Multiple NF-κB and IFN Regulatory Factor Family Transcription Factors Regulate CCL19 Expression in Human -Derived Dendritic Cells This information is current as of September 29, 2021. Taija E. Pietilä, Ville Veckman, Anne Lehtonen, Rongtuan Lin, John Hiscott and Ilkka Julkunen J Immunol 2007; 178:253-261; ; doi: 10.4049/jimmunol.178.1.253 http://www.jimmunol.org/content/178/1/253 Downloaded from

References This article cites 57 articles, 33 of which you can access for free at:

http://www.jimmunol.org/content/178/1/253.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Multiple NF-␬B and IFN Regulatory Factor Family Transcription Factors Regulate CCL19 in Human Monocyte-Derived Dendritic Cells1

Taija E. Pietila¨,2* Ville Veckman,* Anne Lehtonen,† Rongtuan Lin,‡ John Hiscott,‡ and Ilkka Julkunen*

CCL19 has a central role in (DC) biology regulating DC traffic and recruitment of naive T cells to the vicinity of activated DCs. In this study, we have analyzed the regulation of CCL19 gene expression in human monocyte-derived DCs. DCs infected with Salmonella enterica or Sendai virus produced CCL19 at late times of infection. The CCL19 promoter was identified as having two putative NF-␬B binding sites and one IFN-stimulated response element (ISRE). Transcription factor binding experiments demonstrated that Salmonella or Sendai virus infection increased the binding of classical p50؉p65 and Downloaded from alternative p52؉RelB NF-␬B to both of the CCL19 promoter NF-␬B elements. Interestingly, Salmonella or Sendai virus infection also increased the binding of multiple IFN regulatory factors (IRFs), STAT1, and STAT2, to the ISRE element. Enhanced binding of IRF1, IRF3, IRF7, and IRF9 to the CCL19 promoter ISRE site was detected in Salmonella or Sendai virus-infected cell extracts. The CCL19 promoter in a luciferase reporter construct was activated by the expression of NF-␬B p50؉p65 or p52؉RelB dimers. IRF1, IRF3, and IRF7 proteins also activated CCL19 promoter in the presence of Sendai virus infection. CCL19 promoter constructs mutated at NF-␬B and/or ISRE sites were only weakly activated. Ectopic expression of RIG-I (⌬RIG-I, CARDIF) or http://www.jimmunol.org/ TLR3/4 (TRIF, MyD88, IKK␧, or TBK1) signaling pathway components induced CCL19 promoter activity, suggesting that these pathways are important in CCL19 gene expression. Our experiments reveal that expression of the CCL19 gene is regulated by a combined action of several members of the NF-␬B, IRF, and STAT family transcription factors. The Journal of Immunology, 2007, 178: 253–261.

endritic cells (DCs)3 are professional APCs that reside in ever, maturation of DCs leads to down-regulation of CCR6 and peripheral tissues where they are on alert for emerging thus loss of their responsiveness to CCL20. At the same time, pathogens. DCs regulate the activation of both innate mature DCs gain responsiveness to CCL19 via induced CCR7 ex- D by guest on September 29, 2021 and adaptive immune responses, and their role during microbial pression (2, 3). DCs eventually migrate to zones of local infections is well recognized. Upon contact with a microbe, they lymph nodes where T are also recruited by the effect undergo a maturation process that is associated with enhanced ex- of . CCL19, and the other ligand of CCR7, CCL21, are pression of Ag presenting and costimulatory molecules and the both expressed by stromal cells in the T cell zone of the lymph nodes production of and chemokines. Eventually, DCs migrate (4). Mice deficient in CCL19 and CCL21 or CCR7 display defective to a local lymph nodes where Ag presentation to naive T cells DC traffic and impaired immune responses (5–7). Because DCs are takes place (1). also capable of producing both CCL19 and CCL20, it is evident that DC trafficking is tightly controlled by differential expression of these chemokines have a unique role in DC biology. chemokine ligands and chemokine receptors. Immature DCs ex- Transcription of and chemokine requires the press CCR6 and respond to its exclusive ligand CCL20 (2). How- controlled action of multiple transcription factors activated by mi- crobes or their structural components. Activated transcription fac- *Department of Viral Diseases and Immunology, National Public Health Institute, tors bind to the regulatory elements of cytokine/chemokine genes, † Helsinki, Finland; Molecular Cancer Biology Program, Institute of Biomedicine, and may either repress or activate the transcription of the respec- Biomedicum Helsinki, Finland; and ‡Lady Davis Institute for Medical Research, De- partment of Microbiology and Immunology, Department of Medicine, and Depart- tive gene. Mammalian NF-␬B/Rel family has five members; NF- ment of Oncology, McGill University, Montreal, Canada ␬B1 (p50), NF-␬B2 (p52), RelA (p65), RelB, and c-Rel. NF-␬B Received for publication May 24, 2006. Accepted for publication October 9, 2006. plays an important role in the regulation of innate immunity by The costs of publication of this article were defrayed in part by the payment of page activating a wide variety of immune response genes, such as proin- charges. This article must therefore be hereby marked advertisement in accordance flammatory cytokines and chemokines, and cell adhesion mole- with 18 U.S.C. Section 1734 solely to indicate this fact. cules (8–10). NF-␬B proteins form various homo- or heterodimers 1 This work was supported by the Medical Research Council of the Academy of Finland and the Sigrid Juselius Foundation. that bind to specific NF-␬B recognition sites located in the regu- 2 Address correspondence and reprint requests to Dr. Taija E. Pietila¨, Department of latory regions of many genes (10). Viral Diseases and Immunology, National Public Health Institute, Mannerheimintie IFN regulatory factors (IRFs) constitute a family of nine 166, FI-00300 Helsinki, Finland. E-mail address: taija.pietila@ktl.fi (IRF1–9) transcription factors that bind to a specific DNA motif 3 Abbreviations used in this paper: DC, dendritic cell; IRF, IFN regulatory factor; known as the IFN-stimulated response element (ISRE) (11). ISRE, IFN-stimulated response element; ISGF3, IFN-stimulated gene factor 3; MOI, multiplicity of infection; PDTC, pyrrolidine dithiocarbamate; DEM, diethyl maleate; Among IRF family members, IRF1, IRF3, and IRF7 have been CsA, cyclosporin A; IKK␧, inducible I␬B kinase; TBK1, Tank binding kinase 1; established as essential factors for chemokine gene expression TRIF, Toll/IL-1R homology domain containing adaptor -inducing IFN-␤. in response to viral or cytokine stimulation (12–16). Recently, Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$2.00 IRF5 has also been implicated in the regulation of cytokine and www.jimmunol.org 254 CCL19 REGULATION IN HUMAN DENDRITIC CELLS chemokine gene expression (17, 18). IRF9 (p48/ISGF3␥) inter- acts with STAT1 and STAT2 and forms a complex called IFN- stimulated gene factor 3 (ISGF3) that is also able to bind to ISRE sequences (11, 19). ISGF3 or IRF9/STAT1 complexes have been previously associated with the regulation of chemo- kine gene expression (20, 21). We have previously reported that CCL19 mRNA is induced in human monocyte-derived DCs in response to Streptococcus pyo- genes (22), Salmonella enterica serovar typhimurium (23), and Sendai virus infections (24). Furthermore, recent findings by us and others have shown that DCs harbor Salmonella (23, 25–27) and that mature DCs containing Salmonella migrate toward che- mokines CCL19 and CCL21 (27). At present, the mechanisms by which CCL19 expression is regulated have been only partially re- vealed. Saccani and Natoli (28) have previously shown that LPS- stimulated DCs up-regulate the expression of CCL19 by a meth- ylation event occurring at lysine 9 of histone H3. Moreover, a phenomenon called NF-␬B dimer exchange on CCL19 promoter has been described in LPS-stimulated DCs (29). Also, the murine Downloaded from CCL19 has been reported to contain a functional NF-␬B binding site with an alternative consensus sequence that preferentially binds RelB/p52 dimers (30). Because CCL19 is central in DC biology, we aimed to study its expression in human monocyte-derived DCs in detail. We have

