 <10-3 5.2% solitaria T.solitaria solitaria 5 0.07%

N.p.variegatus 6 0 - 0.17% 0 Numenius N.p.phaeopus 6 0 - 0.27% 16 phaeopus -4 N.p.hudsonicus 6 18 <10 0.11% 3.50%

N.p.alboaxillaris 0 n/a - n/a n/a

L.l.melanuroides East 8 12 <10-4 0.04% 2.2%

Limosa L.l.melanuroides Central 4(+1) 1 - 0 21 limosa L.l.islandica 4 1 - 0 0.17-0.33%

L.l.limosa 4 0 0

A.g.simonsi 3 0 Attagis 7 0.05 1.4% A.g.gayi 5 2 0.3% gayi A.g.latreillii 0 n/a - n/a n/a

T.t.robusta 4 0 - 0.08%

Tringa T.t.totanus 4 0 - 0 0 17 totanus unknown - W.Russia, Kazakhstan 3 0 - 0

unknown - Mongolia to Australia 6 5 <10-3 0 0.85%

T.s.inornatus 7 0.05% Tringa 9 4 0.01 0.78% semipalmata T.s.semipalmatus 2 0.2%

C.a. schinzii 4 (+1)

C.a.alpina 4 3 10-5 0 1.0-1.2%

(alpina or schinzii) 2

C.a.hudsonia 4 4 <10-3 0 1.0-1.2% Calidris C.a.sakhalina 25 3 alpina C.a.kistchinskii 1 2 <10-5 0.3% 1.0-1.2% C.a.actites 1

C.a.pacifica or articola 4

C.a.arctica 0 n/a - n/a n/a

Arenaria A.i.interpres 13 0 - 0.07% 18 - interpres A.i.morinella 5 0 - 0.1%

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 26

Diagnostic Prob. not Intra- Inter- Species Subspecies # Specimens Sites RM subsp %D subsp %D

C.c. rufa 5 0 - 0

C.c.islandica 3 0 - 0.1%

C.c.rogersii 4 0 - 0.2% Calidris - C.c.canutus 21 2 0 - 0.2% canutus C.c.piersmai 2 0 - 0.2%

subspecies unknown 5 0

C.c.roselaari 0 n/a - n/a n/a

C.a. aucklandica 26 0 - 0 Coenocoryph C.a. meinertzhagenae 9 0 - 0 - a aucklandica C.a. Campbell Is subsp 17 0 - 0.15%

Gallinago G.g.gallinago 10 0 - 0.13% 14 - gallinago G.g.faroeensis 4 0 - 0.09%

Limicola L.f.sibirica 4 0 - 0 9 - falcinellus L.f.falcinellus 5 0 - 0

L.g.griseus 6 0 - 0.1% Limnodromus L.g.hendersoni 11 3 0 - 0 - griseus L.g.caurinus 2 0 - 0.2%

L.l.menzbieri 4 0 - 0.2% Limosa L.l.lapponica 17 9 0 - 0.3% - lapponica L.l.baueri 4 0 - 0.2%

Numenius N.a.arquata 5 0 - 0 7 - arquata N.a.orientalis 2 - 0

Thinocorus T.o.ingae 3 0 0.1% 6* - - orbignyianus T.o.orbignyianus 3 0

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 27

70 All species, n=69, mean=0.49% 60

Polytypic species, n=16, mean=1.2%

) %

( 50

c n

e 40

q e

r 30 F

Rufous-bellied Seedsnipe 20 Black-tailed Godwit

10 Whimbrel Solitary Sandpiper

0 0 1 2 3 4 5 6 7 MaximumMaximum Intraspecific Intra-specific Barcode Barcode Distance Distance (%) (%)

Fig. 2.1a. Maximum intraspecific K2P barcode distances in the Scolopaci. Only those species with four or more specimens are included in this frequency analysis (see Table 2.1). Black areas represent polytypic species with specimens from two or more described subspecies (n=16, see Table 2.2). Identities of the 4 species with the top intraspecific distances are indicated above their distance class. All frequencies are expressed as a percentage of the 69 species included in this analysis.

35 Summary Statistics N=68 Median=6.74% 30 Mean=6.79%

) Standard Deviation=3.38

% 25

(

Minimum=0% y

c Maximum=14.12%

(%)

e 20

q e

r 15 F

Frequency 10

0 0 2 4 6 8 10 12 14 Barcode Distance to Nearest Neighbour (%) Barcode distance to nearest-neighbour (%)

Fig.2.1b. K2P distances between COI barcodes of nearest-neighbours within the Scolopaci. Species have been excluded from the analysis if closest relatives are not also represented (see Table 2.1).

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 28

Fig. 2.2. Scolopaci species not a. Rossiya RUS Dec KBPBU272-06 gallinago distinguished by COI barcodes. KhabarovskiyK RUS Jun KBPBU269-06 gallin a. Gallinago gallinago (◊) and Texas USA Mar BROM169-06 delicata Gallinago delicata (♦). K2P Alaska USA Jun BROM514-07 delicata Neighbour joining tree of 602 bp Kamchatka RUS Jul KBPBU270-06 gallinago of the COI gene. Labels show Tuva RUS Jun KBPBU271-06 gallinago region, country code and month of Alaska USA Sep BOTW001-04 delicata capture, followed by the BOLD Alaska USA Jun TZBNA214-03 delicata specimen ID and subspecies Lappi FIN Jun BROM222-06 gallinago designation where available. Ontario CAN Sep BROM513-07 delicata b. Coenocorypha pusilla and Alaska USA Sep BOTW245-05 delicata Coenocorypha heugeli. Median Gardur ISL Jul BROM515-07 faroeensis joining network of 104 COI Ontario CAN TZBNA195-03 delicata barcode sequences of 602 bp. Stockkseyri ISL Jul BROM411-06 faroeensi Numbers represent substitution Oland SWE Sep BISE375-08 position. Sequences are from Stockholm SWE Apr BISE083-07 Baker et al. (2010). Oppland NOR Jul BON052-06 gallinago Finnmark NOR Jul BON217-07 gallinago Hyogo JPN Oct BROM919-08 gallinago Hof ISL Jul BROM516-07 faroeensis Gallinago nigripennis BROM216-06 Gallinago paraguaiae BROM266-06

0.01

b. Coenocorypha pusilla, n=24 C. heugeli, n=28 C. aucklandica aucklandica, n=26 C. a. meinertzhagenae, n=9 C. aucklandica (Campbell Is), n=17

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 29

In two cases, species were indistinguishable resulting in a nearest-neighbour distance of 0%. In the first, the Eurasian Common Snipe, Gallinago gallinago is indistinguishable from the American Wilson’s Snipe, Gallinago delicata: seven G. delicata specimens from Alaska, Ontario, and Texas have barcodes identical to 10 G. gallinago specimens from Iceland, Finland, Russia and Japan (see Figure 2.2 a). However, even the addition of 2005 base pairs of mitochondrial sequence from cytochrome b, 12S rDNA, and ATPase6 is not enough to resolve these two taxa (Baker et al., 2009). It appears that any divergence that has occurred has been too recent to allow for mitochondrial DNA lineage sorting.

The second case is that of the Chatham Island Snipe, Coenocorypha pusilla and the Snare’s Island Snipe, C. heugeli, which are also indistinguishable by barcodes. Clements (2007) considered the Snares Island Snipe to be a subspecies of the Subantarctic Snipe and as such it is listed as Coenocorypha aucklandica heugeliin the Barcode of Life Database. The 104 Coenocorypha barcodes presented here are part of a more extensive study of this genus in which microsatellites, 1980 base pairs of mitochondrial DNA and morphology were used (Baker et al., 2010). This study concluded that C. aucklandica heugeli should be considered a separate species in part because longer mitochondrial sequences of C. pusilla sort out from those of C. a. heugeli (Baker et al., 2010). A median joining network of COI barcodes (figure 2.2 b) shows that even this short sequence suggests differentiation between the two taxa since there is a second haplotype in C. a. heugeli that appears not to exist in C. pusilla. C. aucklandica can be more easily identified with barcodes: only two substitutions distinguish it from the other two Coenocorypha species but with 52 specimens all bearing the same two substitutions, it can be concluded that these are fixed differences that can be considered diagnostic.

Finally it is worth noting the large distance between the Greater Painted Snipe, Rostratula benghalensis and the Australian Painted Snipe, Rostratula australis as previously reported (Baker et al., 2007a). The Australian bird was considered to be a subspecies of R. benghalensis until the 2007 revision of the Clements checklist (Clements, 2007). Barcodes show a K2P distance of 9% between R. benghalensis and R. australis (Table 2.1). This is well above the 7% nearest-neighbour average for the Scolopaci (Figure 2.1a) and when combined with morphometric and other genetic data (Baker et al., 2007a), leaves little doubt that these taxa are sufficiently distinct to be considered separate species.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 30

Subspecies identification and putative new species

Clements (2007) listed 22 Scolopacidae species with described subspecies. Barcode differences between subspecies are examined for the 14 of these 22 species that have at least two barcodes from two or more recognized subspecies (Table 2.2). In addition, two out of three Thinocoridae species with described subspecies are examined to bring the total to 16 polytypic species encompassing 47 subspecies with data.

Subspecies barcodes are considered to cluster into distinct groups if two or more conserved differences are observed between the barcodes of these groups. This means that Limosa limosa limosa and L. l. islandica are considered to cluster together since there is only one fixed difference between them. The probability that the observed clusters are observed by chance due to inadequate sampling is estimated by the method of Rosenberg and Harrison (2007). Based on this test of chance occurrence of reciprocal monophyly with a conservative criterion of α < 0.01, six of sixteen species (38%) show evidence of significant differentiation between the barcodes of at least two of their subspecies (Table 2.2). A seventh species, Attagis gayi, has subspecies barcodes separated by a distance of 1.4%, but with just five specimens, the probability that the two groups observed in this species are due to chance is estimated at 5%

The greatest divergence between subspecies is in the Solitary Sandpiper, Tringa solitaria. This split has been reported already (Hebert et al., 2004, Kerr et al., 2007), though without reference to subspecies identity. Specimens from Alaska of the subspecies T. solitaria cinnamomea have 28 fixed differences compared to T. solitaria solitaria specimens from Ontario, and the K2P distance between them is 5.1%. Published barcodes of specimens from Argentina (Kerr et al., 2009) match barcodes of T. solitaria cinnamomea, indicating that these birds are from the same lineage as the Alaskan specimens (Fig.2.3).

The next largest barcode divergence between subspecies occurs in the Whimbrel (Numenius phaeopus) with 18 fixed substitutions and a K2P distance of 3.5%. These differences occur between the North American subspecies N. p. hudsonicus and the Eurasian subspecies N. p. phaeopus and N. p. variegatus (Fig 2.4). Samples were not available for the third Eurasian subspecies, N. p. alboaxillaris.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 31

Alaska USA - BOTW012-04 cinnamomea Alaska USA Jun - TZBNA557-03 cinnamomea Alaska USA Jun - TZBNA148-03 cinnamomea Alaska USA Jun - TZBNA555-03 cinnamomea T. s. cinnamomea Alaska USA Jun - TZBNA556-03 cinnamomea Corrientes ARG Sep - KBARG070-07 Corrientes ARG Sep - KBARG021-07 Ontario CAN Jun - TZBNA560-03 solitaria Ontario CAN Jun - TZBNA561-03 solitaria Ontario CAN Jun - TZBNA558-03 solitaria T. s. solitaria Ontario CAN Jun - TZBNA559-03 solitaria Ontario CAN Aug - TZBNA209-03 solitaria BROM126-06|C460-112734|Tringa ochropus Tringa ochropus

0.01 Fig. 2.3. Tringa solitaria subspecies with highly divergent COI barcodes. K2P neighbour-joining tree is based on 603 bp of the COI gene. Labels show region, country and month of capture, followed by the BOLD specimen ID and subspecies identity.

Krasnoyarskiy RUS May KBPBU151-06 Primorskiy RUS Sep KBPBU149-06 WAustralia AUS Mar - BROM827-07 WAustralia AUS Mar - BROM200-06 SKorea KOR - KBBI167-07 Murmanskaya RUS Jul KBPBU147-06 N.phaeopus phaeopus + variegatus WAustralia AUS Mar - BROM233-06 Murmanskaya RUS Aug KBPBU148-06 Finnmark NOR Jul BON091-06 Rossiya RUS Jun KBPBU150-06 GuineaBuissau GNB Feb - BROM229-06 Sor-Trondelag NOR Jun BON368-07 Ontario CAN Aug - BROM174-06 Ontario CAN Sep - BROM183-06 Ontario CAN - KBNA314-04 N.phaeopus hudsonicus Florida USA Mar - TZBNA157-03 Peru PER Dec - BROM909-08 Numenius tahitiensis BROM527-07

0.01 Fig. 2.4. Highly divergent COI barcodes in the North American subspecies of Numenius phaeopus. K2P Neighbour-joining tree is based on 603 bp of the COI gene. Labels show region, country and month of capture, followed by the BOLD specimen ID and subspecies identity.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 32

A third remarkable split occurs within the Black-tailed Godwit, Limosa limosa (Fig. 2.5). Russian and migrating Australian specimens from the eastern part of the range of L. l. melanuroides, differ by 12 fixed substitutions and a 2% K2P distance from other conspecific specimens including those from Vietnam in the western part of the L. l. melanuroides range. L. l. melanuroides was believed to breed in Eastern Siberia and northern Mongolia and winter from Australia to South East Asia (Lane, 1987, Milton, 2005, Clements et al., 2010) so this is surprising both for the extent of the differentiaton and the subdivision within a subspecies implied by this result. In contrast, L. l. islandica, L. l. limosa and the western specimens of L. l. melanuroides each make up a group that differs from the others by a single fixed substitution.

A recent mitochondrial control region study of the three subspecies of Black-tailed Godwit appears to show a very close relationship between Limosa l. limosa and specimens of Limosa l. melanuroides taken from sites within and just north of Mongolia (Ulanbataar and the River Selenga Delta near Irkutsk), with samples of the latter differing from the nominate subspecies by

RedRiverDelta VNM Dec - BROM822-07 Buryatia RUS Jul KBPBU780-06 L. limosa melanuroides - Central RedRiverDelta VNM Dec - BROM906-08 RedRiverDelta VNM Dec - BROM215-06 SIceland ISL Jul - BROM905-08 SIceland ISL Jul - BROM195-06 L. limosa islandica SIceland ISL Jul - BROM819-07 SIceland ISL Jul - BROM196-06 Overijssel NLD May - BROM203-06 L. limosa limosa Overijssel NLD May - BROM204-06 Overijssel NLD May - BROM817-07 Overijssel NLD May - BROM818-07 KhabarovskiyKray RUS Jun KBPBU152-06 WAustralia AUS Mar - BROM821-07 WAustralia AUS Mar - BROM820-07 WAustralia AUS Apr - BROM823-07 WAustralia AUS Apr - BROM248-06 L. limosa melanuroides - Eastern WAustralia AUS Apr - BROM907-08 KhabarovskiyKray RUS Jun KKBNA290-05 Buryatia RUS Jul KBPBU779-06 Magadanskaya Oblast RUS Jun KKBNA728-05 Limosa haemastica - BROM428-06

0.01 Fig. 2.5. Divergence of eastern Limosa limosa suggested by COI barcodes. K2P Neighbour-joining tree is based on 603 bp of the COI gene. Labels show region, country and month of capture, then BOLD specimen ID and subspecies identity.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 33 just one substitution over a 334 base pair control-region sequence (Hoglund et al., 2009). In both the Hoglund et al. (2009) study and the barcodes presented here, L. l melanuroides specimens that have mitochondrial haplotypes that are close to those of L. l. limosa are from the western edge of the expected range for this subspecies, whereas barcodes of specimens from the eastern edge of the range have a distinct barcode haplotype distinguished by 12 fixed differences. This suggests two distinct groups within L. l. melanuroides though the presence of both haplotypes in Buryatia, Russia, just North of Mongolia, also suggests some present-day contact between the two groups.

The Dunlin, Calidris alpina, has nine subspecies listed in Clements (2007), eight of which are represented in this study based on geographic locations of specimens. Only C. alpina arctica from Greenland is not represented here. C. alpina barcodes fall into three clusters, each distinguished by about 1% K2P distances and two to four unique fixed mutations (Fig. 2.6). The

Oppland NOR Jul BON194-07 Fig. 2.6. Calidris alpina has Murmanskaya RUS Jun KBPBU203-06 groups of subspecies Rogaland NOR Jun BON193-07 distinguished by COI barcodes. Halland SWE May BISE163-08 K2P Neighbour-joining trees Vaygach Is RUS Jul - BROM296-06 Calidris alpina - Europe are based on 603 bp of the COI N Yamal Pen RUS Jul - BROM290-06 gene. Labels show region, Gdansk POL - BROM289-06 country and month of capture, S Iceland ISL Jul - BROM287-06 followed by the BOLD Finnmark NOR Jun - BROM288-06 specimen ID. S Iceland ISL Jul - BROM286-06 Manitoba CAN Jun - HCBR154-03 Delaw are USA May - BROM298-06 Calidris alpina - North America Delaw are USA May - BROM297-06 Florida USA - BOTW050-04 Chukchi RUS Jun - BROM292-06 PrimorskiyKray RUS Dec KBPBU204-06 Chukchi RUS Jul - BROM293-06 Sakhalin RUS Jul - BROM295-06 Oland SWE Aug BISE363-08 Taymyr RUS Jul - BROM291-06 Calidris alpina - Asia to Alaska Chevak Alaska USA Jun - BROM300-06 Kamchatka RUS May - BROM294-06 Barrow Alaska USA Jun - BROM301-06 Alaska USA Jun - TZBNA115-03 Cordova Alaska USA Jun - BROM299-06 Calidris maritima - BROM328-06 Calidris tenuirostris BROM353-06

0.01 2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 34 first group corresponds to the subspecies C. alpina hudsonia and includes samples from North America east of Alaska. The second cluster is a western Palaearctic group including specimens of C. alpina and C. schinzii from Iceland, Norway, Poland and north-western Russia. The third is an eastern Siberian-Alaskan group with specimens from Taymyr, Chukchi, Kamchatka, Sakhalin Island and Alaska, apparently including five described subspecies. Unlike the other two groups, barcodes within this Siberian-Alaskan group do show some variability though it does not appear to be sorted geographically.

The substantial split within the Common Redshank, Tringa totanus, reported previously (Tavares & Baker, 2008, Kerr et al., 2010), is also seen between specimens of eastern and western Eurasia (Fig. 2.7). There is almost no variation within either group and yet there are five fixed differences between them. The western group includes specimens of T. totanus robusta of Iceland and T. totanus totanus of Scandinavia, as well as specimens from Kazakhstan and western Russia. The eastern group includes migrants from Australia and Vietnam, and birds from Mongolia and eastern Russia. Unfortunately several specimens have not been identified to subspecies and may not have been caught on breeding grounds, and thus the two groups cannot be more clearly defined at this time.

Fig. 2.7. Tringa totanus groups Finnmark NOR Jul BON084-06 totanus distinguished by COI barcodes. Finnmark NOR Jul BON206-07 totanus K2P Neighbour-joining tree is Gotland SWE May BISE191-08 totanus based on 603 bp of the COI gene. Gotland SWE May BISE311-08 totanus Labels show region, country and KrasnoyarskiyK RUS May KBPBU241-06 month of capture, followed by the AlmatyOblysy KAZ May KBPBU243-06 T.totanus - western group BOLD specimen ID and subspecies MurmanskayaO RUS Oct KBPBU240-06 identity where known. Stokkseyri ISL Jul BROM163-06 robusta Stokkseyri ISL Jul BROM162-06 robusta Stokkseyri ISL Jul BROM161-06 robusta Stokkseyri ISL Jul BROM160-06 robusta WAustralia AUS BROM164-06 XuayThuay VNM Dec BROM165-06 XuayThuay VNM Dec BROM166-06 T.totanus - eastern group Hentiy MNG Sep KBPBU244-06 Dornod MNG May KBPBU245-06 Tuva RUS Jun KBPBU242-06 Tringa stagnatilis BROM157-06

0.01

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 35

Another shank, the Willet, Tringa semipalmata, has four differences between the American east coast subspecies T. s. inornatus and two specimens of the central subspecies, T. s. semipalmatus (Table 2.2). These barcodes suggest that there may be differentiation between the populations of eastern and western Willets, but this clearly needs to be confirmed with a larger sample size.

Finally, the Rufous-bellied Seedsnipe (Attagis gayi) of the family Thinocoridae shows evidence of mitochondrial divergence between A. g. simonsi of Argentina and A. g. gayi of Chile (Fig 2.8). With seven substitutions between groups, the subspecies are likely to be well differentiated by barcodes though the sample size is sufficiently small that the Rosenberg and Harrison (2007) test puts the probability of reciprocal monophyly being observed in error at 5%. No specimens are available for the third subspecies, A. g. latreillii of Ecuador.

Tarapaca CHL Jul - BROM383-06 Tarapaca CHL Jul - BROM382-06 Attagis gayi simonsi

Tarapaca CHL Jul - BROM384-06 Rio Negro ARG Jan - KBAR433-06 Attagis gayi gayi Catamarca ARG Nov - KBAR454-06 Attagis malouinus BROM712-07

0.01

Fig. 2.8. Small sample suggests Attagis gayi has subspecies distinguished by COI barcodes. K2P Neighbour-joining tree is based on 603 bp of the COI gene. Labels show region, country and month of capture, followed by the BOLD specimen ID and subspecies identity.

The remaining nine of the 16 polytypic species have subspecies with identical barcodes: Arenaria interpres, Calidris canutus, Coenocorypha aucklandica, Gallinago gallinago, Limicola falcinellus, Limnodromus griseus, Limosa lapponica, Numenius arquata and Thinocorus orbignyanus (Figure 2.9, Table 2.2).

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 36

Taymyr RUS Jul BROM567-07 lapponica Fig. 2.9. Examples of polytypic species with Murmanskaya RUS Jul KBPBU156-06 lapponic subspecies not distinguished by COI Murmanskaya RUS Jul KBPBU155-06 lapponic barcodes. Trees are K2P Neighbour-joining Alaska USA Jun TZBNA218-03 baueri trees of 602 bp of the COI gene. Labels show Alaska USA Jun TZBNA217-03 baueri region, country and month of capture, N Auckland NZL Apr BROM816-07 baueri followed by the BOLD specimen ID and the Waddenzee NLD May BROM202-06 lapponica subspecies designation where available. W Australia AUS Mar BROM902-08 menzbieri N Auckland NZL Dec BROM182-06 baueri W Australia AUS Mar BROM904-08 menzbieri W Australia AUS Mar BROM901-08 menzbieri a. Limosa lapponica Waddenzee NLD Aug BROM206-06 lapponica Krasnoyarskiy RUS Jul BROM524-07 lapponi Murmanskaya RUS Jun KBPBU154-06 lapponic Murmanskaya RUS Jun KBPBU153-06 lapponic Finnmark NOR Jan BON437-07 W Australia AUS Mar BROM903-08 menzbieri Limosa fedoa - BROM523-07

0.01 b. Calidris canutus Florida USA - BOTW061-04 rufa T del Fuego ARG Dec - BROM307-06 rufa Keew atin CAN Jul - BROM311-06 rufa Florida USA Dec - BROM319-06 rufa Madeleine Is CAN - TZBNA133-03 rufa Ellesmere CAN Jun - BROM312-06 islandica Friesland NLD Oct - BROM315-06 islandica Queensland AUS Dec - BROM310-06 rogersii WAustralia AUS Mar - BROM308-06 piersmai Taymyr RUS Jul - BROM318-06 canutus MagadanskayaO RUS Mar - KBPBU220-06 Anadyr RUS Jul - KBPBU218-06 rogersii Anadyr RUS Jul - KBPBU219-06 rogersii Ostergotland SWE Aug - BISE378-08 SWE Aug - BISE180-08 Troms NOR May - BON373-07 Troms NOR May - BON374-07 Friesland NLD May - BROM314-06 islandica North Auckland NZL Dec - BROM316-06 roge WAustralia AUS Mar - BROM309-06 piersmai Taymyr RUS Jun - BROM317-06 canutus Calidris tenuirostris - BROM353-06

0.01 2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 37

Finnmark NOR Jul BON092-06 interpres Fig. 2.9 (continued). Examples of polytypic species Finnmark NOR Jul BON222-07 interpres with subspecies not distinguished by COI barcodes. Oland SWE Aug BISE200-08 interpres Nunavut CAN Jul HCBR177-04 morinella c. Arenaria interpres W Australia AUS Apr HCBR176-04 interpres N Auckland NZL Dec BROM275-06 interpres Finnmark NOR Jan BROM276-06 interpres Florida USA Apr BOTW060-04 morinella Taymyr RUS Jul BROM277-06 interpres Sw akopmund NAM Dec BROM710-07 interpres CAN TZBNA400-03 morinella Nunavut CAN Jun BROM274-06 morinella Alaska USA Jun BROM711-07 morinella Oland SWE Aug BISE323-08 interpres Arenaria melanocephala BROM619-07

0.01

Two species that are considered monotypic show some evidence of population divergence in their barcode sequences: the Common Greenshank (Tringa nebularia) with 12 specimens and the Sanderling (Calidris alba) with 16 specimens. The probability that observed reciprocal monophyly is due to chance alone is <0.1% by the method of Rosenberg and Harrison (2007). In both cases, there are three conserved substitutions that separate the specimen barcodes into two groups, but in neither case do the resulting groups sort along clear geographic lines (data not shown). One possibility is that this barcode split is a relict of past segregation of two populations that are now in secondary contact. If so, lack of recombination means that this split will remain in mitochondrial genomes despite current mixing of populations until one or the other haplotype drifts to fixation (Ballard and Rand, 2005).

Preliminary results from the suborder Charadrii

A total of 370 barcodes are presented for 68 of 100 Charadrii species (Table 2.3). Coverage of this suborder is uneven and nearest-neighbour analysis is not performed for the Haematopodiae, Burhinidae or Ibidorhynchidae families, or the genus Vanellus of the Charadriidae family since barcodes are unavailable for too many species in each group. However, a clade of dotterels and typical plovers (Baker et al., 2007b) comprised of 30 Charadrius species, two Thinornis species, Elseyornis melanops, Oreopholus ruficollis, and Phegornis mitchellii, is represented by 179

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 38 barcodes covering 29 ( 83%) of 35 species. Additionally, the stilts and avocets in the family Recurvirostridae are represented by 37 specimens in 8 of the 10 species.

Though limited, these data suggest that taxa in the suborders Charadrii and Scolopaci display similar wide ranges in their respective nearest-neighbour distances. The dotterel/plover clade is estimated to have originated in the late Paleocene (Baker et al., 2007b) and the range of nearest- neighbour distances observed is 1.5 to 11.4% with a mean value of 6.3% (Table 2.3). This is slightly narrower than the range of values found in the larger Scolopaci clade, and no cases are observed in which two or more Charadrii species have overlapping barcodes. However, in the smaller family Recurvirostridae, all eight species tested have low nearest-neighbour distances between 0.8 and 0.9% (Table 2.3), though since none of these species display any intraspecific variation, species identification is clear.

Within-species variation also appears similar in the Charadrii and Scolopaci (Table 2.3). Eighteen species from the dotterel/plover clade have four or more specimens, and maximum intraspecific distance varies between 0 and 1.0% except for that of Charadrius alexandrinus which is an outlier at 8.8%. Similar to the Scolopaci, three of the four species with the highest intraspecific distance are polytypic according to Clements et al. (2010): C. dubius (maximum intraspecific distance: 0.8%), C. hiaticula (maximum intraspecific distance: 1.0%) and the aforementioned C. alexandrinus. The greatest intraspecific distance in a monotypic species is 1.0% in the Two-banded Plover, Charadrius falklandicus, but two specimens from the Magallanes Province of southern Chile in February, differ by five substitutions from the others from the Argentinian coast from Tierra del Fuego to southern Brazil. Thus the Two-banded Plover may not be genuinely monotypic though additional specimens will be required to explore this pattern further. Outside this plover/dotterel clade, Vanellus chilensis is another polytypic species with a high maximum intraspecific variation of 1.7% and a clear split between subspecies (Figure 2.10a).

C. alexandrinus, known as Snowy Plover in the Americas and the Kentish Plover in Eurasia, appears to be paraphyletic as well as polytypic with respect to COI: Mongolian specimens have barcodes that are closer to those of South African specimens of the White-fronted Plover, C. marginatus and the Chestnut-banded Plover, C. pallidus, than to specimens of C. alexandrinus

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 39 nivosus of North America or C. alexandrinus occidentalis of South America (Figure 2.10b). This is consistent with the finding with microsatellites and both nuclear and mitochondrial sequence data that the Palearctic subspecies, C. alexandrinus alexandrinus is more closely related to C. marginatus than to C. alexandrinus nivosus (Küpper et al., 2009), though C. pallidus was not included in that study.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 40

Figure 2.10. Examples of species in the suborder Charadrii with high maximum intraspecific distances. Neighbour-joining trees are based on 603 bp of the COI gene. Labels show location and date of specimen capture, followed by the BOLD specimen ID.

a. Vanellus chilensis displays a Chubut ARG Jan - KAARG328-07 deep split between southern Valparaiso CHL Feb - BROM870-07 and central subspecies of South Rio Negro ARG Jan - KBAR011-06 America. The northern Chubut ARG Jan - KAARG345-07 Rio Negro ARG Jan - KBAR010-06 subspecies, V. c. cayennensis is V. c. chilensis and fretensis not represented. Magallanes-Antartica CHL Feb -BROM469-06 Tierra del Fuego ARG Nov - BROM572-07 Tierra del Fuego ARG Nov - BROM867-07 Chubut ARG BROM868-07 Santiago CHL Feb - BROM468-06 Buenos Aires ARG - KAARG110-07 Rio Grande do Sul BRA Apr - BROM871-07 Rio Grande do Sul BRA Apr - BBROM869-07 Corrientes ARG Apr - KBAR782-06 V. c. lampronotus Rio Grande do Sul BRA Apr - BROM471-06 Corrientes ARG Apr - KBAR777-06 Corrientes ARG Apr - KBAR903-06 Cachoeira do Arari BRA Jun - BROM866-07 BROM590-07 Vanellus resplendens BROM587-07 Vanellus vanellus

0.01

b. Charadrius alexandrinus (shown in red): CHL Feb - BROM219-06 C.alexandrinus American and Asian specimens are paraphyletic. CHL Feb - BROM725-07 C.alexandrinus Numbers represent Bootstrap scores (based on 87 CHL Feb - BROM220-06 C.alexandrinus 1000 replicates) PER Dec - BROM723-07 C.alexandrinus PER Jan - BROM724-07 C.alexandrinus 100 USA Tex Mar - BROM673-07 C.alexandrinus USA Tex Mar - BROM167-06 C.alexandrinus USA Lou Nov - CDLSU023-05 C.alexandrinus USA Tex - TZBNA110-03 C.alexandrinus USA Tex - TZBNA101-03 C.alexandrinus ZAF Nov - BROM644-07 C.pallidus 100 ZAF Nov - BROM881-08 C.pallidus ZAF Nov - BROM880-08 C.pallidus 100 ZAF Nov - BROM641-07 C.marginatus 75 ZAF Nov - BROM642-07 C.marginatus MNG May - KBPBU176-06 C.alexandrinus 99 MNG May - KBPBU175-06 C.alexandrinus 100 MNG May - KBPBU173-06 C.alexandrinus MNG May - KBPBU174-06 C.alexandrinus BROM669-07 Charadrius pecuarius 81 BROM496-07 Charadrius ruficapillus

0.01 2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 41

Table 2.3: Barcoding statistics for Charadrii species. Species where no specimens are available are shaded grey. An additional 15 Vanellus species are missing. n=number of specimens barcoded; NN = nearest-neighbour (see text); %D= percent K2P genetic distance

TABLE 2.3... Intraspecific %D n %D Mean Max to NN Burhinidae Burhinus bistriatus Double-striped Thick-knee 0 n/a n/a n/a Burhinus capensis Spotted Thick-knee 1 n/a n/a n/a Burhinus grallarius Bush Thick-knee 3 0 0 n/a Burhinus magnirostris Beach Thick-knee 1 n/a n/a n/a Burhinus oedicnemus Eurasian Thick-knee 1 n/a n/a n/a Burhinus recurvirostris Great Thick-knee 0 n/a n/a n/a Burhinus senegalensis Senegal Thick-knee 0 n/a n/a n/a Burhinus superciliaris Peruvian Thick-knee 2 0 0 n/a Burhinus vermiculatus Water Thick-knee 1 n/a n/a n/a

Charadriidae i. Typical plover and dotterel clade Charadrius alexandrinus Snowy Plover 14 0.03969 0.08758 1.85 Charadrius alticola Puna Plover 7 0.00098 0.00344 1.46 Charadrius asiaticus Caspian Plover 3 0 0 3.93 Charadrius bicinctus Double-banded Plover 3 0.00115 0.00172 3.13 Charadrius collaris Collared Plover 8 0.00042 0.00166 6.44 Charadrius dubius Little Ringed Plover 11 0.00165 0.00759 8.73 Charadrius falklandicus Two-banded Plover 12 0.00259 0.01005 1.46 Charadrius forbesi Forbes' Plover 0 n/a n/a n/a Charadrius hiaticula Common Ringed Plover 13 0.00496 0.01004 7.32 Charadrius javanicus Javan Plover 0 n/a n/a n/a Charadrius leschenaultia Greater Sandplover 7 0.00145 0.00344 2.59 Charadrius marginatus White-fronted Plover 2 0 0 1.85 Charadrius melodus Piping Plover 8 0.00042 0.00172 7.32 Charadrius modestus Rufous-chested Dotterel 6 0.00335 0.00667 11.35 Charadrius mongolus Lesser Sandplover 8 0 0 2.59 Charadrius montanus Mountain Plover 6 0.00056 0.00172 8.36 Charadrius morinellus Eurasian Dotterel 10 0 0 11.31 Charadrius obscures Red-breasted Dotterel 4 0.00086 0.00172 3.13

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 42

TABLE 2.3... Intraspecific %D n %D Mean Max to NN i. Typical plover and dotterel clade - continued

Charadrius pallidus Chestnut-banded Plover 3 0 0 3.67 Charadrius pecuarius Kittlitz's Plover 3 0.00345 0.00517 5.83 Charadrius peronii Malaysian Plover 0 n/a n/a n/a Charadrius placidus Long-billed Plover 0 n/a n/a n/a Charadrius ruficapillus Red-capped Plover 5 0.00169 0.00333 6.2 Charadrius sanctaehelenae St. Helena Plover 0 n/a n/a n/a Charadrius semipalmatus Semipalmated Plover 12 0.00055 0.00333 8.34 Charadrius thoracicus Madagascar Plover 0 n/a n/a n/a Charadrius tricollaris Three-banded Plover 3 0.00113 0.00172 7.97 Charadrius veredus Oriental Plover 4 0.00783 0.01565 3.93 Charadrius vociferous Killdeer 10 0.00135 0.00345 8.34 Charadrius wilsonia Wilson's Plover 5 0.00133 0.00333 7.06 Elseyornis melanops Black-fronted Dotterel 2 0.00344 0.00344 10.64 Oreopholus ruficollis Tawny-throated Dotterel 3 0.00345 0.00517 10.18 Phegornis mitchellii Diademed Sandpiper-Plover 2 0 0 11.35 Thinornis cucullatus Hooded Plover 4 0 0 7.97 Thinornis novaeseelandiae Shore Plover 1 n/a n/a 8.39

ii. Other Charadriidae species Anarhynchus frontalis Wrybill 5 0 0 3.5 Erythrogonys cinctus* Red-kneed Dotterel 5 0.00069 0.00175 10.61 Peltohyas australis Inland Dotterel 3 0 0 10.13 Pluvialis apricaria Eurasian Golden-Plover 15 0.00022 0.00166 2.58 Pluvialis dominica American Golden-Plover 12 0.00028 0.00166 4.26 Pluvialis fulva Pacific Golden-Plover 9 0.00148 0.00333 2.58 Pluvialis squatarola Black-bellied Plover 22 0.00129 0.00517 5.46 Vanellus armatus Blacksmith Plover 3 0 0 n/a Vanellus cayanus Pied Lapwing 1 n/a n/a n/a Vanellus chilensis Southern Lapwing 18 0.0842 0.01687 n/a Vanellus coronatus Crowned Lapwing 1 n/a n/a n/a Vanellus miles Masked Lapwing 1 n/a n/a n/a Vanellus resplendens Andean Lapwing 1 n/a n/a n/a Vanellus senegallus Wattled Lapwing 1 n/a n/a n/a

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 43

TABLE 2.3... Intraspecific %D n %D Mean Max to NN ii. Other Charadriidae species (continued) Vanellus tricolor Banded Lapwing 2 0 0 n/a Vanellus vanellus Northern Lapwing 12 0.00055 0.0033 n/a Missing 15 Vanellus species: albiceps, cinereus, crassirostris, duvaucelii, gregarious, indicus, leucurus, lugubris, macropterus, malabaricus, melanocephalus, melanopterus, spinosus, superciliosus, tectus. Chionididae Chionis albus Snowy Sheathbill 1 n/a n/a 3.11 Chionis minor Black-faced Sheathbill 9 0.00371 0.00835 3.11 Haematopodidae Haematopus ater Blackish Oystercatcher 1 n/a n/a n/a Haematopus bachmani Black Oystercatcher 4 0 0 n/a Haematopus chathamensis Chatham Oystercatcher 0 n/a n/a n/a Haematopus finschi South Island Oystercatcher 0 n/a n/a n/a Haematopus fuliginosus Sooty Oystercatcher 0 n/a n/a n/a Haematopus leucopodus Magellanic Oystercatcher 2 0 0 n/a Haematopus longirostris Pied Oystercatcher 0 n/a n/a n/a Haematopus moquini African Oystercatcher 0 n/a n/a n/a Haematopus ostralegus Eurasian Oystercatcher 8 0.00113 0.00332 n/a Haematopus palliatus American Oystercatcher 2 0 0 n/a Haematopus unicolor Variable Oystercatcher 4 0.00083 0.00166 n/a Ibidorhynchidae Ibidorhyncha struthersii Ibisbill 0 n/a n/a n/a Pluvianellidae Pluvianellus socialis Magellanic Plover 3 0.00111 0.00166 13.07 Recurvirostridae Cladorhynchus Banded Stilt 0 n/a n/a n/a leucocephalus Himantopus himantopus Black-winged Stilt 4 0 0 0.84 Himantopus leucocephalus Pied Stilt 4 0 0 0.84 Himantopus melanurus White-backed Stilt 6 0 0 0.84 Himantopus mexicanus Black-necked Stilt 5 0 0 0.89 Himantopus novaezelandiae Black Stilt 0 n/a n/a n/a Recurvirostra Americana American Avocet 7 0 0 0.84 Recurvirostra andina Andean Avocet 6 0 0 0.84 Recurvirostra avosetta Pied Avocet 3 0 0 0.79 R. novaehollandiae Red-necked Avocet 2 0 0 0.79

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 44

2.4 Discussion

With 81% of Scolopaci species represented, this study is a good example of how barcodes can be used to survey a substantial clade of birds, as well as a test of the power of COI barcodes to identify closely related taxa. Most species have well differentiated barcodes, with both mean and median K2P distances of about 7% between nearest-neighbours. This is slightly higher than the 6% mean distance between nearest-neighbours found in a general dataset of birds of North America (Kerr et al., 2007). Although this result seems surprising given that the birds in the North American dataset (Kerr et al., 2007) are not always compared to their closest relatives, the larger nearest-neigbour distance in the Scolopaci is likely due to the relative age of the root of the clade which has been estimated to be about 80 million years old (Baker et al., 2007b). Just two instances are found where pairs of species cannot be distinguished by barcodes, and 38% of polytypic species have subspecies that can be distinguished with barcode sequences.

Scolopaci barcodes support current research findings

Building a reference database of COI barcodes will occasionally pinpoint taxonomic issues that require further research. The fact that the results of recent studies are reflected in this dataset demonstrates that observations made from barcodes do have the potential to lead to pertinent research. Rostratula australis is a good example: the large 9% distance between R. australis and R. benghalensis barcodes (Table 2.1) matches differences in morphometrics and equally large splits in other mitochondrial genes (Baker et al., 2007a), and clearly supports the recent promotion of R. australis to full species status (Clements, 2007).

In another example, barcodes of what used to be Coenocorypha australis heugeli match those of C. pusilla and not other subspecies of C. australis (Fig. 2.2 b) and this flags a problem in the taxonomy of this group. Morphology, microsatellites and additional mitochondrial sequences do show that this snipe from the Snares Island south of the New Zealand mainland is unlikely to be a subspecies of the Subantarctic Snipe, C. australis, but rather should be considered a species in its own right (Worthy et al., 2002; Baker et al., 2010), though one that shares a barcode sequence with C. pusilla

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 45

Deep splits within polytypic species point to new research directions

Unexpected results in several taxa suggest new research questions that need to be addressed. Some issues arising from this dataset are outlined below.

Solitary Sandpiper: The 5% K2P distance between specimens of the Solitary Sandpiper (Tringa solitaria) from Alaska and Ontario (Fig. 2.3) is large enough to suggest that these may represent two different species (Hebert et al.et al., 2004, Kerr et al., 2007). However, subspecies designations suggest that this is a North-South split between subspecies that inhabit forests of different latitudes (Conover, 1944, Moskoff, 1995) rather than an East-West split: T. solitaria cinnamomea breeds between the tree line and about 60o latitude from Alaska across north- western Canada to Hudson’s Bay, whereas T. s. solitaria has a more southern range extending from British Columbia to Labrador (Conover, 1944, Moskoff, 1995). Additional specimens from throughout the range of the solitary sandpiper will be useful to confirm that each haplotype is consistently associated with one of the described subspecies, and to better define the range of each. If the pattern is maintained, then barcodes will have demonstrated divergence between subspecies despite breeding ranges that are juxtaposed along thousands of kilometres. Since these are forest-breeding birds that take over abandoned nests in trees (Moskoff, 1995), division based on forest types found at different latitudes is plausible. Finally, the potential for barcodes to contribute to mapping migration routes is considerable in species where subspecies and/or geographic origin are associated with clear haplotype differences. In this case, migrating birds sampled in Corrientes, Argentina have barcodes that match the Alaskan specimens and therefore are likely to be T. s. cinnamomea.

Whimbrel: The clear split in barcodes is matched by readily identifiable differences in size and plumage between N. p. hudsonicus and Eurasian subspecies (Audubon, 1844, Hayman et al., 1986, Skeel & Mallory, 1996). Furthermore, a deep split between Eurasian and American Whimbrels has been observed before using restriction fragment length polymorphisms or RFLPs (Zink et al., 1995). The interpretation of these results may have been hindered by very small samples and a lack of background information about typical RFLP differences between closely related species. In contrast, there is ample data to provide a context for the barcode findings. A 3.5% distance with 18 conserved substitutions between N. phaeopus hudsonicus and other

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 46 subspecies and a 4.2% maximum intraspecific distance overall in this Whimbrel dataset (Figure 2.4, Tables 2.1, 2.2) is below the average distance between nearest-neighbours of 6.9% for the Scolopaci (Fig. 2.1 b), but is well above the average maximum distance within Scolopaci species of 0.5% (Fig. 2.1 a). Of the 69 species examined, the only other species with such a high maximum intraspecific distance among individuals is the polytypic Solitary Sandpiper described above. A recent study of the Whimbrel using mitochondrial ND2 sequences from Russia and Alaska also found good evidence for population differentiation, though only minimal differences were found with nuclear ampified fragment length polymorphism data (Humphries and Winker, 2011). The use of different mitochondrial markers means that the ND2 results cannot be pooled with COI barcode results, and this is regrettable since different portions of the species range in North America are covered by each.

Black-tailed Godwit: Barcodes of the Black-tailed Godwit, Limosa limosa are somewhat at odds with the current understanding of the subspecific taxonomy of this species. Barcodes suggest that there are two Asian breeding populations (Fig. 2.5). The first is a central Asian population that includes the Mongolian birds of the Hoglund et al. (2009) study and that probably winters in Vietnam and perhaps other locations in Southeast Asia. With almost identical barcode and control region sequences, this population is likely to have diverged from L. l. limosa quite recently if at all. There is a population identified as L. l. limosa that breeds on the Western Siberian plain to Kazakhstan (Groen & Yurlov, 1999) separated from this Mongolian population by the Himalayas. A second population likely breeds in eastern Siberia and winters in Australia and Indonesia as described by Milton (2005). This population would have to be quite distinct from both the central Asian population and the European subspecies L. l. limosa and L. l. islandica, with a barcode divergence of about 2%. Nevertheless, there does appear to be some contact between the two groups now given that both Asian haplotypes are found in the two summer specimens from Buryatia, Russia, to the North of Mongolia. The global population of the Black-tailed Godwit has been estimated to have decreased by 30% over 15 years and the species was classified as Near Threatened for the IUCN Red List in 2006 (BirdLife International, 2011a). The genetic uniqueness of the East Asian specimens studied here suggests that they might be part of a population requiring separate management from other Black-tailed Godwits, and therefore it is important to establish their geographic range so that numbers can be monitored appropriately.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 47

Distances within and between species and subspecies form a continuous spectrum

The collection of COI barcodes provides an unprecedented opportunity to examine patterns of genetic differentiation between groups of taxa. Unlike either population or phylogenetic studies, comparable data are being collected both within and between species throughout major clades. As data from diverse regions continues to be added to the BOLD system, coverage will improve for this and other clades. In the meantime some preliminary observations can be made.

There does appear to be a continuous spectrum of distances between barcodes of different levels of taxa of this one clade. There is rarely much difference between conspecific specimens of monotypic species with a range of maximum intraspecific distances of 0 to 1.2%, but some of the polytypic species show larger differences with distances between subspecies ranging from 0 to 5%. Finally, the nearest-neighbour distance between full species ranges from 0 to 14% with a clear central tendency around the mean of 7%.

Not surprisingly, most cases of high variation and clusters within a species occur in polytypic species. However this is not the case for all polytypic species: 40% of the polytypic species examined have at least one subspecies or group of subspecies with distinct barcodes. This agrees reasonably well with a meta-analysis that found that 36% of 259 subspecies from 67 avian species form distinct monophyletic groups with mitochondrial sequence data (Phillimore & Owens, 2006). Conversely, an earlier study of 41 species found that just 3% of subspecies designations actually correspond to distinct mitochondrial groups (Zink, 2004). This discrepancy has been attributed to an overrepresentation of recent Nearctic-Palearctic splits in the latter study (Phillimore & Owens, 2006, Phillimore et al., 2007), but may also be due to a scoring method used by Zink (2004) that places no value on groups of subspecies.

Phenotypes may differentiate faster than COI barcodes

It is tempting to speculate that subspecies designations that are not reflected in barcodes or other mitochondrial sequences may be without merit, but more than half of the polytypic species in the suborder Scolopaci examined here showed no differentiation between barcodes of any subspecies (Table 2.2). Of these, three species stand out as having well delineated subspecies that differ not

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 48 only in colouring and morphometrics but also in migration strategies: Red Knots, Bar-tailed Godwits and Ruddy Turnstones (Fig. 2.9).

The Red Knot, Calidris canutus, has six subspecies, each of which has a distinct arctic breeding ground and a predictable migration route. These routes vary in length from about 5000 km for C. c .islandica to 15 000 km for C. c. rufa and C. c. rogersi, and destinations are equally variable. To prepare for their flights, these subspecies depart at different times, moult at different times and in different patterns, adopt different feeding and staging strategies and display different physiological and immunological adaptations (Buehler and Piersma, 2008).

The Bar-tailed Godwit has equivalent differences between subspecies with L. l. bauri flying 11 000 km non-stop from Eastern Australia and New Zealand to breeding grounds in Alaska (Gill et al., 2005), L. l. menzbieri flying a slightly shorter total distance from Western Australia to northern Siberia but in stages along the Asian coast, and L. l. lapponica which flies across Europe to Africa and India. L. l. menzbieri and L. l. bauri both winter in Australia, but in separate locations and with different feeding and weight gain patterns and different times of departure (Wilson, 2007).

Finally, the Ruddy Turnstone (Arenaria interpres) also has subspecies that display quite different migration strategies. A. i. morinella breeds along the north coast and islands of the Canadian arctic and Alaska and migrates south along the Atlantic and Pacific coasts to South America, primarily Brazil (Nettleship, 2000). A. i. interpres breeds in various locations around the Palearctic and Nearctic including Ellesmere Island of the Canadian high arctic but winters in Western Europe (Nettleship, 2000). A study of Ruddy Turnstones using mitochondrial control region sequences also found no structure between subspecies (Wenink et al., 1994).

