(12) Patent Application Publication (10) Pub. No.: US 2011/0009353 A1 Chen-Kiang Et Al

Home , Carfilzomib

US 2011 0009353A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0009353 A1 Chen-Kiang et al. (43) Pub. Date: Jan. 13, 2011

(54) TARGETING CDK4 AND CDK6 IN CANCER Publication Classification THERAPY (51) Int. Cl. A63/496 (2006.01) (75) Inventors: Selina Chen-Kiang, New York, NY A 6LX 3/59 (2006.01) A63L/337 (2006.01) (US); Maurizio Di Liberto, A63L/454 (2006.01) Riverdale, NJ (US); Xiangao A 6LX 3L/505 (2006.01) Huang, New York, NY (US) A63L/437 (2006.01) A63/4965 (2006.01) Correspondence Address: A6II 3/4I (2006.01) A 6LX 3/5.377 (2006.01) SCHWEGMAN, LUNDBERG & WOESSNER, A63L/4353 (2006.01) P.A. A6II 3/40 (2006.01) P.O. BOX 2938 A63L/7034 (2006.01) MINNEAPOLIS, MN 55402 (US) A63L/7068 (2006.01) C7H 2L/02 (2006.01) Assignee: A 6LX 3L/705 (2006.01) (73) Cornell Research Foundation, Inc CI2N 5/09 (2010.01) CI2O 1/18 (2006.01) (21) Appl. No.: 12/741,884 CI2O I/68 (2006.01) A6IP35/04 (2006.01) (52) U.S. Cl...... 514/34: 514/252.16; 514/259.3: (22) PCT Fled: Oct. 1, 2008 514/422:514/326; 514/275: 514/283: 514/255.06; 514/354: 514/231.5; 514/300: 514/381: 514/49; PCT NO.: PCT/USO8/11331 514/449; 514/44 R; 435/347; 435/32: 435/6; (86) 536/24.5 S371 (c)(1), (57) ABSTRACT (2), (4) Date: Sep. 17, 2010 The invention involves methods of inhibiting the cancer cell cycle to make cancer cells more susceptible to chemothera Related U.S. Application Data peutic agents. In particular, inhibition of CDK4 and/or CDK6 inhibits cell cycle progression in cancer cells. When com bined with chemotherapy such cell cycle inhibition can effec (60) Provisional application No. 60/986,176, filed on Nov. tively treat even aggressive cancer types that are drug-resis 7, 2007. tant and intractable to most chemotherapies.

15h-release 15h-release 15h-release 15h-release from 24h-PD from 72h-PD from 96h-PD from 120-PD Medium 24h-PD Patent Application Publication Jan. 13, 2011 Sheet 1 of 45 US 2011/0009353 A1

PD PD

AA - PD (G) FIG, IA Patent Application Publication Jan. 13, 2011 Sheet 2 of 45 US 2011/0009353 A1

2N 4N t DNA COntent Patent Application Publication Jan. 13, 2011 Sheet 3 of 45 US 2011/0009353 A1

1O O s. 5 O O dO d1 d2 d3 d4 d5 d6 FIG 10

dO d1 d2 d3 d4 d5 d6 FIG. ID Patent Application Publication Jan. 13, 2011 Sheet 4 of 45 US 2011/0009353 A1

?II'9IH

WNO Patent Application Publication Jan. 13, 2011 Sheet 5 of 45 US 2011/0009353 A1

No BZ 250 nMBZ(1h)

No PD

red FIG. I.F Patent Application Publication Jan. 13, 2011 Sheet 6 of 45 US 2011/0009353 A1

250 :250 nM BZ (1h)

200 (

IndNI%)ST130319\'|\

NO PD 12

PD WASHOUT (h) FIG, 1G Patent Application Publication Jan. 13, 2011 Sheet 7 of 45 US 2011/0009353 A1

NO BZ 250 nM BZ(1h)

NO PD

2N 4N DNA Content FIG, 1H Patent Application Publication Jan. 13, 2011 Sheet 8 of 45 US 2011/0009353 A1

:PD WASHOUT

6 C)

–IW% 40

××××××××××××2

FIG. IJ Patent Application Publication Jan. 13, 2011 Sheet 9 of 45 US 2011/0009353 A1

150 BZ — -o- SS2 100 PD + BZ . PD s PD -o- 50 -A- 5 -- h-48 -24 O 24 O BZ (nM) 0 0 2 4 6 h O 24 FIG 2A

1OO

BZ 80 t – -O- l 60 PD + BZ c PD SS 40 PD -O- - A - 20 -- h-48 -24 O 24 O

FIG. 2B Patent Application Publication Jan. 13, 2011 Sheet 10 of 45 US 2011/0009353 A1

-PD

--PD

FIG, 2C Patent Application Publication Jan. 13, 2011 Sheet 11 of 45 US 2011/0009353 A1

BZ (nM) 0 O O 4 O O 4 cyclin D2 up up in ne s m - " - ages

assasser sessssss-a-

FIG. 2D

n-t ShPRNA - - CDK4 shRNA - 520 CDK6 shRNA - 744 CDK4 it is CDK6 is . . . . p27 Actin sess is FIG, 2E Patent Application Publication Jan. 13, 2011 Sheet 12 of 45 US 2011/0009353 A1

p=0.018

n-t ShPRNA CodkAf6 ShPRNA

(520+744) Patent Application Publication Jan. 13, 2011 Sheet 13 of 45 US 2011/0009353 A1

p=0.0038 p=0.0215

20 s D n 4. is 15 SS SS Yea

u 3. s 9, 10 UU 4. ord s D 5

O n-t shRNA -- n-t ShrNA - CDK4. ShrNA - 520 CDK4. ShrNA - 520 CDK6 ShrNA - 744 CDK6 ShrNA - 744 BZ (nM) 4 4. BZ (nM) 4 4 FIG, 2G FIG, 2H Patent Application Publication Jan. 13, 2011 Sheet 14 of 45 US 2011/0009353 A1

400 -o- -PD S -O- +PD 9 300 SS DEX y 200 -PD -- 100 +PD 9. -- ce -24 h O h 24 h O DEX (nM) 0 0 0 5 50 h O O 24

400 DEX as H 9 300 DEX + BZ SS 7, 200 it C 9 DEX L a 100 -A- s DEXy + BZ O +PD f DEX (nM) 0 O O 5 50 h -24 O 24 h O O 24 Patent Application Publication Jan. 13, 2011 Sheet 15 of 45 US 2011/0009353 A1

DEX (nM O 50 FIG, 2L Patent Application Publication Jan. 13, 2011 Sheet 16 of 45 US 2011/0009353 A1

--PO -24 h Oh 24h

JC-1 green FIG. 2N Patent Application Publication Jan. 13, 2011 Sheet 17 of 45 US 2011/0009353 A1

MM1S No HS-5 + HS-5 60 p=0.0125 p=0.0001

PD - - - -- BZ (nM) O O 4 4 FIG, 3A NO HS-5 -- HS-5

3OO E 250 S g 200 2 150 CD CD c 100 is 50 O PO - - - -- BZ (nM) O O 4 4 Patent Application Publication Jan. 13, 2011 Sheet 18 of 45 US 2011/0009353 A1

2. -O--PD 10 -O-+PD F 8O 60 8 40 C) S. 20. D 0 BZ (nM) 0 0 4 8 h O 24 FIG, 3C

s 60 =0.0334" i. O=U,- 3 40 is 20 D O PD- + - + BZ (nM) O O 6 6 FIG. 3D Patent Application Publication Jan. 13, 2011 Sheet 19 of 45 US 2011/0009353 A1

6 p=0.0462

4. i 3 Patent Application Publication Jan. 13, 2011 Sheet 20 of 45 US 2011/0009353 A1

-- r Vr 2 -- O O

- CO KO N. :O s -- co co - O O - Co cd -- C O

as od od v - O O - Od s OO y -- O O H

er CO

-- O

s O

-- o

g g g g dhe 2 8 CO CO w CN o (ndu%) Sileo e|qelA Patent Application Publication Jan. 13, 2011 Sheet 21 of 45 US 2011/0009353 A1

8O MM 4 60 C p=0.0042 S8 40 p=0.0013 d CD CDo 20 D O PD (uM) 0 1 2 0 1 2 BZ (nM) O O O 8 8 8 FIG, 3G

100 s 80 4. SS ? 60 40 ar s 20- -O--PD -O- +PD O DEX (nM) 0 O 4. 6 h -24 24 FIG, 3H Patent Application Publication Jan. 13, 2011 Sheet 22 of 45 US 2011/0009353 A1

9 MM 14 80 . & 60 92 p=0.0454 g 40 D 20 D O PO - - - - BZ (nM) 0 O 4 4 FIG, 3.I

1OO 468 OOO 2 O

O PD - + - + BZ (nM) 0 0 8 8 FIG 3) Patent Application Publication Jan. 13, 2011 Sheet 23 of 45 US 2011/0009353 A1

Patent Application Publication Jan. 13, 2011 Sheet 24 of 45 US 2011/0009353 A1

OO 68 OO 4. O

2 O

MM 8 -O-CNTL -O- PD 1 OO - A-4BZ S - A - PD-4BZ e 80 Š 60 2 8 40 CD 20 D O h 24 O 24 48 FIG, 4C Patent Application Publication Jan. 13, 2011 Sheet 25 of 45 US 2011/0009353 A1

0 nMBZ 4 nMBZ

P D

-- P D

FIG, 4D Patent Application Publication Jan. 13, 2011 Sheet 26 of 45 US 2011/0009353 A1

Patent Application Publication Jan. 13, 2011 Sheet 27 of 45 US 2011/0009353 A1

LucGFP MM1S cells PD BZ g H72 fify it if (d) 1 4. 7 9 11 FIG 5A

p=0.0456 o Vehicle l O PD A BZ A PD+BZ

e Patent Application Publication Jan. 13, 2011 Sheet 28 of 45 US 2011/0009353 A1

BMGFP MM1.S Cells BM Cells

Vehicle

PD 49,405

BZ Mitotacker FIG, 5C Patent Application Publication Jan. 13, 2011 Sheet 29 of 45 US 2011/0009353 A1

Luc GFP MM1.S cells a 1-1-1-1-1 o - PD -Ya---- e. BZ -a A

/ PD A (d) 1 8 1011 14 18 21 22 FIG 5D Patent Application Publication Jan. 13, 2011 Sheet 30 of 45 US 2011/0009353 A1

Patent Application Publication Jan. 13, 2011 Sheet 31 of 45 US 2011/0009353 A1

p=0.0296 s 400 O Vehicle O 9 O PD 320 A BZ p=0.0387 c) A PD+BZ S 240 CD 53 160 S 5 80 9. O (d)

P D

+PD Patent Application Publication Jan. 13, 2011 Sheet 32 of 45 US 2011/0009353 A1

12 FIG 5H Patent Application Publication Jan. 13, 2011 Sheet 33 of 45 US 2011/0009353 A1

PARP Orge'sass

ravis-a-vases

FIG, 6A

Patent Application Publication Jan. 13, 2011 Sheet 35 of 45 US 2011/0009353 A1

NOL-6 + L-6 PD --PD -PD --PD

p-Stat3 }} { Actin oup as is eign as a d 1 2 3 4 5 6 7

FIG. 6D

ÇIWIS—dBAIIWT38

0.5

8X 8 S d 888Cy CS XXXS. FIG 6E Patent Application Publication Jan. 13, 2011 Sheet 36 of 45 US 2011/0009353 A1

|N|000TT30

y sex gp150 n-t ShrNA ---- gp130 shRNA-286 ---- gp130 shRNA-285 - gp150 shRNA-284 ISOTYPE CNTRL FIG, 6F Patent Application Publication Jan. 13, 2011 Sheet 37 of 45 US 2011/0009353 A1

ÇO o

n-t ShrNA + gp130 sh RNA - 286 283 284 FIG, 6G Patent Application Publication Jan. 13, 2011 Sheet 38 of 45 US 2011/0009353 A1

§3

284 FIG 6H Patent Application Publication Jan. 13, 2011 Sheet 39 of 45 US 2011/0009353 A1

Patent Application Publication Jan. 13, 2011 Sheet 40 of 45 US 2011/0009353 A1

- FP - - EP - Oh 12 h Oh 12h BZ (nM) O O 4 O O 4 Noxa is as is Patent Application Publication Jan. 13, 2011 Sheet 41 of 45 US 2011/0009353 A1

-PD --PD -P) +PD Bz (nM) o 40 4 Bz (M) o 4 o 4 P. Bin P: MC-1

Im-s Bim-L McI-1 au. Bim-S

Bcl-2 -es st P: BC-2 BC-XL Bcl-2 . in s ; :-

P: BC-XL Bim-EL as as fails is Bcl-XL as és, - fall Bim-Bim-S - - as a Bim-EL () is is is Bim-L Birn-S FIG 7C

----IB FACS (MT) FIG 7D Patent Application Publication Jan. 13, 2011 Sheet 42 of 45 US 2011/0009353 A1

n-tsiRNA - - - Bim siRNA - - + Bim-EL O S

Bim-S guns chain as Bim-EL is e are Bim-L 68.se

Yakwaxw- . . . -

--- re

FIG. ZE

250 °.sO,004 200 99. - 150 2 8 100 CD 50 > 0 n-t siRNA - - - Bim siRNA - - -- FIG 7F Patent Application Publication Jan. 13, 2011 Sheet 43 of 45 US 2011/0009353 A1

80 O-BZ OPD p=0.0204 &+BZ ZPD + BZ

n-t SiRNA - -- D -- D Bim SiRNA - D -- - -- FIG, 7G

-PD --PD

P: Bak kDa Bak dimer fif airs - 49 area on - 38

FIG, 8A Patent Application Publication Jan. 13, 2011 Sheet 44 of 45 US 2011/0009353 A1

BZ (nM) - O - 4 O - 4 C M C M C M C M Bak - is see is - see - by

BC-2 's th s

MC-1

Noxa p L g

Cytoc nine . . . ame

c-IAP1 see sts - lists,

C-IAP2 is sis as .

Tubulin is a g is is FIG. 8B Patent Application Publication Jan. 13, 2011 Sheet 45 of 45 US 2011/0009353 A1

LOW DOSE LOW DOSE PD O352991 PD 0552991 DCYTOTOXIC CYTOTOXC AGENT AGENT l A CDK4/6 co 6 y SUSTAINED SUSTAINED G1 ARREST G1 s IL-6Ro NOXA

0.000.)

MEMBRANE MEMBRANE PERMEABILIZATION PERMEABILIZATION

Cyto c Cyto c (E)-(CASPASE-9)

CYTOSTATIC APOPTOSIS APOPTOSIS

OVERCOME CHEMORESISTANCE FIG, 8C US 2011/0009353 A1 Jan. 13, 2011

TARGETING CDK4 AND CDK6 IN CANCER method can further comprise treating the mammal with radia THERAPY tion in an amount Sufficient to inhibit growth of the cancer and/or tumor cells in the mammal. In some embodiments, an amount of chemotherapeutic agent or radiation is used that is 0001. This application claims priority to U.S. Provisional Sufficient to induce apoptosis in the cancer and/or tumor cells Application Ser. No. 60/986,176, filed Nov. 7, 2007, the con in the mammal. tents of which are specifically incorporated herein in their 0007. The inhibitor of CDK4 and/or CDK6 is adminis entirety. tered for several days to several weeks. For example, the 0002. This invention was made with U.S. Government inhibitor of CDK4 and/or CDK6 can be administered from support under grant numbers R01 AR 49436 and 1 RO1CA about one to about seven days prior to administration of the 120531, from the National Institutes of Health. As a result the chemotherapeutic agent or the radiation. In other embodi U.S. government has certain rights in the invention. ments, the inhibitor of CDK4 and/or CDK6 is administered for about one to twelve days. In further embodiments, the BACKGROUND inhibitor of CDK4 and/or CDK6 is administered for at least about three days prior to administration of the chemothera 0003 Cancers occur and progress due to loss of both cell peutic agent or the radiation. The method involving adminis cycle and apoptotic controls. Currently, cancer chemothera tration of the inhibitor of CDK4 and/or CDK6 followed by pies center on the use of cytotoxic agents, which kill cancer administration of a chemotherapeutic agent and/or radiation cells but do not prevent them from dividing. This approach is can be repeated at least two times. In some embodiments, the often insufficient to control the rapid expansion of cancer method is repeated indefinitely until remission of the cancer cells during aggressive tumor growth and relapse. No anti or tumor. Thus, numerous cycles of administration of the cancer compounds are currently available that also selec CDK4 and/or CDK6 inhibitor(s) with a chemotherapeutic tively inhibit the cell cycle. Consequently devastating cancers agent or radiation can be performed. Such as multiple myeloma are generally fatal. 0008. The inhibitor of CDK4 and/or CDK6 can be admin istered at a dosage of about 0.1 mg/Kg to about 500 mg/Kg SUMMARY OF THE INVENTION per day. In other embodiments, the inhibitor of CDK4 and/or 0004. According to the invention, cyclin-dependent CDK6 is administered at a dosage of about 50 mg to about kinase (CDK)4 and the closely related CDK6 are essential for 150 mg per day. control of cell cycle reentry and progression through G1 0009. Examples of CDK4 and/or CDK6 inhibitors that can phase of the cell cycle. Aberrant expression of CDK4 and be used include compounds of formulae I or II: CDK6 is a hallmark of cancer. As demonstrated herein, treat ment of cancer cells with inhibitors of CDK4 and/or CDK6 makes those cancer cells more Vulnerable to chemotherapeu tic agents. Thus, when CDK4 and/or CDK6 inhibitors are administered, lower concentrations of chemotherapeutic agents are needed to effectively treat cancer. Even drug-re sistant cancers exhibit significantly reduced cell growth and greater Susceptibility to chemotherapeutic agents. Use of R II CDK4 and/or CDK6 inhibitors also promotes cancer cell (CH2)Air apoptosis and inhibits osteoclast differentiation, thereby o, / reducing the incidence of metastasis of cancer cells to bone NH and destruction of bone. 0005. Therefore, one aspect of the invention involves a R2 method of sensitizing cancer and/or tumor cells in a mammal N N to a chemotherapeutic agent comprising: administering to the M mammal an inhibitor of CDK4 and/or CDK6 in an amount N sufficient to arrest the cancer and/or tumor cell cycle at G1 to H thereby sensitize the cancer and/or tumor cells in the mammal 0010 wherein: to a chemotherapeutic agent. Cell cycle inhibition is achieved by administering at least one CDK4small molecule inhibitor, 0011 X is a heteroatom; and CDK6 small molecule inhibitor, CDK4 inhibitory nucleic 0012 each R is independently a hydrogen, lower alkyl, acid, CDK6 inhibitory nucleic acid (generally referred to carboxy-lower alkyl, oxygen, or cycloalkyl; herein collectively as “CDK4 and/or CDK6 inhibitors'), or a 0013 R is a hydrogen or halogenatom, an NH, NHR, combination thereof. NHCOR, NO, CN, CH-NH and CH-NHR; or phe 0006. One aspect of the invention is a method of sensitiz nyl or heteroaromatic group, wherein the phenyl or het ing cancer and/or tumor cells in a mammal to a chemothera eroaromatic group is optionally Substituted with 1-3 peutic agent or to radiation comprising: administering to the lower alkyl, carboxy-lower alkyl, oxygen, or cycloalkyl mammal an inhibitor of CDK4 and/or CDK6 in an amount groups: sufficient to arrest the cancer and/or tumor cell cycle at G1 to 0.014 Aris phenyl or heteroaromatic group, wherein the thereby sensitize the cancer and/or tumor cells in the mammal phenyl or heteroaromatic group is optionally substituted to a chemotherapeutic agent or to radiation. The method can with 1-3 lower alkyl, carboxy-lower alkyl (—(C=O)- further comprise administering to the mammala chemothera lower alkyl), oxygen (=O), or cycloalkyl groups; and peutic agent in an amount Sufficient to inhibit growth of the 0015 n is 0, 1, 2 or 3. cancer and/or tumor cells in the mammal. Alternatively, the 0016. In some embodiments, X is N or NH. US 2011/0009353 A1 Jan. 13, 2011

0017. Other examples of CDK4 and/or CDK6 inhibitors 0.018 wherein Aris phenyl or heteroaromatic group that include compounds with the following structures: is optionally substituted with 1-3 lower alkyl, carboxy lower alkyl, oxygen, or cycloalkyl groups. 0019. In other embodiments, the inhibitor of CDK4 and/or CDK6 is an inhibitory nucleic acid that can reduce the expres sion and/or activity of a CDK4 and/or CDK6 mRNA, com prising a nucleic acid that is complementary to SEQID NO:1 or 3. For example, the inhibitory nucleic acid can be a shRNA with sequence CCGGACAGTTCGTGAG GTGGCTT TACTCGAGTAAAGCCA CCTCACGAACTGTTTTTT (SEQ ID NO:5), CCGGGACCTGGAAAGGT GCAAA GAACTCGAGTTCTTTGC ACCTTTCCAGGTCTTTTTG (SEQ ID NO:6), or a combination thereof. 0020. The methods of the invention have particular utility for treating cancer cells and/or tumor cells that are already resistant to a chemotherapeutic drug. 0021 Examples of chemotherapeutic agents that can be used in the methods of the invention include a proteasome inhibitor, Steroid, cytotoxic agent, photosensitizing agent, OH HN folate antagonist, pyrimidine antimetabolite, purine antime tabolite, 5-aminolevulinic acid, alkylating agent, platinum anti-tumor agent, anthracycline, DNA intercalator, epipodo phyllotoxin, DNA topoisomerase inhibitor, microtubule-tar geting agent, Vinca alkaloid, SMAC mimetic, taxane, epothilone, an asparaginase or a combination thereof. In Some embodiments, the chemotherapeutic agent is bort eZomib, dexamethasone, CEP 18770, carfilzomib, cytosine arabinoside or a combination thereof. The chemotherapeutic agent can be administered at a dosage of about 0.001 mg/Kg to about 100 mg/Kg per day. Alternatively, the chemothera peutic agent is administered at a dosage of about 0.01 mg/Kg to about 5 mg/Kg per day. In many embodiments, the amount of chemotherapeutic agent administered is lower than that C used when the inhibitor of CDK4 and/or CDK6 is not admin istered. 0022. The methods of the invention can be used to treat any type of cancer or tumor. Examples of cancer and/or tumor cells that can be treated include cancer cells and/or tumor cells in which the retinoblastoma gene (Rb) is expressed. In Some embodiments, the cancer and/or tumor cells are hematopoietic/blood cancer cells. Examples of cancer and/or tumor cells that can be treated with the methods of the inven tion include mantle cell lymphoma cells, diffused large B cell lymphoma cells, acute myeloid leukemia cells, chronic lym phatic leukemia cells, chronic myelocytic leukemia cells, polycythemia Vera cells, malignantlymphoma cells, multiple myeloma cells, Hodgkin’s lymphoma cells, non-Hodgkin’s lymphoma cells or combinations thereof. Other examples include breast cancer, glioblastoma, and metastatic lung adenocarcinoma, where CDK4 is overexpressed or the levels of physiologic inhibitors of CDK4 or CDK6 are insufficient. In some embodiments, the cancer and/or tumor cells treated with the methods of the invention are myeloma cells. 0023 The methods of the invention reduce the growth of the cancer and/or tumor cells or kill the cancer and/or tumor cells. In some embodiments, the methods of the invention induce apoptosis in the cancer and/or tumor cells. Moreover, the methods of the invention can also inhibit osteoclast dif ferentiation, which can inhibit metastasis of the cancer and/or tumor cells to the bone. 0024. In general, the methods of the invention have fewer side effects than methods where the chemotherapeutic agent is administered without administration of the inhibitor of CDK4 and/or CDK6. US 2011/0009353 A1 Jan. 13, 2011