used Salmonella or Sendai virus, which are able to induce the http://www.jimmunol.org/ expression of CCL19 in human DCs. We show that these microbes activate different members of the NF-␬B, IRF, and STAT families in DCs, and they bind to the CCL19 promoter NF-␬B and ISRE elements in a coordinated fashion. These results were further con- FIGURE 1. Microbe-induced CCL19, CCL20, CXCL10, and IFN-␥ firmed by studying the transcriptional activity of the CCL19 pro- gene expression in human DCs. Monocyte-derived DCs from four individ- moter in a luciferase reporter assay. ual blood donors were infected with Salmonella or Sendai virus for indi- cated times. A, The cells were pooled and total cellular RNA was isolated Materials and Methods for Northern blotting. Ethidium bromide staining of ribosomal RNA and Cell culture ␤-actin probing were used to monitor equal RNA loading. B, CCL19, by guest on September 29, 2021 CCL20, CXCL10, and IFN-␥ protein production from cell culture super- Leukocyte-rich buffy coats were obtained from healthy blood donors (Finn- natants (blood donors were analyzed separately) was determined by ish Red Cross Blood Transfusion Service, Helsinki, Finland). PBMCs were isolated by a density gradient centrifugation using Ficoll-Paque (Amer- ELISA. Error bars represent SD of the means. sham Biosciences) followed by isolation of by Percoll gradient centrifugation (Amersham Biosciences) as described previously (23, 31). Remaining T and B cells were depleted using anti-CD3 and anti-CD19 ϫ 6 magnetic beads (Dynal Biotech). Monocytes (2.5 10 cells/well) were Alexis Biochemicals. PDTC and DEM were used at 100 ␮M unless oth- allowed to adhere to six-well plates (Falcon, BD Biosciences) for1hat erwise indicated, and CsA was used at 1 ␮g/ml. 37°C in RPMI 1640 medium (Sigma-Aldrich) supplemented with antibi- otics and glutamine without FCS. Nonadherent cells were removed by Northern blot analysis washing with PBS. To obtain immature DCs, monocytes were grown in RPMI 1640 medium (2 ml/well) supplemented with 10% FCS (Integro Total cellular RNA was isolated with RNeasy Midi kit (Qiagen). Equal BV), recombinant human-IL-4 (20 ng/ml; R&D Systems), and GM-CSF amounts of RNA (10 ␮g) were size-fractionated on a 1.0% formaldehyde- (10 ng/ml; Biosite) for 6–7 days. Fresh medium was added every 2 days (1 agarose gel, transferred to a nylon membrane (Hybond; Amersham Bio- ml/well). sciences), and hybridized with CCL19 and CCL20 (provided by Dr. A. HEK293 cells (American Type Culture Collection (ATCC) CLR1573) Zlotnik, Neurocrine Biosciences, San Diego, CA) (33), IFN-␥ (34), and were maintained in Eagle-MEM (Sigma-Aldrich) with antibiotics and 10% CXCL10 (21) probes. To control equal RNA loading, ribosomal RNA FCS. One day before transfections, 75 000 cells/well were seeded on 24- bands were stained with ethidium bromide, or membranes were hybridized well plates (Falcon) in Eagle-MEM with 2% FCS. with a ␤-actin probe. The probes were labeled with [␣-32P]dATP (3000 Ci/mmol; Amersham Biosciences) by a random-primed DNA labeling kit. Infections Membranes were hybridized overnight in Ultrahyb buffer (Ambion) at 42°C. Membranes were washed three times with 1 ϫ SSC/0.1% SDS at Salmonella enterica serovar typhimurium ATCC 14028 strain was grown 42°C and once at 65°C, and then exposed to Kodak BioMax XAR films as described previously (23). A multiplicity of infection (MOI) of 5 was (Eastman Kodak) at Ϫ70°C with intensifying screens. The results were used throughout the study. Sendai (Cantell strain) virus was grown as out- quantitated using Kodak Digital Science 1D image analysis software. lined by Ronni et al. (32). The hemagglutination titer of Sendai virus was 4098, and the infectivity of the stock in DCs was 6 ϫ 109 PFU/ml (24). To ELISA ensure 100% infection in DCs, a MOI of 50 was used. CCL19 and CCL20 levels from cell culture supernatants were determined Cytokines and inhibitors by a Duoset kit (R&D Systems). CXCL10 levels were measured using Ab ␥ ␣ ␥ pairs and standards obtained from BD Pharmingen, and IFN- determina- Highly purified human leukocyte IFN- and IFN- were provided by the tions were conducted with an Elipair kit (Nordic Biosite). Finnish Red Cross Blood Transfusion Service and used at 100 IU/ml. Re- combinant human IL-1␤ and TNF-␣ were purchased from R&D Systems Plasmids and used at 10 ng/ml. PD98059 and SB202190 (Calbiochem) were used at 50 ␮M and 10 ␮M, respectively. Pyrrolidine dithiocarbamate (PDTC), DNA fragment of 1478 bp encompassing the CCL19 promoter area was diethyl maleate (DEM), and cyclosporin A (CsA) were obtained from amplified from human chromosomal DNA using the following The Journal of Immunology 255 Downloaded from http://www.jimmunol.org/