Thus these three species all display significant morphological and behavioural differences between subspecies that appear to have arisen in less time than it takes to fix a single barcode substitution in the subspecies in question. While the actual amount of time must vary with the demographic history, effective population size and mutation rate of the particular populations involved (Charlesworth, 2009, Woolfit, 2009), it would appear that migration strategy and the adaptations that it entails have evolved rapidly. Calidris c. canutus has been estimated to have diverged from the lineage leading to the other subspecies about 20 000 years ago (Buehler &

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 49

Baker, 2005), and it has been suggested that the bottlenecks imposed by the rigours of long distance migration have resulted in strong selection pressures and thus rapid divergence of the six subspecies of this species (Buehler and Piersma, 2008). Unfortunately, divergence time estimates are not available for Arenaria interpres or Limosa lapponica but lack of barcode distinction between subspecies despite differences in migration route and strategy is consistent with a similar phenomenon in these long distant migrants too.

Dates have been estimated for within-species divergence in the Dunlin (Calidris alpina) using mitochondrial control region sequences (Buehler & Baker, 2005). The Canadian, European and Siberian-Alaskan mitochondrial lineages are estimated to have originated 180 000, 110 000 and 70 000 years ago respectively, and since the number of conserved barcode differences is 4, 3 and 2 in each of these subspecies, this implies that the average number of years for a single substitution to become fixed in a subspecies has been in the neighbourhood of 40 000 years in Dunlins. Furthermore, a minimum spanning network of mitochondrial control region sequences further subdivided the 70 000 year old Siberian-Alaskan lineage into separate Siberian, Beringean and Alaskan lineages (Buehler & Baker, 2005), and this is not clearly reflected in barcodes, suggesting that this more recent split is at the limit of the resolving power of DNA barcodes in this species.

Two species that also cannot be separated by barcodes are the Common Snipe (Gallinago gallinago) from Eurasia and Wilson’s Snipe (Gallinago delicata), from the Americas. Each of these species have extensive ranges across their respective continents, though some limited contact may occur, given that G. gallinago migrants occur on the Western Aleutian Islands and Alaskan Islands and G. delicata breeds on the Alaskan mainland and Eastern Aleutians (Gibson et al., 2003). These two taxa were considered subspecies of the same species until the recent 43rd Supplement to the AOU check-list (Banks et al., 2002) and this change was adopted by Clements in 2007. Birds from these taxa are generally considered hard to distinguish in the field, the principal difference being the number and shape of the tail feathers: G. gallinago usually has fourteen tail feathers though this number may vary between 12 and eighteen, whereas G. delicata seems to always have sixteen and these are significantly narrower in width (Tuck, 1972). The significance of this difference lies in the typical aerial mating display of the male snipe: a high- speed descent generates tail feather vibrations that produce a characteristic sound known as

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 50

“winnowing”. A change in tail feather number and shape changes the sound produced and might reduce mating success between populations with different tail conformations (Miller, 1996). If the winnowing display is subject to sexual selection, rapid divergence between populations might occur and so the situation is similar to that of long distance migrant subspecies. Whether this is a sufficient difference for G. delicata and G. gallinago to be considered separate species while differences in migration strategy are not, is beyond the scope of this study.

These findings imply that phenotypic characters such as migration strategy and associated physiological and moult patterns that experience strong selection pressure (Buehler and Piersma, 2008), may evolve faster than mitochondrial protein-coding DNA. This leads naturally to the conclusion that there are limits on what we can learn about population differentiation from mitochondrial sequence data. The use of mitochondrial DNA for the assessment of potential conservation units (Zink, 2004) will require caution since these sequences may be uninformative in recently differentiated populations and subspecies. Similar conclusions have been reached in recent studies of avian subspecies (Oyler-McCance et al., 2010, Haig and Winker, 2010, Pruett and Winker, 2010).

When mitochondrial sequences are less divergent than expected, mitochondrial introgression through hybrid zones is a potential explanation that should be considered (Ballard & Whitlock, 2004). Mitochondrial patterns have been shown to be in conflict with either nuclear or phenotypic patterns, and thus suggestive of mitochondrial introgression, in a range of vertebrates including mammals (Melo-Ferreira et al., 2005, Alves et al., 2008), fish (Bossu & Near, 2009) and reptiles (McGuire et al., 2007).

In this data set, introgression is unlikely to be the main factor producing the similarity of barcodes of the Coenocorypha species: nuclear microsatellite sequences and morphology are consistent with mitochondrial evidence and low diversity is easily explained by the fact that populations are small, isolated on islands, and have a known history of bottlenecks (Worthy et al., 2002; Baker et al., 2010).

Comparable studies are not available for the Common and Wilson’s Snipes. The range of each spans a different land mass but both occur in the Aleutian Islands (Gibson et al., 2003) creating the possibility of a low level of gene flow. Specimens presented here are from throughout the

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 51 ranges of these two species and all have essentially the same COI barcode with minor variations. Is the observed morphological divergence simply very recent, with or without some level of ongoing gene flow, or is a recent mitochondrial introgression event masking a deeper split between the taxa? While recent divergence seems more probable, introgression is hard to rule out without additional lines of evidence.

Conclusions

This is not an exhaustive review of the Scolopaci: 18% of species remain unrepresented and a third of polytypic species are represented by a single subspecies. However, as the All Birds Barcoding Initiative progresses and additional specimen barcodes are published from projects around the world, the remaining holes can be expected to be filled. There does appear to be a continuous spectrum of distances between barcodes sampled in different levels of the taxonomic hierarchy in this clade. While the frequency distributions of COI barcode distances between species, between conspecific subspecies and within monotypic species are quite different, they do overlap and all include zero. Mallet (2008) argued that there is no clear dividing line between subspecies and species and certainly the mitochondrial data presented here do not suggest any threshold of divergence that separates species from subspecies. However, the 1.6% distance threshold proposed for Palearctic birds as a species screening tool (Kerr et al., 2009a) would produce a false negative rate of 13% and a false positive rate of just 4% in this dataset, assuming current taxonomic identities are appropriate. Such a threshold should never be used as a criterion of species identification but may still be a useful as a preliminary screening tool to identify clusters of interest in large datasets.

Some well differentiated subspecies do not display differences in their DNA barcodes, confirming that selection-driven phenotypic divergence and neutral marker divergence may not always be coupled below the species level (Winker, 2009). In the Scolopaci data presented here, there does not appear to be actual conflict between barcode genotype and phenotypic-based nomenclature, but there are cases where barcode genotype lags behind phenotypic differentiation between subspecies. Nowhere is this more evident than in the long-distance migrants: Red Knots, Ruddy Turnstones and Bar-tailed Godwits.

2. Barcoding the Scolopaci and Charadrii: Species, Subspecies and Patterns of Variation 52

As barcode collections of other clades grow, they will provide considerable data for comparison and allow further insight into relationships between phenotype, mitochondrial genotype and taxonomy. Already the shorebird suborder Charadrii is producing similar results to those of the Scolopaci and further examples from other orders will produce new opportunities for comparison. As 95% of Scolopaci species examined here are clearly distinguished from their closest relatives, COI barcodes are a consistently useful tool when applied at the species level, and in some cases, may have utility at the subspecies level.

CHAPTER THREE

Barcoding the Lari: Rates of Evolution and the Identification of Species

Abstract: COI barcodes of five families of the Charadriiforme suborder, Lari are assembled and an explanation is sought for reduced species identification rates. With 106 species (80% of the total number extant) represented by 664 specimens, it is shown that COI barcoding is highly effective in the Alcidae and Sternidae, but that species identification rates are poor in the Laridae (49%) and Stercoraridae (57%), giving an overall identification rate of 77% of Lari species tested. Average COI substitution rates are estimated for representatives of each genus of the Charadriiformes using a Bayesian relaxed clock method and published node dates, and these rates are found to be low in the Lari compared to the Scolopaci and Charadrii. Thus historically reduced substitution rates combine with recent radiation and, in some cases, ongoing gene flow, to reduce the efficacy of COI barcoding in identifying species of masked gulls, southern- hemisphere skuas and white-headed gulls. However, the slowly-evolving but older species in the family Alcidae are all identified accurately and barcodes reveal that the critically endangered Kittlitz’s Murrelet may have two distinct populations.

3.1 Introduction

The proportion of bird species that can be distinguished by a 600 base pair COI barcode has been found to range from 93 to 98% in North America (Kerr et al., 2007), South America (Kerr et al., 2009b), Scandinavia (Johnsen et al., 2010) and the Eastern Palearctic (Kerr et al., 2009a). A similar rate has been found among a selection of known sister species (Tavares and Baker, 2008) and in the suborder Scolopaci of the Charadriiformes (Chapter 2). Species that cannot be distinguished by barcodes tend to be pairs or trios of closely related species (Baker et al., 2009) such as the Common and Wilson’s Snipes (Chapter 2, Baker et al., 2009) or the American Black duck, Mallard and Mottled duck (Kerr et al. 2007).

3. Barcoding Lari: Rates of Evolution and the Identification of Species 54

The white-headed gulls are unusual in that avian barcoding surveys have found groups of 10 or more of these species with shared barcode haplotypes (Kerr et al., 2007, Kerr et al., 2009a, Johnsen et al., 2010). The white-headed gulls are a monophyletic group of 21 species in the genus Larus (Pons et al. 2005) that has been troubling systematists for years. All but Larus dominicanus are northern hemisphere gulls with overlapping geographic ranges and many active hybrid zones. Ernst Mayr (1942) famously proposed that a large subset known as the Herring Gull complex makes up a circumpolar “ring species”. The ancestral lineage supposedly emerged from a single mid-Eurasian refugium and dispersed in two directions around the Holarctic creating a chain of taxa such that gene flow occurs between adjacent populations but not between those that are more distant. At one end of the chain was the Lesser Black-backed Gull, Larus fuscus of Europe, and at the other was the North American Herring Gull, L. smithsonianus. This latter was supposed to have closed the “ring” by dispersing to Europe where it would have given rise to the European Herring Gull and would have been reproductively isolated from L. fuscus (Mayr, 1942, Liebers et al., 2004).

More recently, attempts have been made to study the white-headed gulls using mitochondrial DNA and it has generally been found that many taxa share haplotypes (Crochet et al., 2002, Crochet et al., 2003, Liebers and Helbig, 2002, Liebers et al., 2004, Gay et al., 2009) and that the phylogenetic tree of these species cannot be resolved (Pons et al., 2005). However, the ring species hypothesis has been called into question by the finding that the taxa of the so-called Herring Gull complex fall into two distinct mitochondrial sequence clades and that there is no evidence of a sister relationship between North American and European Herring Gulls (Liebers et al. 2004).

Variation at nuclear markers such as AFLPs and microsatellites also tends to be low between many of these white-headed gull taxa (Crochet 2000, Crochet et al. 2003, Gay et al., 2007, Gay et al., 2009). Evolution of their distinct morphological phenotypes has been suggested to have been the result of differential selection pressure on certain characters such as colouration and behaviour despite some ongoing gene flow between taxa (Pons et al., 2004, Gay et al., 2007, Gay et al., 2009). This is in keeping with the idea of genic speciation (Wu, 2001) which predicts that differentiation need not be homogeneous throughout the genome. Consequently, a variable selective landscape can give rise to population differentiation and ultimately speciation without

3. Barcoding Lari: Rates of Evolution and the Identification of Species 55 physical barriers to gene flow (Wu, 2001, Rundle and Nosil, 2005, Nosil et al. 2009). Loci under selection and loci linked to them may diverge relatively quickly while the remainder will diverge more slowly under genetic drift once gene flow is sufficiently reduced (Nosil et al., 2009).

Most avian species have well differentiated COI barcode sequences even when compared to those of their sister species (Tavares and Baker, 2008, see also Chapter 2), and COI barcodes or other mitochondrial sequence data are frequently incorporated into taxonomic research. As a result, the discovery of species that are poorly differentiated by DNA barcodes requires further investigation as to why the techique fails. In general, a species can be identified with barcodes if diagnostic substitutions have been fixed within the standard 600 base pair portion of the mitochondrial COI gene. The time that this takes will depend on how long it takes for new mutations to arise within the barcode region and then become fixed thoughout the taxon, thereby becoming diagnostic. Neutral coalescence theory predicts that the time that this takes will depend not only on mutation rate but also effective population size since small populations are more prone to genetic drift (reviewed in Charlesworth 2009). Furthermore, gene flow is expected to slow population divergence (Slatkin, 1987), and this has been observed recently in a comparison of barcode divergence in flying and non-flying insects (Papadopoulou et al., 2008). Finally, if any portion of the mitochondrial genome is under selection, the rate of COI evolution will be affected (Dowling et al., 2008). With only sequence data at our disposal, it is hard to disentangle these factors since the determination of each requires assumptions about the others. However, with a reasonable phylogeny and some fossil or biogeographic evidence against which to calibrate divergence dates, it is possible to estimate the average overall substitution rate of a sequence for a particular lineage (Arbogast, 2002, Thorne and Kishino, 2002, Thorne et al., 1998).

The substitution rate in mitochondrial DNA can vary both between lineages and over time (Mueller, 2006, Pereira and Baker, 2006). A standard mitochondrial molecular clock of 2% divergence between lineages per million years (or 1% per lineage per million years) was first estimated in primates by Brown et al. (1979), and was generally accepted as a standard for birds after a similar rate was found in geese (Shields and Wilson, 1987) and later supported by an estimate of 1.6% per million years in Hawaiian Honeycreepers (Fleischer et al., 1998). However, after twenty years of widespread use, the appropriateness of a standard mitochondrial molecular

3. Barcoding Lari: Rates of Evolution and the Identification of Species 56 clock for birds has being called into question (Lovette, 2004, Pereira and Baker, 2006, Nabholz et al. 2009). Recent empirical data using cytochrome b has shown that the average rate across a range of avian species may be close to this 2% divergence/MY rate (Weir and Schluter, 2008, Paekert et al., 2007), but a closer look at the data reveals that individual lineages may vary substantially from 0.4 to 1.8% divergence/MY in tit subgenera of the family Paridae (Paekert et al. 2007) to 0.95 to 4.31% in 74 taxa from 12 different orders each with its own fossil or biogeographical calibration point (Weir and Schluter, 2008).

Larus species including the white-headed gulls are members of the family Laridae and the suborder Lari. The Lari are a monophyletic group that make up one of three suborders of the shorebird order, Charadriiformes (Baker et al., 2007b). Within the Lari, there are five families of mostly sea-faring shorebirds that together comprise a clade estimated to be some 68 million years old (95% confidence interval: 60.1 to 76.8 MY) (Baker et al., 2007b). This clade is made up of the Laridae with 53 species of gulls and two species of kittiwakes, the Sternidae with 44 species of terns and noddies, the Rynchopidae with three species of skimmers, Stecoraridae made up of seven species of skuas and jaegers and finally the Alcidae with 23 species of auklets, murrelets and puffins (Baker et al., 2007b, Clements, 2009). Successively basal branches to this group are the largely inland-dwelling coursers and pratincoles of the Glareolidae and the buttonquails of the Turnicidae (Baker et al., 2007b, Paton et al., 2003).

This paper examines COI barcodes of the five families of the internal Lari clade. In so doing, the problematic white-headed gulls are set in their phylogenetic and historic context and factors that may interfere with barcoding success can be examined. Considerable molecular phylogenetic work has been done in these families on a species level (Pereira and Baker, 2008, Given et al., 2005, Bridge et al., 2005, Pons et al., 2005, Ritz et al., 2008, Cohen et al., 1997), and a genus- level phylogeny built on nuclear as well mitochondrial genes is available for the entire shorebird order with node dates estimated using multiple fossil calibration points (Baker et al., 2007b). We know therefore that whereas the Larus lineage appears to have split from Rissa about 17 million years ago (95% CI: 15.9-19.0 MY) and has given rise to 48 extant species, alcids tend to have older nodes between genera ranging from about 15 to 45 million years, and no more than four extant species per genus. Furthermore, the dated tree allows a rate of COI substitution to be

3. Barcoding Lari: Rates of Evolution and the Identification of Species 57 estimated in genera across the shorebird order using a Bayesian relaxed clock method (Thorne and Kishino, 2002, Thorne et al., 1998).

This chapter combines published COI barcodes with 225 new sequences to provide coverage for 80% of the species of the families Laridae, Sternidae, Alcidae, Rhynchopidae and Stercoraridae in the suborder Lari. COI substitution rates are estimated for representatives of each genus of the Charadriiformes and the impact these may have had on the ability of DNA barcodes to identify species is examined in detail.

3.2 Methods

Taxon sampling

Barcodes were obtained for 225 new specimens of the families Laridae, Sternidae, Rynchopidae, Stercoridae and Alcidae from the frozen tissue collection of the Royal Ontario Museum. These sequences were combined with 439 previously published COI sequences (Hebert et al., 2004, Yoo et al. 2006, Baker et al., 2009, Kerr et al., 2007, Pereira and Baker, 2008, Tavares & Baker, 2008, Aliabadian et al., 2009, Kerr et al., 2009a; Kerr et al. 2009b, Johnsen et al., 2010) to give a total dataset of 664 barcodes from the five families that make up the Lari. Specimen records for all barcodes included in this study are available on the Barcode of Life Data Systems BOLD website (www.boldsystems.org) in the projects of the All Birds Barcoding Innitiative (ABBI). BOLD accession numbers are given in Appendix 1, along with the ID, geographic origin and date of collection of each specimen. Records for previously unpublished specimen barcodes will be publicly available in the ABBI project Royal Ontario Museum – Birds 4.

Taxonomy in this paper follows Clements Checklist of Birds of the World, 6th edition (Clements, 2007), as updated to version 6.2 (Clements et al., 2007) which is the standard currently used by the All Birds Barcoding Initiative (www.barcodingbirds.org). This includes the splitting of the North American and European Herring Gulls into two species: Larus smithonianus and Larus argentatus. ABBI has not adopted later updates to the 6th edition including Clements 6.3 (Cornell

3. Barcoding Lari: Rates of Evolution and the Identification of Species 58

Lab of Ornithology, 2009), which divides the speciose Larus genus into six separate genera but reunites the recently split Larus argentatus and Larus smithsonianus.

DNA amplification and sequencing

New specimens were primarily from the collection of the Royal Ontario Museum and took the form of frozen organ tissue, frozen blood samples or frozen tissue preserved in alcohol. Most DNA extractions were performed using a glass-fibre filter and chaotropic salt technique developed for the high volume demands of DNA barcoding (Ivanova et al., 2006). The manual protocol was followed using 96 well Acroprep 1.0 μm glass filter plates (PALL Corporation, East Hills, New York, USA). Additional extractions were performed using standard phenol- chloroform technique (Sambrook et al., 1989).

PCR amplification of the barcode region of the COI gene was performed by combining 1μl of DNA extract (target 20-25 ng DNA) with 0.2μM of each amplification primer, 1U Taq polymerase (Invitrogen), 0.4mmol dNTPs and buffer solution (after Hagelberg (1994): 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.01% gelatin, and 160mg/mL BSA.) to make up a 12.5 μL reaction. Amplification primers have been previously reported in Tavares & Baker, (2008), and targeted the first 900 base pairs of the COI gene, starting just upstream in the tRNA Tyrosine gene: LTyr – TGTAAAAAGGWCTACAGCCTAACGC, (Oliver Haddrath, pers. comm.) and COI908aH2 – GTRGCNGAYGTRAARTATGCTCG (Rebecca Elbourne). This combination reliably amplified COI in all species and provided a high quality template that was somewhat longer than the standard barcode region. However, sequencing primers described below were also used for amplification in some cases. The PCR thermocycler protocol was as follows: initial denaturation at 94°C for 5 min; 36 cycles of 94°C for 40 sec, 50°C for 40sec, and 72°C for 1 min; and a final extension at 72°C for 7 min. The amplification product was run out on a 1% agarose gel containing ethidium bromide. Bands were cut out and the amplified DNA separated from the gel by centrifugation through a filter tip.

Sequencing was performed using an Applied Biosystems ABI3100 sequencer following the manufacturer’s recommended protocols. Primers COI50L-cal (forward) and COI746H-cal (reverse) designed for the Scolopacidae (Chapter 2) were found to be effective in most shorebirds including the Lari. Nevertheless a number of variants were tried in an attempt to find

3. Barcoding Lari: Rates of Evolution and the Identification of Species 59 primers that best deliver quality and universality in this and other orders. Primers are listed in Table 3.1 below. In general, degenerate bases improve universality but may reduce trace quality if overused. M13 tails were added to LTyr and COI50L amplification primers so that a standard universal M13 sequencing primer could be used. Actual primers used for each specimen are included in the BOLD specimen records. Sequences were edited using ChromasPro version 1.33 (Technelysium Pty Ltd).

Table 3.1: Amplification and sequencing primers for COI barcoding of Charadriiiform birds

Primers* Position Sequence (5’-3’) Direction Reference from COI 5’ end

LTyr TF -24 TGTAAAAAGGWCTACAGCCTAACGC Forward O. Haddrath COI908aH2 907 GTRGCNGAYGTRAARTATGCTCG Reverse R. Elbourne COI746H-cal 757 GCTACAAARTGNGARATGATTCC Reverse R. Elbourne COIHT 748 TGGGARATAATTCCRAAGCCTGG Reverse Tavares & Baker, 2008 COI50L-cal 50 TCAACCAACCAYAAAGAYATCGG Forward R. Elbourne COI50L TF 50 TCAACCAACCAYAAAGAYATYGG Forward R. Elbourne COIAR 52 AACYAACCACAAAGACATTGG Forward O. Haddrath COIART 52 AACAAACCACAAAGATATCGG Forward Tavares & Baker, 2008

TF – M13 forward tail at 5’ end (CACGACGTTGTAAAACGAC)

Analysis

All sequences were aligned using ClustalW as implemented in MEGA 4.0 (Tamura et al., 2007) and then trimmed to give a uniform length of 603 base pairs starting at position 100 and finishing at position 702 from the 5’ end of the COI gene. Distance calculations were performed and Neighbour-Joining trees built in MEGA 4.0 (Tamura et al., 2007) using a Kimura two parameter (“K2P”) evolutionary model of correction. The nearest-neighbour distance is calculated one family at a time using the BOLD Management System (Ratnasingham & Hebert, 2007) and a K2P correction. Nearest-neighbour values are reported only where closest relatives are included in the dataset so as to avoid overestimating the true value of this parameter.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 60

A median-joining network (Bandelt et al., 1999) of white-headed gull barcodes was prepared using Network 4.5.1.0 (2008 Fluxus Technology Ltd.). This program displays relationships between closely related haplotypes of non-recombining DNA using a maximum parsimony algorithm. No differential weights were applied.

Substitution rates

Average rates of COI substitution are estimated for genera of the order Charadriiformes. The starting point is a published genera-level phylogeny of 90 representative taxa generated by Bayesian analysis of 5 kb of nuclear and mitochondrial sequence (Baker et al., 2007b). This work goes on to estimate node dates using 14 internal fossil calibration points plus root ages derived from the analysis of avian and other vertebrate mitochondrial genomes (Pereira and Baker, 2006). This provides a well-supported tree topology and set of node dates with 95% credible intervals that are used in the current work to derive COI barcode substitution rates for the same set of taxa.

Rate analysis was performed using Multidivtime (Thorne and Kishino, 2002). The method is built on the idea that not only do substitution rates vary between lineages and through time but biological similarities between closely related species result in a correlation between rates of ancestral and descendant branches (Thorne et al., 1998). This is known as autocorrelation of rates, which is implemented by positing that the log of the rate at the end of a branch will form a normal probability distribution, the mean of which is assumed to be equal to the log of the rate at the beginning of the branch. A parameter, brownmean, is generated which when multiplied by time will give the variance of this distribution. In other words, this parameter predicts how much a rate will differ between nodes. If brownmean is constrained to zero, a constant molecular clock results (Kishino et al. 2001). Minima or maxima can be provided for node dates, and sequence data may be partitioned to allow for differences between genes or categories of sequence in addition to differences between lineages and through time (Thorne and Kishino, 2002). Parameters for the model of evolution are estimated from the data in the baseml program of PAML (Yang 1997, Yang 2007) and maximum likelihood branch lengths are then estimated using estbranches from the Multidistribute package. Finally, all this information is brought

3. Barcoding Lari: Rates of Evolution and the Identification of Species 61 together in a Bayesian analysis that uses a Markov chain Monte Carlo procedure to explore node dates and evolutionary rates (Thorne et al., 1998, Thorne and Kishino, 2002).

The tree topology was taken from Baker et al. (2007b) using Pterocles and Columba as outgroup genera. Sequences were COI barcodes from the same species and in most cases the same specimen as those used in Baker et al. (2007b). The HKY85 model of evolution was used with gamma-distributed rate variation between sites approximated with five discrete rate categories. This model allows for different rates of transitions and transversions and allows nucleotide frequencies to be unequal (Hasegawa et al., 1985). Each node date was constrained to the 95% credible interval obtained in the multigene analysis of the Baker et al. (2007b) study since single genes are unlikely to contain enough information for reliable date estimates (Battistuzzi, 2010). The root time prior, rttm, and its standard deviation, rttmsd, were set at 103 MY and 4.3 MY to reflect the estimated divergence of Pterocles and Charadriiformes (Baker et al., 2007b). The root rate prior, rtrate was estimated following the method suggested in the program read-me files and elsewhere (Wiegmann et al., 2003, Baker et al., 2007b): substitutions estimated in estbranches are summed along each branch and the median is divided by the root time prior to generate the rate prior for the root. This gives a rtrate of 0.9775 %/MY and its standard deviation is set to be the same. Finally, the mean Brownian motion prior brownmean and its standard deviation, brownsd, are set at 0.9718 such that the product of rttm and brownmean (the autocorrelation constant “nu”) is equal to 1 unit of time (100 MY in this case) (Wiegmann et al., 2003, Baker et al., 2007b). Multidivtime was run with a burn-in of 50 000 cycles after which the Markov chain was sampled 20 000 times at intervals of 100 cycles. Extending the burn-in to 100000 cycles had no impact and three independant runs produced mean and credible interval rates that were within 0.01%/MY of each other.

A recent study that makes use of simulation to test the accuracy of node date estimates by Multidvtime has found that that there is a high probability of the actual simulated node date being within the 95% credible interval of the date recovered by Multidivtime if the simulated rates are made to be auto-correlated (Battistuzzi et al., 2010). Performance is also improved if the calibration point is close to the node being tested and multiple genes are used (Battistuzzi et al., 2010). However, if simulated rates are generated at random from one branch to the next, Multidivtime performs poorly whereas a second program, BEAST (Drummond and Rambaut,

3. Barcoding Lari: Rates of Evolution and the Identification of Species 62

2007) that does not assume rate autocorrelation fares much better (Battistuzzi et al., 2010). Thus the choice of program needs to take into account whether autocorrelation is likely in the dataset to be analysed. A study comparing performance of dating methods of real protein data sets suggests that there is evidence for rate autocorrelation in vertebrates, particularly when taxon sampling is dense, and that molecular dating software that models autocorrelation performs better than that which does not in such datasets (Lepage et al., 2007). Both a fish mitochondrial data set including COI and a mammalian nuclear data set were evaluated (Lepage et al., 2007) and so Multidivtime does seem a reasonable choice for the present study.

3.3 Results

The overall barcoding success rate in the Lari is 77% of tested species, but results vary considerably among the four families (Table 3.2, Table 3.3). Barcoding of species is 100% successful in the Alcidae and 100% successful in tested species of Sternidae, but is just 49% in the Laridae and 57% in the Stercoraridae. While the overlap of barcodes of the white-headed gulls has been reported already (Kerr et al., 2007, Kerr et al., 2009a), these results identify two more groups with barcodes that cluster together: the masked gulls and the southern hemisphere skuas.

Species identification in Gulls and skuas

The family Stercoraridae includes seven recognized species of skuas and jaegers, all of which have been barcoded. Three species of skua are found to share barcode haplotypes: Stecorarius antarcticus, S. chilensis, and S. maccormicki (Figure 3.1). Sample sizes here are small, but a larger study of mitochondrial control region sequences from 270 skua individuals (Ritz et al., 2008) confirms that these three species share mitochondrial haplotypes and therefore cannot be identified with mitochondrial DNA alone. Another pair, S. skua and S. pomarinus differ by just two substitutions, but analysis of 6 and 11 specimens respectively showed no variation within each species, so these differences do appear to be diagnostic (Figure 3.1).

3. Barcoding Lari: Rates of Evolution and the Identification of Species 63

3. Barcoding Lari: Rates of Evolution and the Identification of Species 64

Table 3.2: Summary of barcoding statistics for five Lari families.

Alcidae Laridae Stercoraridae Sternidae Rynchopidae Total

Species 23 55 7 44 3 132

Species barcoded 23 42 7 33 1 106

% species barcoded 100% 76% 100% 75% 33% 80%

Total Specimens 169 248 48 194 5 664

Species without unique barcodes 0 22 3 0 0 25

Barcode success rate (% of species barcoded) 100% 48% 57% 100% n/a 76%

Mean nearest-neighbour distance (%)1 4.55 1.46 2.05 4.12 n/a 3.00

Range of nearest- neighbour 0.8- distances (%)1 10.8 0-6.1 0.2-6.6 0.7-8.9 n/a 0-10.8

Mean maximum intraspecific distance (%)2 0.50 0.44 0.27 0.62 n/a 0.49

Range of maximum intraspecific distances (%)2 0-2.03 0-2.02 0-0.52 0-2.03 n/a 0-2.03

1 Species are generally excluded from nearest-neighbour analysis if congeneric species are absent. See Table 3.3. A K2P correction is applied to all distances. 2 Species are excluded from intraspecific distance analysis if the number of specimens is less than 4. See Table 3.3. Sternidae Thalasseus sandvicencis is excluded from this analysis given evidence that it is two separate species (Efe et al., 2009).

3. Barcoding Lari: Rates of Evolution and the Identification of Species 65

Table 3.3: Barcoding statistics for five Lari families. Species where no specimens are available are shaded grey. n=number of specimens barcoded; NN = nearest-neighbour (see text); %D= K2P genetic distance. Nearest-neighbour distances are not calculated where more than 15% of congeneric species are absent.

TABLE 3.3... % Intraspecific D % D to n Mean Max NN

ALCIDAE Aethia cristatella Crested Auklet 5 0.07 0.17 5.07 Aethia psittacula Parakeet Auklet 5 0.20 0.50 5.07 Aethia pusilla Least Auklet 5 0.00 0.00 6.27 Aethia pygmaea Whiskered Auklet 5 0.17 0.33 5.33 Alca torda Razorbill 11 0.19 0.52 9.02 Alle alle Dovekie 10 0.18 0.67 8.35 Brachyramphus brevirostris Kittlitz's Murrelet 13 0.57 1.22 5.84 Brachyramphus marmoratus Marbled Murrelet 10 0.03 0.18 5.84 Brachyramphus perdix Long-billed Murrelet 4 0.00 0.00 10.82 Cepphus carbo Spectacled Guillemot 4 0.00 0.00 0.77 Cepphus columba Pigeon Guillemot 5 0.17 0.17 0.77 Cepphus grylle Black Guillemot 11 0.03 0.18 4.96 Cerorhinca monocerata Rhinoceros Auklet 7 0.19 0.67 3.49 Fratercula arctica Atlantic Puffin 13 0.18 0.50 1.32 Fratercula cirrhata Tufted Puffin 8 0.22 0.50 3.32 Fratercula corniculata Horned Puffin 6 0.00 0.00 1.32 Ptychoramphus aleuticus Cassin's Auklet 7 0.10 0.33 6.65 Synthliboramphus antiquus Ancient Murrelet 8 0.04 0.17 3.28 Synthliboramphus craveri Craveri's Murrelet 2 0.00 0.00 1.52 Synthliboramphus hypoleucus Xantus' Murrelet 1 n/a n/a 1.52 Synthliboramphus Japanese Murrelet 2 0.17 0.17 3.28 wumizusume Uria aalge Common Murre 15 0.80 1.87 5.45 Uria lomvia Thick-billed Murre 12 0.98 2.03 5.45

LARIDAE White-headed Gulls Larus argentatus European Herring Gull 8 0.52 1.00 0.00 Larus armenicus Armenian Gull 0 n/a n/a n/a

3. Barcoding Lari: Rates of Evolution and the Identification of Species 66

TABLE 3.3... % Intraspecific D % D to n Mean Max NN

White-headed Gulls (continued) Larus cachinnans Caspian Gull 1 n/a n/a 0.16 Larus californicus California Gull 7 0 0.00 0.00 Larus dominicanus Kelp Gull 7 0.095 0.17 0.00 Larus fuscus Lesser Black-backed Gull 13 0 0.00 0.00 Larus glaucescens Glaucous-winged Gull 7 0 0.00 0.00 Larus glaucoides Iceland Gull 4 0.083 0.17 0.00 Larus heuglini Heuglin's Gull 1 n/a n/a 0 Larus hyperboreus Glaucous Gull 13 0.45 1.00 0.00 Larus livens Yellow-footed Gull 0 n/a n/a n/a Larus marinus Great Black-backed Gull 14 0.34 1.00 0.00 Larus michahellis Yellow-legged Gull 2 n/a n/a 0.17 Larus occidentalis Western Gull 4 0.17 0.33 0.00 Larus schistisagus Slaty-backed Gull 0 n/a n/a n/a Larus smithsonianus American Herring Gull 11 0.18 1.00 0.00 Larus thayeri Thayer's Gull 4 0.085 0.17 0.00 Larus vegae East Siberian Gull 3 n/a n/a 0 Larus heermanni Heermann's Gull 3 n/a n/a 0.81 Larus canus Mew Gull 17 1.12 2.02 1.01 Larus delawarensis Ring-billed Gull 7 0.095 0.33 0.67

Masked Gulls Larus brunnicephalus Brown-headed Gull 0 n/a n/a n/a Larus bulleri Black-billed Gull 5 0.21 0.52 0.17 Larus cirrocephalus Gray-headed Gull 5 0.17 0.33 0.00 Larus genei Slender-billed Gull 1 n/a n/a 3.04 Larus hartlaubii Hartlaub's Gull 2 n/a n/a 0.00 Larus maculipennis Brown-hooded Gull 4 0.25 0.50 0.83 Larus novaehollandiae Silver Gull 1 n/a n/a 0.17 Larus philadelphia Bonaparte's Gull 7 0.04 0.17 2.74 Larus ridibundus Black-headed Gull 18 0.075 0.35 0.43 Larus scopulinus Red-billed Gull 0 n/a n/a n/a Larus serranus Andean Gull 1 n/a n/a 0.30

3. Barcoding Lari: Rates of Evolution and the Identification of Species 67

TABLE 3.3... % Intraspecific D % D to n Mean Max NN

Other Gulls Creagrus furcatus Swallow-tailed Gull 1 n/a n/a 5.66 Larus audouinii Audouin's Gull 0 n/a n/a n/a Larus hemprichii Sooty Gull 0 n/a n/a n/a Larus ichthyaetus Great Black-headed Gull 0 n/a n/a n/a Larus leucophthalmus White-eyed Gull 0 n/a n/a n/a Larus melanocephalus Mediterranean Gull 0 n/a n/a n/a Larus relictus Relict Gull 1 n/a n/a Larus atlanticus Olrog's Gull 0 n/a n/a n/a Larus belcheri Belcher's Gull 2 n/a n/a n/a Larus crassirostris Black-tailed Gull 11 0.033 0.18 n/a Larus pacificus Pacific Gull 0 n/a n/a n/a Larus atricilla Laughing Gull 11 0.12 0.68 0.48 Larus fuliginosus Lava Gull 0 n/a n/a n/a Larus modestus Gray Gull 4 0 0.00 2.48 Larus pipixcan Franklin's Gull 7 0.096 0.35 0.48 Larus scoresbii Dolphin Gull 2 n/a n/a 3.45 Larus saundersi Saunders' Gull 7 0.079 0.17 6.02 Larus minutus Little Gull 1 n/a n/a n/a Rhodostethia rosea Ross' Gull 4 0.42 0.67 6.07 Xema sabini Sabine's Gull 5 0.1 0.17 4.79 Rissa brevirostris Red-legged Kittiwake 2 n/a n/a 4.74 Rissa tridactyla Black-legged Kittiwake 16 0.19 0.50 4.74 Pagophila eburnea Ivory Gull 4 0 0 4.79

RYNCHOPIDAE Rynchops albicollis Indian Skimmer 0 n/a n/a n/a Rynchops flavirostris African Skimmer 0 n/a n/a n/a Rynchops niger Black Skimmer 9 0.04 0.17 n/a

STERCORARIDAE Stercorarius antarcticus Brown Skua 4 0.28 0.33 0.17 Stercorarius chilensis Chilean Skua 2 0 n/a 0.17 Stercorarius longicaudus Long-tailed Jaeger 16 0.19 0.52 6.59

3. Barcoding Lari: Rates of Evolution and the Identification of Species 68

TABLE 3.3... % Intraspecific D % D to n Mean Max NN

Stercorarius maccormicki South Polar Skua 2 0 n/a 0.17 Stercorarius parasiticus Parasitic Jaeger 11 0.15 0.51 6.59 Stercorarius pomarinus Pomarine Jaeger 9 0 0.00 0.34 Stercorarius skua Great Skua 4 0 0.00 0.34

STERNIDAE Anous minutus Black Noddy 4 0.083 0.17 n/a Anous stolidus Brown Noddy 2 0 n/a n/a Anous tenuirostris Lesser Noddy 0 n/a n/a n/a Chlidonias albostriatus Black-fronted Tern 1 n/a n/a 3.74 Chlidonias hybrida Whiskered Tern 7 0.4 1.01 5.38 Chlidonias leucopterus White-winged Tern 5 0.27 0.50 1.40 Chlidonias niger Black Tern 11 0.12 0.33 1.40 Gelochelidon nilotica Gull-billed Tern 11 1.32 2.03 7.23 Gygis alba White Tern 2 0.84 n/a n/a Hydroprogne caspia Caspian Tern 10 0.12 0.33 8.01 Larosterna inca Inca Tern 2 0.17 n/a 8.36 Onychoprion aleuticus Aleutian Tern 7 0 0.00 8.81 Onychoprion anaethetus Bridled Tern 4 1.31 2.03 4.20 Onychoprion fuscatus Sooty Tern 7 0.081 0.17 5.64 Onychoprion lunatus Gray-backed Tern 1 n/a n/a 4.20 Phaetusa simplex Large-billed Tern 4 0.2 0.34 8.94 Procelsterna albivitta Gray Noddy 0 n/a n/a n/a Procelsterna cerulea Blue Noddy 0 n/a n/a n/a Sterna acuticauda Black-bellied Tern 0 n/a n/a n/a Sterna aurantia River Tern 0 n/a n/a n/a Sterna dougallii Roseate Tern 1 n/a n/a n/a Sterna forsteri Forster's Tern 4 0 0.00 n/a Sterna hirundinacea South American Tern 1 n/a n/a n/a Sterna hirundo Common Tern 18 0.37 1.00 n/a Sterna paradisaea Arctic Tern 11 0.19 0.50 n/a Sterna repressa White-cheeked Tern 0 n/a n/a n/a Sterna striata White-fronted Tern 2 0.17 n/a n/a Sterna sumatrana Black-naped Tern 2 0 n/a n/a

3. Barcoding Lari: Rates of Evolution and the Identification of Species 69

TABLE 3.3... % Intraspecific D % D to n Mean Max NN

Sterna trudeaui Snowy-crowned Tern 4 0.083 0.17 n/a Sterna virgata Kerguelen Tern 0 n/a n/a n/a Sterna vittata Antarctic Tern 2 0.17 n/a n/a Sternula albifrons Little Tern 12 0.67 1.52 n/a Sternula antillarum Least Tern 4 0.17 0.33 n/a Sternula balaenarum Damara Tern 0 n/a n/a n/a Sternula lorata Peruvian Tern 0 n/a n/a n/a Sternula nereis Fairy Tern 1 n/a n/a n/a Sternula saundersi Saunders' Tern 0 n/a n/a n/a Sternula superciliaris Yellow-billed Tern 5 0 0.00 n/a Thalasseus bengalensis Lesser Crested Tern 2 0 n/a 0.65 Thalasseus bergii Great Crested Tern 3 0 n/a 1.31 Thalasseus bernsteini Chinese Crested Tern 0 n/a n/a n/a Thalasseus elegans Elegant Tern 6 0.11 0.33 1.77 Thalasseus maximus Royal Tern 10 0.13 0.34 0.65 Thalasseus sandvicensis Sandwich Tern 28 1.63 4.49 1.77 T.s. sandvicensis 21 0.097 1.01 2.06 T.s. acuflavidus/eurygnathus 7 0.26 0.34 2.78

3. Barcoding Lari: Rates of Evolution and the Identification of Species 70

BROM570-07 S.antarticus BROM571-07 S.antarticus BROM217-06 S.chilensis BROM637-07 S.chilensis BROM848-07 S.antarticus BROM616-07 S.maccormicki BROM912-08 S.maccormicki KAARG003-07 S.antarticus NOR Aug - BON412-07 S.skua ISL Aug - KKBNA227-05 S.skua ISL Jul - BROM198-06 S.skua ISL Jul - BROM197-06 S.skua ISL Aug - BOTW305-05 S.skua SWE Oct - BISE130-07 S.skua CAN Nov - BROM546-07 S.pomarinus USA Jun - KBNA749-04 S.pomarinus USA - BROM575-07 S.pomarinus USA - BROM574-07 S.pomarinus CAN Nov - BROM265-06 S.pomarinus USA Jun - BROM191-06 S.pomarinus USA Sep - BOTW270-05 S.pomarinus NOR May - BON164-07 S.pomarinus USA Sep - CDUSM022-05 S.pomarinus USA Sep - CDUSM023-05 S.pomarinus USA Sep - CDUSM024-05 S.pomarinus Stercorarius parasiticus

Stercorarius longicaudus

0.01

Fig. 3.1: Stercoraridae species are poorly differentiated by COI barcodes. A K2P-corrected neighbour-joining tree shows that three southern hemisphere species of skua Stercorarius maccormicki, S. chilensis and S. antarcticus, cannot be distinguished by COI barcodes. S. pomarinus and S. skua have a small but consistent difference of 0.3% which represents 2 substitutions.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 71

The family Laridae includes 53 species of gulls and two species of kittiwakes. Black-headed gulls and black-tailed gulls are poorly represented with just three out of 10 species barcoded, but other groups have reasonable coverage. The masked gulls are a monophyletic group of 11 species that it has been suggested should be assigned to Chroicocephalus (Pons et al., 2005, Clements 2008). Larus genei and L. philadelphia appear to be basal to the rest of the group (Pons et al., 2005) and have distinct barcodes (Table 3.3). The remaining seven barcoded species all fall within a cluster in which the maximum distance between any two specimens is 1.4% (Figure 3.2). Sampling is uneven and yet it is clear that this group will be problematic. Within the cluster, L. cirrocephalus and L. hartlaubi share a haplotype and L. bulleri has two haplotypes, one of which falls with L. novaehollandiae. Previous results obtained with mitochondrial control region and cytohrome b sequences (Pons et al., 2005) suggest that the unbarcoded L. scopulinus can be expected to fall with L. novaehollandiae and L. bulleri, whilst L. brunnicephalus is a recently diverged sister to L. ridibundus and will need to be BROM570-07 barcoded S.antarticusbefore the distinctness of the L. BROM571-07 S.antarticus ridbundus barcode can be confirmed despite the eigh BROM217-06teen specimens S.chilensis of the latter. BROM637-07 S.chilensis BROM848-07 S.antarticus BROM616-07 S.maccormicki BROM912-08 S.maccormicki Figure 3.2: Masked gull species are Larus ridibundus (18) KAARG003-07 S.antarticus poorly differentiated by COI NOR Aug - BON412-07 S.skua barcodes. A K2P-corrected ISL Aug - KKBNA227-05 NZL Nov - S.skuaBROM552-07 L.bulleri Neighbour-joining tree shows a ISL Jul - BROM198-06 S.skua AUS BWA044-06 L.novaehollandiae cluster of at least seven species. Two ISL Jul - BROM197-06 S.skua NZL Nov - BROM774-07 L.bulleri species are missing from the clade: ISL Aug - BOTW305-05 S.skua NZL Nov - BROM775-07 L.bulleri Larus brunnicephalus, expected to be SWE Oct - BISE130-07 S.skua NZL - BROM613-07 L.bulleri sister to L. ridibundus and L. CAN Nov - BROM546-07 S.pomarinus NZL Nov - BROM553-07 L.bulleri scopulinus, expected to fall with L. USA Jun - KBNA749-04 S.pomarinus ECU Jul - BROM814-07 L.serranus novaehollandiae (Pons et al., 2005). USA - BROM575-07 S.pomarinus CHL Feb - BROM792-07 L.maculipennis USA - BROM574-07 S.pomarinus ARG Feb - BROM791-07 L.maculipennis CAN Nov - BROM265-06 S.pomarinus CHL Feb - BROM793-07 L.maculipennis USA Jun - BROM191-06 S.pomarinus USA Sep - BOTW270-05 BRA AprS.pomarinus - BROM794-07 L.maculipennis NOR May - BON164-07 ZAF Nov S.pomarinus - BROM566-07 L.cirrocephalus USA Sep - CDUSM022-05 ZAF Jun - S.pomarinusBROM779-07 L.cirrocephalus USA Sep - CDUSM023-05 ZAF Dec - BROM565-07 S.pomarinus L.cirrocephalus USA Sep - CDUSM024-05 ECU May - BROM612-07 S.pomarinus L.cirrocephalus Stercorarius ZAF parasiticus Dec - BROM778-07 L.cirrocephalus ZAF Nov - BROM787-07 L.hartlaubii Stercorarius longicaudus ZAF Nov - BROM788-07 L.hartlaubii BHR Mar - BROM614-07 L.genei

Larus philadelphia (7) 0.01 Larus dominicanus

0.01 3. Barcoding Lari: Rates of Evolution and the Identification of Species 72

Twenty-one species of white-headed gull are currently recognized, of which 18 have barcodes (Table 3.3). Of these, Larus delawarensis, L. canus and L. heermanni are the only ones clearly identified by barcodes, and North American and Eurasian specimens of L. canus are paraphyletic with respect to their barcodes as has been reported already (Kerr et al., 2009a). The remaining 15 white-headed species have barcodes that cluster together (Figure 3.3a) with a maximum distance between any two specimens of 1.2%. Three white-headed species have not yet been barcoded (L. armenicus, L. livens and L. schistisagus) but other research that makes use of mitochondrial DNA in this group (Crochet et al., 2002, Liebers et al., 2004, Pons et al., 2005) suggests that these will also have barcodes that fall within this major white-headed gull cluster and thus will not be identified to species level.

A median joining network of barcodes from 126 specimens reveals some interesting geographic patterns within the cluster of 15 overlapping white-headed gull species (Figure 3.3b). Most North American and Pacific Asian specimens share the NA/PA haplotype or have a unique haplotype that differs from NA/PA by a single substitution. This group includes 10 species with 32 North American specimens and seven East Asian specimens from Mongolia to Kamchatka. A second North American haplotype, NA-cal, differs from NA/PA by 2 substitutions and includes all six specimens of the North American L. californicus and one L. occidentalis.

European specimens fall into two groups. The first European group, E1, is a cluster separated by four substitutions from the second. In this E1 group, 14 of 16 specimens are specimens of L. marinus, L. michahellis, L. argentatus and L. hyperboreus. Individual haplotypes are named for the predominant species. What is particularly surprising is that with the exception of L. michahellis which is limited to Europe, each of these species also has North American specimens with the same NA/PA haplotype. The second group that includes European specimens E/SA is separated from the NA/PA group by a single substitution and includes all of the European L. fuscus as well as some European specimens of L. argentatus and some of the South American Larus dominicanus. This group also includes the only specimen of Larus heuglini which was taken from the Yamalo-Nenetskiy region, just east of the Urals. Unfortunately this is the only specimen of these overlapping white-headed gull species from northern central Russia.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 73

No European specimens have North American haplotypes and only five of 42 North American specimens in this cluster have European haplotypes. These five exceptional specimens come from 2 species: the holarctic Black-backed Gull, L. marinus and the North American Pacific- coast Western Gull, L. occidentalis. North American specimens of L. marinus are split between NA/PA and E1 though European specimens all have haplotypes in the E1 cluster. In addition, two specimens of L. occidentalis have the E/SA haplotype, though these may be the result of hybridization as described below.

The Western Gull, L. occidentalis inhabits the west coast of North America and forms a large hybrid zone with L. glauscescens that extends from Vancouver Island to Oregon (Gay et al., 2009). Past studies using control region and cytochrome b sequences but with specimens from a limited range have found L. occidentalis specimens to be quite distinct from other white-headed gulls (Liebers et al., 2004, Gay et al., 2005). This is not apparent here though with the four specimens barcoded to date (Kerr et al., 2007) each having a haplotype that matches others: one British Columbia specimen matches L. glaucescens with the common North American NA/PA haplotype, another matches L. californicus, and two, one from British Columbia and another from California, have the E/SA haplotype shared by L. dominicanus and L.fuscus among others. This suggests that L. occidentalis may hybridize with more species than previously documented.