0025. In some embodiments, the chemotherapeutic agent 0043. In some embodiments, the methods of identifying or radiation is administered while administering the inhibitor effective chemotherapeutic agents and effective dosages of CDK4 and/or CDK6. Moreover, the chemotherapeutic thereof include use of about 1:1 to about 3:1 cancer/tumor agent or radiation can be administered while administering cells to HS-5/HS-27A cells. The mixed cell culture can also the inhibitor of CDK4 and/or CDK6 but after administration contain an amount of human IL-6 and human insulin-like of the inhibitor of CDK4 and/or CDK6 for at least two days. growth factor-1 effective for proliferation of the cancer or 0026. Another aspect of the invention is an ex vivo cell tumor cells. For example, about 10 to about 80 units IL-6 per culture system that recapitulates a patient's tumor cell drug ml as well as about of 30 to about 200 ng insulin-like growth sensitivity and/or tumor cell drug resistance, which com factor-1 per ml can be included. prises: 0044. The inhibitor of CDK4 and/or CDK6 used in these 0027 primary cancer or tumor cells isolated from the methods of identifying effective chemotherapeutic agents patient; and effective dosages thereof can be any of the CDK4 and/or 0028 HS-5 or HS-27A human stromal cells; and CDK6 inhibitors described herein. 0029 an amount of human interleukin-6 (IL-6) and 0045. The method of identifying effective chemothera human insulin-like growth factor-1 (IGF-1) effective for peutic agents and an effective dosages thereof can involve maintaining proliferation of the cancer or tumor cells. addition of the inhibitor of CDK4 and/or CDK6 to the culture 0030. In some embodiments, the cell culture system from 4 to 24 hours prior to addition of the chemotherapeutic includes about 1:1 to about 3:1 cancer/tumor cells to HS-57 agent. In some embodiments, the inhibitor of CDK4 and/or HS-27A cells. The HS-5 or HS-27A human Stromal cells can CDK6 is removed from the culture prior to addition of the also be treated with mitomycin C to inhibit replication; In chemotherapeutic agent. These methods are useful for pri mary cancer or tumor cells from the mammal that are resistant addition, the cell culture system can include about 10 to about to one or more chemotherapeutic agents. The chemothera 80 units IL-6 per ml, as well as about 30 to about 200 ng peutic agent to be tested or evaluated can, for example, be a insulin-like growth factor-1 per ml. proteasome inhibitor, Steroid, cytotoxic agent, photosensitiz 0031. Another aspect of the invention is a method of iden ing agent, folate antagonist, pyrimidine antimetabolite, tifying a chemotherapeutic agent effective for treatment of a purine antimetabolite, 5-aminolevulinic acid, alkylating cancer or tumor in a mammal comprising: agent, platinum anti-tumor agent, anthracycline, DNA inter 0032 isolating primary cancer or tumor cells from the calator, epipodophyllotoxin, DNA topoisomerase inhibitor, mammal; microtubule-targeting agent, Vinca alkaloid, taxane, 0033 co-culturing the primary cancer or tumor cells epothilone and/or asparaginase. with HS-5 or HS-27A human stromal cells to form a 0046. Another aspect of the invention is an inhibitory mixed cell culture; nucleic acid that can reduce the expression and/or activity of 0034 incubating the mixed cell culture with an inhibi a CDK4 and/or CDK6 mRNA, comprising a nucleic acid that tor of CDK4 and/or CDK6, wherein the inhibitor is is complementary to SEQ ID NO:1 or 3. For example, the present in an amount Sufficient to arrest the primary inhibitory nucleic acid can be a shRNA with sequence CCG cancer or tumor cells at cell cycle phase G1, to thereby GACAGTTCGTGAGGTGGCTTTACTCGAGT AAAG form an arrested cell culture; CCACCTCACGAACTGTTTTTT (SEQ ID NO:5) or 0035 adding a test chemotherapeutic agent to the CCGGGACCTGG AAAGGTGCAAAGAACTCGAGT arrested cell culture to form a test culture; and TCTTTGCACCTTTCCAGGTCTTTTTG (SEQID NO:6). 0036 observing whether the cancer or tumor cells in the 0047 Another aspect of the invention is a method of treat test culture undergo apoptosis, to thereby identify a che ing cancer or tumors in a mammal comprising: (a) adminis motherapeutic agent effective for treatment of a cancer tering at least one CDK4 and/or CDK6 inhibitor on days one or tumor in a mammal. (1) to fourteen (14); and (b) administering one or more che 0037 Another aspect of the invention is a method of iden motherapeutic agents, or radiation, periodically after about tifying an effective dosage range of a chemotherapeutic agent day three (3), for several weeks (e.g., about 2 to about 6 for treatment of a cancer or tumor in a mammal comprising: weeks). Administration of the chemotherapeutic agent(s) and 0038 isolating primary cancer or tumor cells from the the radiation can then be stopped at least temporarily. In some mammal; embodiments, this method is repeated after cessation of the 0039 co-culturing the primary cancer or tumor cells chemotherapeutic agent or radiation, for example, at least two with HS-5 or HS-27A human stromal cells to form a times. In some embodiments, the method is repeated indefi mixed cell culture; nitely. In other embodiments, the method is repeated for ten to 0040 incubating the mixed cell culture with an inhibi fifty times. tor of CDK4 and/or CDK6, wherein the inhibitor is present in an amount Sufficient to arrest the primary DESCRIPTION OF THE FIGURES cancer or tumor cells at cell cycle phase G1, to thereby 0048 FIG. 1A-J illustrate that PD 0332991 induces G1 form an arrested cell culture; arrest and synchronous cell cycle progression, which primes 0041 adding a test amount of a chemotherapeutic agent myeloma cells for cytotoxic killing. FIG. 1A is a schematic to the arrested cell culture to form a test culture; and diagram of reversible inhibition of CDK4/6 by PD 0332991 0042 observing what amounts of the chemotherapeutic (PD) (cyclin D is “D). MM1.S cells were cultured with PD agent induce apoptosis of the cancer or tumor cells in the 0332991 for 24 hours (h) before removal of PD 0332991 and test cell culture and converting those amounts into a incubated further in fresh media. MM1.S and MM1. Rhuman dosage amount, to thereby identify an effective dosage myeloma cell lines (HMCLs) are described in Greenstein et range of a chemotherapeutic agent for treatment of a al. (Exper. Hematol. 31: 271-282 (2003)). FIG. 1B shows the cancer or tumor in the mammal. percentage of dividing cells (detected with BrdU) and the cell US 2011/0009353 A1 Jan. 13, 2011

cycle phase after treatment with PD for 24 hours (PD was 2K) and dexamethasone-resistant MM1.R cells (FIG. 2L) removed at time 0). BrdU was added at time indicated (*) for after treatment with PD and dexamethasone (dex) at the indi 30 min before FACS analysis of BrdU uptake and DNA cated concentrations as detected by JC-1 red. p-value was content. Sub-G1 (<2N), G1 (2N), S (>2N<4N) and G2/M determined by two-tailed t-test. FIG. 2M shows the BrdU (4N). Numbers indicate the percentage of BrdU-positive incorporation and DNA content of dexamethasone-sensitive cells. FIG.1C illustrates the viability of MM1.S cells cultured MM1.S cells treated as shown in the schematic diagram to the with PD 0332991 for the number of days (d) indicated. FIG. left. FIG. 2N shows the mitochondrial membrane potential 1D illustrates the mitochondrial membrane potential (MT) (MT) of dexamethasone-sensitive MM1.S cells after treat of MM1.S cells cultured with PD 0332991 for the number of ment with PD and dexamethasone (dex) at the indicated con days indicated. FIG. 1E illustrates FACS analysis of BrdU centrations as detected by JC-1. Data are representative of 3 uptake (using BrdU exposure for 30 minutes) and the DNA independent experiments. content percell at the indicated times after incubation with, or 0050 FIG. 3A-J show that induction of G1 arrest primes removal of, PD 0332991. FIG.1F-J illustrate the effect of the primary myeloma cells for killing by bortezomib. FIG. 3A anti-cancer agent, bortezomib, upon myeloma cells when shows the mitochondrial membrane potential (MT) of dex cells were also treated with PD 0332991. At 0, 4, 8 or 12 h amethasone-sensitive MM1.S cells after culture in media or after PD 0332991 removal, cells were incubated in the with HS-5 cells, with or without 24 h PD 0332991 (2 uM) absence or presence of 250 nMbortezomib for 1 h. At 6 hr pretreatment and 24hbortezomib incubation. FIG. 3B shows after removal of bortezomib (total 7h), loss of mitochondrial the viability of dexamethasone-sensitive MM1.S cells after membrane potential (MT) or mitochondrial membrane culture in media or with HS-5 cells, with or without 24 h PD depolarization (MMD) by MitoTracker Red CMXRos (FIG. 0332991 (2 uM) pretreatment and 24 h bortezomib incuba 1F), percentage viable cells (FIG. 1G), as well as BrdU tion. FIGS. 3C and 3D show the viability of primary CD138" uptake and DNA content (FIG. 1H) were monitored. The BM myeloma cells (BMM) isolated from patients (MM1 and number of viable cells was determined by trypan blue exclu MM16, respectively) that were co-cultured with HS-5 cells in sion staining in triplicate and presented as the percentage of the presence or absence of 2 uMPD 0332991 for 24 h before the number of cells at the start of the experiment (% input). addition of bortezomib at indicated concentration for 24 h. FIG. 1I shows the loss of mitochondrial membrane potential FIG. 3E shows BrdU-uptake in primary myeloma cells iso (MT) and FIG. 1J shows the percent cell viability in MM1.S lated from patient MM16 during the initial 16 hr of PD cells after treatment and removal of PD 0332991, followed by 0332991 incubation. FIG.3F shows the viability of primary incubation with bortezomib at the indicated concentrations CD138" human BM myeloma (BMM) cells from different for 12 h before analysis of MT and viability. Data are repre patients (MM) treated with different amounts of bortezomib. sentative of 3 independent experiments. BMMs were incubated with PD 0332991 for time indicated 0049 FIG. 2A-N illustrate that induction of sustained G1 before treatment with bortezomib for 24 hand analysis of cell arrest enhances cytotoxic killing of myeloma cells. FIG. 2A viability. Data represent meants.d. in triplicate. p-value was shows the percentage of viable MM1.S cells relative to input determined by two-tailed or *one-tailed t-test. FIG. 3G fur after culturing as diagrammed. FIG. 2B shows the mitochon ther illustrates the cell viability of BMM cells from various drial membrane potential (MT) of MM1.S. after culturing as patients (MM) where the cells were treated with PD 0332991 diagrammed. FIG. 2C shows simultaneous analysis of BrdU and bortezomib as indicated for 24 h. FIG. 3H-J also illus uptake and DNA content after 24 hr of PD 0332991 pretreat trates the viability of BMM cells from various patients (MM), ment followed by incubation with bortezomib (4 nM) for 24 where the cells were pre-treated with PD 0332991 (2 uM) for hr. FIG. 2D shows an immunoblot of cell proteins probed with 24 h, or left untreated, and incubated with bortezomib at antibodies directed against the proteins listed to the left of the indicated concentrations for 24 h and analyzed for viable blot. Cells were incubated for 12 h or 24 h with bortezomib cells. Data represent meants.d. in triplicate. p-value was after 24 hr of PD 0332991 pretreatment. FIG.2E is an immu determined by two-tailed or *one-tailed t-test. noblots showing that CDK4 and CDK6 expression is dramati 0051 FIG. 4A-E show that sustained G1 arrest overcomes cally reduced by shRNA interference but that such knock chemoresistance in primary myeloma cells. FIG. A-D illus down of CDK4 and CDK6 expression also dramatically trate the viability of primary BMM cells co-cultured with increases p27 expression. MM1.S cells were transduced with HS-5 cells in the presence of bortezomib (4 nM) for 24h after CDK4 (clone 520) and CDK6 (clone 744), or with the non pretreatment with PD 0332991 (2M) for 4 or 17 h (FIG.4A), targeting (n-t) shRNA lentiviral particles. At 66 h post trans or for 4 or 24 h (FIG. 4B). The amount of bortezomib (BZ: 4 duction, the expression of CDK4, CDK6 and p27 were deter nM or 6 nM) is shown below the bar graph, opposite “BZ.” mined by immunoblotting. FIG. 2F shows the percentage of FIGS. 4C and 4D illustrate the viability of the BMM cells BrdU-positive cells at 72 hr post-transduction as determined from MM8 (also shown in FIG. 4B) immediately after isola by FACS. FIG. 2G shows the percentage of increase in MT tion (-24), at 24 h after incubation in the presence or absence in cells transduced with CDK4 (clone 520) and CDK6 (clone of PD 0332991 (0), and at 24 h and 48 h after addition of 744) shRNA and subsequently treated with bortezmib (6 nM) bortezomib (4 nM). Cell death was determined by labeling for 17 h. FIG. 2H shows the viability of cells transduced with DNA with To-Pro-3 at 48 h of incubation with bortezomib CDK4 (clone 520) and CDK6 (clone 744) shRNA and sub and indicated by the numbers shown (right). Data represent sequently treated with bortezmib (6 nM) for 17 h. FIGS. 2I meants.d. in triplicate. p-value was determined by two-tailed and 2J show the viability of dexamethasone-sensitive MM1.S t-test. FIG.4E illustrates synergistic tumor suppression by the cells and dexamethasone-resistant MM1.R cells respectively combination of PD 0332991 and bortezomib using serial after treatment with dexamethasone (dex) using the protocol noninvasive bioluminescence imaging (BLI) to visualize depicted in the schematic diagrams to the left of the graphs. tumor mass on day 8 of NOD/SCID mice treated with PD FIGS. 2K and 2L show the mitochondrial membrane poten 0332991 and bortezomib as diagrammed in FIG. 5A.V. ven tial (MT) of dexamethasone-sensitive MM1.S cells (FIG. tral; D, dorsal. US 2011/0009353 A1 Jan. 13, 2011

0052 FIG. 5A-H illustrate synergistic tumor suppression bortezomib treatment (FIG.6F-G), and q-RT-PCR analysis of by PD 0332991 in combination with bortezomib. FIG. 5A is Bim, Noxa, Mcl-1 and Bcl-2 mRNAs was performed at 13 hr a schematic diagram illustrating the timing of agents admin (FIG. 6H). istered to, followed by bioluminescence imaging (BLI) and 0054 FIG. 7A-G illustrate that Bim mediates PD-B MT (FACS) analyses of NOD/SCID mice that developed induced apoptosis via enhanced neutralization of Mc1-1 and aggressive tumors after injection with Luc--GFP+M1.S cells. Bcl-2. FIG. 7A illustrates the relative mRNA levels of the Mice were treated with PD 0332991 (150 mg/Kg) and bort indicated genes in MM1.S cells that were incubated with eZomib (0.25 mg/Kg) on the days shown. FIG.5B graphically bortezomib (4 nM) for 12 h, with or without pretreatment illustrates the fold of tumor growth as observed by BLIonday with PD 0332991 (0.25 uM) for 24 hr as detected by q-RT 9, relative to day 1 for the same mice. FIG.5C shows a FACS PCR analysis. FIG.7B shows an immunoblots where a family analysis of GFPMM1.S cells and BM cells that were flushed of Bcl-2 proteins were detected. FIG.7C illustrates immuno from mouse femurs on day 11 (after treatment as described in precipitation (IP) and immunoblotting of Bim and proteins FIG. 5A), and stained with MitoTracker Red CMXRos. The that interact with Bim. FIG. 7D is a schematic diagram illus percentage of MT (meants.d.) is as indicated. FIG. 5D trating transfection of MM1.S cells with Bim or non-targeting shows a schematic diagram of the experimental treatment (n-t) siRNA and the time of addition of PD 0332991 and received by mice injected with NOD/SCID mice, after early bortezomib, as well as the time for immunoblotting (IB) and in tumor development. Mice received PD 0332991 (80 FACS analysis of MT. FIG. 7E shows an immunoblot of mg/kg) and bortezomib (0.25 mg/Kg) at the indicated times. cellular proteins from these myeloma cells, where Bim iso FIG.5E shows bioluminescence images of tumors in mice on forms were detected at 72 h post-transfection in the absence days 1 and 22, after treatment as indicated in FIG.5D. FIG.5F of PD 0332991 treatment. FIG. 7F shows the viability of shows the tumor mass in mice treated as indicated and MM1.S cells transduced with Bim or non-targeting (n-t) described in FIG. 5D. Bioluminescence was used as a mea siRNA. FIG. 7G shows a FACS analysis of MT in cells sure of tumor mass (photons/s/cm/steradian) on days indi treated as shown in FIG. 7D with bortezomib and PD cated. V. Ventral; D, dorsal. p-value was determined by two 0332991. Data are representative of 4 independent experi tailed or *one-tailed t-test. Data are representative of 3 ments. p-value was determined by two-tailed t-test. independent experiments. FIG. 5G-H illustrate activation of 0055 FIG. 8A illustrates activation of Bak and release caspase-8, but not TRAIL, by PD 0332991-bortezomib. FIG. of Smac by PD 0332991-boretzomib in MM1.S cells incu 5G shows a FACS analysis of activated caspase-8 while FIG. bated with bortezomib (4 nM) for 12hafterpretreatment with 5H shows a q-RT-PCR analysis of TRAIL mRNA in MM1.S PD 0332991 (0.25uM) for 24 h. FIG. 8A shows an immuno cells treated as described in FIG. 5A. blot of cellular proteins from these MM1.S cells where Bak and Bak dimer are detected in Bak immune complexes. FIG. 0053 FIG. 6A-H illustrate that suppression of gp130 sig 8B shows an immunoblot of cellular proteins from these naling augments activation of Bim, Noxa and caspase by MM1.S cells where cytochrome c (Cytic), Smac, Bcl-2-fam bortezomib. FIG. 6A shows an immunoblot of proteins from ily and IAP-family were detected in cytosolic (C) or mito MM1.S cells, illustrating caspase-8,-9 and PARP cleavage in chondrial (M) fractions. 10 ug of protein was loaded in each MM1.S cells cultured in media or with HS-5 cells in the lane. Tubulin and Hsp60 were probed as loading controls for presence of absence of bortezomib (4 nM) for 12 h, with or the cytosolic and the mitochondrial fraction, respectively. without PD 0332991 (0.25 uM) pretreatment for 24 h. FIG. Data are representative of 4 independent experiments. FIG. 6B shows an immunoblot of BMM cellular proteins, illustrat 8C is a schematic diagram illustrating the key events in Syn ing PARP cleavage in the BMM cells shown in FIG. 4A, with ergistic induction of apoptosis by inhibition of CDK4 and or without PD 0332991 pretreatment for 17 h. FIG. 6C shows CDK6 with PD 0332991 and induction of Sustained G1 arrest a FACS analysis of surface IL-6R.C. and gp130 in MM1.S cells in combination with induction of apoptosis by low dose cyto treated with increasing concentrations of PD 0332991 for 36 toxic agent. h (upper panels), or with 0.25uMPD 0332991 for 20h before bortezomib (4 nM) was added for 16 h (lower panels). FIG. DETAILED DESCRIPTION OF THE INVENTION 6D shows an immunoblot of proteins from MM1.S cells, illustrating Tyr 705 phosphorylated Stat3 (p-Stat3) and total 0056. The invention involves methods and compositions Stat3 in MM1.S cells cultured as shown in the lower panel of for treating cancer that include use of CDK4 and/or CDK6 FIG. 6C and treated with 5 ng/ml human IL-6 for 10 min. FIG. inhibitors. In some embodiments, the CDK4 and/or CDK6 6E graphically illustrates the relative p-Stat3 levels in the inhibitors are used in combination with other chemotherapeu lanes shown in FIG. 6D, as determined by dividing the p-Stat3 tic agents. For example, the CDK4 and/or CDK6 inhibitors level by the total Stat3 level in each culturing condition and can be used prior to treatment with cytotoxic chemotherapeu compared to that of IL-6 stimulation alone (lane 5). FIG. tic agents. Such pre-treatment with CDK4 and/or CDK6 6F-G illustrate gp130 expression, the percentage of MT cells inhibitors arrests the cancerous cell cycle (e.g., at the G1 or and cell viability as detected by FACS analysis after 15 h of G1-S phase of the cell cycle). When the CDK4 and/or CDK6 bortezomib treatment and knocking down gp130 expression inhibitors are no longer administered, the cancer cells Syn using gp130 shRNAs (n-t shRNA is a non-target shRNA). chronously begin to proceed through the cell cycle. However, FIG. 6H illustrates relative mRNA levels of Bim, Noxa, according to the invention, the cancer cells become particu Mcl-1 and Bcl-2 mRNAs after 13 hr ofbortezomib treatment larly vulnerable to cytotoxins just as they are released from as detected by q-RT-PCR. For FIG. 6F-H, bortezomib (4 nM) the cell cycle blockade. Hence, a greater proportion of cancer was added at 72 h post transduction of MM1.S cells with cells are killed when the CDK4 and/or CDK6 inhibitors are gp130 shRNA lentiviral particles. gp130 expression and the used (e.g. before administering an chemotherapeutic agent) percentage of MT cells were analyzed by FACS at 15 h of than when no CDK4 and/or CDK6 inhibitors are used. US 2011/0009353 A1 Jan. 13, 2011

0057 Thus, the combination therapy both prevents tumor tably re-enter the cell cycle and proliferate without restraint cell replication and induces Synergistic killing of tumor cells. during relapse (Chen-Kiang, 2003). While the genetic basis The combination therapy as invented is based on two prin for cell cycle deregulation in MM remains undefined, dele ciples. tion and inactivation of p18'' and other INK4 CKIs have 0058 First, prolonging the inhibition of G1 cell cycle pro been noted (Dib et al., 2006; Ng et al., 1997), and cyclin D is gression can disrupt the coupling between cellular function frequently overexpressed (Chesi et al., 1996; Shaughnessy et and cell cycle progression, thereby preferentially sensitizing al., 2001). Gain of cyclin D expression alone, however, is cycling cancer or tumor cells to killing by a cytotoxic agent. insufficient to drive cell cycle progression in MM. Instead, 0059 Second, inhibition of G1 cell cycle progression can proliferation of primary CD138" human bone marrow lead to synchronous S phase entry, thereby enhancing the myeloma (BMM) cells in vivo is preceded by mutually exclu killing of replicating cancer or tumor cells by a cytotoxic sive co-activation of CDK4-cyclin D1 or CDK6-cyclin D2 agent. specific for each case of MM (Ely et al., 2005), suggesting that CDK4 and CDK6 are promising targets for cell cycle CDK4 and CDK6 control in MM. 0060 Dysregulation of the cyclin-dependent kinase 0063 Cyclin-dependent kinase (CDK)4 and CDK6 asso (CDK)4 and CDK6 activity by gain of function or loss of ciate with the D-type cyclin to promote cell cycle entry and inhibition is one of the most frequent aberrations in cancer progression through G1 by inactivating the retinoblastoma (Malumbres and Barbacid, 2007). Together with the regula protein Rb and antagonizing the INK4 family of CDK inhibi tory D-type cyclin, CDK4 and CDK6 promote cell cycle tors (CKI)s. They also function to titrate the Cip/Kip CKIs entry and progression through G1 by antagonizing the INK4 that inhibit CDK2-cyclin E and CDK2-cyclin A (Sherr and family of CDK inhibitors (CKI)s and titrating the Cip/Kip Roberts, 1999). CKIs that inhibit CDK2-cyclin E and CDK2-cyclin A (Sherr 0064. Inhibition of CDK4 and CDK6 by PD 0332991 in and Roberts, 1999). For example, CDK6 over-expression has freshly isolated primary human BMM cells and myeloma cell been reported in hematopoietic malignancies such as lym lines (HMCL)s ex vivo (ICs, 0.06 uM) led to exclusive G1 phoma and leukemia as well as melanoma. While germline arrest in the absence of apoptosis. Additionally, PD 0332991 mutation of CDK4 is rare in human cancer, rare cases of effectively inhibited CDK4/6 in mantle cell lymphoma hereditary melanoma do arise. Moreover, amplification of (MCL) and acute myeloid leukemia cells (AML) ex vivo CDK4 and deletion of CDK4/6-specific CKIs, p16'' and (Marzec et al., 2006: Wang et al., 2007), and suppressed p15', are among the most common genomic alternations tumor growth in myeloma, AML and solid tumor xenograft in human lung adenocarcinoma (Weir et al., 2007). Emerging models (Baughn et al., 2006; Fry et al., 2004; Wang et al., evidence further suggests that a related CKI p18'' (Guan 2007). However, myeloma tumor growth resumed upon dis et al., 1994; Hirai et al., 1995), which suppresses pituitary continuation of PD 0332991 (Baughnet al., 2006). Therefore, adenoma development in mice (Franklin et al., 1998), is a administration of PD 0332991 alone is not sufficient. tumor Suppressor gene for human glioblastoma development CDK4 and/or CDK6 Inhibitors (Wiedemeyer et al., 2008). CDK4 and CDK6 are dispensable 0065 According to the invention, arrest of the cell cycle, during embryonic development, although they are required for example, using inhibitors of cyclin-dependent kinase 4 for the expansion of hematopoietic progenitors in mice (CDK4) and/or cyclin-dependent kinase 6 (CDK6) primes (Malumbres et al., 2004). In preclinical models, disruption of cancer cells to cytotoxic killing. CDK4 function protects mice from developing mammary and 0066. A variety of CDK4 and/or CDK6 inhibitors can be breast tumors induced by ErbB-2 and Ras (Landis et al., 2006; used in the compositions and methods of the invention. For Yu et al., 2006). Thus, increasing the expression and/or func example, in some embodiments, the inhibitor can be a com tion of CDK4 and/or CDK6 can give rise to cancer. pound of formula I: 0061 According to the invention, inhibition of CDK4 and CDK6 can significantly improve cancer therapeutic outcome by halting unscheduled cancer cell division, especially aggressive and relapsed tumors. However, targeting the cell cycle in cancer with pan-CDK inhibitors has achieved modest Success So far, in part due to lack of selectivity and high toxicity (Malumbres et al., 2008). PD 0332991 is a cell per meable pyridopyrimidine with oral bioavailability. Unlike other broad-spectrum CDK inhibitors, at concentrations spe cific for inhibition of CDK4 and CDK6 (below 5uM) PD 0332991 has little or no activity against at least thirty-eight other types of kinases, including CDK2 (Fry et al., 2004). wherein: 0062) Deregulation of CDK4 and CDK6 is correlated with 0067 X is a heteroatom (e.g., O, N, NH, or S); the loss of cell cycle control in multiple myeloma (MM), the 0068 each R is independently a hydrogen, lower alkyl, second most common hematopoietic malignancy that is rap carboxy-lower alkyl ( (C=O)-lower alkyl), oxygen (=O), idly rising in incidence but remains incurable. In MM, malig or cycloalkyl groups. nant plasma cells retain self-renewing potential in contrast to 0069 PD 0332991 is one example of a compound of for normal plasma cells, which are permanently arrested in G1 mula I with excellent inhibitory activity against CDK4 (ICso due to inhibition of CDK4 and CDK6 by p 18'' (Morse et 0.011 Limol/L) and CDK6 (ICs, 0.016 umol/L). Moreover, al., 1997: Tourigny et al., 2002). During the stable phase of the PD 0332991 has little or no activity against other protein disease, myeloma cells accumulate in the bone marrow (BM) kinases. The chemical name for PD 0332991 is 6-acetyl-8- mainly because of impaired apoptosis. However, they inevi cyclopentyl-5-methyl-2-5-piperazin-1-yl-pyridin-2- US 2011/0009353 A1 Jan. 13, 2011 ylamino)-8H-pyrido 2,3-dipyrimidin-7-one. The structure for PD 0332991 is shown below. -continued N O N C y-soO NH