FIGURE 2. The effect of intracellular signaling pathway inhibitors on CCL19, CCL20, CXCL10, and IFN-␥ gene expression in DCs. Cells were left untreated or treated with inhibitors 30 min before infection with Salmonella. A, PD98059, SB202190, PDTC/DEM, and CsA were used to block ERK MAPK, p38 MAPK, NF-␬B, and NFAT pathways, respectively. The expression of CCL19 and CCL20 mRNAs was analyzed by Northern blotting. Total cellular RNA was pooled from four individual blood donors. ␤-Actin probing was used to monitor equal RNA loading. A repre- sentative experiment of three is shown. B, DCs were treated with NF-␬B inhibitors PDTC or DEM with indicated concentrations and infected with Salmonella. Inhibitors were added at the 10-h time point to ensure sufficient inhibitor concentration throughout the experiment. mRNA expression by guest on September 29, 2021 was studied as in A at 24 h after infection using also CXCL10 and IFN-␥ probes. The Northern blotting results were quantitated by measuring the band intensities and normalized by ␤-actin levels. Relative mRNA levels as compared with Salmonella 9h(A)orSalmonella 24h(B) are shown below the corresponding probings. primers: sense, 5Ј-ACTCAGGGATCCTCACTTAATCCTAAG (BamHI- (TBK1) (40) have been described elsewhere. Toll/IL-1R homology domain site underlined) and antisense, 5Ј-CGACTGAAGCTTAGGGGTGAAAT containing adaptor protein-inducing IFN-␤ (TRIF) and MyD88 expression GCAAGG (HindIII-site underlined) (all oligonucleotides used in the study plasmids were gifts from Dr. K. Fitzgerald (University of Massachusetts were obtained from DNA Technology). The resulting PCR product was Medical School, Worcester, MA). directly TA-cloned into the PCRII-vector (Invitrogen Life Technologies), from which it was released by BamHI and HindIII digestion. The fragment Transfections was cloned into BglII and HindIII restriction sites of the pGL3-basic (Pro- HEK293 cells were seeded on 24-well plates 1 day before transfection, mega) luciferase vector and named CCL19promWT thereafter. Site-spe- after which the reporter and NF-␬B or IRF expression plasmids (100 ng/ cific mutations were introduced using the QuickChange II site-directed plasmid) were introduced into cells using FuGENE6 (Roche) transfection mutagenesis kit (Stratagene), and the correct mutations were confirmed by reagent. Renilla luciferase plasmid (10 ng/reaction; Promega) was used to sequencing. The primers used for creating base mutations for relevant bind- control transfection efficiency. Cells were collected 18 h after transfection. ing sites were as follows: NF-␬B(1), 5Ј-CACAGAATGGGACATGAAG In some experiments, the cells were infected with Sendai virus (MOI, 50) aaaAATTTaAGGCAGAGAAAGTGAAG; NF-␬B(2), 5Ј-GAAGCACCA for 24 h. Luciferase reporter assays were performed with a Dual Glo kit GTGAGGACAAaaaATAAAaaTAAGGAAGGGAGCAC; and ISREmut, (Promega) according to manufacturer’s instructions. 5Ј-CTGGGCGTTTCACATTTAaaaaCTCaaaCAAGGCC (mutated nucle- otides are written in lower case). DNA affinity binding and Western blot analysis Human p50 and p65 cDNAs have been described previously (14), and p52 in pCDNA3 and RelB cloned in frame with a FLAG epitope in Equal amounts of cells were collected, and nuclear extracts were prepared pCDNA3 were provided by Dr. G. Natoli (Institute for Research in Bio- by lysing the cells in buffer containing 10 mM HEPES-KOH, 10 mM KCl, medicine, Bellinzona, Switzerland). The human IRF1 gene was amplified 1.5 mM MgCl2, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor with sense, 5Ј-CTGCAGGATCCCCAACATGCCCATCACTTGGATG mixture (Complete; Roche). The remaining nuclei were lysed in 10 mM and antisense, 5Ј-GCC CAGGATCCCTGCTACGCTGCACAGGGAA HEPES, 400 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01%

TGG oligonucleotides and cloned into the BamHI site (underlined) of the Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mix- expression plasmid pBC12/CMV (35). Human IRF5 cDNA was cloned ture. Both strands of the DNA elements were synthesized with BamHI from total cellular RNA isolated from human by PCR using overhangs as spacers, and the upper strand oligonucleotide was 5Ј-biotin- sense, 5Ј-TCGGACGGATCCACCATGAACCAGTCCATCCCAGT and ylated (DNA Technology): CCL19 NF-␬B(1) (GGATCCGACATGAAG antisense, 5Ј- CCGTCTGGATCCCTATTATTGCATGCCAGCTGGGT GGGAATTTCAGGCAGAGAAA), NF-␬B(2) (GGATCCGAGGACAAG oligonucleotides and inserted into the BamHI site (underlined) of the GGATAAACCTAAGGAAGGG), and CCL19 ISRE (GGATCCCACAT pCDNA3.1(ϩ)-FLAG-tagged expression vector (36). Expression con- TTAGTTTCTCTTTCAAGGCCTTCT). Protein samples were incubated structs for IRF3 (37), IRF7 (38), retinoic acid-inducible gene I (RIG-I) and for2hat4°Cwith streptavidin-agarose beads (Pierce) coupled to annealed ⌬RIG-I (39), inducible I␬B kinase (IKK␧), and Tank binding kinase 1 oligonucleotides. The binding reactions were performed in binding buffer 256 CCL19 REGULATION IN HUMAN DENDRITIC CELLS

containing 10 mM HEPES, 133 mM KCl, 10% glycerol, 2 mM EDTA, 1

mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture followed by washing the unbound proteins with binding buffer. The oligonucleotide-bound proteins were released in SDS sample buffer and separated on 8 or 10% SDS-PAGE gels. For direct West- ern blot analysis, cells were lysed in the presence of 0.5 mM DTT, 1 mM ␮ Na3VO4, and a protease inhibitor mixture, and 20 g of protein aliquots were run on 10% SDS-PAGE gels. Proteins were transferred onto Immobilon-P membranes (Millipore), and specific Abs were used to visualize the protein bands on HyperMax or Biomax film using the ECL system (Amersham Biosciences). The results were quantitated using Kodak Digital Science 1D image analysis software. Raising Abs in guinea pigs (anti-IRF1, anti-IRF7) and rabbits (anti-IRF3) has been described previously (15, 24, 41). Rabbit anti-phospho-S396- IRF3 was as described previously (42). Rabbit anti-IRF9 (sc-496), anti- STAT1 (sc-346), anti-STAT2 (sc-476), anti-p50 (sc-7178), anti-p65 (sc- 372) anti-RelB (sc-226X), and anti-actin (sc-10731) were all obtained from Santa Cruz Biotechnology. Rabbit anti-p52 (06-413) was obtained from Upstate Biotechnology. Anti-IRF5 was prepared in rabbits by immunizing the animals four times at 4-wk intervals with preparative SDS-PAGE (Bio- Rad) purified Escherichia coli-expressed GST-IRF5 fusion protein (20 ␮g/ immunization). The animals were bled 7 days after the last immunization.

HRP-conjugated anti-guinea pig (P0141) and anti-rabbit (P0448) Igs ob- Downloaded from tained from DakoCytomation were used as secondary Abs. Results Salmonella- and Sendai virus-induced expression of CCL19, CCL20, CXCL10, and IFN-␥ genes in DCs

Chemokine and IFN-␥ expression was first studied at the mRNA http://www.jimmunol.org/ level by Northern blotting (Fig. 1A). DCs were left uninfected or infected with Salmonella or Sendai virus, and total cellular RNA was collected at different time points. Consistent with our previous findings (23), CCL19 expression was only seen at later time points starting from 9 h, whereas CCL20 expression peaked at3hand was down-regulated thereafter. CXCL10 mRNA expression was rapid and seen at 3-h infection after infection with Salmonella as well as with the Sendai virus. Although CXCL10 mRNA levels remained elevated almost 48 h after infection with Salmonella, by guest on September 29, 2021 FIGURE 3. Nucleotide sequence of the 5Ј-flanking promoter region of Sendai virus-induced CXCL10 mRNA levels returned to undetect- ␥ the human CCL19 gene (essentially the same as the sequence derived from able levels within 24 h. IFN- mRNA expression was slowly in- accession no. AL162231). A fragment of the CCL19 promoter encompass- creased until the 48-h time point in Salmonella-infected cells, ing nucleotide residues from Ϫ1437 to ϩ41 relative to the ϩ1 transcription whereas its expression was only seen at3hinSendai virus-in- start site was cloned to a luciferase reporter vector and confirmed by se- fected cells. quencing. The sequence was compiled from the sequenced clone and the Next, CCL19, CCL20, CXCL10, and IFN-␥ protein levels from data in accession no. AL162231. The program Vector NTI Suite was used to cell culture supernatants were determined by ELISA (Fig. 1B). The analyze the sequence for putative transcription factor binding sites. Previously results are well in line with the mRNA expression data. In mono- identified transcription and translation initiation sites are marked with arrows, cyte-derived DCs, Salmonella appeared to be a better inducer of all and a putative TATA-box is underlined. Core sequences of the potential tran- analyzed chemokine genes and IFN-␥ as compared with Sendai scription factor binding sites are typed in bold face, and boxed sequences indicate oligonucleotides used for DNA affinity binding experiments. virus. Typically, some constitutive CCL19 production was de- tected in uninfected DCs. cluded CXCL10 and IFN-␥ in the analysis to monitor the overall pathway inhibitors reduce CCL19 production effects of the inhibitors (Fig. 2B). Consistent with the above re- in DCs sults, CCL19 mRNA level was down-regulated dose dependently To determine which intracellular signal transduction pathways are in response to PDTC and DEM also at 24 h. However, we detected required for CCL19 production in DCs, we treated the cells with nonspecific up-regulation of CCL20 mRNA in response to the chemical inhibitors. PD98059 selectively blocks the activity of highest PDTC concentration. CXCL10 and IFN-␥ mRNA levels ERK MAPK and has no effect on the activation of p38 or JNK (43, were partially down-regulated as expected, demonstrating the im- 44), whereas SB202190 inhibits the action of p38 MAPK (45). portance of the NF-␬B sites in both of these genes (12, 50). PDTC and DEM are widely used as inhibitors of NF-␬B activation (46–48), and CsA blocks the action of NFAT family of transcrip- The human CCL19 promoter tion factors (49). DCs were treated with these inhibitors 30 min To characterize transcription factors that could be involved in reg- before infection with Salmonella and total cellular RNA was col- ulating CCL19 gene expression, we analyzed the CCL19 promoter lected at 9 h. As shown in Fig. 2A, Salmonella-induced CCL19 region using Vector NTI suite and MatInspector programs. The mRNA levels were down-regulated to some extent in response to detailed sequence of the promoter region is presented in Fig. 3. We all inhibitors tested. In contrast, CCL20 mRNA levels were clearly identified two putative NF-␬B binding sites located between nt affected by DEM and CsA. To further investigate the differential Ϫ62 to Ϫ52 and nt Ϫ363 to Ϫ354 (relative to the transcription effects of PDTC and DEM on CCL19 and CCL20 mRNA levels, start site) referred to as NF-␬B(1) and NF-␬B(2) hereafter. In ad- we performed a similar experiment as described above, and in- dition, a potential consensus ISRE element was identified further The Journal of Immunology 257