Finally, the white-headed Mew Gull (L. canus) forms two distinct, paraphyletic clusters with respect to COI (Johnsen et al., 2010), one from North America and one from Eurasia, with the core Herring Gull complex between the two. Unlike other white-headed species, Asian Pacific specimens of L. canus cluster with the European specimens and not with the North American specimens (Figure 3.3b).

Intraspecific variation is generally limited in the Laridae. Maximum intraspecific distance in species with 4 or more specimens averages 0.4% with the Mew gull, L. canus, having the highest value at 2.0% followed by some of the Holarctic white-headed gulls such as L. hypoleucus or L. argentatus at 1.0%. Little structure suggestive of subspecies is observed though the 16 specimens of the Black-legged Kittiwake (Rissa tridactyla) separate into Atlantic and Pacific clusters differing by two fixed differences.

Species , Specimen Number Larus argentatus, 10 Larus marinus, 14 Larus smithsonianus, 11 Larus hyperboreus, 13 (L. argentatus smithsonianus) NA-hee Larus michahellis, 2 Larus vegae, 3 (L. argentatus vegae) Larus heuglini, 1 Larus thayeri, 4 Larus dominicanus, 7 Larus glaucoides, 4 Larus fuscus, 13 Larus occidentalis, 4 NA-del Larus heermanni, 3 Larus cachinnans, 1 NA-can NA-cal Larus canus, 17 E-hyp Larus californicus, 6 SH-dom Larus glaucescens, 7 E-mar Larus delawarensis, 7 E-mic E/PA-can E/SH

NA/PA E1 Group E1 Group Figure 3.3a: Median joining network of 126 white-headed gull COI barcodes from 18 species. Haplotype names denote region followed by first 3 letters of a species name if one species predominates. E=Europe, NA=North America, PA=Pacific Asia, SH=Southern Hemisphere. Node size is proportional to specimen number and each species is represented by a different colour. Larus argentatus smithsonianus and L. a. vegae are represented as separate species L. smithsonianus (black) and L. vegae (olive) as per the All Birds Barcoding Innitiative checklist, though they are considered subspecies of L. argentatus by Clements and the AOU (Clements et al., 2008).

Europe (E)

Pacific Asia (PA) NA-hee

North America (NA)

Southern Hemisphere (SH)

NA-del

NA-can NA-cal E-hyp

SH-dom

E-mar E-mic E/SH E-mar E-mic E/PA-can

NA/PA E1 Group E1 Group

Figure 3.3b: Regional distribution of white-headed gull barcodes. Same median joining network as Figure 3.3a but here colours represent geographic origin of specimens. Three species, L. marinus, L. argentatus and L. hyperboreus, all have specimens from Europe with E-mar/E-hyp haplotypes and specimens from North America or the Pacific coast of Asia with the NA-PA haplotype.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 76

Species Identification in Auks and Terns

The 23 species of the Alcidae are all represented here and all are clearly distinguished by their COI barcodes. The Spectacled and Pigeon Guillemots, Cepphus columba and Cepphus carbo are the closest with 0.77% genetic distance between their barcodes and just three fixed differences. Overall, the mean distance between nearest-neighbours is 4.55% and among-population differentiation is evident in several species.

Uria aalge and Uria lomvia show splits between Atlantic and Pacific specimens within each species of 1.4% and 1.6%, respectively. This means that Northern European specimens match those of Northern and Eastern Canada, whereas specimens from eastern Asia (only available for Uria lomvia) match those of the North American West coast. This common pattern suggests a similar history for these two species and reflects the tendency of seabirds such as these to have ranges delimited by oceans rather than land (Friesen et al., 2007).

In contrast, the Kittlitz Murrelet (Brachyramphus brevirostris) has a 1% phylogeographic split within the Pacific basin (Figure 3.4). One group includes summer specimens from two Aleutian Islands - Attu at the western end of the archipelago and Unalaska near the Alaskan peninsula - as well as a specimen from the Russian Sea of Okhotsk. The other group includes summer specimens from the glacier-covered mainland coast of the Gulf of Alaska. The two groups of barcodes are largely invariant and separated by six fixed differences, suggesting the presence of two distinct populations. The Kittlitz murrelet is listed as critically endangered on the 2010 IUCN Red List (Birdlife International, 2011b) and the presence of distinct populations may have profound implications for the management of the species. Marbled Murrelet, Brachyramphus marmoratus, which is sister to the Kittlitz murrelet (Pereira and Baker, 2008) and which also breeds on the Aleutian Islands and the coast of north-western North America, shows no such split in barcodes taken from throughout its breeding range. 6

3. Barcoding Lari: Rates of Evolution and the Identification of Species 77

Grewink Glacier USA Jul - BROM388-06 G ESE Cordova USA Jun - KKBNA264-05 I SE Cordova USA Jun - KKBNA263-05 I SE Cordova USA Jun - KKBNA262-05 B. brevirostris gr.1 SE Cordova USA Jul - KKBNA261-05 Grewink Glacier USA Jul - BROM113-06 G Grewink Glacier USA Jul - BROM713-07 Attu Is USA Aug - BROM620-07 B Attu Is USA Aug - BROM714-07 Adian Bay Magadan RUS Jun - KKBNA652-05 A B. brevirostris gr.2 Attu Is USA Aug - BROM389-06 B Unalaska Is USA Jul - CDAMH014-05 C Unalaska Is USA Jul - CDAMH015-05 Kachemak Bay USA Jul - BROM581-07 F Attu Is USA Aug - BROM582-07 B Oregon USA Jul - BROM583-07 L Big Konuiji Is USA Jun - BROM716-07 E Attu Is USA Aug - BROM717-07 B B. marmoratus Unakwik Bay USA Aug - BROM114-06 H Shumagins Is USA Jun - BROM390-06 D Quatsino Vlg BC CAN Jan - KBNA591-04 J Holberg Inlet BC CAN Oct - KBNA590-04 K 0.01 Quatsino Snd BC CAN Feb - KBNA592-04 J Okhotsk Sea RUS Jun - BROM718-07 A Adian Bay Magadan RUS Jun - KBPBU357-06A B. perdix Adian Bay Magadan RUS Jun - KBPBU356-06 Okhotsk Sea RUS Jun - BROM478-07

H I F A Bering G Sea Sea of Gulf of Okhotsk Alaska C E B D Kodiak Is K J Attu Is & Agattu Is L

Fig. 3.4. K2P-corrected Neighbour Joining tree of COI barcodes of North Pacific murrelets displaying a 1% split within the endangered Kittlitz Murelet, Brachyramphus brevirostris. Specimens from the glaciated coast of the Gulf of Alaska have distinct barcodes from those from the Aleutian Islands and Sea of Okhotsk. Islands labelled in red are unglaciated sites where Kittlitz murrelets have unexpectedly been observed nesting (Kaler et al., 2009, Stenhouse et al., 2008). Letter labels correspond to sampling locations on the map below with Sea of Okhotsk, Aleutian Islands and mainland North America indicated by green, blue and orange labels respectively.

2000 km

1000 mi © Daniel Dalet / d-maps.com 3. Barcoding Lari: Rates of Evolution and the Identification of Species 78

Finally, the species in the Sternidae are also well delineated by barcodes, though coverage is less complete with just 33 of 44 species represented, or 75% of the family. This includes all species of Chlidonias and Onychoprion and five of six species of Thalasseus. Similar to the alcids, the average nearest-neighbour distance in these three genera and their allies (Bridge et al., 2005) is 4.12% with the closest pair being the Royal Tern, Thalasseus maximus and the Lesser Crested Tern, Thalasseus bengalensis, with just 0.7% distance and three substitutions between them. Twenty species have four or more specimens and on average, and the maximum intraspecific distance among them is 0.6% (Table 3.2).

Within-species structure is evident in four species of terns. DNA barcodes of the Sandwich Tern (Thalasseus sandvicensis) have been reported to fall into two distinct paraphyletic clusters that correspond to American and European subspecies (Efe et al., 2009). This result is confirmed here with additional sequences from Sweden, south-western Russia and Argentina falling within the appropriate geographic groups. The common tern (Gelochelidon nilotica) has also been shown to display substantial barcode splits (Tavares and Baker, 2008) with birds that breed in Australia (G. n. macrotarsa) and birds that winter in Australia but breed in eastern Asia (G. n. addenda) each having a distinct haplotype that is different again from those found in Europe and the Americas. Two other species appear to have distinct barcodes for specimens from Australia: the Little Tern, Sternula albifrons and the Bridled Tern, Onychoprion anaethetus. The Australian Bridled Tern which corresponds to the subspecies O. a. anaethetus appears to differ by as much as 2% from American specimens, but with only 2 specimens of each, this result is inconclusive.

Poor resolution in Lari matched by low rates of COI substitution

Rates of COI barcode sequence evolution are determined for a representative of each genus of the shorebird order, Charadriiformes (Figure 3.6) in order to explore the role of substitution rate in barcoding success. The mean rate of evolution for the entire shorebird order is 0.88 %/MY but considerable variation is seen throughout the order with rates ranging from 0.26 to 2.3 %/MY. While there is some overlap in the 95% credible intervals between substitution rates in most species, the rates in genera of gulls in the Lari do not overlap with those of some genera of the Scolopaci including the snipes (Gallinago), the shanks (Tringa) and the woodcocks (Scolopax). In general, the rates for the four Lari families examined here are lower than for other Charadriiformes

3. Barcoding Lari: Rates of Evolution and the Identification of Species 79 with a mean rate of just 0.55 %/MY and a frequency distribution that is significantly different (χ2=28.81, 6 degrees of freedom, p<0.001) from that of the order as a whole (Figure 3.5).

15 Other Charadriiformes

% Frequency% 10 Lari families

0 0.4 0.6 0.8 1 1.2 1.4 1.6+ COI Barcode Substitution Rate (%/lineage/MY)

Figure 3.5: Frequency distribution of estimated rates of COI barcode substitution in 86 shorebird genera as reported in Figure 3.5. The 31 genera of the Lari clade under study are shaded blue and are from the families Laridae, Sternidae, Alcidae, Stercoraridae and Rynchopidae. All genera n=86; mean=0.84 %/lineage/MY; sd=0.35; min=0.26 %/l/MY; max=2.30 %/l/MY. Lari clade n=31; mean=0.55 %/l/MY; max=0.98 %/l/MY; min=0.26 %/l/MY.

Figure 3.6: Rates of substitution in the COI barcode sequence of shorebird lineages. Estimates are based on a multigene tree of Charadriiiform genera dated using 14 fossil internal calibration points (Baker et al., 2007b). Each rate is an average for the terminal branch that extends from a genus node to a representative species of that genus. Species and specimens are listed in Appendix 2. Red lines represent Bayesian 95% credible intervals.

See next page.

Rate of COI barcode evolution in shorebird genera

4 Scolopaci Lari Charadrii Out

Actophilornis

Jacana Pedionomus

3.5 Turnix

Pluvianellus

Lymnocryptes

Xenus

Pterocles Erythrogonys

3 Coenocorypha

Eudromias

Irediparra

Limnodromus

Cursorius

Gallinago

Chionis

Attagis

Nycticryphes

Heteroscelus

Rostratula Haematopus

2.5 Rynchops

Eurynorhynchus

Catoptrophorus

Synthliboramphus

Scolopax

Elseyornis

Tringa

Pluvianus

Stercorarius

Phalaropus

Recurvirostra

Brachyramphus

Numenius

Thinocoridae

Charadrius

Burhinus

Actitis

Glareola Bartramia

2 Peltohyas

Phegornis

Rhinoptilus

Arenaria

Cladorhynchus

Esacus

Anous

Vanellus

Limosa

Gygis

Anarhyncus

Stiltia

Philomachus

Catharacta

Thinornis

Oreopholus

Alle

Limicola

Cepphus

Aphriza

Himantopus

Calidris Alca

1.5 Pluvialis

Sternula

Uria

Ptychoramphus

Micrpalama

Tryngites

Cyclorrhynchus

Thalasseus

Larosterna

Onychoprion

Phaetusa

Chlidonias

Hydroprogne

Gelochelidon

Rhodostethia

Cerorhinca

Fratercula

Sterna Aethia

1 Creagrus

Pagophila

Rissa

Larus

Xema Rate (%/lineage/MY) with (%/lineage/MY) credible intervals 95% Rate

0.5

0 Genus

3. Barcoding Lari: Rates of Evolution and the Identification of Species 81

3.4 Discussion

The barcoding success rate in the Lari compares poorly with that found in other avian barcoding studies. The average nearest neighbour distance in the five Lari families examined here is just 3%, and only 77% of species have a unique COI barcode. In the Laridae, the barcode success rate is just 49%. This is in marked contrast with the 95% success rate and 6.9% mean distance between nearest-neighbours found in another shorebird suborder, the Scolopaci (Chapter 2). Success rates in studies of avifaunas in large geographic areas are also much higher: 93% of North American birds (Kerr et al., 2007), 96% of Eastern Palearctic birds (Kerr et al., 2009a) and 94% of Scandinavian birds (Johnsen et al., 2010), and in each case, Lari species make up a substantial portion of those that cannot be distinguished by barcodes.

Reduced rate of COI substitution may slow barcode differentiation

Genera of the suborder Lari from the five families under consideration, have an average COI barcode substitution rate of 0.55%/lineage/MY which is half that of the Scolopaci (1.05%/lineage/MY), and two thirds of the mean rate in shorebirds overall (0.84%/lineage/MY). Additionally, the rate frequency distribution is significantly different from that of other shorebirds (Figure 3.5). This means that over a million years, a typical species from this Lari group will accumulate an average of just three fixed differences, and in some lineages as little as two within a 600 bp barcode. Substitutions accumulate twice as fast in the barcodes of Scolopaci lineages – 6 substitutions per million years on average.

It is important to note that 95% credible intervals for the rates of barcode substitution presented here are generally wide with upper limits often double the best estimate. Furthermore, rates are expected to vary through time as well as between lineages (Thorne et al., 1998). Nevertheless, the slower rate of barcode evolution seen in some groups is consistent with the slower rate of mitochondrial control region evolution already reported in gulls (Crochet and Desmarais, 2000), and helps to explain why Lari species resulting from recent radiations such as in the white- headed gulls (Liebers et al., 2004) are not resolved by barcodes. With a rate of 0.32%/lineage/MY (95% credible interval: 0.15-0.56, see figure 3.6), the lineage culminating in the Greater Black-backed Gull (Larus marinus) has accumulated substitutions in the COI

3. Barcoding Lari: Rates of Evolution and the Identification of Species 82 barcode sequence at a rate of one every half a million years on average since the divergence of the Rissa and Larus genera around 17 million years ago (Baker et al., 2007b). Reliable dates are not available for the origin of the white-headed gull clade, though the age of the Herring Gull complex including L. marinus has been estimated at 300 000 years (Liebers et al., 2004). This date is likely to be an underestimate since it was derived using a cytochrome b clock of 0.8%/lineage/MY (or 1.6% between lineages) based on Hawaiian honeycreepers (Fleischer et al., 1998), but it underlines how little mitochondrial diversification can be expected in these species even if isolation were complete.

The New Zealand snipes of the Scolopacidae provide an interesting contrast. Since the Coenocorypha – Gallinago split 27 MY ago (95%CI: 20-36 MY; Baker et al., 2007b), the average rate of COI substitution in the Coenocorypha aucklandica lineage has been well above average at 1.32%/lineage/MY (95%CI: 0.60-2.41). C. aucklandica is believed to have split from C. pusilla and C. heugeli only about 96 000 years ago (Baker et al., 2010), but nevertheless its barcode is distinguished by two fixed substitutions seen in 52 specimens (Table 3.1, Scolopaci chapter). A historically high rate of substitution along with rapid coalescence expected from small, isolated island populations that are subject to rapid drift have resulted in slight but consistent barcode differentiation within a period of time far less than the age of the white headed gulls.

Gene flow may slow barcode differentiation

Hybridization between various white-headed gull species has been well documented (for example: Pierotti, 1987, Bell 1996, Gay et al. 2009) and this can be expected to affect barcode resolution both by slowing differentiation (Slatkin, 1987) particularly at neutral loci during adaptive speciation (Thibert-Plante and Hendry, 2010), and by promoting introgression of haplotypes between species. The general lack of COI differentiation in this group makes introgression hard to pinpoint, though at least one example is likely: L. occidentalis is expected to have a unique, basal haplotype (Liebers et al., 2004, Gay et al., 2005) but displays three different haplotypes, none of which are unique to L. occidentalis and thus are likely the result of hybridization.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 83

Mixing of haplotypes in three Holarctic species, L. marinus, L. argentatus and L. hypoboreus, suggest a history of introgression. All have European specimens that have EI haplotypes, and North American or Asian Pacific specimens that have NA/PA haplotypes. If one considers L. smithsonianus to be the North American subspecies of L. argentatus and L. vegae to be the East Asian subspecies (i.e. L. argentatus smithsonianus and L. argentatus vegae) as per the AOU and Clements (2008, 2010) then this too follows the pattern since all these specimens are North American or Pacific Asian and have the NA/PA haplotype whereas the European Herring Gulls are predominantly from the E1 group. The Greater Black-backed Gull (L. marinus) is somewhat different from the other species in that North American specimens are divided between those having NA/PA and E1 haplotypes, whereas no European specimens have the NA/PA haplotype. The E1 haplotypes differ from NA/PA and other white head haplotypes by 4 substitutions, and this split is maintained across all three species consistent with the earlier observation that white headed gulls form two mitochondrial clades (Liebers et al., 2004). Slow rates of differentiation typical in the group mean that this split may be as old as 2 million years – much older than previous estimates of the age of the radiation of the herring gull complex. Shared ancestral polymorphism from a common ancestral population as well as gene flow between species within North America and the Pacific coast of Asia on the one hand and within western and central Eurasia on the other may be at least partly responsible for the continental divergences in barcodes across multiple species.

More rigorous analysis is limited by the fact that some Eurasian taxa are poorly represented (L. cachinnans, L. heuglini) or missing altogether (L. armenicus, L. schistisagus, L. livens). Nevertheless, the networks of Figures 3.3 and 3.4 build on the findings of Liebers et al. (2004) by expanding the range of specimens of some other species (L. marinus, L. occidentalis, L. dominicanus, L. fuscus, L. glaucescens) and in re-evaluating the time of divergence of mitochondrial haplotype clades. To date there has been no comprehensive barcoding study of specimens from Europe, the Middle East and central Asia that will help to complete the geographic pattern in barcode variation in the Laridae.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 84

Skuas and Masked Gulls: further evidence

The two other Lari groups in which species identification by barcodes is poor, present a similar history to that of the white-headed gulls. The southern hemisphere skuas, Stercorarius antarcticus, S. chilensis and S. maccormicki are believed to have diverged between 210 000 and 150 000 years ago at which time an Antarctic glaciation period would have forced birds away from the continent to find hospitable breeding grounds (Ritz et al., 2008). These species, one of which has three subspecies, have distinct ranges around Antarctica but are known to hybridize regularly (Cohen et al., 1997, Ritz et al., 2006, Ritz et al., 2008). Much like the white-headed gulls, there is overlap and paraphyly in trees built from COI barcodes of different species (Figure 3.1). The number of barcoded specimens is small but a much larger study using control region and cyt b mitochondrial sequences reveals a network of shared haplotypes (Ritz et al., 2008), making it clear that species identification by barcodes will not be possible. Estimated rates of substitution in the skuas Stercorarius skua and Stercorarius longicaudus are faster than in the Laridae and close to the average for shorebirds: 0.70 %/lineage/MY (95%CI: 0.28, 1.3) for S. skua and 0.89 %/lineage/MY (95%CI: 0.34, 1.78) for S. longicaudus. The rate of substitution is generally faster in skuas than in white-headed gulls. This faster rate is not enough to overcome the recent radiation and ongoing interspecific gene flow in the southern group of skuas, but likely indicates why barcodes of S. skua and S. pomarinus in the northern hemisphere are able to be distinguished by two fixed substitutions.

The masked gulls are likely to have the same low COI substitution rate found throughout the Laridae though this is offset by a radiation estimated to be half a million years old (Given et al., 2005), older than that of the southern hemisphere skuas. Furthermore, this date is likely to be an underestimate since the date used for calibration of the Larus-Rissa split (Paton et al., 2003) has since been revised from 3.3 MY to 16.4 MY(Baker et al., 2007b). Ten of these species breed throughout the southern hemisphere and hybridization is documented for example between L. hautlaubi and L. cirrocephalus (Randler, 2002), L. bulleri and L. scopulinus (McCarthy, 2006), and L. ridibundus and L. brunnicephalus (McCarthy, 2006). Thus slow rates of substitution and some ongoing hybridization combine to confound barcode identification.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 85

Alcids: slow substitution rate is overcome by species age

All 23 species of alcids are identified by barcodes even though COI substitution rates are almost as slow as those of the gulls in five of the Alcidae genera (Figure 3.6). The closest sister-species pair are the Spectacled and Pigeon Guillemots, Cepphus carbo and Cepphus columba estimated to have diverged about 2.5 MY ago (95%CI: 0.4-5.6 MY) (Pereira and Baker, 2008). The average rate estimated for Cepphus columba is a moderate 0.75 %/lineage/MY (95%CI: 0.32, 1.33), but this combination of divergence time and substitution rate has resulted in a genetic distance of 0.77% between the barcodes of these sister species. Fratercula species have the slowest rates of evolution in the family at 0.37 %/lineage/MY (95%CI: 0.17, 0.63) but their divergence time has been estimated at 4.3 MYA (95%CI: 1.1, 10.7) (Pereira and Baker, 2008), and so there is no trouble indentifying these species with barcode sequences that differ by 1.3%.

The substitution rate for the Brachyramphus murrelets is about average for the shorebirds at 0.84%/lineage/MY (95%CI: 0.33-1.58) but relatively fast for the Lari, and this has allowed population structure to be clearly observed in the Kittlitz Murrelet, Brachyramphus brevirostris. One of the great advantages of the Barcode of Life project is that results from different studies can easily be brought together, and this has allowed a geographic pattern to emerge that may have strong conservation implications (Figure 3.4). The Kittlitz Murrelet is listed as critically endangered on the 2010 IUCN Red List after sharp population declines over the last 10 years (Birdlife International 2011b). It is currently considered monotypic but its remote range has made it difficult to study. Alaskan mainland birds nest near glaciers and are believed to prefer foraging in turbid waters generated by glacial run-off during nesting season (Day et al., 2003, Kissling 2007). Recently, Kittlitz Murrelets have been observed nesting on glacier-free Agattu Island at the west end of the Aleutians and Kodiak Island closer to Alaska (Kaler et al., 2009, Stenhouse et al., 2008), leading to speculation that these murrelets are less specialized than previously thought (Stenhouse et al., 2008). However, the split seen in COI barcodes suggests divergence between mainland Alaskan birds and those of the Aleutians and the Sea of Okhotsk, and thus observations of foraging and nesting differences between these groups is consistent with two differentiated populations.

3. Barcoding Lari: Rates of Evolution and the Identification of Species 86

Conclusion: interplay of dates, rates and flow determines barcoding success

The white-headed gulls, masked gulls and southern hemisphere skuas together demonstrate that there is an interplay between time since divergence, variable rates of COI substitution and extent of gene flow among species, all of which may contribute to poor species discrimination with COI barcodes. An unusually slow rate of substitution as found in the gulls can result in an unusually high proportion of species that cannot be identified with DNA barcodes. However, some alcids have similarly low substitution rates, suggesting that slow rates are only a problem when divergence has been recent. Hybridization can result in misleading identifications in any circumstance, but will be harder to detect if species are poorly resolved. The combination of hybridization and poor mitochondrial resolution may limit species identification with barcodes, but if taxa are also differentiated phenotypically it may serve to flag groups where speciation is ongoing and heterogenous genomic divergence and adaptive speciation (Nosil et al., 2009, Wu, 2001) may be observed in action.

Finally, it is notable that the average substitution rate in COI barcodes across the Charadriiformes of 0.84%/lineage/MY (standard deviation=0.35) or about 1.7%/MY divergence between two lineages, is very similar to average rate estimates for avian mitochondrial protein- coding genes which vary from 1.6%/MY to 2.1%/MY (Shields and Wilson, 1987, Fleischer et al., 1998, Paekert et al. 2007, Weir and Schluter, 2008, Nabholz et al., 2009). However, this is a broad average encompassing considerable variance among different lineages, and therefore is not a definitive constant clock that can be applied to any lineage. The results presented here make it clear that the mitochondrial substitution rate differences between lineages and the time of divergence from a common ancestor have an impact on both our understanding of the phylogeography of species and the efficacy of species recognition using COI barcodes.

4. Conclusions 87

CHAPTER FOUR

Conclusions

This dataset from the shorebird order Charadriiformes is the largest and most complete set of COI barcodes for a single avian clade presented to date. Furthermore it is an order for which there is a considerable body of modern phylogenetic and population research, including estimates of divergence dates from fossils and molecular data. This has allowed patterns of COI variation to be examined relative to time, rate of evolution and taxonomic level. Success of taxon identification varies considerably between families, but this range of outcomes has allowed an exploration of factors that limit resolution with COI, making this shorebird dataset one of considerable interest.

COI barcoding is largely successful throughout the suborder Scolopaci with 95% of species tested clearly identified by COI barcodes. Subspecies were then tested in an effort to explore the limits of what can be detected with these short sequences. A set of 16 polytypic species was examined each of which had representative specimens from two or more subspecies, but only six showed evidence of barcode divergence between subspecies. Among species with recently evolved but phenotypically defined subspecies that could not be detected with DNA barcodes were long-distance migrants species such as Red Knots, Ruddy Turnstones and Bar-tailed Godwits. Thus it appears that in some cases, phenotypic differentiation can occur faster than a single barcode substitution can be fixed in subspecies populations.

Variation in DNA barcodes was then compared at different taxonomic levels within the Scolopaci. Nearest-neighbour distances between species vary between 0 and 14% with both a mean and median of about 7%. Between conspecific subspecies, the range is 0 to 5% and among individuals within monotypic species, the range is 0 to 1%. In other words, barcode differentiation is progressive through time and there is no clear boundary between levels of variation that are found between species, between subspecies, within a polytypic species or within a monotypic species. Furthermore, at each of these hierarchial levels are instances of

4. Conclusions 88 barcode invariance. Luckily these instances are rare at the species level, and sufficient fixed differences have accumulated between nearest-neighbours to allow 95% of Scolopaci species to be identified.

The Charadrii dataset is less complete than those of the other suborders and yet results thus far suggest excellent identification of species and a distribution of variation similar to that found in the Scolopaci. A clade of dotterels and typical plovers is identified to species level with 100% success with 29 of 35 species barcoded, all of which have nearest-neighbour distances greater than 1%. On the other hand all of the stilts and avocets barcoded so far (8 of 10 species) have a nearest-neighbour distance less than 1%, though identification to species is also straightforward because there is almost no intraspecific variation.

The most problematic clade in this study was the suborder Lari as expected from previous studies, with the southern hemisphere skuas, the masked gulls and the white-headed gulls known to be poorly differentiated and prone to ongoing hybridization. Of these, the white-headed gulls are the biggest problem with shared COI barcodes detected in 15 species that were tested. In the five Lari families that were examined the barcoding success rate in identifying species was just 77% overall, and as low as 49% in the gulls (Laridae), though the rate was 100% for alcids.

While it is to be expected that time since speciation will be an important factor in poorly resolved species, it is not an adequate explanation in itself since a wide range of species and subspecies of varying ages are successfully barcoded in other shorebirds. For example, divergences among subspecies populations of the dunlin (Calidris alpina) were detected despite having arisen in the last 100 000 to 200 000 years (Buehler and Baker, 2005), whereas divergences that occurred on this timescale in skuas (Ritz et al., 2008) and white-headed gulls (Liebers et al., 2004) were not mirrored in the COI sequences.

Mitochondrial substitution rates are expected to vary between avian lineages and through time (Pereira and Baker, 2006), and such variation in COI substitution rates within the shorebirds would affect the minimum time required for divergence between taxa to be reflected in barcodes. The average rate of COI substitution since divergence between genera is estimated for a representative lineage of each of 86 genera of the Charadriiformes order. Estimates range from 2.3%/MY/lineage for Turnix, 1.5%/MY/lineage for Jacana and 1.4%/MY/lineage in several

4. Conclusions 89

Scolopacidae genera, to 0.3%/MY/lineage in Laridae genera. The 95% credible intervals are wide and overlapping for most of the intervening genera, but between genera at the two extremes there is little or no overlap suggesting real differences in evolutionary rate. Furthermore, one of the lowest rates of substitution occurs in the genus Larus containing the white-headed and masked gulls that are refractory to species identification using DNA barcodes.

Another factor that may contribute to poor resolution of species with COI sequences is the mode of speciation. Heterogeneous genomic divergence may result from adaptive speciation in which genes under strong differential selection pressure begin to diverge even while gene flow is ongoing (Nosil et al., 2009, Wu, 2001). Such a mechanism has been hypothesized to explain the maintenance of distinct white-headed gull species despite overlapping ranges and extensive hybridization (Gay et al., 2009). In such a scenario, lack of differentiation at neutral markers such as nuclear microsatellites (Gay et al., 2009) or mitochondrial sequences such as barcodes is the consequence not just of limited time, but also of ongoing gene flow. Over time, gene flow may be reduced as the portions of the genome that are under selection continue to diverge, until eventually it is reduced to the point that divergence of unlinked neutral portions of the genome may occur (Nosil et al., 2009).

As for the Scolopaci, at least one of the two species pairs and several of the subspecies not distinguished by barcodes show evidence of being distinguished by traits under strong selection pressure. For example, the Common Snipe and Wilson’s Snipe are two species distinguished primarily by the shape and number of tail feathers involved in the winnowing mating display – a trait expected to be under strong sexual selection (Miller, 1996). Similarly, some long distance migrant polytypic species such as Red Knots have subspecies that cannot be distinguished by barcodes but which vary in annual cycle, migration route and migration strategy – also traits expected to be under strong selection (Buehler and Piersma, 2008).

When these observations are put together, a coherent picture begins to emerge. Time is required for barcode substitutions to arise and become fixed in divergent taxa but just how much time will depend in part on a COI substitution rate demonstrated here to be variable. At the same time, the phenotypic differences that allow taxa to be readily diagnosed by traditional taxonomy also evolve at different rates with those under strong selection pressure likely to appear faster,

4. Conclusions 90 perhaps even with ongoing gene flow in some cases. Thus recent cases of rapid adaptive speciation are the most likely to be poorly identified with barcodes, particularly in lineages that typically have the slowest rates of COI substitution.

As the All Birds Barcoding Innitiative continues to progress, this shorebird dataset will be enlarged as will those of other avian orders, and new clades will be available for analysis. The results obtained for shorebirds in this study could not be obtained so easily without an underlying mature taxonomy; nevertheless it will be important to find other suitable clades for comparative analysis. Determining how much rate variation occurs within a genus will be an interesting next step and may lead to insights into what is responsible for differences between major lineages. The role of coalescence time, effective population size and selection on mitochondrial DNA in the identification of young species are issues that remain to be explored.

REFERENCES

Aliabadian, M., Kaboli, M., Nijman, V. & Vences, M. 2009. Molecular identification of birds: Performance of distance-based DNA barcoding in three genes to delimit parapatric species. PLoS One 4: e4119. Alves, P.C., Melo-Ferreira, J., Freitas, H. & Boursot, P. 2008. The ubiquitous mountain hare mitochondria: Multiple introgressive hybridization in hares, genus lepus. Philos. Trans. R. Soc. B-Biol. Sci. 363: 2831-2839. Arbogast, B.S., Edwards, S.V., Wakeley, J., Beerli, P. & Slowinski, J.B. 2002. Estimating divergence times from molecular data on phylogenetic and population genetic timescales. Annu. Rev. Ecol. Syst. 33: 707-740. Audubon, J.J. 1844. The hudsonian curlew. In: The Birds of America, Volume 6. J.B. Chevalier, Philadelphia. Avise, J.C., Lansman, R.A. & Shade, R.O. 1979. Use of restriction endonucleases to measure mitochondrial-DNA sequence relatedness in natural-populations .1. population-structure and evolution in the genus Peromyscus. Genetics 92: 279-295. Avise, J.C. & Walker, D.E. 1999. Species realities and numbers in sexual vertebrates: Perspectives from an asexually transmitted genome. Proc. Natl. Acad. Sci. U. S. A. 96: 992-995. Baker, A.J., Miskelly, C.M. & Haddrath, O. 2010. Species limits and population differentiation in New Zealand snipes (Scolopacidae: Coenocorypha). Conserv. Genet. 11: 1363-1374. Baker, A.J., Pereira, S.L., Rogers, D.I., Elbourne, R. & Hassell, C.J. 2007a. Mitochondrial-DNA evidence shows the Australian painted snipe is a full species, Rostratula australis. Emu 107: 185-189. Baker, A.J., Pereira, S.L. & Paton, T.A. 2007b. Phylogenetic relationships and divergence times of Charadriiformes genera: Multigene evidence for the cretaceous origin of at least 14 clades of shorebirds. Biol. Lett. 3: 205-209. Baker, A.J., Tavares, E.S. & Elbourne, R.F. 2009. Countering criticisms of single mitochondrial DNA gene barcoding in birds. Mol. Ecol. Resour. 9: 257-268. Ballard, J.W.O. & Rand, D.M. 2005. The population biology of mitochondrial DNA and its phylogenetic implications. Annual Review of Ecology Evolution and Systematics 36: 621- 642. Ballard, J.W.O. & Whitlock, M.C. 2004. The incomplete natural history of mitochondria. Mol. Ecol. 13: 729-744. Bandelt, H.J., Forster, P. & Rohl, A. 1999. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16: 37-48. Banks, R.C., Cicero, C., Dunn, J.L., Kratter, A.W., Rasmussen, P.C., Remsen, J.V., Jr., Rising, J.D., Stotz, D.F. 2002. Forty-Third Supplement to the American Ornithologists' Union Check-List of North American Birds. The Auk: 119: 897-906

References 92

Battistuzzi, F.U., Filipski, A., Hedges, S.B. & Kumar, S. 2010. Performance of relaxed-clock methods in estimating evolutionary divergence times and their credibility intervals. Mol. Biol. Evol. 27: 1289-1300. Bell, D.A. 1996. Genetic differentiation, geographic variation and hybridization in gulls of the Larus glaucescens-occidentalis complex. Condor 98: 527-546. Birdlife International. 2011a. Species Factsheet: Limosa limosa, Downloaded from http://www.birdlife.org on 09/08/2011. BirdLife International, 2011b. Species factsheet: Brachyramphus brevirostris. Downloaded from http://www.birdlife.org on 09/08/2011. Bossu, C.M. & Near, T.J. 2009. Gene trees reveal repeated instances of mitochondrial DNA introgression in Orangethroat Darters (Percidae: Etheostoma). Syst. Biol. 58: 114-129. Bridge, E., Jones, A. & Baker, A. 2005. A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: Implications for taxonomy and plumage evolution. Mol. Phylogenet. Evol. 35: 459. Brown, W.M., George, M. & Wilson, A.C. 1979. Rapid evolution of animal mitochondrial-DNA. Proc. Natl. Acad. Sci. U. S. A. 76: 1967-1971. Buehler, D.M. & Baker, A.J. 2005. Population divergence times and historical demography in Red Knots and Dunlins. Condor 107: 497-513. Buehler, D.M. & Piersma, T. 2008. Travelling on a budget: Predictions and ecological evidence for bottlenecks in the annual cycle of long-distance migrants. Philosophical Transactions of the Royal Society B: Biological Sciences 363: 247-266. Burns, J.M., Janzen, D.H., Hajibabaei, M., Hallwachs, W. & Hebert, P.D.N. 2008. DNA barcodes and cryptic species of skipper butterflies in the genus Perichares in Area de conservacion Guanacaste, Costa Rica. Proc. Natl. Acad. Sci. U. S. A. 105: 6350-6355. Cai, Y., Yue, B., Jiang, W., Xie, S., Li, J. & Zhou, M. 2010. DNA barcoding on subsets of three families in aves. Mitochondrial DNA 21: 132-137. Campagna, L., Lijtmaer, D.A., Kerr, K.C.R., Barreira, A.S., Hebert, P.D.N., Lougheed, S.C. & Tubaro, P.L. 2010. DNA barcodes provide new evidence of a recent radiation in the genus Sporophila (Aves: Passeriformes). Mol. Ecol. Resour. 10: 449-458. Charlesworth, B. 2009. Effective population size and patterns of molecular evolution and variation. Nat. Rev. Genet. 10: 195-205. Chaves, A.V., Clozato, C.L., Lacerda, D.R., Sari, E.H.R. & Santos, F.R. 2008. Molecular taxonomy of Brazilian tyrant-flycatchers (Passeriformes: Tyrannidae). Mol. Ecol. Resour. 8: 1169-1177. Clements, J.F. 2007. The Clements Checklist of Birds of the World, 6th ed. edn. Comstock Publishing Associates, Ithaca, NY. Clements, J.F., Schulenberg, T.S., Iliff, M.J., Sullivan, B.L., Wood, C.L. 2010. The Clements Checklist of Birds of the World: Version 6.5.,

References 93

http://www.birds.cornell.edu/clementschecklist/Clements%206.5.xls/view. edn. Cornell Lab of Ornithology, USA. Clements, J.F., Schulenberg, T.S., Iliff, M.J., Sullivan, B.L., Wood, C.L. 2009. The Clements Checklist of Birds of the World: Version 6.4., http://www.birds.cornell.edu/clementschecklist/corrections/updates-corrections-dec-2009 edn. Cornell Lab of Ornithology, USA. Clements, J.F., Schulenberg, T.S., Iliff, M.J., Sullivan, B.L., Wood, C.L. 2008. The Clements Checklist of Birds of the World: Version 6.3., http://www.birds.cornell.edu/clementschecklist/corrections/Nov08updatescorr edn. Cornell Lab of Ornithology, USA. Clements, J.F., Schulenberg, T.S., Iliff, M.J., Sullivan, B.L., Wood, C.L. 2007. The Clements Checklist of Birds of the World: Version 6.2., http://www.birds.cornell.edu/clementschecklist/corrections/oct2007 edn. Cornell Lab of Ornithology, USA. Cohen, B.L., Baker, A.J., Bleschschmidt, K., Dittmann, D.L., Furness, R.W., Gerwin, J.A., Helbig, A.J., DeKorte, J., Marshall, H.D., Palma, R.L., Peter, H.U., Ramli, R., Siebold, I., Willcox, M.S., Wilson, R.H. & Zink, R.M. 1997. Enigmatic phylogeny of skuas (Aves: Stercorariidae). Proc. R. Soc. Lond. Ser. B-Biol. Sci. 264: 181-190. Conover, B. 1944. The races of the Solitary Sandpiper. Auk 61: 537-544. Cracraft, J. 1992. The species of the birds-of-paradise (Paradisaeidae) - applying the phylogenetic species concept to a complex pattern of diversification. Cladistics-Int. J. Willi Hennig Soc. 8: 1-43. Crochet, P.A., Chen, J.J.Z., Pons, J.M., Lebreton, J.D., Hebert, P.D.N. & Bonhomme, F. 2003. Genetic differentiation at nuclear and mitochondrial loci among large white-headed gulls: Sex-biased interspecific gene flow? Evolution 57: 2865-2878. Crochet, P. 2000. Genetic structure of avian populations - allozymes revisited. Mol. Ecol. 9: 1463-1469. Crochet, P.A. & Desmarais, E. 2000. Slow rate of evolution in the mitochondrial control region of gulls (Aves : Laridae). Mol. Biol. Evol. 17: 1797-1806. Crochet, P.A., Lebreton, J.D. & Bonhomme, F. 2002. Systematics of large white-headed gulls: Patterns of mitochondrial DNA variation in western European taxa. Auk 119: 603-620. Day, R.H., Prichard, A.K. & Nigro, D.A. 2003. Ecological specialization and overlap of Brachyramphus murrelets in Prince William Sound, Alaska. Auk 120: 680-699. de Carvalho, M.R., Bockmann, F.A., Amorim, D.S. & Brandao, C.R.F. 2008. Systematics must embrace comparative biology and evolution, not speed and automation. Evol. Biol. 35: 150-157. deQueiroz, K. & Donoghue, M.J. 1988. Phylogenetic systematics and the species problem. Cladistics 4: 317.

References 94

Dowling, D.K., Friberg, U. & Lindell, J. 2008. Evolutionary implications of non-neutral mitochondrial genetic variation. Trends in Ecology & Evolution 23: 546-554. Drummond, A.J. & Rambaut, A. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7: 214. Ebach, M.C. & Holdrege, C. 2005a. DNA barcoding is no substitute for taxonomy. Nature 434: 697-697. Ebach, M.C. & Holdrege, C. 2005b. More taxonomy, not DNA barcoding. Bioscience 55: 822- 823. Edwards, S.V. 2009. Is a new and general theory of molecular systematics emerging? Evolution 63: 1-19. Efe, M.A., Tavares, E.S., Baker, A.J. & Bonatto, S.L. 2009. Multigene phylogeny and DNA barcoding indicate that the Sandwich Tern complex (Thalasseus sandvicensis, Laridae, Sternini) comprises two species. Mol. Phylogenet. Evol. 52: 263-267. Emelianov, I., Marec, F. & Mallet, J. 2004. Genomic evidence for divergence with gene flow in host races of the Larch Budmoth. Proc. R. Soc. Lond. Ser. B-Biol. Sci. 271: 97-105. Fleischer, R.C., McIntosh, C.E. & Tarr, C.L. 1998. Evolution on a volcanic conveyor belt: Using phylogeographic reconstructions and K-ar-based ages of the Hawaiian Islands to estimate molecular evolutionary rates. Mol. Ecol. 7: 533-545. Floyd, R., Abebe, E., Papert, A. & Blaxter, M. 2002. Molecular barcodes for soil nematode identification. Mol. Ecol. 11: 839-850. Galtier, N., Nabholz, B., Glemin, S. & Hurst, G.D.D. 2009. Mitochondrial DNA as a marker of molecular diversity: a reappraisal. Mol. Ecol. 18: 4541-4550. Gay, L., Bell, D.A. & Crochet, P.A. 2005. Additional data on mitochondrial DNA of North American large gull taxa. Auk 122: 684-688. Gay, L., Neubauer, G., Zagalska-Neubauer, M., Debain, C., Pons, J.-., David, P. & Crochet, P.-. 2007. Molecular and morphological patterns of introgression between two large white- headed gull species in a zone of recent secondary contact. Mol. Ecol. 16: 3215-3227. Gay, L., Neubauer, G., Zagalska-Neubauer, M., Pons, J., Bell, D.A. & Crochet, P. 2009. Speciation with gene flow in the large white-headed gulls: Does selection counterbalance introgression? Heredity 102: 133-146. Gibson, D.D., Heinl, S.C., Tobish, T.G.,Jr. 2003. Report of the Alaska Checklist Committee, 1997-2002. Western Birds 34: 122. Gill, R.E., Piersma, T., Hufford, G., Servranckx, R. & Riegen, A. 2005. Crossing the ultimate ecological barrier: Evidence for an 11000-km-long nonstop flight from Alaska to New Zealand and eastern Australia by Bar-tailed Godwits. Condor 107: 1-20. Given, A.D., Mills, J.A. & Baker, A.J. 2005. Molecular evidence for recent radiation in southern hemisphere masked gulls. Auk 122: 268-279.

References 95

Groen, N.M. & Yurlov, A.K. 1999. Body dimensions and mass of breeding and hatched Black- tailed Godwits (Limosa l. limosa): A comparison between a West Siberian and a Dutch population. J. Ornithol. 140: 73-79. Hagelberg, E. 1994. Mitochondrial DNA from ancient bones. In: Ancient DNA (H.S. Herrmann B, ed), pp. 195-195-204. Springer, New York. Haig, S.M., Winker, K. 2010. Avian subspecies: Summary and prospectus. In: Ornithological Monographs no. 67, pp. 172-175. American Ornithologists' Union. Hasegawa, M., Kishino, H. & Yano, T.A. 1985. Dating of the human ape splitting by a molecular clock of mitochondrial-dna. J. Mol. Evol. 22: 160-174. Hayman, P., Marchant, J., Prater, T. 1986. Shorebirds : An Identification Guide to the Waders of the World. Croom Helm, London. Hebert, P.D.N., Cywinska, A., Ball, S.L. & DeWaard, J.R. 2003. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. Ser. B-Biol. Sci. 270: 313-321. Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S. & Francis, C.M. 2004. Identification of birds through DNA barcodes. PLoS. Biol. 2: 1657-1663. Hey, J. 2006. Recent advances in assessing gene flow between diverging populations and species. Current opinion in genetics development 16: 592. Hoglund, J., Johansson, T., Beintema, A. & Schekkerman, H. 2009. Phylogeography of the Black-tailed Godwit Limosa limosa: substructuring revealed by mtDNA control region sequences. J. Ornithol. 150: 45-53. Hollingsworth, P.M., Forrest, L.L., Spouge, J.L., Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M.W., Cowan, R.S., Erickson, D.L., Fazekas, A.J., Graham, S.W., James, K.E., Kim, K., Kress, W.J., Schneider, H., van AlphenStahl, J., Barrett, S.C.H., van den Berg, C., Bogarin, D., Burgess, K.S., Cameron, K.M., Carine, M., Chacon, J., Clark, A., Clarkson, J.J., Conrad, F., Devey, D.S., Ford, C.S., Hedderson, T.A.J., Hollingsworth, M.L., Husband, B.C., Kelly, L.J., Kesanakurti, P.R., Kim, J.S., Kim, Y., Lahaye, R., Lee, H., Long, D.G., Madrinan, S., Maurin, O., Meusnier, I., Newmaster, S.G., Park, C., Percy, D.M., Petersen, G., Richardson, J.E., Salazar, G.A., Savolainen, V., Seberg, O., Wilkinson, M.J., Yi, D., Little, D.P. & CBOL Plant Working Grp. 2009. A DNA barcode for land plants. Proc. Natl. Acad. Sci. U. S. A. 106: 12794-12797. Humphries, E.M. & Winker, K. 2011. Discord reigns among nuclear, mitochondrial and phenotypic estimates of divergence in nine lineages of trans-beringian birds. Mol. Ecol. 20: 573-583. Ivanova, N.V., Dewaard, J.R. & Hebert, P.D.N. 2006. An inexpensive, automation-friendly protocol for recovering high-quality DNA. Mol. Ecol. Notes 6: 998-1002. Janzen, D.H., Hallwachs, W., Blandin, P., Burns, J.M., Cadiou, J., Chacon, I., Dapkey, T., Deans, A.R., Epstein, M.E., Espinoza, B., Franclemont, J.G., Haber, W.A., Hajibabaei, M., Hall, J.P.W., Hebert, P.D.N., Gauld, I.D., Harvey, D.J., Hausmann, A., Kitching, I.J., Lafontaine, D., Landry, J., Lemaire, C., Miller, J.Y., Miller, J.S., Miller, L., Miller, S.E., Montero, J., Munroe, E., Green, S.R., Ratnasingham, S., Rawlins, J.E., Robbins, R.K.,

References 96

Rodriguez, J.J., Rougerie, R., Sharkey, M.J., Smith, M.A., Solis, M.A., Sullivan, J.B., Thiaucourt, P., Wahl, D.B., Weller, S.J., Whitfield, J.B., Willmott, K.R., Wood, D.M., Woodley, N.E. & Wilson, J.J. 2009. Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity. Mol. Ecol. Resour. 9: 1-26. Johns, G.C. & Avise, J.C. 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Mol. Biol. Evol. 15: 1481-1490. Johnsen, A., Rindal, E., Ericson, P., Zuccon, D., Kerr, K., Stoeckle, M. & Lifjeld, J. 2010. DNA barcoding of Scandinavian birds reveals divergent lineages in trans-Atlantic species. Journal of Ornithology 151: 565-565-578. Kaler, R.S.A., Kenney, L.A. & Sandercock, B.K. 2009. Breeding ecology of Kittlitz's Murrelets at Agattu Island, Aleutian Islands, Alaska. Waterbirds 32: 363-373. Kerr, K.C.R., Birks, S.M., Kalyakin, M.V., Red'kin, Y.A., Koblik, E.A. & Hebert, P.D.N. 2009a. Filling the gap - COI barcode resolution in eastern Palearctic birds. Front. Zool. 6: 29. Kerr, K.C.R., Lijtmaer, D.A., Barreira, A.S., Hebert, P.D.N. & Tubaro, P.L. 2009b. Probing evolutionary patterns in Neotropical birds through DNA barcodes. PLoS ONE 4: e4379. Kerr, K.C.R., Stoeckle, M.Y., Dove, C.J., Weigt, L.A., Francis, C.M. & Hebert, P.D.N. 2007. Comprehensive DNA barcode coverage of North American birds. Mol. Ecol. Notes 7: 535-543. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide-sequences. J. Mol. Evol. 16: 111-120. Kishino, H., Thorne, J.L. & Bruno, W.J. 2001. Performance of a divergence time estimation method under a probabilistic model of rate evolution. Mol. Biol. Evol. 18: 352-361. Kissling, M.L., Reid, M., Lukacs, P.M., Gende, S.M. & Lewis, S.B. 2007. Understanding abundance patterns of a declining seabird: Implications for monitoring. Ecol. Appl. 17: 2164-2174. Küpper, C., Augustin, J., Kosztolanyi, A., Burke, T., Figuerola, J. & Szekely, T. 2009. Kentish versus Snowy Plover: Phenotypic and genetic analyses of Charadrius alexandrinus reveal divergence of Eurasian and American subspecies. Auk 126: 839-852. Lane, B.A. 1987. Shorebirds in Australia. Nelson, Melbourne. Lepage, T., Bryant, D., Philippe, H. & Lartillot, N. 2007. A general comparison of relaxed molecular clock models. Mol. Biol. Evol. 24: 2669-2680. Liebers, D., de Knijff, P. & Helbig, A.J. 2004. The herring gull complex is not a ring species. Proc. R. Soc. Lond. Ser. B-Biol. Sci. 271: 893-901. Liebers, D. & Helbig, A.J. 2002. Phylogeography and colonization history of Lesser Black- backed Gulls (Larus fuscus) as revealed by mtDNA sequences. J. Evol. Biol. 15: 1021- 1033. Lovette, I.J. 2004. Mitochondrial dating and mixed-support for the "2% rule" in birds. Auk 121: 1-6.

