Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages
by
SABBA MEHMOOD
Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad, Pakistan 2018
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages
A dissertation submitted in the partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY In
BIOCHEMISTRY
by
SABBA MEHMOOD
Department of Biochemistry Faculty of Biological Sciences Quaid-i-Azam University Islamabad 2018
Contents
Contents
i-ii Acknowledgements
iii-iv List of Figures
v-vi List of Tables
vii-ix List of Abbreviations
x-xii Abstract
Chapter no.1: Introduction
1 Skin
3 Embryonic origin of skin appendages
Hair morphogenesis 3-4
Nail morphogenesis 4-5
Tooth morphogenesis 5
Exocrine/ sweat gland morphogenesis 5-6
8 Ectodermal signal transduction
LPA/ LIPH/ LPAR6 signaling 8-9
Wnt/ β-catenin signaling 9-10
HR/ U2HR signaling 10
EDA/ EDAR/ EDARADD signaling 10-11
11 Genodermatoses of the hair
Isolated Hereditary Hypotrichosis 11
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Contents
Hypotrichosis Associated with other anomalies 15
15 Genodermatoses of the nail
Isolated nail dysplasia 15-17
Associated nail dysplasia 17
Pure hair and Nail Ectodermal Dysplasia 17-18
18 Genodermatoses of the skin
Isolated Ichthyosis 18-19
Associated Ichthyosis 20
Aims and objectives of the studies presented in the dissertation 20-21
Chapter no.2: Materials and Methods
Study authorization 22
Recruitment of families with written consents 22
Pedigree construction and clinical inspection 22
23 Extraction of Genomic DNA
Genomic DNA Extraction and Purification 23
23 Polymerase chain reaction (PCR)
Standard protocol 23-24
24 PCR program
PCR optimization 24
24 Linkage Analysis to Known Loci
24 Gel Electrophoresis
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Contents
24-25 Agarose Gel Electrophoresis
Polyacrylamide gel electrophoresis (PAGE) 25
26 Genome scan via SNP DNA microarray
26 Exome sequencing and data interpretation
27 RNA Extraction and cDNA synthesis
Protein modeling and molecular docking 27
Chapter no: 3
Isolated Hereditary Hypotrichosis 34-35
35 Family A
Family recruitment and clinical investigation 35 Family B
Family recruitment and clinical investigation 35-36
36 Genetic characterization of families A and B
Linkage analysis to known genes 36
Sequencing LIPH gene 36
36 Family C
Family recruitment and clinical investigation 36-37
37 Genetic characterization of families C
Linkage analysis to known genes and loci 37
Whole genome sequencing 37
Whole exome sequencing 37-38
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Contents
38 Family D
Family recruitment and clinical investigation 38
39 Family E
Family recruitment and clinical investigation 39
39 Family F
Family recruitment and clinical investigation 39
39-40 Genetic characterization of families D, E and F
40 Family G
Family recruitment and clinical investigation 40
40 Genetic characterization of family G
Linkage analysis to known genes and loci 40
Whole genome sequencing 40
Exome sequencing 41
41-45 Discussion
Chapter no: 4
59-60 Atrichia with Papular Lesions
60 Family H
60 Family recruitment and clinical investigation
60 Family I
Family recruitment and clinical investigation 60
60 Family J
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Contents
Family recruitment and clinical investigation 60-61
61 Genetic characterization of families H, I and J
Linkage analysis to known genes 61
Sequencing HR gene and its upstream open reading frames 61-62
62-65 Discussion
Chapter no: 5
75-76 Ectodermal Dysplasia of Nail phenotype
Family with isolated nail dysplasia 77
77 Family K
Family recruitment and clinical investigation 77
77 Genetic characterization of family K
Linkage analysis to known genes 77
Sequencing PLCD1 gene 77
Whole exome sequencing 78
Families with Pure Hair and Nail Ectodermal Dysplasia 78 (PHNED) 78 Family L
Family recruitment and clinical investigation 78
78 Genetic characterization of family L
Linkage analysis to known genes 78-79
79 Sequencing HOXC13 gene for family L
79 Family M
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Contents
Family recruitment and clinical investigation 79
80 Genetic characterization of family M
Linkage analysis to known genes 80
Whole exome sequencing 80
Sequencing GJB6 gene 80
Discussion 80-84
Chapter no: 6
93 Genetics of Ichthyosis and Kindler syndrome
94 Family N
Family recruitment and clinical investigation 94
94 Genetic characterization of family N
Screening STS gene and its flanking region 94
94 Families O and P
Family recruitment and clinical investigation 94-95
95 Genetic characterization of families O and P
Whole genome Scan 95
Whole Exome Sequencing in Family O 95-96
96 Sequencing FERMT1 gene for family P
96 Family Q
Family recruitment and clinical investigation 96
96 A family with congenital ichthyosis and hairloss syndrome
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Contents
96 Family R
Family recruitment and clinical investigation 96-97
97 Genetic characterization of families Q and R
Linkage analysis to known genes 97
97-98 Whole exome sequencing in Families Q and R
98-100 Discussion
113-115 Conclusion
116-144 References
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages Acknowledgements
Acknowledgements
All glories are to “ALLAH Almighty” the most Beneficent, the most merciful, who bestowed me with potential and ability to complete the present work. All respects and Darud and Salam to Hazrat Mohammad (SAW) who enables us to recognize our creator and whose knowledge flourished my thoughts to live here and hereafter.
I take this opportunity to express my deepest gratitude and honest thanks to Dr. Muhammad Ansar Chairperson Department of Biochemistry for his kind guidance and sincere advises.
I feel proud to pay my deep feelings of gratitude for my worthy and honorable supervisor, Dr. Wasim Ahmad, whose dynamic supervision, keen interest, literally skills, polite and co-operative attitude, expert advice and valuable suggestions make me able to carry out this research work. His devoted personality is a role model not only for me but for all the researchers and seekers of knowledge across the world.
I wish to express my honest thanks to my foreign supervisor, colleagues and friends Prof. Hans Van Bokhoven, Prof. Hans Brunner, Prof. France Kremer, Prof. Hanie Cremer, Mr. Micheal, Mr. Daniel, Mr. Imran Khan, Mrs. Shazia Micheal, Miss. Leisian and Miss. Carmen, which were not only the source of learning for me in the field of research but also supported me to learn socially and morally.
I am obliged to all members of the families for participating in the study. The work, presented here was funded by research grant to Wasim Ahmad by Higher Education Commission (HEC) Islamabad, Pakistan. I am grateful to HEC, Pakistan for providing me an opportunity to pursue my research work in Radboud University Netherlands under the ‘International Research Support Initiative Programme’ (IRSIP), which facilitated me to validate my expertise and standards of research up to international levels, not only improved my scientific vision but also flourished my social and communication skills.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages i Acknowledgements
I offer my cordial appreciations and gratitude for my seniors Miss Gul Naz, Miss Bushra Khan, Miss Kalsoom Ibrahim, Mr. Kamran Ali, and Mr. Zahid Azeem, Mr. Aziz, Mr. Abid Jan, Mr. Sayed Irfan Shah, Mr. Raja Hussain Ali especially to Mr. Salman Basit for their immense endurance, inspiring guidance and encouragements during my research work.
I would like to say special thanks to my lab fellows Irfanullah, Farooq Ahmad, Khadim Shah, Asmat Marwat, Khurram Liaqat and Shabir Hussain for their friendly company, co-operation and Peace of mind during research work. I wish to express my sincere thanks to my juniors Fouzia, Hira, Abdul Nasir, Sidra Basharat, Nazish, Rubab Raza, Anila, Naila for the respect they gave to me.
I convey my heartiest thanks to my worthy friends Irum Naqvi, Irum Iqrar, Noshaba Hassan, Tehreem Ijaz and Rida for their love, care, and superb company during my university life.