FIGURE 4. Salmonella and Sen- dai virus infection enhances NF-␬B binding to CCL19 promoter DNA el- ements in DCs. Nuclear extracts were prepared from DCs infected with Salmonella or Sendai virus for indicated times. Proteins binding to CCL19 promoter NF-␬B(1) (A) and NF-␬B(2) (B) DNA elements were pulled down by DNA affinity binding assay, separated on 10% SDS- PAGE, and analyzed by Western blotting with anti-p65, anti-p50, anti- RelB, and anti-p52 Abs. The results were quantitated by determining the band intensities. Relative binding of ␬

NF- B components, compared with Downloaded from 3 h control, is shown on the right pan- els. This experiment was performed three times with similar results. http://www.jimmunol.org/

upstream between nt Ϫ851 to Ϫ842. Other putative transcription (Fig. 5A). Sendai virus also induced the expression of IRF1, IRF7, factor binding sites displaying less significant similarity with the and IRF9, but to a lesser extent than Salmonella. In the case of IRF3, transcription factor consensus sequences were found by the pro- a slower migrating form of IRF3 (representing the phosphorylated grams, but we focused on the three sites described above, because form, see below) is detected at the 3-h time point. STAT1 protein it is expected that these elements would be of greatest importance expression was weakly reduced in Sendai virus-infected cells. in regulating microbe-induced CCL19 gene expression in DCs. Next, we performed DNA affinity binding experiments using CCL19 ISRE element oligonucleotides. Interestingly, the ISRE el- by guest on September 29, 2021 ␬ Functionality of NF- B and ISRE elements in DCs ement bound multiple IRFs, STAT1, and STAT2 (Fig. 5B). In- To analyze the functionality of the putative CCL19 promoter duced IRF1 binding was detected in response to Salmonella at 9 NF-␬B sites in DCs, we performed DNA affinity binding experi- and 24 h. Sendai virus, in contrast, increased IRF1 binding already ments. DCs were infected with Salmonella or Sendai virus fol- at 3 h. It was of interest that the m.w. of microbe-induced ISRE- lowed by isolation of cells and preparation of nuclear extracts for bound IRF1 was somewhat lower as compared with that found in promoter element binding experiments. Proteins binding to biotin- uninfected cells. This difference could be due to degradation or ylated oligonucleotides spanning the CCL19 promoter NF-␬B(1) differential phosphorylation of IRF1. Basal IRF3 binding to the and NF-␬B(2) elements were pulled down and identified by West- promoter element was clearly detectable, but an activated form of ern blotting using NF-␬B-specific Abs. Both NF-␬B(1) (Fig. 4A) IRF3 upon Sendai stimulus was detected using a specific anti- and NF-␬B(2) (Fig. 4B) elements bound the classical pathway phospho-S396-IRF3. Also in case of IRF5, some basal binding of NF-␬B components, p50 and p65, with similar efficiency (upper IRF5 to the promoter element was observed in untreated cells. two blots). The binding of p65 was clearly increased during infec- However, no microbe-induced enhancement of IRF5 binding to tion with Salmonella or Sendai virus. Homodimers of p50 (and ISRE oligonucleotide could be detected (Fig. 5B). Strong IRF7 and likely p52) are constitutively transported into the nucleus, where moderate IRF9 binding to the promoter element was observed in they may function as suppressors of gene expression (51, 52). response to Salmonella. IRF7 binding to the promoter element was Basal binding of p50 was seen in uninfected cells, but its binding also induced in Sendai virus-infected cells, whereas no detectable was also increased simultaneously with p65 binding in response to increase in IRF9 binding could be seen. Finally, both Salmonella Salmonella or Sendai virus infection. In addition, both NF-␬B(1) and Sendai virus increased the binding of STAT1 and STAT2 to and NF-␬B(2) promoter elements were able to bind p52 and RelB the CCL19 ISRE element, although STAT2 binding was decreased (Fig. 4; lower two blots). c-Rel binding to NF-␬B(1) and NF-␬B(2) rapidly after3hofSendai virus infection. elements could not be detected, and no significant differences in bind- ing of NF-␬B components were seen at later time points (48 h; data Cytokine inducibility of CCL19 expression in DCs not shown). As observed above, both bacterial and viral stimulation of DCs is We then studied the functionality of the putative ISRE binding able to turn on CCL19 gene expression. Because CCL19 promoter site upstream of the NF-␬B sites. First, we characterized by direct had functional ISRE and NF-␬B sites, we studied whether cytokine Western blotting whether the expression of IRF proteins was al- stimulation is sufficient to induce CCL19 production. We stimu- tered during Salmonella or Sendai virus infection in DCs. In Sal- lated DCs with STAT-activating cytokines IFN-␣ or IFN-␥,or monella-infected cells the expression of IRF1, IRF7, IRF9, and with NF-␬B-activating IL-1␤ or TNF-␣. For comparison, we also STAT2 proteins was induced to a different degree, whereas IRF3, infected the cells with Salmonella or Sendai virus with different IRF5, and STAT1 protein levels remained virtually unchanged MOIs. None of the cytokine treatments alone could induce significant 258 CCL19 REGULATION IN HUMAN DENDRITIC CELLS

FIGURE 6. Cytokine-stimulated DCs are capable of producing CCL19 and CCL20. Monocyte-derived DCs were stimulated with purified IFN-␣ (100 IU/ml), IFN-␥ (100 IU/ml), TNF-␣ (10 ng/ml), or IL-1␤ (10 ng/ml) alone, or in different combinations as shown in the figure. For comparison, Downloaded from DCs were also infected with Salmonella or Sendai virus at indicated MOIs. Cell culture supernatants were collected at 24 h and analyzed for CCL19 and CCL20 production by ELISA. The results are the means (ϮSD) of DCs from four blood donors analyzed separately.