References 97

Mallet, J. 2008. Hybridization, ecological races and the nature of species: Empirical evidence for the ease of speciation. Philos. Trans. R. Soc. B-Biol. Sci. 363: 2971-2986. Mayr, E. 1942. Systematics and the Origin of Species. Columbia University Press, New York. Mayr, E. 1963. Animal Species and Evolution. Belknap Press of Harvard University Press, Cambridge. Mayr, G. 2011. The phylogeny of Charadriiiform birds (shorebirds and allies)- reassessing the conflict between morphology and molecules. Zool. J. Linn. Soc. 161: 916-934. McCarthy, E.M. 2006. Handbook of Avian Hybrids of the World. Oxford University Press, New York. McGuire, J.A., Linkem, C.W., Koo, M.S., Hutchison, D.W., Lappin, A.K., Orange, D.I., Lemos- Espinal, J., Riddle, B.R. & Jaeger, J.R. 2007. Mitochondrial introgression and incomplete lineage sorting through space and time: Phylogenetics of crotaphytid lizards. Evolution 61: 2879-2897. Melo-Ferreira, J., Boursot, P., Suchentrunk, F., Ferrand, N. & Alves, P.C. 2005. Invasion from the cold past: Extensive introgression of Mountain Hare (Lepus timidus) mitochondrial DNA into three other hare species in northern Iberia. Mol. Ecol. 14: 2459-2464. Meyer, P.M. & Paulay, G. 2005. DNA barcoding: Error rates based on comprehensive sampling. PLoS biology 3: 2229. Miller, E.H. 1996. Acoustic differentiation and speciation in shorebirds. In: Acoustic Differentiation and Speciation in Shorebirds (D.E. Kroodsma and E.H. Miller, eds), pp. 241-257. Comstock Pub., Ithaca, N.Y. Milton, D. 2005. Migratory Shorebirds of the Freshwater Wetlands of the Southern Gulf Region. QLD Wader Group and WWF-Australia, accessed online 19/04/2011 at Birds Australia: Shorebirds 2020 http://www.shorebirds.org.au/pdfs/MigratoryShorebirdsoftheSouthernGulf_1.31MB.pdf Moriyama, E.N. & Powell, J.R. 1997. Synonymous substitution rates in Drosophila: mitochondrial versus nuclear genes. J. Mol. Evol. 45: 378-391. Moskoff, W. 1995. Solitary Sandpiper (Tringa Solitaria), the Birds of North America Online (A. Poole, Ed.), http://bna.birds.cornell.edu/bna/species/156 edn. Cornell Lab of Ornithology. Mueller, R.L. 2006. Evolutionary rates, divergence dates, and the performance of mitochondrial genes in bayesian phylogenetic analysis. Syst. Biol. 55: 289-300. Nabholz, B., Glemin, S. & Galtier, N. 2009. The erratic mitochondrial clock: Variations of mutation rate, not population size, affect mtDNA diversity across birds and mammals. BMC Evolutionary Biology 9: 54. Nettleship, D.N. 2000. Ruddy Turnstone (Arenaria Interpres), Birds of North America Online (A. Poole, Ed.), http://bna.birds.cornell.edu/bna/species/537 edn. Cornell Lab of Ornithology, Ithica, USA. Nosil, P. 2008. Speciation with gene flow could be common. Mol. Ecol. 17: 2103-2106.

References 98

Nosil, P., Funk, D.J. & Ortiz-Barrientos, D. 2009. Divergent selection and heterogeneous genomic divergence. Mol. Ecol. 18: 375-402. Oyler-Mccance, S.J., John, J.S., Quinn, T.W. 2010. Rapid evolution in lekking grouse: Implications for taxonomic definitions. In: Ornithological Monographs no. 67, pp. 114- 122. American Ornithologists' Union. Packer, L., Grixti, J.C., Roughley, R.E. & Hanner, R. 2009. The status of taxonomy in Canada and the impact of DNA barcoding. Can. J. Zool. -Rev. Can. Zool. 87: 1097-1110. Padial, J.M. & de la Riva, I. 2007. Integrative taxonomists should use and produce DNA barcodes. Zootaxa 67-68. Padial, J.M. & De La Riva, I. 2010. A response to recent proposals for integrative taxonomy. Biol. J. Linn. Soc. 101: 747-756. Paeckert, M., Martens, J., Tietze, D.T., Dietzen, C., Wink, M. & Kvist, L. 2007. Calibration of a molecular clock in tits (Paridae) - do nucleotide substitution rates of mitochondrial genes deviate from the 2% rule? Mol. Phylogenet. Evol. 44: 1-14. Papadopoulou, A., Bergsten, J., Fujisawa, T., Monaghan, M.T., Barraclough, T.G. & Vogler, A.P. 2008. Speciation and DNA barcodes: Testing the effects of dispersal on the formation of discrete sequence clusters. Philos. Trans. R. Soc. B-Biol. Sci. 363: 2987- 2996. Paton, T.A. & Baker, A.J. 2006. Sequences from 14 mitochondrial genes provide a well- supported phylogeny of the Charadriiiform birds congruent with the nuclear RAG-1 tree. Mol. Phylogenet. Evol. 39: 657-667. Paton, T.A., Baker, A.J., Groth, J.G. & Barrowclough, G.F. 2003. RAG-1 sequences resolve phylogenetic relationships within Charadriiiform birds. Mol. Phylogenet. Evol. 29: 268- 278. Pereira, S.L. & Baker, A.J. 2005. Multiple gene evidence for parallel evolution and retention of ancestral morphological states in the shanks (Charadriiformes: Scolopacidae). Condor 107: 514-526. Pereira, S.L. & Baker, A.J. 2006. A mitogenomic timescale for birds detects variable phylogenetic rates of molecular evolution and refutes the standard molecular clock. Mol. Biol. Evol. 23: 1731-1740. Pereira, S.L. & Baker, A.J. 2008. DNA evidence for a Paleocene origin of the Alcidae (Aves: Charadriiformes) in the Pacific and multiple dispersals across northern oceans. Mol. Phylogenet. Evol. 46: 430-445. Phillimore, A.B. & Owens, I.P.F. 2006. Are subspecies useful in evolutionary and conservation biology? Proc. R. Soc. B-Biol. Sci. 273: 1049-1053. Phillimore, A.B., Orme, C.D.L., Davies, R.G., Hadfield, J.D., Reed, W.J., Gaston, K.J., Freckleton, R.P. & Owens, I.P.F. 2007. Biogeographical basis of recent phenotypic divergence among birds: A global study of subspecies richness. Evolution 61: 942-957. Pierotti, R. 1987. Isolating mechanisms in seabirds. Evolution 41: 559-570.

References 99

Pinzon-Navarro, S., Barrios, H., Murria, C., Lyal, C.H.C. & Vogler, A.P. 2010. DNA-based taxonomy of larval stages reveals huge unknown species diversity in Neotropical seed weevils (genus Conotrachelus): Relevance to evolutionary ecology. Mol. Phylogenet. Evol. 56: 281-293. Pons, J.M., Crochet, P.A., Thery, M. & Bermejo, A. 2004. Geographical variation in the yellow- legged gull: Introgression or convergence from the herring gull? J. Zool. Syst. Evol. Res. 42: 245-256. Pons, J.M., Hassanin, A. & Crochet, P.A. 2005. Phylogenetic relationships within the laridae (Charadriiformes: Aves) inferred from mitochondrial markers. Mol. Phylogenet. Evol. 37: 686-699. Pons, J., Barraclough, T.G., Gomez-Zurita, J., Cardoso, A., Duran, D.P., Hazell, S., Kamoun, S., Sumlin, W.D. & Vogler, A.P. 2006. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Syst. Biol. 55: 595-609. Price, T.D. & Bouvier, M.M. 2002. The evolution of F-1 postzygotic incompatibilities in birds. Evolution 56: 2083-2089. Pruett, C.L., Winker, K. 2010. Alaska song sparrows (melospiza melodia) demonstrate that genetic marker and method of analysis matter in subspecies assessments. In: Ornithological Monographs no. 67, pp. 162-171. American Ornithologists' Union. Randler, C. 2002. Avian hybridization, mixed pairing and female choice. Anim. Behav. 63: 103- 119. Ratnasingham, S. & Hebert, P.D.N. 2007. BOLD: The barcode of life data system (www.barcodinglife.org). Mol. Ecol. Notes 7: 355-364. Ritz, M.S., Hahn, S., Janicke, T. & Peter, H.U. 2006. Hybridisation between South Polar Skua (Catharacta maccormicki) and Brown Skua (C-antarctica lonnbergi) in the Antarctic peninsula region. Polar Biol. 29: 153-159. Ritz, M.S., Millar, C., Miller, G.D., Phillips, R.A., Ryan, P., Sternkopf, V., Liebers-Helbig, D. & Peter, H. 2008. Phylogeography of the southern skua complex-rapid colonization of the southern hemisphere during a glacial period and reticulate evolution. Mol. Phylogenet. Evol. 49: 292-303. Rosenberg, N.A. & Harrison, R. 2007. Statistical tests for taxonomic distinctiveness from observations of monophyly. Evolution 61: 317-323. Rubinoff, D., Cameron, S. & Will, K. 2006. A genomic perspective on the shortcomings of mitochondrial DNA for "barcoding" identification. J. Hered. 97: 581-594.

Rundle, H.D. & Nosil, P. 2005. Ecological speciation. Ecol. Lett. 8: 336-352. Saitou, N. & Nei, M. 1987. The neighbor-joining method - a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.

References 100

Sambrook, J., Fritsch, E.F., Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY. Sarkar, I.N., Planet, P.J. & Desalle, R. 2008. CAOS software for use in character-based DNA barcoding. Mol. Ecol. Resour. 8: 1256-1259. Saunders, G.W. 2005. Applying DNA barcoding to red macroalgae: A preliminary appraisal holds promise for future applications. Philos. Trans. R. Soc. B-Biol. Sci. 360: 1879-1888. Shields, G.F. & Wilson, A.C. 1987. Calibration of mitochondrial-DNA evolution in geese. J. Mol. Evol. 24: 212-217. Skeel, M.A., Mallory, E.P. 1996. Whimbrel (Numenius Phaeopus), the Birds of North America Online (A. Poole, Ed.)., http://bna.birds.cornell.edu/bna/species/219 edn. Cornell Lab of Ornithology;. Slatkin, M. 1987. Gene flow and the geographic structure of natural-populations. Science 236: 787-792. Stenhouse, I.J., Studebaker, S. & Zwiefelhofer, D. 2008. Kittlitz’s murrelet Brachyranphus brevirostris in the Kodiak Archipelago, Alaska. Marine Ornithology 36: 59-59-65. Stern, R.F., Horak, A., Andrew, R.L., Coffroth, M., Andersen, R.A., Kuepper, F.C., Jameson, I., Hoppenrath, M., Veron, B., Kasai, F., Brand, J., James, E.R. & Keeling, P.J. 2010. Environmental barcoding reveals massive dinoflagellate diversity in marine environments. PLoS One 5: e13991. Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599. Tavares, E.S. & Baker, A.J. 2008. Single mitochondrial gene barcodes reliably identify sister- species in diverse clades of birds. BMC Evol. Biol. 8: 81. Tavares, E.S., de Kroon, G.H.J. & Baker, A.J. 2010. Phylogenetic and coalescent analysis of three loci suggest that the water rail is divisible into two species, Rallus aquaticus and R. indicus. BMC Evol. Biol. 10: 226. Thibert-Plante, X. & Hendry, A.P. 2010. When can ecological speciation be detected with neutral loci? Mol. Ecol. 19: 2301-2314. Thorne, J.L. & Kishino, H. 2002. Divergence time and evolutionary rate estimation with multilocus data. Syst. Biol. 51: 689-702. Thorne, J.L., Kishino, H. & Painter, I.S. 1998. Estimating the rate of evolution of the rate of molecular evolution. Mol. Biol. Evol. 15: 1647-1657. Tuck, L.M. 1972. The Snipes; a Study of the Genus Capella. Canadian Wildlife Service Monograph Series, no. 5, Information Canada, Ottawa. Weir, J.T. & Schluter, D. 2008. Calibrating the avian molecular clock. Mol. Ecol. 17: 2321-2328. Wenink, P.W., Baker, A.J., Rosner, H.U. & Tilanus, M.G.J. 1996. Global mitochondrial DNA phylogeography of Holarctic breeding Dunlins (Calidris alpina). Evolution 50: 318-330.

References 101

Wenink, P.W., Baker, A.J. & Tilanus, M.G.J. 1994. Mitochondrial control-region sequences in 2 shorebird species, the Turnstone and the Dunlin, and their utility in population genetic- studies. Mol. Biol. Evol. 11: 22-31. Wheeler, Q.D., Raven, P.H. & Wilson, E.O. 2004. Taxonomy: Impediment or expedient? Science 303: 285-285. White, D.J., Wolff, J.N., Pierson, M. & Gemmell, N.J. 2008. Revealing the hidden complexities of mtDNA inheritance. Mol. Ecol. 17: 4925-4942. Wiegmann, B.M., Yeates, D.K., Thorne, J.L. & Kishino, H. 2003. Time flies, a new molecular time-scale for brachyceran fly evolution without a clock. Syst. Biol. 52: 745-756. Will, K.W., Mishler, B.D. & Wheeler, Q.D. 2005. The perils of DNA barcoding and the need for integrative taxonomy. Syst. Biol. 54: 844-851. Will, K.W. & Rubinoff, D. 2004. Myth of the molecule: DNA barcodes for species cannot replace morphology for identification and classification. Cladistics-Int. J. Willi Hennig Soc. 20: 47-55. Wilson, J.R., Nebel, S. & Minton, C.D.T. 2007. Migration ecology and morphometrics of two bar-tailed godwit populations in australia. Emu 107: 262-274. Winker, K. 2009. Reuniting phenotype and genotype in biodiversity research. Bioscience 59: 657-665. Woolfit, M. 2009. Effective population size and the rate and pattern of nucleotide substitutions. Biol. Lett. 5: 417-420. Worthy, T.H., Miskelly, C.M. & Ching, B.A. 2002. Taxonomy of North and South Island snipe (Aves : Scolopacidae : Coenocorypha), with analysis of a remarkable collection of snipe bones from Greymouth, New Zealand. N. Z. J. Zool. 29: 231-244. Wu, C.I. 2001. The genic view of the process of speciation. Journal of evolutionary biology 14: 851. Yang, Z.H. 1997. PAML: A program package for phylogenetic analysis by maximum likelihood. Computer Applications in the Biosciences 13: 555-556. Yang, Z. 2007. PAML 4: Phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24: 1586-1591. Yassin, A., Markow, T.A., Narechania, A., O’Grady, P.M. & DeSalle, R. 2010. The genus Drosophila as a model for testing tree- and character-based methods of species identification using DNA barcoding. Mol. Phylogenet. Evol. 57: 509-517. Yoo, H.S., Eah, J., Kim, J.S., Kim, Y., Min, M., Paek, W.K., Lee, H. & Kim, C. 2006. DNA barcoding Korean birds. Mol. Cells 22: 323-327. Zink, R.M. 2004. The role of subspecies in obscuring avian biological diversity and misleading conservation policy. Proc. R. Soc. Lond. Ser. B-Biol. Sci. 271: 561-564. Zink, R.M. & Barrowclough, G.F. 2008. Mitochondrial DNA under siege in avian phylogeography. Mol. Ecol. 17: 2107-2121.

References 102

Zink, R.M., Rohwer, S., Andreev, A.V. & Dittmann, D.L. 1995. Trans-Beringia comparisons of mitochondrial-DNA differentiation in birds. Condor 97: 639-649.

103

Appendix 1 Charadriiformes specimens used in this study

Specimens are organized by suborder (Charadrii, Lari, Scolopaci) and then by family. Complete specimen records, COI barcode sequences and ABI traces can be found on the Barcode of Life Data Systems website (www.boldsystems.org) under the BOLD Process ID number and Project Code.

Contents

Part1: Charadrii specimens, page 103 Part 2: Lari specimens, pages 114 Part 3: Scolopaci specimens, page 134

Key to project codes

Royal Ontario Museum Projects:

BROM unpublished ROM shorebird specimens (574/693 by RE) AROM Published: Tavares and Baker, 2008 (76/352 by RE) AROMB Published: Baker et al., 2009 (11/128 by RE) AROMC Published: Baker et al., 2007 (9/9 by RE)

(ROMC consists of oystercatcher sequences by Erika Tavares and is not included here)

Other Projects:

BARG Kerr et al., 2009b BEPAL Kerr et al., 2009a TZBNA Hebert et al., 2004; Kerr et al., 2007 BNAUS Kerr et al., 2007 AAPR unpublished public records (16 sequences) SWEBI Kerr et al., 2009a NORBI Kerr et al., 2009a KBBI Yoo et al., 2006

Appendix 1 Part 1: Charadrii Specimens 104

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Part 1: Charadrii Specimens Burhinidae Burhinus capensis BROM BROM187-06 MKP 1360 30-Nov-1991 South Africa, Western Cape, Velddrif Burhinus grallarius BROM BROM407-06 AJB 6177 17-Mar-1996 Australia, W. Australia, Perth Zoo Burhinus grallarius BROM BROM479-07 AJB 6174 17-Mar-1996 Australia, W. Australia, Perth Zoo Burhinus grallarius BROM BROM621-07 AJB 6176 17-Mar-1996 Australia, W. Australia, Perth Zoo Burhinus magnirostris BROM BROM653-07 MKP 2659 11-Sep-1995 Australia, Northern Territory, Darwin Burhinus oedicnemus BEPAL KBPBU134-06 UWBM 56911 06-Mar-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Burhinus superciliaris BROM BROM211-06 JG 019 27-Jul-1995 Chile, Tarapaca, Lluta River Valley Burhinus superciliaris BROM BROM212-06 JG 020 27-Jul-1995 Chile, Tarapaca, Lluta River valley Burhinus vermiculatus BROM BROM391-06 MKP 1483 03-Feb-1991 South Africa, KwaZulu-Natal, 8 km from St Lucia, Cape Vidal Rd

Charadriiidae Anarhynchus frontalis BROM BROM379-06 AJB 4814 01-May-1986 New Zealand, North Auckland vs. North Island Anarhynchus frontalis BROM BROM380-06 NZ3 New Zealand, North Island, Auckland, Manukau Harbour Anarhynchus frontalis BROM BROM617-07 NZ1 New Zealand, North Island, Auckland, Manukau Harbour Anarhynchus frontalis BROM BROM876-08 NZ2 New Zealand, North Island, Auckland, Manukau Harbour Anarhynchus frontalis BROM BROM877-08 NZ4 New Zealand, North Island, Auckland, Manukau Harbour Charadrius alexandrinus BROM BROM167-06 JGS 1705 21-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Charadrius alexandrinus BROM BROM219-06 MKP 2543 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Charadrius alexandrinus BROM BROM220-06 MKP 2544 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Charadrius alexandrinus BROM BROM673-07 JGS 1750 01-Mar-1985 United States, Texas Charadrius alexandrinus BROM BROM723-07 JPM 2088 01-Dec-1986 Peru Charadrius alexandrinus BROM BROM724-07 JPM 2222 01-Jan-1987 Peru Charadrius alexandrinus BROM BROM725-07 MKP 2549 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Charadrius alexandrinus BNAUS CDLSU023-05 LSU5723 17-Nov-1984 United States, Louisiana, Cameron, 2 m. W of mouth Mermentau R. Charadrius alexandrinus BEPAL KBPBU173-06 UWBM 59943 29-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Charadrius alexandrinus BEPAL KBPBU174-06 UWBM 60131 29-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Charadrius alexandrinus BEPAL KBPBU175-06 UWBM 60140 30-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Charadrius alexandrinus BEPAL KBPBU176-06 UWBM 60141 30-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Charadrius alexandrinus TZBNA TZBNA101-03 JGS 1751 United States, Texas Charadrius alexandrinus TZBNA TZBNA110-03 JGS 1704 United States, Texas, Bolivar Flats Charadrius alticola BROM BROM480-07 JG 015 26-Jul-1995 Chile, Tarapaca, Cotacotani, Portzuelo de Putre Charadrius alticola BROM BROM481-07 JG 016 26-Jul-1995 Chile, Tarapaca, Cotacotani, Portzuelo de Putre Charadrius alticola BARG KBAR008-06 MACN-Or-ct 1088 08-Nov-2005 Argentina, Jujuy, E of Laguna Guayatayoc

Appendix 1 Part 1: Charadrii Specimens 105

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Charadrius alticola BARG KBAR009-06 MACN-Or-ct 1101 09-Nov-2005 Argentina, Jujuy, E of Laguna Guayatayoc Charadrius alticola BARG KBAR322-06 MACN-Or-ct 860 08-Nov-2005 Argentina, Jujuy, Quebralena Charadrius alticola BARG KBAR736-06 MACN-Or-ct 1288 12-Nov-2005 Argentina, Catamarca, Embalse Cortaderas Charadrius alticola BARG KBAR738-06 MACN-Or-ct 1294 13-Nov-2005 Argentina, Catamarca, Ca. La Gruta Charadrius asiaticus BROM BROM482-07 MKP 1447 11-Dec-1991 Namibia, Mariental, Norikam Farm, Uhlenhorst dist Charadrius asiaticus BROM BROM638-07 MKP 1449 11-Dec-1991 Namibia, Mariental, Norikam Farm, Uhlenhorst dist Charadrius asiaticus BROM BROM878-08 MKP 1448 11-Dec-1991 Namibia, Mariental, Uhlenhorst District, Norikam Farm Charadrius bicinctus BROM BROM674-07 AJB 4788 29-Apr-1986 New Zealand, North Island, Auckland, Sand Is, Kaipara Harbour Charadrius bicinctus BROM BROM675-07 AJB 4789 29-Apr-1986 New Zealand, North Island, Auckland, Sand Is, Kaipara Harbour Charadrius bicinctus BROM BROM726-07 AJB 4787 29-Apr-1986 New Zealand, North Island, Sand Is, Kaipara Harbour Charadrius collaris BROM BROM261-06 E29502 08-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixei Charadrius collaris BROM BROM262-06 E29504 08-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixei Charadrius collaris BROM BROM483-07 JPM 2203 01-Jan-1987 Peru Charadrius collaris BROM BROM484-07 MKP 2545 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Charadrius collaris BROM BROM485-07 140171602 14-Apr-1997 Brazil, Para, Cuiarana, near Salinas Charadrius collaris BARG KBAR520-06 MACN-Or-ct 1445 28-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes Charadrius collaris BARG KBAR521-06 MACN-Or-ct 1446 28-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes Charadrius collaris BARG KBARG045-07 MACN-Or-ct 1751 19-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Charadrius dubius SWEBI BISE204-08 BISE-Aves206 01-Aug-2000 Sweden, Oland, Ottenby birdstation Charadrius dubius SWEBI BISE326-08 BISE-Aves335 01-Aug-2000 Sweden, Oland, Ottenby birdstation Charadrius dubius NORBI BON090-06 NHMO-BC90 17-Jun-2004 Norway, Aust-Agder, Birkenes Charadrius dubius BROM BROM486-07 MKP 2653 04-Jul-1995 Sweden, Uppsala, Uppsala, Storvreta, Uppland Lans Charadrius dubius BROM BROM487-07 MKP 2650 04-Jul-1995 Sweden, Uppsala, Uppsala, Storvreta Charadrius dubius BEPAL KBPBU177-06 UWBM 59714 29-May-1998 Mongolia, Dornod, Dornod Aymag, Symber, Halhin Gol Charadrius dubius BEPAL KBPBU178-06 UWBM 46242 18-May-1993 Kazakhstan, Almaty Oblysy, Akkol`, Topar River Charadrius dubius BEPAL KBPBU179-06 UWBM 61031 27-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Charadrius dubius BEPAL KBPBU180-06 UWBM 66650 17-Jun-2000 Russia, Tuva, Mongun-Taiginskiy Kozhuun, Mugur-Aksy Charadrius dubius BEPAL KBPBU181-06 UWBM 47418 06-Jan-1993 Russia, Magadanskaya Oblast, Talon, 30 km NW, along Tauy River Charadrius falklandicus BROM BROM488-07 XA17601 07-Mar-1998 Argentina, Rio Negro, Banco Lobos, San Antonio Este Charadrius falklandicus BROM BROM489-07 AJB 4437 30-Nov-1984 Argentina, Tierra del Fuego & S. Atlantic Islands, Rio Grande mouth Charadrius falklandicus BROM BROM490-07 G29683 07-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixe Charadrius falklandicus BROM BROM676-07 MKP 2437 13-Feb-1995 Chile, Magallanes-Antartica, Tres Brasos River, near Punta Arenas Charadrius falklandicus BROM BROM677-07 MKP 2438 13-Feb-1995 Chile, Magallanes-Antartica, Tres Brasos River, near Punta Arenas Charadrius falklandicus BROM BROM730-07 81136150 24-Mar-1997 Argentina, Buenos Aires, Punta Rasa, San Clemente Charadrius falklandicus BROM BROM731-07 AJB 3352 17-Nov-1981 Argentina, Chubut, Puerto Melo, near Camarones Charadrius falklandicus BROM BROM732-07 AJB 4438 01-Nov-1984 Argentina, Santa Cruz, Rio Grande, Rivermouth Charadrius falklandicus BROM BROM733-07 G13803 07-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixe

Appendix 1 Part 1: Charadrii Specimens 106

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Charadrius falklandicus BROM BROM734-07 MKP 2606 22-Feb-1995 Argentina, Tierra del Fuego, Punta Popper, 2 km S Rio Grande Charadrius falklandicus BARG KAARG008-07 MACN-Or-ct 144 01-Dec-2004 Argentina Charadrius falklandicus BARG KAARG036-07 MACN-Or-ct 306 01-Dec-2004 Argentina Charadrius hiaticula SWEBI BISE201-08 BISE-Aves203 01-Aug-2000 Sweden, Oland, Ottenby birdstation Charadrius hiaticula SWEBI BISE327-08 BISE-Aves336 01-Aug-2000 Sweden, Oland, Ottenby birdstation Charadrius hiaticula NORBI BON022-06 NHMO-BC22 02-Aug-1966 Norway, Finnmark, Porsanger Charadrius hiaticula NORBI BON218-07 NHMO-BC218 18-Jul-2004 Norway, Finnmark, Svartnes Charadrius hiaticula BNAUS BOTW173-04 USNM 627546 United Kingdom, Suffolk, Mildenhall Air Force Base Charadrius hiaticula BROM BROM640-07 MKP 1562 15-Jul-1992 Iceland, Gardur Charadrius hiaticula BROM BROM491-07 CRPL5 16-Jul-1995 Russia, Chukchi Aut Okrug, Anadyr River Charadrius hiaticula BNAUS BOTW300-05 USNM 623270 07-Aug-2001 Iceland, Keflavik Charadrius hiaticula BROM BROM639-07 MKP 1354 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius hiaticula BROM BROM667-07 MKP 2639 26-Jun-1995 Finland, Lappi, 7 km NE Karigasniemi Charadrius hiaticula BROM BROM668-07 PMN-092 22-Aug-1994 Russia, Yamalo-Nenets, Aut. Okrug, West Yamal Pen, Lokal 3/23, 2A Charadrius hiaticula BROM BROM735-07 MKP 1563 15-Jul-1992 Iceland, Gardur Charadrius hiaticula BROM BROM879-08 CRPL 19950713 13-Jul-1995 Russia, Chukotskiy Aut. Okrug, Up. Anadyr R near Balaganchik Trib Charadrius leschenaultii BNAUS BOTW040-04 USNM 621501 Mongolia, Omnogovi Aymag, Dalandzadgad Charadrius leschenaultii BROM BROM492-07 MKP 1475 18-Dec-1991 South Africa, KwaZulu-Natal, Durban, Bayhead Charadrius leschenaultii BROM BROM599-07 AJB 6028 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Charadrius leschenaultii BROM BROM678-07 MKP 2229 24-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains, North Marsh Charadrius leschenaultii BROM BROM679-07 MKP 2228 24-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains, North Marsh Charadrius leschenaultii BROM BROM736-07 AJB 6040 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Charadrius leschenaultii BEPAL KBPBU186-06 UWBM 66641 15-Jun-2000 Russia, Tuva, Mongun-Taiginskiy Kozhuun, Mugur-Aksy Charadrius marginatus BROM BROM641-07 MKP 1341 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius marginatus BROM BROM642-07 MKP 1351 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius melodus BROM BROM700-07 JGS 1708 01-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Charadrius melodus BROM BROM701-07 JGS 1753 01-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Charadrius melodus BNAUS KBNA609-04 CWS37859 08-Jul-1987 Canada, Alberta, Handhills Lake Charadrius melodus BNAUS KBNA610-04 CWS37860 30-Jun-1987 Canada, Alberta, Handhills Lake Charadrius melodus BNAUS KBNA611-04 CWS00705 10-Jul-1998 Canada, New Brunswick, South Kouchibouguac Charadrius melodus BNAUS KBNA612-04 CWS00716 25-Jun-1997 Canada, Prince Edward Island, Cavendish Sandspit Charadrius melodus TZBNA TZBNA083-03 JGS 1756 United States, Texas, Bolivar Flats Charadrius melodus TZBNA TZBNA092-03 JGS 1757 United States, Texas, Bolivar Flats Charadrius modestus BROM BROM493-07 H23927 08-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixe Charadrius modestus BROM BROM684-07 AJB 4435 01-Nov-1984 Argentina, Tierra del Fuego, Estancia Violeta, Rio Grande Charadrius modestus BROM BROM685-07 MKP 2439 13-Feb-1995 Chile, Magallanes-Antartica, Tres Brasos River, near Punta Arenas Charadrius modestus BROM BROM738-07 MKP 2448 14-Feb-1995 Chile, Magallanes-Antartica, Dinamarquero, 118 km N Punta Arenas

Appendix 1 Part 1: Charadrii Specimens 107

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Charadrius modestus BARG KAARG370-07 MACN-Or-ct 3345 18-Jul-2007 Argentina Charadrius modestus BARG KAARG371-07 MACN-Or-ct 3346 18-Jul-2007 Argentina Charadrius mongolus BROM BROM494-07 MKP 2242 26-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains Charadrius mongolus BROM BROM495-07 SBB 008 31-Mar-1991 Australia, W. Australia, Broome Beach Charadrius mongolus BROM BROM600-07 AJB 6036 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Charadrius mongolus BROM BROM739-07 AJB 6039 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Charadrius mongolus BROM BROM740-07 SBB 006 31-Mar-1991 Australia, W. Australia, Broome Beach Charadrius mongolus BEPAL KBPBU183-06 UWBM 51109 09-Dec-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Charadrius mongolus BEPAL KBPBU184-06 UWBM 51110 09-Dec-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Charadrius mongolus BEPAL KBPBU185-06 UWBM 44445 30-Jun-1992 Russia, Magadanskaya Oblast, Magadan, near mouth Oroholyndja R. Charadrius montanus BROM BROM682-07 JGS 2017 01-May-1985 United States, Colorado Charadrius montanus BROM BROM683-07 JGS 2018 27-May-1985 United States, Colorado, Weld Co, 14 mi W Grover Charadrius montanus BROM BROM741-07 JGS 1202 28-Jun-1982 United States, Colorado, Weld Co, 3 mi S Keota Charadrius montanus BROM BROM742-07 JGS 2012 27-May-1985 United States, Colorado, Weld Co, 22 mi W Grover Charadrius montanus TZBNA TZBNA147-03 JGS 2014 United States, Colorado Charadrius montanus TZBNA TZBNA156-03 JGS 1195 United States, Colorado, 5 mi S Keota Charadrius morinellus SWEBI BISE220-08 BISE-Aves224 24-Oct-1997 Sweden, Oland, Ottenby Charadrius morinellus SWEBI BISE372-08 BISE-Aves388 05-Jul-1994 Sweden, Norrbotten, Kiruna WNW,Luobasjaure Charadrius morinellus NORBI BON196-07 NHMO-BC196 11-Jul-2005 Norway, Oppland, Valdresflya Charadrius morinellus NORBI BON313-07 NHMO-BC313 10-Jun-2006 Norway, Oppland, Valdresflya Charadrius morinellus BROM BROM408-06 MKP 2647 29-Jun-1995 Finland, Lappi, Karigasniemi Charadrius morinellus BROM BROM689-07 MKP 2648 01-Jul-1995 Finland, Lappi, Kilpisjaervi, Enontekioe Charadrius morinellus BROM BROM743-07 KRN-94-57 05-Jul-1994 Sweden, Norrbotten, Kiruna Charadrius morinellus BROM BROM744-07 KRN-94-65 05-Jul-1994 Sweden, Norrbotten, Kiruna Charadrius morinellus BEPAL KBPBU182-06 UWBM 66722 07-Mar-2000 Russia, Tuva, Bai-Taiginskiy Kozhuun, Kyzyl Charadrius morinellus BNAUS KKBNA186-05 NRM 946516 09-Aug-2001 Sweden, Lappland, Luobasjaure, 60 Km Wnw Kiruna Charadrius obscurus BROM BROM666-07 MKP 2654 02-Nov-1995 New Zealand, North Island, Auckland, Mangawhai, North Is Charadrius obscurus BROM BROM745-07 BD 002 New Zealand, North Is Charadrius obscurus BROM BROM746-07 BD 513 New Zealand, North Is Charadrius obscurus BROM BROM747-07 BD 922 New Zealand, North Is Charadrius pallidus BROM BROM644-07 MKP 1352 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius pallidus BROM BROM880-08 MKP 1338 30-Nov-1991 South Africa, Western Cape, Velddrif Charadrius pallidus BROM BROM881-08 MKP 1339 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius pecuarius BROM BROM669-07 MKP 1348 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius pecuarius BROM BROM670-07 MKP 1349 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius pecuarius BROM BROM882-08 MKP 1346 29-Nov-1991 South Africa, Western Cape, Velddrif Charadrius ruficapillus BROM BROM496-07 MKP 218 01-Dec-1985 Australia, Victoria, Corinella Pen

Appendix 1 Part 1: Charadrii Specimens 108

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Charadrius ruficapillus BROM BROM497-07 SBB 051 10-Mar-1994 Australia, W. Australia, Broome Beach Charadrius ruficapillus BROM BROM498-07 SBB 028 02-Apr-1994 Australia, W. Australia, 80 Mile Beach Charadrius ruficapillus BROM BROM750-07 AJB 6019 19-Mar-1996 Australia, W. Australia, Port Hedland, Saltworks Charadrius ruficapillus BROM BROM883-08 MKP 2164 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Charadrius semipalmatus BNAUS BOTW041-04 USNM 626408 United States, Florida, Hillsborough, Macdill Air Force Base Charadrius semipalmatus BROM BROM239-06 JPM 2153 01-Jan-1987 Peru Charadrius semipalmatus BROM BROM263-06 G13817 11-Apr-1997 Brazil, Para, Salinas Charadrius semipalmatus BROM BROM264-06 G13818 11-Apr-1997 Brazil, Para, Salinas Charadrius semipalmatus BROM BROM499-07 JGS 1918 06-May-1985 United States, AK, Valdez-Cordova, Whitshed Pnt, 9 mi SW Cordova Charadrius semipalmatus BROM BROM646-07 MKP 2382 29-Jun-1994 Canada, Manitoba, Churchill Local Gov dist, Churchill Charadrius semipalmatus BROM BROM751-07 JGS 1848 29-Apr-1985 United States, AK, Valdez-Cordova, Whitshed Pnt, 9 mi SW Cordova Charadrius semipalmatus BROM BROM884-08 RRS 151 15-Jul-1985 Canada, Nunavut, Baffin Region, Home Bay Is, Home Bay Charadrius semipalmatus TZBNA HCBR137-03 MKP 2381 Canada, Manitoba, Churchill Charadrius semipalmatus BNAUS KBNA613-04 CWS58126 Venezuela, Sucre District Charadrius semipalmatus BNAUS KBNA614-04 CWS63834 16-May-1992 United States, New Jersey, Delaware Bay Charadrius semipalmatus BNAUS KBNA615-04 CWS63836 16-May-1992 United States, New Jersey, Delaware Bay Charadrius tricollaris BROM BROM647-07 MKP 1467 16-Dec-1991 South Africa, KwaZulu-Natal, near Hluhluwe Charadrius tricollaris BROM BROM671-07 MKP 1403 05-Dec-1991 South Africa, Western Cape, Lamberts Bay Charadrius tricollaris BROM BROM672-07 MKP 1404 05-Dec-1991 South Africa, Western Cape, Lamberts Bay Charadrius veredus BROM BROM500-07 051 9196408 09-Sep-1998 Australia, W. Australia, 80 Mile Beach Charadrius veredus BROM BROM680-07 MKP 2155 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Charadrius veredus BROM BROM681-07 AJB 6173 04-Apr-1996 Australia, W. Australia, 80 Mile Beach Charadrius veredus BROM BROM752-07 051 9196415 09-Sep-1998 Australia, W. Australia, 80 Mile Beach Charadrius vociferus BNAUS BOTW042-04 USNM 626429 United States, Florida, Bay, Tyndall Air Force Base Charadrius vociferus BROM BROM395-06 JAD 7478 20-May-1986 Canada, Ontario, Simcoe Co, Nottawa Charadrius vociferus BROM BROM396-06 JGS 2059 20-May-1986 United States, Nebraska, York Co, 7 mi ENE York Charadrius vociferus BROM BROM753-07 1B-3538 01-May-2000 Canada, Nunavut, Keewatin Region, Akimiski Is Charadrius vociferus BROM BROM754-07 1B-3660 22-Feb-2000 Canada, BC, New Westminster, George C Reifel Migr. Bird Sanctuary Charadrius vociferus BROM BROM755-07 JGS 1642 20-Mar-1985 United States, TX, Chambers Co, by W Anahuac Nat Wildlife Refuge Charadrius vociferus BROM BROM756-07 JPM 2169 01-Dec-1986 Peru Charadrius vociferus BROM BROM757-07 JPM 2352 01-Dec-1986 Peru Charadrius vociferus TZBNA TZBNA119-03 JGS 2025 United States, Colorado Charadrius vociferus TZBNA TZBNA128-03 JAD 7470 Canada, Ontario, Stayner Charadrius wilsonia BNAUS BOTW314-05 USNM 626399 22-Apr-2001 United States, Florida, Hillsborough, Macdill Afb Charadrius wilsonia BROM BROM501-07 JGS 1703 21-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Charadrius wilsonia BROM BROM502-07 G13820 11-Apr-1997 Brazil, Para, Salinas Charadrius wilsonia BROM BROM758-07 JGS 1707 21-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats

Appendix 1 Part 1: Charadrii Specimens 109

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Charadrius wilsonia TZBNA TZBNA127-03 JGS 1812 United States, Texas Elseyornis melanops BROM BROM405-06 MKP 234 06-Dec-1985 Australia, Victoria, Seymour Elseyornis melanops BROM BROM691-07 MKP 2244 26-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains Erythrogonys cinctus BROM BROM406-06 MKP 2259 29-Mar-1994 Australia, W. Australia, Roebuck Plains Erythrogonys cinctus BROM BROM688-07 MKP 2168 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Erythrogonys cinctus BROM BROM727-07 MKP 2142 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Erythrogonys cinctus BROM BROM728-07 MKP 2146 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Erythrogonys cinctus BROM BROM729-07 MKP 2153 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Oreopholus ruficollis BROM BROM218-06 MKP 2446 14-Feb-1995 Chile, Magallanes-Antartica, Dinamarquero, 118 km N Punta Arenas Oreopholus ruficollis BROM BROM227-06 MKP 2447 14-Feb-1995 Chile, Magallanes-Antartica, Dinamarquero, 118 km N Punta Arenas Oreopholus ruficollis BARG KAARG102-07 MACN-Or-ct 1926 01-Jan-2006 Argentina, Santa Cruz, 20 km al Oeste de Piedra Buena Peltohyas australis BROM BROM542-07 MKP 2683 27-Nov-1995 Australia, New South Wales, 20 km S Hay Peltohyas australis BROM BROM690-07 MKP 2682 27-Nov-1995 Australia, New South Wales, 20 km S Hay Peltohyas australis BROM BROM910-08 MKP 2681 27-Nov-1995 Australia, New South Wales, 20 km S Hay Phegornis mitchellii BROM BROM438-06 MKP 2556 25-Feb-1995 Chile, Magallanes-Antartica, 16 km E Embalse el Yeso Phegornis mitchellii BROM BROM439-06 MKP 2555 25-Feb-1995 Chile, Magallanes-Antartica, 16 km E Embalse el Yeso Pluvialis apricaria SWEBI BISE038-07 BISE-Aves45 09-Sep-1997 Sweden, Stockholm, Uppland, Arlanda Pluvialis apricaria SWEBI BISE481-08 BISE-Aves503 Sweden Pluvialis apricaria SWEBI BISE482-08 BISE-Aves504 Sweden Pluvialis apricaria NORBI BON214-07 NHMO-BC214 07-Jul-2004 Norway, Finnmark, Domen Pluvialis apricaria NORBI BON220-07 NHMO-BC220 09-Jul-2004 Norway, Finnmark, Svartnes Pluvialis apricaria AAPR BOTW044-04 USNM 620109 05-Jul-1994 Sweden, Lappland, Luobasjaure Pluvialis apricaria BROM BROM586-07 MKP 2649 01-Jul-1995 Finland, Lappi, Kilpisjarvie Pluvialis apricaria BROM BROM609-07 EUPL 26 4 97 26-Apr-1997 Netherlands, Friesland Pluvialis apricaria BROM BROM656-07 PMN-103 25-Aug-1994 Russia, Nenets, Aut. Okrug, Pechora Bay, Lokal 4/24, Camp 2A Pluvialis apricaria BROM BROM831-07 MAR 1651 17-Sep-1998 Germany, Schleswig-Holstein, Helgoland, North Frisian Is, North Sea Pluvialis apricaria BROM BROM832-07 MKP 2636 26-Jun-1995 Finland, Lappi, 7 km NE Karigasniemi Pluvialis apricaria BEPAL KBPBU168-06 UWBM 49669 07-Jun-1994 Russia, Murmanskaya Oblast, Teriberka Pluvialis apricaria BEPAL KBPBU169-06 UWBM 49670 07-Jun-1994 Russia, Murmanskaya Oblast, Teriberka Pluvialis apricaria BEPAL KBPBU170-06 UWBM 61323 06-Sep-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Pluvialis apricaria BEPAL KBPBU171-06 UWBM 59599 13-Jun-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Pluvialis dominica BROM BROM548-07 AJB 3400 19-Nov-1981 Argentina, Chubut, Punta Tafor Pluvialis dominica BROM BROM549-07 JGS 1989 01-Jun-1985 United States, Alaska Pluvialis dominica BROM BROM554-07 MKP 790 17-Jul-1989 Canada, Nunavut, Baffin Region, Pond Inlet, Baffin Is Pluvialis dominica BROM BROM595-07 9822-03086 09-Jul-1999 Canada, Nunavut, Bay of God's Mercy, Southampton Is Pluvialis dominica BROM BROM608-07 JL 012 07-Jul-1998 Canada, Nunavut, Kitikmeot Region, Jenny Lind Is, Queen Maud Gulf Pluvialis dominica BROM BROM702-07 MKP 784 12-Jul-1989 Canada, Nunavut, Baffin Region, Pond Inlet, Baffin Is

Appendix 1 Part 1: Charadrii Specimens 110

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Pluvialis dominica BROM BROM833-07 1B-1692 20-Sep-1993 Canada, Ontario, Peel RM, Lester B Pearson International Airport Pluvialis dominica BARG KAARG440-07 MACN-Or-cp 56 24-Nov-1998 Argentina, Corrientes, Estero Valenzuela Pluvialis dominica BNAUS KBNA606-04 CWS52277 12-Jun-1991 Canada, Manitoba, Churchill Pluvialis dominica BNAUS KBNA607-04 CWS52281 12-Jun-1991 Canada, Manitoba, Churchill Pluvialis dominica BNAUS KBNA608-04 CWS52405 17-Jun-1991 Canada, Manitoba, Churchill Pluvialis dominica TZBNA TZBNA136-03 JGS 1825 United States, Texas, 3 mi SE High Is Pluvialis fulva BNAUS BOTW045-04 PSM 21817 United States, Johnston Atoll Pluvialis fulva BROM BROM598-07 AJB 6022 20-Mar-1996 Australia, W. Australia, Port Hedland Racecourse Pluvialis fulva BROM BROM606-07 PAPL 1 09-Jul-1993 Russia, Chukotskiy Aut. Okrug, Anadyr River Pluvialis fulva BROM BROM834-07 PAPL 2 16-Jun-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Pluvialis fulva BNAUS CDAMH084-05 AMNH-DOT9644 10-Nov-1994 Singapore CHANGI AIRPORT Pluvialis fulva KBBI KBBI090-07 KRIBB 1328 South Korea, Seoul-si Pluvialis fulva BEPAL KBPBU165-06 UWBM 44171 08-Mar-1992 Russia, Magadanskaya Oblast, Balagannoye, near mouth of Tauy R. Pluvialis fulva BEPAL KBPBU166-06 UWBM 44172 08-Mar-1992 Russia, Magadanskaya Oblast, Balagannoye, near mouth of Tauy R. Pluvialis fulva BEPAL KBPBU167-06 UWBM 44231 07-Aug-1992 Russia, Sakha, Cherskiy, Little Kon'kovaya River Pluvialis squatarola SWEBI BISE390-08 BISE-Aves407 16-Sep-1999 Sweden, Stockholm, Arlanda Pluvialis squatarola BNAUS BOTW046-04 USNM 626535 United States, Florida, Okaloosa, Eglin Air Force Base Pluvialis squatarola BROM BROM440-06 TP7 14-Jul-1994 Russia, Taymyrskiy Avtonomnyy Okrug, Sterlegova Pluvialis squatarola BROM BROM441-06 JL 009 04-Jul-1998 Canada, Nunavut, Kitikmeot Region, Jenny Lind Is, Queen Maud Gulf Pluvialis squatarola BROM BROM442-06 1374087 01-Aug-1998 Netherlands, Waddenzee Pluvialis squatarola BROM BROM579-07 GRPL 19 01-Feb-1993 Guinea-Bissau Pluvialis squatarola BROM BROM584-07 TP46 27-Jul-1997 Russia, Taymyrskiy Avtonomnyy Okrug, Sterlegova Pluvialis squatarola BROM BROM601-07 AJB 6140 01-Apr-1996 Australia, W. Australia, 80 Mile Beach, 8 km mark Pluvialis squatarola BROM BROM615-07 1B-4348 03-Oct-2004 Canada, Ontario, Northumberland Co, Gull Is, Presqu'ile Prov Park Pluvialis squatarola BROM BROM665-07 MKP 493 11-Mar-1988 United States, Florida, Collier Co, Marco Is Pluvialis squatarola BROM BROM836-07 BBPL 49 01-Feb-1993 Guinea-Bissau Pluvialis squatarola BROM BROM837-07 BBPL 118 19-Jun-1990 Russia, Krasnoyarskiy Kray, Taymyr Aut Okrug, N Taymyr Pen Pluvialis squatarola BROM BROM838-07 BBPLFL001 31-Dec-2005 United States, Florida, Manatee Co, Longboat Key Pluvialis squatarola BROM BROM839-07 J14818 22-Apr-1999 Brazil, Rio Grande do Sul, Lagoa do Peixei Pluvialis squatarola BROM BROM840-07 Wolfe001 11-Sep-2002 United States, Georgia, McIntosh Co, Wolf Is Pluvialis squatarola KBBI KBBI181-07 KRIBB 2275 South Korea, Kangwon-do Pluvialis squatarola BEPAL KBPBU161-06 UWBM 43963 13-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Pluvialis squatarola BEPAL KBPBU162-06 UWBM 43964 13-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Pluvialis squatarola BEPAL KBPBU163-06 UWBM 44500 07-Oct-1992 Russia, Sakha, Cherskiy, about 100 km NE Pluvialis squatarola BEPAL KBPBU164-06 UWBM 51608 15-Sep-1993 Russia, Magadanskaya Oblast, Zaliv Odyan, Umara river mouth Pluvialis squatarola TZBNA TZBNA145-03 JGS 1822 United States, Texas, 3 mi SE High Is Pluvialis squatarola TZBNA TZBNA154-03 RCA 87-91 Canada, Alberta