I owe my sincerest acknowledgements to my pertinacious friends and students Hammad Ismail, Ayesha, Mona, Sara, Sana, Abdullah, Haseeb, Hassan, Omer, Ibrahim, Noor and Aleena for encouragement and moral support.
My deep feelings to express my indebtedness to my family especially my dearest and loving mother (late) and father for their loving advise, kind and continuous prayers, unending strength, support, encouragement, which provided me an excellent basis for my life. I can’t return what they have done for me (may Allah bless them Ameen). I would like to extend my heartiest thanks to my sisters Shazia, Fouzia, Shagufta, nosheen, Kainat and to my dearest brother and friend Imran Mehmood for their endless love, understanding attitude, great affections and confidence on me, which has been essential for the completion of this work.
In the end I want to present my unbending thanks to all those hands who prayed for my betterment and serenity.
Sabba Mehmood
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages ii List of Figures
Figure No. Title Page No. Figure 1.1 Topographical view of deep inside the multilayered human skin 2 Figure 1.2 An indication of early morphogenesis of ectoderm derived 7 appendages Figure 3.1 Haplotype sketch of the family A segregating isolated hairloss. 46 Figure 3.2 Clinical manifestations of an affected individual in family A. 46 Figure 3.3 Haplotype sketch of the family B segregating isolated hairloss. 47
Figure 3.4 Clinical manifestations of affected individuals in family B. 47 Figure 3.5 Under light microscopy, hair shafts of an affected individual in 48 family B Figure 3.6 Restriction enzyme (Bg1II) digestion analysis of exon-7 in 48 family A Figure 3.7 Sequence analysis of the LIPH gene in the family A. 49 Figure 3.8 Sequence analysis of the LIPH gene in family B. 50 Figure 3.9 Pedigree illustration of family C segregating thick woolly hair 51 phenotype. Figure 3.10 Clinical manifestations of affected individuals in family C. 51 Figure 3.11 Pedigree illustration of family D segregating thick wooly hair 52 phenotype. Figure 3.12 Clinical manifestations of two affected individuals in family D. 52 Figure 3.13 Pedigree illustration of family E segregating patchy hair loss 53 phenotype. Figure 3.14 Clinical manifestations of affected individuals in family E. 53 Figure 3.15 Pedigree illustration of family F segregating patchy to complete 54 hair loss phenotype. Figure 3.16 Clinical manifestations of affected individual in family F. 54 Figure 3.17 Pedigree illustration of family G segregating complete hair loss 55 phenotype. Figure 3.18 Clinical manifestations of affected individual in family G. 55 Figure 3.19 Sequencing analysis of the EXPH5 gene. 56 Figure 4.1 Haplotype analysis of the family H segregating APL. 66 Figure 4.2 Clinical manifestations of affected individuals in family H. 66 Figure 4.3 Close up view of phenotypic appearance of numerous skin- 67 colored papules on the facial surface in an affected member in the family H Figure 4.4 Haplotype sketch of the family I segregating APL. 68 Figure 4.5 Clinical manifestations of affected individuals in family I. 68 Figure 4.6 Haplotype sketch of the family J segregating APL. 69 Figure 4.7 Clinical manifestations of affected individuals in family J. 69 Figure 4.8 Sequence analysis of the HR gene in family H. 70 Figure 4.9 Sequence analysis of the U2HR in affected individuals in both 71 the families (I, J). Figure 4.10 Predicted 3D structure of U2HR peptide. C, coil; H, helix 72 Figure 4.11 Proposed mechanism of U2HR’s involvement in HR 72 translational regulation. Figure 4.12 Normal (A) and mutated (B) U2HR-RNA docking complexes. 73 Figure 5.1 Pedigree illustration of family K segregating koilonychia. 85 Figure 5.2 Clinical manifestations of affected individuals in family K. 85
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages iii List of Figures
Figure 5.3 Pedigree illustration of family L segregating (PHNED) 86 phenotype. Figure 5.4 Clinical manifestations of affected individuals in family L. 87 Figure 5.5 Sequence analysis of the HOXC13 gene in family L. 88 Figure 5.6 Pedigree illustration of family M segregating hair and nail 89 ectodermal dysplasia. Figure 5.7 Clinical manifestations of affected individuals in family M. 89 Figure 5.8 Sequence analysis of the GJB6 gene in family M. 90 Figure 5.9 Schematic representation of human GJB6 structural and 90 functional domains. Figure 5.10 The three dimensional structure of GJB6. 91 Figure 6.1 Pedigree illustration of family N segregating XLI phenotype. 101 Figure 6.2 Clinical phenotypes of affected male members (V-1, V-2) in 101 family N. Figure 6.3 Schematic presentation of the interstitial deletions detected in 102 family (N) segregating XLI. Figure 6.4 Pedigree illustration of family O segregating Kindler syndrome 103 phenotype. Figure 6.5 Clinical phenotypes of affected members in family O. 103 Figure 6.6 Pedigree illustration of family P segregating Kindler syndrome 104 phenotype. Figure 6.7 Clinical findings in family P affected with kindler syndrome. 104 Figure 6.8 Sequence analysis of the FERMT1 gene in family O. 105 Figure 6.9 Sequence analysis of the FERMT1 gene in family P. 106 Figure 6.10 Pedigree illustration of family Q segregating ichthyosis 107 phenotype. Figure 6.11 Clinical phenotypes in family Q affected with ichthyosis. 107 Figure 6.12 Pedigree illustration of family R segregating defected skin and 108 hair phenotype. Figure 6.13 Clinical phenotypes in family R 108 Figure 6.14 Homozygous region marked on chromosome 2 (212-216 Mb 109 approx.) by SNP microarray Figure 6.15 Sequence analysis of LPAR6 gene in family R 110 Figure 6.16 In silico analysis of LPAR6 protein. 111
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages iv List of Tables
Table No. Title Page No. Table 1.1 Classification and clinical overview of isolated 12-14 hypotrichosis related genes and loci Table 2.1 The compositions of solutions used in genomic DNA 23 extraction Table 2.2 The compositions of solutions used in agarose gel 25 Table 2.3 Polyacrylamide Gel Composition 25