CCL19promWT. We also created NF-␬B and ISRE site mutant http://www.jimmunol.org/ forms of the promoter as shown in Fig. 7A. Because primary DCs are not suitable for conventional transfections, we transiently trans- fected HEK293 cells with CCL19promWT reporter and NF-␬〉 ex- pression plasmids and examined the ability of the promoter construct to drive the expression of the firefly luciferase gene. CCL19promWT transfected alone did not result in reporter gene expression in HEK293 cells. However, the expression of NF-␬B ϩ ϩ FIGURE 5. Multiple IRF and STAT transcription factors bind to the components p50 p65 or p52 RelB led to strongly enhanced, by guest on September 29, 2021 CCL19 promoter ISRE element in DCs. A, Expression of IRF and STAT 325- or 70-fold activation of the promoter construct, respectively proteins in microbe-infected DCs. Whole cell extracts were prepared from (Fig. 7B). These results demonstrate that either p50ϩp65 or Salmonella or Sendai virus-infected DCs, separated on 10% SDS-PAGE, p52ϩRelB dimers can activate transcription of the CCL19 gene. and analyzed by direct Western blotting with anti-IRF or anti-STAT-specific Proximal NF-␬B(1) mutant construct lost a significant proportion Abs. Actin staining shows equal protein loading. B, Nuclear extracts were of its response to cotransfected p50ϩp65 or p52ϩRelB (ϳ80%). prepared from DCs, and proteins binding to the CCL19 ISRE element were However, mutation of NF-␬B(2) site interfered with the promoter pulled down by DNA affinity binding assay. Bound proteins were separated on activity to a lesser extent; 54 or 30% of the activity was lost with 10% SDS-PAGE (8% for detection of P-IRF3, IRF5, STAT1, and STAT2), NF-␬B(2) mutant in the presence of overexpressed p50ϩp65 or and analyzed by Western blotting with specific Abs as indicated in the figure. p52ϩRelB, respectively. A promoter construct containing muta- tions in both NF-␬B(1) and NF-␬B(2) sites showed an inhibition of transcription comparable to that of the NF-␬B(1) mutant. These production of CCL19 as measured by ELISA (Fig. 6). However, the results suggest that the proximal NF-␬B(1) site is the major NF- production of CCL20 could be seen after IL-1␤ stimulation but not by ␬B-responsive element in the human CCL19 promoter. TNF-␣. ⌻his is contradictory to the previous reports that indicate Next, we studied the role of IRFs in the induction of CCL19 CCL20 as a gene up-regulated by TNF-␣ via a NF-␬B-dependent promoter activity. Because HEK293 cells transiently transfected mechanism (53, 54). However, when IFNs were combined with with CCL19promWT and IRF1, IRF3, or IRF7 expression plas- IL-1␤ or TNF-␣, elevated levels of CCL19 and CCL20 were detected mids did not result in significant induction of promoter activity in DC supernatants. In contrast, as compared with the cytokine treat- (Fig. 7C), we used Sendai virus as an activator of IRFs. Sendai ments, Salmonella-infected DCs secreted higher levels of CCL19 and virus has extensively been used in studies concerning the regula- CCL20. In the case of CCL19, Salmonella MOI 100 was toxic for the tory role of IRF1, IRF3, and IRF7 in cytokine gene expression (13, cells and the production of CCL20 was no longer dose responsive. As 14, 21). The activation of IRF5, however, has been shown to occur, compared with Salmonella, Sendai virus was a weaker inducer of e.g., by vesicular stomatitis virus or Newcastle disease virus, but chemokine production at all tested MOIs. not by Sendai virus (17). In the presence of Sendai virus infection, all IRFs were able to activate the CCL19promWT 14- to 20-fold, ␬ Regulation of CCL19 transcription through NF- B and depending on the IRF protein. The greatest activation of the ISRE sites CCL19 promoter was seen in response to IRF3 expression. As To better characterize the role of NF-␬B and ISRE sites in CCL19 expected, the expression of IRF5 during Sendai virus infection did gene expression, we PCR-cloned the CCL19 promoter region en- not induce CCL19 promoter activity (data not shown). Moreover, compassing nucleotide residues from Ϫ1437 to ϩ 41 bp relative to IRF5 did not activate CCL19 promoter in response to vesicular the transcription start site (Fig. 3). The promoter fragment was stomatitis virus infection (data not shown). The role of ISRE site cloned into pGL3basic luciferase reporter vector and was named as (located upstream of the two NF-␬B sites) was examined by using The Journal of Immunology 259

FIGURE 8. RIG-I and TLR pathways are involved in the activation of the CCL19 promoter transcription. HEK293 cells were transfected with pGL3basic or CCL19promWT alone or together with RIG-I, ⌬RIG-I (con- stitutively active form), CARDIF, TRIF, MyD88, IKK␧, or TBK1 expres- sion plasmids. After overnight transfection, the cells were infected with Sendai virus for 24 h, after which luciferase activities were measured. Luciferase levels were normalized with Renilla activities and then plotted

as fold induction (test plasmid/pGL3basic) with pGL3basic activity nor- Downloaded from malized to value 1. The data shown are the means (ϮSD) of triplicate determinations. A representative experiment is shown.

contrast, MyD88, a central TLR adaptor molecule, transmits a signal in a complex pathway leading to the activation of MAPKs and NF- ␬ B. The MyD88-independent pathway triggered by TLRs is governed http://www.jimmunol.org/ by TRIF. TLR3/4-activated TRIF is also able to activate TBK-1 and IKK␧, leading to enhanced expression of type I IFN genes (55). The involvement of these signaling components in the activation of CCL19 promoter was examined using HEK293 cell transfection approach. Plasmids encoding RIG-I, or its constitutively active form ⌬RIG-I, CARDIF, TRIF, MyD88, IKK␧, or TBK1 were in- troduced in the cells together with the CCL19 promoter, and the FIGURE 7. NF-␬B and IRF family members regulate CCL19 promoter cells were left uninfected or infected with Sendai virus. The full- activity. A, WT and mutated sequences of human CCL19 promoter region length RIG-I-dependent activation of CCL19 promoter required by guest on September 29, 2021 ␬ ␬ containing the NF- B(1), NF- B(2), and ISRE elements (mutations shown Sendai virus infection, whereas ⌬RIG-I could activate the pro- in lower case). B, HEK293 cells were transfected with pGL3-basic back- moter independently of virus infection (Fig. 8). Interestingly, over- bone vector, CCL19promWT, or different CCL19 promoter NF-␬B mutant expression of TRIF also activated the promoter efficiently and in- constructs with or without NF-␬B expression plasmids as shown in the figure. The luciferase activities indicating transcriptional activity were measured in dependently of virus infection. Ectopic expression of CARDIF, ␧ cell extracts collected at 18 h after transfection. C, HEK293 cells were trans- MyD88, IKK , or TBK-1 directly stimulated CCL19 promoter ac- fected with pGL3-basic backbone vector, CCL19promWT, or an ISRE mutant tivity, but the promoter-inducing activity was also clearly en- construct alone, or in combination with IRF expression plasmids. After over- hanced by Sendai virus infection (Fig. 8). As a whole, our exper- night transfection, the cells were infected with Sendai virus for 24 h, after iments indicate that CCL19 promoter activity can be activated by which luciferase activities were measured. Luciferase levels were normalized both the RIG-I and the TLR pathways. with Renilla activities and then plotted as fold induction (test plasmid/ pGL3basic) with pGL3basic activity normalized to value 1. Experiments were Discussion performed with four replicates and repeated three times with similar results. DCs play an essential role in regulating the activation of both Representative experiments of three are shown. TF, Transcription factors; Sv, Sendai virus. innate and adaptive immunity during microbial infections. DC maturation triggered by microbes is associated with the production of CCL19 and enhanced expression of its specific receptor, CCR7. the ISRE mutant CCL19 promoter construct (Fig. 7A). As a result, CCL19 thus regulates the migration of mature DCs, and it is also clear inhibition of IRF-associated CCL19 promoter activity was involved in recruiting naive T cells to the vicinity of mature DCs seen in Sendai virus-infected cells (Fig. 7C). in the T cell zones of local lymph nodes (1–3). Although CCL19 has many important functions in DC biology, the molecular mech- RIG-I and TLR pathway signaling components activate anisms regulating its gene expression have remained largely un- CCL19 promoter characterized. In this study, we conducted a detailed analysis on Having identified the transcription factors involved in the regula- the mechanisms of Salmonella or Sendai virus-induced expression tion of CCL19 transcription, we determined which signaling mol- of CCL19 gene in human monocyte-derived DCs. In addition, we ecules upstream of IRFs would induce CCL19 promoter activation. cloned the CCL19 promoter and characterized its functionality in RIG-I has been shown to act as a cytoplasmic detector of dsRNA transfection experiments. We observed that multiple intracellular synthesized by viruses. RIG-I associates with another CARD-do- signal transduction pathways are involved in the regulation of main containing protein, CARDIF (CARD adaptor inducing CCL19 gene expression. IFN-␤, also known as IPS-1/MAVS/VISA), which is associated To obtain an insight into which signaling pathways are impor- with mitochondria. RIG-I and CARDIF signal downstream to tant for CCL19 gene expression in DCs, we used chemical inhib- TBK1 and IKK␧ that directly phosphorylate IRF3 and IRF7. In itors that could interfere with the activation of NF-␬B, MAPK, and 260 CCL19 REGULATION IN HUMAN DENDRITIC CELLS

