Multiplex RT-PCR Identification of Five Viruses Associated with the Watermelon Crops in the Brazilian Cerrado
Total Page：16
File Type：pdf, Size：1020Kb
Vol. 13(3), pp. 60-69, 21 January, 2019 DOI: 10.5897/AJMR2018.8976 Article Number: 26D429A59941 ISSN: 1996-0808 Copyright ©2019 Author(s) retain the copyright of this article African Journal of Microbiology Research http://www.academicjournals.org/AJMR Full Length Research Paper Multiplex RT-PCR identification of five viruses associated with the watermelon crops in the Brazilian Cerrado Raimundo Wagner de Souza Aguiar1,2*, Adelmo Rodrigues Martins1, Vitor L. Nascimento1, Aristóteles Capone1, Lara Teixeira Melo Costa2, Fabrício Souza Campos2, Rodrigo Ribeiro Fidelis1, Gil Rodrigues dos Santos1, Renato de Oliveira Resende3 and Tatsuya Nagata3 1Plant Production Graduate Program, Federal University of Tocantins, Gurupi-TO, Brazil. 2Departament of Biotechnology, Universidade Federal do Tocantins, Gurupi, TO, 77413-070, Brazil. 3Department of Cell Biology, Universidade de Brasilia, Brasilia-DF, Brazil. Received 3 September, 2018; Accepted 13 December, 2018 Watermelon plants can be naturally infected by several viruses in single or mixed infections, of which the diagnosis is difficult and require specific techniques. This study aims to detect and to verify the presence of Cucumber mosaic virus (CMV), Papaya ringspot virus type W (PRSV-W), Watermelon mosaic virus (WMV), Zucchini lethal chlorosis virus (ZLCV), Zucchini yellow mosaic virus (ZYMV), and the main cucurbit viruses in Brazil using multiplex reverse transcriptase polymerase chain reaction (RT- PCR) assay. Oligonucleotides were designed towards the conserved regions of the virus genomes. In the duplex-PCR, it was possible to detect all the virus combinations, except ZLCV with ZYMV. The amplified product sizes were 644 bp (CMV), 535 bp (WMV-2), 398 bp (PRSV-W), 244 bp (ZLCV), and 214 bp (ZYMV). To test the efficacy of the methodology, we analyzed plants with virus symptoms from four municipalities in the state of Tocantins, located at Brazilian Cerrado. Mixed infections were detected in 80% of samples in all the municipalities. The multiplex RT-PCR assay can be used to detect and differentiate watermelon viruses that affect crops in the state of Tocantins. Key words: Cucumovirus, multiplex RT-PCR, Orthotospovirus, potyvirus, watermelon. INTRODUCTION Watermelon (Citrullus lanatus (Thunb.) Matsum. and The most important viruses that affect the watermelon Nakai) is a crop of significant importance to Brazil due to plants are: (i) cucumovirus as Cucumber mosaic virus its economic and social aspects, mainly in the northern (CMV) (Roossinck, 2001); (ii) potyviruses as Papaya and northeastern regions. However, the crop in these ringspot virus type W (PRSV-W) (Barnett, 1991; Bateson regions is affected by viruses (Aguiar et al., 2013, 2015). et al., 2002), Watermelon mosaic virus (WMV) (Desbiez *Corresponding author. E-mail: [email protected]. Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License de Souza Aguiar et al. 61 and Lecoq, 2004; Purcifull and Hiebert, 1979), and In the present study, we developed the mRT-PCR Zucchini yellow mosaic virus (ZYMV) (Desbiez and method for the simultaneous detection of five watermelon Lecoq, 1997; Harth et al., 2017); and (iii) orthotospovirus viruses (PRSV-W, WMV, ZYMV, CMV, and ZLCV), in the as Zucchini lethal chlorosis viruses (ZLCV) (Camelo- leaf tissue samples from infected watermelon from four García et al., 2015; Lima et al., 2016). These viruses are different municipalities of Tocantins state, located at the widely distributed in the cucurbit cultivation areas in Brazilian Cerrado. Brazil, limiting the yield and fruit quality (Aguiar et al., 2013, 2015; Soares et al., 2016). Moreover, they have been reported to cause not only single but mixed MATERIALS AND METHODS infections in the cucurbits (Aguiar et al., 2015; Ali et al., 2012; Soares et al., 2016), that contribute not only to the Plant and virus samples maintenance of the population diversity but also Leaf samples from the infected watermelon plants in the associated with the predominance of these viruses in reproductive stage, at the main watermelon producing regions of commercial crops (Gómez et al., 2009; Kumar et al., the municipalities of Gurupi, Porto Nacional, Lagoa da Confusão, 2010). Therefore, the development of methods that allow and Formoso do Araguaia of Tocantins state (Figure 1) were the simultaneous detection and identification of different collected as described by Aguiar et al. (2015). CMV, PRSV-W, WMV, ZYMV, and ZLCV were obtained from viruses are desirable for the routine diagnosis of cucurbit Embrapa CNPH and Universidade de Brasília (UnB); they were virus infections, particularly, one that would require less provided by Dr. Mirtes