Table 2.4 List of variable applied for screening exome variants 26 Table 2.5 Primers designed to sequence the coding exons of the 28 LIPH gene Table 2.6 Primers designed to sequence the coding exons of HR gene 28-30 Table 2.7 Primers designed to sequence the coding exons the U2HR 30 region Table 2.8 Primers designed to sequence the coding exons of DSG4 30-31 gene Table 2.9 Primers designed to sequence the coding exons of PLCD1 31 gene Table 2.10 Primers designed to sequence the coding exons the 32 HOXC13 gene Table 2.11 Primers designed to sequence the coding exons of GJB6 32 gene Table 2.12 Primers designed to sequence the coding exons of 32 FERMT1 gene Table 2.13 Primers designed to sequence the coding exons of EXPH5 33 gene Table 2.14 Primers designed to sequence the coding exons of XRCC5 33 gene Table 3.1 List of filtered variants tested in family C 57 Table 3.2 List of LIPH mutations identified so far 57-58 Table 4.1 3D structural validation of normal and mutated U2HR 74 peptides Table 4.2 Docking analysis of normal and mutated U2HR peptide 74 with single stranded RNA
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages v List of Tables
Table 5.1 List of filtered variants tested in family K 92 Table 5.2 List of mutations reported in the gene HOXC13 so far 92 Table 6.1 List of filtered variants tested for family Q 112
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages vi List of Abbreviations
List of Abbreviations
(NH4)2SO4 Ammonium Sulphate µl Micro Liter aa Amino Acid ABCA12 ATP binding Cassette Transporter 12 ABDH5 Abhydrolase Domain Containing 5 ADWH Autosomal Dominant Wooly Hair AEI Annular Epidermolytic Ichthyosis ALOX12B Arachidonate 12-Lipooxygenase APL Atrichia with Papular Lesion APMR Alopecia with Mental Retardation APS Ammonium Persulphate ARCI Autosomal Recessive Congenital Ichthyosis AREI Autosomal Recessive Epidermolytic Ichthyosis ARWH Autosomal Recessive Wooly Hair BMP Bone Morphogenetic Proteins Bp Base Pair CDH3 Cadherin-3 CDSN Corneodesmosin cM Centimorgan cm Centimeter COL7A1 Collagen 7A1 CRIE Congenital Reticular Ichthyosiform Erythroderma CS Clouston syndrome CYCL1 Cyclin 1 CYP4F22 Cytochrome P450, family F, polypeptide 22 Dkk4 Dickkopf WNT Signaling Pathway Inhibitor 4 DNA Deoxyribonucleic Acid DSC3 Desmocollin-3 DSG4 Desmoglein-4 DTCS Dye Terminator Cycle Sequencing EB Epidermolysis Bullosa EBS Epidermolysis Bullosa Simplex ECM Extracellular Matrix ED Ectodermal Dysplasia EDA Ectodysplasin EDAR Ectodysplasin receptor EDTA Ethylene Diamine Tetra Acetic Acid EI Epidermolytic Ichthyosis EN Epidermolytic Nevi EXPH5 Exophilin 5 FGF Fibroblast Growth Factors FLG Filaggrin FZD6 Frizzled Receptor 6
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages vii
List of Abbreviations
GHHS Generalized Hereditary Hypotrichosis Simplex GPCR G-Protein-Coupled Receptor HDM Histone Demethylases HED Hypohidrotic (anhidrotic) Ectodermal Dysplasia HF Hair Follicle Hg Hedgehog HGMD Human Gene Mutation Database HI Harlequin Ichthyosis HOXC13 Homeobox C13 HR Hairless HSS Hereditary Hypotrichosis Simplex HYPT Hypotrichosis ICNC Isolated Congenital Nail Clubbing ICND Isolated Congenital Nail Dysplasia IRE Iron Responsive Element IRES Internal Ribosome Entry Site IRS Inner Root Sheath JmjC Jumonji C Kb Kilo base KDa Kilo Dalton KID Keratitis Ichthyosis Deafness Syndrome KIND1/ FERMT1 Kindlin-1 KRT Keratin LAH Localized Autosomal Recessive Hypotrichosis LIPH Lipase H LIPN Lipase Family Member N LOH Loss of Heterozygosity LPA Lysophosphatidic Acid LPAR6 Lysophosphatidic Acid Receptor 6 MAGEA11 Melanoma Associated Antigen 11 Mb Mega Base MEDOC Mendelian Disorders Of Cornification mg Milli Gram MH Military Hospital ml Milli Liter MUHH Marie Unna Hereditary Hypotrichosis NaCl Sodium Chloride NCBI National Center for Biotechnology Information NDNC Nail Disorder Non-syndromic Congenital NHEJ Non-Homologous End Joining NIPAL4 NIPA Domain Like Containing 4 nm Nano Meter ORS Outer Root Sheath PA Phosphatidic Acid PAGE Polyacrylamide Gel Electrophoresis
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages viii
List of Abbreviations
PCR Polymerase Chain Reaction PHNED Pure Hair and Nail type of Ectodermal Dysplasia PLCD1 Phospholipase C Delta 1 PNPLA1 Patatin like Phospholipase C Domain Containing 1 PVRL4 Poliovirus Like Receptor-4 RD Repression Domains RFLP Restriction Fragment Length Polymorphism ROR Retinoic acid receptor-related Orphan Receptors RPL21 Ribosomal Protein L21 RSPO4 R-Spondin Family Member 4 SC Stratum Corneum SEI Superficial Epidermolytic Ichthyosis SG Sebaceous Gland Shh Sonic Hedgehog SLS Sample Loading Solution SNP Single Nucleotide Polymorphisms SNRPE Small Nuclear Ribonucleoprotein Polypeptide E SPINK5 Serine Protease Inhibitor, Kazal-type 5 STS Steroid Sulfatase Ta Annealing Temperature Taq Thermusphillus Aquaticus TBE Tris-Borate-EDTA TEMED N’N’N’N-Tetra Methyl Ethylene Diamine Tgfβ Transforming Growth Factor Beta TGM1 Transglutaminase 1 TND Twenty Nail Dystrophy TNF Tumor Necrosis Factor TR Thyroid Receptor TRID TR-Interaction Domains Tris Hydroxymethylaminomethane U2HR Upstream open reading frame of Hairless Gene uORF Upstream Open Reading Frame UV Ultraviolet v/v Volume by Volume VDR Vitamin D receptor WES Whole Exome Sequencing WH Wooly Hair WHO World Health Organization XLI X-linked Ichthyosis XRCC5 X-ray Repair Cross Complementing protein-5
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages ix
Abstract
Abstract
To function and respond effectively to the dynamic external environment, skin, the most exposed part of the human body and its appendages possess a significant ability to regenerate in a sensibly controlled fashion. When this finely tuned homeostatic system is disrupted, skin diseases such as genodermatoses may arise, which represents a complex group of acquired and congenital ectodermal disorders, personifying an investigative challenge due to highly variable and overlapping clinical phenotypes, non-specific representation, genetic heterogeneity and lack of recognition as a discrete clinical entity.
In the present research, eighteen consanguineous families (A-R) segregating diverse forms of hereditary ectodermal disorders were investigated at clinical and molecular level. Subsequently extracted DNA from given blood was processed for genetic trialing using microsatellite markers, SNP microarray, whole exome and Sanger’s sequencing. The study led to the identification of two novel genes, first report of involvement of U2HR in causing complete hairloss, and few novels and previously reported mutations in genes causing skin disorders.
Clinical topographies, witnessed in affected members of seven families (A-G), were analogous to isolated hereditary hypotrichosis. Linkage in two of these families was established to chromosome 3q26.33-q27.3 residing LIPH gene. Subsequently sequencing revealed two novel mutations (p.Arg110*, p.Pro311Leufs*3) in the LIPH gene. In another family, a novel compound heterozygous variant (p.Ser1589Tyr/p.Ala1092Glu) was identified in a potentially novel gene EXPH5. Search for linkage and disease causing variants in rest of the four families was not successful.