NFAT pathways. Our results showed that the inhibition of the efficiently interfere with IFN signaling by targeting STAT proteins NF-␬B pathway with PDTC or DEM efficiently blocked Salmo- (56). Thus, the binding of Sendai virus-activated IRFs to the nella-induced CCL19 expression. These inhibitors also reduced CCL19 promoter ISRE site remained at a relatively low level. The Salmonella-induced CXCL10 and IFN-␥ expression, because only exception was IRF3, which was rapidly and efficiently acti- these genes are at least partially NF-␬B-regulated genes (12, 50). vated by Sendai virus and its binding was clearly stronger than the CCL20 gene expression, instead, was partially inhibited by DEM, one seen in Salmonella-infected DC extracts. but high concentrations of PDTC led to up-regulation of the gene. Unlike ectopically expressed NF-␬B dimers, which in the ab- We cannot fully explain this observation, but it may reflect the sence of their inhibitors (I␬Bs) are constitutively in an active form, differential requirements of gene regulation in human DCs as IRF3 and IRF7 require additional virus-induced phosphorylations compared with cell lines that have been used by other investi- before they are transcriptionally active (57). Therefore, in trans- gators studying CCL20 gene regulation (53, 54). PD98059, fection experiments we had to use Sendai virus infection to induce SB202190, and CsA, inhibitors of ERK MAPK, p38 MAPK, and IRF activation. Consistent with the DNA binding experiments, NFAT pathways, respectively, partially blocked CCL19 production. we found that in transfected HEK293 cells, IRF1, IRF3, or IRF7 Experiments with chemical inhibitors suggested that, in addition to induced CCL19 promoter activity, and this activity was depen- NF-␬B, which is likely to be one of the major CCL19 gene regulatory dent on the functional ISRE site located upstream of the two pathways, MAPK and NFAT pathways may also contribute to mi- NF-␬B sites. However, we found no evidence that IRF5, which crobe-induced CCL19 mRNA expression in human DCs. has been described to regulate the expression of many cytokine With computer analysis, we identified two NF-␬B sites in the genes (17, 18), would be involved in CCL19 gene expression in proximal part of the CCL19 promoter. To study the functionality human monocyte-derived DCs or in promoter reporter assays. Downloaded from of these sites we performed DNA affinity binding experiments. We Further experimental analyses of the pathways upstream of IRFs found out that both NF-␬B promoter elements were capable of revealed that the activation of both TLR and RIG-I pathways reg- binding NF-␬B p50 and p65 proteins upon Salmonella or Sen- ulate CCL19 gene expression. Expression of the crucial receptor/ dai virus infection. Furthermore, the same elements also bound adapter components of the TLR3/4 pathway (MyD88, TRIF, the alternative pathway NF-␬B proteins, p52 and RelB. Our IKK␧, or TBK1) or the RIG-I pathway (RIG-I, ⌬RIG-I, CARDIF,

results are consistent with the chromatin immunoprecipitation IKK␧, or TBK1) lead to efficient transcription of the CCL19 pro- http://www.jimmunol.org/ analyses conducted by Saccani and Natoli (29) in LPS-stimu- moter reporter construct. The data indicate that the common path- lated DCs. They observed that the CCL19 promoter region, en- ways activated by Gram-negative bacteria (TLR4) or RNA vi- compassing the NF-␬B(1) element of the present study, rapidly ruses (TLR3 or RIG-I) led to the activation of multiple IRF binds p50ϩp65 containing dimers, but these factors are later family members, which together with NF-␬B regulate CCL19 replaced by more slowly activated p52/RelB dimers. Neither they nor gene expression. we detected c-Rel binding to the CCL19 promoter NF-␬B sites. In this study we demonstrate that, in human monocyte-derived NF-␬B(1) and NF-␬B(2) promoter elements showed practically DCs, both bacteria and viruses can induce CCL19 gene expression. equal protein binding capacities in oligonucleotide binding exper- Efficient activation of CCL19 production correlates with the ability of iments. However, by using mutated CCL19 promoter reporter a given microbe to induce DC maturation and cytokine gene expres- by guest on September 29, 2021 constructs, we were able to determine the relative importance of sion in general. Detailed analysis of the intracellular signal transduc- the two sites for transcription efficiency. Transfection experi- tion pathways indicated that the CCL19 promoter is regulated by mul- ments in HEK293 cells suggested that the proximal NF-␬B(1) tiple transcriptional systems, at least by NF-␬B, IRFs, and STATs. site was more important in transcription, because the mutations in the We cannot rule out the possibility that MAPK cascades and NFAT NF-␬B(1) site reduced transcription activity more than the ones in the transcription factors are also involved, because pharmacological in- NF-␬B(2) site. Although the relative importance of CCL19 pro- hibitors of these pathways also reduced CCL19 gene expression to moter NF-␬B sites was different in regulating transcription, both sites some extent. It was also of interest that NF-␬B- and STAT-activating clearly contributed to the transcription in a positive fashion. cytokines, IL-1␤ or TNF-␣ together with IFNs, were also able to We also identified an ISRE site located upstream of the two induce CCL19 production in DCs albeit in low levels. The data sug- NF-␬B sites. This ISRE site turned out to be very interesting be- gest that signals, whether they are bacteria, viruses, or cytokines, cause it was able to bind multiple IRF family members as well as which are able to activate NF-␬B, IRF, and/or STAT family tran- STAT1 and STAT2. Before analyzing IRF or STAT binding to the scription factors in DCs can also activate the CCL19 promoter in a putative CCL19 ISRE site, we studied whether the expression of quantitatively, qualitatively, and timely regulated fashion. IRF or STAT proteins was changed in response to Salmonella or Sendai virus infection. It was of interest that Salmonella efficiently Acknowledgments induced the expression of IRF1, IRF7, IRF9, and STAT2. By using We thank Mari Aaltonen, Hanna Valtonen, and Johanna Lahtinen for ex- sensitive oligonucleotide binding assays, these factors as well as pert technical assistance. constitutively expressed IRF3 and STAT1 were found to bind to the CCL19 ISRE site at later times of infection. To our knowledge, Disclosures induction of such broad-spectrum binding of IRF and STAT pro- The authors have no financial conflict of interest. tein to cytokine/chemokine promoter IRF/ISRE sites has not pre- viously been described for Salmonella or any other bacteria. Al- References together, our results suggest that Salmonella is likely to activate a 1. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of wide array of NF-␬B, IRF, and STAT-responsive genes in human immunity. Nature 392: 245–252. DCs. Sendai virus is a well-known activator of IRFs and other 2. Dieu, M. C., B. Vanbervliet, A. Vicari, J. M. Bridon, E. Oldham, S. Ait-Yahia, F. Briere, A. Zlotnik, S. Lebecque, and C. Caux. 1998. Selective recruitment of transcription factors involved in cytokine gene expression (13, 14, immature and mature dendritic cells by distinct chemokines expressed in different 21, 24, 37). However, in Sendai virus-infected cells, the expression anatomic sites. J. Exp. Med. 188: 373–386. of IFN-inducible IRF1, IRF7, IRF9, STAT1, and STAT2 remained 3. Sallusto, F., B. Palermo, D. Lenig, M. Miettinen, S. Matikainen, I. Julkunen, R. Forster, R. Burgstahler, M. Lipp, and A. Lanzavecchia. 1999. Distinct patterns and clearly at a lower level as compared with Salmonella-infected kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol. DCs. This is likely due to the effect of Sendai virus C proteins that 29: 1617–1625. The Journal of Immunology 261