O O C NH NH

0070 PD 0332991 is a potent anti-proliferative agent, for example, against retinoblastoma (Rb)-positive tumor cells, N NH inducing an exclusive Garrest, with a concomitant reduction of phosphorylation of the Ser7/Ser' residues on the ret inoblastoma (Rb) protein. Further information on PD - 0332991 and related compounds can be found in the O Examples of this application and in U.S. Application Publi \-N N 21 F cation 2005/0059670, the contents of which are specifically 1 \ incorporated herein in their entirety. NH2 O F 0071. In other embodiments, the inhibitor can be a com H pound of formula II: N II 2 (CH2)Air O f NH N 2 / NH R2 N N M N F H F wherein: - N. 0072 R is a hydrogen or halogen atom, an NH, NHR, NHCOR, NO, CN, CH-NH and CH-NHR; or phenyl or M / O heteroaromatic group, wherein the phenyl or heteroaromatic N group is optionally substituted with 1-3 lower alkyl, carboxy H lower alkyl (—(C=O)-lower alkyl), oxygen (=O), or O cycloalkyl groups; 0073 Ar is phenyl or heteroaromatic group, wherein the 0076 wherein Ar is phenyl or heteroaromatic group, phenyl or heteroaromatic group is optionally Substituted with wherein the phenyl or heteroaromatic group is optionally 1-3 lower alkyl, carboxy-lower alkyl (—(C=O)-lower substituted with 1-3 lower alkyl, carboxy-lower alkyl alkyl), oxygen or cycloalkyl groups; and (—(C=O)-lower alkyl), oxygen (=O), or cycloalkyl groups. 0074 n is 0, 1, 2 or 3. 0075. Examples of CDK4 and/or CDK6 inhibitors that can 0077. For further information on CDK4 and/or CDK6 be used in the compositions and methods of the invention also inhibitors see, Malumbres et al., TRENDS PHARM. SCI. 29(1): include the following: 16-21 (2008); Joshi et al., MOL. CANCERTHER. 6(3): 918-25 (2007, the contents of which are specifically incorporated herein in their entireties. 0078. In cases where compounds are sufficiently basic or N N acidic to form acid or base salts, use of the compounds as Salts 2 re OH O may be appropriate. Examples of acceptable salts are organic acid addition salts formed with acids which form a physi ological acceptable anion, for example, tosylate, methane HO O Air Sulfonate, acetate, citrate, malonate, tartarate. Succinate, ben OH HN Zoate, ascorbate, y-ketoglutarate, and y-glycerophosphate. OH Suitable inorganic salts may also be formed, including hydro chloride, Sulfate, nitrate, bicarbonate, and carbonate salts. 0079 Acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a Sufficiently basic compound Such as an amine with a Suitable acid affording a physiologically acceptable anion. Alkali US 2011/0009353 A1 Jan. 13, 2011

metal (for example, Sodium, potassium or lithium) or alkaline I0087. Nucleic acid and amino acid sequences for CDK4 earth metal (for example calcium) salts of carboxylic acids and CDK6 can be found in the art, for example, in the data can also be made. base maintained by the National Center for Biotechnology 0080 Alkyl includes straight or branched Co alkyl Information (NCBI). See website at ncbi.nlm.nih.gov. For groups, e.g., methyl, ethyl, propyl, butyl, pentyl, isopropyl. isobutyl, 1-methylpropyl, 3-methylbutyl, hexyl, and the like. example, one nucleic acid sequence for human CDK4 is Lower alkyl includes straight or branched C. alkyl groups, provided below for easy reference as SEQ ID NO:1 (NCBI e.g., methyl, ethyl, propyl, 1-methylethyl, butyl, 1-methyl accession number NM000075; gi: 1693.6531). propyl, 2-methylpropyl, 1,1-dimethylethyl, pentyl, 1-meth ylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1-dimethylpropyl. 1.2-dimethylpropyl. 2,2-dimethylpropyl, and the like. AGCCCTCCCA GTTTCCGCGC GCCTCTTTGG CAGCTGGTCA 0081. The term “alkylene' refers to a divalent straight or 41 CATGGTGAGG GTGGGGGTGA. GGGGGCCTCT CTAGCTTGCG branched hydrocarbon chain (e.g., ethylene. —CH2— CH, ). 81 GCCTGTGTCT ATGGTCGGGC CCTCTGCGTC CAGCTGCTCC 0082 Cycloalkyl includes groups such as, cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, and the like, and alkyl 121 GGACCGAGCT CGGGTGTATG GGGCCGTAGG AACCGGCTCC Substituted cycloalkyl group, preferably straight or branched 161 GGGGCCCCGA TAACGGGCCG CCCCCACAGC ACCCCGGGCT Calkyl group such as methyl, ethyl, propyl, butyl orpentyl. In some embodiments, the cycloalkyl is C-7 cycloalkyl, and 2O1 GGCGTGAGGG TCTCCCTTGA TCTGAGAATG GCTACCSTCTC in other embodiments the cycloalkyl is a C-7 cycloalkyl group Such as, cyclopentyl or cyclohexyl, and the like. 241 GATATGAGCC AGTGGCTGAA ATTGGTGTCG GTGCCTATGG 0083 Lower alkoxy includes C. alkoxy groups, such as 281 GACAGTGTAC AAGGCCCGTG ATCCCCACAG TGGCCACTTT methoxy, ethoxy or propoxy, and the like. Lower alkanoyl includes C. alkanoyl groups, such as formyl, acetyl, pro 321 GTGGCCCTCA AGAGTGTGAG. AGTCCCCAAT GGAGGAGGAG panoyl, butanoyl, pentanoyl or hexanoyl, and the like. Lower alkoxycarbonyl includes C, alkoxycarbonyl groups, such as 361 GTGGAGGAGG CCTTCCCATC AGCACAGTTC GTGAGGTGGC methoxycarbonyl, ethoxycarbonyl or propoxycarbonyl, and 4O1 TTTACTGAGG CGACTGGAGG CTTTTGAGCA TCCCAATGTT the like. Lower alkylamino group means amino group Substi tuted by C. alkyl group. Such as, methylamino, ethylamino, 44.1 GTCCGGCTGA TGGACGTCTG TGCCACATCC CGAACTGACC propylamino, butylamino, and the like. Lower alkylcarbam oyl group means carbamoyl group Substituted by C. alkyl 481. GGGAGATCAA. GGTAACCCTG GTGTTTGAGC ATGTAGACCA group (e.g., methylcarbamoyl, ethylcarbamoyl, propylcar 521 GGACCTAAGG ACATATCTGG ACAAGGCACC CCCACCAGGC bamoyl, butylcarbamoyl). Halogen atom means halogen atom Such as fluorine atom, chlorine atom, bromine atom or 561 TTGCCAGCCG AAACGATCAA. GGATCTGATG CGCCAGTTTC iodine atom. I0084 Aryl refers to a Comonocyclic or fused cyclic aryl 6O1 TAAGAGGCCT AGATTTCCTT CATGCCAATT GCATCGTTCA group, Such as phenyl, indenyl, or naphthyl, and the like. 641 CCGAGATCTG AAGCCAGAGA ACATTCTGGT GACAAGTGGT C7 aroyl, includes groups such as benzoyl or naphthoyl. 0085 Heterocyclic or heterocycle refers to monocyclic 681 GGAACAGTCA AGCTGGCTGA CTTTGGCCTG GCCAGAATCT saturated heterocyclic groups, or unsaturated monocyclic or fused heterocyclic group containing at least one heteroatom, 721 ACAGCTACCA GATGGCACTT ACACCCGTGG TTGTTACACT e.g., 0-3 nitrogenatoms ( NR where R is H, alkyl), 0-1 761. CTGGTACCGA GCTCCCGAAG TTCTTCTGCA GTCCACATAT oxygen atom (—O—), and 0-1 Sulfur atom (—S ). Non limiting examples of Saturated monocyclic heterocyclic 8O1 GCAACAC CTG TGGACATGTG GAGTGTTGGC TGTATCTTTG group includes 5 or 6 membered Saturated heterocyclic group, Such as tetrahydrofuranyl, pyrrolidinyl, morpholinyl, pip 841 CAGAGATGTT TCGTCGAAAG CCTCTCTTCT GTGGAAACTC eridyl, piperazinyl or pyrazolidinyl. Non-limiting examples ofunsaturated monocyclic heterocyclic group includes 5 or 6 881 TGAAGCCGAC CAGTTGGGCA AAATCTTTGA, CCTGATTGGG membered unsaturated heterocyclic group. Such as furyl, pyr 921. CTGCCTCCAG. AGGATGACTG GCCTCGAGAT GTATCCCTGC rolyl pyrazolyl, imidazolyl, thiazolyl, thienyl, pyridyl or pyrimidinyl. Non-limiting examples of unsaturated fused het 961 CCCGTGGAGC CTTTCCCCCC AGAGGGCCCC GCCCAGTGCA erocyclic groups includes unsaturated bicyclic heterocyclic group, Such as indolyl, isoindolyl, quinolyl, benzothizolyl, OO1 GTCGGTGGTA. CCTGAGATGG AGGAGTCGGG AGCACAGCTG chromanyl, benzofuranyl, and the like. O41. CTGCTGGAAA TGCTGACTTT TAACCCACAC AAGCGAATCT 0.086. In addition, as illustrated herein, nucleic acids that can inhibit the expression and/or translation of CDK4 and/or O81. CTGCCTTTCG. AGCTCTGCAG CACTCTTATC TACATAAGGA CDK6 can also be used as inhibitors of CDK4 and/or CDK6. 121. TGAAGGTAAT CCGGAGTGAG CAATGGAGTG GCTGCCATGG Such inhibitory nucleic acids can hybridize to a CDK4 and/or CDK6 nucleic acid under intracellular or stringent condi 161 AAGGAAGAAA AGCTGCCATT TCCCTTCTGG ACACTGAGAG tions. The inhibitory nucleic acid is capable of reducing expression or translation of a nucleic acid encoding the CDK4 2O1 GGCAATCTTT GCCTTTATCT CTGAGGCTAT GGAGGGTCCT and/or CDK6. A nucleic acid encoding a CDK4 and/or CDK6 241 CCTCCATCTT TCTACAGAGA TTACTTTGCT GCCTTAATGA may be genomic DNA as well as messenger RNA. It may be incorporated into a plasmid vector or viral DNA. It may be 281 CAT TCCCCTC CCACC TOTCC TTTTGAGGCT TCTCCTTCTC single strand or double strand, circular or linear. Examples of 321. CTTCCCATTT CTCTACACTA AGGGGTATGT TCCCTCTTGT nucleic acids encoding CDK4 and CDK6 are set forth in SEQ ID NO:1 and SEQID NO:2.

US 2011/0009353 A1 Jan. 13, 2011 13

0090. The CDK6 protein encoded by SEQ ID NO:3 has of a particular target nucleic acid. Inhibitory nucleic acids of NCBI accession number NP 001250 (gi: 4502741) and is the invention include, for example, a ribozyme oran antisense provided below for easy reference (SEQ ID NO:4). nucleic acid molecule. 0094. The antisense nucleic acid molecule may be single or double stranded (e.g. a small interfering RNA (siRNA)), MEKDGLCRAD OOYECVAEIG EGAYGKVFKA RDLKNGGRFV and may function in an enzyme-dependent manner or by steric blocking. Antisense molecules that function in an 41 ALKRVRVOTG EEGMPLSTIR EVAVLRHLET FEHPNVVRLF enzyme-dependent manner include forms dependent on 81 DVCTVSRTDR ETKLTLVFEH WDODLTTYLD KVPEPGVPTE RNase H activity to degrade target mRNA. These include single-stranded DNA, RNA and phosphorothioate mol 121 TIKDMMFOLL RGLDFLHSHR VVHRDLKPON ILVTSSGOIK ecules, as well as the double-stranded RNAi/siRNA system 161 LADFGLARIY SFOMALTSVV VTLWYRAPEV LLOSSYATPV that involves target mRNA recognition through sense-anti sense strand pairing followed by degradation of the target 2O1 DLWSVGCIFA EMFRRKPLFR GSSDVDOLGK ILDWIGLPGE mRNA by the RNA-induced silencing complex. Steric block ing antisense, which are RNase-H independent, interferes 241 EDWPRDVALP ROAFHSKSAO PIEKFVTDID ELGKDLLLKC with gene expression or other mRNA-dependent cellular pro 281 LTFNPAKRIS AYS ALSHPYF ODLERCKENL DSHLPPSONT cesses by binding to a target mRNA and getting in the way of other processes. Steric blocking antisense includes 2'-O alkyl 321 SELNTA (usually in chimeras with RNase-H dependent antisense), 0091 An inhibitory nucleic acid is a polymer of ribose peptide nucleic acid (PNA), locked nucleic acid (LNA) and nucleotides or deoxyribose nucleotides having more than morpholino antisense. three nucleotides in length. An inhibitory nucleic acid may 0.095 Small interfering RNAs, for example, may be used include naturally-occurring nucleotides; synthetic, modified, to specifically reduce CDK4 and/or CDK6 translation such or pseudo-nucleotides such as phosphorothiolates; as well as that the level of CDK4 and/or CDK6 polypeptide is reduced. siRNAS mediate post-transcriptional gene silencing in a nucleotides having a detectable label such as P. biotin, sequence-specific manner. See, for example, http://www.am fluorescent dye or digoxigenin. An inhibitory nucleic acid bion.com/techlib/hottopics/rnai/rnai may2002 print.html that can reduce the expression and/or activity of a CDK4 (last retrieved May 10, 2006). Once incorporated into an and/or CDK6 nucleic acid may be completely complemen RNA-induced silencing complex, siRNA mediate cleavage of tary to the CDK4 and/or CDK6 nucleic acid (e.g., SEQ ID the homologous endogenous mRNA transcript by guiding the NO:1 or 3). Alternatively, some variability between the complex to the homologous mRNA transcript, which is then sequences may be permitted. cleaved by the complex. The siRNA may be homologous to 0092 An inhibitory nucleic acid of the invention can any region of the CDK4 and/or CDK6 mRNA transcript. The hybridize to a CDK4 and/or CDK6 nucleic acid under intra region of homology may be 30 nucleotides or less in length, cellular conditions or under stringent hybridization condi preferable less than 25 nucleotides, and more preferably tions. The inhibitory nucleic acids of the invention are suffi about 21 to 23 nucleotides in length. SiRNA is typically ciently complementary to endogenous CDK4 and/or CDK6 double stranded and may have two-nucleotide 3' overhangs, nucleic acids to inhibit expression of a CDK4 and/or CDK6 for example, 3' overhanging UU dinucleotides. Methods for nucleic acid under either or both conditions. Intracellular designing siRNAs are known to those skilled in the art. See, conditions refer to conditions such as temperature, pH and for example, Elbashir et al. Nature 411: 494-498 (2001): salt concentrations typically found inside a cell, e.g. a mam Harborth et al. Antisense Nucleic Acid Drug Dev. 13:83-106 malian cell. One example of Such a mammalian cell is a (2003). Typically, a target site that begin with AA, have 3'UU cancer cell (e.g., a myeloma cell), or any cell where CDK4 overhangs for both the sense and antisense siRNA strands, and/or CDK6 is or may be expressed. and have an approximate 50% G/C content is selected. siR 0093 Generally, stringent hybridization conditions are NAs may be chemically synthesized, created by in vitro tran selected to be about 5°C. lower than the thermal melting point Scription, or expressed from an siRNA expression vector or a (T) for the specific sequence at a defined ionic strength and PCR expression cassette. See, e.g. http://www.ambion.com/ pH. However, stringent conditions encompass temperatures techlib/tb/tb 506.html (last retrieved May 10, 2006). in the range of about 1° C. to about 20° C. lower than the 0096. When an siRNA is expressed from an expression thermal melting point of the selected sequence, depending vector or a PCR expression cassette, the insert encoding the upon the desired degree of stringency as otherwise qualified siRNA may be expressed as an RNA transcript that folds into herein. Inhibitory nucleic acids that comprise, for example, 2. an siRNA hairpin. Thus, the RNA transcript may include a 3, 4, or 5 or more stretches of contiguous nucleotides that are sense siRNA sequence that is linked to its reverse comple precisely complementary to a CDK4 and/or CDK6 coding mentary antisense siRNA sequence by a spacer sequence that sequence, each separated by a stretch of contiguous nucle forms the loop of the hairpin as well as a string of U's at the otides that are not complementary to adjacent coding 3' end. The loop of the hairpin may be of any appropriate sequences, may inhibit the function of a CDK4 and/or CDK6 lengths, for example, 3 to 30 nucleotides in length, preferably, nucleic acid. In general, each stretch of contiguous nucle 3 to 23 nucleotides in length, and may be of various nucle otides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. otide sequences including, AUG, CCC, UUCG, CCACC, Non-complementary intervening sequences may be 1, 2, 3, or CTCGAG, AAGCUU, CCACACC and UUCAAGAGA 4 nucleotides in length. One skilled in the art can easily use (SEQ ID NO:7). SiRNAs also may be produced in vivo by the calculated melting point of an inhibitory nucleic acid cleavage of double-stranded RNA introduced directly or via a hybridized to a sense nucleic acid to estimate the degree of transgene or virus. Amplification by an RNA-dependent RNA mismatching that will be tolerated for inhibiting expression polymerase may occur in Some organisms. US 2011/0009353 A1 Jan. 13, 2011

0097. An antisense inhibitory nucleic acid may also be shRNA. For example, the promoter can be a U6 promoter, used to specifically reduce CDK4 and/or CDK6 expression, which is useful for continuous expression of the shRNA. The for example, by inhibiting transcription and/or translation. An vector can, for example, be passed on to daughter cells, allow antisense inhibitory nucleic acid is complementary to a sense ing the gene silencing to be inherited. See, McIntyre G. Fan nucleic acid encoding a CDK4 and/or CDK6. For example, it ning G. Design and cloning strategies for constructing may be complementary to the coding Strand of a double shRNA expression vectors, BMC BIOTECHNOL. 6:1 (2006): stranded cDNA molecule or complementary to an mRNA Paddison et al., Short hairpin RNAs (shRNAs) induce sequence. It may be complementary to an entire coding strand sequence-specific silencing in mammalian cells, GENES DEV. or to only a portion thereof. It may also be complementary to 16 (8): 948-58 (2002). all or part of the noncoding region of a nucleic acid encoding 0103) An inhibitor of the invention may also be a a CDK4 and/or CDK6. The non-coding region includes the 5' ribozyme. A ribozyme is an RNA molecule with catalytic and 3' regions that flank the coding region, for example, the 5' activity and is capable of cleaving a single-stranded nucleic and 3' untranslated sequences. An antisense inhibitory acid such as an mRNA that has a homologous region. See, for nucleic acid is generally at least six nucleotides in length, but example, Cech, Science 236: 1532-1539 (1987); Cech, Ann. may be about 8, 12, 15, 20, 25, 30, 35, 40, 45, or 50 nucle Rev. Biochem. 59:543-568 (1990); Cech, Curr. Opin. Struct. otides long. Longer inhibitory nucleic acids may also be used. Biol. 2: 605-609 (1992); Couture and Stinchcomb, Trends 0098. An antisense inhibitory nucleic acid may be pre Genet. 12:510-515 (1996). A ribozyme may be used to cata pared using methods known in the art, for example, by expres lytically cleave a CDK4 and/or CDK6 mRNA transcript and sion from an expression vector encoding the antisense inhibi thereby inhibit translation of the mRNA. See, for example, tory nucleic acid or from an expression cassette. Haseloff et al., U.S. Pat. No. 5,641,673. A ribozyme having Alternatively, it may be prepared by chemical synthesis using specificity for a CDK4 and/or CDK6 nucleic acid may be naturally-occurring nucleotides, modified nucleotides or any designed based on the nucleotide sequence of SEQID NO:1 combinations thereof. In some embodiments, the inhibitory and/or 3. nucleic acids are made from modified nucleotides or non 0104 Methods of designing and constructing a ribozyme phosphodiester bonds, for example, that are designed to that can cleave an RNA molecule intrans in a highly sequence increase biological stability of the inhibitory nucleic acid or specific manner have been developed and described in the art. to increase intracellular stability of the duplex formed See, for example, Haseloffet al., Nature 334:585-591 (1988). between the antisense inhibitory nucleic acid and the sense A ribozyme may be targeted to a specific RNA by engineering nucleic acid. a discrete “hybridization” region into the ribozyme. The 0099 Naturally-occurring nucleotides include the ribose hybridization region contains a sequence complementary to or deoxyribose nucleotides adenosine, guanine, cytosine, the target RNA that enables the ribozyme to specifically thymine and uracil. hybridize with the target. See, for example, Gerlach et al., EP 0100 Examples of modified nucleotides include 5-fluo 321.201. The target sequence may be a segment of about 5, 6, rouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypox 7, 8, 9, 10, 12, 15, 20, or 50 contiguous nucleotides selected anthine, Xanthine, 4-acetylcytosine, 5-(carboxyhydroxylm from a nucleotide sequence having SEQ ID NO:1 and/or 3. ethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, Longer complementary sequences may be used to increase 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- the affinity of the hybridization sequence for the target. galactosylqueosine, inosine, N6-isopentenyladenine, 1-me 0105. The hybridizing and cleavage regions of the thylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-me ribozyme can be integrally related; thus, upon hybridizing to thyladenine, 2-methylguanine, 3-methylcytosine, the target RNA through the complementary regions, the cata 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methy lytic region of the ribozyme can cleave the target. Thus, an laminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, existing ribozyme may be modified to target a CDK4 and/or beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, CDK6 nucleic acid of the invention by modifying the hybrid 5-methoxyuracil, 2-methylthio-N6-isopentenyladeninje, ization region of the ribozyme to include a sequence that is uracil-5oxyacetic acid, butoxosine, pseudouracil, queosine, complementary to the target CDK4 and/or CDK6 nucleic 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiou acid. Alternatively, an mRNA encoding a CDK4 and/or racil, 5-methyluracil, uracil-5-oxacetic acid methylester, CDK6 may be used to select a catalytic RNA having a specific uracil-5-oxacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3- ribonuclease activity from a pool of RNA molecules. See, for N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. example, Bartel & Szostak, Science 261:141 1-1418 (1993). 0101 Thus, inhibitory nucleic acids of the invention may 0106. One example of a sequence of an shRNA that can be include modified nucleotides, as well as natural nucleotides used to knock down CDK4 is CCGGACAGTTCGTGAG Such as combinations of ribose and deoxyribose nucleotides, GTGGCTTTACTCGAGTAAAGCCACCTCACGA ACT and an antisense inhibitory nucleic acid of the invention may GTTTTTT (SEQ ID NO:5). An example of an shRNA be of any length discussed above and that is complementary sequence that can be used to knock down CDK6 is CCGG SEQID NO:1 and/or 3. GACCTGGAAAGGTGCAAAGAACTCGAGTT CTTTG 0102. An inhibitor of the invention can also be a small CACCTTTCCAGGTCTTTTTG (SEQID NO:6). hairpin RNA or short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence Methods of Use gene expression via RNA interference. The shRNA hairpin 0107 According to the invention, administration of CDK4 structure is cleaved by the cellular machinery into a siRNA, and/or CDK6 inhibitors is useful for treating cancer, particu which is then binds to and cleaves the target mRNA. shRNA larly when used in conjunction with other chemotherapeutic can be introduced into cells via a vector encoding the shRNA, agents. As described and illustrated herein, CDK4 and/or where the shRNA coding region is operably linked to a pro CDK6 inhibitors are cell cycle inhibitors. Targeting the cell moter. The selected promoter permits expression of the cycle in combination with cytotoxic killing is a promising US 2011/0009353 A1 Jan. 13, 2011

approach to rational cancer therapy. According to the inven and/or CDK6 inhibitor, or a combination of CDK4 and/or tion effective control of the cell cycle, by controlling cyclin CDK6 inhibitors is administered about 3 or 4 days prior to dependent kinases CDK4 and CDK6, is a key to effective administering a chemotherapeutic agent or anti-tumor agent. cancer treatment. By combining CDK4 and CDK6-specific Infurther embodiments, the CDK4 and/or CDK6 inhibitor, or inhibitors with at least one chemotherapeutic agent tumor cell a combination of CDK4 and/or CDK6 inhibitors is adminis proliferation is not only inhibited but cell cycle-coupled apo tered about 1 or 2 days prior to administering a chemothera ptosis is activated in cancer cells, including highly aggressive peutic agent or anti-tumor agent. In some embodiments, the and intractable cancer cells Such as multiple myeloma cells. inhibitor of CDK4 and/or CDK6 is administered from 2 to 7 0108 Treatment of, or treating, cancer is intended to days prior to the chemotherapeutic agent, or from 4 to 24 include the alleviation of or diminishment of at least one hours prior to administration of the chemotherapeutic agent. symptom typically associated with the disease. The treatment 0113. The CDK4 and/or CDK6 inhibitor(s) (compounds also includes alleviation or diminishment of more than one and/or nucleic acids) can be administered to an animal in symptom. The treatment may cure the cancer, e.g., it may single or multiple doses per day over a period of time suffi substantially kill the cancer cells and/or it may arrest or cient to sensitize the cancer cells to a chemotherapeutic agent. inhibit the growth of the cancerous tumor. The treatment can For example, the CDK4 and/or CDK6 inhibitor(s) can be also promote apoptosis of cancer cells. Thus, by inhibiting administered to an animal in single or multiple doses per day cell cycle progression, CDK4 and/or CDK6 inhibitors can over a period of from one to 180 days, or one to 150 days, or promote a cascade of activities that leads to cellular apopto one to 120 days, or one to ninety days, or one to forty-five sis, particularly in cancer cells. days, or one to thirty days, or one to twenty one days, or one 0109. One aspect of the present invention is a method of to fourteen days, or one to twelve days, or one to seven days, treating cancer in an animal, for example, for treatment of or one to four days, or one to three days, or one to two days. human and veterinary animals, which includes administering 0114. The administration of the CDK4 and/or CDK6 to a subject animal (e.g., a human), a therapeutically effective inhibitor(s) can be followed by administration of an chemo amount of a CDK4 and/or CDK6 inhibitor, or a combination therapeutic agent to the animal. Alternatively, the CDK4 and/ of CDK4 and/or CDK6 inhibitors. Such CDK4 and/or CDK6 or CDK6 inhibitor(s) can be administered at the same time as inhibitors include CDK4 small molecule inhibitors, CDK6 the chemotherapeutic agent(s). In some embodiments, the small molecule inhibitors, CDK4 inhibitory nucleic acids, CDK4 and/or CDK6 inhibitor(s) are administered before and/or CDK6 inhibitory nucleic acids. administering one or more chemotherapeutic agents, and then 0110. Another aspect of the invention is a method of treat such CDK476 inhibitor administration is either terminated or ing cancer in an animal which includes administering to a continued during administration of one or more chemothera Subject animal (e.g., a human), a therapeutically effective peutic agent(s). In further embodiments, the CDK4 and/or amount of a CDK4 and/or CDK6 inhibitor, or a combination CDK6 inhibitor(s) are administered before and during inter of CDK4 and/or CDK6 inhibitors, prior to administering a mittent administration of one or more chemotherapeutic chemotherapeutic agent or anti-tumor agent. agent(s). 0111. The CDK4 and/or CDK6 inhibitors are adminis 0115 PD 0332991 acts reversibly. When PD 0332991 is tered for a time sufficient to induce G1 arrest. Such a time no longer administered, cancer cells (e.g., myeloma cells) needed to induce G1 arrest can be determined by immuno synchronously enter the S phase of the cell cycle and are histochemical assay for phosphorylation of retinoblastoma sensitized to killing by low doses of chemotherapeutic agents (Rb) protein by CDK4/6 and Ki67 staining of cycling cells for (e.g., bortezomib) during G1/S transition. This has been a selected cancer type or disease. Ki67 is a molecule that can shown by the inventors in myeloma cell lines in vitro and in be easily detected in growing cells in order to gain an under the animal models in vivo. standing of the rate at which cancer cells or the cells within a 0116. In some embodiments, the CDK4 and/or CDK6 tumor are growing. Ki67 can be detected using commercially inhibitor(s) (e.g., PD 0332991) are administered on days one available anti-Ki67 antibodies (e.g., from Thermo Fisher Sci (1) to seven (7) days and then administration of these inhibi entific) and standard immunohistochemical procedures. In tors is terminated. However, at about day three (3), one or general, it is believed from preliminary results that adminis more chemotherapeutic agents (e.g., bortezomib and/or dex tration of CDK4 and/or CDK6 inhibitors for about three days amethasone) or radiation is periodically administered. Such is sufficient to induce G1 arrest for most cancer and/or tumor administration of chemotherapeutic agents and/or radiation is cell types. continued for at least about three to about six weeks. This 0112. In some embodiments, the CDK4 and/or CDK6 therapeutic regimen can be repeated. Thus, for example, after inhibitor, or a combination of CDK4 and/or CDK6 inhibitors, about twenty-one (21) to about forty-two (42) days, another is administered about 9 or 10 days prior to administering a cycle begins with administration of the CDK4 and/or CDK6 chemotherapeutic agent or anti-tumor agent. In other inhibitor(s) (e.g., PD 0332991) for seven (7) days and with embodiments, the CDK4 and/or CDK6 inhibitor, or a com administration of one or more chemotherapeutic agents (e.g., bination of CDK4 and/or CDK6 inhibitors is administered bortezomib and/or dexamethasone), or radiation, periodi about 8 days prior to administering a chemotherapeutic agent cally for three to six weeks. Therefore, the chemotherapeutic or anti-tumor agent. In further embodiments, the CDK4 and/ agents are administered both with and without the PD or CDK6 inhibitor, or a combination of CDK4 and/or CDK6 0332991 so that the chemotherapeutic agents can kill both the inhibitors is administered about 7 days prior to administering sensitized cells exposed to the CDK4 and/or CDK6 inhibitor a chemotherapeutic agent or anti-tumor agent. In still further (s) as well as the synchronized cells that are proceeding embodiments, the CDK4 and/or CDK6 inhibitor, or a com through the cell cycle (without CDK4 and/or CDK6 inhibitor bination of CDK4 and/or CDK6 inhibitors is administered (s)). about 5 or 6 days prior to administering a chemotherapeutic 0117 Treatment of, or treating, cancer is intended to agent or anti-tumor agent. In other embodiments, the CDK4 include the alleviation of or diminishment of at least one US 2011/0009353 A1 Jan. 13, 2011