Linkage in three families (H, I, J), segregating atrichia with papular lesion (APL), was established to hairless gene HR on chromosome 8q21.3. Sequence analysis of the HR gene revealed a novel non-sense variant (p.Trp847*) in family H. In two other families genetic sequence exploration identified a novel homozygous missense variant (p.Arg20Leu) in one of the upstream regulatory regions, U2HR, of the HR gene. In silico analysis of mutated and normal modelled U2HR proteins exposed abnormal regulation of HR translation leading to APL.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages x Abstract
Three consanguineous families (K, L, M), presenting different types of nail dysplasias, were investigated in the present study. Haplotype analysis followed by sequence analysis identified a novel variant (p.Gln89*) in the HOXC13 and prior stated (p.Ala88Val) in the GJB6 gene. In the third family, segregating Koilonychia, whole exome sequencing failed to detect disease causing variant. A combination of SNP genotyping, exome and Sanger sequencing was used to genetically characterize ichthyosis and Kindler syndrome in five families. In family N, segregating X-linked ichthyosis, a deleted region (1.67 Mb) including STS gene on chromosome Xp22.3 was found a responsible factor. Genetic mapping followed by exome and Sanger sequencing identified a novel (p.F9Lfs*23) and a recurrent splice site variant (c.1718+2A>G) in the FERMT1 gene on chromosome 20p13 in two families segregating Kindler Syndrome. In family Q with ichthyosis, a single potential homozygous region (212-216 Mb) was mapped through SNP microarray on chromosome 2 in all the affected individuals. Further analysis lead to the identification of a rare splice site variant (c.938-7T>C) in potentially novel gene XRCC5. In the fifth family with ichthyosis and hair loss, a disease causing variant (p.Asp63Val) was detected in the LPAR6 gene. An extensive study on diverse cases of genodermatoses has been performed, which provided a comprehensive understanding about related diseases, their molecular pathways and probability of identifying novel molecular players responsible for causing several dermatological diseases. This provided an insight information for formulating the missing links between previously known pathological reasons/ pathways. This will support to design procedures for gene therapies for disorders involving human skin. The research work, presented here, contributed to the publications of following articles in internal peer-reviewed journals. 1. Mehmood S, Raza SI, Van Bokhoven H, Ahmad W (2017). Autosomal recessive transmission of a rare HOXC13 variant causes pure hair and nail ectodermal dysplasia. Clinical and Experimental Dermatology doi: 10.1111/ced.13115. 2. Mehmood S, Jan A, Raza SI, Ahmad F, Younus M, Irfanullah, Shahi S, Ayub M, Khan S, Ahmad W (2016). Disease causing homozygous variants in the human hairless gene. International Journal of Dermatology 55: 977-81
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages xi Abstract
3. Mehmood S, Shah SH, Jan A, Younus M, Ahmad F, Ayub M, Ahmad W (2016). Frameshift sequence variants in the human Lipase-H gene causing hypotrichosis. Pediatric Dermatology 33: e40-2 4. Ali RH, Mahmood S, Raza SI, Aziz A, Irfanullah, Naqvi SK, Wasif N, Ansar M, Ahmad W, Shah SH, Khan BT, Zaman Q, Gul A, Wali A, Ali G, Khan S, Khisroon M, Basit S (2015). Genetic analysis of Xp22.3 micro-deletions in seventeen families segregating isolated form of X-linked ichthyosis. Journal of Dermatological Science 80: 214-7 5. Mehmood S, Jan A, Muhammad D, Ahmad F, Mir H, Younus M, Ali G, Ayub M, Ansar M, Ahmad W (2015). Mutations in the lipase-H gene causing autosomal recessive hypotrichosis and woolly hair. Australasian Journal of Dermatology 56: e66-70 6. Shah K, Mehmood S, Jan A, Abbe I, Ali RH, Khan A, Chishti MS, Lee K, Ahmad F, Ansar M, University of Washington Center for Mendelian Genomics, Shahzad S, Nickerson DB, Bamshad MJ, Coucke PJ, Santos-Cortez RLP, Spritz RA, Leal SM, Ahmad W (2017). Sequence Variants in Nine Different Genes Underlying Rare Skin Disorders in Ten Consanguineous Families. International Journal of Dermatology 56: 1406–1413. 7. Mehmood S, Mahmood A, Noor Z, Ahmad S, Jelani M, Tariq M, Rashid S, Ahmad W (2017). A novel homozygous sequence variant in the U2HR underlies Atrichia with papular lesions (APL) in two consanguineous families. (In Preparation)
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages xii Chapter 1 Introduction
Introduction
‘Skin’ the first line of defense is the outermost covering in all humans, and undergoes a lifetime regeneration process to provide physical, immunological support and homeostasis. Various structural features originated from its topmost layer (ectoderm) termed as ectodermal appendages, which include hair, nail, teeth, exocrine glands (Leah and Mikkola, 2014; Langton et al., 2017). Disruption of this finely tuned homeostatic system results in skin diseases such as genodermatoses.
Genodermatoses is a collective term representing disorders of hair and nail malformations, skin pigmentation, blistering, acne, cornification, photosensitivity, erythema, dermatitis, mucosal and structural disorders, vascular malformations, neoplasms, connective tissue disorders, metabolic diseases, immune mediated disorders, premature aging, dental, sweat disorders, urticarial, deafness, endocrine, gastrointestinal, cardiac and pulmonary development or growth disorders, diseases of lymphatic, nervous, musculoskeletal, renal and urogenital organs (Jen and Nallasamy, 2016).
Skin
The human skin covers multifaceted layers: which are stratified epidermis and underlying dermis buildup by connective tissues. Skin signifies the major interface between the organism and the surroundings, which works as a protection wall against any injury or environmental insult (Sdobnov et al., 2017). Penta-layered epidermis function as biochemical, physical and adoptive immunological barrier. Stratum corneum (SC) function as a physical barrier, whereas lipids, hydrolytic enzymes, macrophages and antimicrobial peptide serve as chemical/biochemical barrier, while cellular and humoral elements of the immune system are the main driver of adoptive barriers (Proksch et al., 2008). The functional control of dermis is governs by two main layers: papillary dermis and reticular dermis detached by vascular plexus, the rete subpapillare. The poorly organized collagens (type I and type III) constitutes the papillary dermis, whereas, these are finely ordered in the reticular dermis (Woodley, 2017). Dermis enhances the strength and elasticity of the skin.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 1
Chapter 1 Introduction
Figure 1.1: Topographical view of deep inside the multilayered human skin (Adopted from Integumentary system, Wikipedia)
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 2
Chapter 1 Introduction
Embryonic Origin of Skin Appendages
During primary embryogenesis, the peripheral germ layer of the embryo: ectoderm gives rise to skin. Subsequently skin tissues diversify into branches and increase the surface area for functional differentiation and secretions (Chuong et al., 2014). These ectodermal branches can be termed as ectodermal appendages e.g. hair follicles, nail, teeth and exocrine glands. The morphogenesis of ectodermal appendages share similar series of molecular events involves mutual and successive crosstalk between the epithelium and mesenchyme (Pispa and Thesleff, 2003). However, they differ greatly in shape, function and regenerative properties (Mikkola and Millar, 2006).
Organogenesis begins with three main phases, initiation: the first evident signal of development in most of the ectodermal appendages marked by the local condensing of the epithelial layer to form a placode which bulges out to make a bud due to condensation of the mesenchymal cells out of the mesenchyme. Next phase is morphogenesis determined by continuous interaction of the epithelial and mesenchymal components to make branches and folding (Jimenez-Rojo et al., 2012). Subsequently final stage of ectodermal appendages: development is accomplish by differentiation in shape and size of the organs.
Hair Morphogenesis
Hairs are the mini organ among the ectodermal appendages which retained the renewed activity throughout the skin lineage (Marlon et al., 2009). Hair morphogenesis involve three major phases classified as: induction, organogenesis and cytodifferentiation controlled by active interplay of Wnt, Notch, Shh and BMP signaling pathways (Rishikaysh et al., 2014). Induction begins with first signal of mesenchymal cells placode formation mediated by wnt activation followed by organogenesis during which a complex network of signals direct epithelial cells to make a dermal condensate and conveys the signals down to the dermis (Schmidt-Ullrich et al., 2005). Subsequently dermal condensate is surrounded by follicular epithelial cells to make dermal papilla via morphogens and growth factors which instruct the ectoderm to orient in proper position and shape of the entire hair follicle, marked as cytodifferentiation (Mou et al., 2006).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 3
Chapter 1 Introduction
Fully developed hair is composed of epidermal bulge portions in epidermis termed as the hair follicle and an outer extended portion of the hair shaft. Eight different types of cells originate from the epithelium of hair follicles, these cells develop to hair shaft (cuticle, cortex, medulla), the external support to the shaft designated as inner root sheath (IRS) composed of cuticle, Henle’s layer. Companion cells outer root sheath (ORS) and Huxley’s layer lineage which serves to mark margin between hair follicles and epidermis (Niemann and Watt, 2002).