4. Luther, S. A., H. L. Tang, P. L. Hyman, A. G. Farr, and J. G. Cyster. 2000. tivation of IKK␣ target genes depends on recognition of specific ␬B binding sites Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion by RelB:p52 dimers. EMBO J. 23: 4202–4210. of the ELC gene in the plt/plt mouse. Proc. Natl. Acad. Sci. USA 97: 12694–12699. 31. Veckman, V., M. Miettinen, S. Matikainen, R. Lande, E. Giacomini, E. M. 5. Gunn, M. D., S. Kyuwa, C. Tam, T. Kakiuchi, A. Matsuzawa, L. T. Williams, and Coccia, and I. Julkunen. 2003. Lactobacilli and streptococci induce inflammatory H. Nakano. 1999. Mice lacking expression of secondary lymphoid organ che- chemokine production in human macrophages that stimulates Th1 cell chemo- mokine have defects in homing and dendritic cell localization. taxis. J. Leukocyte Biol. 74: 395–402. J. Exp. Med. 189: 451–460. 32. Ronni, T., T. Sareneva, J. Pirhonen, and I. Julkunen. 1995. Activation of IFN-␣, 6. Nakano, H., and M. D. Gunn. 2001. Gene duplications at the chemokine locus on IFN-␥, MxA, and IFN regulatory factor 1 genes in influenza A virus-infected mouse 4: multiple strain-specific haplotypes and the deletion of human peripheral blood mononuclear cells. J. Immunol. 154: 2764–2774. secondary lymphoid-organ chemokine and EBI-1 ligand chemokine genes in the 33. Rossi, D. L., A. P. Vicari, K. Franz-Bacon, T. K. McClanahan, and A. Zlotnik. 1997. plt mutation. J. Immunol. 166: 361–369. Identification through bioinformatics of two new macrophage proinflammatory hu- 7. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, man chemokines: MIP-3␣ and MIP-3␤. J. Immunol. 158: 1033–1036. and M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing 34. Sareneva, T., J. Pirhonen, K. Cantell, N. Kalkkinen, and I. Julkunen. 1994. Role functional microenvironments in secondary lymphoid organs. Cell 99: 23–33. of N-glycosylation in the synthesis, dimerization and secretion of human inter- 8. Chen, L. F., and W. C. Greene. 2004. Shaping the nuclear action of NF-␬B. Nat. feron-␥. Biochem. J. 303: 831–840 (Pt. 3). Rev. Mol. Cell Biol. 5: 392–401. 35. Melen, K., P. Keskinen, T. Ronni, T. Sareneva, K. Lounatmaa, and I. Julkunen. 9. Beinke, S., and S. C. Ley. 2004. Functions of NF-␬B1 and NF-␬B2 in immune 1996. Human MxB protein, an -␣-inducible GTPase, contains a nuclear cell biology. Biochem. J. 382: 393–409. targeting signal and is localized in the heterochromatin region beneath the nuclear 10. Natoli, G., S. Saccani, D. Bosisio, and I. Marazzi. 2005. Interactions of NF-␬B envelope. J. Biol. Chem. 271: 23478–23486. with chromatin: the art of being at the right place at the right time. Nat. Immunol. 36. Melen, K., L. Kinnunen, and I. Julkunen. 2001. Arginine/lysine-rich structural 6: 439–445. element is involved in interferon-induced nuclear import of STATs. J. Biol. 11. Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. IRF family of Chem. 276: 16447–16455. transcription factors as regulators of host defense. Annu. Rev. Immunol. 19: 623–655. 37. Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phos- 12. Ohmori, Y., and T. A. Hamilton. 1993. Cooperative interaction between inter- phorylation of the IRF-3 transcription factor regulates nuclear translocation, feron (IFN) stimulus response element and ␬B sequence motifs controls IFN␥- transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. and -stimulated transcription from the murine IP-10 promoter. 18: 2986–2996. Downloaded from J. Biol. Chem. 268: 6677–6688. 38. Zhang, L., and J. S. Pagano. 1997. IRF-7, a new interferon regulatory factor 13. Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, and J. Hiscott. 1999. Essential role associated with Epstein-Barr virus latency. Mol. Cell. Biol. 17: 5748–5757. of interferon regulatory factor 3 in direct activation of RANTES chemokine tran- 39. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, scription. Mol. Cell. Biol. 19: 959–966. K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential 14. Genin, P., M. Algarte, P. Roof, R. Lin, and J. Hiscott. 2000. Regulation of RANTES function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. chemokine gene expression requires cooperativity between NF-␬B and IFN-regula- 5: 730–737. tory factor transcription factors. J. Immunol. 164: 5352–5361. 40. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott.