Appendix 1 Part 1: Charadrii Specimens 111

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Thinornis cucullatus BROM BROM686-07 MKP 2658 12-Jul-1995 Australia, Victoria, Anglesea, 30 km SW Geelong Thinornis cucullatus BROM BROM687-07 MKP 2657 07-Nov-1995 Australia, Victoria, Anglesea, 30 km SW Geelong Thinornis cucullatus BROM BROM748-07 MKP 2655 24-Nov-1995 Australia, Victoria, Anglesea, 30 km SW Geelong Thinornis cucullatus BROM BROM749-07 MKP 2656 24-Nov-1995 Australia, Victoria, Anglesea, 30 km SW Geelong Thinornis novaeseelandiae BROM BROM464-06 AJB 5261 01-Mar-1986 New Zealand Vanellus armatus BROM BROM225-06 MKP 1347 29-Nov-1991 South Africa, Western Cape, Velddrif Vanellus armatus BROM BROM226-06 MKP 1364 30-Nov-1991 South Africa, Western Cape, Velddrif Vanellus armatus BROM BROM692-07 MKP 1356 30-Nov-1991 South Africa, Western Cape, Velddrif Vanellus cayanus BROM BROM693-07 ANSP 7560 13-Nov-1996 Guyana, Rupununi dist, Iwokrama Reserve, ca 1 mi W Kurupukari Vanellus chilensis BARG KAARG328-07 MACN-Or-ct 3007 23-Jan-2007 Argentina, Chubut, 26 km S Esquel, Trevelin Vanellus chilensis BARG KAARG345-07 MACN-Or-ct 3028 24-Jan-2007 Argentina, Chubut, Ruta provincial 19, Rio Pico Vanellus chilensis BROM BROM870-07 MKP 2546 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Vanellus chilensis BARG KBAR010-06 MACN-Or-ct 578 23-Jan-2005 Argentina, Rio Negro, Pilcaniyeu, Estancia Neneo Ruca Vanellus chilensis BARG KBAR011-06 MACN-Or-ct 587 24-Jan-2005 Argentina, Rio Negro, Pilcaniyeu, Estancia Neneo Ruca Vanellus chilensis BROM BROM468-06 MKP 2558 26-Feb-1995 Chile, Santiago, Santiago Airport Vanellus chilensis BROM BROM469-06 MKP 2445 13-Feb-1995 Chile, Magallanes-Antartica, Rinconada Bulnes, near Punta Arenas Vanellus chilensis BROM BROM867-07 AJB 4424 29-Nov-1984 Argentina, Tierra del Fuego, Estancia Violeta, Rio Grande Vanellus chilensis BROM BROM572-07 1B-982 28-Nov-1984 Argentina, Tierra del Fuego & S. Atlantic Islands, Rio Grande Vanellus chilensis BROM BROM868-07 AJB 4477 Argentina, Chubut, Punta Tafor Vanellus chilensis BROM BROM869-07 LDP009 28-Apr-1999 Brazil, Rio Grande do Sul, Lagoa dos Patos Vanellus chilensis BROM BROM871-07 N07433 07-Apr-1997 Brazil, Rio Grande do Sul, Lagoa dos Patos Vanellus chilensis BARG KAARG110-07 MACN-Or-ct 1938 23-May-2007 Argentina, Buenos Aires, Luj Vanellus chilensis BROM BROM471-06 N07427 05-Apr-1997 Brazil, Rio Grande do Sul, Lagoa dos Patos Vanellus chilensis BROM BROM866-07 43925 04-Jun-1989 Brazil, Para, Cachoeira do Arari, Rio Caracara river banks Vanellus chilensis BARG KBAR777-06 MACN-Or-ct 1423 27-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes Vanellus chilensis BARG KBAR782-06 MACN-Or-ct 1432 27-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes Vanellus chilensis BARG KBAR903-06 MACN-Or-ct 1676 23-May-2006 Argentina, Corrientes, Estacion biologica de Corrientes Vanellus coronatus BROM BROM705-07 MKP 1409 07-Dec-1991 Namibia, Windhoek, Windhoek Vanellus miles BROM BROM662-07 AJB 5627 15-Nov-1989 Australia, New South Wales, Alstonville Vanellus resplendens BROM BROM590-07 JG 017 26-Jul-1995 Chile, Tarapaca, Chocuyo, Portzuelo de Putre Vanellus senegallus BROM BROM872-07 WALA 01 20-Feb-1992 Vanellus tricolor BROM BROM593-07 MKP 2684 27-Nov-1995 Australia, New South Wales, 20 km S Hay Vanellus tricolor BROM BROM594-07 MKP 2686 28-Nov-1995 Australia, New South Wales, 20 km S Hay Vanellus vanellus SWEBI BISE235-08 BISE-Aves240 12-Apr-2005 Sweden, Stockholm, Maersta, Arlanda airport Vanellus vanellus SWEBI BISE281-08 BISE-Aves287 01-Mar-1997 Sweden, Stockholm, Arlanda Vanellus vanellus SWEBI BISE282-08 BISE-Aves288 01-Aug-1998 Sweden, Stockholm, Arlanda Vanellus vanellus NORBI BON314-07 NHMO-BC314 18-Jun-2006 Norway, Rogaland, Holmavatnet

Appendix 1 Part 1: Charadrii Specimens 112

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Vanellus vanellus NORBI BON316-07 NHMO-BC316 17-Jun-2006 Norway, Rogaland, Varhaug Vanellus vanellus AAPR BOTW043-04 USNM 621342 United Kingdom Vanellus vanellus BROM BROM587-07 MKP 2651 04-Jul-1995 Sweden, Uppsala, Uppsala, Storvreta Vanellus vanellus BEPAL KBPBU135-06 UWBM 49187 22-May-1994 Russia, Rossiya, Moscovskaya Oblast, Beloomut Vanellus vanellus BEPAL KBPBU136-06 UWBM 46383 16-May-1993 Kazakhstan, Almaty Oblysy, Akkol' Vanellus vanellus BEPAL KBPBU137-06 UWBM 46397 17-May-1993 Kazakhstan, Almaty Oblysy, Akkol' Vanellus vanellus BEPAL KBPBU138-06 UWBM 59768 05-Dec-1998 Mongolia, Dornod, Dornod Aymag, Kherlen Gol, Choibalsan Vanellus vanellus BEPAL KBPBU139-06 UWBM 60142 30-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur

Chionididae Chionis albus BROM BROM503-07 AJB 4465 01-Dec-1984 Argentina Chionis minor BROM BROM397-06 CM 6 10-Oct-1994 French Southern and Antarctic Territories, S. Indian Ocean, Crozet Is Chionis minor BROM BROM504-07 BFSH1 01-Nov-1993 South Africa, Prince Edward Is, Marion Is Chionis minor BROM BROM505-07 PADDY 19920731 31-Jul-1992 South Africa, Prince Edward Is , Marion Is Chionis minor BROM BROM506-07 CHIKER 250 01-Oct-1994 French S. and Antarctic Territories, S. Indian Ocean, Kerguelen Is Chionis minor BROM BROM663-07 CM 7 10-Oct-1994 French Southern and Antarctic Territories, S. Indian Ocean, Crozet Is Chionis minor BROM BROM759-07 BFSH 5 01-Nov-1993 South Africa, Prince Edward Is, Marion Is Chionis minor BROM BROM760-07 BFSH 2 01-Nov-1993 South Africa, Prince Edward Is, Marion Is Chionis minor BROM BROM761-07 CHIKER 232 01-Oct-1994 French S. and Antarctic Territories, S. Indian Ocean, Kerguelen Is Chionis minor BROM BROM762-07 CHIKER 254 01-Oct-1994 French S. and Antarctic Territories, S. Indian Ocean, Kerguelen Is

Haematopodidae Haematopus ater BARG KAARG040-07 MACN-Or-ct 335 01-Dec-2004 Argentina Haematopus leucopodus BARG KAARG006-07 MACN-Or-ct 136 01-Dec-2004 Argentina Haematopus ostralegus BEPAL KBPBU157-06 UWBM 49540 21-Jun-1994 Russia, Sverdlovskaya Oblast, Krasnoufimsk, along Bizert' river Haematopus ostralegus BEPAL KBPBU158-06 UWBM 49759 15-Jul-1994 Russia, Murmanskaya Oblast, Umba, Kandalakshskaya Guba shore Haematopus ostralegus BEPAL KBPBU159-06 UWBM 56916 06-Mar-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Haematopus bachmani BNAUS KBNA616-04 CWS82858 02-Jun-1999 Canada, British Columbia, Five Finger Island Haematopus bachmani BNAUS KBNA617-04 CWS82859 03-Jun-1999 Canada, British Columbia, Brandon Island Haematopus bachmani BNAUS KBNA618-04 CWS82861 07-Jun-1999 Canada, British Columbia, Christie Islet Haematopus leucopodus BROM BROM253-06 AJB 4455 02-Dec-1984 Argentina, Tierra del Fuego & S. Atlantic Islands, Estancia San Martin Haematopus ostralegus BROM BROM256-06 Hol 89-9 25-Sep-1989 Netherlands, Groningen, Groningen Haematopus unicolor BROM BROM257-06 AJB 89-8 21-Nov-1989 New Zealand, South Island, Dummys Beach, South Is Haematopus unicolor BROM BROM258-06 AJB 89-1 19-Nov-1989 New Zealand, South Island, Otago, Sandfly Bay, Otago Pen, South Is Haematopus unicolor BROM BROM259-06 AJB 89-37 04-Dec-1989 New Zealand, Auckland, Mangawhai, North Is Haematopus unicolor BROM BROM260-06 AJB 89-40 New Zealand, Auckland, Mangawhai, North Is Haematopus ostralegus NORBI BON382-07 NHMO-BC382 01-Apr-2006 Norway, Troms, Langnes Flyplass

Appendix 1 Part 1: Charadrii Specimens 113

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Haematopus ostralegus NORBI BON383-07 NHMO-BC383 01-Apr-2006 Norway, Troms, Langnes Flyplass Haematopus ostralegus SWEBI BISE188-08 BISE-Aves183 01-Jul-2004 Sweden, Stockholm, Furusundsbron, Norrtaelje, Furusund Haematopus ostralegus SWEBI BISE422-08 BISE-Aves444 08-May-2003 Sweden, Gotland, Burs, Bandlundsviken, Burs, Bandlundsviken Haematopus bachmani TZBNA TZBNA109-03 JGS 1857 United States, Alaska Haematopus palliatus TZBNA TZBNA084-03 MKP 479 United States, Florida, Marco Is Haematopus palliatus TZBNA TZBNA118-03 SVN 8 United States, Virginia, Assawoman Is

Pluvianellidae Pluvianellus socialis BROM BROM443-06 MKP 2559 15-Feb-1995 Chile, Magallanes-Antartica, Porvenir Pluvianellus socialis BARG KAARG022-07 MACN-Or-ct 210 01-Dec-2004 Argentina Pluvianellus socialis BARG KAARG023-07 MACN-Or-ct 211 01-Dec-2004 Argentina

Recurvirostridae Himantopus himantopus AROM BROM189-06 MKP 1438 09-Dec-1991 Namibia, Swakopmund, Walvis Bay Himantopus himantopus AROM BROM190-06 MKP 1457 13-Dec-1991 South Africa, KwaZulu-Natal, Sea Cow Lake, Durban, Sewage plant Himantopus himantopus AROM BROM418-06 MKP 1402 05-Dec-1991 South Africa, Western Cape, Lamberts Bay Himantopus himantopus KBBI KBBI235-07 KRIBB 2814 South Korea, South Cholla Himantopus leucocephalus AROM BROM231-06 MKP 2156 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Himantopus leucocephalus AROM BROM234-06 MKP 2147 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Himantopus leucocephalus AROM BROM255-06 AJB 4790 29-Apr-1986 New Zealand, North Island, Sand Is, Kaipara Harbour Himantopus leucocephalus AROM BROM417-06 MKP 2218 23-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains, North Marsh Himantopus melanurus AROM BROM270-06 N07423 05-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixe Himantopus melanurus AROM BROM271-06 N07422 05-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixe Himantopus melanurus AROM BROM771-07 N07405 02-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixei Himantopus melanurus BARG KBAR831-06 MACN-Or-ct 1580 03-May-2006 Argentina, Corrientes, Estacion biologica de Corrientes Himantopus melanurus BARG KBAR853-06 MACN-Or-ct 1612 08-May-2006 Argentina, Corrientes, Estancia "Relatz", Estero Valenzuela Himantopus melanurus BARG KBAR855-06 MACN-Or-ct 1616 08-May-2006 Argentina, Corrientes, Estancia "Relatz", Estero Valenzuela Himantopus mexicanus BNAUS BOTW366-05 FMNH 360235 United States Himantopus mexicanus BNAUS BOTW367-05 FMNH 387716 United States, Florida, Escambia Co, Pensacola area Himantopus mexicanus AROM BROM179-06 JGS 1760 22-Mar-1985 United States, TX, Chambers Co, by W Anahuac Nat Wildlife Refuge Himantopus mexicanus BROM BROM918-08 JGS 1761 22-Mar-1985 United States, TX, Chambers Co, by W Anahuac Nat Wildlife Refuge Himantopus mexicanus TZBNA TZBNA082-03 JGS 1761 United States, Texas, by W Anahuac Nat Wildlife Refuge, Recurvirostra americana AROM BROM178-06 JAD 7328 14-Jun-1982 Canada, Saskatchewan, Reno Rural Mun, 8 km S Consul Recurvirostra americana AROM BROM180-06 JGS 1747 22-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Recurvirostra americana AROM BROM446-06 JAD 7317 12-Jun-1982 Canada, Saskatchewan, Reno Rural Mun, 8 km S Consul Recurvirostra americana AROM BROM664-07 RCA 87-255 01-Jun-1987 Canada, Alberta Recurvirostra americana AROM BROM843-07 JGS 1205 18-May-1982 United States, Kansas, Barton Co, Cheyenne Bottoms

Appendix 1 Part 1: Charadrii Specimens 114

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Recurvirostra americana TZBNA TZBNA137-03 RCA 87-254 Canada, Alberta Recurvirostra americana TZBNA TZBNA146-03 JGS 1746 United States, Texas Recurvirostra andina AROM BROM213-06 JG 013 26-Jul-1995 Chile, Tarapaca, Catacotani, Portzuelo de Putre Recurvirostra andina AROM BROM214-06 JG 014 25-Jul-1995 Chile, Tarapaca, Cotacotani, Portezuelo de Putre Recurvirostra andina BARG KBAR005-06 MACN-Or-ct 864 08-Nov-2005 Argentina, Jujuy, E of Laguna Guayatayoc, Recurvirostra andina BARG KBAR006-06 MACN-Or-ct 1190 13-Nov-2005 Argentina, Catamarca, Ca. La Gruta Recurvirostra andina BARG KBAR739-06 MACN-Or-ct 1296 13-Nov-2005 Argentina, Catamarca, Ca. La Gruta Recurvirostra andina BARG KBAR740-06 MACN-Or-ct 1297 13-Nov-2005 Argentina, Catamarca, Ca. La Gruta Recurvirostra avosetta SWEBI BISE162-08 BISE-Aves131 18-Jun-2002 Sweden, Blekinge, Karlskrona, Konungshamn: Langaskaer, Jaemjoe Recurvirostra avosetta SWEBI BISE436-08 BISE-Aves462 25-May-2001 Sweden, Skane, Spillepeng, Lomma, Spillepeng Recurvirostra avosetta BROM BROM188-06 MKP 1435 09-Dec-1991 Namibia, Swakopmund, Walvis Bay Recurvirostra BROM BROM224-06 MKP 2256 29-Mar-1994 Australia, W. Australia, Roebuck Plains novaehollandiae Recurvirostra BROM BROM529-07 MKP 2255 29-Mar-1994 Australia, W. Australia, Roebuck Plains novaehollandiae

Appendix 1 Part 2: Lari Specimens 115

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Part 2: Lari Specimens

Aethia cristatella AROM BROM112-06 JP 3166 06-Jul-1991 United States, Alaska, Nome (CA), Fairway Rock Aethia cristatella AROM BROM376-06 JP 3175 07-Jul-1991 United States, Alaska, at sea Aethia cristatella AROM BROM475-07 JP 3162 06-Jul-1991 United States, Alaska, Fairway Rock Aethia cristatella AAPR KKBNA984-06 MCZ 335 910 15-Jul-2003 United States, Alaska, Aleutian Islands, Kiska Island Aethia cristatella TZBNA TZBNA220-03 JP 2221 United States, Alaska, Buldir Is, Aleutian Is Aethia psittacula AROM BROM118-06 JP 2340 08-Jun-1990 United States, Alaska, Aleutians East, N Hall Is, Yukon River, Koniuji Strait Aethia psittacula AROM BROM404-06 JP 2369 11-Jun-1990 United States, Alaska, Aleutians East, Koniuji Strait Aethia psittacula BROM BROM706-07 JP 2339 08-Jun-1990 United States, Alaska, Aleutians East, N Hall Is, Yukon River, Koniuji Strait Aethia psittacula TZBNA TZBNA224-03 JP 2351 United States, Alaska, N Hall Is, Yukon River, Koniuji Strait Aethia psittacula TZBNA TZBNA225-03 JP 2366 United States, Alaska, Koniuji Strait Aethia pusilla BROM BROM109-06 JP 3140 26-Jun-1991 United States, Alaska, Bethel (CA), Bull Seal Pt, St Matthew Is Aethia pusilla BROM BROM476-07 JP 3143 26-Jun-1991 United States, Alaska, Bethel (CA), Bull Seal Pt, St Matthew Is Aethia pusilla BROM BROM707-07 JP 3142 26-Jun-1991 United States, Alaska, Bethel (CA), Bull Seal Pt, St Matthew Is Aethia pusilla BNAUS CDAMH003-05 AMNH-DOT1410 28-May-1990 United States, Alaska, BULDIR ISLAND Aethia pusilla TZBNA TZBNA221-03 JP 3139 United States, Alaska, Bull Seal Pt, St Matthew Is Aethia pygmaea AROM BROM110-06 JP 3395 25-Aug-1991 United States, Alaska, Aleutian Islands, Egg Is Aethia pygmaea AROM BROM708-07 JP 3387 25-Aug-1991 United States, Alaska, Aleutian Islands, Egg Is Aethia pygmaea AROM BROM709-07 JP 3394 25-Aug-1991 United States, Alaska, Aleutian Islands, Egg Is Aethia pygmaea AAPR CDAMH004-05 AMNH-DOT1213 02-Jul-1989 United States, Alaska, BULDIR ISLAND Aethia pygmaea TZBNA TZBNA222-03 JP 3386 United States, Alaska, Aleutian Islands, Egg Is Alca torda SWEBI BISE150-08 BISE-Aves110 17-Mar-2002 Sweden, Gotland, Faroe, Sundersand, Sudersand Faroe Alca torda SWEBI BISE244-08 BISE-Aves250 07-Mar-1996 Sweden, Vastra Gotaland, Pater Noster skaeren Alca torda NORBI BON119-07 NHMO-BC119 03-Apr-2003 Norway, Aust-Agder, Tromoy Alca torda NORBI BON132-07 NHMO-BC132 01-May-2003 Norway, Finnmark, Havoysund Alca torda BROM BROM377-06 GC 003 28-Jul-1993 Canada, Quebec, N shore of St Lawrence River Alca torda TZBNA HCBR171-03 GC 001 Canada, Quebec, St Lawrence River, N shore Alca torda TZBNA HCBR172-03 GC 002 Canada, Quebec, St Lawrence River, N shore Alca torda BNAUS KBNA514-04 MSI47895-17406 22-Jul-2004 Canada, New Brunswick, Machias Seal Island Alca torda BNAUS KBNA515-04 MSI895-17065 22-Jul-2004 Canada, New Brunswick, Machias Seal Island Alca torda BNAUS KBNA595-04 CWS18967 12-Jun-1978 Canada, Quebec Alca torda BNAUS KBNA596-04 CWS28313 08-Aug-1970 Canada, Nfld & Labrador, Grady Harbour

Appendix 1 Part 2: Lari Specimens 116

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Alle alle SWEBI BISE115-07 BISE-Aves146 28-Oct-2003 Sweden, Vastra Gotaland, Bohuslan, Orust Alle alle SWEBI BISE361-08 BISE-Aves376 27-Nov-2006 Sweden, Skane, Skanoer, Vellinge, Skanoer Alle alle NORBI BON283-07 NHMO-BC283 29-Nov-1999 Norway, Oslo, Toyenparken Alle alle NORBI BON322-07 NHMO-BC322 18-Jul-2001 Norway, Svalbard, Arie Alle alle BROM BROM111-06 1B-1361 22-Oct-1992 Canada, Nfld & Labrador, Long Pt, near Twillingate Alle alle BROM BROM378-06 1B-1633 13-Jan-1989 Canada, Nfld & Labrador, St Brides, Avalon Pen Alle alle BROM BROM477-07 1B-1360; 20 22-Oct-1992 Canada, Nfld & Labrador, Long Pt, near Twillingate Alle alle TZBNA HCBR169-03 1B-1368 Canada, Nfld & Labrador, Twillingate, Long Pt. Alle alle BNAUS KBNA589-04 CWS57259 22-Oct-1992 Canada, Nfld & Labrador, Twillingate Alle alle BNAUS KKBNA145-04 CWSL93-57862- 28-Oct-1992 Canada, Nfld & Labrador, Twillingate 01 Alle alle TZBNA TZBNA223-03 JP 3145 United States, Alaska, Little Diomede Is B. brevirostris AROM BROM113-06 JP 3087 26-Jul-1990 United States, AK, Kenai Pen., Grewingk Glacier, Kachemak Bay B. brevirostris AROM BROM388-06 JP 3083 26-Jul-1990 United States, AK, Kenai Pen., Grewingk Glacier, Kachemak Bay B. brevirostris AROM BROM389-06 MAMU 3693 02-Aug-1992 United States, Alaska, Aleutians West (CA), Attu Is, Aleutian Is B. brevirostris BROM BROM620-07 MAMU 3706 02-Aug-1992 United States, Alaska, Aleutians West (CA), Attu Is, Aleutian Is B. brevirostris BROM BROM713-07 JP 3085 26-Jul-1990 United States, AK, Kenai Pen, Grewingk Glacier, Kachemak Bay B. brevirostris BROM BROM714-07 MAMU 3694 02-Aug-1992 United States, Alaska, Aleutians West (CA), Attu Is, Aleutian Is B. brevirostris BNAUS CDAMH014-05 AMNH-DOT1254 20-Jul-1989 United States, Alaska, UNALASKA ISLAND B. brevirostris BNAUS CDAMH015-05 AMNH-DOT1255 20-Jul-1989 United States, Alaska, UNALASKA ISLAND B. brevirostris BNAUS KKBNA261-05 UWBM 55348 12-Jul-1991 United States, Alaska, coastal Gulf of Alaska, SE of Cordova B. brevirostris BNAUS KKBNA262-05 UWBM 55349 07-Jun-1991 United States, Alaska, coastal Gulf of Alaska, SE of Cordova B. brevirostris BNAUS KKBNA263-05 UWBM 55350 06-Jun-1991 United States, Alaska, coastal Gulf of Alaska, SE of Cordova B. brevirostris BNAUS KKBNA264-05 UWBM 55351 19-Jul-1991 United States, Alaska, coastal Gulf of Alaska, ESE of Cordova B. brevirostris BNAUS KKBNA652-05 UWBM 44436 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is and Oroholyndja R Brachyramphus marmoratus AROM BROM114-06 JP 3312 03-Aug-1991 United States, AK, Valdez-Cordova, Unakwik Inlet B. marmoratus AROM BROM390-06 JP 2466 12-Jun-1990 United States, Alaska, Aleutians East, Shumagins B. marmoratus BROM BROM581-07 MAMU 3103 26-Jul-1990 United States, Alaska, Kenai Peninsula, Kachemak Bay B. marmoratus BROM BROM582-07 MAMU 3695 02-Aug-1992 United States, Alaska, Aleutians West (CA), Attu Is, Aleutian Is B. marmoratus BROM BROM583-07 MM 4 01-Jul-1992 United States, Oregon, Lane Co, Mapleton, USFWS Ranger Stn B. marmoratus BROM BROM716-07 MAMU 2362 11-Jun-1990 United States, Alaska, Aleutians East, near Yukon Harbor, Big Koniuji Is B. marmoratus BROM BROM717-07 MAMU 3705 02-Aug-1992 United States, Alaska, Aleutians West (CA), Attu Is, Aleutian Is B. marmoratus BNAUS KBNA590-04 CWS23649 31-Oct-1981 Canada, British Columbia, Holberg Inlet B. marmoratus BNAUS KBNA591-04 CWS23660 17-Jan-1982 Canada, British Columbia, Quatsino Village B. marmoratus BNAUS KBNA592-04 CWS23731 21-Feb-1982 Canada, British Columbia, Quatsino Sound Brachyramphus perdix BROM BROM478-07 SAR 6060 28-Jun-1992 Russia, Sea of Okhotsk, between Umara Is & Oroholyndja R mouth

Appendix 1 Part 2: Lari Specimens 117

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Brachyramphus perdix BROM BROM715-07 JMB 992 Russia Brachyramphus perdix BROM BROM718-07 SAR 6058 28-Jun-1992 Russia, Sea of Okhotsk, between Umara Is & Oroholyndja R mouth Brachyramphus perdix BEPAL KBPBU356-06 UWBM 44405 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Island & Oroholyndja R Brachyramphus perdix BEPAL KBPBU357-06 UWBM 44434 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is & Oroholyndja R Cepphus carbo BROM BROM115-06 CSW 4372 28-Jun-1993 Russia, Magadanskaya Oblast, Magadan, at sea, 70 km E, 45 km S Cepphus carbo BEPAL KBPBU352-06 UWBM 44404 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is & Oroholyndja River Cepphus carbo BEPAL KBPBU353-06 UWBM 44429 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is & Oroholyndja River Cepphus carbo BEPAL KBPBU354-06 UWBM 44430 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is & Oroholyndja River Cepphus columba BROM BROM116-06 JP 2462 24-Jun-1990 United States, Alaska, Aleutians East, N of FEH Cepphus columba BROM BROM392-06 JP 1656 18-Jul-1989 United States, Alaska, Aleutians East, Poperechnoi Is Cepphus columba BROM BROM547-07 1B-3668 Canada, British Columbia, New Westminster dist, Delta, Delta DM Cepphus columba BNAUS KBNA593-04 CWS27582 06-Mar-1971 Canada, British Columbia, East Coast Queen Charlotte, Cepphus columba BNAUS KBNA594-04 CWS27585 06-Mar-1971 Canada, British Columbia, South Coast Queen Charolette Cepphus grylle SWEBI BISE433-08 BISE-Aves458 11-Sep-2005 Sweden, Stockholm, Oerskaersfyr, Graesoe, Oerskaerfyr Cepphus grylle SWEBI BISE474-08 BISE-Aves493 Sweden Cepphus grylle SWEBI BISE475-08 BISE-Aves494 Sweden Cepphus grylle NORBI BON182-07 NHMO-BC182 01-May-2000 Norway, Finnmark, Hjelmsoya Cepphus grylle NORBI BON183-07 NHMO-BC183 01-May-2000 Norway, Finnmark, Hjelmsoya Cepphus grylle BNAUS BOTW303-05 USNM 623290 09-Aug-2001 Iceland, Keflavik Cepphus grylle BNAUS KBNA587-04 CWS57819 26-Nov-1992 Canada, Nfld & Labrador, Gand Bank, Cepphus grylle BNAUS KBNA588-04 CWS60865 01-Jul-1993 Canada, Northwest Territories, Prince Leopold Island, Cepphus grylle AAPR KBNA970-06 K05-13892-00-05 01-Jul-2005 Canada, Nunavut, St. Helena Island Cepphus grylle AAPR KBNA976-06 K05-14082-00-00 21-Jul-2005 Canada, Nunavut, St. Helena Island Cepphus grylle BNAUS KKBNA184-05 USNM 623291 15-Sep-1995 Iceland, Keflavik, North Coast Cerorhinca monocerata AROM BROM117-06 JMB 862 15-Oct-1991 Pacific Ocean, off NE coast of Honshu, Japan Cerorhinca monocerata BROM BROM393-06 JMB 861 15-Oct-1991 North Pacific Ocean Cerorhinca monocerata AROM BROM394-06 MM 8 United States Cerorhinca monocerata BNAUS KBNA001-04 AXBS001 Canada, British Columbia Cerorhinca monocerata BNAUS KBNA002-04 AXBS002 Canada, British Columbia Cerorhinca monocerata BNAUS KBNA598-04 CWS46347 29-Apr-1990 Canada, British Columbia, Cleland Island Cerorhinca monocerata BNAUS KBNA599-04 CWS46381 19-May-1990 Canada, British Columbia, Lucy Island Fratercula arctica SWEBI BISE026-07 BISE-Aves28 15-Sep-1997 Sweden, Halland, Halland, LAHOLMSBUKTEN, MELLBYSTRAND Fratercula arctica SWEBI BISE383-08 BISE-Aves399 15-Feb-1998 Sweden, Vastra Gotaland, Tjoern, Hakenaeset Fratercula arctica NORBI BON162-07 NHMO-BC162 01-Jul-2005 Norway, Finnmark, Hornoya Fratercula arctica NORBI BON163-07 NHMO-BC163 18-Jul-2006 Norway, Finnmark, Hornoya Fratercula arctica BNAUS BOTW302-05 USNM 623287 09-Aug-2001 Iceland, Keflavik

Appendix 1 Part 2: Lari Specimens 118

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Fratercula arctica AROM BROM409-06 1B-1369 22-Oct-1992 Canada, Nfld & Labrador, Long Pt, near Twillingate Fratercula arctica BROM BROM511-07 AJB 5523 13-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Fratercula arctica BROM BROM767-07 AJB 5522 13-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Fratercula arctica BNAUS KBNA585-04 CWS57261 31-Oct-1992 Canada, Nfld & Labrador, Exploits Island, Fratercula arctica BNAUS KBNA586-04 CWS57852 10-Oct-1992 Canada, Nfld & Labrador, Burgeo Fratercula arctica BNAUS KBNA677-04 MSI1015-04328 19-Aug-2004 Canada, New Brunswick, Machias Seal Island Fratercula arctica BNAUS KBNA678-04 MSI1015-04006 19-Aug-2004 Canada, New Brunswick, Machias Seal Island Fratercula arctica TZBNA TZBNA005-03 AJB 5521 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Fratercula cirrhata AROM BROM119-06 JP 3416 27-Aug-1991 United States, Alaska, Aleutians East, Agattu Is, Aleutian Is Fratercula cirrhata BROM BROM512-07 JP 3372 25-Aug-1991 United States, Alaska, Egg Is, Aleutian Is Fratercula cirrhata BROM BROM654-07 JP 3352 22-Aug-1991 United States, Alaska, Aleutians West (CA), Bogoslof Is, Aleutian Is Fratercula cirrhata BROM BROM768-07 JP 3379 25-Aug-1991 United States, Alaska, Egg Is, Aleutian Is Fratercula cirrhata BEPAL KBPBU358-06 UWBM 44103 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is and Oroholyndja R. Fratercula cirrhata BEPAL KBPBU359-06 UWBM 44431 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is. and Oroholyndja R. Fratercula cirrhata BNAUS KKBNA162-04 CWS7351 Canada, British Columbia, Fratercula cirrhata TZBNA TZBNA226-03 JP 3343 United States, Alaska, Bogoslof Is, Aleutian Is, Fratercula corniculata AROM BROM120-06 JP 2600 21-Jun-1990 United States, AK, Aleutians E, Yukon Harbor to FEH, Big Koniuji Is Fratercula corniculata AROM BROM410-06 JP 2460 14-Jun-1990 United States, Alaska, Aleutians East, N of FEH Fratercula corniculata BROM BROM769-07 JP 2459 14-Jun-1990 United States, Alaska, Aleutians East, N of FEH Fratercula corniculata BROM BROM770-07 JP 2602 21-Jun-1990 United States, AK, Aleutians E, Yukon Harbor to FEH, Big Koniuji Is Fratercula corniculata BNAUS CDAMH046-05 AMNH-DOT1248 18-Jul-1989 United States, Alaska, POPEROCHNOI ISLAND Fratercula corniculata TZBNA TZBNA227-03 JP 3371 United States, Alaska, Egg Is, Aleutian Is, Ptychoramphus aleuticus BROM BROM121-06 JP 2650 25-Jun-1990 United States, Alaska, Aleutians East, Yukon Harbor, Big Koniuji Is Ptychoramphus aleuticus BROM BROM528-07 1B-3427 07-Jun-1996 Canada, BC, Rupert dist, South Bay, Triangle Is, NW of Vancouver Is Ptychoramphus aleuticus BROM BROM657-07 JP 2578 18-Jun-1990 United States, Alaska, Aleutians East, NE Hall Is and Koniuji St Ptychoramphus aleuticus BROM BROM841-07 JP 2501 17-Jun-1990 United States, Ak, Aleutians E, Koniuji Strait, Yukon River, S of FEH Ptychoramphus aleuticus BROM BROM842-07 JP 2579 18-Jun-1990 United States, Alaska, Aleutians East, Yukon Harbor, Big Koniuji Is Ptychoramphus aleuticus BROM BROM911-08 CAAU7 21-Jan-1994 Ptychoramphus aleuticus TZBNA TZBNA233-03 JP 2652 United States, Alaska, Yukon Harbour, Hall St to FEH Synthliboramphus antiquus AROM BROM462-06 JP 2337 08-Jun-1990 United States, Ak, Aleutians E, N Hall Is, Yukon River, Koniuji Strait S. antiquus AROM BROM463-06 JP 2381 11-Jun-1990 United States, Alaska, Aleutians East, Koniuji Strait S. antiquus BROM BROM857-07 JP 2379 11-Jun-1990 United States, Alaska, Aleutians East, Koniuji Strait S. antiquus KBBI KBBI247-07 KRIBB 3058 South Korea, Kangwon-do, S. antiquus KBBI KBBI250-07 KRIBB 3145 South Korea, South Cholla, S. antiquus BNAUS KBNA584-04 CWS48162 13-May-1990 Canada, British Columbia, Hippa Island, S. antiquus BEPAL KBPBU763-06 UWBM 74989 05-Apr-2002 Russia, Primorskiy Kray, Vladivostok, Zaliv Petra Velikogo

Appendix 1 Part 2: Lari Specimens 119

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

S. antiquus TZBNA TZBNA236-03 JP 2338 United States, Alaska, N Hall Is, Yukon River, Koniuji Strait, Synthliboramphus craveri BNAAS KKBNA980-05 ROM B6371 19-May-1984 Mexico, Baja California, Gulf of California, E of Isla Partida Norte Synthliboramphus craveri BNAAS KKBNA981-05 ROM B5790 19-May-1984 Mexico, Baja California, Gulf of California, E of Isla Partida Norte Synthliboramphus BNAUS KKBNA330-05 UWBM 54879 03-Dec-1995 United States, Washington, Grays Harbor, Ocean City hypoleucus Synthliboramphus AROM BROM122-06 JMB 811 13-Aug-1990 North Pacific Ocean wumizusume S.wumizusume AROM BROM531-07 JMB 810 13-Aug-1990 North Pacific Ocean Uria aalge SWEBI BISE141-08 BISE-Aves34 20-Sep-1997 Sweden, Halland, MELLBYSTRAND-SKUMMESLOeVSSTRAND Uria aalge SWEBI BISE412-08 BISE-Aves431 12-Mar-1997 Sweden, Vastra Gotaland, Pater Noster skaeren, Klaedesholmen Uria aalge NORBI BON161-07 NHMO-BC161 01-May-2000 Norway, Finnmark, Hjelmsoya Uria aalge NORBI BONSC031-08 NHMO-BC544 01-May-2000 Norway, Finnmark, Hjelmsoya Uria aalge BNAUS BOTW294-05 USNM 622482 15-Mar-1997 United States, Alaska, Sitka Uria aalge AROM BROM123-06 AJB 5518 13-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Uria aalge BROM BROM124-06 JP 2171 29-May-1990 United States, Alaska, Aleutians West (CA), Agattu Is, Aleutian Is Uria aalge BROM BROM466-06 JP 3146 06-Jul-1991 United States, Alaska, Nome (CA), Fairway Rock Uria aalge AROM BROM860-07 AJB 5519 13-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Uria aalge AROM BROM861-07 AJB 5520 13-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Uria aalge BROM BROM862-07 JP 2388 11-Jun-1990 United States, Alaska, Aleutians East, Big Koniuji Is Uria aalge BROM BROM863-07 JP 3359 22-Aug-1991 United States, Alaska, Aleutians West (CA), Bogoslof Is, Aleutian Is Uria aalge BNAUS KBNA516-04 MSI996-97510 23-Jul-2004 Canada, New Brunswick, Machias Seal Island Uria aalge BNAUS KBNA517-04 MSI996-795001 23-Jul-2004 Canada, New Brunswick, Machias Seal Island Uria aalge TZBNA TZBNA069-03 AJB 5517 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Uria lomvia NORBI BON165-07 NHMO-BC165 Norway Uria lomvia NORBI BON166-07 NHMO-BC166 24-Mar-1997 Norway, Svalbard, Svea Uria lomvia NORBI BONSC038-08 NHMO-BC566 15-Aug-2004 Norway, Bjornoya Uria lomvia AROM BROM125-06 JP 3364 22-Aug-1991 United States, Alaska, Aleutians West (CA), Bogoslof Is, Aleutian Is Uria lomvia AROM BROM467-06 JP 3135 26-Jul-1991 United States, Alaska, Bethel (CA), St Matthew Is Uria lomvia BROM BROM535-07 JP 3158 06-Jul-1991 United States, Alaska, Nome (CA), Fairway Rock Uria lomvia BROM BROM864-07 JP 2044 15-May-1990 United States, Alaska, Dillingham (CA), Semidi Is Uria lomvia BROM BROM865-07 JP 3137 26-Jul-1991 United States, Alaska, Bethel (CA), St Matthew Is Uria lomvia BNAUS KBNA603-04 CWS58105 10-Mar-1993 Canada, Nfld & Labrador, Colinet Island Uria lomvia BNAUS KBNA604-04 CWS81931 26-Jul-1998 Canada, Northwest Territories, Coats Island Uria lomvia BEPAL KBPBU355-06 UWBM 44177 28-Jun-1992 Russia, Magadan, Adian Bay between Umara Is. and Oroholyndja R. Uria lomvia TZBNA TZBNA237-03 JP 3363 United States, Alaska, Bogoslof Is, Aleutian Is

Dromadidae

Appendix 1 Part 2: Lari Specimens 120

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Dromas ardeola BROM BROM703-07 DRAR001 20-May-2006 Eritrea, Dahret Is Dromas ardeola BROM BROM704-07 DRAR002 20-Jun-2005 Eritrea, Dahret Is

Glareolidae Cursorius temminckii BROM BROM402-06 MKP 1450 11-Dec-1991 Namibia, Mariental, Norikam Farm, Uhlenhorst dist Cursorius temminckii BROM BROM403-06 MKP 1446 11-Dec-1991 Namibia, Mariental, Norikam Farm, Uhlenhorst dist Glareola maldivarum BROM BROM230-06 MKP 2166 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Glareola maldivarum BROM BROM413-06 AJB 6129 29-Mar-1996 Australia, W. Australia, Roebuck Plains Glareola nordmanni BEPAL KBPBU187-06 UWBM 56661 29-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Glareola nordmanni BEPAL KBPBU188-06 UWBM 56675 31-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Glareola nordmanni BEPAL KBPBU190-06 UWBM 56900 31-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Glareola pratincola BROM BROM518-07 MKP 1464 16-Dec-1991 South Africa, KwaZulu-Natal, near Hluhluwe Glareola pratincola BROM BROM519-07 MKP 1468 16-Dec-1991 South Africa, KwaZulu-Natal, near Hluhluwe Glareola pratincola BEPAL KBPBU192-06 UWBM 46259 20-May-1993 Kazakhstan, Almaty Oblysy, Alma-Ata, Sorbulak Ksl Glareola pratincola BEPAL KBPBU193-06 UWBM 46260 20-May-1993 Kazakhstan, Almaty Oblysy, Alma-Ata, Sorbulak Ksl Pluvianus aegyptius BROM BROM444-06 LSUMZ B-16872 , Rhinoptilus chalcopterus BROM BROM447-06 LSUMZ B-45086 Ghana, Northern Prov, 2 km SW Buipe Stiltia isabella BROM BROM460-06 MKP 2231 24-Mar-1994 Australia, W. Australia, Anna Plains Stiltia isabella BROM BROM461-06 AJB 5647 23-Oct-1990 Australia, Queensland, 25 km E Noonbeh Station Stiltia isabella BROM BROM856-07 MKP 2233 24-Mar-1994 Australia, W. Australia, Anna Plains

Laridae Creagrus furcatus BROM BROM401-06 C512 20-Jun-1992 Ecuador, Guayas, Punta Sta Larus argentatus SWEBI BISE238-08 BISE-Aves243 08-Aug-2005 Sweden, Vastra Gotaland, Nya varvet Goeteborg, Goeteborg Larus argentatus SWEBI BISE408-08 BISE-Aves427 30-Jun-2000 Sweden, Stockholm, Sundbybergs C., Stockholm, Sundbyberg Larus argentatus NORBI BON332-07 NHMO-BC332 04-Jun-2006 Norway, Finnmark, Hornoya Larus argentatus BROM BROM556-07 RRS 324 14-Jun-1986 Iceland, Karlsskali Larus argentatus BROM BROM560-07 RRS 431 03-Jun-1987 Norway, Troms, Tromso Larus argentatus BROM BROM772-07 RRS 407 30-May-1987 Norway, Troms, Tromso Larus argentatus KBBI KBBI036-07 KRIBB 537 South Korea, Seoul-si Larus atricilla BNAUS BOTW033-04 USNM B03162 United States, New York, New York City, JFK International Airport Larus atricilla BROM BROM551-07 MKP 496 11-Mar-1988 United States, Florida, Collier Co, Marco Is Larus atricilla BROM BROM604-07 1B-2669 24-May-1997 United States, Delaware, Sussex Co, Slaughter Beach Larus atricilla BROM BROM611-07 LAGU001 15-May-2001 United States, New Jersey, Cape May Co, Villas Larus atricilla BROM BROM773-07 MKP 498 11-Mar-1988 United States, Florida, Collier Co, Marco Is Larus atricilla BNAUS CDUSM012-05 B03163 01-Jan-2001 United States, New York, New York City, JFK International Airport

Appendix 1 Part 2: Lari Specimens 121

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Larus atricilla BNAUS CDUSM013-05 B03164 01-Jan-2001 United States, New York, New York City, JFK International Airport Larus atricilla BNAUS CDUSM014-05 B16413 13-Apr-2001 United States, Florida, Miami-Dade, South Miami-Dade Landfill Larus atricilla BNAUS CDUSM015-05 B16414 13-Apr-2001 United States, Florida, Miami-Dade, South Miami-Dade Landfill Larus atricilla BNAUS CDUSM016-05 B16415 13-Apr-2001 United States, Florida, Miami-Dade, South Miami-Dade Landfill Larus atricilla BNAUS CDUSM017-05 B08761 20-Dec-1999 JOHNSTON ISLAND, Larus belcheri BROM BROM591-07 JG 021 27-Jul-1995 Chile, Tarapaca, Lluta River mouth Larus belcheri BROM BROM592-07 JG 022 27-Jul-1995 Chile, Tarapaca, Lluta River mouth Larus bulleri BROM BROM552-07 MKP 427 22-Nov-1987 New Zealand, Southland, Lochiel, South Is Larus bulleri BROM BROM553-07 JAM 309 20-Nov-1987 New Zealand, Southland, Lochiel, South Is Larus bulleri BROM BROM613-07 BB2 New Zealand, Marlborough, Kaikoura Pen Larus bulleri BROM BROM774-07 JAM 257 20-Nov-1987 New Zealand, South Island, Lochiel, South Is Larus bulleri BROM BROM775-07 MKP 431 22-Nov-1987 New Zealand, South Island, Lochiel, South Is Larus californicus BNAUS BOTW034-04 USNM 621109 United States, Washington, Pierce, Point Defiance Larus californicus BROM BROM544-07 DL356 02-Aug-1995 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus californicus BROM BROM776-07 DL360 02-Aug-1995 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus californicus BNAUS CDUSM009-05 B02990 30-Aug-1996 United States, Washington, PIERCE, Point Defiance, 1 MI N Larus californicus BNAUS CDUSM010-05 B02992 30-Aug-1996 United States, Washington, PIERCE, Steilacoom, 1 MI N, 2 MI W Larus californicus BNAUS KBNA624-04 CWS04516 20-Jun-2001 Canada, British Columbia, Kelowna Larus canus SWEBI BISE089-07 BISE-Aves104 18-Jul-2001 Sweden, Stockholm, Uppland, Maersta, Arlanda Larus canus SWEBI BISE418-08 BISE-Aves440 30-Jul-2002 Sweden, Vastra Gotaland, Billdal, Billdal Larus canus NORBI BON340-07 NHMO-BC340 22-Jun-2006 Norway, Oslo, Husbergoya Larus canus NORBI BON375-07 NHMO-BC375 21-Jun-2006 Norway, Troms, Langnes Flyplass Larus canus BNAUS BOTW035-04 USNM 622481 United States, Alaska, Anchorage Larus canus BROM BROM545-07 DL419 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus canus BROM BROM568-07 PW 005 Netherlands, Friesland, Schiermonnikoog Is, West Frisian Is Larus canus BROM BROM603-07 DL428 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus canus BROM BROM777-07 DL420 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus canus BNAUS KBNA654-04 CWS79035 Canada, NWT, Inland away Yellowknife Larus canus BNAUS KBNA655-04 CWS79036 Canada, NWT, Inland away Yellowknife Larus canus BEPAL KBPBU307-06 UWBM 43929 07-Oct-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Larus canus BEPAL KBPBU308-06 UWBM 44068 24-Jul-1992 Russia, Kamchatka, KoYa. A. Red'kinki, Larus canus BEPAL KBPBU309-06 UWBM 61302 14-Sep-1997 Russia, Tverskaya Oblast, Maloye Novosel`ye, Ozero Ivan`kovskoje Larus canus BEPAL KBPBU310-06 UWBM 44196 30-Jun-1992 Russia, Magadan, near mouth of Oroholyndja River Larus canus BEPAL KBPBU311-06 UWBM 44309 22-Jul-1992 Russia, Kamchatka, KoYa. A. Red'kinki, Larus canus TZBNA TZBNA155-03 JGS 1853 United States, Alaska, Larus cirrocephalus BROM BROM565-07 MKP 1469 17-Dec-1991 South Africa, KwaZulu-Natal, Umvoti River Mouth