Hair follicles act as progenitor stem cells due to a continuous cycle of elongation, thinning and fall out phases termed as hair growth cycle which commences with catagen (regression) phase during which most of epidermal compartment faces apoptosis followed by telogen (quiescent) phase. Telogen is interrupted by rapid differentiation and proliferation of hair follicles termed as anagen (growth) phase (Paus and Foitzik, 2004). Various signals cross talks control hair regeneration cycle, including molecular communication between epidermis and underlying mesenchyme as a main prerequisite.
Nail Morphogenesis
The first dermal signal of epithelium and mesenchymal contents interaction drives the nail morphogenesis in much similar fashion as involved in hair development (Chuong et al., 2001). Nail field start to appear from epithelial matrix around 10 week of gestation and completed in 32 week of pregnancy (Steensel et al., 2004). Primordial nail formation begins with nail placode appearance at the dorsal side of the digits which possess proliferating keratinocytes. Subsequently continuous apoptosis and deposition of the keratinocytes facilitate cornified nail plate formation. Several hard and soft keratins and keratin associated proteins play crucial role in nail morphogenesis (Cashman and Sloan, 2010). Mature nail appears white due to loosely attached nail plate with the underlying nail matrix (Lunula), which is visible from the ventral roof of the nail plate surface (McGowan and Coulombe, 2000). Whereas dorsal roof of the nail plate is shiny and is attached to the nail plate via cuticle produced by the nail fold termed as eponychium (Wegener and Johnson, 2010). Beneath the free space of nail plate there is layer of epidermis in the middle of the nail bed and distal nail groove termed as hyponychium (Stone et al., 2000).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 4
Chapter 1 Introduction
Nails grow throughout the life but vary greatly in growth among the people depending upon their nutrition, mechanical demand, vesicular and neurological supply (Khan et al., 2015). Nails not only protect the soft tissues of the toes and nails but also enhance their manicure esthetic appeal and serve as a natural weapon for defense.
Tooth Morphogenesis
Odontogenesis is the process of formation of human teeth initiated with the series of signals from the oral epithelium to the underlying mesenchyme, which upon getting potential odontogenic signal start to migrate and divided into branches to mark the horse-shoe shaped first arch for tooth development called dental lamina ((Mitsiadis and Graf, 2009; Jussila and Thesleff, 2012). It is believed that separate placode are formed to give rise the different types of teeth (Incisor, canine, molar, premolar). Dental lamina grows and invaginates into the mesenchyme and condenses around the nascent localized dental placode to give rise distinct types of teeth (Thesleff and Mikkola 2002; Marja and Mikkola 2007). The main genetic players which play crucial role in oral ectoderm and mesenchyme interaction are FGF, Shh and BMP. Recently, MAPK pathway, associated to dental morphogenesis, has been defined which is involved in BMP regulation (Matthew et al., 2015). Fully mature teeth possess three different mineralized tissues Enamel, dentin, and cementum (Hu and Simmer, 2007) and serve for the purpose of food grinding and swallowing.
Exocrine/sweat Gland Morphogenesis
Exocrine glands are secretory appendages of the skin which are essential for maintaining physiology and homeostasis of the human body (Cui and Schlessinger, 2006). Exocrine glands include sweat, salivary, sebaceous, mammary, Meibomian, lacrimal and preputial.
Thermoregulation in particular is regulated by sweat glands in the human body. Sweat gland morphogenesis begins with same event of epithelial and mesenchymal cells combination, gland bud grows from the epithelial top to the deep into dermis ending into secretory coil of sweat duct. However the phenomenon of epidermal condensate or papilla formation is less evident in sweat gland organogenesis (Headon, 2009). Like other exocrine glands, sweat glands deny branching and confined to only single tubular duct formation (Sato et al., 1989; Mikkola and Millar, 2006; Tucker, 2007). The salivary gland possesses
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 5
Chapter 1 Introduction three basic cells lineage: acinar, myoepithelial and ductal cells. Depending upon the secretion composition acinar cells can be split into serous or mucous. Likewise ductal cell according to their location can be assembled into three basic types i.e., intercalated, granular or striated ductal cells (Tucker, 2007; Cui et al, 2014). The main genetic players of signaling cascade monitoring sweat gland morphogenesis (Wnt-Dkk4-Eda-Shh) are much similar as involved in expression profile of other ectodermal appendages.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 6
Chapter 1 Introduction
Figure 1.2: An indication of early morphogenesis of ectoderm derived appendages (Adopted from Jimenez-Rojo et al., 2012)
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 7
Chapter 1 Introduction
Ectodermal Signal Transduction
During embryogenesis, pluripotent stem cells undergo unceasing fate determination by striking balance between cell regeneration, differentiation and maturation to produce a specific cell lineage for particular tissue or organ buildup (Li and Clevers, 2010; Fuchs and Chen, 2013). This phenomenon of cell fate decision is finely controlled by a complex network of signaling molecules making cross talks at distinct levels of morphogenesis and organogenesis of ectodermal appendages (Moore and Lemischka, 2006; Xie and Li, 2007; Voog and Jones, 2010). Several molecular players are categorized through animal knockout models which play crucial role in ectodermal signaling cascade. (Tumer and Grose, 2010; Ingham et al., 2011; Dunphy et al., 2011; Niehrs, 2012; Leah and Mikkola, 2014; Mehmood et al., 2015a,b).
LPA/ LIPH/ LPAR6 Signaling
Lysophosphatidic acid (LPA) is a group of small lipids reside in the plasma membrane and act as extracellular signaling mediator which directs variety of signals to perform wide range of physiological functions (Mutoh et al., 2012; Choi and Chun, 2013; Mehmood et al., 2015a). Phosphatidic acid (PA) acts as substrate for lipase H (LIPH), which is an enzyme belongs to large triglyceride lipase family. LIPH gene possesses 10 exons spanning 46.3Kb genomic region encoding 55Kdal protein encoded by exon 5-6, Hinge region encoded by exon 6-7 and plate domain encoded by exon 8-9 respectively (Roger et al., 2012). Catalytic domain N-terminal of LIPH is composed of triad of critical amino acids (ser154, asp178 and his248) encoded by exons 3, 4 and 6, respectively and are required for LIPH catalytic activity (Aoki et al., 2007). LIPH acted upon phosphatidic acid (PA) and produces oleoyl-L alpha-lysophosphatidic acid, which functions as a ligand for the lysophosphatidic acid receptor 6 (P2RY5) receptor (Sundberg et al., 2000; Sonoda et al., 2002; Takahashi et al., 2003; Inoue et al., 2011).
The LPAR6 gene is lies deep within the intron 17 of retinoblastoma 1 gene (RB1) on chromosome 13 (Herzog et al., 1996). It encodes for transmembrane protein, which is a member of orphan G-protein-coupled receptor (GPCR) that ranges from LPAR1 to LPAR6 (Kazantseva et al., 2006; Yanagida et al., 2009). Expression of LIPH/LPAR6 is notable in several tissues but strongly observed in the hair shaft cuticle, precortex, and prominently
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 8
Chapter 1 Introduction in the outer and inner root sheaths (ORS, IRS) of the hair follicles (Diribarne et al., 2012; Mehmood et al., 2015a).
The broad spectrum of LIPH/LPAR6 expression profile is suggesting that both genes have overlapping role in LPA mediated signal transduction (Yung et al., 2014; Tsujiuchi et al., 2014; Stoddard et al., 2015), which is initiated by accurate recruitment of LPA (catalyzed by LIPH) on LPAR6 receptors to activate downstream cascade of signaling molecules involved in variety of cellular functions such as cell morphogenesis, differentiation, proliferation, migration, protection against apoptosis and invasion (Kazantseva et al., 2006; Tariq et al., 2009). Due to their prominent expression in hair shaft LIPH/LPAR6 plays crucial role in hair follicle morphogenesis and any disruption in their activity lead to woolly or sparse hair phenotype (Khan et al., 2011; Kurban et al., 2013; Hayashi et al., 2015). Recently this signaling pathway is under great debate due to it dynamic roles in tumorigenesis and cancer progression (Okabe et al., 2013; Cui et al., 2014; Seki et al., 2014; Ishimine et al., 2016).