15. Veckman, V., P. Osterlund, R. Fagerlund, K. Melen, S. Matikainen, and 2003. Triggering the interferon antiviral response through an IKK-related path- http://www.jimmunol.org/ I. Julkunen. 2006. TNF-␣ and IFN-␣ enhance influenza-A-virus-induced che- way. Science 300: 1148–1151. mokine gene expression in human A549 epithelial cells. Virology 345: 41. Matikainen, S., T. Ronni, M. Hurme, R. Pine, and I. Julkunen. 1996. Retinoic 96–104. acid activates interferon regulatory factor-1 gene expression in myeloid cells. 16. Liu, J., X. Guan, and X. Ma. 2005. Interferon regulatory factor 1 is an essential Blood 88: 114–123. and direct transcriptional activator for interferon ␥-induced RANTES/CCl5 ex- 42. Servant, M. J., N. Grandvaux, B. R. tenOever, D. Duguay, R. Lin, and J. Hiscott. pression in macrophages. J. Biol. Chem. 280: 24347–24355. 2003. Identification of the minimal phosphoacceptor site required for in vivo 17. Barnes, B. J., M. J. Kellum, A. E. Field, and P. M. Pitha. 2002. Multiple regulatory activation of interferon regulatory factor 3 in response to virus and double- domains of IRF-5 control activation, cellular localization, and induction of chemo- stranded RNA. J. Biol. Chem. 278: 9441–9447. kines that mediate recruitment of T lymphocytes. Mol. Cell. Biol. 22: 5721–5740. 43. Cobb, M. H., and E. J. Goldsmith. 1995. How MAP kinases are regulated. J. Biol. 18. Takaoka, A., H. Yanai, S. Kondo, G. Duncan, H. Negishi, T. Mizutani, S. Kano, Chem. 270: 14843–14846. K. Honda, Y. Ohba, T. W. Mak, and T. Taniguchi. 2005. Integral role of IRF-5 in the 44. Dudley, D. T., L. Pang, S. J. Decker, A. J. Bridges, and A. R. Saltiel. 1995. A

gene induction programme activated by Toll-like receptors. Nature 434: 243–249. synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc. Natl. by guest on September 29, 2021 19. Kanno, Y., B. Z. Levi, T. Tamura, and K. Ozato. 2005. Immune cell-specific Acad. Sci. USA 92: 7686–7689. amplification of interferon signaling by the IRF-4/8-PU.1 Complex. J. Interferon 45. Davies, S. P., H. Reddy, M. Caivano, and P. Cohen. 2000. Specificity and mech- Cytokine Res. 25: 770–779. anism of action of some commonly used protein kinase inhibitors. Biochem. J. 20. Majumder, S., L. Z. Zhou, P. Chaturvedi, G. Babcock, S. Aras, and 351: 95–105. R. M. Ransohoff. 1998. p48/STAT-1␣-containing complexes play a predominant 46. Schreck, R., B. Meier, D. N. Mannel, W. Droge, and P. A. Baeuerle. 1992. role in induction of IFN-␥-inducible protein, 10 kDa (IP-10) by IFN-␥ alone or Dithiocarbamates as potent inhibitors of nuclear factor ␬B activation in intact in synergy with TNF-␣. J. Immunol. 161: 4736–4744. cells. J. Exp. Med. 175: 1181–1194. 21. Matikainen, S., J. Pirhonen, M. Miettinen, A. Lehtonen, C. Govenius-Vintola, 47. Ziegler-Heitbrock, H. W., T. Sternsdorf, J. Liese, B. Belohradsky, C. Weber, T. Sareneva, and I. Julkunen. 2000. Influenza A and sendai viruses induce dif- A. Wedel, R. Schreck, P. Bauerle, and M. Strobel. 1993. Pyrrolidine dithiocar- ferential chemokine gene expression and transcription factor activation in human bamate inhibits NF-␬B mobilization and TNF production in human monocytes. macrophages. Virology 276: 138–147. J. Immunol. 151: 6986–6993. 22. Veckman, V., M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen, and I. Julkunen. 48. Horton, N. D., S. S. Biswal, L. L. Corrigan, J. Bratta, and J. P. Kehrer. 1999. Acrolein 2004. Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce causes inhibitor ␬B-independent decreases in nuclear factor ␬B activation in human maturation and production of Th1-type cytokines and chemokines in human lung adenocarcinoma (A549) cells. J. Biol. Chem. 274: 9200–9206. monocyte-derived dendritic cells. J. Leukocyte Biol. 75: 764–771. 49. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT 23. Pietila, T. E., V. Veckman, P. Kyllonen, K. Lahteenmaki, T. K. Korhonen, and family: regulation and function. Annu. Rev. Immunol. 15: 707–747. I. Julkunen. 2005. Activation, cytokine production, and intracellular survival of 50. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, and bacteria in Salmonella-infected human monocyte-derived macrophages and den- H. A. Young. 1997. Interaction of NF-␬B and NFAT with the interferon-␥ pro- dritic cells. J. Leukocyte Biol. 78: 909–920. moter. J. Biol. Chem. 272: 30412–30420. 24. Osterlund, P., V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and 51. Fagerlund, R., L. Kinnunen, M. Kohler, I. Julkunen, and K. Melen. 2005. NF-␬B I. Julkunen. 2005. Gene expression and antiviral activity of ␣␤ and in- is transported into the nucleus by importin ␣3 and importin ␣4. J. Biol. Chem. terleukin-29 in virus-infected human myeloid dendritic cells. J. Virol. 79: 280: 15942–15951. 9608–9617. 52. Zhong, H., M. J. May, E. Jimi, and S. Ghosh. 2002. The phosphorylation status 25. Marriott, I., T. G. Hammond, E. K. Thomas, and K. L. Bost. 1999. Salmonella of nuclear NF-␬B determines its association with CBP/p300 or HDAC-1. Mol. efficiently enter and survive within cultured CD11cϩ dendritic cells initiating Cell 9: 625–636. cytokine expression. Eur. J. Immunol. 29: 1107–1115. 53. Harant, H., S. A. Eldershaw, and I. J. Lindley. 2001. Human macrophage in- 26. Niedergang, F., J. C. Sirard, C. T. Blanc, and J. P. Kraehenbuhl. 2000. Entry and flammatory protein-3␣/CCL20/LARC/Exodus/SCYA20 is transcriptionally up- survival of Salmonella typhimurium in dendritic cells and presentation of recom- regulated by -␣ via a non-standard NF-␬B site. FEBS Lett. binant antigens do not require macrophage-specific virulence factors. Proc. Natl. 509: 439–445. Acad. Sci. USA 97: 14650–14655. 54. Sugita, S., T. Kohno, K. Yamamoto, Y. Imaizumi, H. Nakajima, T. Ishimaru, and 27. Cheminay, C., M. Schoen, M. Hensel, A. Wandersee-Steinhauser, U. Ritter, T. Matsuyama. 2002. Induction of macrophage-inflammatory protein-3␣ gene H. Korner, M. Rollinghoff, and J. Hein. 2002. Migration of Salmonella typhi- expression by TNF-dependent NF-␬B activation. J. Immunol. 168: 5621–5628. murium: harboring -derived dendritic cells towards the chemokines 55. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate CCL19 and CCL21. Microb. Pathog. 32: 207–218. immunity. Cell 124: 783–801. 28. Saccani, S., and G. Natoli. 2002. Dynamic changes in histone H3 Lys 9 meth- 56. Gotoh, B., T. Komatsu, K. Takeuchi, and J. Yokoo. 2002. Paramyxovirus strat- ylation occurring at tightly regulated inducible inflammatory genes. Genes Dev. egies for evading the interferon response. Rev. Med. Virol. 12: 337–357. 16: 2219–2224. 57. tenOever, B. R., S. Sharma, W. Zou, Q. Sun, N. Grandvaux, I. Julkunen, H. Hemmi, 29. Saccani, S., S. Pantano, and G. Natoli. 2003. Modulation of NF-␬B activity by M. Yamamoto, S. Akira, W. C. Yeh, R. Lin, and J. Hiscott. 2004. Activation of exchange of dimers. Mol. Cell 11: 1563–1574. TBK1 and IKKvar␧ kinases by vesicular stomatitis virus infection and the role of 30. Bonizzi, G., M. Bebien, D. C. Otero, K. E. Johnson-Vroom, Y. Cao, D. Vu, viral ribonucleoprotein in the development of interferon antiviral immunity. J. Virol. A. G. Jegga, B. J. Aronow, G. Ghosh, R. C. Rickert, and M. Karin. 2004. Ac- 78: 10636–10649.