symptom typically associated with the disease. The treatment (0123 Thus, the invention is also directed to a method of also includes alleviation or diminishment of more than one inhibiting osteoclast differentiation in an animal by adminis symptom. The treatment may cure the cancer, e.g., it may tering to the animal atherapeutically effective amount of one substantially kill the cancer cells and/or it may arrest or or more CDK4 and/or CDK6 inhibitors of the invention to inhibit the growth of the cancerous tumor. The treatment can thereby inhibit osteoclast differentiation. also promote apoptosis of cancer cells. Thus, inhibitors of 0.124. The amount of CDK4 and/or CDK6 inhibitor CDK4/6 actually inhibit the cascade of activities that leads to administered can vary with the type of inhibitor. However, in progression through the cell cycle, particularly in cancer cells some embodiments, the CDK4 and/or CDK6 inhibitors are where retinoblastoma (Rb) is involved in the control of the used in dosages of about 1 to about 500 mg, or about 2 mg to cell cycle. about 400 mg. or about 5 mg to about 300 mg. or about 10 mg to about 200 mg. For example, in some embodiments, the PD 0118 Anti-cancer activity can be evaluated against vari 0332991 inhibitor is used in dosages of about 100 mg. eties of cancers using methods available to one of skill in the Chemotherapeutic Agents and/or Radiation art. Anti-cancer activity, for example, is determined by iden tifying the lethal dose (LD100) or the 50% effective dose 0.125. According to the invention, chemotherapeutic (ED50) or the dose that inhibits growth at 50% (GI50) of an agents and/or radiation is administered to an animal or patient agent of the present invention that inhibits the growth of a who may be suffering from cancer after administration of one cancer. In one aspect, anti-cancer activity is the amount of the or more CDK4 and/or CDK6 inhibitors. Any available che agents that kills 50% or 100% of the cancer cells, for example, motherapeutic agent can be used with the CDK4 and/or when measured using standard dose response methods. CDK6 inhibitors of the invention. 0.126 In some embodiments, radiation is used with or after 0119 The present invention also provides a method of administration of one or more CDK4 and/or CDK6 inhibitors. monitoring responses to therapy and/or evaluating a thera Thus, one aspect of the invention is a method of sensitizing peutically effective dosage for treating a cancer with an cancer and/or tumor cells in a mammal to a radiation therapy inhibitor of the invention. For example, dosages can be evalu comprising: administering to the mammal an inhibitor of ated by determining the LD100 or ED50 of the agent in vitro. CDK4 and/or CDK6 in an amount sufficient to arrest the Such a method permits calculation of the approximate cancer and/or tumor cell cycle at G1 to thereby sensitize the amount of agent needed per Volume to inhibit cancer cell cancer and/or tumor cells in the mammal to radiation. After growth or to kill 50% to 100% of the cancer cells. Such administration of one or more CDK4 and/or CDK6 inhibitors, amounts can be determined, for example, by standard the method involves treating the mammal with radiation for a microdilution methods. time sufficient to inhibit growth of the cancer and/or tumor 0120 Moreover, according to the invention, several genes cells in the mammal. are related to the cell cycle arrest and amplified apoptotic I0127. In general, radiation therapy (or radiotherapy) is the pathway related to administration of CDK4 and/or CDK6 medical use of ionizing radiation as part of cancer treatment inhibitor(s). For example, expression or activity of Noxa, to control the growth and spreading of malignant cells. Proton BIM, MCC1, SMAC, Bak, ciap1, and/or ciap2 that can be radiotherapy works by sending protons with varying kinetic used to monitor and evaluate responses to the therapy. These energy to precisely stop at the tumor. Radiation therapy works can be measured by RT-PCR, gene profiling, SNP analysis or by damaging the DNA of cells. The damage is caused by a Western blot. Another way to monitor in vivo responses to photon, electron, proton, neutron or ion beam directly or therapy this is by observing mitochondrial depolarization, indirectly ionizing the atoms which make up the DNA chain. using FACS and Mitotracker (a dye taken up by intact mito Indirect ionization happens as a result of the ionization of chondria). water, forming free radicals, notably hydroxyl radicals, 0121. The term “animal as used herein, refers to an ani which then damage the DNA. In the most common forms of mal. Such as a warm-blooded animal, which is susceptible to radiation therapy, most of the radiation effect is through free or has a disease associated with protease expression, for radicals. Because cells have mechanisms for repairing DNA example, cancer. Mammals include cattle, buffalo, sheep, damage, breaking the DNA on both strands proves to be the goats, pigs, horses, dogs, cats, rats, rabbits, mice, and most significant technique in modifying cell characteristics. humans. Also included are other livestock, domesticated ani Because cancer cells generally are undifferentiated and stem mals and captive animals. The term “farm animals' includes cell-like, they reproduce more, and have a diminished ability chickens, turkeys, fish, and other farmed animals. Mammals to repair sub-lethal damage compared to most healthy differ and other animals including birds may be treated by the entiated cells. Thus, the DNA damage to cancer cells is inher methods and compositions described and claimed herein. In ited through cell division, causing them to die or reproduce Some embodiments, the animal is a human, for example, a more slowly. human patient Suffering from cancer. I0128. The total dose radiation is often fractionated (spread 0122) Another aspect of the invention is a method of inhib out over time) in order to give normal cells time to recover. iting osteoclast differentiation. According to the invention, Fractionation regimes are highly individualized between dif CDK4 and/or CDK6 inhibitors also inhibit osteoclast differ ferent radiotherapy centers and even between individual doc entiation, for example, through inhibition of progenitor cell tors. In the United States, Australia, and much of Europe, the expansion. Osteoclasts are a type of bone cell that removes typical fractionation schedule for adults is 1.8 to 2Gyperday, bone tissue by removing its mineralized matrix. Osteoclasts five days a week. In the northern United Kingdom, fractions are normally involved in bone resorption, however, bone are more commonly 2.67 to 2.75Gy per day. For children, a destruction is a key issue in metastasis to the bone in many typical fraction is 1.5 to 1.7 Gyper day, reducing the chance cancers. Accordingly, by inhibiting osteoclast differentiation, and severity of late-onset side effects. In some cases, two the CDK4 and/or CDK6 inhibitors can inhibit metastasis of fractions per day are used near the end of a course of treat cancer cells to bone. ment. This schedule, known as a concomitant boost regimen US 2011/0009353 A1 Jan. 13, 2011 or hyperfractionation, is used on tumors that regenerate more breakdown of these intracellular proteins, thereby interfering quickly when they are Smaller, for example, some tumors in with numerous cellular processes. This disruption of essential the head and neck. processes and pathways within cancer cells lead to cell death 0129. Also, as illustrated herein, administration of chemo and inhibit tumor growth. therapeutic agents such as proteasome inhibitors and steroids can be used in the methods of the invention. For example, bortezomib is a reversible proteasome inhibitor that is effec tive in treating some but not all myeloma cases. Use of CDK4 and/or CDK6 inhibitors improves the efficacy of bortezomib. Similar results are observed with the steroid dexamethasone. O s H Bortezomib can be used in dosages of about 1 mg/m to about N N CH3 3 mg/m human skin. The average surface area of a human is n N about 1 to 2 m. Therefore, in some embodiments, bort eZomib is used in dosages of about 0.5 mg to about 3 mg. | 2 | f O| B CH3 Dexamethasone can be used in dosages of about 1 to about N HO1 YOH 100 mg. or about 2 mg to about 50 mg. or about 5 mg to about Bortezomib 40 mg, or about 10 mg to about 30 mg. In some embodiments, dexamethasone is used in dosages of about 20 mg. 0130. In addition to proteasome inhibitors and steroids, 21 O other chemotherapeutic agents can be employed with the CDK4 and/or CDK6 inhibitors of the invention. According to N N sus N B1 O the invention, any chemotherapeutic agent useful for modu i H lating, treating, killing or otherwise affecting the physiologi cal state of a cancer or tumor cell can be used in the methods O O 1N O of the invention (e.g., with or after administration of one or CEP 18770 more CDK4 and/or CDK6 inhibitors). 0131 Examples of chemotherapeutic agents that can be used with the CDK4 and/or CDK6 inhibitors include protea Some inhibitors, mimetics of second mitochondria-derived activator of caspases (SMAC), Steroids, cytotoxic agents, photosensitizing agents, folate antagonists, pyrimidine anti ^ O H O H O metabolites, purine antimetabolites, 5-aminolevulinic acid, N-N- N Nulls N N s CH3 alkylating agents, platinum anti-tumor agents, anthracy H S H S O clines, DNA intercalators, epipodophyllotoxins, DNA topoi O CH O Somerases, microtubule-targeting agents, Vinca alkaloids, CH taxanes, epothilones and asparaginases. Further types of che H3C H3C motherapeutic agents and information on Such agent can be PR-171 found in Bast et al., CANCER MEDICINE, edition 5, which is (carfilzomib) available free as a digital book. See website at ncbi.nlm.nih. gov/books/bv.fcgi?call=bv View...ShowTOC&rid=cmed. TOC&depth=2. 0132) Proteasomes are enzyme complexes that are present 0.133 Second mitochondria-derived activator of caspases in all cells and that break down intracellular proteins in a (Smac) promotes apoptosis via activation of caspases. Simi regulated manner within both healthy and cancerous cells, larly, Smac mimetics also induce apoptosis in cancer cells Intracellular proteins are involved in pathways by which can (e.g., in multiple myeloma (MM) cells). Even cancer cells cer cells multiply, spread, interact with other cells and avoid resistant to conventional and Bortezomib therapies can programmed cell death. Inhibition of proteasomes by inhibi become vulnerable to SMAC mimetics. Examples of SMAC tors such as bortezomib, NPI-0052 (salinosporamide A) CEP mimitics that can be used in the invention include compounds 18770 and PR-171 (carfilzomib) prevents the regulated with the following structures.

LBW242 US 2011/0009353 A1 Jan. 13, 2011

-continued

wherein R3 is hydrogen (H) or CO C(CH). DNA. Although these compounds react with many biologic 0134. Folic acid antagonists are cytotoxic agents used as molecules, the primary cytotoxic actions of both classes of antineoplastic, antimicrobial, anti-inflammatory, and agents appear to be the inhibition of DNA replication and cell immune-suppressive agents. While several folate antagonists division produced by their reactions with DNA. However, the have been developed, and several are now in clinical trial, chemical differences between these two classes of agents methotrexate (MTX) is the antifolate with the most extensive produce significant differences in their anti-tumor and toxic history and widest spectrum of use. MTX is often a key drug effects. The most frequently used alkylating agents are the in the chemotherapy regimens used to treat patients with nitrogen mustards. Although thousands of nitrogen mustards acute lymphoblastic leukemia, lymphoma, osteosarcoma, have been synthesized and tested, only five are commonly breast cancer, choriocarcinoma, and head and neck cancer, as used in cancer therapy today. These are mechlorethamine (the well as being an important agent in the therapy of patients original "nitrogen mustard'), cyclophosphamide, ifosfamide, with nonmalignant diseases, such as rheumatoid arthritis, melphalan, and chlorambucil. Closely related to the nitrogen psoriasis, and graft-Versus-host disease. mustards are the aziridines, which are represented in current 0135 Pyrimidine antimetabolites include fluorouracil, therapy by thiotepa, mitomycin C, and diaziquone (AZQ). cytosine arabinoside, 5-azacytidine, and 2,2'-difluoro-2'- Thiotepa (triethylene thiophosphoramide) has been used in deoxycytidine. In some embodiments, the compositions and the treatment of carcinomas of the ovary and breast and for the methods of the invention include use of cytosine arabinoside, intrathecal therapy of meningeal carcinomatosis. The alkyl whose structure is shown below. alkane Sulfonate, buSulfan, was one of the earliest alkylating agents. This compound is one of the few currently used agents that clearly alkylate through an SN2 reaction. Hepsulfam, an alkyl Sulfamate analogue of buSulfan with a wider range of anti-tumor activity in preclinical studies, has been evaluated in clinical trials but thus far has demonstrated no Superiority HO 1s to buSulfan. BuSulfan has a most interesting, but poorly N O understood, selective toxicity for early myeloid precursors. OPH This selective effect is probably responsible for its activity against chronic myelocytic leukemia (CML). 0.138 Photosensitizing agents induce cytotoxic effects on OH cells and tissues. Upon exposure to light the photosensitizing compound may become toxic or may release toxic Substances 0.136 Purine antimetabolites include 6-mercatopurine, Such as singlet oxygen or other oxidizing radicals that are thioguanine, allopurinol (4-hydroxypyrazolo-3,4-d-pyrimi damaging to cellular material or biomolecules, including the dine), deoxycoformycin (pentostatin), 2-fluoroadenosine membranes of cells and cell structures, and Such cellular or arabinoside (fludarabine; 9-f-d-arabinofuranosyl-2-fluorad membrane damage can eventually kill the cells. A range of enine), and 2-chlorodeoxyadenosine (Cl-dAdo, cladribine). photosensitizing agents can be used, including psoralens, In addition to purine and pyrimidine analogues, other agents porphyrins, chlorines, aluminum phthalocyanine with 2 to 4 have been developed that inhibit biosynthetic reactions lead Sulfonate groups on phenyl rings (e.g., AlPcS, or AlPcS) ing to the ultimate nucleic acid precursors. These include and phthalocyanins. Such chemotherapeutic agents become phosphonacetyl-L-aspartic acid (PALA), brequinar, acivicin, toxic when exposed to light. In one embodiment, the photo and hydroxyurea. sensitizing agent is an amino acid called 5-aminolevulinic 0137 Alkylating agents and the platinum anti-tumor com acid, which is converted to protoporphyrin IX, a fluorescent pounds form strong chemical bonds with electron-rich atoms photosensitizer. The structure of 5-aminolevulinic acid is (nucleophiles). Such as Sulfur in proteins and nitrogen in shown below. US 2011/0009353 A1 Jan. 13, 2011 19

represented by the Vinca and Colchicum alkaloids, as well as other plant-derived products such as paclitaxel (Taxol) and podophyllotoxin, do not target DNA. Rather, they either inter act with intact microtubules, integral components of the HO NH cytoskeleton of the cell, or with their subunit molecules, the tubulins. Clinically useful plant products that target microtu bules include the Vinca alkaloids, primarily vinblastine (VLB), vincristine (VCR), vinorelbine (Navelbine, VRLB), 5-Aminolevulinic acid has been approved for treating skin and a newer Vinca alkaloid, vinflunine (VFL; 20.20'-dif and esophagus cancers and is in clinical trial for brain tumor luoro-3',4'-dihydrovinorelbine), as well as the two taxanes, detection and therapy. After administration, 5-aminolevulinic paclitaxel and docetaxel (Taxotere). The structure of pacli acid is generally metabolically converted to protoporphyrin taxel is provided below. IX. Light therapy is used to activate this photosensitizing agent. For example, laser treatment can be used. Alterna tively, light rods can be inserted into the flesh.

0139 Topoisomerase poisons are believed to bind to DNA, the topoisomerase, or either molecule at or near the region of the enzyme involved in the formation of the DNA protein covalent linkage. Many topoisomerase poisons. Such as the anthracyclines and actinomycin D, are relatively planar hydrophobic compounds that bind to DNA with high affinity by intercalation, which involves stacking of the compound between adjacent base pairs. Anthracyclines intercalate into double-stranded DNA and produce structural changes that interfere with DNA and RNA syntheses. Two of the clinically relevant anthracyclines are shown below.

O OH O OH

H 0.142 Hence, examples of chemotherapeutic agents that O OCH O OH CH3 can be used include, but are not limited to, aldesleukin, 5-ami O nolevulinic acid, asparaginase, bleomycin Sulfate, camptoth ecin, carboplatin, carmustine, cisplatin, cladribine, cyclo HN phosphamide (lyophilized), cyclophosphamide (non OH lyophilized), cytarabine (lyophilized powder), dacarbazine, Doxorubicin dactinomycin, daunorubicin, diethylstilbestrol, doxorubicin O OH O (doxorubicin, 4'-epidoxorubicin, 4- or 4'-deoxydoxorubicin), H epoetin alfa, esperamycin, etidronate, etoposide, N.N-bis(2- chloroethyl)-hydroxyaniline, 4-hydroxycyclophosphamide, OH fenoterol, filgrastim, floxuridine, fludarabine phosphate, fluorocytidine, fluorouracil, fluorouridine, goserelin, granis H etron hydrochloride, idarubicin, ifosfamide, interferon alpha O OCH O OH CH3 2a, interferon alpha-2b, leucovorin calcium, leuprolide, O levamisole, mechiorethamine, medroxyprogesterone, mel phalan, methotrexate, mitomycin, mitoxantrone, muscarine, HN octreotide, ondansetron hydrochloride, oxyphenbutaZone, OH paclitaxel, pamidronate, pegaspargase, plicamycin, Salicylic Daunorubicin acid, salbutamol, Sargramostim, streptozocin, taxol, terbuta line, terfenadine, thiotepa, teniposide, vinblastine, Vindesine and Vincristine. Other chemotherapeutic agents and toxic 0140. Non-intercalating topoisomerase-targeting drugs effector molecules for use in the present invention are dis include epipodophyllotoxins such as etoposide and tenipo closed, for example, in WO98/13059; Payne, 2003; US 2002/ side. Etoposide is approved in the United States for the treat 0.147138 and other references available to one of skill in the ment of testicular and Small cell lung carcinomas. Etoposide phosphate is more water soluble than etoposide and is rapidly art. converted to etoposide in vivo. Other non-intercalating topoi Somerase-targeting drugs include topotecan and irinotecan. Cancers 0141 Unique classes of natural chemotherapeutic agents 0.143 According to the invention, the CDK4/6 inhibitors have been derived from plants. As distinct from those agents described herein are useful for treating cancer. As used derived from bacterial and fungal Sources, the plant products, herein, the term "cancer includes solid mammalian tumors US 2011/0009353 A1 Jan. 13, 2011 20 as well as hematological malignancies. The terms "tumor bors, and can sometimes migrate to distal sites to generate cell(s)' and "cancer cells(s) are used interchangeably tumors in other areas of the body. herein. 0144) “Solid mammalian tumors” include cancers of the Cell Culture Systems head and neck, lung, mesothelioma, mediastinum, esopha 014.9 The invention also provides cell culture systems and gus, stomach, pancreas, hepatobiliary system, Small intestine, methods for assessing the resistance or sensitivity of tumor colon, colorectal, rectum, anus, kidney, urethra, bladder, and/or cancer cells in a mammal to various chemotherapeutic prostate, urethra, penis, testis, gynecological organs, ovaries, agents and dosing regimens. In particular, the invention pro breast, endocrine system, skin central nervous system; sarco vides an ex vivo cell culture system that recapitulates a mas of the Soft tissue and bone; and melanoma of cutaneous patient's tumor cell drug sensitivity and/or tumor cell drug and intraocular origin. resistance. This cell culture system includes (a) primary can 0145 The term “hematological malignancies' includes cer or tumor cells isolated from the patient; (b) HS-5 or childhood leukemia and lymphomas, Hodgkin's disease, HS-27A human Stromal cells; and (c) an amount of human lymphomas of lymphocytic and cutaneous origin, acute and interleukin-6 (IL-6) and human insulin-like growth factor-1 chronic leukemia, plasma cell neoplasms and cancers asso (IGF-1) effective for maintaining proliferation of the cancer ciated with AIDS. or tumor cells. 0146 In some embodiments, the cancer is associated with 0150. This cell culture system can be used in a method for inactivation of the retinoblastoma gene or protein. The ret evaluating the resistance or sensitivity of tumor and/or cancer inoblastoma protein (abbreviated Rb) is a tumor suppressor cells to chemotherapeutic agents and dosing regimens by: (a) protein that is dysfunctional in many if not all types of cancer. isolating primary cancer or tumor cells from a mammal; (b) Exemplary Rb protein-expressing cancers include, without co-culturing the primary cancer or tumor cells with HS-5 or limitation, all acute myelogenous leukemias (AML); acute HS-27A human stromal cells to form a mixed cell culture; (c) promyelocytic leukemia (APL); all myeloproliferative disor incubating the mixed cell culture with an inhibitor of CDK4 ders (MPD), including chronic myelogenous leukemia and/or CDK6, wherein the inhibitor is present in an amount (CML), polycythemia Vera, essential thrombocythemia, and Sufficient to arrest the primary cancer or tumor cells at cell idiopathic myelofibrosis; all myelodysplastic syndromes cycle phase G1, to thereby form an arrested cell culture; (d) (MDS) and myelodysplastic/myeloproliferative diseases; all adding a test chemotherapeutic agent to the arrested cell acute lymphoblastic leukemias (ALL), including precursor culture to form a test culture; and (e) observing whether the B-lymphoblastic leukemia/lymphoma and precursor T lym cancer or tumor cells in the test culture undergo apoptosis, to phoblastic leukemia/lymphoma; chronic lymphocytic leuke thereby identify a chemotherapeutic agent effective for treat mia (CCL); multiple myeloma (MM); monoclonal gamm ment of a cancer or tumor in a mammal. opathy of undetermined significance (MGUS); amyloidosis: 0151. Apoptosis can be detected using any available pro Hodgkin lymphoma (HL), including all classical Hodgkin cedure. For example, any of the following apoptotic param lymphoma cell types (e.g., Reed Sternberg cell; including eters can be detected or monitored to assess apoptosis: (i) nodular Sclerosis, mixed cellularity and lymphocyte depleted fragmentation of DNA in populations of cells or in individual types); all non-Hodgkin’s lymphomas (NHL) including all B cells, in which apoptotic DNA breaks into different length cell, all T cell and all NK cell types; histiocytic disorders and pieces; (ii) alterations in membrane asymmetry; (iii) activa mastocytosis. tion of apoptotic caspases; and (iv) release of cytochrome C 0147 In addition, a cancer at any stage of progression can and AIF into cytoplasm by mitochondria. Membrane asym be treated, such as primary, metastatic, and recurrent cancers. metry can be monitored by observing whether phosphati The invention can also be used to treat autoimmune defi dylserine translocates from the cytoplasmic to the extracellu ciency syndrome-associated Kaposi's sarcoma, cancer of the lar side of the cell membrane. Caspases are a family of adrenal cortex, cancer of the cervix, cancer of the proteases that set off a cascade of events resulting in loss of a endometrium, cancer of the esophagus, cancer of the head multitude of cell functions. and neck, cancer of the liver, cancer of the pancreas, cancer of the prostate, cancer of the thymus, carcinoid tumors, chronic 0152. In some embodiments, apoptosis can be detected lymphocytic leukemia, Ewing's sarcoma, gestational tropho using a TUNEL method according to the manufacturer's blastic tumors, hepatoblastoma, multiple myeloma, non instructions (Roche, Indianapolis, Ind.). Small cell lung cancer, retinoblastoma, or tumors in the ova ries. A cancer at any stage of progression can be treated or Compositions and Formulations detected. Such as primary, metastatic, and recurrent cancers. 0153. In one embodiment, the invention provides a phar Information regarding numerous types of cancer can be maceutical composition comprising an inhibitor of CDK4 found, e.g., from the American Cancer Society (www.cancer. and/or CDK6. The inhibitor can be any available CDK4 and/ org), or from, e.g., Wilson et al. (1991) Harrison's Principles or CDK6 inhibitor, including the small molecule inhibitors of Internal Medicine, 12th Edition, McGraw-Hill, Inc. Both and inhibitory nucleic acids described herein. Compositions human and Veterinary uses are contemplated. of the invention can include more than one inhibitor. Combi 0148. As used herein the terms “normal mammalian cell nations of inhibitors may be used, for example, a combination and “normal animal cell are defined as a cell that is growing of small molecule inhibitors and/or a combination of inhibi under normal growth control mechanisms (e.g., genetic con tory nucleic acids. In some embodiments, both Small mol trol) and that displays normal cellular differentiation and ecule inhibitors and inhibitory nucleic acids are used in the normal migration patterns. Cancer cells differ from normal same composition. cells in their growth patterns, migration and in the nature of 0154 The inhibitors are present in the compositions in their cell Surfaces. For example cancer cells tend to grow therapeutically effective amounts where the precise amount continuously and chaotically, without regard for their neigh to be administered to an animal or patient will be the respon US 2011/0009353 A1 Jan. 13, 2011