Wnt/ β-Catenin Signaling
In multicellular organism Wnt mediated signal transduction plays crucial role in fueling pluripotent stem cells to differentiate into different types of ectodermal appendages (hair, nail, teeth, and mammary glands) and promote their cells renewal activity (Clevers et al., 2014). Wnt or wingless (in drosophila) are cysteine-rich secreted signaling proteins which perform their activity in a short expression interval during embryogenesis, operated by short lived vesicles at neurotransmitter junctions and stem cells niche (Alexandre et al., 2014). Wnt acts as a ligand which directs the signals for tissues patterning by residing to their cognate receptors entitled as Frizzled receptors (Wodarz and Nusse, 1998; Janda et al., 2012). There are 10 frizzled receptors known in literature which make 190 different ligand/ receptor combinations upon binding with 19 different types of wnt proteins during stem cells fate determination and ectodermal appendages development (Van Amerongen et al., 2008).
Wnt signaling can be operated through canonical or non-canonical signaling pathways (Jimenez Rojo et al., 2012). In canonical pathway, one of the major molecular players is cytosolic β-catenin which controls signaling events in a highly organized fashion. Wnt
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 9
Chapter 1 Introduction ligand is recruited to frizzled receptors through Lrp5/6 transmembrane co-receptor, upon making this interaction, conformational changes in the complex occur with cause phosphorylation by associated protein kinases and inhibition of cytoplasmic kinase GSK- 3b, which normally causes cytosolic β-catenin destruction in the absence of wnt (Myung et al., 2013; Stamos et al., 2014). Subsequently in the presence of wnt cytosolic β-catenin gets mobilize and translocate into the nucleus where it establishes association with Tcf/Lef transcription factors to govern the transcription of various signaling factors involve in ectodermal organogenesis. However there are some conditions in which wnt signaling is noticed without the involvement of β-catenin (Amerongen et al., 2009), such non-canonical pathways are governed by an intracellular transduction component (Disheveled) and frizzled receptors.
HR/ U2HR Signaling
Hairless (HR) acts as a nuclear receptor co-repressor desirable for normal function of the skin (Thompson et al., 2009; Mehmood et al., 2015b). Expression of hairless is observed in inter follicular epidermis. Hairless expresses all over the cell cycle, but it is abundantly expressed during the catagen phase involved in regulating the Wnt signaling (Beaudoin et al., 2005; Ramot et al., 2010).
Additionally, it has also been updated that HR protein shows a major role in the formation of inner root sheath of the hair follicles (Kim et al., 2012).
EDA/EDAR/EDARADD Signaling
One of the main driving forces for ectodermal organogenesis is the interaction between a tumor necrosis superfamily (TNF) ligand: Ectodysplasin (EDA) to its receptor EDAR (Vladimir et al., 2005; Chang and David, 2006; Mikkola, 2008). This interaction is facilitated by adaptor proteins EDARADD. Ectodysplasin pathway relies on two Ectodysplasin isoforms (EDA-1, EDA-2) which are product of alternate splicing of the same gene (EDA) (Yan et al., 2000; Thesleff and Mikkola, 2002; Courtney et al., 2005). EDAR possess extracellular ligand binding site at N-terminal, single transmembrane region and intracellular death domain with interacts to EDARADD adaptor protein after getting signal of EDA recruitment on EDAR (Kere et al., 1996; Ezer et al., 1999). During canonical Ectodysplasin pathway primary interaction between EDA-1 to its receptors
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 10
Chapter 1 Introduction
EDAR initiates series of selective interaction among EDARADD and TRAF (TRAF 1-6 except TRAF4) transcription factors, which consequently lead to activation and translocation of cytosolic NF-kB transcription factors into the nucleus where it regulates the transcription of various genes involved in ectodermal organogenesis. However EDA-1 signaling maybe weakly activates JNK pathway (Headon et al., 2001; Kumar et al., 2001; Yan et al., 2002; Mikkola and Thesleff, 2003).
In case of other ectodysplasin isoform (EDA-2), it acts as ligand for XEDAR receptors instead of EDAR which interacts to TRAF-3 and TRAF-6 through its intracellular domain and resulted in downstream activation of both NF-kB and JNK pathways (Kojima et al., 2000; Hashimoto et al., 2006; Verhelst et al., 2015). During early organogenesis Wnt/ β catenin signaling regulates epidermal placode formation which is maintained by EDA signaling via complex network of ligand/ receptor interactions which direct the signals for ectodermal appendages (hair, teeth, mammary and exocrine glands) development, morphogenesis, control their density, size and structures (Pipsa et al., 2008; Harris et al., 2008; Priolo, 2009; Atukorala et al., 2010; Sadier et al., 2013; Schneider and Mikkola, 2015; Garcin et al., 2016).
Genodermatoses of the Hair
Genodermatoses of the hair is the collection of heterogeneous hair abnormalities which can be classified as hypertrichosis and hypotrichosis. Hypertrichosis is the term used for excessive hair growth and hypotrichosis can be distinguished by sparse to complete hair loss (Alopecia) from scalp and different parts of the body. Hypotrichosis (HYPT) is further classified into two categories depending upon hair loss manifestation as isolated or associated with other anomalies.
Isolated Hereditary Hypotrichosis
Isolated hypotrichosis possess collection of non-syndromic hereditary hair loss disorders which can be progressive in generations either in autosomal recessive or autosomal dominant manner. To date, several autosomal recessive and equal no. of autosomal dominant isolated hereditary hypotrichosis loci have been mapped (Basit et al., 2015). Genes responsible for causing non-syndromic hypotrichosis are summarized in Table 1.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 11
Chapter 1 Introduction
Table 1.1: Classification and clinical overview of isolated hypotrichosis related genes and loci
Hypotrichosis Associated Physical Gene Clinical Hair position (OMIM) classification disease phenotype abnormalities
HYPT1 Hypotrichosis 18p11.22 APCDD1 Diffused, thin and sparse Hair follicle Simplex of Scalp scalp hair. Normal hairs of miniaturization eyebrows, eye lashes and Type 1 (HSS1) beard
HYPT2 Hypotrichosis 6p21.3 CDSN Progressive sparse hairs from Hair architecture Simplex of Scalp childhood to adulthood on the defects, skin scalp, hairs of beard, barrier defects with Type 2 (HSS2) eyebrows and eye lashes susceptibility to appear normal psoriasis
HYPT3 Dominant 12q13 KRT74 Diffused woolly hairs, which Tightly curled hair hereditary are extremely dry, dull and with tapered distal hypotrichosis 3 stiff with normal eye brows, ends including knot eye lashes and beard formation and and wooly hairs dystrophic anagen hair
HYPT4 Marie Unna 8p21.2 U2HR Sparse hairs on scalp, eye Defects of hair Hereditary brows and eye lashes at birth follicle which progressively shed morphogenesis, Hypotrichosis with age and leads to varying disrupted hair cycle 1/Hypotrichosis 4 degree of alopecia (MUHH1)
HYPT5 Marie Unna 1p13.3 EPS8L3 Absence of scalp hairs at Hair architecture Hereditary birth which develop to thin, defects irregular and wiry hairs on Hypotrichosis scalp, eyebrows and eye 2/Hypotrichosis 5 lashes in adults. Absence of (MUHH1) axillary and pubic hairs
Continued…
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 12
Chapter 1 Introduction
HYPT6 Localized 18q12 DSG4 Sparse to complete absence Monilethrix like autosomal of hair on scalp, eyebrows hair, tapered fragile recessive and eye lashes. Axillary and hair shaft ends with pubic hairs are normal uneven diameter hypotrichosis and longitudinal 1/Hypotrichosis 6 twisting (LAH1) suggestive of pili torti
HYPT7 Localized 3q27.2 LIPH Thin scalp hairs which Defects in crucial autosomal gradually decrease in density signaling events of recessive in adults, tightly curled hair growth cycle woolly hair. sparse to normal hypotrichosis eyebrows and eyelashes 2/Hypotrichosis 7
(LAH2)
HYPT8 Localized 13q14 LPAR6 Sparse tightly curled, Reduced no. of hair autosomal depigmented woolly hair follicles, low hair recessive with sparse to normal follicle eyebrows, eyelashes, axillary infundibulum, hypotrichosis and pubic hairs defects in hair shaft 3/Hypotrichosis 8 development (LAH3)