Lima and Dr. Tatsuya Nagata. All the viruses time, work, and costs. were kept in a greenhouse at Universidade Federal do Tocantins- Several methods are used to detect viruses such as Gurupi in Cucurbita pepo, Nicotine benthamiana, and Datura enzyme-linked immunosorbent assay (ELISA), double- stramonium plants by mechanical inoculation (Aguiar et al., 2015; antibody sandwich ELISA (DAS-ELISA), reverse Lima et al., 2009). transcription polymerase chain reaction (RT-PCR), quantitative real-time PCR (qRT-PCR), nucleic acid spot Primer design hybridization (NASH), macroarrays and microarray technologies (Ge et al., 2013). However, all these The primers used in this study (Table 1) were designed from the methods are slow and expensive to carry out in a specific nucleotide sequences data obtained from National Center standard research laboratory. To overcome these for Biotechnology Information (NCBI) GenBank and checked by BLAST to confirm virus specificity. 11 accessions to CMV, 18 shortcomings and increase the diagnostic capacity of accessions to PMV-W, 18 accessions to WMV, 13 accessions to PCR, a variant method termed multiplex PCR (mPCR) ZYMV, and 2 accessions to ZLCV (Supplemental Table 1) were has been developed wherein one target sequence can be used. The sequences were aligned by CLUSTAL W multiple amplified by including more than one single pair of sequence alignment program (Higgins and Sharp, 1989, 1988; primers in the reaction (Elnifro et al., 2000). Reverse Thompson et al., 1994) to find the genome regions specific for each virus (Table 1). Self-annealing and primer-dimer formation were Transcription reaction followed by mPCR (mRT-PCR) tested in silico by using OligoCalc software (Kibbe, 2007). The can be used for the simultaneous detection of multiple primers were used here in several duplex combinations (Figures 4 viruses, and it is more efficient and economical than the and 5). other conventional methods (Kwon et al., 2014; Zhao et al., 2016). RNA extraction and complementary DNA (cDNA) synthesis Multiplex systems have been developed for the detection of multiple viral infections. Several genera have Total RNA extraction was performed from the leaves of watermelon already been detected, for instance, astrovirus, rotavirus plants with symptoms of infection with CMV, PRSV-W, WMV, and reovirus (Jindal et al., 2012), carlavirus (Nam et al., ZYMV, and ZLCV viruses (Figure 2) using the Plant RNA 2015), crinivirus (Wintermantel and Hladky, 2010), Purification Reagent Kit (Invitrogen Life Technologies, USA), nodavirus (Senapin et al., 2010), potyvirus, and according to the manufacturer's protocol. cDNA was synthesized from the total RNA extracted from the leaves with symptoms of allexivirus (Kumar et al., 2010), in animals (Jindal et al., infection of the viruses as previously described. First-strand cDNAs 2012; Senapin et al., 2010) and plants (Kumar et al., were synthesized using Moloney Murine Leukemia Virus (M-MLV) 2010; Nam et al., 2015; Wintermantel and Hladky, 2010). Reverse Transcriptase (Invitrogen Life Technologies, USA) According to the literature, the identification of viruses according to the manufacturer’s instructions, with DEPC-treated using mRT-PCR with specific primers has been widely water and random primers (NNNNNNN) (Invitrogen Life Technologies, USA) according to the supplied protocol. used to detect viruses associated with different important crops around the world such as grapevine (Vitis vinifera) (Hajizadeh et al., 2012), pepino (Solanum muricatum) Monoplex and multiplex PCR (Ge et al., 2013), potato (Solanum tuberosum L.) (Agindotan et al., 2007; Rigotti and Gugerli, 2007), PCR reactions were performed using the cDNA product with the addition of 0.4 μM of each virus-specific oligonucleotide, 10 μM of Prunus spp (Jarosova and Kundu, 2010), sugarcane each dNTP, 2.5 μL of Taq DNA Polymerase Reaction Buffer, 2.0 (Saccharum spp) (Xie et al., 2009) and tomato (Solanum mM of MgCl2, and 1U of Taq DNA Polymerase (Invitrogen Life lycopersicum L.) (Chen et al., 2011). Technologies, USA), to a total volume of 25 μL. 62 Afr. J. Microbiol. Res. Figure 1. Tocantins state’s map indicating the four main producing municipalities from where the watermelon samples with viral infection symptoms, were harvested. Numbers on the map represent: 1, Porto Nacional; 2, Lagoa da Confusão; 3, Formoso do Araguaia; and 4, Gurupi. Table 1. Oligonucleotides used in monoplex and multiplex RT-PCR for the detection of watermelon viruses. Virus Oligonucleotide sequence (5' - 3')* Position Amplicon size (bp) Temperature of annealing (ºC) F: ACTNTTAACCACCCAACCTT 1379-1399 CMV 644 53.6 - 55.8 R: TTAGCCGTAAGCTGGATGGA 2003-2023 F: TGGGTTATGATGGATGGGGA 9703-9723 PRSV-W 398 55.5 - 55.1 R: ATACCCAGGAGAGAGTGCAT 10081-10101 F: TTRTTGTTGAATGCTGTCCT 8164-8184