sibility of the veterinarian or attendant physician. However, to compositions of the invention can also contain thickening achieve the desired effect(s), an inhibitor of the invention, or agents such as cellulose and/or cellulose derivatives. They a combination thereof, may be administered as single or may also contain gums such as Xanthan, guar or carbo gum or divided dosages, for example, of at least about 0.01 mg/kg to gum arabic, or alternatively polyethylene glycols, bentones about 750 mg/kg, of at least about 0.1 mg/kg to about 500 and montmorillonites, and the like. mg/kg, at least about 1 mg/kg to about 300 mg/kg, or at least about 10 mg/kg to about 250 mg/kg of body weight, although 0.161 For oral administration, an inhibitor (e.g., a small other dosages may provide beneficial results. In some molecule inhibitor) may be present as a powder, a granular embodiments, the dosage is about 25 mg/kg to about 200 formulation, a solution, a suspension, an emulsion or in a mg/kg. In other embodiments, the inhibitor of CDK4 and/or natural or synthetic polymer or resin for ingestion of the CDK6 is administered at a dosage of about 0.1 mg/Kg to active ingredients from a chewing gum. The inhibitor may about 150 mg/Kg per day. or at a dosage of about 125 mg per also be presented as a bolus, electuary or paste. The formu day. lations may, where appropriate, be conveniently presented in 0155 Daily doses of the inhibitors of the invention can discrete unit dosage forms and may be prepared by any of the vary as well. Such daily doses can range, for example, from methods well known to the pharmaceutical arts including the about 0.001 g/day to about 5 g/day, from about 0.005 g/day to step of mixing the therapeutic agent with liquid carriers, solid about 2.5 g/day, from about 0.01 g/day to about 2 g/day, from matrices, semi-solid carriers, finely divided Solid carriers or about 0.025 g/day to about 8 g/day, from about 0.04 g/day to combinations thereof, and then, if necessary, introducing or about 4 g/day, and from about 0.05 g/day to about 2 g/day. In shaping the product into the desired delivery system. The total some embodiments, the inhibitor of CDK4 and/or CDK6 is active ingredients in Such formulations comprise from 0.1 to administered at a dosage of about 125 mg per day. 99.9% by weight of the formulation. 0156 The absolute weight of a given inhibitor included in (0162. In some embodiments, the inhibitors of the inven a unit dose can vary widely. For example, about 0.001 to about tion are administered as tablets and/or capsules. For example, 2 g, or about 0.01 to about 1 g, of at least one inhibitor of the small molecule inhibitors are often administered as tablets or invention, or a plurality of inhibitors can be administered. capsules. Tablets or caplets containing the inhibitors of the Alternatively, the unit dosage can vary from about 0.001 g to invention can include buffering agents such as calcium car about 2 g, from about 0.01 g to about 1 g, from about 0.1 g to bonate, magnesium oxide and magnesium carbonate. Caplets about 0.5g, from about 0.05 g to about 0.4g, from about 0.5 and tablets can also include inactive ingredients such as cel g to about 0.2g, or about 125 mg. lulose, pre-gelatinized starch, silicon dioxide, hydroxy pro 0157 To prepare such a pharmaceutical composition, an pyl methyl cellulose, magnesium Stearate, microcrystalline inhibitor of the invention is synthesized or otherwise cellulose, starch, talc, titanium dioxide, benzoic acid, citric obtained, purified as necessary or desired, and optionally acid, corn starch, mineral oil, polypropylene glycol, Sodium lyophilized and/or stabilized. The composition is then pre phosphate, Zinc Stearate, and the like. Hard or soft gelatin pared by mixing the inhibitor with a carrier (e.g., a pharma capsules containing at least one inhibitor of the invention can ceutically acceptable carrier), adjusting it to the appropriate contain inactive ingredients such as gelatin, microcrystalline concentration and then optionally combining this composi cellulose, Sodium lauryl Sulfate, starch, talc, and titanium tion with one or more other agents or excipients. dioxide, and the like, as well as liquid vehicles Such as poly 0158. By “pharmaceutically acceptable' it is meant a car ethylene glycols (PEGs) and vegetable oil. Moreover, enteric rier, diluent, excipient, and/or salt that is compatible with the coated caplets or tablets containing one or more inhibitors of other ingredients of the formulation, and not deleterious to the the invention are designed to resist disintegration in the stom recipient thereof. ach and dissolve in the more neutral to alkaline environment 0159 Pharmaceutical formulations containing atherapeu of the duodenum. tic inhibitor of the invention can be prepared by procedures 0163 Orally administered inhibitors of the invention can known in the art using well-known and readily available also be formulated for Sustained release. In this case, an ingredients. For example, the inhibitor can be formulated inhibitor of the invention can be coated, micro-encapsulated with common excipients, diluents, or carriers, and formed (see WO94/07529, and U.S. Pat. No. 4,962,091), or other into tablets, capsules, Solutions, Suspensions, powders, aero wise placed within a Sustained delivery device. A Sustained sols and the like. Examples of excipients, diluents, and carri release formulation can be designed to release the inhibitor, ers that are suitable for such formulations include buffers, as for example, in a particular part of the intestinal or respiratory well as fillers and extenders such as starch, cellulose, Sugars, tract, possibly over a period of time. Coatings, envelopes, and mannitol, and silicic derivatives. Binding agents can also be protective matrices may be made, for example, from poly included such as carboxymethyl cellulose, hydroxymethyl meric Substances. Such as polylactide-glycolates, liposomes, cellulose, hydroxypropyl methylcellulose and other cellulose microemulsions, microparticles, nanoparticles, or waxes. derivatives, alginates, gelatin, and polyvinyl-pyrrolidone. These coatings, envelopes, and protective matrices are useful 0160 Moisturizing agents can be included such as glyc to coat indwelling devices, e.g., stents, catheters, peritoneal erol, disintegrating agents such as calcium carbonate and dialysis tubing, draining devices and the like. Sodium bicarbonate. Agents for retarding dissolution can also (0164. An inhibitor of the invention can also be formulated be included such as paraffin. Resorption accelerators such as as elixirs or solutions for convenient oral administration or as quaternary ammonium compounds can also be included. Sur Solutions appropriate for parenteral administration, for face active agents such as cetyl alcohol and glycerol instance by intramuscular, Subcutaneous, intraperitoneal or monostearate can be included. Adsorptive carriers such as intravenous routes. A pharmaceutical formulation of an kaolin and bentonite can be added. Lubricants such as talc, inhibitor of the invention can also take the form of an aqueous calcium and magnesium Stearate, and Solid polyethylglycols or anhydrous solution or dispersion, or alternatively the form can also be included. Preservatives may also be added. The of an emulsion or Suspension or salve. In some embodiments, US 2011/0009353 A1 Jan. 13, 2011 22 the inhibitory nucleic acids are administered parenterally, for invention present in a topical formulation will depend on example, at the site of a tumor or systemically to inhibit various factors, but generally will be from 0.01% to 95% of metastasis of cancerous cells. the total weight of the formulation, and typically 0.1-85% by 0.165 Thus, an inhibitor may be formulated for parenteral weight. administration (e.g., by injection, for example, bolus injec 0170 Drops, such as eye drops or nose drops, may be tion or continuous infusion) and may be presented in unit dose formulated with one or more of the inhibitors in an aqueous or form in ampoules, pre-filled Syringes, Small Volumes infusion non-aqueous base also comprising one or more dispersing containers or in multi-dose containers. As noted above, pre agents, solubilizing agents or Suspending agents. Liquid servatives can be added to help maintain the shelve life of the sprays are conveniently delivered from pressurized packs. dosage form. The inhibitors and other ingredients may form Drops can be delivered via a simple eye dropper-capped Suspensions, solutions, or emulsions in oily or aqueous bottle, or via a plastic bottle adapted to deliver liquid contents vehicles, and may contain formulatory agents such as Sus dropwise, via a specially shaped closure. pending, stabilizing and/or dispersing agents. Alternatively, 0171 The inhibitors may further beformulated for topical the inhibitors and other ingredients may be in powder form, administration in the mouth or throat. For example, the active obtained by aseptic isolation of sterile solid or by lyophiliza ingredients may be formulated as a lozenge further compris tion from solution, for constitution with a suitable vehicle, ing a flavored base, usually Sucrose and acacia or tragacanth; e.g., sterile, pyrogen-free water, before use. pastilles comprising the composition in an inert base Such as 0166 These formulations can contain pharmaceutically gelatin and glycerin or Sucrose and acacia; and mouthwashes acceptable carriers, vehicles and adjuvants that are well comprising the composition of the present invention in a known in the art. It is possible, for example, to prepare solu suitable liquid carrier. tions using one or more organic solvent(s) that is/are accept 0172. The pharmaceutical formulations of the present able from the physiological standpoint, chosen, in addition to invention may include, as optional ingredients, pharmaceuti water, from solvents such as acetone, ethanol, isopropyl alco cally acceptable carriers, diluents, solubilizing or emulsify hol, glycol ethers such as the products sold under the name ing agents, and salts of the type that are available in the art. “Dowanol polyglycols and polyethylene glycols, C-C, Examples of Such Substances include normal saline solutions alkyl esters of short-chain acids, ethyl or isopropyl lactate, Such as physiologically buffered saline solutions and water. fatty acid triglycerides Such as the products marketed under Specific non-limiting examples of the carriers and/or diluents the name "Miglyol isopropyl myristate, animal, mineral and that are useful in the pharmaceutical formulations of the Vegetable oils and polysiloxanes. present invention include water and physiologically accept (0167. Other ingredients can be included such as antioxi able buffered saline solutions such as phosphate buffered dants, Surfactants, preservatives, film-forming, keratolytic or saline solutions pH 7.0-8.0. comedolytic agents, perfumes, flavorings and colorings. (0173 The inhibitors of the invention can also be adminis Antioxidants such as t-butylhydroquinone, butylated tered to the respiratory tract. Thus, the present invention also hydroxyanisole, butylated hydroxytoluene and C-tocopherol provides aerosol pharmaceutical formulations and dosage and its derivatives can also be added. forms for use in the methods of the invention. In general. Such 0168 For topical administration, the inhibitors may be dosage forms comprise an amount of at least one of the agents formulated as is known in the art for direct application to a of the invention effective to treat or prevent the clinical symp target area. Forms chiefly conditioned for topical application toms of disease (e.g., cancer). Any statistically significant take the form, for example, of creams, milks, gels, dispersion attenuation of one or more symptoms of the disease (e.g., or microemulsions, lotions thickened to a greater or lesser cancer) treated pursuant to the methods of the present inven extent, impregnated pads, ointments or sticks, aerosol formu tion is considered to be a treatment of such disease within the lations (e.g., sprays or foams), Soaps, detergents, lotions or Scope of the invention. cakes of soap. Thus, in one embodiment, an inhibitor of the 0.174 Alternatively, for administration by inhalation or invention can be formulated as a cream to be applied topi insufflation, the composition may take the form of a dry cally. Other conventional forms for this purpose include powder, for example, a powder mix of the therapeutic agent wound dressings, coated bandages or other polymer cover and a suitable powder base Such as lactose or starch. The ings, ointments, creams, lotions, pastes, jellies, sprays, and powder composition may be presented in unit dosage form in, aerosols. Thus, the inhibitors of the invention can be delivered for example, capsules or cartridges, or, e.g., gelatin or blister via patches or bandages for dermal administration. Alterna packs from which the powder may be administered orally or tively, the inhibitor can beformulated to be part of an adhesive with the aid of an inhalator, insufflator, or a metered-dose polymer, such as polyacrylate or acrylate/vinyl acetate inhaler (see, for example, the pressurized metered dose copolymer. For long-term applications it might be desirable inhaler (MDI) and the dry powder inhaler disclosed in New to use microporous and/or breathable backing laminates, so man, S. P. in Aerosols and the Lung, Clarke, S.W. and Davia, hydration or maceration of the skin can be minimized. The D. eds., pp. 197-224, Butterworths, London, England, 1984). backing layer can be any appropriate thickness that will pro 0.175. Inhibitors of the present invention can also be vide the desired protective and support functions. A suitable administered in an aqueous Solution when administered in an thickness will generally be from about 10 to about 200 oral, aerosol or inhaled form. Thus, other aerosol pharmaceu microns. tical formulations may comprise, for example, a physiologi 0169 Ointments and creams may, for example, beformu cally acceptable buffered saline Solution containing between lated with an aqueous or oily base with the addition of suitable about 0.1 mg/mL and about 100 mg/mL of one or more of the thickening and/or gelling agents. Lotions may be formulated inhibitors of the present invention specific for the indication with an aqueous or oily base and will in general also contain or disease (e.g., cancer) to be treated. Dry aerosol in the form one or more emulsifying agents, stabilizing agents, dispers of finely divided solid inhibitor or nucleic acid particles that ing agents, Suspending agents, thickening agents, or coloring are not dissolved or Suspended in a liquid are also useful in the agents. The inhibitors can also be delivered via iontophoresis, practice of the present invention. Inhibitors of the present e.g., as disclosed in U.S. Pat. Nos. 4,140,122; 4,383,529; or invention may be formulated as dusting powders and com 4,051,842. The percent by weight ofatherapeutic agent of the prise finely divided particles having an average particle size US 2011/0009353 A1 Jan. 13, 2011

of between about 1 and 5um, alternatively between 2 and 3 tion and induces synergistic killing of tumor cells. This com um. Finely divided particles may be prepared by pulveriza bination therapy is accomplished by prolonged inhibition of tion and screen filtration using techniques well known in the CDK4 and CDK6 to induce G1 cell cycle arrest, followed by art. The particles may be administered by inhaling a prede treatment with a chemotherapeutic agent/cytotoxic agent or termined quantity of the finely divided material, which can be radiation in the presence of the CDK4 and CDK6 inhibitor. in the form of a powder. It will be appreciated that the unit By prolonging the inhibition of CDK4/6 and G1 arrest before content of active ingredient or ingredients contained in an addition of a chemotherapeutic or cytotoxic drug, a combi individual aerosol dose of each dosage form need not in itself nation therapy has been invented that sensitizes cancer cells constitute an effective amount for treating the particular (e.g., primary myeloma cells and clonal human myeloma cell infection, indication or disease since the necessary effective lines (HMCLs)) to killing by the chemotherapeutic or cyto amount can be reached by administration of a plurality of toxic agent. Such methods are effective even when the cancer dosage units. Moreover, the effective amount may be cells (e.g. myeloma cells) are resistant to cytotoxic and/or achieved using less than the dose in the dosage form, either chemotherapeutic agents (for example, bortezomib or dex individually, or in a series of administrations. amethasone). 0176 For administration to the upper (nasal) or lower 0181. The invention identifies the optimal order and tim respiratory tract by inhalation, the inhibitors of the invention ing of addition of the CDK inhibitor and the chemotherapeu are conveniently delivered from a nebulizer or a pressurized tic agent or radiation that maximize the killing of multiple pack or other convenient means of delivering an aerosol myeloma cells. Thus, inhibitors of CDK4 and/or CDK6 are spray. Pressurized packs may comprise a suitable propellant employed prior to administration or addition of the chemo such as dichlorodifluoromethane, trichlorofluoromethane, therapeutic or cytotoxic agent. dichlorotetrafluoroethane, carbon dioxide or other suitable 0182 Another aspect of the invention involves induction gas. In the case of a pressurized aerosol, the dosage unit may of synchronous S phase entry by cancer and/or tumor cells. be determined by providing a valve to deliver a metered This method comprises inhibition of CDK4 and CDK6 with amount. Nebulizers include, but are not limited to, those induction of G1 arrest followed by release of CDK4 and described in U.S. Pat. Nos. 4,624,251: 3,703,173; 3,561,444; CDK6 inhibition, which lead to synchronous S phase entry. and 4,635,627. Aerosol delivery systems of the type disclosed Cancer and tumor cells become particularly vulnerable to herein are available from numerous commercial sources chemotherapeutic and cytotoxic agents upon entry into S including Fisons Corporation (Bedford, Mass.), Schering phase. Work by the inventors indicates that this method leads Corp. (Kenilworth, N.J.) and American Pharmoseal Co., (Va.- to synchronous S phase entry by about 70% of human lencia, Calif.). For intra-nasal administration, the therapeutic myeloma cell lines and greater than 82% of human mantle inhibitory agent may also be administered via nose drops, a cell lymphoma cell lines. This is the first demonstration that liquid spray, Such as via a plastic bottle atomizer or metered selective inhibition of CDK4 and CDK6 can lead to effec dose inhaler. Typical of atomizers are the Mistometer (Win tively synchronous S phase entry. According to the invention, trop) and the Medihaler (Riker). this is the most effective method for induction of synchronous 0177. An inhibitor of the invention may also be used in S phase entry. combination with one or more known therapeutic agents, for 0183 This combination therapy induces synergistic kill example, a pain reliever, a vitamin; an antioxidant; an anti ing of tumor cells by inducing synchronous S phase entry bacterial agent; an anti-cancer agent; an anti-inflammatory following the release of G1 arrest induced by inhibition of agent; an antihistamine; a bronchodilator and appropriate CDK4 and CDK6, and preferential killing of tumor cells that combinations thereof, whether for the conditions described are in the S phase of the cell cycle. By induction of synergistic herein or some other condition. killing, this combination therapies sensitize drug-resistant primary myeloma cells to killing by the same drug, to which Kits and Articles of Manufacture they were previously insensitive. This is accomplished by pretreatment with one or more inhibitors of CDK4 and 0178. In one embodiment, the invention provides an CDK6. The combination therapies can also sensitize drug article of manufacture that includes a pharmaceutical com resistant myeloma cells to killing by an alternative cytotoxic position containing an inhibitor of the invention for any of the agent, for example killing primary myeloma cells resistant to uses and methods of the invention. Such articles may be a useful device Such as a Sustained release device, bandage, the combination of PD 0332991/bortezomib by PD 0332991/ transdermal patch or a similar device. The device holds a NPI-0052, PD 0332991/PR-171 or by PD 0332991/dexam therapeutically effective amount of a pharmaceutical compo ethasone. sition. The device may be packaged in a kit along with 0.184 Moreover, the combination therapies kill myeloma instructions for using the pharmaceutical composition for any cells at doses of cytotoxic agent that are substantially lower of the uses or methods described herein. The pharmaceutical than those used when the cytotoxic agent is used as a single composition includes at least one inhibitor of the present agent. Even though two potentially cytotoxic agents (or a invention, in a therapeutically effective amount Such that the cytotoxic agent and radiation) are used, the combination use or method is accomplished. therapy still reduces cytotoxic side effects. 0179 Another aspect of the invention is a kit that includes 0185. The combination therapies also preferentially target a composition containing an inhibitor of the invention pack cycling tumor cells and induces synergistic tumor Suppres aged in a kit along with an anti-cancer agent and instructions sion in human myeloma NOD/SCID mouse xenograft models for using the pharmaceutical composition and the chemo without significant side effects in the host mice. therapeutic agent for any of the uses or methods described 0186 The combination therapies induce synergistic kill herein. ing of human myeloma cells by induction of preferential release of the second mitochondria activator of caspase (SMAC), mitochondria depolarization and caspase activa Unique Features of the Invention tion. 0180. One aspect of the invention is a combination therapy 0187. Another aspect of the invention is a combination that inhibits (i.e., substantially prevents) tumor cell replica therapy which combines the inhibition of CDK4 and CDK6 US 2011/0009353 A1 Jan. 13, 2011 24

(e.g., using PD 0332991) with small molecule inhibitors that 0.195 The invention can be used to predict in advance selectively target the apoptotic pathway identified in this which myeloma patient will respond to a specific combina invention, such as XIAP and the release of cytochrome C. tion therapy and which specific combination will benefit a 0188 Examples of cancers/tumors that can be effectively specific patient by testing the tumor cells isolated from treated by inducing synchronous S phase entry following the patients in the co-culture system ex vivo for only 3-7 days. release of G1 arrest (induced by the inhibition of CDK4 and 0196. The invention can be used to select in advance the CDK6) include a variety of Rb-expressing and primary hema optimal cytotoxic agent for controlling myeloma progression tological cancers. For example, tumors and cancers that can for each myeloma patient using this combination therapy and be treated by this method include but not limited to multiple the co-culture system. myeloma, Walderstrom's macroglobulinemia, lymphoma 0197) The invention involves application of a combination (mantle cell lymphoma, Burkett's lymphoma, diffused large therapy as an intervention for a variety of Rb-expressing and B cell lymphoma) and leukemia. hematopoietic/blood cancers characterized by uncontrolled 0189 In some embodiments, the methods of the invention cell division. Typically, such uncontrolled cell division occurs also involve determining cell cycle gene signatures as biom during drug resistance and aggressive tumor growth. The arkers for blood cancers by induction of synchronous S phase cancers include, but are not limited to, mantle cell lymphoma, entry and analysis of the types of genes expressed and time diffused large B cell lymphoma, acute myeloid leukemia, course of their gene expression profile. Such analysis of gene chronic lymphatic leukemia, chronic myelocytic leukemia, expression can be evaluated, for example, by microarray gene polycythemia Vera, malignantlymphoma, multiple myeloma, expression analysis and real time RT-PCR. Hodgkin's lymphoma, non-Hodgkin’s lymphoma or combi 0190. According to the invention, methods involving such nations thereof. combination therapy can be used to control relapse of Solid 0198 The invention is also useful for inhibiting, control tumors and to Suppress the progression of all cancers that ling and treating the relapse of Solid tumors and to suppress have metastasized or can metastasize to the bone. the progression of all cancers that may metastasize to the 0191) While not wishing to be limited to one mechanism bone. of action, it is believed that the combination therapies of the 0199 The invention can be used to develop combination invention effectively kill primary myeloma cells by overrid therapy in which inhibition of CDK4/6 with PD 0332991 is ing the protection from bone stromal cells. combined with drugs that selectively target the apoptotic 0.192 Another aspect of the invention is to use this com pathway identified in this invention, such as SMAC. bination therapy to inhibit cell cycle reentry and expansion of 0200. The invention is further illustrated by the following cancer stem cells. non-limiting Examples. 0193 Another aspect of the invention is a method for assessing cancer/tumor cell drug sensitivity or drug resis Example 1 tance. This method involves first co-culturing a patient's pri Experimental Procedures mary cancer cells from the bone marrow with a HS-5 human stromal cell line in the presence of cytokines (human IL-6) 0201 This Example describes some of the materials and and growth factor (human IGF-1). For plasma cell neoplasms, methods used in developing the invention. such as multiple myeloma, these cells would be CD138 posi tive cells, for other hematological malignacies, the bone mar Isolation of Primary Bone Marrow Myeloma Cells and Cell row cells to co-culture with the HS-5 cell line would carry, Culture and be selectable by cell Surface markers (e.g., as shown in the Examples). Then this culture is incubated with a CDK4/ 0202 Bone marrow specimens were obtained from mul CDK6 inhibitor to keep these cells in G1. Next, a test chemo tiple myeloma patients at the New York-Presbyterian Hospi therapeutic agent oratest dosage of a chemotherapeutic agent tal under informed consent as part of an Institutional Review is added to the culture, and the amount of cell death or cell Board approved study. Primary CD138" human BM Survival of the cells carrying the hematological cell marker of myeloma (BMM) cells were isolated as previously described the cancer being studied in the culture is determined. Differ (Baughn et al., 2006) from the patients described in Table 1. ent types and combinations of chemotherapeutic agents can be tested as well as different amounts of chemotherapeutic TABLE 1 agents. Use of this culture system and these methods permits one of skill in the art to determine optimal therapeutic regi Clinical information of myeloma cases in this study. mens for treatment of cancer. Thus, the inventors have invented the first ex vivo cell culture system that recapitulates Ig Prior tumor cell drug sensitivity and resistance in the patient. MM fi Age Dx Stage Isotype Tx CD138 is a cell surface marker of plasma cells and malignant 1 59 MM III GK Y myeloma cells. Human interleukin 6 (IL-6) and human insu 2 43 MM II 'K Y: 3 46 MGUS O GK N lin-like growth factor-1 (IGF-1) are available from R&D sys 4 36 MM III GK Y: tems (catalog nos. 206-IL and 291-G1-050, respectively; 5 57 MM III 'K Y: Minneapolis, Minn.). 6 44 MM III GK Y 7 55 MM III GK N Uses of the Invention 8 63 MM III 'K Y 9 60 MM III GK Y: 10 55 MM III GK Y 0194 The invention can be used to treat multiple myeloma 13 72 MM III AK Y patients for example, during aggressive tumor growth or 14 82 MM III G. N relapse by targeting cell division and induction of synergistic 15 44 MM II N tumor killing using the combination therapy, for example, 16 68 MM II G. Y using a combination of PD 0332991 with bortezomib, or PD 0332991 with dexamethasone. US 2011/0009353 A1 Jan. 13, 2011

BMM cells were co-cultured, at a 2:1 ratio with mitomycin CDK6 was validated by immunoblotting and expression of C-arrested HS-5 stromal cells (ATCC, Manassas, Va.). For surface gp130 was determined by FACS analysis, at 72 h analysis, BMM cells were removed from stromal cells by post-transfection. gentle pipetting. The purity of the BMM cells was determined 0207. The sequence of shRNA that was used to knock to be >96% by staining with a PE-conjugated anti-human down CDK4 is CCGGACAGTTCGTGAGGTGGCTTTA CD138 mouse mAb (Invitrogen, Carlsbad, Calif.). CTCGAGTAAAGCCACCTCACGAACTGTTTTTT (SEQ ID NO:5), and the sequence of shRNA that was used to knock 0203 MM1.S and MM1.R human myeloma cell lines down CDK6 is CCGGGACCTGGAAAGGTGCAAAGAA (HMCLs) are described in Greenstein et al. (Exper. Hematol. CTCGAGTTCTTTGC ACCTTTCCAGGTCTTTTTG 31: 271-282 (2003)). Cells were treated with PD 0332991 (2 (SEQID NO:6). uM for BMM cells and 0.25 uM for HMCLs, unless stated otherwise) (Pfizer, San Diego, Calif.), bortezomib (Millen Quantitative RT-PCR nium Pharmaceuticals, Inc. Cambridge, Mass.), or dexam 0208 Total RNA was isolated using the TRIZol reagent ethasone (Sigma, St. Louis, Mo.) at concentrations and for (Invitrogen). The first strand cDNA was synthesized using times indicated. To induce phosphorylation of Stat3, cells SuperScript 111 (Invitrogen) and subjected to real-time RT were cultured in the presence of 5 ng/ml recombinant human PCR using the Assays-on-Demand gene expression mixes IL-6 (PeproTech, Rocky Hill, N.J.). Cell viability was deter specific for human Noxa, Bim, Mcl-1, Bc 12, TRAIL, Rb or mined by trypan blue exclusion and presented as percentage B-actin, and the TaqMan Universal PCR Master Mix (Applied of the starting number of cells (% input). The surface expres Biosystems, Foster City, Calif.). Reactions were carried out in sion of IL-6Ra and gp130 was detected with PE-conjugated triplicate in the ABI PRISM 7900 HT Sequence Detection anti-human CD126 (Immunotech, Marseille, France) and System. The relative amount of products was determined by gp130 (R&D, Minneapolis, Minn.) mouse mabs. Activated the comparative Ct method according to the manufacturer's caspase-8 was stained by using a CaspGLOWTM red active instructions. caspase-8 staining kit (MBL, Woburn, Mass.) and analyzed using a FACSCalibur and Cell Quest (BD Biosciences, San Immunoblotting and Immunoprecipitation Jose, Calif.) and the Flo.Jo software (TreeStar, San Carlos, (0209 Viable cells were obtained by Ficoll density cen Calif.). trifugation (GE Healthcare, Piscataway, N.J.). Cytosolic and mitochondrial fractions were isolated as described (Yang et Analysis of BrdU-Uptake and DNA Content al., 1997). Whole cells or purified mitochondria were lysed in 0204 Cells were incubated with 5-bromo-2-deoxyuridine a buffer containing 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, (BrdU, 5ug/ml; Sigma) at 37° C. for 30 min (HMCLs) or 16 5 mM EDTA, 1% Triton X-100, and protease inhibitors. For h (BMM cells). Cells were fixed with 70% ethanol overnight detection of phosphorylated Stat3, cells were lysed in a buffer at 4°C., incubated with 0.4 mg/ml pepsin for 20 min at room containing 20 mM Tris, pH 7.5, 150 mMNaCl, 1 mM EDTA, temperature and 2N HCl for 10 min at 37° C. Samples were 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophos washed with 50 mM sodium borate (pH 8.5) and then 0.1% phate, 1 mM f-glycerophosphate, 1 mM NaVO, and pro BSA/PBS. To detect BrdU, cells were incubated with a FITC tease inhibitors. Immunoblotting was performed as described conjugated anti-BrdU mouse mab (Roche Diagnostics, in Huang et al. (2004). The primary antibodies used are sum Pleasanton, Calif.) for 30 min at room temperature. For DNA marized in Table 2. Signals were developed with the Super content analysis, cells were incubated further with 50 lug/ml Signal West Femto Maximum Sensitivity Substrate (Pierce propidium iodide and 100 U/ml ribonuclease A (Sigma) for Biotechnology, Rockford, Ill.). 30 min at 37° C. Samples were analyzed by flow cytometry. TABLE 2 Detection of Mitochondrial Membrane Depolarization Antibodies used in immunoblotting 0205 To detect mitochondrial membrane depolarization and immunoprecipitations. (MMD), cells were incubated with 66 nM MitoProbeTMJC-1 Antibody Source Species Clone; Cat.# Sotype or 33 nM MitoTracker Red CMXRos (Invitrogen) for 30 min Cyclin D2 (M20) Santa Cruz Rabbit Sc-593 gG at 37° C. and re-suspended in PBS for FACS analysis. To p27 (C-19) Santa Cruz Rabbit Sc-528 gG detect cell death 2 nM To-Pro-3 (Invitrogen) was added just Phospho-Statis Cell Signaling Mouse i9138 gG1 before acquisition. Stats Upstate Rabbit #06-596 Noxa Alexis Mouse 114C307.1; gG1 Biochemicals iALX804,408 RNA Interference Bim Alexis Ra 3C5; gG2ak Biochemicals #ALX804527 0206 To knock down Bim expression, MM1.S cells were Bim Cell Signaling Rabbit #4582 transfected with 100 nM Bim siRNA using a SignalSilence(R) Bid Cell Signaling Rabbit #2002 Puma Cell Signaling Rabbit #4976 Bim siRNA Kit (Cell Signaling Technology, Danvers, Mass.) Bak Sigma Rabbit HBS897 gG following the manufacturer's instructions. To knock down Bak (TC-100) Calbiochem Mouse iAMO3T gG2a CDK4 and CDK6 or gp130, MM1.S cells were transduced Bax Cell Signaling Rabbit #2772 simultaneously with CDK4 TRCN0000000520 and CDK6 Bcl-2 DakoCytomation Mouse 124; MO887 gG1 Bcl-2 Cell Signaling Rabbit #2876 TRCN0000039744, or with gp130 TRCN0000058283 (283), Bcl-XL Cell Signaling Rabbit #2762 284,286 MISSIONR shRNA lentiviral transduction particles Bcl-XL SouthernBiotech mouse 7B2.5; gG3 (Sigma), following the manufacturer's instructions. The #10O3O-O1 MISSIONR non-target shRNA lentiviral transduction par McI-1 Santa Cruz Rabbit Sc-819 gG ticles were used as a control. Knockdown of Bim, CDK4 and US 2011/0009353 A1 Jan. 13, 2011 26