HYPT9 Localized 10q11.23- Unknown Sparse to absence of hairs Hair development autosomal from scalp and different parts and growth q22.3 recessive of the body, low hair pigment abnormalities
hypotrichosis 4/Hypotrichosis 9 (LAH4)
HYPT10 Localized 7p22.3- Unknown Devoid of hairs on scalp and Hair follicle autosomal different body parts at birth degeneration and p21.3 recessive with reduced density at adult reduction age, papular lesions hypotrichosis 5/Hypotrichosis 10
(LAH5)
Continued…
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 13
Chapter 1 Introduction
HYPT11 Hypotrichosis 1q32.1 SNRPE Sparse to complete hair loss Hair follicle Simplex of Scalp from scalp and eyebrows, maintenance normal pubic hairs disorders Type 3 (HSS3)
HYPT12 Hypotrichosis 13q12.2 RPL21 Progressive hairloss from 2-6 Significant Simplex of Scalp months age, complete devoid decrease in number of hairs from scalp, and size of the hair Type 4 (HSS4) eyebrows, eyelashes in adults follicles
HYPT13 Hypotrichosis 12q13 KRT71 Tightly curled woolly hair at Hair shaft defects with woolly hair birth, sparse to absent in with frequent adults longitudinal grooves
HYPT Hypotrichosis 18q12.1 DSC3 Thin scalp and body hairs, Mild follicular with recurrent recurrent skin vesicles plugging and inflammation skin vesicles
HYPT Digenic 16q22.1 CDH3 Sparse to absence of hairs Hair growth autosomal and and an from scalp and the whole abnormalities recessive body, limited hair growth without any other 12q21.2- unknown hypotrichosis associated disorder q22 gene
HYPT Autosomal 2q31.1– Unknown Sparse, curled hairs, variable Hair development recessive q32.2 degree of hairloss from scalp, and maintenance hypotrichosis eyelashes, eyebrows, beard disorders and mustaches
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 14
Chapter 1 Introduction
Hypotrichosis Associated with Other Anomalies
Hypotrichosis associated with other non-dermal pathological conditions is designated as syndromic hypotrichosis in which commonly observed other pathophysiological conditions include: retinal degeneration, Ichthyosis, skeletal deformity, macular dystrophy, intellectual disability, hearing impairment and cardiac disorders. Such syndromic anomalies can be inherited in both autosomal recessive and dominant manner.
Genodermatoses of the Nail
Genodermatoses of the nails is the collection of heterogeneous congenital ectodermal dysplasia of the nail due to nail development and morphogenesis defects. It can be inherited in isolated manner or associated with other anomalies and can be segregated in both autosomal recessive and dominant fashion.
Isolated Nail Dysplasia
Isolated nail dysplasia also termed as: nail disorder non-syndromic congenital (NDNC), which are further categorized into ten diverse categories depending upon the genetic defect in the nail development and homeostasis.
NDNC1(MIM 161050) nail dysplasia is also termed as isolated onychodystrophy totalis or ‘twenty nail dystrophy’ (TND) segregates in autosomal dominant manner characterized by sand paper like rough nails with excessive longitudinal striations, nail are variable in thickening and thinning from margins often possess koilonychia phenotype , absence of toe nails, loss of luster and discoloration of nails. To date, any locus/ gene has not been mapped for NDNC1 (Hazelrigg et al., 1977; Tosti et al., 1994; Karakayali et al., 1999; Sehgal, 2007). The rare phenotype of spoon-shaped nails is classified under NDNC2 (MIM 149300) nail dysplasia, in which nails are abnormally concave from the margins, discolored, thin and rough. There is no locus and gene still mapped for this autosomal dominant inherited phenotype (Hellier, 1950; Bergeson and Stone, 1967; Bumpers and Bishop, 1980). In case of NDNC3 (MIM 151600) or leukonychia is most common nail pigment disorder in which nails appear chalky white (complete leukonychia), translucent nails at distal end with yellow coloration (incomplete leukonychia). NDNC3 is mapped on chromosome 3p21.3 with pathogenic mutations in PLCD1 (MIM 6022142) gene located
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 15
Chapter 1 Introduction in this region and inherited in both autosomal recessive and dominant fashion (Baran and Kechijian, 2001; Kiuru et al., 2011; Mir et al., 2012; Farooq et al., 2012). Nail dysplasia, nonsyndromic type 4 (NDNC4 MIM 610573) or anonychia inherited in autosomal recessive manner is a severe condition of complete absence of nails, nail matrix and nail bud from all fingers and toes whereas hyponychial cogenita in milder state in which rudimentary nail bud is observed. Leukonychia is mapped on chromosome 20p13 which harbors RSPO4 as a causative gene (Chishti et al., 2008; Breuchle et al., 2008; Ishii et al., 2008). NDNC5 (MIM 164800) or hereditary distal onycholysis is characterized by thick/ hard nails with slow growth rate and discoloration of fingers and toe nails. It is inherited in dominant fashion and locus/gene is yet to be discovered (Schulze, 1966; Hundeiker, 1969; Burg, 1975; Bazex et al., 1990). Partial absence of the nails phenotype is classified under NDNC6 (MIM 107000) inherited in autosomal dominant manner. Most severely affected digits in NDNC6 are thumb and toes nails whereas other digits are less affected. Genes responsible for partial nail loss are still under investigation (Charteris, 1918; Hobbs, 1935; Strandskov, 1939). Isolated congenital onychodystrophy of the nails is classified under NDNC7 (MIM 605779), it is mapped on chromosome 17p13 and distinguished from other isolated nail dysplasia due to presence of very thin, impaired nail plate with longitudinal streaks and vulnerably exposed nail margins. It is inherited in autosomal dominant manner but causative gene is not identified so far (Hamm et al., 2000; Krebsov et al., 2000). Isolated toe nail dystrophy or NDNC8 (MIM 120120) is caused by pathogenic variations in COL7A1 gene located on Chr: 3p21.3 and inherited in autosomal dominant fashion, often segregate with recessively inherited skin trait: epidermolysis bullosa. Patients are reported to have severe toe nail malformation, nail plate is narrow and buried inside the nail bed (Shimizu et al., 1999; Sato-Matsumura et al., 2002). Isolated anonychia-onycholysis/ onychodystrophy is the ninth type of nail disorder nonsyndromic congenital NDNC9 (MIM 614149) mapped to chromosome 17q25.1-q25.3, characterized by anonychia of the toe nails and onycholysis of the finger nails in the age of 8 to 10 years, whereas nails appear normal at the time of birth. Genes responsible for producing such phenotype are still under exploration (Rafiq et al., 2004). NDNC10 (MIM 603409) is verified by recessively inherited claw shaped, shiny, hyperplastic and hyperpigmented nails produced by pathogenic mutations in frizzled receptor 6 (FZD6) gene located on chromosome 8q22.3,
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 16
Chapter 1 Introduction which perform dynamic role in ectodermal appendages development (Freojmark et al., 2011; Naz et al., 2012; Raza et al., 2013). Another isolated form of congenital nail dystrophy is marked as nail clubbing caused by mutation in HPGD gene (MIM 119900) mapped to chromosome 4q33-q34 responsible for nail growth disorders in which nails are abnormally enlarged with hyperpigmented dystrophic margins (Horsfall, 1936; Fenton, 1995; Myers and Farquhar, 2001; Uppal et al., 2008; Tariq et al., 2009). Associated Nail Dysplasia
In several congenital ectodermal dysplasias: abnormality of two or more ectodermal appendages is commonly observed, in which dysplasia of the nail is remarkably inherited along with hypotrichosis/ hair deformity (pure hair and nail ED; Trichothiodystrophy; Monilethrix; Netherton syndrome), exocrine gland defects (anhidrotic/hypohidrotic ED), keratoderma (Clouston syndrome; Pychyonychia congenita), dental disorders (Odonto- onycho dental dysplasia; Witkop syndrome), intellectual disability, immunodeficiency (Human nude phenotype), musculoskeletal deformities (Menkes Kinky hair syndrome), kidney abnormalities (Nail patella syndrome), cleft lip palate (Cleft lip palate syndrome) and skin fragility syndromes (Clouston, 1939; Hart, 1983; Judge et al., 1994; Richard et al., 1996; Mclntosh et al., 1997; McGrath et al., 1999; Stratigos et al., 2001; Richetta et al., 2001; Simmons et al., 2016).