Appendix 1 Part 2: Lari Specimens 122

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Larus cirrocephalus BROM BROM566-07 MKP 1324 27-Nov-1991 South Africa, Western Cape, Muizenburg, Coastal Park Larus cirrocephalus BROM BROM612-07 C374-112648 07-May-1991 Ecuador, Guayas, Punta Carnero Larus cirrocephalus BROM BROM778-07 MKP 1476 18-Dec-1991 South Africa, KwaZulu-Natal, Durban, Bayhead Larus cirrocephalus BROM BROM779-07 MKP 1481 05-Jun-1991 South Africa, KwaZulu-Natal, St Lucia Village, iSimangaliso Reserve Larus crassirostris KBBI KBBI186-07 KRIBB 2304 South Korea, South Cholla, Larus crassirostris KBBI KBBI189-07 KRIBB 2333 South Korea, Seoul-si, Larus crassirostris BEPAL KBPBU312-06 UWBM 46971 07-Aug-1993 Russia, Sakhalinskaya Oblast, south end of Sakhalin Larus crassirostris BEPAL KBPBU313-06 UWBM 51176 17-Sep-1994 Russia, Primorskiy Kray, Kiyevka, Melkovodnoe Zaliv Larus crassirostris BEPAL KBPBU314-06 UWBM 51177 17-Sep-1994 Russia, Primorskiy Kray, Kiyevka, Melkovodnoe Zaliv Larus crassirostris BEPAL KBPBU315-06 UWBM 47274 07-Jun-1993 Russia, Sakhalinskaya Oblast, south end of Sakhalin Larus delawarensis BNAUS BOTW036-04 USNM B03160 United States, New York, New York City, Jfk International Airport Larus delawarensis BROM BROM004-06 DL407 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus delawarensis BROM BROM028-06 MKP 798 10-Oct-1989 Canada, Ontario, Durham RM, Pickering Dump Larus delawarensis BROM BROM029-06 1B-3887 22-Apr-2002 Canada, Ontario, Frontenac Co, Kingston Larus delawarensis BROM BROM780-07 PMF 300 24-May-1983 Canada, Ontario, Metro Toronto RM, Toronto, Leslie St Spit Larus delawarensis TZBNA HCBR085-03 1B-1714 Canada, Ontario, Larus delawarensis BNAUS KBNA660-04 CWS32827 23-Aug-1984 Canada, Quebec, Baie Comeau Larus dominicanus BROM BROM550-07 AML 8 17-Dec-1983 Argentina, Chubut, Punta Tafor, near Camarones Larus dominicanus BROM BROM555-07 DGULL 4 04-Dec-1989 New Zealand, North Auckland, Mangawhai, North Is Larus dominicanus BROM BROM564-07 MKP 1306 27-Nov-1991 South Africa, Western Cape, Muizenburg, Coastal Park Larus dominicanus BROM BROM781-07 MKP 805 08-Dec-1989 New Zealand, North Island Larus dominicanus BARG KBARG031-07 MACN-Or-ct 395 01-Dec-2005 Argentina, Chubut, Punta Leon Larus dominicanus BARG KBARG033-07 MACN-Or-ct 1340 01-Dec-2005 Argentina, Chubut, Punta Leon Larus dominicanus AAPR KBNA651-04 CWS21896 27-Nov-1981 Chile, Bahia de Concepcion Larus fuscus SWEBI BISE239-08 BISE-Aves244 11-Sep-2006 Sweden, Stockholm, Bromma flygplats, Stockholm, Bromma Larus fuscus SWEBI BISE365-08 BISE-Aves380 04-Jul-2003 Sweden, Skane, Slottsparken i Malmoe, Malmoe Larus fuscus NORBI BON338-07 NHMO-BC338 22-Jun-2006 Norway, Oslo, Husbergoya Larus fuscus NORBI BON339-07 NHMO-BC339 25-Jun-2006 Norway, Oslo, Sunbyholmen Larus fuscus BNAUS BOTW326-05 USNM 631712 07-Aug-2001 Iceland, Keflavik Larus fuscus BROM BROM558-07 RRS 380 Faeroe Islands Larus fuscus BROM BROM563-07 RRS 590 07-May-1988 France, Finistere, Ile de Balanec Larus fuscus BROM BROM782-07 RRS 405 Faeroe Islands Larus fuscus BROM BROM783-07 RRS 594 07-May-1988 France, Finistere, Ile de Balanec Larus fuscus BNAUS CDUSM018-05 B07755 17-Jul-1995 United Kingdom, Suffolk, MILDENHALL AIR FORCE BASE Larus fuscus BNAUS CDUSM019-05 B07756 17-Jul-1995 United Kingdom, Suffolk, MILDENHALL AIR FORCE BASE Larus fuscus BNAUS CDUSM093-05 B07754 17-Jul-1995 United Kingdom, Suffolk, MILDENHALL AIR FORCE BASE

Appendix 1 Part 2: Lari Specimens 123

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Larus fuscus BNAUS KKBNA200-05 USNM 631713 09-Mar-1991 Iceland, Keflavik, Naval Air Station Larus genei BROM BROM614-07 112849 28-Mar-1992 Bahrain, Bahrain Larus glaucescens BNAUS BOTW176-04 B17820 United States Larus glaucescens BROM BROM569-07 JP 2471 14-Jun-1990 United States, Alaska, Aleutians East, N of FEH Larus glaucescens BROM BROM588-07 TB 9701 02-Jun-1994 United States, AK, Aleutians W (CA), Amchitka Is, Rat Is, Aleutian Is Larus glaucescens BROM BROM784-07 TB 9709 06-Jun-1994 United States, Alaska, Aleutians West (CA), Buldir Is, Aleutian Is Larus glaucescens BNAUS KBNA637-04 CWS23682 07-Mar-1982 Canada, British Columbia, QUATSINO NARROWS Larus glaucescens BNAUS KKBNA176-04 CWSL96-73250- 11-Jan-1996 Canada, British Columbia, Delta 01 Larus glaucescens BNAUS KKBNA177-04 CWS23678 07-Mar-1982 Canada, British Columbia, QUATSINO NARROWS Larus glaucoides BROM BROM785-07 RRS 105 27-Jun-1985 Canada, Nunavut, Baffin Region, Pitchforth Fiord, Baffin Is Larus glaucoides BROM BROM886-08 RRS 137 04-Jul-1985 Canada, Nunavut, Baffin Region, Home Bay Is, Home Bay Larus glaucoides TZBNA TZBNA006-03 RRS 123 Canada, Nunavut, Home Bay Is, Home Bay Larus glaucoides BROM TZBNA191-03 1B-462 01-Jan-1992 Canada, Ontario, Metro Toronto RM, Sunnyside Beach, near Ellis Ave Larus hartlaubii BROM BROM787-07 MKP 1330 27-Nov-1991 South Africa, Western Cape, Muizenburg, Coastal Park Larus hartlaubii BROM BROM788-07 MKP 1335 28-Nov-1991 South Africa, Western Cape, Capetown Larus heermanni BNAUS KBNA641-04 CWS26870 01-Aug-1973 Canada, British Columbia, Barkley Sound Larus heermanni BNAUS KBNA642-04 CWS26872 01-Aug-1973 Canada, British Columbia, Barkley Sound Larus heermanni BNAUS KBNA643-04 CWS26875 01-Aug-1973 Canada, British Columbia, Barkley Sound Larus heuglini BEPAL KBPBU304-06 UWBM 56820 22-Jun-1996 Russia, Tyumenskaya Oblast', Yamalo-Nenetskiy A. Okrug, Noyabr'sk Larus hyperboreus NORBI BON167-07 NHMO-BC167 04-Oct-2005 Norway, Svalbard, Longyearbyen Larus hyperboreus NORBI BON168-07 NHMO-BC168 04-Oct-2005 Norway, Svalbard, Longyearbyen Larus hyperboreus BROM BROM789-07 RRS 208 03-Jun-1986 Iceland, Bjarnarhafnarfjall Larus hyperboreus BROM BROM790-07 TB 9501 01-Jun-1994 United States, AK, Bethel (CA), Kigigak Is, Yukon-Kuskokwin Delta Larus hyperboreus BROM BROM887-08 RRS 165 19-Jul-1985 Canada, Nunavut, Baffin Region, Pitchforth Fiord, Baffin Is Larus hyperboreus BROM BROM888-08 RRS 250 04-Jun-1986 Iceland, Bjarnarhafnarfjall Larus hyperboreus BROM BROM889-08 RRS 460 09-Jun-1987 Norway, Svalbard, Spitsbergen Island, Adventfjorden, Spitsbergen Larus hyperboreus BNAUS CDLSU067-05 LSU21853 28-Apr-1994 United States, LA, Cameron Parish, 6 mi. W old Mouth Mermentau R. Larus hyperboreus BNAUS KBNA634-04 CWS51568 27-Oct-1991 Canada, Quebec, Inukjuag, Larus hyperboreus BNAUS KBNA635-04 CWS61976 04-Aug-1993 Canada, NWT, Black Guillemot colony, Pr.Leo.II. Larus hyperboreus BNAAS KBNA968-06 K05-13902-00-00 28-Jul-2005 Canada, Nunavut, St. Helena Island Larus hyperboreus BNAAS KBNA971-06 K05-13898-00-07 01-Jun-2005 Canada, Nunavut, St. Helena Island Larus hyperboreus BEPAL KBPBU318-06 UWBM 43851 29-Jun-1992 Russia, Magadanskaya Oblast, Magadan, mouth of Oroholyndja R. Larus hyperboreus BEPAL KBPBU319-06 UWBM 43852 29-Jun-1992 Russia, Magadanskaya Oblast, Magadan, mouth of Oroholyndja R. Larus hyperboreus TZBNA TZBNA313-03 1B-3005 Canada, Ontario, Hamilton, Van Wagners Beach Larus maculipennis BROM BROM791-07 LM2 06-Feb-1998 Argentina, Rio Negro, Banco Lobos, San Antonio Este

Appendix 1 Part 2: Lari Specimens 124

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Larus maculipennis BROM BROM792-07 MKP 2440 13-Feb-1995 Chile, Magallanes-Antartica, Rio Colorado, near Punta Arenas Larus maculipennis BROM BROM793-07 MKP 2441 13-Feb-1995 Chile, Magallanes-Antartica, Rio Colorado, near Punta Arenas Larus maculipennis BROM BROM794-07 N18802 30-Apr-1999 Brazil, Rio Grande do Sul, Lagoa do Peixei Larus marinus SWEBI BISE240-08 BISE-Aves245 10-Oct-2005 Sweden, Skane, Falsterbokanalen, Hoellviken, Falsterbokanalen Larus marinus SWEBI BISE407-08 BISE-Aves426 04-Sep-2000 Sweden, Stockholm, Bjoernskogsvaegen, Gustavsberg, Gustavsberg Larus marinus NORBI BON029-06 NHMO-BC29 01-Jan-1966 Norway, Finnmark, Porsanger Larus marinus NORBI BON401-07 NHMO-BC401 17-Mar-2006 Norway, Ostfold, Spjaeroy Larus marinus BNAUS BOTW037-04 USNM B03168 United States, New York, New York City, JFK International Airport Larus marinus BROM BROM425-06 RRS 265 08-Jun-1986 Iceland, Skruder Larus marinus BROM BROM426-06 DL631 11-Dec-1996 Canada, New Brunswick, Charlotte Co, The Wolves, Bay of Fundy Larus marinus BROM BROM795-07 AJB 5527 14-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Larus marinus BROM BROM796-07 RRS 595 07-May-1988 France, Finistere, Ile de Balanec Larus marinus BROM BROM890-08 RRS 264 08-Jun-1986 Iceland, Skruder Larus marinus BROM BROM891-08 RRS 596 07-May-1988 France, Finistere, near Ile Richard Larus marinus BNAUS KBNA640-04 CWS81590 09-Jul-1998 Canada, Nfld & Labrador, Nain, Larus marinus TZBNA TZBNA363-03 1B-3673 Canada, Ontario, Point pelee, Larus michahellis BROM BROM561-07 RRS 530 24-Apr-1988 France, Vaucluse, La Tour du Valat, Etang du fournelet, LaCamargue Larus michahellis BROM BROM562-07 RRS 539 25-Apr-1988 France, Vaucluse, Etang de la Galere, La Camargue Larus minutus SWEBI BISE472-08 BISE-Aves484 15-Jul-2007 Sweden, Gotland, Faroe,Sudersand Larus modestus BROM BROM797-07 JG 023 27-Jul-1995 Chile, Tarapaca, Lluta River mouth Larus modestus BROM BROM798-07 JG 024 27-Jul-1995 Chile, Tarapaca, Lluta River mouth Larus modestus BROM BROM799-07 MKP 2550 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Larus modestus BROM BROM800-07 MKP 2551 24-Feb-1995 Chile, Valparaiso, Santo Domingo beaches Larus occidentalis BNAUS CDLSU044-05 LSU20665 03-Sep-1987 United States, CA, Riverside Co., North end Salton Sea, mouth Whitewater River. Larus occidentalis BNAUS KBNA664-04 CWS06086 12-Jul-1968 Canada, British Columbia Larus occidentalis BNAUS KBNA665-04 CWS06087 12-May-1968 Canada, British Columbia Larus occidentalis BNAUS KBNA666-04 CWS27489 19-Jul-1968 Canada, British Columbia, Port Alberni Larus philadelphia BROM BROM801-07 DL412 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus philadelphia BROM BROM802-07 DL435 30-Jul-1996 Canada, Alberta, Improvement dist 8, Margaret Lake Larus philadelphia BROM BROM875-07 1B-4342 25-Sep-2004 Canada, Ontario, Northumberland Co, Presqu'ile Prov Park Larus philadelphia BNAUS CDLSU068-05 LSU21799 06-Apr-1994 United States, LA, Cameron Parish, 5 mi. W. Old Mouth Mermentau R Larus philadelphia BNAUS KKBNA138-04 CWSL97-79038- Canada, Northwest Territories, YKSA #192 00-01 Larus philadelphia BNAUS KKBNA139-04 CWSL97-79040- Canada, Northwest Territories, Baker Island, just past 00-01 Larus philadelphia BNAUS KKBNA140-04 CWSL97-79041- Canada, Northwest Territories, Leg, 00-01

Appendix 1 Part 2: Lari Specimens 125

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Larus pipixcan BNAUS BOTW038-04 USNM 622194 United States, Kansas, Jefferson, Perry Lake Dam Larus pipixcan BROM BROM803-07 DL433 30-Jul-1996 Canada, Alberta, Improvement dist 8, Margaret Lake Larus pipixcan BROM BROM804-07 RCA 88-42 29-May-1988 Canada, Alberta Larus pipixcan BROM BROM805-07 RCA 88-43 01-Jun-1988 Canada, Alberta Larus pipixcan TZBNA HCBR077-03 DL434 Canada, Alberta Larus pipixcan BNAUS KBNA631-04 CWS21940 21-Nov-1981 Chile, North Outfall Larus pipixcan TZBNA TZBNA203-03 1B-737 Canada, Ontario Larus relictus BROM BROM806-07 HOKO 0001 01-Jun-1998 China, Nei Mongol Zizhiqu, Taolimiao-Alashan Nur Larus ridibundus SWEBI BISE117-07 BISE-Aves149 13-Aug-2002 Sweden, Oland, Oland, Sandvik, Ottenby Larus ridibundus SWEBI BISE409-08 BISE-Aves428 20-Jul-2000 Sweden, Stockholm, Jakobsberg, Riddarparken Larus ridibundus NORBI BON341-07 NHMO-BC341 26-Jun-2006 Norway, Oslo, Mokkalassene, Snaroya Larus ridibundus NORBI BON342-07 NHMO-BC342 26-Jun-2006 Norway, Oslo, Mokkalassene, Snaroya Larus ridibundus BNAUS BOTW039-04 USNM 621248 United Kingdom, Suffolk, Mildenhall Air Force Base Larus ridibundus BROM BROM807-07 BHGU 8902 Netherlands Larus ridibundus BROM BROM808-07 BHGU 8904 Netherlands Larus ridibundus BROM BROM809-07 MKP 1619 20-Jul-1992 Iceland, Gardur Larus ridibundus BROM BROM810-07 MKP 1620 20-Jul-1992 Iceland, Gardur Larus ridibundus BROM BROM892-08 HO 11 01-Oct-1989 Norway Larus ridibundus BROM BROM893-08 LR 1 01-Oct-1989 Norway, Troms, Tromso Larus ridibundus BNAUS CDUSM007-05 B07786 16-Dec-1994 United Kingdom, Suffolk, MILDENHALL AIR FORCE BASE Larus ridibundus BNAUS CDUSM008-05 B08853 United Kingdom Larus ridibundus BNAUS CDUSM091-05 B07787 16-Dec-1994 United Kingdom, Suffolk, MILDENHALL AIR FORCE BASE Larus ridibundus BNAUS KBNA626-04 CWS10466 France Larus ridibundus BEPAL KBPBU321-06 UWBM 43840 28-Jun-1992 Russia, Magadanskaya Oblast, Magadan, mouth of Oroholyndja R Larus ridibundus BEPAL KBPBU322-06 UWBM 44057 23-Jul-1992 Russia, Kamchatka, KoYa. A. Red'kinki Larus ridibundus BEPAL KBPBU325-06 UWBM 59734 31-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Larus scoresbii BARG KAARG004-07 MACN-Or-ct 130 01-Dec-2004 Argentina Larus scoresbii BARG KAARG005-07 MACN-Or-ct 131 01-Dec-2004 Argentina Larus serranus BROM BROM814-07 112856 13-Jul-1993 Ecuador, Imbabura, Ibarra, Velasques Larus smithsonianus BNAUS BOTW032-04 USNM B03165 United States, New York, New York City, JFK International Airport Larus smithsonianus BROM BROM557-07 RRS 341 27-Jul-1986 Canada, PEI, Prince Co, Little Courtin Is, Malpeque Bay Larus smithsonianus BROM BROM602-07 DL363 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Larus smithsonianus BROM BROM895-08 DL436 30-Jul-1996 Canada, Alberta, Improvement dist 8, Margaret Lake Larus smithsonianus BROM BROM896-08 RRS 622 United States, Alaska Larus smithsonianus BROM BROM897-08 RRS 629 United States, Alaska Larus smithsonianus BNAUS KBNA311-04 LPBO001 Canada, Ontario, Port Rowan, Old Cut Field Station, Long Point

Appendix 1 Part 2: Lari Specimens 126

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Larus smithsonianus BNAUS KBNA644-04 CWS04393 11-Jun-2001 Canada, New Brunswick, Kent Island Larus smithsonianus BNAUS KBNA645-04 CWS70624 12-May-1995 Canada, Ontario, GLO, Scotch Bonnet Island Larus smithsonianus BNAUS KBNA646-04 CWS70942 19-May-1995 Canada, Ontario, GLS, Skin Island Larus smithsonianus TZBNA TZBNA034-03 RRS 370 Canada, Prince Edward Island, Little Courtin Is, Malpeque Bay Larus thayeri BROM BROM813-07 RRS 127 02-Jul-1985 Canada, Nunavut, Baffin Region, Home Bay Is, Home Bay Larus thayeri BNAUS CDLSU045-05 LSU21855 27-Apr-1994 United States, Louisiana, Cameron Parish, 1 mi E Holly Beach Larus thayeri BROM HCBR084-03 1B-1755 19-Dec-1993 Canada, Ontario, Hamilton-Wentworth RM, Desjardins Canal Larus thayeri BNAAS KBNA969-06 K05-13905-00-00 28-Jul-2005 Canada, Nunavut, St. Helena Island Larus thayeri BNAAS KBNA972-06 K05-13901-00-07 18-Jul-2005 Canada, Nunavut, St. Helena Island Larus thayeri TZBNA TZBNA079-03 RRS 124 Canada, Nunavut, Baffin Region, Home Bay Is, Home Bay Larus vegae BEPAL KBPBU305-06 UWBM 71997 08-Mar-2001 Russia, Primorskiy Kray, Spasskiy Rayon, Gayvoron, Ozero Khanka, mouth Spasovka river Larus vegae BEPAL KBPBU306-06 UWBM 59969 06-Feb-1998 Mongolia, Dornod, Dornod Aymag, Ondsrhushuu Larus vegae BEPAL KBPBU789-06 UWBM 73195 16-Jul-2002 Russia, Buryatia, Kabanskiy Rayon, Mursino, Ulan-Ude Pagophila eburnea NORBI BON008-06 NHMO-BC8 21-Jul-1984 Norway, Svalbard Pagophila eburnea NORBI BON009-06 NHMO-BC9 21-Jul-1984 Norway, Svalbard Pagophila eburnea NORBI BON432-07 NHMO-BC432 04-Aug-1984 Norway, Svalbard Pagophila eburnea BNAUS KKBNA605-05 UWBM 72711 07-Sep-1993 Arctic Ocean Rhodostethia rosea SWEBI BISE344-08 BISE-Aves357 24-Nov-1992 Sweden, Norrbotten, 3 KM OeSTER OM Vittangi, VAeG mot Pajala Rhodostethia rosea SWEBI BISE476-08 BISE-Aves496 Sweden Rhodostethia rosea BROM BROM448-06 C510 13-Jul-1999 Russia, Krasnoyarskiy Kray, Taymyr Aut Okrug, N Taymyr Pen Rhodostethia rosea BNAUS KBNA661-04 CWS35250 14-Jun-1986 Canada, Northwest Territories, Arctic Bay Rissa brevirostris BNAUS CDAMH097-05 AMNH-DOT1461 01-Jun-1990 United States, Alaska, BULDIR ISLAND Rissa brevirostris TZBNA TZBNA234-03 JP 2231 United States, Alaska, Buldir Is, Aleutian Is Rissa tridactyla SWEBI BISE126-07 BISE-Aves173 19-Jan-2005 Sweden, Vastra Gotaland, Goteborg, Naesetskolan, Vaestra Frolunda Rissa tridactyla NORBI BON159-07 NHMO-BC159 20-Nov-2002 Norway, Svalbard, Longyearbyen Rissa tridactyla AROM BROM449-06 JP 2528 18-Jun-1990 United States, Alaska, Aleutians East, NE Hall Is and Koniuji St Rissa tridactyla AROM BROM450-06 AJB 5531 15-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Rissa tridactyla BROM BROM844-07 1B-4560 29-Oct-2005 Canada, Ontario, Ottawa, Constance Bay, Ottawa Rissa tridactyla BROM BROM845-07 AJB 5534 15-Jun-1990 Canada, Nfld & Labrador, Bay Bulls, Avalon Pen Rissa tridactyla BROM BROM846-07 JP 2590 21-Jun-1990 United States, AK, Aleutians E, Yukon Harbor to FEH, Big Koniuji Is Rissa tridactyla BROM BROM847-07 JP 3457 28-Aug-1991 United States, Alaska, Aleutians East, Midun Is, Aleutian Is Rissa tridactyla BNAUS KKBNA265-05 UWBM 55364 03-Jun-1991 United States, Alaska, coastal Gulf of Alaska SE of Cordova Rissa tridactyla BNAUS KKBNA266-05 UWBM 55376 31-Oct-1991 N. Pacific Ocean, off NE coast of Honshu, Japan Rissa tridactyla BNAUS KKBNA275-05 UWBM 43861 30-Jun-1992 Russia, Magadan, near mouth of Oroholyndja River Rissa tridactyla BNAUS KKBNA448-05 UWBM 68175 01-Jul-1999 United States, Alaska, Homer, 8.5 mi SW, Kachemak Bay, Gull Island

Appendix 1 Part 2: Lari Specimens 127

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Rissa tridactyla BNAUS KKBNA527-05 UWBM 55583 15-Nov-1990 N.orth Pacific Ocean Rissa tridactyla TZBNA TZBNA010-03 1B-233 Canada, Nfld & Labrador Rissa tridactyla TZBNA TZBNA231-03 JP 2025 United States, Alaska, Semidi Is Rissa tridactyla TZBNA TZBNA235-03 JP 3454 United States, Alaska, Midun Is, Aleutian Is Xema sabini SWEBI BISE143-08 BISE-Aves38 20-Sep-1997 Sweden, Halland, MELLBYSTRAND Xema sabini SWEBI BISE379-08 BISE-Aves395 23-Sep-1997 Sweden, Halland, MELLBYSTRAND Xema sabini BROM BROM472-06 MKP 984 06-Jul-1990 Canada, Nunavut, Kitikmeot Region, Cambridge Bay, Victoria Is Xema sabini TZBNA TZBNA023-03 MKP 986 Canada, Nunavut, Cambridge Bay, Victoria Is Xema sabini TZBNA TZBNA032-03 MKP 985 Canada, Nunavut, Cambridge Bay, Victoria Is

Rynchopidae Rynchops niger BROM BROM019-06 LDP006 24-Apr-1999 Brazil, Rio Grande do Sul, Lagoa do Peixe Rynchops niger BROM BROM036-06 MKP 485 11-Mar-1988 United States, Florida, Marco Island Rynchops niger BROM BROM037-06 N07411 02-Apr-1997 Brazil, Lagoa do Peixe Rynchops niger BARG KAARG119-07 MACN-Or-ct 2068 24-Nov-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Rynchops niger BARG KAARG120-07 MACN-Or-ct 2069 24-Nov-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Rynchops niger BARG KAARG121-07 MACN-Or-ct 2070 24-Nov-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Rynchops niger TZBNA TZBNA093-03 MKP 491 United States, Florida, Marco Is Rynchops niger TZBNA TZBNA102-03 MKP 489 United States, Florida

Stercorariidae Stercorarius antarcticus BROM BROM570-07 CHSK 03 New Zealand, Chatham Islands, Chatham Is Stercorarius antarcticus BROM BROM571-07 CHSK 05 New Zealand, Chatham Islands, Chatham Is Stercorarius antarcticus BROM BROM848-07 ANSK 07 Stercorarius antarcticus BARG KAARG003-07 MACN-Or-ct 127 01-Dec-2004 Argentina Stercorarius chilensis BROM BROM217-06 MKP 2451 14-Feb-1995 Chile, Magallanes-Antartica, Cabo Negro, near Punta Arenas Stercorarius chilensis BROM BROM637-07 AJB 4453 Argentina Stercorarius longicaudus SWEBI BISE029-07 BISE-Aves32 28-Jun-1997 Sweden, Norrbotten, Torne lappmark, Stenbacken, Luobasjaure Stercorarius longicaudus NORBI BON133-07 NHMO-BC133 07-Sep-1985 Norway, Svalbard, Hopen Stercorarius longicaudus AROM BROM184-06 MKP 989 08-Jul-1990 Canada, Nunavut, Kitikmeot Region, Cambridge Bay, Victoria Is Stercorarius longicaudus AROM BROM185-06 MKP 990 08-Jul-1990 Canada, Nunavut, Kitikmeot Region, Cambridge Bay, Victoria Is Stercorarius longicaudus AROM BROM454-06 122398104 01-Jun-1990 Canada, Nunavut, Baffin Region, Alert, Ellesmere Is Stercorarius longicaudus BROM BROM576-07 B-4063 United States, Washington, Grays Harbor Co, Grays Harbor Stercorarius longicaudus BROM BROM577-07 DLD2978 United States, Louisiana, Plaquemines Par, ca 15 mi S South Pass Stercorarius longicaudus BROM BROM578-07 B-4058 United States, Washington, Grays Harbor Co, Grays Harbor Stercorarius longicaudus BROM BROM658-07 B-16730 United States, North Carolina, Dare Co, Oregon Inlet

Appendix 1 Part 2: Lari Specimens 128

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Stercorarius longicaudus BEPAL KBPBU294-06 UWBM 43888 07-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Stercorarius longicaudus BEPAL KBPBU295-06 UWBM 43950 07-Nov-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, along Avtatkuul River Stercorarius longicaudus BNAUS KKBNA432-05 UWBM 53896 08-Jun-1995 United States, Alaska, Deadhorse Stercorarius longicaudus BNAUS KKBNA435-05 UWBM 53906 10-Jun-1995 United States, Alaska, Deadhorse, just west of Sagavanirktok River Stercorarius longicaudus BNAUS KKBNA437-05 UWBM 44124 10-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Stercorarius longicaudus BNAUS KKBNA528-05 UWBM 55609 26-Aug-1991 North Pacific Ocean Stercorarius longicaudus BNAUS KKBNA529-05 UWBM 55610 30-Aug-1991 North Pacific Ocean Stercorarius maccormicki BROM BROM616-07 10826 23-Jan-1985 Stercorarius maccormicki BROM BROM912-08 SPSK 1985-07-21 27-Jan-1985 Stercorarius parasiticus SWEBI BISE177-08 BISE-Aves167 08-Jul-2003 Sweden, Skane, Falsterbostrand, Falsterbostrand Stercorarius parasiticus NORBI BON093-06 NHMO-BC93 08-Jul-2004 Norway, Finnmark, Vardo Stercorarius parasiticus NORBI BON307-07 NHMO-BC307 15-Jul-2005 Norway, Finnmark, Svartnes Stercorarius parasiticus BNAUS BOTW306-05 USNM 623304 11-Aug-2001 Iceland, Hafnir Stercorarius parasiticus AROM BROM192-06 MKP 1526 07-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak Stercorarius parasiticus AROM BROM269-06 1B-2750 02-Nov-1997 Canada, Ontario, Hamilton-Wentworth RM, Stoney Creek, Lake Ontario shoreline Stercorarius parasiticus BROM BROM573-07 B-20730 United States, Louisiana Stercorarius parasiticus AROM BROM659-07 DLD2972 27-Sep-1989 United States, Louisiana, Orleans Par, New Orleans Stercorarius parasiticus BNAUS CDUSM020-05 B00498 28-Feb-1989 Panama, Bocas Del Toro, b/w Islas Cristobal & Pastores, Bahia Almirante Stercorarius parasiticus BNAUS CDUSM021-05 B00540 02-Mar-1989 Panama, Bocas Del Toro, S of Is San Cristobal, L. de Tierra Oscura Stercorarius parasiticus BEPAL KBPBU299-06 UWBM 43914 07-Sep-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Stercorarius pomarinus NORBI BON164-07 NHMO-BC164 03-May-1985 Norway, Svalbard Stercorarius pomarinus BROM BROM191-06 MKP 1559 15-Jun-1992 United States, Alaska, North Slope, Barrow Stercorarius pomarinus BROM BROM265-06 1B-4565 12-Nov-2005 Canada, Ontario, Simcoe Co, Barrie Stercorarius pomarinus BROM BROM546-07 1B-2659 27-Nov-1996 Canada, Ontario, Niagara RM, Lake Ontario shoreline Stercorarius pomarinus BROM BROM574-07 B-8662 United States, North Carolina, Dare Co, Oregon Inlet Stercorarius pomarinus BROM BROM575-07 B-18939 United States, Washington, Grays Harbor Co, 20 mi W Point Brown Stercorarius pomarinus BNAUS CDUSM022-05 B01669 15-Sep-1995 United States, North Carolina, Off Cape Hatteras National Seashore Stercorarius pomarinus BNAUS CDUSM023-05 USNM 620724 15-Sep-1995 United States, North Carolina, Off Cape Hatteras National Seashore Stercorarius pomarinus BNAUS CDUSM024-05 B01676 15-Sep-1995 United States, North Carolina, Off Cape Hatteras National Seashore Stercorarius pomarinus BNAUS KBNA749-04 CWS26130 28-Jun-1971 United States, Alaska, AMCHITKA, Stercorarius skua SWEBI BISE130-07 BISE-Aves184 15-Oct-2003 Sweden, Vastra Gotaland, Bohuslan, Gullmarsfjorden, Skredsvik Stercorarius skua NORBI BON412-07 NHMO-BC412 04-Aug-1999 Norway, Svalbard, Akseloya Stercorarius skua BNAUS BOTW305-05 USNM 623300 09-Aug-2001 Iceland, Keflavik Stercorarius skua BROM BROM197-06 MKP 1592 17-Jul-1992 Iceland, Hof Stercorarius skua BROM BROM198-06 MKP 1593 17-Jul-1992 Iceland, Hof Stercorarius skua BNAUS KKBNA227-05 USNM 623301 09-Aug-2001 Iceland, Keflavik, North Coast

Appendix 1 Part 2: Lari Specimens 129

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Sternidae Anous minutus AAPR BOTW261-05 USNM 614220 29-Aug-1991 Pacific Ocean Anous minutus BROM BROM106-06 233348 United States, Hawaii, Anous minutus BROM BROM107-06 236189 United States, Hawaii, Anous minutus AAPR KKBNA201-05 USNM 614222 09-Aug-2001 Pacific Ocean Anous stolidus BROM BROM108-06 X8367 United States, Hawaii Anous stolidus BNAUS KKBNA181-05 PSM 21816 09-May-1991 Johnston Atoll Chlidonias albostriatus BROM BROM006-06 BFT 001 30-Nov-1992 New Zealand, Marlborough, S. New Zealand, Kaikoura, South Is Chlidonias hybrida BROM BROM001-06 MKP 2260 29-Mar-1994 New Zealand, Marlborough, S. New Zealand, Kaikoura, South Is Chlidonias hybrida BROM BROM033-06 AJB 6149 01-Apr-1996 Australia, W. Australia, 80 Mile Beach Chlidonias hybrida BROM BROM763-07 MKP 2220 23-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains, North Marsh Chlidonias hybrida BEPAL KBPBU334-06 UWBM 56920 06-Mar-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Chlidonias hybrida BEPAL KBPBU335-06 UWBM 61480 28-Jun-1998 Russia, Krasnoyarskiy Kray, Temryukskiy, Sea of Azov, Temryuk Chlidonias hybrida BEPAL KBPBU336-06 UWBM 59704 22-May-1998 Mongolia, Dornod, Dornod Aymag, Halhin Gol, Burkhan Chlidonias hybrida BEPAL KBPBU337-06 UWBM 59947 30-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Chlidonias leucopterus AROM BROM002-06 SBB 042 10-Mar-1994 Australia, W. Australia, Port Hedland Chlidonias leucopterus AROM BROM398-06 SBB 030 02-Apr-1994 Australia, W. Australia, 80 Mile Beach Chlidonias leucopterus BEPAL KBPBU330-06 UWBM 61237 28-Jun-1998 Russia, Krasnoyarskiy Kray, Temryukskiy, Sea of Azov, Temryuk Chlidonias leucopterus BEPAL KBPBU331-06 UWBM 61238 28-Jun-1998 Russia, Krasnoyarskiy Kray, Temryukskiy, Sea of Azov, Temryuk Chlidonias leucopterus BEPAL KBPBU332-06 UWBM 60147 31-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Chlidonias niger SWEBI BISE232-08 BISE-Aves237 11-Aug-2006 Sweden, Oland, Ottenby birdstation Chlidonias niger AROM BROM003-06 DL390 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Chlidonias niger AROM BROM026-06 RCA 88-38 28-May-1988 Canada, Alberta Chlidonias niger AROM BROM027-06 JGS 2037 31-May-1985 United States, Alaska Chlidonias niger BROM BROM765-07 DL393 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Chlidonias niger BROM BROM766-07 RCA 88-44 01-Jun-1988 Canada, Alberta Chlidonias niger BEPAL KBPBU326-06 UWBM 56893 30-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Chlidonias niger BEPAL KBPBU328-06 UWBM 56906 06-Jan-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Chlidonias niger BEPAL KBPBU329-06 UWBM 61479 28-Jun-1998 Russia, Krasnoyarskiy Kray, Temryukskiy, Sea of Azov, Temryuk Chlidonias niger BNAUS KKBNA149-04 CWS23519 21-Jul-1981 Canada, Alberta, FORT CHIPEWYAN Chlidonias niger TZBNA TZBNA091-03 JGS 2039 United States, Alaska Gelochelidon nilotica AROM BROM012-06 LDP010 30-Apr-1999 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Gelochelidon nilotica AROM BROM047-06 AJB 6130 29-Mar-1996 Australia, W. Australia, Roebuck Plains Gelochelidon nilotica BROM BROM048-06 GUTE G1 16-Nov-1997 Argentina, Rio Negro, Banco Lobos, San Antonio Este Gelochelidon nilotica AROM BROM049-06 AJB 6144 01-Apr-1996 Australia, W. Australia, 80 Mile Beach, 8 km mark

Appendix 1 Part 2: Lari Specimens 130

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Gelochelidon nilotica AROM BROM094-06 AJB 6147 01-Apr-1997 Australia, W. Australia, 80 Mile Beach, 8 km mark Gelochelidon nilotica AROM BROM095-06 AJB 6145 01-Apr-1998 Australia, W. Australia, 80 Mile Beach, 8 km mark Gelochelidon nilotica AROM BROM096-06 AJB 6146 01-Apr-1999 Australia, W. Australia, 80 Mile Beach, 8 km mark Gelochelidon nilotica AROM BROM458-06 AJB 6157 02-Apr-1996 Australia, W. Australia, 80 Mile Beach Gelochelidon nilotica BROM BROM852-07 GUTE G3 16-Nov-1997 Argentina, Rio Negro, Banco Lobos, San Antonio Este Gelochelidon nilotica BNAUS KKBNA636-05 UWBM 61560 29-Jul-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Gelochelidon nilotica BNAUS KKBNA705-05 UWBM 56832 22-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan` Gygis alba BROM BROM105-06 X8557 United States, Hawaii Gygis alba BROM BROM414-06 C1066 06-Nov-1996 Saint Helena, Ascension Is Hydroprogne caspia SWEBI BISE076-07 BISE-Aves91 06-May-1999 Sweden, Blekinge, Vierydsfjaerden mellan Ronneby och Karlshamn Hydroprogne caspia SWEBI BISE477-08 BISE-Aves497 Sweden Hydroprogne caspia SWEBI BISE478-08 BISE-Aves498 Sweden Hydroprogne caspia AROM BROM008-06 AJB 6101 26-Mar-1996 Australia, W. Australia, Wader Beach, Broome Bird Observatory Hydroprogne caspia AROM BROM025-06 DL396 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Hydroprogne caspia AROM BROM042-06 CASPT 1 04-Dec-1989 New Zealand, Auckland, North Auckland, Mangawhai, North Is Hydroprogne caspia AROM BROM097-06 1B-4127 16-May-2003 Canada, Ontario, Lennox and Addington Co, Bath Hydroprogne caspia BNAUS KKBNA158-04 CWSL98-80256- 21-May-1998 United States, Michigan, GLH, Channel Shelter Isl. 00-01 Hydroprogne caspia BNAUS KKBNA159-04 CWSL98-80263- 11-Jun-1998 Canada, Ontario, GLH, Elm Island, N.Channe 00-01 Hydroprogne caspia TZBNA TZBNA318-03 1B-2959 Canada, Ontario Larosterna inca BROM BROM092-06 234220 Larosterna inca BROM BROM093-06 234198 Onychoprion aleuticus BROM BROM102-06 JK9404 United States, Minnesota Onychoprion aleuticus BEPAL KBPBU340-06 UWBM 47320 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun'skiy Zaliv Onychoprion aleuticus BNAUS KKBNA286-05 UWBM 46989 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun`skiy Zaliv Onychoprion aleuticus BNAUS KKBNA654-05 UWBM 47321 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun`skiy Zaliv Onychoprion aleuticus BNAUS KKBNA655-05 UWBM 47323 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun`skiy Zaliv Onychoprion aleuticus BNAUS KKBNA656-05 UWBM 47324 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun`skiy Zaliv Onychoprion aleuticus BNAUS KKBNA657-05 UWBM 47325 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun`skiy Zaliv Onychoprion anaethetus BNAUS BOTW411-05 FMNH 385750 United States, Florida, Monroe Co, Upper Keys Onychoprion anaethetus BNAUS BOTW412-05 FMNH 385751 United States, Florida, Monroe Co, Upper Keys, .5 mi off shore Onychoprion anaethetus BROM BROM007-06 AJB 5615 25-Nov-1990 Australia, W. Australia, Penguin Is, Perth Onychoprion anaethetus AAPR CDAMH103-05 AMNH-DOT6552 25-Jun-1995 Solomon Islands, Rennell Island, Tahatmatangi, TG NEGANO Onychoprion fuscatus BNAUS BOTW262-05 USNM 614223 29-Aug-1991 Onychoprion fuscatus BROM BROM052-06 AJB 5625 Australia, Onychoprion fuscatus BROM BROM098-06 B-41340

Appendix 1 Part 2: Lari Specimens 131

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Onychoprion fuscatus BROM BROM099-06 B-41339 Onychoprion fuscatus BROM BROM100-06 X8265 Onychoprion fuscatus BNAUS CDUSM026-05 B08881 08-Jan-1997 JOHNSTON ISLAND, Onychoprion lunatus BROM BROM101-06 BMNH 44973 United States, Hawaii Phaetusa simplex BROM BROM018-06 J14864 02-May-1999 Brazil, Rio Grande do Sul, Lagoa do Peixe Phaetusa simplex BROM BROM035-06 L50140 01-May-1999 Brazil, Rio Grande do Sul, Lagoa do Peixe Phaetusa simplex BROM BROM437-06 L50141 01-May-1999 Brazil, Rio Grande do Sul, Lagoa do Peixei Phaetusa simplex BARG KBAR858-06 MACN-Or-ct 1619 08-May-2006 Argentina, Corrientes, Estancia "Relatz", Estero Valenzuela Sterna dougallii BROM BROM083-06 44190 United States, Massachusetts Sterna forsteri BNAUS BOTW169-04 USNM 626468 United States, Florida, Bay, Tyndall Air Force Base Sterna forsteri BROM BROM088-06 44052 United States, Minnesota Sterna forsteri BNAUS KBNA630-04 CWS36881 08-Jul-1986 Canada, Manitoba, Duck Bay Sterna hirundinacea BROM BROM016-06 Sth001 24-Mar-1997 Argentina, Buenos Aires, Punta Rasa, San Clemente Sterna hirundo SWEBI BISE184-08 BISE-Aves178 02-Sep-2004 Sweden, Oland, Ottenby Sterna hirundo SWEBI BISE283-08 BISE-Aves289 01-Jan-2001 Sweden, Stockholm, Maersta, Arlanda, Arlanda airport Sterna hirundo NORBI BON343-07 NHMO-BC343 26-Jun-2006 Norway, Oslo, Mokkalassene, Snaroya Sterna hirundo NORBI BON352-07 NHMO-BC352 16-Jun-2006 Norway, Ostfold, Ogderen Sterna hirundo BROM BROM010-06 H40486 01-May-1999 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Sterna hirundo BROM BROM034-06 RCA 88-11 26-May-1988 Canada, Alberta Sterna hirundo BROM BROM044-06 PR0200205 24-Mar-1997 Argentina, Buenos Aires, Punta Rasa, San Clemente Sterna hirundo BROM BROM045-06 MKP 1366 30-Nov-1991 South Africa, Western Cape, Velddrif Sterna hirundo BROM BROM046-06 H23931 12-Apr-1997 Brazil, Para, Salinas Sterna hirundo BROM BROM457-06 MKP 1367 30-Nov-1991 South Africa, Western Cape, Velddrif Sterna hirundo BROM BROM850-07 AJB 6150 02-Apr-1996 Australia, W. Australia, 80 Mile Beach, 24 km from camp Sterna hirundo BROM BROM851-07 DL406 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Sterna hirundo BEPAL KBPBU341-06 UWBM 56582 22-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Sterna hirundo BEPAL KBPBU342-06 UWBM 44308 22-Jul-1992 Russia, Kamchatka, KoYa. A. Red'kinki Sterna hirundo BEPAL KBPBU343-06 UWBM 61055 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Sterna hirundo BEPAL KBPBU345-06 UWBM 59703 22-May-1998 Mongolia, Dornod, Dornod Aymag, Halhin Gol, Burkhan Sterna hirundo BNAUS KKBNA909-05 ROM RCA 88-10 Canada, Alberta Sterna hirundo BNAUS KKBNA910-05 ROM RCA 88-9 Canada, Alberta Sterna paradisaea SWEBI BISE147-08 BISE-Aves75 08-Aug-1999 Sweden, Oland, Groenhoegens camping Sterna paradisaea SWEBI BISE345-08 BISE-Aves358 30-Jul-2004 Sweden, Oland, Ottenby Sterna paradisaea NORBI BON171-07 NHMO-BC171 09-Jul-2005 Norway, Troms, Langnes Flyplass Sterna paradisaea NORBI BON172-07 NHMO-BC172 09-Jul-2005 Norway, Troms, Langnes Flyplass Sterna paradisaea BROM BROM013-06 DL380 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife

Appendix 1 Part 2: Lari Specimens 132

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Sterna paradisaea BROM BROM853-07 DL375 30-Jul-1996 Canada, NWT, Mackenzie Region, Great Slave Lake, Yellowknife Sterna paradisaea BNAUS KBNA506-04 ARCT003 Canada, Manitoba, Churchill Sterna paradisaea BEPAL KBPBU347-06 UWBM 49683 07-Jul-1994 Russia, Murmanskaya Oblast, Teriberka Sterna paradisaea BEPAL KBPBU348-06 UWBM 49713 07-Oct-1994 Russia, Murmanskaya Oblast, Teriberka Sterna paradisaea BEPAL KBPBU350-06 UWBM 59528 06-Apr-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Sterna paradisaea TZBNA TZBNA143-03 MKP 795 Canada, Nunavut, Resolute Bay, Cornwallis Is Sterna striata BROM BROM014-06 WFT 001 01-Dec-1992 New Zealand, Marlborough, Kaikoura, South Is Sterna striata BROM BROM082-06 BFT 01-Jan-1995 New Zealand, North Island Sterna sumatrana BROM BROM084-06 346066 Micronesia Sterna sumatrana BROM BROM085-06 346067 Micronesia Sterna trudeaui BROM BROM015-06 J14824 30-Apr-1999 Brazil, Rio Grande do Sul, Lagoa do Peixe Sterna trudeaui BROM BROM050-06 L48162 22-Apr-1999 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Sterna trudeaui BARG KAARG034-07 MACN-Or-ct 301 01-Dec-2004 Argentina Sterna trudeaui BARG KAARG035-07 MACN-Or-ct 302 01-Dec-2004 Argentina Sterna vittata BROM BROM086-06 B-9899 Sterna vittata BROM BROM087-06 B-9905 Sternula albifrons SWEBI BISE173-08 BISE-Aves163 02-Jul-1995 Sweden, Halland, Varbergs hamn, Varbergs hamn Sternula albifrons SWEBI BISE455-08 BISE-Aves486 24-Jun-2007 Sweden, Skane, Eskiltorps aengar, Vellinge kommun, Vellinge Sternula albifrons NORBI BON359-07 NHMO-BC359 03-Aug-2006 Sweden, Falsterbo, Nabben Sternula albifrons AROM BROM005-06 AJB 6073 24-Mar-1996 Australia, W. Australia, Quarry Beach, Broome Bird Observatory Sternula albifrons AROM BROM021-06 LETE 001 14-Jul-2005 United Kingdom, England, Norfolk, Greater Yarmouth, North Beach Sternula albifrons AROM BROM022-06 LETE 002 14-Jul-2005 United Kingdom, England, Norfolk, Greater Yarmouth, North Beach Sternula albifrons AROM BROM023-06 LETE 003 14-Jul-2005 United Kingdom, England, Norfolk, Greater Yarmouth, North Beach Sternula albifrons AROM BROM024-06 SBB 011 31-Mar-1991 Australia, W. Australia, Broome Beach Sternula albifrons AROM BROM041-06 SBB 043 10-Mar-1994 Australia, W. Australia, Port Hedland Sternula albifrons AROM BROM252-06 SBB 049 10-Mar-1994 Australia, W. Australia, Broome Beach Sternula albifrons BEPAL KBPBU338-06 UWBM 61048 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Sternula albifrons BEPAL KBPBU339-06 UWBM 61049 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Sternula antillarum BNAUS BOTW187-04 USNM B15103 United States, Florida Sternula antillarum BNAUS BOTW292-05 USNM 622469 03-Jun-1990 United States, California, San Diego, Camp Pendleton Sternula antillarum AROM BROM103-06 B-8423 United States Sternula antillarum AROM BROM104-06 B-8424 United States, Louisiana Sternula nereis BROM BROM051-06 2326 , Sternula superciliaris AROM BROM032-06 G29504 15-Apr-1997 Brazil, Para, Northern Brazil, Salinas Sternula superciliaris AROM BROM040-06 G37754 01-May-1999 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Sternula superciliaris AROM BROM459-06 G29502 15-Apr-1997 Brazil, Para, Salinas