Inhibition of CDK4 and CDK6 Primes Myeloma Cells for TABLE 2-continued Cytotoxic Killing by Inducing G1 Arrest or Synchronous S Phase Entry Antibodies used in immunoblotting and immunoprecipitations. 0215. Inhibition of CDK4 and CDK6 by PD 0332991 leads to exclusive G1 arrest unaccompanied by apoptosis in Antibody Source Species Clone; Cat.# Sotype primary CD138" human BM myeloma (BMM) cells and Smac Cell Signaling Mouse i2954 gG1 human myeloma cell lines (HMCLs) (Baughn et al., 2006). Cytochrome c Cell Signaling Rabbit #4272 gG XIAP Cell Signaling Rabbit #2045 gG However, the inventors hypothesized that sustained G1 arrest c-IAP1 Cell Signaling Rabbit #4952 may perturb cell cycle-coupled cellular function, thereby sen c-IAP2 Cell Signaling Rabbit #3130 sitizing cycling myeloma cells to cytotoxic killing. PD Caspase-9 Cell Signaling Rabbit #95O2 0332991 acts reversibly. Therefore, the inventors further Caspase-8 Cell Signaling Mouse i9746 gG1 hypothesized that release of the G1 block may lead to a PARP BD Pharmingen Mouse #65196E Ascite Hsp60 BD Biosciences Mouse H611562 gG1 synchronous G1-S transition and also heighten the sensitivity Tubulin Cell Signaling Rabbit #2144 to cytotoxic agents. Actin Santa Cruz Rabbit Sc-1615-R gG 0216) To address these possibilities, a complete G1 arrest p44, p42 Cell Signaling Rabbit #9102 Phospho-p44/42 Cell Signaling Mouse i9106 was induced with PD 0332991 (0.25uM) in HMCLs, includ JNK1 2 Cell Signaling Rabbit #9258 ing MM1.S., as depicted in FIG. 1A. Four hours after PD Phospho-JNK1/2 Cell Signaling Mouse i9255 gG1 0332991 removal (wash-out), the cells began to enter S phase IKB-C. Santa Cruz Rabbit Sc-371 as determined by simultaneous analyses of BrdU-uptake (30 Phospho-IkBC. Cell Signaling Mouse i9246 minutes) and DNA content per cell. The cells progressed synchronously through the cell cycle, leading to a sharp 0210 For immunoprecipitation, lysate (50 ug of protein) increase in the proportion of cells in S phase, to 65% by 12 was precleared with 20 Jul of Protein G PLUS-agarose beads hours and 67% by 18 hours with some progressing to G2(FIG. (Santa Cruz Biotechnology, Santa Cruz, Calif.) and incubated 1B). Induction of G1 arrest and synchronous S phase entry by with rabbit anti-Bim, anti Bcl-XL (Cell signaling Technol PD 0332991 was maintained in the absence of apoptosis for at ogy), anti-Mcll (Santa Cruz), anti-Bak (Sigma) or mouse least 6 days, reinforcing the exceptional selectivity and anti-Bcl-2 (DakoCytomation, Carpinteria, Calif.) overnight reversibility with which PD 0332991 inhibits CDK4/6 and at 4°C. The immunocomplexes were collected by incubation cell cycle progression through G1 (FIG. 1C-E). with Protein G PLUS-agarose beads (Santa Cruz) and cen To determine whether cytotoxic killing is coupled to the cell trifugation. These immunocomplex samples were then ana cycle, myeloma cells were treated with bortezomib at high lyzed by immunoblotting. The primary antibodies used in dose at various times after PD 0332991 removal. immunoblotting are as Summarized in Table 2. 0217. To determine whether cytotoxic killing is coupled to 0211 Signals were developed with the SuperSignal West the cell cycle, myeloma cells were treated with bortezomib at Femto Maximum Sensitivity Substrate (Pierce Biotechnol high doses for one hour at various times after PD 0332991 ogy, Rockford, Ill.). Samples were then washed in lysis buffer removal. Note that bortezomib is also called Velcade and is and immunoblotted with specific antibody against Bim, Mcl available from Millennium Pharmaceuticals. The structure of 1, Bcl-2, Bcl-XL or Bak. Bortezomib is shown below. Myeloma Xenograft Model and Therapy 0212 MM1.S cells (1x107) stably expressing the HSV TK-egFP-luciferase fusion protein were injected intrave OH nously to NOD/SCID (NOD/LTSZPrko/J) mice (Jackson B Laboratories, Bar Harbor, Me.) at 8-9 weeks of age as on 1 Ng(R) described (Wu et al., 2005). The tumor distribution was fol lowed by serial whole-body noninvasive imaging of visible O NH light emitted by luciferase-expressing myeloma cells upon O injection of mice with luciferin. Mice with established dis (S) seminated MM were divided into 4 cohorts, with statistically N NN equivalent tumor burden evaluated by bioluminescence imag i || ing between cohorts. PD 0332991 was dissolved in vehicle Null (50 mM sodium lactate, pH 4.0) and administered daily at 80 mg/kg or 150 mg/kg by gavage for time indicated. Bort Bortezomib eZomib (0.25 mg/kg) was administered intravenously. The control mice received the vehicle through the same route. Bortezomib is a general proteasome inhibitor that has anti Statistical Analysis cancer activity in diverse cancers and has previously been 0213 All statistical analyses were performed by using the used at dosages associated with toxicity. Its exact molecular Student's t-test, and significance was set at p-0.05. mechanism of action was previously not known, due to the pleiotrophic effects of a generalized inhibition of proteasome Example 2 function. Cell Cycle Inhibition Facilitates Cancer Cell Death 0218 Cytotoxic killing was determined 6 hours later in the 0214. This Example illustrates two novel strategies to absence of bortezomib, by assessing cell viability and mito arrest the cell cycle and prime myeloma cells for cytotoxic chondrial membrane depolarization (MMD) (loss of mito killing. chondrial membrane potential) indicative of apoptosis (FIG. US 2011/0009353 A1 Jan. 13, 2011 27

1F). Bortezomib killing was profoundly enhanced by prior ing (referred to as PD-B) may overcome chemoresistance was G1 arrest regardless of the continuous presence or absence of addressed in freshly isolated CD138" BMM cells obtained PD 0332991, and augmented further in cells pulsed with from the patients described in Table 1. Freshly isolated bortezomib during synchronous G1-S transition at 4 hours CD138"BMM cells were co-cultured with mitomycin-treated post PD 0332991 removal (FIG. 1G). The simultaneous loss human HS-5 BM stromal cells (BMSC)s in the presence of of BrdU-uptake and G2/M cells along with increased DNA IL-6 and IGF-1. Under these conditions, proliferation of fragmentation confirmed that bortezomib killing was BMM cells is extended transiently, while BMSC are insensi enhanced before or during S phase entry (FIG. 1H). As a corollary, adding bortezomib at Sub-optimal concentrations tive to PD-B killing due to G2/M arrest. (4 or 6 nM) upon removal of PD 0332991 also led to greater 0222 FIG. 3A-B demonstrate that synergistic killing of MMD and loss of viability in the continuous presence of HMCLs by PD-B was maintained in the presence of BMSC, bortezomib when compared with unsynchronized cells (FIG. despite protection from bortezomib killing. The reduction of 1I-J). Thus, by inducing exclusive and reversible G1 arrest in live BMM cells in 24 hours ex vivo was greater in the pres the absence of apoptosis, selective inhibition of CDK4 and ence of PD 0332991 (1-2 uM), presumably due to accelera CDK6 by PD 0332991 sensitizes cycling myeloma cells to tion of G1 arrest, or bortezomib because it induces apoptosis bortezomib killing, and this is markedly augmented during (FIG. 3C-E). Pretreatment with PD 0332991 for 4-24 hours synchronous G1-S transition following the removal of the G1 markedly augmented bortezomib killing, except for those block. BMM cells that were exceptionally sensitive to bortezomib (e.g., MM13) (FIG.3E-I). Sustained Inhibition of CDK476 Primes Chemoresistant 0223 Importantly, pretreatment with PD 0332991 for 4 Myeloma Cells to Cytotoxic Killing Through Induction of hours was sufficient to sensitize BMM cells isolated from Mitochondrial Membrane Depolarization some bortezomib-refractory patients (MM10) to killing by 0219 Killing by low dose bortezomib (2-6 nM) was bortezomib (FIG. 4A). Extending PD 0332991 pretreatment greater when it was added to HMCLs at 24 or 48 hours after to 24 hours rendered otherbortezomib-refractory BMM cells PD 0332991 treatment than when bortezomib was present susceptible to bortezomib killing, whether they remained concurrently with PD 0332991 (FIG. 2A-B; some data not resistant (MM8) or became sensitive to bortezomib with time shown). These results further verify that sustained G1 arrest of culturing (MM9) (FIG.4B). Synergistic killing was ampli enhances cytotoxic killing of myeloma. As expected, the fied by 48 hours of bortezomib treatment (MM 8) as evi absence of BrdU-uptake in PD 0332991-treated cells was denced by the To-Pro3 assay (FIG. 4C). Induction of G1 accompanied by a marked accumulation of G1 cells, but not arrest by PD 0332991 therefore primes primary BM myeloma dead cells (FIG. 2C). Bortezomib (6 nM) alone induced a cells to cytotoxic killing and overcomes chemoresistance striking loss of cells in the S phase and prominent increase in despite protection by BMSCs. the proportion of G2/M cells and dead cells, consistent with Synergistic Tumor Suppression by Inhibiting CDK4/6 in preferential killing of cells entering the S phase. However, Combination with Cytotoxic Killing bortezomib killed myeloma cells in G1 in synergy with prior 0224. The anti-tumor activity of inhibiting CDK4/6 in PD 0332991 treatment, as observed with high doses of bort combination therapy was then evaluated in a NOD/SCID eZomib (FIGS. 2C and 1 F-H). This correlated with synergis Xenograft human myeloma model by serial noninvasive tic elevation of p27' protein and reduction of cyclin D2. bioluminescence imaging (BLI). In this model, disseminated corroborating that the cells were arrested in O1 (FIG. 2D). tumors develop following injection of Luc"GFPMM1.S Furthermore, induction of G1 arrest by knocking down both cells that stably express the HSV-TK-egFP-luciferase fusion CDK4 and CDK6 with shRNA interference, shown by the dramatic increase in p27 protein and reduction in BrdU protein (Wu et al., 2005). uptake, markedly augmented bortezomib killing by increas 0225. To augment cytotoxic killing by sustained G1 arrest ing MMD (FIG. 2E-H). Sustained inhibition of CDK4/6 by as well as synchronous G1-S transition, mice developing PD 0332991, therefore, primes cycling myeloma cells to aggressive tumors were treated with a sub-optimal dose of cytotoxic killing in early G1. bortezomib (0.25 mg/kg) on day 4, after being given PD 0220 Similarly, induction of G1 arrest by PD 0332991 0332991 (150 mg/kg) daily for 3 days, and on day 7 when cell augmented MMD and cytotoxic killing by low dose dexam cycle resumed following the decline of serum PD 0332991 ethasone (Dex) (5-50 nM), at a level comparable to simulta (FIG. 5A and data not shown). At this concentration, PD neous treatment with Substantially higher concentrations of 0332991 inhibits CDK4/6 in tumor cells overnight and PD 0332991 (2 mM) and Dex (0.1-1.0 mM) (Baughn et al., reduced tumor burden profoundly by day 9 in a related CAG 2006) (Baughn et al., 2006)(FIG.2I-L). Of particular interest, NOD/SCID myeloma model (Baughn et al., 2006). BLI PD 0332991 sensitized Dex-resistant MM1.R cells (a clonal analysis on day 8 demonstrated that tumor development was derivative of MM1.S cells) to killing by low dosebortezomib, synergistically Suppressed by the combination therapy, while leading to virtual eradication of cells in 24 hours through only modestly reduced by PD 0332991 or bortezomib treat dramatic acceleration of MMD independent of Dex (FIG. ment alone (FIG. 5B and FIG. 4E). Moreover, MMD was 2I-L). Induction of sustained G1 arrest by PD 0332991 inhi differentially induced by bortezomib in human myeloma bition of CDK4/6, therefore, primes HMCLs, including cells but not in the mouse BM cells, and was augmented by chemoresistant myeloma cells, for killing by more than one PD 0332991 pretreatment (FIG.5C). These observation indi cytotoxic agent through synergistic induction of MMD. cate that induction of G1 arrest and synchronous cell cycle progression by PD 0332991 leads to synergistic tumor sup Sustained G1 Arrest Primes Chemoresistant Primary pression by amplifying differential killing of myeloma cells Myeloma Cells for Cytotoxic Killing Despite Stromal Pro by bortezomib in vivo. tection 0226 Prolonging treatments with low concentrations of 0221) The possibility that induction of sustained G1 arrest PD 0332991 (80 mg/kg, 10 days) and bortezomib (0.25 with PD 0332991 followed by low doses of bortezomib kill mg/kg, days 10, 13, 17, and 20) early in tumor development US 2011/0009353 A1 Jan. 13, 2011 28 reduced tumor growth to 20% of the vehicle treated mice by 2000; Puthalakath et al., 2007), suggesting that they may be day 21, as opposed to less than 50% by PD 0332991 or up-regulated by impaired IL-6 signaling to enhance bort bortezomib alone (FIG. 5D-F). Therefore, sequential treat eZomib killing. Knocking downgp130 expression by shRNA ment with sub-optimal concentration of PD 0332991 and interference profoundly augmented MMD and loss of viabil bortezomib early in disease development also leads to syner ity, as well as induction of Bim, Noxa and Mcl-1, but not gistic tumor Suppression. Bcl-2, mRNAs, in response to bortezomib (FIGS. 6F-H). Collectively, these data indicate that in concert with loss of Suppression of IL-6 Signaling Augments Bortezomib Acti IL-6R.C. and Stat3 expression, Suppression of gp130 signaling vation of Bim, Noxa and Caspase-9 impairs IL-6 signaling and augments bortezomib killing 0227. To address the mechanism that underlies synergistic through differential activation of Bim, Noxa and Mcl-1 syn killing in early G1 by PD-B, the inventors focused on signal thesis in cells treated with PD 0332991 and bortezomib. ing upstream and downstream of MMD, a signature for prim ing of myeloma cells by PD 0332991 to cytotoxic killing. Bim Mediates Synergistic Killing by Neutralizing Mcl-1 and Killing by PD-B is caspase-dependent as it is completely Bcl-2 in the Absence of Noxa inhibited by the pan-caspase inhibitor ZVAD-FMK (data not 0230 Noxa, however, does not contribute to the induction shown). The cleavage of caspase-9 as well as poly ADP of apoptosis by PD 0332991+bortezomib treatment (PD-B) ribose polymerase (PARP) was synergistically induced by because Noxa mRNA and protein were no longer detectable PD-B in HMCLs and BMMs regardless of the presence of following PD 0332991-induced G1 arrest (FIGS. 7A-B). By BMSCs, demonstrating that the downstream intrinsic apop contrast, Bimand MCL-1, but not Bcl-2, mRNAs were coor tosis pathway was activated (FIGS. 6A-B). Activation of dinately elevated by bortezomib and further by PD-B, capase-8 by bortezomib was similarly augmented by prior PD whereas the control Rb mRNA remained unchanged (FIG. 0332991 treatment (FIG. 6A and FIG.5G-H), suggesting that 7A). The prominent increases in Bim and Mcl-1 mRNAs death ligands such as TNF-C., FasL and TRAIL might have were not mirrored by the modest increases in Bim isoforms by been induced to trigger the extrinsic apoptotic pathway (Pe PD-B or in Mc1-1 protein by bortezomib (FIG. 7B), suggest tersen et al., 2007: Varfolomeev et al., 2007; Vince et al., ing these proteins were kept in check with PD-B by rapid 2007). However, no TNF-C. or FasL mRNA was detected in turnover. Consistent with this possibility, activation of ERK, myeloma cells under any condition, and TRAIL mRNA which is known to promote Bim degradation (Ley et al., 2003) remained unchanged by PD-B despite a marginal increase by but not JNK, was modestly increased in PD-B, as was inhi bortezomib (FIG. 5H and data not shown). Activation of bition of NF-KB (data not shown). Nonetheless, the increases caspase-8, therefore, is likely secondary to activation of the in Bim and Mcl-1 proteins were specific because other BH3 intrinsic apoptosis pathway (Slee et al., 1999), as a means to only (Puma and Bid) and anti-apoptotic (Bcl-2 and Bcl-XL) amplify apoptosis in PD-B. proteins did not vary appreciably (FIG. 7B). 0228. The absence of death ligands during synergistic 0231 Bim is thought to mediate bortezomib killing of activation of MMD and caspase-8 by PD-B despite protection myeloma cells by neutralizing Mcl-1 and Bcl-2 (Gomez by BMSCs (FIGS. 3-4, and 6A) suggests that critical BMSC Bougie et al., 2005). Reciprocal immunoprecipitation-immu derived survival signals must have been disrupted. The inven noblotting revealed an increase in the association of Bim with tors hypothesized that alikely survival signal candidate might Mc1-1 or Bcl-2, but not with Bcl-XL, in response to PD-B but be IL-6, which is essential for BMM survival, produced at not to either PD 0332991 or bortezomib (FIG.7C). Confirm high levels by BMSCs such as HS-5 cells (Roecklein and ing a role for Bim in the induction of apoptosis in PD-B, Torok-Storb, 1995) and can antagonize bortezomib killing of knocking down all three Bim isoforms by siRNA interference myeloma cells through IL-6 signaling (Chauhan et al., 1996). increased the viability and reduced MMD in myeloma cells, Testing indicated that the expression of surface IL-6a (gp80) including those treated with PD 0332991 or bortezomib (FIG. on myeloma cells was virtually eliminated by PD 0332991 7D-F), or in combination when MMD was extensive (FIG. (0.25 mM), but did not vary in response to low dose bort 7G). Taken together, these data indicate that Bim and Mcl-1 eZomib (4 nM). gp130, the signaling receptor Subunit, was are coordinately increased upon disruption of IL-6 signaling reduced synergistically by PD-B, but only modestly by PD and that through selective neutralization of Mc1-1 and Bcl-2. 0332991 or bortezomib alone (FIG. 6C). Correspondingly, Bim mediates synergistic killing of myeloma cells by PD-B. tyrosine phosphorylation of Stat3 (p-Stat3) upon IL-6 stimu Preferential Activation of Bak and Release of Smac by Sus lation was impaired by treatment of cells with PD 0332991 tained G1 Arrest in Combination with Bortezomib and bortezomib, in part due to reduction of Stat3 protein in 0232 Neutralization of Mc1-1 and Bcl-2 by Bim could response to PD 0332991 (FIG. 6D-E). These data demon lead to displacement and activation of the pro-apoptotic strate that IL-6 signaling is impaired in cells treated with PD multi-domain Bak and Bax, which oligomerize on the outer 0332991 and bortezomib due to differential reduction of mitochondrial membrane to increase membrane permeability IL-6RC. and Stat3 in G1-arrest and synergistic suppression of and induce the release of apoptotic factors (Willis et al., Surface gp130 expression. 2005). Bak was appreciably increased and activated in 0229 Survival of myeloma and normal plasma cells is myeloma cells, as evidenced by the enhanced formation of tightly modulated by the interplay between anti-apoptotic and dimers (Willis et al., 2005) by 12 hours of bortezomib treat pro-apoptotic BH3-domain only proteins of the Bcl-2 family ment following PD 0332991-induced G1 arrest (FIG. 8A). (Altmeyer et al., 1997: Gomez-Bougie et al., 2004), as is This correlated with enhanced association of Bak with the MMD (Adams and Cory, 2007). Bim and Noxa, two BH3 mitochondria, determined by immunoblotting of cytosolic only proteins, are upregulated by bortezomib to induce apo extracts and membrane fractions enriched in intact mitochon ptosis of myeloma cells (Gomez-Bougie et al., 2007: Qinet dria (at 6-fold cellular equivalent) (FIG. 8B). This was spe al., 2005). They are also excquisitely activated by cytokine cific, because Bax remained predominantly localized to the withdrawal and endoplasmic reticulum stress (Dijkers et al., cytosol, whereas Bcl-2. Mcl-1 and Noxa were largely asso US 2011/0009353 A1 Jan. 13, 2011 29 ciated with mitochondria, with Noxa being virtually absent in Since the cytotoxic partners for targeting CDK4/6 may vary G1-arrested cells as expected (FIG. 8B). in myeloma and be specific for each disease, the selection of 0233. Notably, the increase in the association of Bak with one or the other strategy for targeting CDK4/6 in combination the mitochondrial membrane in PD-B was coincidental with therapy should take into consideration the cell cycle-speci enhanced release of the second mitochondrial-derived acti ficity with which individual cytotoxic agents kill cancer cells vator of caspase (Smac/DIABLO) (Du et al., 2000), but not and its interplay with the cell cycle-coupled apoptotic check cytochrome c (Cytoc) (Yang et al., 1997) (FIG. 8B). Smac point. relieves the inhibition of caspase activation by IAPs (inhibi 0236. The ability of PD 0332991 to induce exclusive and tors of apoptosis) (Roy et al., 1997), in partthrough binding to reversible G1 arrest in the absence of apoptosis (FIG. 1) c-IAP1 and causing its rapid degradation (Yang and Du, further suggests that PD 0332991 is an ideal reagent for cell 2004). Both c-IAP-1 and c-IAP-2, while marginally cycle synchronization. Genetic evidence indicated that increased by bortezomib due to inhibition of proteasome CDK2 can compensate for the loss of both CDK4 and CDK6 mediated degradation, were significantly reduced in G1-ar in mouse embryonic fibroblasts to promote cell cycle entry rested MM1.S. cells, even in the presence of bortezomib. By and progression in response to serum stimulation (Malum contrast, the XIAP level did not vary (FIG. 8B). These data bres et al., 2004). Induction of G1 arrest by inhibiting indicate that enhanced oligomerization of Bak on the mito CDK4/6 demonstrates that the loss of CDK4/6 activity can chondrial membrane triggers synergistic mitochondrial not be functionally compensated by CDK2 in myeloma cells. membrane depolarization and preferential release of Smac, Possible explanations include a lack of compensatory which, in concert with reduction of c-IAPs, promotes caspase increase in CDK2 or cyclin E, the marked elevation of p27' activation in PD-B. (FIG. 2C and data not shown) and the intrinsic differences between embryonic and adult cells. However, optimal inhi Summary bition of CDK4/6 by PD 0332991 requires p18'Y', at least 0234. Through selective inhibition of CDK4 and CDK6 in antigen-activated, non-transformed primary B cells ex vivo with PD 0332991, two novel strategies have been developed (Baughn et al., 2006). It is not yet known whether this is the to target the cell cycle in order to prime myeloma cells for case in other cell types or transformed cells, or whether other cytotoxic killing. In the first strategy, cytotoxic killing is INK4 CKIs can substitute for p 18INK4c. Understanding the enhanced by continuous inhibition of CDK4/6 with PD mechanism by which PD 0332991 cooperates with CKI and 0332991, which induces sustained cell cycle arrest in early the cell type specificity should significantly advance studies G1 in the absence of apoptosis in myeloma cells (FIG. 1-2). of cell cycle coupled cellular function as well as targeting While it is generally believed that non-cycling cells turn over CDK4/6 in a clinical setting. more slowly than cycling cells under physiologic conditions, 0237. The exceptional selectivity and potency with which transformed cells seem to be exceptions to the rule. Myeloma PD 0332991 inhibits CDK4 and CDK6 further provides a cells become more vulnerable to cytotoxic killing when unique system to address the coupling between the cell cycle arrested in early G1, by either knocking down CDK4 and and apoptosis. In this proof-of-concept study, we showed that CDK6 expression by shRNA interference or inhibiting the induction of sustained early G1 arrest by PD 0332991 directs CDK4/6 catalytic activity with PD 0332991 (FIG. 2). Syner bortezomib to induce apoptosis in early G1, whenbortezomib gistic killing was induced by exposure to bortezomib, briefly alone preferentially kills myeloma cells during S phase entry. at a high concentration to simulate its rapid decay in vivo Although induction of apoptosis by PD-B and bortezomib (Orlowski and Kuhn, 2008) or continuously at a sub-optimal converge in mitochondrial dysfunction and caspase activa concentration to rule out any off-target effect (FIGS. 1-2). It tion, the two pathways are distinct in part due to cell cycle was also induced by other proteasome inhibitors and steroids specific gene expression (FIG. 8C). with diverse mode of action also (FIG. 1-2 and data not 0238 First, induction of early G1 arrest leads to coordi shown). Priming of myeloma cells for cytotoxic killing by nated Suppression of Surface IL-6R.C. expression and reduc induction of sustained early G1 arrest, therefore, is likely tion of Stat3, and primes myeloma cells for synergistic loss of rooted in the uncoupling of cellular function from cell cycle Surface gp130 in response to Suboptimal concentration bort progression that results in lowering the threshold for apopto eZomib (FIG. 6). The precise mechanism of IL-6RC. and sis. This is particularly notable in the case of bortezomib, gp130 regulation in G1 remains to be defined, but post-tran which preferentially kills myeloma cells during S phase entry Scriptional regulation appears to play a major role (data not (FIG. 2B) yet potently induces apoptosis at a sub-optimal shown). gp130 has been reported to be cleaved by caspase in concentration in early G1 in PD 0332991-treated myeloma response to higher doses of bortezomib (Hideshima et al., cells, including primary bone marrow myeloma cells isolated 2003). However, synergistic reduction of surface gp130 in from bortezomib-refractory patients (FIG. 2-4). PD-B precedes significant caspase activation (data not 0235. In the second strategy, removal of the G1 block shown) and knocking down gp130 expression activates the induced by PD 0332991 leads to synchronous cell cycle pro apoptosis pathway induced by PD-B (FIG. 6). On this basis, gression and a dramatic increase inbortezomib killing in cells it is tempting to postulate that the impairment of IL-6 signal during G1-S transition or in S phase (FIG. 1 and data not ing is an early event in PD-B that triggers Synergistic induc shown). This suggests that myeloma cells are censored by tion of apoptosis in the IL-6-rich bone marrow microenviron apoptosis during G1-S transition. This apoptotic checkpoint ment. IL-6 is critical for the Survival of cancer cells in general, is present in non-synchronized cells but does not extent to G2 gp130 is also a co-receptor for other cytokines such as oncos or M phase of the cell cycle, given the loss of Sphase cells and tatin M and Stat3 mediates the signals of a large number of increase in the proportion of G2/M cells following bort cytokines and growth factors. Cell cycle control of gp130 and eZomib treatment (FIG. 2B). It is amplified by cell cycle Stat3 signaling may therefore have broader implications for synchronization, judging from the dramatic loss of cells in S. the coupling of the cell cycle to apoptosis in cancer cells as G2 and M in response to bortezomib (FIGS. 1E and 2B). well as non-transformed cells. US 2011/0009353 A1 Jan. 13, 2011 30

0239 Second, genes of the Bcl-2 family are differentially ing of CDK4/6 in combination therapy, therefore, may have regulated by the cell cycle. One prominent example is the significant therapeutic benefit for multiple myeloma and silencing of Noxa RNA synthesis in early G1 arrest induced potentially other cancers. by PD 0332991, which overrides the increase of Noxa RNA by bortezomib and precludes a role for Noxa in mediating Example 3 synergistic killing by PD-B (FIGS. 7-8C). By contrast, the Inhibition of CDK4/6 by PD 0332991 Results in increase in Bim and Mcl-1 RNA in response to bortezomib is Abrogation of Osteoclast Formation markedly augmented in PD-B, which contributes to the enhanced neutralization of Mc1-1 by Bim in PD-B (FIG. 7). 0243 This Example describes preliminary results on tests PD-B modestly augments bortezomib activation of Erk and performed to ascertain whether PD 0332991, alone and in inhibition of NF-kB (FIG. 6), in line with reduction of cyclin combination with bortezomib, may inhibit osteoclastogen D2, a target of both pathways, and the absence of TNF-C. and CS1S. TRAIL that activate NF-KB (FIGS. 2 and 6). Activation of 0244 Non-adherent mononuclearbone marrow cells from Bim RNA synthesis in PD-B appears to be mediated by the multiple myeloma patients were cultured in the presence of transcription factor C/EBP (data not shown), but the path macrophage colony Stimulating factor (M-CSF) and Recep ways linking early G1 arrest and impairment of IL-6 signaling tor Activator for Nuclear Factor KB lingand (RANKL) for to differential regulation of Noxa and Bim remain to be deter three weeks. mined. 0245 Treatment of human osteoclast cultures with PD 0332991 for 3 weeks decreased osteoclast formation in a 0240. Third, induction of early G1 arrest leads to enhanced dose-dependent manner with an ICs of 50 nM. The combi activation of Bak and association of Bak with the mitochon nation of PD 0332991 and bortezomib led to synergistic drial membrane as well as preferential release of SMAC and inhibition of osteoclast formation, and completely abrogated reduction of c-IAP, in contrast to the enhancement of Bax osteoclastogenesis using only low doses of PD 0332991 (25 association with the mitochondrial membrane and preferen nM) and bortezomib (2 nM). A time course study of PD tial release of cytochrome c by boretezomib (FIG. 8A). 0332991 treatment indicated that a first week, but not second Accordingly, synergistic induction of apoptosis by PD-B is or the third week, was sufficient to inhibit osteoclast forma further augmented by Smac-mimetics (Huang and Chen-Ki tion. ang unpublished). 0246 PD 0332991 is the only known selective inhibitor of 0241 Most importantly, induction of sustained early G1 CDK4 and CDK6, which at concentration below 5 uM does arrest sensitizes primary bone marrow myeloma cells isolated not cross react with at least 38 kinases or when used alone from bortezomib-refractory patients to killing by low dose does not induce apoptosis. Taken together, these data indicate bortezomib and other cytotoxic agents (FIG. 3-4 and data not that by inducing G1 arrest and inhibiting progenitor expan sion, PD 0332991 is a powerful and selective inhibitor for shown). Induction of synergistic killing is mediated by osteoclastogenesis. Therefore, targeting CDK4/6 with PD caspase activation and sustained in the presence of BMSCs 0332291 in combination therapy is a promising therapeutic (FIGS. 3-4 and 6A), Suggesting that synergistic killing by strategy to improve bone integrity in multiple myeloma PD-B is likely relevant in vivo. While it is not feasible to patients. determine whether PD-B killing of primary BMMs is aug mented further by induction of synchronous cell cycle pro REFERENCES gression due to limited proliferation ex vivo, we have addressed this possibility in two preclinical animal models. 0247 Adams, J., and Kauffman, M. (2004). Development We demonstrated by BLI that treatment with a suboptimal of the proteasome inhibitor Velcade (Bortezomib). Cancer concentration of bortezomib during G1 arrest induced by PD Invest 22, 304-311. 0332991 and again during synchronous cell cycle progres 0248 Adams, J. M., and Cory, S. (2007). The Bcl-2 apo sion led to synergistic Suppression of human myeloma tumor ptotic Switch in cancer development and therapy. Onco development in a NOD/SCID xenograft model (FIG. 5). In a gene 26, 1324-1337. complementary study, we show in the immuno-competent 0249. Altmeyer, A., Simmons, R. C., Krajewski, S. Reed, 5T33 mouse myeloma model that sequential induction of G1 J. C., Bornkamm, G.W., and Chen-King, S. (1997). Rever arrestandbortezmib treatment prolonged the survival of mice sal of EBV immortalization precedes apoptosis in IL-6- developing aggressive myeloma (Menu et al., 2008). Given induced human B cell terminal differentiation. Immunity that inhibition of cell proliferation by PD 0332991 is tissue 7, 667-677. specific in mice (Ramsey et al., 2007), the tumor and cell type (0250 Baughn, L. B., Di Liberto, M., Wu, K., Toogood, P. specificity are important considerations for targeting CDK4/6 L., Louie, T., Gottschalk, R., Niesvizky, R., Cho, H., Ely, S., Moore, M.A., et al. (2006). A novel orally active small with PD 0332991 in combination with cytotoxic killing. molecule potently induces G1 arrest in primary myeloma 0242 On the basis of the superior selectivity, oral bioavail cells and prevents tumor growth by specific inhibition of ability and low toxicity of PD 0332991 and the novel cyclin-dependent kinase 4/6. Cancer Research 66, 7661 approaches we have developed in this study, a proof-of-con 7667. cept phaseI/II clinical trial targeting CDK4 and CDK6 in 0251 Chauhan, D., Uchiyama, H., Akbarali, Y., combination with bortezomib and dexamethasone is in Urashima, M., Yamamoto, K., Libermann, T. A., and progress in multiple myeloma. Already, preliminary data Anderson, K.C. (1996). Multiple myeloma cell adhesion have validated that PD 0332991 completely inhibits CDK4 induced interleukin-6 expression in bone marrow stromal and CDK6 and halts tumor cell division within the tolerable cells involves activation of NF-kappa B. Blood 87, 1104 dose in humans (data not shown). Mechanism-based target 1112. US 2011/0009353 A1 Jan. 13, 2011

0252 Chen-Kiang, S. (2003). Cell-cycle control of inhibitor PS-341 abrogates IL-6 triggered signaling cas plasma cell differentiation and tumorigenesis. Immunol cades via caspase-dependent downregulation of gp130 in Rev 194, 39-47. multiple myeloma. Oncogene 22,8386-8393. 0253 Chesi, M., Bergsagel, P. L., Brents, L.A., Smith, C. 0266 Hideshima, T., Richardson, P. Chauhan, D., Palom M., Gerhard, D. S., and Kuehl, W. M. (1996). Dysregula tion of cyclin D1 by translocation into an IgEI gamma bella, V. J., Elliott, P. J., Adams, J., and Anderson, K. C. switch region in two multiple myeloma cell lines. Blood (2001). The proteasome inhibitor PS-341 inhibits growth, 88, 674-681. induces apoptosis, and overcomes drug resistance in 0254. Dib, A., Peterson, T. R. Raducha-Grace, L., Zin human multiple myeloma cells. Cancer Research 61,3071 gone, A., Zhan, F., Hanamura, I., Barlogie, B., Shaugh 3O76. nessy, J., Jr., and Kuehl, W.M. (2006). Paradoxical expres 0267 Hirai, H., Roussel, M. F., Kato, J.Y., Ashmun, R.A., sion of INK4c in proliferative multiple myeloma tumors: and Sherr, C.J. (1995). Novel INK4 proteins, p19 and p18. bi-allelic deletion vs increased expression. Cell Div 1, 23. are specific inhibitors of the cyclin D-dependent kinases 0255 Dijkers, P. F., Medema, R. H., Lammers, J. W., CDK4 and CDK6. Mol Cell Biol 15, 2672-2681. Koenderman, L., and Coffer, P.J. (2000). Expression of the 0268 Huang, X., Di Liberto, M., Cunningham, A. F., pro-apoptotic Bcl-2 family member Bim is regulated by the Kang, L., Cheng, S., Ely, S. Liou, H. C., Maclennan, I.C., forkhead transcription factor FKHR-L1. Curr Biol 10, and Chen-Kiang, S. (2004). Homeostatic cell-cycle control 1201-1204. by BLyS: Induction of cell-cycle entry but not G1/S tran 0256 Du, C., Fang, M., Li Y., Li, L., and Wang, X. (2000). sition in opposition to p18INK4c and p27Kip1. Proc Natl Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibi Acad Sci USA 101, 17789-17794. tion. Cell 102, 33-42. 0269 Jeffrey, P. D., Tong, L., and Pavletich, N. P. (2000). 0257 Durie, B.G. (1986). Staging and kinetics of multiple Structural basis of inhibition of CDK-cyclin complexes by myeloma. Semin Oncol 13,300-309. INK4 inhibitors. Genes & Development 14, 3115-3125. 0258 Ely, S.A., Di Liberto*, M., Niesvizky, R., Baughn, (0270. Landis, M. W., Pawlyk, B.S., Li, T., Sicinski, P., and L. B., Cho, H., Hatada, E., Knowles, D. M., Lane, J., and Hinds, P. W. (2006). Cyclin D1-dependent kinase activity Chen-Kiang, S. (2005). Mutually exclusive Cdk-4-Cyclin in murine development and mammary tumorigenesis. Can D1 and Cdk6-Cyclin D2 pairing inactivates Rb and pro cer Cell 9, 13-22. motes cell cycle dysregulation in multiple myeloma (0271 Ley, R., Balmanno, K. Hadfield, K., Weston, C., (*equal contribution). Cancer Research 65, 11345-11353. and Cook, S.J. (2003). Activation of the ERK1/2 signaling 0259 Franklin, D.S., Godfrey, V. L., Lee, H., Kovalev, G. pathway promotes phosphorylation and proteasome-de I., Schoonhoven, R., Chen-Kiang, S., Su, L., and Xiong, Y. pendent degradation of the BH3-only protein, Bim. J Biol (1998). CDK inhibitors p18(INK4c) and p27(Kip1) medi Chem 278, 18811-18816. ate two separate pathways to collaboratively suppress pitu (0272 Lu, H., and Schulze-Gahmen, U. (2006). Toward itary tumorigenesis. Genes & Development 12, 2899 understanding the structural basis of cyclin-dependent 2911. kinase 6 specific inhibition. Journal of medicinal chemistry 0260 Fry, D.W., Harvey, P.J., Keller, P. R., Elliott, W. L., 49, 3826-3831. Meade, M., Trachet, E., Albassam, M., Zheng, X. (0273 Malumbres, M., and Barbacid, M. (2007). Cell Leopold, W. R. Pryer, N. K., et al. (2004). Specific inhi cycle kinases in cancer. Current Opinion in Genetics & bition of cyclin-dependent kinase 4/6 by PD 0332991 and Development 17, 60-65. associated antitumor activity in human tumor Xenografts. 0274 Malumbres, M., Pevarello, P., Barbacid, M., and Molecular Cancer Therapeutics 3, 1427-1438. Bischoff, J. R. (2008). CDK inhibitors in cancer therapy: 0261 Gomez-Bougie, P., Bataille, R., and Amiot, M. what is next? Trends in Pharmacological Sciences 29, (2004). The imbalance between Bimand Mcl-1 expression 16-21. controls the survival of human myeloma cells. EurJImmu nol 34, 3156-3164. 0275 Malumbres, M., Sotillo, R., Santamaria, D., Galan, 0262 Gomez-Bougie, P., Bataille, R., and Amiot, M. J. Cerezo, A., Ortega, S., Dubus, P., and Barbacid, M. (2005). Endogenous association of Bim BH3-only protein (2004). Mammalian cells cycle without the D-type cyclin with Mcl-1, Bcl-XL and Bcl-2 on mitochondria in human B dependent kinases Cdk4 and Cdk6. Cell 118, 493-504. cells. EurJImmunol 35,971–976. 0276 Marzec, M., Kasprzycka, M., Lai, R., Gladden, A. 0263 Gomez-Bougie, P., Wuilleme-Toumi, S., Menoret, B., Wlodarski, P., Tomczak, E., Nowell, P., Deprimo, S.E., E., Trichet, V., Robillard, N., Philippe, M., Bataille, R., and Sadis, S., Eck, S., et al. (2006). Mantle cell lymphoma cells Amiot, M. (2007). Noxa up-regulation and Mcl-1 cleavage express predominantly cyclin D1a isoform and are highly are associated to apoptosis induction by bortezomib in sensitive to selective inhibition of CDK4 kinase activity. multiple myeloma. Cancer Research 67, 5418-5424. Blood 108, 1744-1750. 0264 Guan, K. L., Jenkins, C. W., Li Y., Nichols, M.A., 0277 Menu, E., Garcia, J., Huang, X., Di Liberto, M., Wu. X., O'Keefe, C. L., Matera, A. G., and Xiong, Y. Toogood, P. L., Chen, I., Vanderkerken, K., and Chen (1994). Growth suppression by p18, a p16INK4/MTS1 Kiang, S. (2008). A novel therapeutic combination using and p14INK4B/MTS2-related CDK6 inhibitor, correlates PD 0332991 and bortezomib: study in the 5T33MM with wild-type pRb function. Genes & Development 8, myeloma model. Cancer Research 68, 5519–5523. 2939-2952. 0278 Morse, L., Chen, D., Franklin, D., Xiong, Y., and 0265 Hideshima, T., Chauhan, D., Hayashi, T., Akiyama, Chen-Kiang, S. (1997). Induction of cell cycle arrest and B M., Mitsiades, N., Mitsiades, C., Podar, K., Munshi, N.C., cell terminal differentiation by CDK inhibitorp 18(INK4c) Richardson, P. G., and Anderson, K.C. (2003). Proteasome and IL-6. Immunity 6, 47-56. US 2011/0009353 A1 Jan. 13, 2011 32

(0279 Ng, M. H., Chung.Y.F., Lo, K.W., Wickham, N.W., antagonists induce autoubiquitination of c-IAPB, NF-kap Lee, J. C., and Huang, D. P. (1997). Frequent hypermethy paB activation, and TNFalpha-dependent apoptosis. Cell lation of p16 and p15 genes in multiple myeloma. Blood 131,669-681. 89, 2500-2506. 0293 Vince, J. E., Wong, W. W., Khan, N., Feltham, R., 0280 Orlowski, R.Z., and Kuhn, D.J. (2008). Proteasome Chau, D., Ahmed, A.U., Benetiatos, C.A., Chunduru, S.K., inhibitors in cancer therapy: lessons from the first decade. Condon, S. M. McKinlay, M., et al. (2007). IAP antago Clin Cancer Res 14, 1649-1657. nists target cIAP1 to induce TNFalpha-dependent apopto 0281 Petersen, S. L. Wang, L., Yalcin-Chin, A., Li, L., sis. Cell 131, 682-693. Peyton, M., Minna, J., Harran, P., and Wang, X. (2007). 0294 Wang, L., Wang, J., Blaser, B.W., Duchemin, A.M., Autocrine TNFalpha signaling renders human cancer cells Kusewitt, D.F., Liu, T., Caligiuri, M.A., and Briesewitz, R. Susceptible to Smac-mimetic-induced apoptosis. Cancer (2007). Pharmacologic inhibition of CDK4/6: mechanistic Cell 12, 445-456. evidence for selective activity or acquired resistance in 0282 Puthalakath, H. O'Reilly, L.A., Gunn, P. Lee, L., acute myeloid leukemia. Blood 110, 2075-2083. Kelly, P.N., Huntington, N.D., Hughes, P. D., Michalak, E. 0295 Weir, B.A., Woo, M. S., Getz, G., Perner, S., Ding, M. McKimm-Breschkin, J., Motoyama, N., et al. (2007). L., Beroukhim, R., Lin, W. M., Province, M.A., Kraja, A., ER stress triggers apoptosis by activating BH3-only pro Johnson, L. A., et al. (2007). Characterizing the cancer tein Bim. Cell 129, 1337-1349. genome in lung adenocarcinoma. Nature 450, 893-898. 0283 Qin, J. Z. Ziffra, J., Stennett, L., Bodner, B., Bon 0296 Wiedemeyer, R., Brennan, C., Heffernan, T. P. ish, B.K., Chaturvedi, V., Bennett, F., Pollock, P.M., Trent, Xiao, Y., Mahoney, J., Protopopov, A., Zheng, H., Bignell, J. M., Hendrix, M. J., et al. (2005). Proteasome inhibitors G. Furnari, F., Cavenee, W. K., et al. (2008). Feedback trigger NOXA-mediated apoptosis in melanoma and circuit among INK4 tumor Suppressors constrains human myeloma cells. Cancer Research 65, 6282-6293. glioblastoma development. Cancer Cell 13, 355-364. 0284. Ramsey, M. R. Krishnamurthy, J., Pei, X. H., Tor 0297 Willis, S. N., Chen, L., Dewson, G., Wei, A., Naik, rice, C., Lin, W., Carrasco, D. R. Ligon, K. L., Xiong, Y., E., Fletcher, J. I., Adams, J. M., and Huang, D.C. (2005). and Sharpless, N. E. (2007). Expression of p16Ink4a com Proapoptotic Bak is sequestered by Mcl-1 and Bcl-XL, but pensates for p18Ink4c loss in cyclin-dependent kinase 4/6- not Bcl-2, until displaced by BH3-only proteins. Genes & dependent tumors and tissues. Cancer Research 67, 4732 Development 19, 1294-1305. 4741. 0298 Wu, K. D., Cho, Y. S., Katz, J., Ponomarev, V., 0285 Richardson, P. G., Mitsiades, C., Hideshima, T., and Chen-Kiang, S., Danishefsky, S. J., and Moore, M. A. Anderson, K. C. (2006). Bortezomib: proteasome inhibi (2005). Investigation of antitumor effects of synthetic tion as an effective anticancer therapy. Annual Review of epothilone analogs in human myeloma models in vitro and Medicine 57, 33-47. in vivo. Proc Natl Acad Sci USA 102, 10640-10645. 0286 Roecklein, B.A., and Torok-Storb, B. (1995). Func 0299 Yang, J., Liu, X., Bhalla, K., Kim, C. N., Ibrado, A. tionally distinct human marrow stromal cell lines immor M. Cai, J., Peng, T.I., Jones, D. P., and Wang, X. (1997). talized by transduction with the human papilloma virus Prevention of apoptosis by Bcl-2: release of cytochromec E6/E7 genes. Blood 85,997-1005. from mitochondria blocked. Science 275, 1129-1132. (0300 Yang, Q. H., and Du, C. (2004). Smac/DIABLO 0287 Roy, N., Deveraux, Q. L., Takahashi, R., Salvesen, selectively reduces the levels of c-IAP1 and c-IAP2 but not G. S., and Reed, J. C. (1997). The c-IAP-1 and c-IAP-2 that of XIAP and livin in HeLa cells. J Biol Chem 279, proteins are direct inhibitors of specific caspases. Embo J 16963-1697O. 16,6914-6925. 0301 Yu, Q., Sicinska, E., Geng, Y., Ahnstrom, M., 0288 Shaughnessy, J., Jr., Gabrea, A., Qi, Y. Brents, L., ZagoZdzon, A., Kong, Y., Gardner, H., Kiyokawa, H., Har Zhan, F., Tian, E., Sawyer, J., Barlogie, B., Bergsagel, P. L., ris, L. N. Stal, O., et al. (2006). Requirement for CDK4 and Kuehl, M. (2001). Cyclin D3 at 6p21 is dysregulated kinase function in breast cancer. Cancer Cell 9, 23-32. by recurrent chromosomal translocations to immunoglo 0302 All patents and publications referenced or men bulin loci in multiple myeloma. Blood 98, 217-223. tioned herein are indicative of the levels of skill of those 0289 Sherr, C.J., and Roberts, J. M. (1999). CDK inhibi skilled in the art to which the invention pertains, and each tors: positive and negative regulators of G1-phase progres such referenced patent or publication is hereby incorporated sion. Genes & Development 13, 1501-1512. by reference to the same extent as if it had been incorporated 0290 Slee, E. A., Harte, M.T., Kluck, R. M., Wolf, B. B., by reference in its entirety individually or set forth herein in Casiano, C.A., Newmeyer, D.D., Wang, H.G., Reed, J. C., its entirety. Applicants reserve the right to physically incor Nicholson, D. W., Alnemri, E. S., et al. (1999). Ordering porate into this specification any and all materials and infor the cytochrome c-initiated caspase cascade: hierarchical mation from any such cited patents or publications. activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase 0303. The specific methods and compositions described 9-dependent manner. The Journal of Cell Biology 144, herein are representative of preferred embodiments and are 281-292. exemplary and not intended as limitations on the scope of the 0291 Tourigny, M.R., Ursini-Siegel, J., Lee, H., Toellner, invention. Other objects, aspects, and embodiments will K. M., Cunningham, A. F., Franklin, D. S., Ely, S., Chen, occur to those skilled in the art upon consideration of this M., Qin, X. F., Xiong, Y., et al. (2002). CDK inhibitor specification, and are encompassed within the spirit of the p18(INK4c) is required for the generation of functional invention as defined by the scope of the claims. It will be plasma cells. Immunity 17, 179-189. readily apparent to one skilled in the art that varying Substi 0292 Varfolomeev, E., Blankenship, J. W., Wayson, S.M., tutions and modifications may be made to the invention dis Fedorova, A.V. Kayagaki, N., Garg, P. Zobel, K., Dynek, closed herein without departing from the scope and spirit of J. N., Elliott, L. O., Wallweber, H. J., et al. (2007). IAP the invention. The invention illustratively described herein US 2011/0009353 A1 Jan. 13, 2011

Suitably may be practiced in the absence of any element or exclude any equivalent of the features shown and described or elements, or limitation or limitations, which is not specifi portions thereof, but it is recognized that various modifica cally disclosed herein as essential. The methods and pro tions are possible within the scope of the invention as cesses illustratively described herein suitably may be prac claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred ticed in differing orders of steps, and that they are not embodiments and optional features, modification and varia necessarily restricted to the orders of steps indicated herein or tion of the concepts herein disclosed may be resorted to by in the claims. As used herein and in the appended claims, the those skilled in the art, and that Such modifications and varia singular forms “a,” “an,” and “the include plural reference tions are considered to be within the scope of this invention as unless the context clearly dictates otherwise. Thus, for defined by the appended claims. example, a reference to “an antibody includes a plurality (for 0305 The invention has been described broadly and example, a Solution of antibodies or a series of antibody generically herein. Each of the narrower species and Subge preparations) of Such antibodies, and so forth. Under no cir neric groupings falling within the generic disclosure also cumstances may the patent be interpreted to be limited to the form part of the invention. This includes the generic descrip specific examples or embodiments or methods specifically tion of the invention with a proviso or negative limitation disclosed herein. Under no circumstances may the patent be removing any Subject matter from the genus, regardless of interpreted to be limited by any statement made by any Exam whether or not the excised material is specifically recited iner or any other official or employee of the Patent and Trade herein. mark Office unless such statement is specifically and without 0306 Other embodiments are within the following claims. qualification or reservation expressly adopted in a responsive In addition, where features or aspects of the invention are writing by Applicants. described in terms of Markush groups, those skilled in the art 0304. The terms and expressions that have been employed will recognize that the invention is also thereby described in are used as terms of description and not of limitation, and terms of any individual member or subgroup of members of there is no intent in the use of Such terms and expressions to the Markush group.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 7

<21 Os SEQ ID NO 1 &211s LENGTH: 1474 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs SEQUENCE: 1 agc cct ccca gttt.ccgc.gc gcct ctittgg cagctggtca catggtgagg gtgggggtga 60 gggggcct ct ctagottgcg gcctgttgtct atggtcgggc cct ctg.cgt. C cagotgct Co 12O ggaccgagct cq99tgt atggggg.cgtagg aaccggct CC ggggcc.ccga taacgggc.cg 18O

cc.cccacagc accc.cgggct gg.cgtgaggg to tccCttga totgagaatg gCtacct Ctc 24 O

gatatgagcc agtggctgaa attggtgtcg gtgcctatgg gacagtgtac aaggc.ccgtg 3 OO

at CCC cacag togcc actitt gtggCCCtca agagtgtgag agtic cc caat ggaggaggag 360 gtggaggagg cctt CCC at C agcacagttc gtgaggtggc titt actgagg cactggagg 42O cittittgagca toccaatgtt gtc.cggctga tiggacgtctg togccacatcc cqaact gacc 48O

gggagat Caa gg talacc Ctg gtgtttgagc atgtagacca ggacct aagg acat atctgg 54 O

acaaggc acc cccaccaggc titgc.ca.gc.cg aaacgat Caa ggatctgatg cqc.cagtttic 6 OO taagaggcct agattitcctt catgccaatt gcatcgttca cc.gagatctgaa.gc.ca.gaga 660

acattctggit gaCaagtggt ggaac agtica agctggctga ctittggcct g gC Cagaat ct 72O

acagctacca gatggcactt acaccc.gtgg ttgttacact ctgg taccga gctic cc.gaag 78O

ttcttctgca gtc.ca catat gcaac acct g toga catgtg gagtgttggc tigitat ctittg 84 O

cagagatgtt togtogaaag cct ct cttct gtggaaactic taa.gc.cgaC cagttgggca 9 OO

aaatctttga cctgattggg ctgcctic cag aggatgact g gcct cagat gt at Coctgc 96.O

cc.cgtggagc ctitt CCCCCC agagggc.ccc gcc.cagtgca gtcggtggta Cctgagatgg 102O US 2011/0009353 A1 Jan. 13, 2011 34

- Continued aggagt cqgg agcacagctg. Ctgctggaaa totgactitt talacc cacac aag.cgaatct 108 O

Ctgc ctitt cq agctctgcag cact Cttatc tacataagga tigaaggtaat cc.ggagtgag 114 O

Caatggagtg gctgc.catgg aaggaagaaa agctgc.catt tocct tctgg acactgaga.g 12 OO ggcaat ctitt gcc tittat ct citgaggctat ggagggit cot cotccatct t t ctacagaga 126 O ttactittgct gccittaatga cattcc.cctic ccacct citcc titttgaggct tct cottctic 132O citt.cccattt citctacacta agggg tatgt tocct cittgt ccctitt.ccct acctittatat 1380 ttgggg.tcct tttittataca ggaaaaacaa aacaaagaaa taatggit citt tttitttittitt 144 O ttaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaa. 1474

<210s, SEQ ID NO 2 &211s LENGTH: 3O3 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 2 Met Ala Thr Ser Arg Tyr Glu Pro Val Ala Glu Ile Gly Val Gly Ala 1. 5 1O 15 Tyr Gly Thr Val Tyr Lys Ala Arg Asp Pro His Ser Gly His Phe Val 2O 25 3O Ala Lieu Lys Ser Val Arg Val Pro Asn Gly Gly Gly Gly Gly Gly Gly 35 4 O 45 Lieu Pro Ile Ser Thr Val Arg Glu Val Ala Lieu. Lieu. Arg Arg Lieu. Glu SO 55 6 O Ala Phe Glu. His Pro Asn Val Val Arg Lieu Met Asp Val Cys Ala Thr 65 70 7s 8O Ser Arg Thr Asp Arg Glu Ile Llys Val Thir Lieu Val Phe Glu. His Val 85 90 95 Asp Glin Asp Lieu. Arg Thr Tyr Lieu. Asp Lys Ala Pro Pro Pro Gly Lieu 1OO 105 11 O Pro Ala Glu Thir Ile Lys Asp Lieu Met Arg Glin Phe Lieu. Arg Gly Lieu. 115 12 O 125 Asp Phe Lieu. His Ala Asn. Cys Ile Val His Arg Asp Lieu Lys Pro Glu 13 O 135 14 O Asn. Ile Lieu Val Thir Ser Gly Gly. Thr Val Lys Lieu Ala Asp Phe Gly 145 150 155 160 Lieu Ala Arg Ile Tyr Ser Tyr Gln Met Ala Lieu. Thr Pro Val Val Val 1.65 17O 17s Thr Lieu. Trp Tyr Arg Ala Pro Glu Val Lieu. Leu Gln Ser Thr Tyr Ala 18O 185 19 O Thr Pro Val Asp Met Trp Ser Val Gly Cys Ile Phe Ala Glu Met Phe 195 2OO 2O5 Arg Arg Llys Pro Lieu. Phe Cys Gly Asn. Ser Glu Ala Asp Glin Lieu. Gly 21 O 215 22O Lys Ile Phe Asp Lieu. Ile Gly Lieu Pro Pro Glu Asp Asp Trp Pro Arg 225 23 O 235 24 O Asp Val Ser Leu Pro Arg Gly Ala Phe Pro Pro Arg Gly Pro Arg Pro 245 250 255 Val Glin Ser Val Val Pro Glu Met Glu Glu Ser Gly Ala Glin Lieu. Leu 26 O 265 27 O