Appendix 1 Part 2: Lari Specimens 133

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Sternula superciliaris BARG KBARG003-07 MACN-Or-ct 1768 22-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Sternula superciliaris BARG KBARG054-07 MACN-Or-ct 1782 28-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Thalasseus bengalensis BROM BROM017-06 AJB6104 26-Mar-1996 Australia, W. Australia, Wader Beach, Broome Bird Observatory Thalasseus bengalensis BROM BROM849-07 AJB 6106 26-Mar-1996 Australia, W. Australia, Wader Beach, Broome Bird Observatory Thalasseus bergii BROM BROM020-06 AJB 5621 08-Jan-1990 Australia, New South Wales, Broken Head Nature Reserve Thalasseus bergii BROM BROM038-06 MKP 2246 27-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains Thalasseus bergii BROM BROM039-06 AJB 6102 26-Mar-1996 Australia, W. Australia, Wader Beach, Broome Bird Observatory Thalasseus elegans AROM BROM091-06 B-5788 Mexico, Baja California Sur Thalasseus elegans BNAUS KKBNA628-05 UWBM 62056 13-Aug-1992 United States, Washington, Grays Harbor, Westport, Grays Harbor Thalasseus elegans BNAUS KKBNA629-05 UWBM 70559 13-Aug-1992 United States, Washington, Grays Harbor, Westport, Grays Harbor Thalasseus elegans BNAUS KKBNA630-05 UWBM 62055 13-Aug-1992 United States, Washington, Grays Harbor, Westport, Grays Harbor Thalasseus elegans BNAUS KKBNA631-05 UWBM 70561 13-Aug-1992 United States, Washington, Grays Harbor, Westport, Grays Harbor Thalasseus elegans BNAUS KKBNA632-05 UWBM 70560 13-Aug-1992 United States, Washington, Grays Harbor, Westport, Grays Harbor Thalasseus maximus BROM BROM011-06 N07418 02-Apr-1997 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Thalasseus maximus BROM BROM030-06 N07420 02-Apr-1997 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Thalasseus maximus BROM BROM031-06 N07421 02-Apr-1997 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Thalasseus maximus BNAUS CDUSM028-05 B16595 30-Apr-2001 United States, Florida, BAY, Crooked Island East, Tyndall AFB Thalasseus maximus BNAUS CDUSM029-05 B16596 30-Apr-2001 United States, Florida, BAY, Crooked Island East, Tyndall AFB Thalasseus maximus BNAUS CDUSM095-05 B16597 30-Apr-2001 United States, Florida, BAY, Crooked Island East, Tyndall AFB Thalasseus maximus BARG KAARG017-07 MACN-Or-ct 186 01-Dec-2004 Argentina Thalasseus maximus BARG KAARG018-07 MACN-Or-ct 187 01-Dec-2004 Argentina Thalasseus maximus BNAUS KKBNA470-05 UWBM 73818 08-Sep-2001 United States, North Carolina, Carteret, Bogue Sound Thalasseus sandvicensis SWEBI BISE157-08 BISE-Aves120 19-Aug-2001 Sweden, Skane, Falsterbo, Maklaeppen, Maklaeppen Thalasseus sandvicensis NORBI BON363-07 NHMO-BC363 28-Aug-2006 Sweden, Falsterbo, Skanoers revlar Thalasseus sandvicensis BNAUS BOTW298-05 USNM 622556 23-Apr-2001 United States, Florida, Hillsborough, Macdill Afb Thalasseus sandvicensis AROM BROM009-06 G12328 15-Apr-1997 Brazil, Para, Northern Brazil, Salinas, (Belem) Thalasseus sandvicensis AROM BROM043-06 L34941 02-Apr-1997 Brazil, Rio Grande do Sul, Southern Brazil, Lagoa do Peixe Thalasseus sandvicensis AROM BROM089-06 B-8445 United States, Louisiana Thalasseus sandvicensis AROM BROM090-06 B-8458 United States, Louisiana Thalasseus sandvicensis BNAUS CDUSM031-05 B16533 23-Apr-2001 United States, FL, Hillsborough, MacDill AFB, Bayshore Blvd; shore Thalasseus sandvicensis BNAUS CDUSM096-05 B16535 23-Apr-2001 United States, FL, Hillsborough, MacDill AFB, Bayshore Blvd; shore Thalasseus sandvicensis BARG KAARG013-07 MACN-Or-ct 167 01-Dec-2004 Argentina Thalasseus sandvicensis BARG KAARG014-07 MACN-Or-ct 168 01-Dec-2004 Argentina Thalasseus sandvicensis BNAUS KKBNA229-05 USNM 626542 23-Apr-2001 United States, FL, Hillsborough, MacDill AFB, Bayshore Blvd; shore Thalasseus sandvicensis BNAUS KKBNA472-05 UWBM 73832 22-Sep-2002 United States, LA, St. Mary`s, Morgan City, Atchafalaya River delta Thalasseus sandvicensis BEPAL KKBNA532-05 UWBM 61053 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya

Appendix 1 Part 2: Lari Specimens 134

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Thalasseus sandvicensis BEPAL KKBNA533-05 UWBM 61054 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Thalasseus sandvicensis BNAUS KKBNA768-05 UWBM 73836 22-Sep-2002 United States, LA, St. Mary`s, Morgan City, Atchafalaya River delta

Appendix 1 Part 3: Scolopaci Specimens 135

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Part 3: Scolopaci Specimens

Jacanidae Actophilornis africanus BROM BROM374-06 MKP 1455 13-Dec-1991 South Africa, KwaZulu-Natal, Sea Cow L., Durban, Sewage Works Actophilornis africanus BROM BROM375-06 MKP 1462 15-Dec-1991 South Africa, KwaZulu-Natal, Nhlabane Lake Actophilornis africanus BROM BROM473-07 AJB 3587 01-Apr-1982 South Africa, Transvaal Actophilornis africanus BROM BROM474-07 MKP 1456 13-Dec-1991 South Africa, KwaZulu-Natal, Sea Cow L., Durban, Sewage Works Irediparra gallinacea BROM BROM421-06 LSUMZ B-14046 Australia, Comb Creek Irediparra gallinacea BROM BROM422-06 LSUMZ B-14044 Australia, Comb Creek Jacana jacana AROM BROM240-06 L51904 Brazil, Para, Salinas Jacana jacana AROM BROM241-06 L51905 Brazil, Para, Salinas Jacana jacana AROM BROM423-06 L51903 15-Apr-1997 Brazil, Para, Salinas Jacana jacana BARG KBAR525-06 MACN-Or-ct 1455 28-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes Jacana jacana BARG KBAR902-06 MACN-Or-ct 1675 22-May-2006 Argentina, Corrientes, Estacion biologica de Corrientes Jacana jacana AAPR KKBNA035-04 CWS35608 16-Oct-1984 Panama, PARIS Jacana spinosa BNAUS KKBNA198-05 USNM 608114 20-Jul-1996 Panama, Bocas Del Toro, 4 Km W Chiriqui Grande Jacana spinosa BNAUS KKBNA852-05 MCZ 335881 18-Jun-2001 Costa Rica, Guanacaste, Santa Elena

Pedionomidae Pedionomus torquatus BROMB BROMB857-07 MKP 2685 28-Nov-1995 Australia, New South Wales, 20 km S Hay Pedionomus torquatus BROMB BROMB858-07 MKP 2687 28-Nov-1995 Australia, New South Wales, 20 km S Hay

Rostratulidae Rostratula australis AROMC BROM694-07 81483 28-Mar-2000 Australia, W. Australia, Roebuck Plains (near Broome) Rostratula australis AROMC BROM695-07 81484 28-Mar-2000 Australia, W. Australia, Roebuck Plains (near Broome) Rostratula australis AROMC BROM696-07 81485 28-Mar-2000 Australia, W. Australia, Roebuck Plains (near Broome) Rostratula australis AROMC BROM697-07 81486 28-Mar-2000 Australia, W. Australia, Roebuck Plains (near Broome) Rostratula australis AROMC BROM698-07 81487 28-Mar-2000 Australia, W. Australia, Roebuck Plains (near Broome) Rostratula australis AROMC BROM699-07 81488 28-Mar-2000 Australia, W. Australia, Roebuck Plains (near Broome) Rostratula benghalensis AROMC BROM451-06 MKP 1478 20-Mar-1987 South Africa, KwaZulu-Natal, Kelso Rostratula semicollaris AROMC BROM435-06 H32376 03-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixei Rostratula semicollaris AROMC BROM436-06 H29747 06-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixei Rostratula semicollaris BARG KBAR564-06 MACN-Or-ct 1517 30-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes (Arrocera) Rostratula semicollaris BARG KBAR566-06 MACN-Or-ct 1519 30-Apr-2006 Argentina, Corrientes, Estacion biologica de Corrientes (Arrocera) Rostratula semicollaris BARG KBAR585-06 MACN-Or-ct 1545 01-May-2006 Argentina, Corrientes, Estacion biologica de Corrientes (Arrocera)

Appendix 1 Part 3: Scolopaci Specimens 136

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Scolopacidae Actitis hypoleucos SWEBI BISE144-08 BISE-Aves42 29-Apr-1998 Sweden, Stockholm, Up., Bjoerkoe, Arholma, Simpnaes, Simpnaes Actitis hypoleucos SWEBI BISE400-08 BISE-Aves418 01-May-1999 Sweden, Varmland, Vitsand, Vitsand Actitis hypoleucos NORBI BON017-06 NHMO-BC17 02-Aug-1966 Norway, Finnmark, Porsanger Actitis hypoleucos NORBI BON275-07 NHMO-BC275 05-Jul-2001 Norway, Oppland, Ovre Heimdalen Actitis hypoleucos AROM BROM053-06 MKP 1460 12-Dec-1991 South Africa, KwaZulu-Natal, Sea Cow L., Durban, Sewage Works Actitis hypoleucos AROM BROM054-06 COSA 57 12-Jul-1994 Russia, Chukotskiy Aut. Okrug, Anadyr River Actitis hypoleucos AROM BROM055-06 MKP 1361 30-Nov-1991 South Africa, Western Cape, Velddrif Actitis hypoleucos AROM BROM056-06 COSA 55 04-Jul-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Actitis hypoleucos KBBI KBBI087-07 KRIBB 1235 South Korea, North Ch`ungch`ong Actitis hypoleucos BEPAL KBPBU259-06 UWBM 49579 24-Jun-1994 Russia, Moscovskaya Oblast, along Klyaz'ma river, Kosterevo Actitis hypoleucos BEPAL KBPBU260-06 UWBM 43824 26-Jun-1992 Russia, Magadanskaya O., Magadan, near mouth of Oroholyndja R Actitis hypoleucos BEPAL KBPBU261-06 UWBM 46623 23-Jun-1993 Russia, Buryatia, Ust-Barguzin, shore of Ozero Baykal Actitis hypoleucos BEPAL KBPBU262-06 UWBM 46392 17-May-1993 Kazakhstan, Almaty Oblysy, Akkol' Actitis hypoleucos BEPAL KBPBU263-06 UWBM 60137 30-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Actitis hypoleucos AAPR KKBNA178-05 USNM 613020 05-May-1989 Philippines, Luzon, Cagayan, Sitio Hot Springs, Barrio Via, Baggao Actitis macularius BNAAS BABNA421-07 TLBS 181160413 10-Jun-2006 Canada, Yukon Territory, Teslin Lake, Teslin Lake Bird Banding Stn Actitis macularius BNAAS BABNA422-07 TLBS 181160415 11-Jun-2006 Canada, Yukon Territory, Teslin Lake, Teslin Lake Bird Banding Stn Actitis macularius BNAUS BOTW059-04 USNM 626396 United States, Florida, Hillsborough, Macdill Air Force Base Actitis macularius AROM BROM057-06 JAD 7485 03-Jun-1986 Canada, Ontario, Parry Sound dist, 1.5 km W Ardbeg Actitis macularius AROM BROM058-06 G13813 11-Apr-1997 Brazil, Para, Salinas Actitis macularius AROM BROM059-06 MKP 465 10-Mar-1988 United States, Florida, Collier Co, Marco Is Actitis macularius BNAUS KBNA697-04 MCLR-SPSA-32 Canada, Alberta, Yellowhead County, Whitehorse Creek, Cadomin Actitis macularius BNAUS KBNA698-04 MCLR-SPSA-33 Canada, Alberta, Yellowhead County, Whitehorse Creek, Cadomin Actitis macularius BNAUS KBNA699-04 MCLR-SPSA-34 Canada, Alberta, Yellowhead County, McCleod R/Prospect Creek Actitis macularius TZBNA TZBNA131-03 JGS 1881 United States, Alaska Actitis macularius TZBNA TZBNA140-03 JAD 7476 Canada, Ontario, Nottawa Aphriza virgata BROM BROM536-07 JGS 2204 01-May-1987 United States, Alaska Aphriza virgata TZBNA TZBNA088-03 JGS 2197 United States, Alaska Aphriza virgata TZBNA TZBNA161-03 JGS 2198 United States, Alaska Arenaria interpres SWEBI BISE200-08 BISE-Aves202 01-Aug-2000 Sweden, Oland, Ottenby birdstation Arenaria interpres SWEBI BISE323-08 BISE-Aves331 01-Aug-2000 Sweden, Oland, Ottenby birdstation Arenaria interpres NORBI BON092-06 NHMO-BC92 08-Jul-2004 Norway, Finnmark, Vardo Arenaria interpres NORBI BON222-07 NHMO-BC222 15-Jul-2005 Norway, Finnmark, Barvikmyra Arenaria interpres BNAUS BOTW060-04 USNM 622548 United States, Florida, Hillsborough, Macdill Air Force Base

Appendix 1 Part 3: Scolopaci Specimens 137

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Arenaria interpres BROM BROM274-06 131350797 01-Jun-1990 Canada, Nunavut, Baffin Region, Alert, Ellesmere Is Arenaria interpres BROM BROM275-06 MKP 808 09-Dec-1989 New Zealand, N. Auckland, The Bluff, Ninety Mile Beach, North Is Arenaria interpres BROM BROM276-06 RWS 117 01-Jan-1990 Norway, Finnmark Arenaria interpres BROM BROM277-06 TP8 05-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova Arenaria interpres BROM BROM710-07 MKP 1431 09-Dec-1991 Namibia, Swakopmund, Walvis Bay Arenaria interpres BROM BROM711-07 MKP 1558 14-Jun-1992 United States, Alaska, North Slope, Barrow Arenaria interpres TZBNA HCBR176-04 AJB 6154 02-Apr-1996 Australia, 80 mile beach Arenaria interpres TZBNA HCBR177-04 9822-03089 09-Jul-1999 Canada, Nunavut, Bay of God`s Mercy, South Hampton Is Arenaria interpres BEPAL KBPBU194-06 UWBM 43962 13-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Arenaria interpres BEPAL KBPBU195-06 UWBM 44093 08-May-1992 Russia, Magadanskaya Oblast, Balagannoye, near mouth of Tauy R Arenaria interpres BEPAL KBPBU196-06 UWBM 51166 17-Sep-1994 Russia, Primorskiy Kray, Kiyevka, Melkovodnoe Zaliv Arenaria interpres BEPAL KBPBU197-06 UWBM 44328 25-Jul-1992 Russia, Kamchatka, Oktyabr'skiy, Arenaria interpres TZBNA TZBNA400-03 gi21593906 Canada Arenaria melanocephala BROM BROM168-06 JGS 2232 01-May-1987 United States, Alaska Arenaria melanocephala BROM BROM619-07 JGS 1858 01-Jun-1985 United States, Alaska Arenaria melanocephala TZBNA TZBNA213-03 MKP 1525 United States, Alaska, Chevak Bartramia longicauda BROM BROM385-06 1B-249 01-Jul-1990 Canada, Ontario, Peel RM, Lester B Pearson International Airport Bartramia longicauda BROM BROM386-06 JGS 2003 01-Jun-1985 United States, Alaska Bartramia longicauda BROM BROM387-06 RCA 87-285 01-Jun-1987 Canada, Alberta Bartramia longicauda BNAUS CDLSU015-05 LSU4038 01-Sep-1987 United States, Louisiana, Cameron Parish, Hackberry Ridge Bartramia longicauda TZBNA TZBNA113-03 JGS 1767 United States, Texas Bartramia longicauda TZBNA TZBNA122-03 RCA 87-280 Canada, Alberta Calidris acuminata BROM BROM278-06 MKP 2165 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Calidris acuminata BROM BROM279-06 MKP 221 05-Dec-1985 Australia, Victoria, Corinella Pen Calidris acuminata BROM BROM280-06 MKP 2223 23-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains, North Marsh Calidris acuminata BROM BROM281-06 MKP 271 12-Dec-1985 Australia, Queensland, Lytton, Brisbane Calidris alba SWEBI BISE203-08 BISE-Aves205 01-Aug-2000 Sweden, Oland, Ottenby birdstation Calidris alba NORBI BON357-07 NHMO-BC357 02-Aug-2006 Sweden, Falsterbo, Nabben Calidris alba BNAUS BOTW049-04 USNM 626544 United States, Florida, Hillsborough, Macdill Air Force Base Calidris alba BROM BROM282-06 2SAN6 02-Jul-2002 Canada, Nunavut, Keewatin Region, Southampton Is Calidris alba BROM BROM283-06 MKP 1430 09-Dec-1991 Namibia, Swakopmund, Walvis Bay Calidris alba BROM BROM284-06 H105175 05-Aug-1997 Netherlands, Waddenzee Calidris alba BROM BROM285-06 TP44 26-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova Calidris alba BROM BROM719-07 12778 04-Dec-2000 Argentina, Tierra del Fuego, Rio Grande Calidris alba BROM BROM720-07 1B-3240 03-Jun-1999 United States, New Jersey, Cape May Co, Tolz Beach, Cape May Calidris alba BROM BROM721-07 SAND 42 04-Jul-1992 Russia, Krasnoyarskiy Kray, Taymyr Aut Okrug, N Taymyr Pen

Appendix 1 Part 3: Scolopaci Specimens 138

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Calidris alba BEPAL KBPBU214-06 UWBM 44650 08-May-1992 Russia, Magadanskaya Oblast, Balagannoye, near mouth of Tauy R Calidris alba BEPAL KBPBU215-06 UWBM 59596 06-Dec-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Calidris alba BEPAL KBPBU216-06 UWBM 61347 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Calidris alba BEPAL KBPBU217-06 UWBM 61348 29-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Calidris alba TZBNA TZBNA097-03 JGS 1689 United States, Texas Calidris alba TZBNA TZBNA106-03 RCA 87-158 Canada, Saskatchewan Calidris alpina SWEBI BISE163-08 BISE-Aves139 15-May-1996 Sweden, Halland, Varberg, Bua, Batafjorden, Batafjorden Calidris alpina SWEBI BISE363-08 BISE-Aves378 12-Aug-2005 Sweden, Oland, Ottenby birdstation Calidris alpina NORBI BON193-07 NHMO-BC193 26-Jun-2005 Norway, Rogaland, Holmavatnet, Hogjaeren Calidris alpina NORBI BON194-07 NHMO-BC194 03-Jul-2005 Norway, Oppland, Sanddalen Calidris alpina BNAUS BOTW050-04 USNM 626403 United States, Florida, Hillsborough, Macdill Air Force Base Calidris alpina BROM BROM286-06 MKP 1579 16-Jul-1992 Iceland, South Iceland, Stokkseyri Calidris alpina BROM BROM287-06 MKP 1584 16-Jul-1992 Iceland, Stokkseyri Calidris alpina BROM BROM288-06 DUNL164 21-Jun-1991 Norway, Finnmark, Gamvik, Slettnes Calidris alpina BROM BROM289-06 GD23 Poland, Gdansk Prov, Gdansk Calidris alpina BROM BROM290-06 IC26 03-Jul-1992 Russia, Yamal Nenets Aut Okrug, North Yamal Pen, Siberia Calidris alpina BROM BROM291-06 PP05 02-Jul-1992 Russia, Taymyr Aut Okrug, Lena River Delta Calidris alpina BROM BROM292-06 PT25 19-Jun-1992 Russia, Chukchi Aut Okrug, Anadyr coast, Siberia Calidris alpina BROM BROM293-06 PT26 10-Jul-1992 Russia, Chukchi Aut Okrug, Anadyr coast, Siberia Calidris alpina BROM BROM294-06 PT31 27-May-1990 Russia, Kamchatka Pen Calidris alpina BROM BROM295-06 SAR 6563 18-Jul-1993 Russia, Sakhalinskaya Oblast, Sakhalin Is, Nabilsky Bay Calidris alpina BROM BROM296-06 VN01 02-Jul-1991 Russia, Nenets Aut Okrug, Waigach Is=Vaygach Is Calidris alpina BROM BROM297-06 168188046 19-May-1999 United States, Delaware, Delaware Bay Calidris alpina BROM BROM298-06 168188094 25-May-1999 United States, Delaware, Delaware Bay Calidris alpina BROM BROM299-06 JGS 1860 02-May-1985 United States, AK, Whitshed Point, 9 mi SW Cordova Calidris alpina BROM BROM300-06 MKP 1514 06-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak Calidris alpina BROM BROM301-06 MKP 1543 12-Jun-1992 United States, Alaska, North Slope, Barrow Calidris alpina TZBNA HCBR154-03 MKP 2377 Canada, Manitoba, Churchill, Calidris alpina BEPAL KBPBU203-06 UWBM 49659 07-Jun-1994 Russia, Murmanskaya Oblast, Teriberka Calidris alpina BEPAL KBPBU204-06 UWBM 51106 09-Dec-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Calidris alpina TZBNA TZBNA115-03 JGS 1851 United States, Alaska Calidris bairdii BROM BROM302-06 AJB 4429 29-Nov-1984 Argentina, Tierra del Fuego, Estancia Violeta, Rio Grande Calidris bairdii BROM BROM303-06 AJB 5512 24-Jul-1989 Canada, Nunavut, Baffin Region, Clyde River, Baffin Is Calidris bairdii BROM BROM304-06 MKP 787 13-Jul-1989 Canada, Nunavut, Baffin Region, Pond Inlet, Baffin Is Calidris bairdii BROM BROM305-06 RCA 88-15 27-May-1988 Canada, Alberta Calidris bairdii BROM BROM306-06 MKP 1555 14-Jun-1992 United States, Alaska, North Slope, Barrow

Appendix 1 Part 3: Scolopaci Specimens 139

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Calidris bairdii BARG KAARG352-07 MACN-Or-ct 3039 28-Jan-2007 Argentina, Chubut, 30 km E San Martin, Ruta 25 Calidris bairdii BARG KBAR463-06 MACN-Or-ct 1277 17-Nov-2005 Argentina, Catamarca, Embalse Cortaderas Calidris bairdii BARG KBAR467-06 MACN-Or-ct 1295 13-Nov-2005 Argentina, Catamarca, Ca. La Gruta Calidris bairdii BARG KBAR475-06 MACN-Or-ct 1318 18-Nov-2005 Argentina, Catamarca, W of Pastos Largos Calidris bairdii TZBNA TZBNA111-03 RCA 88-7 Canada, Alberta Calidris bairdii TZBNA TZBNA124-03 JPM 2161 United States, California Calidris canutus SWEBI BISE180-08 BISE-Aves170 16-Aug-2004 Sweden, ship from Germany Calidris canutus SWEBI BISE378-08 BISE-Aves394 01-Aug-1996 Sweden, Ostergotland, MALEXANDER, SOMMEN, MALEXANDER Calidris canutus NORBI BON373-07 NHMO-BC373 18-May-2006 Norway, Troms, Langnes Flyplass Calidris canutus NORBI BON374-07 NHMO-BC374 18-May-2006 Norway, Troms, Langnes Flyplass Calidris canutus BNAUS BOTW061-04 USNM 626409 United States, Florida, Hillsborough, Macdill Air Force Base Calidris canutus BROM BROM307-06 AML 72 22-Dec-1983 Argentina, Tierra del Fuego, Rio Grande Calidris canutus BROM BROM308-06 AJB 6067 24-Mar-1996 Australia, W. Australia, Quarry Beach, Broome Bird Observatory Calidris canutus BROM BROM309-06 MKP 2130 18-Mar-1994 Australia, W. Australia, Broome Beach Calidris canutus BROM BROM310-06 MKP 245 11-Dec-1985 Australia, Queensland, Lytton, Brisbane Calidris canutus BROM BROM311-06 9822-03302 13-Jul-2001 Canada, Nunavut, Keewatin Region, Southampton Is Calidris canutus BROM BROM312-06 GM EK-119 01-Jun-1987 Canada, Nunavut, Baffin Region, Alert, Ellesmere Is Calidris canutus BROM BROM314-06 K401641 21-May-1997 Netherlands, Friesland, Texel Is, West Frisian Is, Waddenzee Calidris canutus BROM BROM315-06 K-410 15-Oct-1988 Netherlands, Friesland, Schiermonnikoog Is, West Frisian Is Calidris canutus BROM BROM316-06 MKP 807 08-Dec-1989 New Zealand, North Auckland Prov. Calidris canutus BROM BROM317-06 REKN 62 17-Jun-1991 Russia, Taymyr Aut Okrug, N Taymyr Pen Calidris canutus BROM BROM318-06 TP4 08-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova 1B-4583; 1172- Calidris canutus BROM BROM319-06 76552 31-Dec-2005 United States, Florida, Manatee Co, Longboat Key, Seahorse Resort Calidris canutus BEPAL KBPBU218-06 UWBM 43967 14-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Calidris canutus BEPAL KBPBU219-06 UWBM 43968 14-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Calidris canutus BEPAL KBPBU220-06 UWBM 44173 08-Mar-1992 Russia, Magadanskaya Oblast, Balagannoye, near mouth of Tauy R Calidris canutus TZBNA TZBNA133-03 YA 9 Canada, Quebec, Pointe-au-Loups, i1/2es de la Madeleine Calidris ferruginea SWEBI BISE171-08 BISE-Aves161 25-Jul-2003 Sweden, Orebro, Oerebro, Kvismaren, Kvismaren, Kaellviken Calidris ferruginea SWEBI BISE324-08 BISE-Aves332 01-Aug-2000 Sweden, Oland, Ottenby birdstation Calidris ferruginea NORBI BON473-07 NHMO-BC476 28-Aug-2006 Sweden, Falsterbo, Skanoers revlar Calidris ferruginea BROM BROM321-06 041 93666 11-Sep-1998 Australia, W. Australia, 80 Mile Beach Calidris ferruginea BROM BROM322-06 MKP 237 09-Dec-1985 Australia, Victoria, Corinella Pen, Western Port Bay Calidris ferruginea BROM BROM323-06 TP11 04-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova Calidris ferruginea BROM BROM324-06 MKP 1343 29-Nov-1991 South Africa, Western Cape, Velddrif Calidris ferruginea BROM BROM455-06 CS 1 27-Jan-1987 South Africa, Western Cape, Lamberts Bay, Saldanha Bay Calidris ferruginea BROM BROM456-06 CS 2 30-Nov-1991 South Africa, Western Cape, Lamberts Bay, Saldanha Bay

Appendix 1 Part 3: Scolopaci Specimens 140

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Calidris ferruginea BEPAL KBPBU781-06 UWBM 73192 16-Jul-2002 Russia, Buryatia, Kabanskiy Rayon, Mursino, Ulan-Ude Calidris fuscicollis BNAUS BOTW051-04 USNM 587310 Guyana, West Bank Upper Essequibo River Calidris fuscicollis BROM BROM325-06 YA-11816 02-Dec-2000 Argentina, Tierra del Fuego, Rio Grande Calidris fuscicollis BROM BROM326-06 MKP 789 17-Jul-1989 Canada, Nunavut, Baffin Region, Pond Inlet, Baffin Is Calidris fuscicollis BROM BROM327-06 YA 40 26-Aug-1983 Canada, Qc, Iles-de-la-Madeleine, Fatima, Iles du Cap-aux-Meules Calidris fuscicollis BROM BROM622-07 SH99-001 11-Jul-1999 Canada, Nunavut, Bay of God's Mercy, Southampton Is Calidris fuscicollis BROM BROM623-07 811-36600 09-Jul-1999 Canada, Nunavut, Bay of God's Mercy, Southampton Is Calidris fuscicollis TZBNA TZBNA142-03 JGS 1997 United States, Nebraska, 5 mi ENE York Calidris fuscicollis TZBNA TZBNA151-03 JAD 7252 Canada, Ontario, North Point, 18 km N Moosonee Calidris himantopus BROM BROM362-06 MKP 982 06-Jul-1990 Canada, Nunavut, Kitikmeot Region, Cambridge Bay, Victoria Is Calidris himantopus BROM BROM363-06 RCA 88-25 27-May-1988 Canada, Alberta Calidris himantopus BROM BROM364-06 JGS 1971 16-May-1985 United States, Nebraska, York Co, 5 mi ENE York Calidris himantopus BROM BROM538-07 JGS 1992 16-May-1985 United States, Nebraska, York Co, 5 mi ENE York Calidris himantopus BNAUS CDANS022-05 2774 18-Jan-1987 Ecuador, Guayas, on the Peninsula de Santa Elena near Pun Calidris himantopus BNAUS CDANS023-05 2813 14-May-1987 United States, Missouri, Mound City; Bigelow Marsh; NW Bigelow Calidris himantopus TZBNA TZBNA141-03 JGS 1995 United States, Nebraska, 5 mi ENE York Calidris maritima NORBI BON492-07 NHMO-BC495 26-Jun-1994 Norway, Svalbard, Nedre gruve 5, Adventdalen Calidris maritima NORBI BON493-07 NHMO-BC496 29-Jun-1994 Norway, Svalbard, Nedre gruve 5, Adventdalen Calidris maritima BNAUS BOTW301-05 USNM 623283 09-Aug-2001 Iceland, Keflavik Calidris maritima BROM BROM328-06 MKP 797 25-Jul-1989 Canada, Nunavut, Baffin Region, Resolute Bay, Cornwallis Is Calidris maritima BROM BROM329-06 MKP 1604 19-Jul-1992 Iceland, ca 10 km E Grundarfjordur Calidris maritima BROM BROM330-06 MKP 1617 19-Jul-1992 Iceland, ca 10 km E Grundarfjordur Calidris maritima BROM BROM331-06 TP19 16-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova Calidris maritima BROM BROM332-06 FS 19 01-Apr-1985 United States, Connecticut Calidris mauri BNAUS BOTW324-05 USNM 630673 14-Aug-2001 United States, Washington, Grant, Moses Lake Calidris mauri BROM BROM333-06 JGS 1882 04-May-1985 United States, AK, Whitshed Point, 9 mi SW Cordova Calidris mauri BROM BROM334-06 MKP 1549 13-Jun-1992 United States, Alaska, North Slope, Barrow Calidris mauri BROM BROM624-07 JGS 1692 21-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Calidris mauri BROM BROM625-07 JPM 2416 01-Feb-1987 Peru Calidris mauri BROM BROM626-07 MKP 349 05-Feb-1987 United States, Florida, Collier Co, NW Marco Is Calidris mauri BNAUS CDLSU021-05 LSU6725 01-Sep-1985 United States, LA, Cameron Parish, 2 mi. S Cameron Calidris mauri BNAUS KBNA798-04 CWSL93-58178 01-Mar-1993 Venezuela, Sucre District, Venezuela Calidris mauri TZBNA TZBNA211-03 MKP 1507 United States, Alaska, Chevak Calidris melanotos BROM BROM335-06 JGS 2231 01-May-1987 United States, Alaska Calidris melanotos BROM BROM336-06 MKP 1509 05-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak Calidris melanotos BROM BROM337-06 MKP 1521 06-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak

Appendix 1 Part 3: Scolopaci Specimens 141

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Calidris melanotos BARG KBARG053-07 MACN-Or-ct 1734 14-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Calidris melanotos BARG KBARG080-07 MACN-Or-ct 1745 15-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Calidris melanotos TZBNA TZBNA087-03 JGS 1809 United States, Texas, 3 mi SE High Is Calidris melanotos TZBNA TZBNA105-03 JGS PESA-001 Canada, Nunavut, Alert Calidris melanotos TZBNA TZBNA116-03 MKP 788 Canada, Nunavut, Pond Inlet, Baffin Is Calidris minuta SWEBI BISE202-08 BISE-Aves204 01-Aug-2000 Sweden, Oland, Ottenby birdstation Calidris minuta SWEBI BISE325-08 BISE-Aves333 01-Aug-2000 Sweden, Oland, Ottenby birdstation Calidris minuta NORBI BON095-06 NHMO-BC95 07-Jul-2005 Norway, Finnmark, Vardo Calidris minuta NORBI BON221-07 NHMO-BC221 04-Jul-2005 Norway, Finnmark, Svartnes Calidris minuta BROM BROM338-06 TP17 16-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova Calidris minuta BROM BROM339-06 TP16 08-Jul-1994 Russia, Taymyr Aut Okrug, Sterlegova Calidris minuta BROM BROM627-07 LIST 35 17-Jun-1991 Russia, Taymyrskiy Avtonomnyy Okrug, Aut. Okrug, N Taymyr Pen Calidris minuta BROM BROM628-07 LIST 36 15-Jun-1991 Russia, Taymyrskiy Avtonomnyy Okrug, Aut. Okrug, N Taymyr Pen Calidris minuta BEPAL KBPBU206-06 UWBM 59575 06-Aug-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Calidris minutilla BNAUS BOTW052-04 USNM 626332 United States, Florida, Miami-Dade, Homestead Air Force Base Calidris minutilla BROM BROM340-06 E12992 13-Apr-1997 Brazil, Para, Salinas Calidris minutilla BROM BROM341-06 E29574 13-Apr-1997 Brazil, Para, Salinas Calidris minutilla BROM BROM342-06 YA 91 21-Aug-1983 Canada, Quebec, Papineau, Gull Lake, Mulgrave-et-Derry Calidris minutilla BROM BROM343-06 YA 97 22-Aug-1983 Canada, Qc, Iles-de-la-Madeleine, Havre aux Basques Calidris minutilla BROM BROM344-06 JGS 1869 03-May-1985 United States, AK, Whitshed Point, 9 mi SW Cordova Calidris minutilla BROM BROM629-07 SVN 383 17-Aug-1981 Canada, Ontario, Cochrane dist, North Point=Northbluff Point Calidris minutilla TZBNA TZBNA096-03 YA 77 Canada, Quebec, Havre aux Basques, i1/2es de la Madeleine Calidris minutilla TZBNA TZBNA114-03 JGS 1867 United States, Alaska Calidris ptilocnemis BNAUS HCBR151-03 ROSA 1 United States, Alaska, Aleutian Island, Attu Island Calidris ptilocnemis BNAUS HCBR152-03 ROSA 2 United States, Alaska, Aleutian Island, Attu Island Calidris pusilla BNAUS BOTW053-04 USNM 626466 United States, Florida, Bay, Tyndall Air Force Base Calidris pusilla BROM BROM345-06 E29506 11-Apr-1997 Brazil, Para, Salinas Calidris pusilla BROM BROM346-06 MKP 1548 12-Jun-1992 United States, Alaska, North Slope, Barrow Calidris pusilla BROM BROM630-07 JL 003 01-Jul-1998 Canada, Nunavut, Kitikmeot Region, Jenny Lind Is, Queen Maud Gulf Calidris pusilla BROM BROM631-07 RCA 87-308 01-Jul-1987 Canada, Ontario, Wellington Co, Guelph Calidris pusilla BROM BROM632-07 YA 59 18-Jul-1983 Canada, Quebec, Les ILes-de-la-Madeleine, Havre aux Basques Calidris pusilla TZBNA TZBNA123-03 JGS 1213 United States, Kansas, Cheyenne Bottoms Calidris pusilla TZBNA TZBNA132-03 YA 52 Canada, Quebec, Fatima, Dune du Nord, i1/2es de la Madeleine Calidris ruficollis BROM BROM347-06 MKP 2209 21-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains Calidris ruficollis BROM BROM348-06 MKP 2665 26-Nov-1995 Australia, Victoria, Inverloch, Maher's Landing Calidris ruficollis BROM BROM633-07 HOPL 4 16-Jul-1995 Russia, Chukotskiy Aut. Okrug, Aut. Okrug, Anadyr River

Appendix 1 Part 3: Scolopaci Specimens 142

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Calidris ruficollis BROM BROM634-07 MKP 242 09-Dec-1985 Australia, Victoria, Corinella Pen, Western Port Bay Calidris subminuta BROM BROM349-06 MKP 2149 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Calidris subminuta BROM BROM350-06 MKP 2171 19-Mar-1994 Australia, W. Australia, Roebuck Plains, water bore Calidris subminuta BEPAL KBPBU209-06 UWBM 51103 09-Nov-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Calidris temminckii SWEBI BISE172-08 BISE-Aves162 25-Jul-2003 Sweden, Orebro, Oerebro, Kvismaren, Kvismaren, Kaellviken Calidris temminckii NORBI BON215-07 NHMO-BC215 06-Jul-2004 Norway, Finnmark, Svartnes Calidris temminckii BROM BROM351-06 TEST 22 13-Jul-1995 Russia, Chukchi Aut Okrug, Anadyr River Calidris temminckii BROM BROM352-06 TEST 21 04-Jul-1995 Russia, Chukchi Aut Okrug, Anadyr River Calidris temminckii BEPAL KBPBU211-06 UWBM 49687 07-Aug-1994 Russia, Murmanskaya Oblast, Teriberka Calidris tenuirostris BROM BROM353-06 AJB 6074 25-Mar-1996 Australia, W. Australia, Two Dog Hermit, Broome Bird Observatory Calidris tenuirostris BROM BROM354-06 AJB 6090 26-Mar-1996 Australia, W. Australia, Wader Beach, Broome Bird Observatory Calidris tenuirostris BROM BROM355-06 AJB 6095 26-Mar-1996 Australia, W. Australia, Wader Beach, Broome Bird Observatory Calidris tenuirostris BROM BROM356-06 MKP 244 11-Dec-1985 Australia, Queensland, Lytton, Brisbane Calidris tenuirostris BROM BROM357-06 GRKN 14 16-Jun-1995 Russia, Chukchi Aut Okrug, Anadyr River Calidris tenuirostris BROM BROM636-07 GRKN 23 23-Jul-1995 Russia, Chukotskiy Aut. Okrug, Aut. Okrug, Anadyr River Calidris tenuirostris KBBI KBBI187-07 KRIBB 2305 South Korea, South Ch`ungch`ong Calidris tenuirostris KBBI KBBI188-07 KRIBB 2326 South Korea, South Cholla Calidris tenuirostris KBBI KBBI193-07 KRIBB 2343 South Korea, South Cholla Calidris tenuirostris KBBI KBBI208-07 KRIBB 2463 South Korea, Seoul-si Calidris tenuirostris BEPAL KBPBU221-06 UWBM 43884 07-Apr-1992 Russia, Magadanskaya Oblast, above headwaters of Ola River Calidris tenuirostris BEPAL KBPBU222-06 UWBM 44219 07-Apr-1992 Russia, Magadanskaya Oblast, above headwaters of Ola River Calidris tenuirostris BEPAL KBPBU223-06 UWBM 44469 07-Apr-1992 Russia, Magadanskaya Oblast, above headwaters of Ola River Coenocorypha aucklandica BROM BROM235-06 CA787 06-Jan-2006 New Zealand, Enderby Is, Auckland Is C. aucklandica BROM BROM236-06 CA837 14-Jan-2006 New Zealand, Campbell Is C. aucklandica BROM BROM399-06 ADA7 01-Feb-2001 New Zealand, Adams Is, Auckland Is C. aucklandica BROM BROM400-06 CA786 06-Jan-2006 New Zealand, Enderby Is, Auckland Is C. aucklandica BROM BROM507-07 Ant 1 25-Jan-2001 New Zealand, Antipodes Is, Antipodes Is C. aucklandica BROM BROM648-07 ADA1 14-Jan-2001 New Zealand, Auckland Islands, Adams Is, Auckland Is C. aucklandica BROM BROM649-07 SIA 06-Apr-2001 New Zealand, Snares Islands, Snares Is Coenocorypha aucklandica – additional sequences are found in Genbank, XXXXXXXX-XXXXXXX (Baker et al., 2009b) Coenocorypha pusilla BROM BROM508-07 MAN1-ROM 26-Oct-2000 New Zealand, Chatham Is, Mangere Is, Chatham Is Coenocorypha pusilla BROM BROM509-07 RAN1 09-May-2001 New Zealand, Chatham Is, Rangatira Is, Chatham Is Coenocorypha pusilla BROM BROM650-07 MAN2 26-Oct-2000 New Zealand, Chatham Islands, Mangere Is, Chatham Is Coenocorypha pusilla BROM BROM651-07 RAN10 11-May-2001 New Zealand, Chatham Islands, Rangatira Is, Chatham Is Coenocorypha pusilla BROM BROM652-07 RAN16 11-May-2001 New Zealand, Chatham Islands, Rangatira Is, Chatham Is Coenocorypha pusilla - additional sequences are found in Genbank, XXXXXXXX-XXXXXXX (Baker et al., 2009b)

Appendix 1 Part 3: Scolopaci Specimens 143

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Eurynorhynchus pygmeus BROM BROM358-06 EP001 01-Jan-2000 Russia Eurynorhynchus pygmeus BROM BROM510-07 FS01456 23-Jun-2003 Russia, Chukotskiy Aut. Okrug, S Chutkova Gallinago delicata BNAUS BOTW001-04 USNM 622680 United States, AK, Fairbanks N.Star, Fort Wainwright Military Res. Gallinago delicata BNAUS BOTW245-05 USNM 601827 07-Sep-2000 United States, Alaska, Anchorage, Elmendorf Air Force Base Gallinago delicata AROMB BROM169-06 JGS 1783 22-Mar-1985 United States, TX, Chambers Co, 0.25 mi W Anahuac Nat Wildlife Ref Gallinago delicata AROMB BROM513-07 1B-3698 22-Sep-1999 Canada, Ontario, Frontenac Co, Kingston Gallinago delicata AROMB BROM514-07 JGS 1902 01-Jun-1985 United States, Alaska Gallinago delicata BNAAS BSBNA099-06 MKNO 1453 30484 12-Sep-2005 Canada, BC, Mackenzie, Mugaha Marsh, Mackenzie Nature Obs. Gallinago delicata BNAUS KBNA480-04 ARBNC026 Canada, Ontario Gallinago delicata BNAUS KBNA672-04 LMA1173-95416 22-Sep-2004 Canada, Ontario, Dufferin County, Luther Marsh Gallinago delicata TZBNA TZBNA195-03 1B-620 Canada, Ontario Gallinago delicata TZBNA TZBNA214-03 MKP 1531 09-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak Gallinago gallinago SWEBI BISE083-07 BISE-Aves98 25-Apr-2001 Sweden, Stockholm, Uppland, 400 m fran Rastasjon, Solna Gallinago gallinago SWEBI BISE375-08 BISE-Aves391 21-Sep-1996 Sweden, Oland, HULTERSTAD, OeLAND Gallinago gallinago NORBI BON052-06 NHMO-BC52 03-Jul-2001 Norway, Oppland, Oystre Slidre Gallinago gallinago NORBI BON217-07 NHMO-BC217 09-Jul-2004 Norway, Finnmark, Svartnes Gallinago gallinago AROMB BROM222-06 MKP 2646 28-Jun-1995 Finland, Lappi, 20 km N Inari Gallinago gallinago AROMB BROM411-06 MKP 1588 17-Jul-1992 Iceland, Stokkseyri Gallinago gallinago AROMB BROM412-06 MKP 1590 17-Jul-1992 Iceland, Seljaland Gallinago gallinago AROMB BROM515-07 MKP 1621 19-Jul-1992 Iceland, Gardur Gallinago gallinago AROMB BROM516-07 MKP 1591 17-Jul-1992 Iceland, Hof Gallinago gallinago AROMB BROM919-08 UMMZ 234734 01-Oct-1992 Japan, Hyogo, Kasai, Befucho Gallinago gallinago BEPAL KBPBU269-06 UWBM 46880 17-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron Gallinago gallinago BEPAL KBPBU270-06 UWBM 44046 23-Jul-1992 Russia, Kamchatka, KoYa. A. Red'kinki Gallinago gallinago BEPAL KBPBU271-06 UWBM 67701 16-Jun-1999 Russia, Tuva, Ovyurskiy Kozhuun, northern bank of Uvs Nuur, Kyzyl Gallinago gallinago BEPAL KBPBU272-06 UWBM 59432 06-Dec-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Gallinago imperialis BROM BROM209-06 C515-112789 31-Jan-2003 Ecuador, Tapichalara (C Mongus, SE Impueron) Gallinago media NORBI BON323-07 NHMO-BC323 09-Jun-2006 Norway, Oppland, Ovre Heimdalen Gallinago media NORBI BON324-07 NHMO-BC324 09-Jun-2006 Norway, Oppland, Ovre Heimdalen Gallinago media BROM BROM199-06 23224 16-Jun-2005 Norway, Oppland?, Gavalia Gallinago media BROM BROM201-06 23246 01-Jun-1994 Norway, Oppland?, Gavalia Russia, Tyumenskaya Oblast', Yamalo-Nenetskiy Aut. Okrug, Vengoyakha Gallinago media BEPAL KBPBU283-06 UWBM 56761 13-Jun-1996 river, Noyabr'sk Gallinago media BEPAL KBPBU284-06 UWBM 61578 05-Jul-1998 Russia, Rossiya, Kirovskaya Oblast,Svechinskiy Rayon, Lebedi Gallinago megala BEPAL KBPBU274-06 UWBM 57929 19-Jun-1997 Mongolia, Tov Aymag, Hentiyn Nuruu Gallinago megala BEPAL KBPBU275-06 UWBM 57927 19-Jun-1997 Mongolia, Tov Aymag Gallinago nigripennis AROMB BROM216-06 Gnig 01 01-Jan-1993 South Africa, KwaZulu-Natal, near Durban

Appendix 1 Part 3: Scolopaci Specimens 144

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Gallinago paraguaiae AROMB BROM266-06 L50137 29-Apr-1999 Brazil, Rio Grande do Sul, Lagoa do Peixei Gallinago paraguaiae BARG KBAR533-06 MACN-Or-ct 1469 28-Apr-2006 Argentina, Corrientes, Distrito Capital, Estancia, Estero Valenzuela Gallinago paraguaiae BARG KBAR551-06 MACN-Or-ct 1498 29-Apr-2006 Argentina, Corrientes, Distrito Capital, Estancia, Estero Valenzuela Gallinago paraguaiae BARG KBAR552-06 MACN-Or-ct 1499 29-Apr-2006 Argentina, Corrientes, Distrito Capital, Estancia, Estero Valenzuela Gallinago stenura BROM BROM207-06 G.stenura39 20-Jul-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Gallinago stenura BROM BROM208-06 G.stenura41 04-Jun-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Gallinago stenura BROM BROM210-06 G.stenura40 27-Jul-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Gallinago stenura BROM BROM885-08 SBB 050 10-Mar-1994 Australia, W. Australia, Broome Beach Gallinago stenura KBBI KBBI086-07 KRIBB 1181 South Korea, Gwangju-si Gallinago stenura KBBI KBBI231-07 KRIBB 2799 South Korea, North Cholla Gallinago stenura BEPAL KBPBU276-06 UWBM 57870 06-Mar-1997 Mongolia, Bayanhongor, Gobi desert Gallinago stenura BEPAL KBPBU277-06 UWBM 46307 06-Jun-1993 Russia, Altay, Gorno-Altaysk Gallinago stenura BEPAL KBPBU278-06 UWBM 67645 28-Jun-1999 Russia, Tuva, Erzinskiy Kozhuun, Erzin Gallinago stenura BEPAL KBPBU279-06 UWBM 51675 26-May-1994 Russia, Magadanskaya O, Ol'skiy, between Arman' and Oyra rivers Gallinago stenura BEPAL KBPBU280-06 UWBM 51859 22-Jul-1994 Russia, Sakha, Oymyakonskiy Rayon, Agayakan weather station Limicola falcinellus SWEBI BISE199-08 BISE-Aves201 01-Aug-2000 Sweden, Oland, Ottenby birdstation Limicola falcinellus SWEBI BISE328-08 BISE-Aves337 01-Aug-2000 Sweden, Oland, Ottenby birdstation Limicola falcinellus NORBI BON321-07 NHMO-BC321 04-Jul-2006 Norway, Hedmark, Storkjolen Limicola falcinellus BROM BROM249-06 SBB 031 10-Mar-1994 Australia, W. Australia, Port Hedland Limicola falcinellus BROM BROM359-06 AJB 6020 19-Mar-1996 Australia, W. Australia, Port Hedland, Saltworks Limicola falcinellus BROM BROM360-06 MKP 2641 26-Jun-1995 Finland, Lappi, 10 km NE Karigasniemi Limicola falcinellus BROM BROM361-06 MKP 2643 28-Jun-1995 Finland, Lappi, 7 km NE Karigasniemi Limicola falcinellus BROM BROM537-07 SBB 032 10-Mar-1994 Australia, W. Australia, Port Hedland Limicola falcinellus BEPAL KBPBU229-06 UWBM 44493 07-Sep-1992 Russia, Sakha, Cherskiy, Little Kon'kovaya River Limnodromus griseus BNAUS BOTW055-04 USNM 626366 United States, Florida, Hillsborough, Macdill Air Force Base Limnodromus griseus BROM BROM181-06 JGS 2122 21-May-1986 United States, Nebraska, York Co, 7 mi ENE York Limnodromus griseus AROM BROM272-06 H23975 12-Apr-1997 Brazil, Para, Salinas Limnodromus griseus BROM BROM520-07 862-88274 16-May-2001 United States, New Jersey, Cape May Co, Villas Limnodromus griseus BROM BROM521-07 JGS 1651 21-Mar-1985 United States, Texas, Galveston Co, Bolivar Flats Limnodromus griseus BROM BROM522-07 JPM 2421 01-Feb-1987 Peru Limnodromus griseus BNAUS CDUSM033-05 B16468 20-Apr-2001 United States, Florida, Hillsborough, Macdill Air Force Base Limnodromus griseus BNAUS CDUSM034-05 B16469 20-Apr-2001 United States, Florida, Hillsborough, Macdill Air Force Base Limnodromus griseus TZBNA TZBNA086-03 JGS 1871 United States, Alaska Limnodromus griseus TZBNA TZBNA159-03 JGS 1955 United States, Nebraska, 5 mi ENE York Limnodromus scolopaceus BROM BROM170-06 JGS 1221 18-May-1982 United States, Kansas, Barton Co, Cheyenne Bottoms Limnodromus scolopaceus AROM BROM427-06 MKP 1523 06-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak

Appendix 1 Part 3: Scolopaci Specimens 145

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Limnodromus scolopaceus BEPAL KBPBU290-06 UWBM 43928 07-Oct-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Limnodromus scolopaceus BEPAL KBPBU291-06 UWBM 43930 07-Oct-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Limnodromus scolopaceus BEPAL KBPBU292-06 UWBM 43936 07-Nov-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, along Avtatkuul River Limnodromus scolopaceus TZBNA TZBNA215-03 MKP 1520 06-Jun-1992 United States, Alaska, Wade Hampton (CA), Chevak Limnodromus scolopaceus TZBNA TZBNA216-03 MKP 1510 United States, Alaska, Chevak Limnodromus semipalmatus BROM BROM250-06 SBB 036 10-Mar-1994 Australia, W. Australia, Port Hedland Limnodromus semipalmatus BROM BROM251-06 SBB 044 10-Mar-1994 Australia, W. Australia, Port Hedland Limosa fedoa BROM BROM172-06 JAD 7344 16-Jun-1982 Canada, Saskatchewan, Reno Rural Mun, 8 km S Consul Limosa fedoa BROM BROM176-06 MKP 473 10-Mar-1988 United States, Florida, Lee Co, Estero Is Limosa fedoa BROM BROM523-07 2801 12-Sep-2002 United States, Georgia, Glynn Co, Little St Simon Is Limosa fedoa BROM BROM898-08 MKP 474 10-Mar-1988 United States, Florida, Lee Co, Estero Is Limosa fedoa BNAUS KKBNA160-04 CWS3840 22-Jun-1968 Canada, Alberta Limosa fedoa TZBNA TZBNA094-03 JGS 1740 United States, Texas Limosa fedoa TZBNA TZBNA103-03 RCA 87-263 Canada, Alberta Limosa haemastica BROM BROM173-06 AML 104 22-Dec-1983 Argentina, Tierra del Fuego, Rio Grande Limosa haemastica BROM BROM175-06 AJB 3399 19-Nov-1981 Argentina, Chubut, Punta Tafor Limosa haemastica BROM BROM267-06 571 05-Feb-2002 Chile, Magallanes-Antartica, Primera Angoustura Limosa haemastica BROM BROM268-06 559 05-Feb-2002 Chile, Magallanes-Antartica, Primera Angoustura Limosa haemastica BROM BROM428-06 MKP 2473 20-Feb-1995 Argentina, Tierra del Fuego, Punta Popper, 2 km S Rio Grande Limosa haemastica BROM BROM815-07 1393-00101 02-Apr-1997 Brazil, Rio Grande do Sul, Lagoa do Peixe Limosa haemastica BROM BROM899-08 1B-3877 20-Sep-2000 Canada, Ontario, Halton RM, Royal Botanical Gardens, from Fishway Limosa haemastica BROM BROM900-08 M14403 01-May-1999 Brazil, Rio Grande do Sul, Lagoa do Peixei Limosa haemastica TZBNA TZBNA112-03 JAD 7254 Canada, Ontario, North Point, 18 km N Moosonee Limosa haemastica TZBNA TZBNA120-03 JAD 7512 07-Jul-1988 Canada, Ontario, Cochrane dist, 15 km NE Moosonee Limosa lapponica NORBI BON437-07 NHMO-BC437 01-Jan-1966 Norway, Finnmark, Ovre Pasvik Limosa lapponica BROM BROM182-06 MKP 802 08-Dec-1989 New Zealand, North Auckland Limosa lapponica BROM BROM202-06 742 16-May-1997 Netherlands, Friesland, Texel Is, West Frisian Is, Waddenzee Limosa lapponica BROM BROM206-06 1374055 01-Aug-1998 Netherlands, Waddenzee Limosa lapponica BROM BROM524-07 BAGO 74 25-Jul-1991 Russia, Krasnoyarskiy Kray, Severnaya Zemlya Limosa lapponica BROM BROM567-07 BAGO 111 01-Jul-1990 Russia, Krasnoyarskiy Kray, Taymyr Aut Okrug, N Taymyr Pen Limosa lapponica BROM BROM816-07 AJB 4791 29-Apr-1986 New Zealand, North Island, Sand Is, Kaipara Harbour Limosa lapponica BROM BROM901-08 AJB 6109 27-Mar-1996 Australia, W. Australia, Crab Creek, Broome Bird Observatory Limosa lapponica BROM BROM902-08 AJB 6113 27-Mar-1996 Australia, W. Australia, Crab Creek, Broome Bird Observatory Limosa lapponica BROM BROM903-08 MKP 2088 17-Mar-1994 Australia, W. Australia, Broome Beach Limosa lapponica BROM BROM904-08 MKP 2089 17-Mar-1994 Australia, W. Australia, Broome Beach Limosa lapponica KBBI KBBI184-07 KRIBB 2302 South Korea, Cheju-do,

Appendix 1 Part 3: Scolopaci Specimens 146

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Limosa lapponica KBBI KBBI185-07 KRIBB 2303 South Korea, Kyonggi-do Limosa lapponica BEPAL KBPBU153-06 UWBM 49664 07-Jun-1994 Russia, Murmanskaya Oblast, Teriberka Limosa lapponica BEPAL KBPBU154-06 UWBM 49665 07-Jun-1994 Russia, Murmanskaya Oblast, Teriberka Limosa lapponica BEPAL KBPBU155-06 UWBM 49751 14-Jul-1994 Russia, Murmanskaya O., Umba, shore of Kandalakshskaya Guba Limosa lapponica BEPAL KBPBU156-06 UWBM 49752 14-Jul-1994 Russia, Murmanskaya O, Umba, shore of Kandalakshskaya Guba Limosa lapponica TZBNA TZBNA217-03 MKP 1529 United States, Alaska, Chevak Limosa lapponica TZBNA TZBNA218-03 MKP 1528 United States, Alaska, Chevak Limosa limosa BROM BROM195-06 MKP 1589 17-Jul-1992 Iceland, Pykkvibaer, 10 km S Hella Limosa limosa BROM BROM196-06 MKP 1587 16-Jul-1992 Iceland, Pykkvibaer, 10 km S Hella Limosa limosa BROM BROM203-06 3477284 16-May-1997 Netherlands, Overijssel Limosa limosa BROM BROM204-06 3477285 16-May-1997 Netherlands, Overijssel Limosa limosa BROM BROM215-06 MKP 2772 03-Dec-1996 Viet Nam, Ha Nam Ninh, Xuay Thuy, Lu Is Limosa limosa BROM BROM248-06 SBB 019 02-Apr-1994 Australia, W. Australia, Broome Beach Limosa limosa BROM BROM817-07 3477283 16-May-1997 Netherlands, Overijssel Limosa limosa BROM BROM818-07 3477286 16-May-1997 Netherlands, Overijssel Limosa limosa BROM BROM819-07 MKP 1596 18-Jul-1992 Iceland, Vodmulastadir Limosa limosa BROM BROM820-07 MKP 2118 18-Mar-1994 Australia, W. Australia, Broome Beach Limosa limosa BROM BROM821-07 MKP 2235 25-Mar-1994 Australia, W. Australia, 13 km S 80 Mile Beach, Anna Plains Limosa limosa BROM BROM822-07 MKP 2778 04-Dec-1996 Viet Nam, Nam Ha, Xuay Thuy, Lu Is Limosa limosa BROM BROM823-07 SBB 018 02-Apr-1994 Australia, W. Australia, Broome Beach Limosa limosa BROM BROM905-08 MKP 1597 18-Jul-1992 Iceland, Vodmulastadir Limosa limosa BROM BROM906-08 MKP 2773 03-Dec-1996 Viet Nam, Nam Ha, Xuay Thuy, Lu Is Limosa limosa BROM BROM907-08 SBB 020 02-Apr-1994 Australia, W. Australia, Broome Beach Limosa limosa BEPAL KBPBU152-06 UWBM 46888 18-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron Limosa limosa BEPAL KBPBU779-06 UWBM 73550 16-Jul-2002 Russia, Buryatia, Kabanskiy Rayon, Mursino, Ulan-Ude Limosa limosa BEPAL KBPBU780-06 UWBM 73771 16-Jul-2002 Russia, Buryatia, Kabanskiy Rayon, Mursino, Ulan-Ude Limosa limosa BEPAL KKBNA290-05 UWBM 46884 18-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron,marsh at river delta Limosa limosa BEPAL KKBNA728-05 UWBM 47118 01-Jun-1993 Russia, Magadanskaya Oblast, Talon, 30 km NW, Tauy River Lymnocryptes minimus SWEBI BISE136-07 BISE-Aves193 18-Oct-2004 Sweden, Stockholm, Uppland, Blekholmsterassen, Naturvardsverket Lymnocryptes minimus SWEBI BISE335-08 BISE-Aves345 01-Jan-2001 Sweden, Vastra Gotaland, Hoenoe , Goeteborgs norra skaergard Lymnocryptes minimus NORBI BON050-06 NHMO-BC50 29-Sep-2003 Norway, Rogaland, Utsira Lymnocryptes minimus NORBI BON051-06 NHMO-BC51 29-Sep-2003 Norway, Rogaland, Utsira Lymnocryptes minimus BROM BROM429-06 946364 20-Feb-1994 Sweden, Stockholm, Tullinge Lymnocryptes minimus BROM BROM430-06 MAR 1016 01-Oct-1998 Germany, Schleswig-Holstein, Helgoland, North Frisian Is, North Sea Lymnocryptes minimus BEPAL KBPBU281-06 UWBM 68121 27-Sep-1999 Russia, Kirovskaya Oblast, Kirovo-Chepetskiy Rayon, Isakovtsy Lymnocryptes minimus BEPAL KBPBU282-06 UWBM 68120 28-Sep-1999 Russia, Kirovskaya Oblast, Kirovo-Chepetskiy Rayon, Isakovtsy

Appendix 1 Part 3: Scolopaci Specimens 147

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Numenius americanus BROM BROM526-07 JGS 1766 01-Mar-1985 United States, Texas Numenius americanus BROM BROM824-07 JGS 1617 01-Mar-1985 United States, Texas Numenius americanus TZBNA TZBNA129-03 RCA 88-47 Canada, Alberta Numenius americanus TZBNA TZBNA130-03 JGS 1765 United States, Texas, 0.25 mi W Anahuac Nat Wildlife Refuge Numenius arquata SWEBI BISE061-07 BISE-Aves70 19-Aug-1999 Sweden, Uppsala, Uppland, Dudero 15 km norr om Osthammar Numenius arquata SWEBI BISE454-08 BISE-Aves485 12-May-2007 Sweden, Dalarna, Mellan Fors och Lycka, Avesta, Fors Numenius arquata NORBI BON192-07 NHMO-BC192 25-Jun-2005 Norway, Rogaland, Revtangen Numenius arquata NORBI BON380-07 NHMO-BC380 04-Jun-2004 Norway, Troms, Langnes Flyplass Numenius arquata BROM BROM223-06 MKP 2652 01-Jun-1995 Sweden, Uppsala, Arlanda Airport Numenius arquata BEPAL KBPBU140-06 UWBM 46329 16-Jun-1993 Russia, Buryatia, Ulan-Ude Numenius arquata BEPAL KBPBU141-06 UWBM 46473 15-Jun-1993 Russia, Buryatia, Ulan-Ude Numenius madagascariensis BROM BROM232-06 MKP 2107 18-Mar-1994 Australia, W. Australia, Broome Beach N. madagascariensis BROM BROM247-06 SBB 017 02-Apr-1994 Australia, W. Australia, Broome Beach N. madagascariensis BROM BROM825-07 SBB 014 02-Apr-1994 Australia, W. Australia, Broome Beach N. madagascariensis BEPAL KBPBU142-06 UWBM 46885 18-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron N. madagascariensis BEPAL KBPBU143-06 UWBM 47020 06-Jan-1993 Russia, Magadanskaya Oblast, Talon, 30 km NW, Tauy River N. madagascariensis BEPAL KBPBU144-06 UWBM 47043 13-Jun-1993 Russia, Khabarovskiy Kray, Khurmuli, marshes north of Goryun River N. madagascariensis BEPAL KBPBU145-06 UWBM 46886 18-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron N. madagascariensis BEPAL KBPBU146-06 UWBM 47183 18-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron, along Goryun River Numenius minutus BROM BROM186-06 AJB 5617 05-Oct-1990 Australia, Northern Terr, Gunn Point Numenius minutus BROM BROM433-06 S 072 78498 01-Nov-1998 Australia, W. Australia, Lake Eda Numenius minutus BROM BROM434-06 R 072 78590 01-Nov-1998 Australia, W. Australia, Lake Eda Numenius minutus BROM BROM826-07 A 072 78501 29-Oct-1998 Australia, W. Australia, Broome, Royal Golf Course Numenius minutus BROM BROM908-08 J 072 78505 29-Oct-1998 Australia, W. Australia, Broome, Royal Golf Course Numenius phaeopus NORBI BON091-06 NHMO-BC91 04-Jul-2004 Norway, Finnmark, Vardo Numenius phaeopus NORBI BON368-07 NHMO-BC368 15-Jun-2005 Norway, Sor-Trondelag, Havmyran Numenius phaeopus AROM BROM174-06 SVN 372 17-Aug-1981 Canada, Ontario, Cochrane dist, North Point=Northbluff Point Numenius phaeopus AROM BROM183-06 1B-27 01-Sep-1989 Canada, Ontario, Peel RM, Lester B Pearson International Airport Numenius phaeopus BROM BROM200-06 AJB 6034 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Numenius phaeopus BROM BROM229-06 NP12 01-Feb-1993 Guinea-Bissau Numenius phaeopus BROM BROM233-06 MKP 2103 17-Mar-1994 Australia, W. Australia, Broome Beach Numenius phaeopus BROM BROM827-07 AJB 6119 28-Mar-1996 Australia, W. Australia, N Quarry Beach, Broome Bird Observatory Numenius phaeopus AROM BROM828-07 MKP 471 10-Mar-1988 United States, Florida, Lee Co, Estero Is Numenius phaeopus BROM BROM909-08 JPM 2004 01-Dec-1986 Peru Numenius phaeopus KBBI KBBI167-07 KRIBB 2150 South Korea, South Cholla Numenius phaeopus BNAUS KBNA314-04 LPBO004 Canada, Ontario, Port Rowan, Old Cut Field Station, Long Point

Appendix 1 Part 3: Scolopaci Specimens 148

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Numenius phaeopus BEPAL KBPBU147-06 UWBM 49676 07-Jul-1994 Russia, Murmanskaya Oblast, Numenius phaeopus BEPAL KBPBU148-06 UWBM 49694 07-Aug-1994 Russia, Murmanskaya Oblast, Teriberka Numenius phaeopus BEPAL KBPBU149-06 UWBM 51181 18-Sep-1994 Russia, Primorskiy Kray, Kiyevka, Melkovodnoe Zaliv Numenius phaeopus BEPAL KBPBU150-06 UWBM 59485 28-Jun-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Numenius phaeopus BEPAL KBPBU151-06 UWBM 61337 28-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Numenius phaeopus TZBNA TZBNA157-03 MKP 476 United States, Florida, Estero Is Numenius tahitiensis BNAUS BOTW382-05 FMNH 346060 Marshall Islands, Enewetak Atoll, Van Numenius tahitiensis AROM BROM228-06 BRCU 645 United States, Alaska, Allen Creek Numenius tahitiensis AROM BROM527-07 BRCU225 United States, Alaska, Nome (CA), Allen Creek Numenius tahitiensis AROM BROM829-07 BTCU 113 United States, Alaska, Nome (CA), Neva Creek Numenius tahitiensis AROM BROM830-07 BTCU 114 United States, Alaska, Nome (CA), Neva Creek Numenius tahitiensis AAPR CDAMH058-05 AMNH-DOT10919 16-Jan-1998 United States, Hawaii, Honolulu, French Frigate Shoals, Tern Is Phalaropus fulicarius SWEBI BISE349-08 BISE-Aves363 20-Jun-2004 Sweden, Stockholm, Sikhjaelma, Hallnaes Phalaropus fulicarius NORBI BON409-07 NHMO-BC409 20-Jun-1982 Norway, Svalbard, Ny Alesund Phalaropus fulicarius NORBI BON410-07 NHMO-BC410 20-Jun-1982 Norway, Svalbard, Ny Alesund Phalaropus fulicarius AROM BROM129-06 Phal.fulic.38 07-Jun-1991 Russia, Taymyrskiy Avtonomnyy Okrug, N Taymyr Pen Phalaropus fulicarius AROM BROM131-06 SH99-002 11-Jul-1999 Canada, Nunavut, Bay of God's Mercy, Southampton Is Phalaropus fulicarius AROM BROM132-06 SH99-003 11-Jul-2000 Canada, Nunavut, Bay of God's Mercy, Southampton Is Phalaropus fulicarius TZBNA TZBNA125-03 MKP 791 Canada, Nunavut, Resolute, Cornwallis Is Phalaropus fulicarius TZBNA TZBNA134-03 MKP 782 Canada, Nunavut, Pond Inlet, Baffin Is Phalaropus lobatus SWEBI BISE028-07 BISE-Aves31 30-Jun-1997 Sweden, Norrbotten, Torne lappmark, Rensjon, Njoallunjaure Phalaropus lobatus SWEBI BISE274-08 BISE-Aves280 05-Jul-1994 Sweden, Norrbotten, Luobasjaure, Kiruna WNW Phalaropus lobatus NORBI BON096-06 NHMO-BC96 15-Jul-2005 Norway, Finnmark, Vardo Phalaropus lobatus BNAUS BOTW273-05 USNM 621128 03-Sep-1996 United States, Washington, Pierce, Point Defiance Phalaropus lobatus AROM BROM133-06 MKP 993 08-Jul-1990 Canada, Nunavut, Kitikmeot Region, Cambridge Bay, Victoria Is Phalaropus lobatus AROM BROM134-06 JPM 2057 01-Dec-1986 Peru Phalaropus lobatus AROM BROM135-06 JPM 2092 01-Jan-1987 Peru Phalaropus lobatus AROM BROM136-06 JPM 2095 01-Jan-1987 Peru Phalaropus lobatus AROM BROM137-06 JPM 2240 01-Jan-1987 Peru Phalaropus lobatus BEPAL KBPBU198-06 UWBM 47002 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun'skiy Zaliv Phalaropus lobatus BEPAL KBPBU199-06 UWBM 43857 30-Jun-1992 Russia, Magadan, Adian Bay off Oroholyndja R Phalaropus lobatus BEPAL KBPBU200-06 UWBM 44235 07-Sep-1992 Russia, Sakha, Cherskiy, Little Kon'kovaya River Phalaropus lobatus BEPAL KBPBU201-06 UWBM 59445 16-Jun-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Phalaropus lobatus BNAUS KKBNA210-05 USNM 586074 23-Feb-1989 United States, Washington, Pierce, 1 Mi N, Point Defiance Phalaropus lobatus BNAUS KKBNA281-05 UWBM 43988 15-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Phalaropus lobatus BNAUS KKBNA287-05 UWBM 46999 15-Jul-1993 Russia, Sakhalinskaya Oblast, Lun`skiy Zaliv, grassy sand bar

Appendix 1 Part 3: Scolopaci Specimens 149

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Phalaropus lobatus BNAUS KKBNA429-05 UWBM 53888 08-Jun-1995 United States, Alaska, Deadhorse Phalaropus lobatus BNAUS KKBNA430-05 UWBM 53889 08-Jun-1995 United States, Alaska, Deadhorse Phalaropus lobatus BNAUS KKBNA431-05 UWBM 53890 08-Jun-1995 United States, Alaska, Deadhorse Phalaropus tricolor BROM BROM071-06 JAD7333 01-May-1982 Canada, Saskatchewan Phalaropus tricolor BROM BROM072-06 RCA 87-192 01-Jun-1987 Canada, Alberta Phalaropus tricolor BROM BROM073-06 JGS 1208 18-May-1982 United States, Kansas, Barton Co, Cheyenne Bottoms Phalaropus tricolor BROM BROM074-06 JGS 2034 11-Jun-1985 United States, Colorado, Weld Co, 8 mi W Grover Phalaropus tricolor BROM BROM075-06 1B-880 01-Jan-1990 Canada, Ontario Phalaropus tricolor TZBNA TZBNA149-03 JGS 2036 United States, Alaska Phalaropus tricolor TZBNA TZBNA158-03 RCA 87-194 Canada, Alberta Philomachus pugnax SWEBI BISE168-08 BISE-Aves152 28-May-2003 Sweden, Norrbotten, Jokkmokk Philomachus pugnax SWEBI BISE453-08 BISE-Aves481 29-Aug-2006 Sweden, Oland, Ottenby birdstation Philomachus pugnax NORBI BON038-06 NHMO-BC38 11-Sep-2003 Norway, Telemark, Kragero Philomachus pugnax NORBI BON302-07 NHMO-BC302 10-Sep-2003 Norway, Telemark, Jomfruland Philomachus pugnax BNAUS BOTW461-05 Jb131 United States, Hawaii, French Frigate Shoals Philomachus pugnax BROM BROM365-06 MKP 1432 09-Dec-1991 Namibia, Swakopmund, Walvis Bay Philomachus pugnax BROM BROM366-06 R45; 1463014 23-Nov-2004 Netherlands Philomachus pugnax BROM BROM367-06 R84; 1463071 26-Jan-2000 Netherlands Philomachus pugnax BROM BROM368-06 R258 10-Dec-2004 Russia, Siberia Philomachus pugnax BROM BROM369-06 R273; GS00700 15-Dec-2004 Belarus Philomachus pugnax BROM BROM370-06 R339; 1471188 20-Dec-2004 Netherlands Philomachus pugnax BROM BROM371-06 R348; 6119839 Sweden, Gotland Philomachus pugnax BROM BROM539-07 1337609 26-Apr-1997 Netherlands, Friesland Philomachus pugnax BNAUS CDAMH121-05 AMNH-DOT11138 31-Dec-1996 United Kingdom, Essex, ABBERTON RESERVOIR Philomachus pugnax BEPAL KBPBU231-06 UWBM 56425 23-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Philomachus pugnax BEPAL KBPBU232-06 UWBM 43980 14-Jul-1992 Russia, Chukotskiy Aut. Okrug, Anadyr, near mouth of Avtatkuul River Philomachus pugnax BEPAL KBPBU233-06 UWBM 56715 06-Oct-1996 Russia, Yamalo-Nenetskiy Aut. Okrug, Vengoyakha river, Noyabr'sk Philomachus pugnax BEPAL KBPBU234-06 UWBM 44232 07-Aug-1992 Russia, Sakha, Cherskiy, Little Kon'kovaya River Philomachus pugnax BEPAL KBPBU235-06 UWBM 59419 06-May-1997 Russia, Rossiya, Yamalo-Nenetskiy Avtonomnyy Okrug, Labytnangi Scolopax minor BNAUS BOTW054-04 USNM 600786 United States, Maryland, Montgomery, Bethesda Scolopax minor BROM BROM452-06 1B-2666 01-Apr-1997 Canada, Ontario, Metro Toronto RM, Toronto, King St at Bay St Scolopax minor BROM BROM453-06 JAD 7498 22-Oct-1987 Canada, Ontario, Parry Sound dist, Ardbeg Scolopax minor BROM BROM530-07 1B-243 22-Jul-1990 Canada, Ontario, Durham RM, Blackstock Scolopax minor BROM BROM894-08 AJB 5526 SM 14-Jun-1990 Canada, Ontario, Metro Toronto RM, Toronto Harbourfront Scolopax minor BNAUS KBNA470-04 ARBNC016 04-Apr-1999 Canada, Ontario, Toronto, Wellington Avenue Scolopax minor BNAUS KBNA471-04 ARBNC017 15-Apr-1999 Canada, Ontario, Toronto, Bay Street and Queen

Appendix 1 Part 3: Scolopaci Specimens 150

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Scolopax minor BNAUS KBNA472-04 ARBNC018 04-Jul-1999 Canada, Ontario, Toronto, Victoria Street and Adelaide Scolopax minor TZBNA TZBNA039-03 JAD 7524 Canada, Ontario, Ardbeg Scolopax rusticola SWEBI BISE190-08 BISE-Aves189 24-May-2004 Sweden, Uppsala, Uppsala, N Fibysjoen, Fiby, Uppland Scolopax rusticola SWEBI BISE321-08 BISE-Aves329 12-Oct-2001 Sweden, Sodermanland, Stockholm, Hornsgatan, Soedermalm Scolopax rusticola NORBI BON036-06 NHMO-BC36 21-Jul-2004 Norway, Oppland, Oystre Slidre Scolopax rusticola NORBI BON379-07 NHMO-BC379 01-Feb-1994 Norway, Troms, Balsfjord Scolopax rusticola BROM BROM205-06 MKP 2779 04-Dec-1996 Viet Nam, Xuay Thuy, Red River Estuary Scolopax rusticola KBBI KBBI026-07 KRIBB 365 South Korea, South Chùngchòng Scolopax rusticola KBBI KBBI027-07 KRIBB 367 South Korea, South Chùngchòng Scolopax rusticola KBBI KBBI073-07 KRIBB 998 South Korea, South Cholla Scolopax rusticola KBBI KBBI134-07 KRIBB 1920 South Korea, North Chùngchòng Scolopax rusticola BEPAL KBPBU285-06 UWBM 46931 07-Feb-1993 Russia, Sakhalinskaya Oblast, Gornozavodsk, Kitosiou Stream Scolopax rusticola BEPAL KBPBU286-06 UWBM 61000 04-Apr-1997 Russia, Kaluzhskaya Oblast, BaYa. A. Red'kintinskiy, Zaitseva Gora Scolopax rusticola BEPAL KBPBU287-06 UWBM 47395 07-Nov-1993 Russia, Sakhalinskaya Oblast, Poronay River Scolopax rusticola BEPAL KBPBU288-06 UWBM 51816 23-Jun-1994 Russia, Irkutskaya Oblast', Slyudyanka, Khamar-D. A. Baninan weather station Scolopax rusticola BEPAL KBPBU289-06 UWBM 61577 05-Jul-1998 Russia, Rossiya, Kirovskaya Oblast,Svechinskiy Rayon, Lebedi Tringa brevipes AROM BROM067-06 AJB 6042 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Tringa brevipes AROM BROM068-06 MKP 2178 21-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains Tringa brevipes AROM BROM069-06 AJB 6033 23-Mar-1996 Australia, W. Australia, Fishead Beach, Broome Bird Observatory Tringa brevipes BEPAL KBPBU254-06 UWBM 44448 07-Feb-1992 Russia, Magadanskaya Oblast, headwaters of the Ola River Tringa erythropus SWEBI BISE030-07 BISE-Aves33 30-Jun-1997 Sweden, Norrbotten, Torne lappmark, RENSJON, NJOALLUNJAURE Tringa erythropus SWEBI BISE347-08 BISE-Aves360 13-Sep-2004 Sweden, Skane, Spillepeng, Burloevs Kommun Tringa erythropus NORBI BON012-06 NHMO-BC12 21-Jul-1966 Norway, Finnmark, Porsanger Tringa erythropus NORBI BON384-07 NHMO-BC384 01-Aug-2005 Norway, Troms, Tonsvika Tringa erythropus BROM BROM076-06 MKP 2637 26-Jun-1995 Finland, Lappi, 7 km NE Karigasniemi Tringa erythropus BROM BROM660-07 MKP 2767 01-Dec-1996 Viet Nam, Nam Ha, Xuay Thue, Lu Is Tringa erythropus BEPAL KBPBU236-06 UWBM 51066 09-Aug-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Tringa erythropus BEPAL KBPBU237-06 UWBM 51068 09-Sep-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Tringa erythropus BEPAL KBPBU238-06 UWBM 51069 09-Sep-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Tringa erythropus BEPAL KBPBU239-06 UWBM 44495 07-Sep-1992 Russia, Sakha, Cherskiy, Little Kon'kovaya River Tringa flavipes BNAUS BOTW058-04 USNM 622537 United States, Florida, Hillsborough, Macdill Air Force Base Tringa flavipes BROM BROM138-06 SVN 374 17-Aug-1981 Canada, Ontario, Cochrane dist, North Point Tringa flavipes AROM BROM139-06 SVN 449 01-Aug-1981 Canada, Ontario, Cochrane dist, North Point Tringa flavipes AROM BROM140-06 JGS 1634 20-Mar-1985 United States, TX, Chambers Co, 0.25 mi W Anahuac Nat Wildlife Ref Tringa flavipes AROM BROM141-06 JGS 1768 22-Mar-1985 United States, TX, Chambers Co, 0.25 mi W Anahuac Nat Wildlife Ref Tringa flavipes AROM BROM142-06 JGS 1770 22-Mar-1985 United States, TX, Chambers Co, 0.25 mi W Anahuac Nat Wildlife Ref

Appendix 1 Part 3: Scolopaci Specimens 151

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Tringa flavipes AROM BROM143-06 JGS 1827 24-Mar-1985 United States, Texas, Galveston Co, 3 mi SE High Is Tringa flavipes AROM BROM144-06 RCA 88-31 28-May-1988 Canada, Alberta Tringa flavipes AROM BROM145-06 RCA 88-36 28-May-1988 Canada, Alberta Tringa flavipes BARG KBARG007-07 MACN-Or-ct 1749 18-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Tringa flavipes BARG KBARG017-07 MACN-Or-ct 1743 15-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Tringa flavipes BARG KBARG051-07 MACN-Or-ct 1737 14-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Tringa flavipes TZBNA TZBNA121-03 JGS 1769 United States, Texas Tringa glareola SWEBI BISE033-07 BISE-Aves39 28-Jun-1997 Sweden, Norrbotten, Torne lappmark, Stenbacken, Luobasjaure Tringa glareola SWEBI BISE212-08 BISE-Aves216 22-Aug-2002 Sweden, Stockholm, Arlanda Tringa glareola SWEBI BISE330-08 BISE-Aves340 01-Aug-2000 Sweden, Oland, Ottenby birdstation Tringa glareola NORBI BON337-07 NHMO-BC337 17-Jun-2006 Norway, Hedmark, Ulvadalen Tringa glareola NORBI BON435-07 NHMO-BC435 01-Jan-1966 Norway, Finnmark, Ovre Pasvik Tringa glareola AROM BROM146-06 MKP 1441 11-Dec-1991 Namibia, Walvis Bay Tringa glareola AROM BROM147-06 MKP 1458 13-Dec-1991 South Africa, Western Cape, Sea Cow Lake, Durban, Sewage Works Tringa glareola AROM BROM148-06 MKP 2638 26-Jun-1995 Finland, Lappi, 7 km NE Karigasniemi Tringa glareola AROM BROM149-06 T.glareola19 14-Jul-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Tringa glareola BEPAL KBPBU255-06 UWBM 49734 13-Jul-1994 Russia, Murmanskaya O, Umba, shore of Kandalakshskaya Guba Tringa glareola BEPAL KBPBU256-06 UWBM 56441 25-May-1996 Russia, Astrakhanskaya Oblast', Astrakhan' Tringa glareola BEPAL KBPBU257-06 UWBM 56513 06-Oct-1996 Russia, Yamalo-Nenetskiy Aut. Okrug, Vengoyakha river, Noyabr'sk Tringa glareola BEPAL KBPBU258-06 UWBM 51134 13-Sep-1994 Russia, Primorskiy Kray, Lazo, near mouth of Tau-Khe river Tringa glareola BNAUS KKBNA231-05 USNM 586138 11-Jun-1996 Russia, Yamalo-Nenetskiy A. O., Vengoyakha River, Noyabr`Sk Tringa glareola BNAUS KKBNA291-05 UWBM 46894 18-Jun-1993 Russia, Khabarovskiy Kray, Ozero Evoron, along river bank Tringa glareola BNAUS KKBNA311-05 UWBM 49660 06-Jul-1994 Russia, Murmanskaya Oblast, Teriberka Tringa glareola BNAUS KKBNA348-05 UWBM 56512 10-Jun-1996 Russia, Yamalo-Nenetskiy Aut. Okrug, Noyabr`sk, Vengoyakha river Tringa incana BNAUS BOTW365-05 FMNH 346061 Marshall Islands, Enewetak Atoll, Buganegan Tringa incana AROM BROM070-06 JGS 2201 01-May-1987 United States, Alaska Tringa incana AROM BROM416-06 JGS 2202 01-May-1987 United States, Alaska Tringa melanoleuca BNAUS BOTW057-04 USNM 621163 United States, Washington, Grant, Moses Lake Tringa melanoleuca AROM BROM077-06 JAD 7513 07-Jul-1988 Canada, Ontario, Cochrane dist, 15 km NE Moosonee Tringa melanoleuca AROM BROM078-06 JGS 1633 03-Mar-1985 United States, Texas Tringa melanoleuca AROM BROM465-06 L50166 26-Apr-1999 Brazil, Rio Grande do Sul, Lagoa do Peixei Tringa melanoleuca AROM BROM534-07 1B-3539 01-May-2000 Canada, Nunavut, Keewatin Region, Akimiski Is Tringa melanoleuca AROM BROM661-07 JGS 1913 01-Jun-1985 United States, Alaska Tringa melanoleuca BARG KAARG012-07 MACN-Or-ct 160 01-Dec-2004 Argentina, Tringa melanoleuca BNAUS KBNA888-04 CWS38315 13-Oct-1987 Mexico, PASER DONA JUAN Tringa melanoleuca TZBNA TZBNA139-03 JAD 7239 Canada, Ontario, North Point, 18 km N Moosonee

Appendix 1 Part 3: Scolopaci Specimens 152

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Tringa nebularia SWEBI BISE102-07 BISE-Aves128 12-Aug-2001 Sweden, Stockholm, Uppland, Vaesterskaersringen Tringa nebularia SWEBI BISE331-08 BISE-Aves341 01-Aug-2000 Sweden, Oland, Ottenby birdstation Tringa nebularia NORBI BON030-06 NHMO-BC30 01-Jan-1966 Norway, Finnmark, Porsanger Tringa nebularia NORBI BON358-07 NHMO-BC358 02-Aug-2006 Sweden, Falsterbo, Nabben Tringa nebularia AAPR BOTW266-05 USNM 620112 02-Jul-1994 Sweden, Lappland, Abisko Kuokkel, Tringa nebularia AROM BROM150-06 MKP 1440 09-Dec-1991 Namibia, Walvis Bay Tringa nebularia AROM BROM151-06 MKP 1439 09-Dec-1991 Namibia, Walvis Bay Tringa nebularia BROM BROM152-06 SBB 023 02-Apr-1994 Australia, W. Australia, 80 Mile Beach Tringa nebularia AROM BROM153-06 SBB 026 02-Apr-1994 Australia, W. Australia, 80 Mile Beach Tringa nebularia AROM BROM154-06 MKP 2184 21-Mar-1994 Australia, W. Australia, 80 Mile Beach, Anna Plains Tringa nebularia AROM BROM155-06 1374069 01-Aug-1998 Netherlands, Waddenzee Tringa nebularia AAPR KKBNA232-05 USNM 620113 03-Jul-1994 Sweden, Lappland, Paksuniemi, 12 Km Ne Of Tringa ochropus SWEBI BISE459-08 BISE-Aves491 25-Jul-1999 Sweden, Stockholm, Arlanda airport Tringa ochropus SWEBI BISE460-08 BISE-Aves492 01-Sep-2001 Sweden, Skane, Lomma, Spillepeng, Spillepeng, Lomma kommun Tringa ochropus NORBI BON351-07 NHMO-BC351 20-May-2006 Norway, Ostfold, Kamperud Tringa ochropus NORBI BON361-07 NHMO-BC361 06-Aug-2006 Sweden, Falsterbo, Flommen Tringa ochropus BROM BROM126-06 C460-112734 09-May-1991 Denmark, Bornholm, Christiano Is Tringa ochropus BEPAL KBPBU249-06 UWBM 49481 17-Jun-1994 Russia, Sverdlovskaya Oblast, Nizhniye Sergi Tringa ochropus BEPAL KBPBU250-06 UWBM 49781 20-Jul-1994 Russia, Vologdaskaya Oblast', along Kobozha river Tringa ochropus BEPAL KBPBU251-06 UWBM 46903 21-Jun-1993 Russia, Khabarovskiy Kray Tringa ochropus BEPAL KBPBU252-06 UWBM 61210 23-Jun-1998 Russia, Krasnoyarskiy Kray, Apsheronskiy Rayon, Apsheronsk Tringa ochropus BEPAL KBPBU253-06 UWBM 44294 18-Jul-1992 Russia, Magadanskaya Oblast, Magadan, along Nel`kandja River Tringa semipalmata BNAUS BOTW056-04 USNM 622543 United States, Florida, Hillsborough, Macdill Air Force Base Tringa semipalmata AROM BROM060-06 W001 19-May-2001 United States, New Jersey, Cumberland Co, Egg Island Tringa semipalmata AROM BROM061-06 JAD 7299 08-Jun-1982 Canada, Saskatchewan, Reno Rural Mun, 3 km E Consul, Reno RM Tringa semipalmata AROM BROM062-06 RCA 87-199 01-Jun-1987 Canada, Alberta Tringa semipalmata AROM BROM063-06 WILL2 12-Sep-2002 United States, Georgia, Glynn Co, Little St Simon Is Tringa semipalmata AROM BROM064-06 MKP 470 10-Mar-1988 United States, Florida, Collier Co, Marco Is Tringa semipalmata AROM BROM065-06 MKP 477 10-Mar-1988 United States, Florida, Lee Co, Estero Is Tringa semipalmata AROM BROM066-06 MKP 478 10-Mar-1988 United States, Florida, Lee Co, Estero Is Tringa semipalmata BROM BROM541-07 RCA 87-182 01-Jun-1987 Canada, Alberta Tringa solitaria BNAAS BABNA420-07 TLBS 195149287 06-Aug-2006 Canada, Yukon Territory, Teslin Lake, Teslin Lake Bird Banding Stn Tringa solitaria BARG KBARG021-07 MACN-Or-ct 1735 14-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Tringa solitaria BARG KBARG070-07 MACN-Or-ct 1750 18-Sep-2006 Argentina, Corrientes, Distrito Capital, Estacion Biologica Corrientes Tringa solitaria PS-1 BNAUS BOTW012-04 USNM 601826 United States, Alaska, Anchorage, Elmendorf Air Force Base Tringa solitaria PS-1 TZBNA TZBNA148-03 JGS 1893 United States, Alaska

Appendix 1 Part 3: Scolopaci Specimens 153

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Tringa solitaria PS-1 TZBNA TZBNA555-03 JGS 1895 United States, Alaska Tringa solitaria PS-1 TZBNA TZBNA556-03 JGS 1896 United States, Alaska Tringa solitaria PS-1 TZBNA TZBNA557-03 JGS 1907 United States, Alaska Tringa solitaria PS-2 TZBNA TZBNA209-03 1B-781 Canada, Ontario, Wawa Tringa solitaria PS-2 TZBNA TZBNA558-03 MKP 334 Canada Tringa solitaria PS-2 TZBNA TZBNA559-03 MKP 335 Canada, Ontario, 5 km SE Hwy 560 and Hwy 144 Tringa solitaria PS-2 TZBNA TZBNA560-03 MKP 336 Canada, Ontario, 5 km SE Hwy 560 and Hwy 144 Tringa solitaria PS-2 TZBNA TZBNA561-03 MKP 337 Canada, Ontario, 5 km SE Hwy 560 and Hwy Tringa stagnatilis BROM BROM157-06 MKP 1353 29-Nov-1991 South Africa, Western Cape, Velddrif Tringa stagnatilis BROM BROM158-06 SBB 021 Australia, W. Australia, 80 Mile Beach Tringa stagnatilis BROM BROM159-06 SBB 022 Australia, W. Australia, 80 Mile Beach Tringa stagnatilis BEPAL KBPBU246-06 UWBM 66737 07-Jul-2000 Russia, Tuva, Erzynskiy Kozhuun, Ozero Tore-Khol', Kyzyl Tringa stagnatilis BEPAL KBPBU247-06 UWBM 59721 29-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Tringa stagnatilis BEPAL KBPBU248-06 UWBM 59950 30-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Tringa totanus SWEBI BISE191-08 BISE-Aves190 11-May-2004 Sweden, Gotland, Burs, Burs, Gotland Tringa totanus SWEBI BISE311-08 BISE-Aves318 11-May-2004 Sweden, Gotland, Burs, Gotland, Burs Tringa totanus NORBI BON084-06 NHMO-BC84 03-Jul-2004 Norway, Finnmark, Batsfjord Tringa totanus NORBI BON206-07 NHMO-BC206 03-Jul-2004 Norway, Finnmark, Sandfjorden Tringa totanus AROM BROM160-06 MKP 1572 15-Jul-1992 Iceland, Stokkseyri Tringa totanus AROM BROM161-06 MKP 1567 15-Jul-1992 Iceland, Stokkseyri Tringa totanus AROM BROM162-06 MKP 1568 15-Jul-1992 Iceland, Stokkseyri Tringa totanus AROM BROM163-06 MKP 1570 15-Jul-1992 Iceland, Stokkseyri Tringa totanus AROM BROM164-06 MKP 2240 Australia, W. Australia, 13 km S 80 Mile Beach, Anna Plains Tringa totanus AROM BROM165-06 MKP 2774 03-Dec-1996 Viet Nam, Ha Nam Ninh, Xuan Thuy, Lu Is Tringa totanus AROM BROM166-06 MKP 2775 04-Dec-1996 Viet Nam, Ha Nam Ninh, Xuay Thuy, Lu Is Tringa totanus BEPAL KBPBU240-06 UWBM 49714 07-Oct-1994 Russia, Murmanskaya Oblast, Teriberka Tringa totanus BEPAL KBPBU241-06 UWBM 61033 27-May-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Tringa totanus BEPAL KBPBU242-06 UWBM 66352 22-Jun-2000 Russia, Mongun-Taiginskiy Kozhuun, Ortaa-Shettey Valley, Kyzyl Tringa totanus BEPAL KBPBU243-06 UWBM 46266 20-May-1993 Kazakhstan, Almaty Oblysy, Alma-Ata, Sorbulak Ksl Tringa totanus BEPAL KBPBU244-06 UWBM 59800 05-Sep-1998 Mongolia, Hentiy, Bayan Ovoo, Kherlen Gol Tringa totanus BEPAL KBPBU245-06 UWBM 59942 29-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur Tryngites subruficollis BROM BROM372-06 JGS 1943 14-May-1985 United States, Nebraska, York Co, 4 mi NW York Tryngites subruficollis BROM BROM373-06 JGS 1960 01-Jun-1985 United States, Alaska Tryngites subruficollis BROM BROM540-07 JL 002 01-Jul-1998 Canada, Nunavut, Kitikmeot Region, Jenny Lind Is, Queen Maud Gulf Tryngites subruficollis TZBNA TZBNA150-03 JGS 1968 United States, Nebraska, 4 mi NW York, Xenus cinereus BROM BROM079-06 MKP 279 01-Dec-1985 Australia

Appendix 1 Part 3: Scolopaci Specimens 154

Project BOLD Museum Collection Identification Collection Location Code Process ID Sample ID Date

Xenus cinereus BROM BROM080-06 MKP 1473 17-Dec-1991 South Africa, KwaZulu-Natal, Durban, Bayhead Xenus cinereus BROM BROM081-06 TESA 28 22-Jul-1995 Russia, Chukotskiy Aut. Okrug, Anadyr River Xenus cinereus BROM BROM874-07 MKP 275 01-Dec-1985 Australia Xenus cinereus BEPAL KBPBU264-06 UWBM 44085 08-Mar-1992 Russia, Magadanskaya Oblast, Balagannoye, near mouth of Tauy R Xenus cinereus BEPAL KBPBU265-06 UWBM 51167 17-Sep-1994 Russia, Primorskiy Kray, Kiyevka, Melkovodnoe Zaliv Xenus cinereus BEPAL KBPBU266-06 UWBM 61247 22-Jul-1998 Russia, Krasnoyarskiy Kray, Anapskiy Rayon, Blagoveshchenskaya Xenus cinereus BEPAL KBPBU267-06 UWBM 44536 14-Jul-1992 Russia, Sakha, Cherskiy Xenus cinereus BEPAL KBPBU268-06 UWBM 59959 31-May-1998 Mongolia, Dornod, Dornod Aymag, Tashigay Nuur

Thinocoridae Attagis gayi BROM BROM382-06 JG 012 25-Jul-1995 Chile, Tarapaca, Las Cuevas, Portezuelo de Putre Attagis gayi BROM BROM383-06 JG 011 25-Jul-1995 Chile, Tarapaca, Las Cuevas, Portezuelo de Putre Attagis gayi BROM BROM384-06 JG 001 25-Jul-1995 Chile, Tarapaca, Portezuelo de Putre Attagis gayi BARG KBAR433-06 MACN-Or-ct 606 01-Jan-1996 Argentina, Rio Negro, Rio Chico Attagis gayi BARG KBAR454-06 MACN-Or-ct 1185 12-Nov-2005 Argentina, Catamarca, Rio Chaschuil, S of La Gruta Chile, Magallanes-Antartica, Estancia Oazy Harbour, ca 258 km N Punta Attagis malouinus BROM BROM712-07 WBSS AM2 21-Sep-1996 Arenas Attagis malouinus BARG KBAR389-06 MACN-Or-ct 290 09-May-2005 Argentina, Santa Cruz, Casco de la Estancia Condor Thinocorus orbignyianus BROM BROM532-07 MKP 2552 25-Feb-1995 Chile, Santiago Prov, Embalse el Yeso, ca 60 km E Santiago Thinocorus orbignyianus BROM BROM533-07 JG 004 25-Jul-1995 Chile, Tarapaca, Portezuelo de Putre Thinocorus orbignyianus BROM BROM585-07 MKP 2554 25-Feb-1995 Chile, Santiago, Embalse el Yeso, ca 60 km E Santiago Thinocorus orbignyianus BROM BROM589-07 JG 002 25-Jul-1995 Chile, Tarapaca, Portzuelo de Putre Thinocorus orbignyianus BROM BROM858-07 JG 010 25-Jul-1995 Chile, Tarapaca, Portezuelo de Putre Thinocorus orbignyianus BROM BROM859-07 MKP 2553 25-Feb-1995 Chile, Santiago, Embalse el Yeso, ca 60 km E Santiago Thinocorus orbignyianus BARG KBAR013-06 MACN-Or-ct 1102 09-Nov-2005 Argentina, Jujuy, E of Laguna Guayatayoc Thinocorus orbignyianus BARG KBAR014-06 MACN-Or-ct 1103 09-Nov-2005 Argentina, Jujuy, E of Laguna Guayatayoc Thinocorus orbignyianus BARG KBAR015-06 MACN-Or-ct 1180 12-Nov-2005 Argentina, Catamarca, Rio Chaschuil, Estancia Valle Chaschuil Thinocorus orbignyianus BARG KBAR016-06 MACN-Or-ct 865 08-Nov-2005 Argentina, Jujuy, E of Laguna Guayatayoc Thinocorus orbignyianus BARG KBAR748-06 MACN-Or-ct 1319 18-Nov-2005 Argentina, Catamarca, W of Pastos Largos Thinocorus orbignyianus BARG KBAR749-06 MACN-Or-ct 1321 18-Nov-2005 Argentina, Catamarca, W of Pastos Largos Thinocorus rumicivorus BROM BROM242-06 AJB 4409 28-Nov-1984 Argentina, Tierra del Fuego, Estancia Violeta, Rio Grande Thinocorus rumicivorus BROM BROM243-06 AJB 4419 28-Nov-1984 Argentina, Tierra del Fuego, Estancia Violeta, Rio Grande Thinocorus rumicivorus BROM BROM244-06 AJB 4411 01-Nov-1984 Argentina, Tierra del Fuego, Rio Grande Thinocorus rumicivorus BROM BROM245-06 AJB 4412 01-Nov-1984 Argentina, Tierra del Fuego, Antartida, Rio Grande Thinocorus rumicivorus BROM BROM246-06 AJB 4431 29-Nov-1984 Argentina, Tierra del Fuego, Estancia Violeta, Rio Grande