US 2011/0009353 A1 Jan. 13, 2011 36

- Continued acgacaagaa taattcaatt ttaaagactic aaggtggtca gtaaataa.ca ggcatttgtt 1920 cactgaaggt gatt caccaa aatagt ctitc. tcaaattaga aagttaa.ccc catgtcc to a 198O gcatttcttt totggccaaa agcagtaaat ttgctagoag taaaagatga agttittatac 2O4. O acacagcaaa aaggagaaaa aattic tagta tattittaaga gatgtgcatg cattctattt 21OO agt citt caga atgctgaatt tacttgttgt aagtic tattt taacct tctg. tatgacatca 216 O tgctittat catttcttittgg aaaatagoct gtaagcttitt tattacttgc tataggttta 222 O gggagtgtac ct cagataga ttittaaaaaa aagaatagaa agc ctittatt toctdgtttg 228O aaattic ctitt citt coctittt tttgttgttgttattgttgt ttgttgttgt tattttgttt 234 O ttgtttittag gaatttgtca gaaactictitt cotgttittgg tttggagagt agttct citct 24 OO aactagagac aggagtggcc titgaaattitt cot catctat tacactgtac tittctgccac 246 O acactgcctt gttggcaaag tat coat citt gtctato tcc cqgcactitct gaaatatatt 252O gctaccattg tataactaat aacagattgc titaagctgtt cocatgcacc acctgtttgc 2580 ttgctttcaa tdaacctitt catalaatticgc agt ct cagot tatggittitat ggcct cqatt 264 O ctgcaaacct aac agggit ca catatgttct ctaatgcagt cct tctacct ggtgtttact 27 OO tittgct accc aaataatgag taggat.cttgtttitcgtata ccc.ccaccac toccattgct 276 O accaactgtc. accttgttgca ctic ctitttitt atagaagata ttitt cagtgt ctittacctga 282O ggg tatgtct ttagctatot tittagggcca tacatttact citatcaaatg atcttittct c 288O catc.ccc.cag gctgtgctta tittctagtgc cittgttgctica citcctgct ct ctacagagcc 294 O agcc toggcct gggcattgta aac agcttitt cotttitt citc titactgttitt citctacagtic 3 OOO ctittatattt cataccatct c toccittata agtggitt tag togcticagttg gctictagtaa 3 O 6 O ccagaggaca Cagaaagt at Cttittggaaa gtttagccac Ctgtgctitt C tact cagag 312 O tgcatgcaac agittagat catcaa.cagtt agattatgtt tagggittagg attittcaaag 318O aatggaggitt gctgcactica gaaaataatt cagat catgt titatgcatta ttaagttgta 324 O ctgaattctt togcagottaa tdtgatatat gactatottgaacaa.gagaa aaaac tagga 33 OO gatgtttct c ctdaagagct tittggggttg ggaactatt c titttittaatt gctgtactac 3360 ttaa cattgttctaatticag tagcttgagg aac aggaaca ttgttittcta gagcaagata 342O atalaaggaga tigggccatac aaatgttitt C tactitt.cgtt gtgacaa.cat tatt aggtg 3480 ttgtcagtac tataaatgct tdagatataa tdaatccaca gcattcaagg to agg to tac 354 O tcaaagttctic acatggaaaa gtgagttctg cctitt cottt gatcgagggit caaaatacaa 36OO agacatttitt gctagggcct acaaattgaa tittaaaaact cactgcact g attcatctga 366 O gctttittggit tag tatt cat ggctagagtgaac at agctt tagtttittgc tigttgtaaaa 372 O gtgttitt cat aagttcactic aagaaaaatg cagctgttct gaactggaat ttitt cagcat 378 O t ctittagaat tittaaatgag tagagagctic aacttittatt cctagoat cit gcttittgact 384 O catttctagg cagtgctitat gaagaaaaat taaag cacaa acattctggc attcaatcqt 3900 tggcagatta t cittctgatg acacagaatgaaagggcatc. tcago: ct ct c tdaactttgt 396 O aaaaatctgt ccc.cagttct tccatcggtg tagttgttgc atttgagtga atact ct citt 4 O2O gatt tatgta ttt tatgtcc agatt cqcca tttctgaaat coagatccaa cacaa.gcagt 4 O8O

Cttgc.cgitta gggcattttg aag cagatag tagagtalaga act tagtgac tacagctitat 414 O US 2011/0009353 A1 Jan. 13, 2011 37

- Continued tottctgtaa catatggttt caaacatctt togccaaaag.c taa.gcagtgg tdaactgaaa 42OO agggcatatt gcc.ccalaggt tacactgaag cagct catag caagttaaaa tattgttgaca 426 O gatttgaaat catgtttgaa titt catagta ggaccagtac aagaatgtcc ctdctag titt 432O

Ctgtttgatgtttggttctg gcggct Cagg cattttggga actgttgcac agggtgcagt 438 O caaaacaa.cc tacatataaa aattacataa aagaaccttg tccatttagc titt catalaga 4 44 O aatcc catgg caaagagtaa taaaaaggac ctaatcttaa aaatacaatt totaa.gcact 4500 tgtaagaacc cagtgggttg gag cct coca Ctttgtc.cct cct ttgaagt ggatgggaac 456 O t calaggtgca aagaac Ctgt tttggaagaa agcttggggc cattt cagcc ccctgtatt C 462O t catgattitt citcticaggaa goacacactg tdaatggcag acttitt catt tagcc cc agg 468O tgact tacta aaaatagttgaaaattatt c acctaagaat agaat ct cag cattgttgtta 474. O aataaaaatgaaagctittag aaggcatgag atgttcc tat cittaaataaa goatgtttct 48OO tittctataga gaaatgtata gtttgact ct c cagaatgta citatic catct tdatgagaaa 486 O act cittaaat agtaccaaac attittgaact ttaaattatg tatttaaagt gag tdtttaa 492 O gaaactgtag ctgcttcttt tacaagtggit gcc tattaaa gtcagtaatg gcc attattg 498O titccattgttg gaaattaa at tatgtaagct tcc taat atc ataaacatat taaaatt citt 5040 ctaaaatatt gcttitt ctitt taagtgacaa tittgactatt cittatgataa goa catgaga 51OO gtgtcttaca tttitccaaaa goaggcttta attgcatagt tdagtictagg aaaaaataat 516 O gttaaaagtgaatatgccac cataattact taattatgtt agtatagaaa citacagaata 522 O tttaccctgg aaagaaaata ttggaatgtt attataaact cittagatatt tatataattic 528 O aaaagaatgc atgttt caca ttgttgacaga taaagatgta tdatttctaa gogotttaaaa 534 O attatt cata aaa.cagtggg caatagataa aggaaattct ggagaaaatgalaggt attta 54 OO aaggg tagtt toaaagctat atatattittg aaggatatat t ctittatgaa caaatatatt 546 O gtaaaaattt atactalaggt Catctggtaa Ctgtgggatt aatatggtcg aaaacaaatg 552O titatggagaa gctgtc.ccaa goaaactaaa ttacctgtac titttitt ccca tttcaaggga 558 O agaggcaa.cc acatgaagica at actitctta cacatgccta agaacgttca ttgaaaaaat 564 O aaatttittaa aaggcatgtg titt cotatgc caccalatact tittgaaaaat tdtgaac citt st OO acccaaaacc attitat catgtcc attaagt at atttgggit atataattag gaagatattt 576. O acatgttcca tot coacagt gigaaaaactt attgaggcta ccaaagtgtg ccaagaaatg 582O taagtic citta gagtaattag aaatgctgtt titcct caaaa gcatgagaaa ctago attitt 588 O catttctitat titactic cct t t ctatat caa tdcaatt cac aaccolaattt taata catcc 594 O ctatat ct ca agcatttcta t cittgtactt titt cagaaaa taalaccaaaa ataatcc titt 6 OOO ggtct citcta t cittctgacc tttgtaagca acagaaatgt aaaaacagaa gogggtccaat 6 O6 O ttitt acacgt tttitttctica agtag cctitt ctdgggattt ttattitt citt aatgaagtgc 612 O caat cagott ttcaaaatgt tttctatttic ticago atttic caggaagtga taacgtttag 618O ctaaatgagt agaagtggac titcCttcaac at attgttac cittgttctago cittaggaaga 624 O aaacaagagc cacctgaaaa taaatacagg ct cittitt cqa gcatctgctgaaatactgtt 63 OO acagcaattt gaagttgatg tdgtaggaaa ggalaggtgac ttitt Cttgca aaagttctitt C 636 O taaacattca cactgtc.cta agagatgagc titt cittgttt tatto cqgta tatt coacala 642O

US 2011/0009353 A1 Jan. 13, 2011 40

- Continued gaaaagtagg gtaaatatgt aacgtaaaat atgtcattca aggaccacca aaactittaag O4 O tacccitat cattaaaaatct ggttittaaaa gtagctcaag taagggatgc tittgttgaccc 1OO agggitttctgaagttcagata gcc attctta cct gcc.cctt actctgactt attgggaaag 16 O ggagaactgc agtggtgttt Ctgttgcagt ggcaaaggta acatgtcaga aaatt cagag 22 O ggttgcatac Caataatcct ttggaaactg gatgtcttac tdggtgctag aatgaaaatg 28O tagg tattta ttgtcagatg atgaagttca ttgtttittitt caaaattggit gttgaaatat 34 O cactgtccaa totgttcact tatgtgaaag ctaaattgaa tdaggcaaaa agagcaaata 4 OO gtttgtatat ttgtaatacc titttgtattt cittacaataa aaatattggit agcaaataaa 460 aataataaaa acaataactt taaactgctt totggagatgaattact ct c ctdgctattt 52O t ctitttittac tittaatgtaa aatgagtata actgtag tda gtaaaattica ttaaatticca 58 O agttittagca gaaaaaaaaa aaaaaaaaaa a 611

<210s, SEQ ID NO 4 &211s LENGTH: 326 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 4 Met Glu Lys Asp Gly Lieu. Cys Arg Ala Asp Glin Glin Tyr Glu. Cys Val 1. 5 1O 15 Ala Glu Ile Gly Glu Gly Ala Tyr Gly Llys Val Phe Lys Ala Arg Asp 2O 25 3O Lieu Lys Asn Gly Gly Arg Phe Val Ala Lieu Lys Arg Val Arg Val Glin 35 4 O 45 Thr Gly Glu Glu Gly Met Pro Leu Ser Thr Ile Arg Glu Val Ala Val SO 55 6 O Lieu. Arg His Lieu. Glu Thir Phe Glu. His Pro Asn Val Val Arg Lieu. Phe 65 70 7s 8O Asp Val Cys Thr Val Ser Arg Thr Asp Arg Glu Thir Lys Lieu. Thir Lieu 85 90 95 Val Phe Glu. His Val Asp Glin Asp Lieu. Thir Thr Tyr Lieu. Asp Llys Val 1OO 105 11 O Pro Glu Pro Gly Val Pro Thr Glu Thir Ile Lys Asp Met Met Phe Glin 115 12 O 125 Lieu. Lieu. Arg Gly Lieu. Asp Phe Lieu. His Ser His Arg Val Val His Arg 13 O 135 14 O Asp Lieu Lys Pro Glin Asn. Ile Lieu Val Thir Ser Ser Gly Glin Ile Llys 145 150 155 160 Lieu Ala Asp Phe Gly Lieu Ala Arg Ile Tyr Ser Phe Gln Met Ala Lieu. 1.65 17O 17s Thir Ser Val Val Val Thr Lieu. Trp Tyr Arg Ala Pro Glu Val Lieu. Leu 18O 185 19 O Gln Ser Ser Tyr Ala Thr Pro Val Asp Leu Trp Ser Val Gly Cys Ile 195 2OO 2O5 Phe Ala Glu Met Phe Arg Arg Llys Pro Lieu. Phe Arg Gly Ser Ser Asp 21 O 215 22O Val Asp Gln Lieu. Gly Lys Ile Lieu. Asp Val Ile Gly Lieu Pro Gly Glu 225 23 O 235 24 O Glu Asp Trp Pro Arg Asp Wall Ala Lieu Pro Arg Glin Ala Phe His Ser US 2011/0009353 A1 Jan. 13, 2011 41

- Continued

245 250 255

Llys Ser Ala Glin Pro Ile Glu Lys Phe Val Thr Asp Ile Asp Glu Lieu. 26 O 265 27 O Gly Lys Asp Lieu Lleu Lleu Lys Cys Lieu. Thir Phe ASn Pro Ala Lys Arg 27s 28O 285

Ile Ser Ala Tyr Ser Ala Leu Ser His Pro Tyr Phe Glin Asp Lieu. Glu 29 O 295 3 OO

Arg Cys Lys Glu Asn Lieu. Asp Ser His Lieu Pro Pro Ser Glin Asn. Thir 3. OS 310 315 32O

Ser Glu Lieu. Asn. Thir Ala 3.25

<210s, SEQ ID NO 5 &211s LENGTH: 57 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: A synthetic oligonucleotide

<4 OOs, SEQUENCE: 5 ccggacagtt C9tgaggtgg Ctt tact.cga gtaaa.gc.cac ct cacgaact gttittitt f

SEQ ID NO 6 LENGTH 58 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: A synthetic oligonucleotide

< 4 OOs SEQUENCE: 6 ccgggacctg gaaaggtgca aagaacticga gttctttgca Cctitt CC agg totttittg 58

SEO ID NO 7 LENGTH: 9 TYPE : RNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: A synthetic oligonucleotide

<4 OO > SEQUENCE: 7 uluca agaga

1. A method of sensitizing cancer and/or tumor cells in a 5. The method of claim 1, wherein the inhibitor of CDK4 mammal to a chemotherapeutic agent or to radiation compris and/or CDK6 is administered from about one to about four 1ng: teen days prior to administration of the chemotherapeutic administering to the mammal an inhibitor of CDK4 and/or agent or the radiation. CDK6 in an amount sufficient to arrest the cancer and/or 6. The method of claim 1, wherein the inhibitor of CDK4 tumor cell cycle at G1 to thereby sensitize the cancer and/or CDK6 is administered for about three days prior to and/or tumor cells in the mammal to a chemotherapeutic administration of the chemotherapeutic agent or the radia agent or to radiation. tion. 2. The method of claim 1, further comprising administer 7. The method of claim 1, wherein the inhibitor of CDK4 ing to the mammal a chemotherapeutic agent in an amount and/or CDK6 is administered for about one to twelve days. sufficient to inhibit growth of the cancer and/or tumor cells in 8. The method of claim 1, wherein the mammal is treated the mammal. with 1 to 10 cycles of administering CDK4 and/or CDK6 3. The method of claim 1, further comprising treating the inhibitor(s) and a chemotherapeutic agent or radiation. mammal with radiation in an amount Sufficient to inhibit 9. The method of claim 1, wherein the inhibitor of CDK4 growth of the cancer and/or tumor cells in the mammal. and/or CDK6 is administered at a dosage of about 0.1 mg/Kg 4. The method of claim 2, wherein the an amount sufficient to about 500 mg/Kg per day. to inhibit growth of the cancer and/or tumor cells in the 10. The method of claim 1, wherein the inhibitor of CDK4 mammal is an amount Sufficient to induce apoptosis in the and/or CDK6 is administered at a dosage of about 50 to about cancer and/or tumor cells in the mammal. 150 mg per day. US 2011/0009353 A1 Jan. 13, 2011 42

11. The method of claim 1, wherein the inhibitor of CDK4 and/or CDK6 is a compound of formula I or II: -continued N O I N C y-soO NH \ / S-s-s-y-1s, O O II C (CH2)Ar NH NH o, / NH R N NH N N M N H - V-N Na2 wherein: 1 S\ F X is a heteroatom; and O OCCNH O F each R is independently a hydrogen, lower alkyl, carboxy H lower alkyl, oxygen, or cycloalkyl; N R is a hydrogen or halogen atom, an NH, NHR, Y NHCOR, NO, CN, CH-NH and CH-NHR; or phe nyl or heteroaromatic group, wherein the phenyl or het eroaromatic group is optionally Substituted with 1-3 lower alkyl, carboxy-lower alkyl, oxygen, or cycloalkyl 4. / NH groups: Ar is phenyl or heteroaromatic group, wherein the phenyl or heteroaromatic group is optionally Substituted with F 1-3 lower alkyl, carboxy-lower alkyl (—(C=O)-lower F alkyl), oxygen (=O), or cycloalkyl groups; and n is 0, 1, 2 or 3. N 12. The method of claim 11, wherein X is N or NH. N / 13. The method of claim 1, wherein the inhibitor of CDK4 N and/or CDK6 is a compound of the following structure: H

wherein Ar is phenyl or heteroaromatic group that is 21 optionally substituted with 1-3 lower alkyl, carboxy lower alkyl, oxygen, or cycloalkyl groups. Sa N N N N O 14. The method of claim 1, wherein the inhibitor of CDK4 H and/or CDK6 is an inhibitory nucleic acid that can reduce the expression and/or activity of a CDK4 and/or CDK6 mRNA, comprising a nucleic acid that is complementary to SEQID NO: 1 or 3. 15. The method of claim 14, wherein the inhibitory nucleic OH O acid is a shRNA with sequence CCGGACAGTTCGTGAG N N GTGGCTTTACTCGAGTAAAGCCA CCTCACGAACT 21 Ne. GTTTTTT (SEQ ID NO:5), CCGGGACCTGGAAAGGT E N A GCAAAGAACTCGAGTTCTTTGC ACCTTTCCAG N NN GTCTTTTTG (SEQID NO:6), or a combination thereof. HO O Air 16. The method of claim 1, wherein the cancer cells and/or OH HN tumor cells are resistant to a chemotherapeutic drug. OH 17. The method of claim 1, wherein the chemotherapeutic agent is a proteasome inhibitor, Steroid, cytotoxic agent, pho 21 N tosensitizing agent, folate antagonist, pyrimidine antime N \ tabolite, purine antimetabolite, 5-aminolevulinic acid, alky S No. lating agent, platinum anti-tumor agent, anthracycline, DNA intercalator, epipodophyllotoxin, DNA topoisomerase US 2011/0009353 A1 Jan. 13, 2011 inhibitor, microtubule-targeting agent, Vinca alkaloid, SMAC 36. The cell culture system of claim 32, comprising about mimetic, taxane, epothilone, an asparaginase or a combina 30 to about 200 ng insulin-like growth factor-1 per ml. tion thereof. 37. A method of identifying a chemotherapeutic agent 18. The method of claim 1, wherein the chemotherapeutic effective for treatment of a cancer or tumor in a mammal agent is bortezomib, dexamethasone, CEP 18770, carfil comprising: Zomib, cytosine arabinoside or a combination thereof. (a) isolating primary cancer or tumor cells from the mam 19. The method of claim 1, wherein the chemotherapeutic mal; agent is administered at a dosage of about 0.001 mg/Kg to (b) co-culturing the primary cancer or tumor cells with about 100 mg/Kg per day. HS-5 or HS-27A human stromal cells to form a mixed 20. The method of claim 1, wherein the chemotherapeutic cell culture; agent is administered at a dosage of about 0.01 mg/Kg to (c) incubating the mixed cell culture with an inhibitor of about 5 mg/Kg per day. CDK4 and/or CDK6, wherein the inhibitor is present in 21. The method of claim 1, wherein the amount of chemo an amount Sufficient to arrest the primary cancer or therapeutic agent administered is lower than that used when tumor cells at cell cycle phase G1, to thereby form an the inhibitor of CDK4 and/or CDK6 is not administered. arrested cell culture; 22. The method of claim 1, wherein the cancer and/or (d) adding a test chemotherapeutic agent to the arrested cell tumor cells are retinoblastoma-mediated cancer and/or tumor culture to form a test culture; and cells. (e) observing whether the cancer or tumor cells in the test 23. The method of claim 1, wherein the cancer and/or culture undergo apoptosis, to thereby identify a chemo tumor cells are hematopoietic/blood cancer cells. therapeutic agent effective for treatment of a cancer or 24. The method of claim 1, wherein the cancer and/or tumor in a mammal. tumor cells are mantle cell lymphoma cells, diffused large B 38. The method of claim 37, further comprising converting cell lymphoma cells, acute myeloid leukemia cells, chronic the amounts of the chemotherapeutic agent that induce apo lymphatic leukemia cells, chronic myelocytic leukemia cells, ptosis of the cancer or tumor cells into a dosage amount, to polycythemia Vera cells, malignantlymphoma cells, multiple thereby identify an effective dosage range of a chemothera myeloma cells, Hodgkin’s lymphoma cells, non-Hodgkin’s peutic agent for treatment of a cancer or tumor in the mam lymphoma cells or combinations thereof. mal. 25. The method of claim 1, wherein the cancer and/or 39. The method of claim 37, comprising about 1:1 to about tumor cells are myeloma cells. 3:1 cancer/tumor cells to HS-5/HS-27A cells. 26. The method of claim 1, wherein the method reduces 40. The method of claim37, wherein the mixed cell culture growth of the cancer and/or tumor cells or kills the cancer also contains an amount of human IL-6 and human insulin and/or tumor cells. like growth factor-1 effective for proliferation of the cancer or tumor cells. 27. The method of claim 1, wherein the method induces 41. The method of claim 40, comprising about 10 to about apoptosis in the cancer and/or tumor cells. 80 units IL-6 per ml. 28. The method of claim 1, wherein the method also inhib 42. The method of claim 40, comprising about of 30 to its osteoclast differentiation. about 200 ng insulin-like growth factor-1 per ml. 29. The method of claim 1, wherein the method has fewer side effects than methods where the chemotherapeutic agent 43. The method of claim 37, wherein the inhibitor of CDK4 is administered without administration of the inhibitor of and/or CDK6 is a compound of formula I or IL CDK4 and/or CDK6. 30. The method of claim 1, further comprising administer ing the chemotherapeutic agent while administering the inhibitor of CDK4 and/or CDK6. 31. The method of claim 1, further comprising administer / \, r1, . sys-R, ing the chemotherapeutic agent after the inhibitor of CDK4 and/or CDK6 has been administered for at least two days, and \ / S-s-s-41s. then co-administering the chemotherapeutic agent with the R inhibitor of CDK4 and/or CDK6. II 32. An ex vivo cell culture system that recapitulates a (CH2)Ar patient's tumor cell drug sensitivity and/or tumor cell drug o, / resistance, which comprises: NH (a) primary cancer or tumor cells isolated from the patient; R2 (b) HS-5 or HS-27A human stromal cells; and N N (c) an amount of human interleukin-6 (IL-6) and human M insulin-like growth factor-1 (IGF-1) effective for main N taining proliferation of the cancer or tumor cells. H 33. The cell culture system of claim 32, comprising about 1:1 to about 3:1 cancer/tumor cells to HS-5/HS-27A cells. wherein: 34. The cell culture system of claim 32, wherein the HS-5 X is a heteroatom; and or HS-27A human stromal cells are treated with mitomycin C each R is independently a hydrogen, lower alkyl, carboxy to inhibit replication; lower alkyl, oxygen, or cycloalkyl; 35. The cell culture system of claim 32, comprising about R is a hydrogen or halogen atom, an NH2, NHR, 10 to about 80 units IL-6 per ml. NHCOR, NO, CN, CH-NH and CH-NHR; or phe US 2011/0009353 A1 Jan. 13, 2011 44

nyl or heteroaromatic group, wherein the phenyl or het eroaromatic group is optionally Substituted with 1-3 -continued lower alkyl, carboxy-lower alkyl, oxygen, or cycloalkyl groups: Ar is phenyl or heteroaromatic group, wherein the phenyl 1n MR or heteroaromatic group is optionally Substituted with N 1-3 lower alkyl, carboxy-lower alkyl (—(C=O)-lower 2 7 NH alkyl), oxygen (=O), or cycloalkyl groups; and N N n is 0, 1, 2 or 3. 44. The method of claim 43, wherein X is N or NH. 45. The method of claim 37, wherein the inhibitor of CDK4 and/or CDK6 is a compound of the following structure:

in O N / O 21 O

N N wherein Ar is phenyl or heteroaromatic group that is optionally substituted with 1-3 lower alkyl, carboxy lower alkyl, oxygen, or cycloalkyl groups. 46. The method of claim 37, wherein the inhibitor of CDK4 and/or CDK6 is added to the culture from 4 to 24 hours prior OH O to addition of the chemotherapeutic agent. N N 47. The method of claim 37, wherein the inhibitor of CDK4 : 2 e and/or CDK6 is removed from the culture prior to addition of E N-NN M the chemotherapeutic agent. r N HO O Air 48. The method of claim 37, wherein the primary cancer or OH HN tumor cells from the mammal were resistant to one or more chemotherapeutic agents. OH 49. The method of claim37, wherein the chemotherapeutic 21 N agent is a proteasome inhibitor, Steroid, cytotoxic agent, pho \ tosensitizing agent, folate antagonist, pyrimidine antime S-N tabolite, purine antimetabolite, 5-aminolevulinic acid, alky lating agent, platinum anti-tumor agent, anthracycline, DNA intercalator, epipodophyllotoxin, DNA topoisomerase W \ inhibitor, microtubule-targeting agent, Vinca alkaloid, taxane, N > epothilone and/or asparaginase. \ y-n S S N 50. The method of claim37, wherein the chemotherapeutic NH agent is bortezomib and/or dexamethasone. 51. An inhibitory nucleic acid that can reduce the expres sion and/or activity of a CDK4 and/or CDK6 mRNA, com prising a nucleic acid that is complementary to SEQID NO:1 or 3. C 52. The inhibitory nucleic acid of claim 51, which is a NH NH shRNA with sequence CCGGACAGTTCGTGAGGTG GCTTTACTCGAGTAAAGCCACCTCAC / \ GAACTGTTTTTT (SEQ ID NO:5) or CCGGGACCTG C -N GAAAGGTGCAAAG NH AACTCGAGTTCTTTGCACCTTTCCAGGTCTTTTTG (SEQID NO:6). 53. A method of treating cancer or tumors in a mammal H N N O comprising: (a) administering at least one CDK4 and/or ? n CDK6 inhibitor on days one (1) to seven (7); and (b) periodi O cally administering one or more chemotherapeutic agents, or N Na2 radiation, after about day three (3). 1. V 54. The method of claim 53, wherein administration of the O NH O F chemotherapeutic agent(s) and/or administration of radiation is temporarily terminated after about two to about six weeks. US 2011/0009353 A1 Jan. 13, 2011 45

55. The method of claim 53, wherein the method is 57. The method of claim 3, wherein the an amount suffi repeated at least twice after administration of the chemothera- cient to inhibit growth of the cancer and/or tumor cells in the peutic agent(s) and/or administration of radiation is tempo- mammal is an amount Sufficient to induce apoptosis in the rarily terminated. cancer and/or tumor cells in the mammal. 56. The method of claim 55, wherein the method is repeated until remission of the cancer and/or tumor. ck