Pure Hair and Nail Ectodermal Dysplasia
Fully mature hair and nail differ greatly in physical appearance but share common signaling events at embryonic level during development and morphogenesis (Sprecher, 2005). Due to this fact abnormality in any of the crucial player of ectodermal signaling cascade can lead to disorders of hair, nail and both together (Stratigo et al., 2001) termed as pure hair and nail ectodermal dysplasia (PHNED).
Till now three loci have been mapped for PHNED phenotype. Autosomal recessively inherited ectodermal dysplasia 4 of pure hair/ nail type (MIM 602032) was mapped to chromosome 12q13 caused by pathogenic mutations in KRT85 gene (Calzavara-Pinton et al., 1991; Naeem et al., 2006; Shimomura et al., 2010). Ectodermal dysplasia 5 of hair/ nail type (MIM 614927) is mapped to chromosome 10q24.32-q25.1 harboring an unknown
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 17
Chapter 1 Introduction gene responsible for producing PHNED (Rafiq et al., 2005). Ectodermal dysplasia 6 of hair/ nail phenotype (MIM 614928) mapped to chromosome 17p12-q21.2 inherited in autosomal recessive manner (Naeem et al., 2006), genes responsible for this phenotype are not yet discovered. Ectodermal dysplasia 7, hair/nail phenotype (MIM 614929) mapped to chromosome 12q13 for autosomal woolly hair phenotype caused by mutations in type-II keratin 74 (Naeem et al., 2007; Rasool et al., 2010; Raykova et al., 2014). Ectodermal dysplasia 9 of hair/ nail phenotype (MIM 614931) mapped to chromosome 12q13 harbors HOXC13 gene which is located in the vicinity of the type-II keratin cluster. Mutations in HOXC13 are responsible for causing pure hair and nail ED inherited in autosomal recessive manner (Lin et al., 2012, Farooq et al., 2013; Ali et al., 2015; Mehmood et al., 2017).
Genodermatoses of the Skin
Skin is the chief organ in human organization which is highly exposed to environmental assaults due to which it is at great risk of getting disorders which can be acquired or congenital. Congenital genodermatoses of the skin is the large group of complex disorders which can be segregated as isolated skin abnormality or associated to other anomalies like gastrointestinal problems, ocular, neurologic, cardiovascular and musculoskeletal deformities. (Pinheiro and Freire-Maia, 1994; Priolo et al., 2000; Lamartine, 2003; Itin and Fistarol, 2004; Priolo 2009; Feramisco et al., 2009).
Isolated Ichthyosis
‘Ichthyosis’ is a large collection of heterogeneous Mendelian disorders of cornification (MEDOC), which affect the entire integument and often progressive as scaling, extremely dry skin, hyperkeratosis and erythroderma (Takeichi and Akiyama, 2016). Inherited ichthyosis is subdivided into non-syndromic and syndromic forms, which were extensively revised in the consensus conference on classification and nomenclature of inherited ichthyosis in Soreze 2009 (Oji et al., 2010).
Non-syndromic hereditary ichthyosis is confined to disorders of the skin only, which is further classified into common ichthyosis (ichthyosis vulgaris/FLG gene) (Smith et al., 2006), autosomal recessive congenital ichthyosis (ARCI1-ARCI11) and keratinopathic ichthyosis which includes epidermolytic ichthyosis (EI), annular epidermolytic ichthyosis
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 18
Chapter 1 Introduction
(AEI), superficial epidermolytic ichthyosis (SEI), autosomal recessive epidermolytic ichthyosis (AREI), epidermolytic nevi (EN) and congenital reticular ichthyosiform erythroderma (CRIE). An autosomal dominant type of isolated ichthyosis include loricrin keratoderma, erythrokeratoderma variabilis and ichthyosis Curth Macklin (Rothnagel et al., 1992; Ishida-Yamamoto et al., 1997; Richardson et al., 2006; Judge et al., 2010; Yoneda et al., 2012; Fonseca et al., 2013; Ogawa et al., 2014; Abdul Wahab et al., 2015). Ichthyosis vulgaris is the most prevailing phenotype which affects 1:250 to 1:1000 individuals around the globe (Oji et al., 2010). The second most common type of ichthyosis is sheltered under the umbrella of autosomal recessive congenital ichthyosis (ARCI) caused by sequence variants in the following genes: Keratinocyte transglutaminase 1 (TGM1) on chromosome 14q11.2 causes autosomal recessive congenital ichthyosis -1 (ARCI1/ MIM), ALOX12B gene located on chromosome 17p13.1 is responsible for causing autosomal recessive congenital ichthyosis 2 (ARCI2; MIM 242100), pathogenic variants in ALOXE3 gene mapped to chromosome 17p13.1 causes autosomal recessive congenital ichthyosis 3 (ARCI3/ MIM 606545). Harlequin ichthyosis or autosomal recessive congenital ichthyosis 4 (HI, MIM242500) is caused by mutation in ABCA12 gene on chromosome 2q35, CYP4F22 gene mapped to chromosome 19p13 is responsible for causing autosomal recessive congenital ichthyosis 5 (ARCI5/ MIM 604777), NIPAL4 gene on chromosome 5q33 causes autosomal recessive congenital ichthyosis 6 (ARCI6/ MIM 609383), autosomal recessive congenital ichthyosis 7 (ARCI7/ MIM 615022) is mapped to chromosome 12p11, but gene responsible for producing this phenotype is unknown. Pathogenic mutations in LIPN gene located on chromosome 10q23 causes autosomal recessive congenital ichthyosis 8 (ARCI8/ MIM 613943), autosomal recessive congenital ichthyosis 9 (ARCI9/ MIM 615023) is triggered by mutations in CERS3 gene mapped on chromosome 15q26, PNPLA1 gene on chromosome 6p21 is responsible for producing autosomal recessive congenital ichthyosis 10 phenotype (ARCI10/ MIM 615024). Recessive X-linked ichthyosis or autosomal recessive congenital ichthyosis 11 (ARCI11/ MIM 602400) is caused by mutations in STS gene mapped to chr: 11q24 (Williams et al., 1985; Griffith et al., 1998; Kelsell et al., 2005; Vahlquist et al., 2010; Sugiura et al., 2013; Radner et al., 2013; Wasio et al., 2014; Cottle et al., 2015; Sugiura et al., 2015; Ali et al., 2015; Takeichi and Akiyama, 2016).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 19
Chapter 1 Introduction
Associated Ichthyosis
Mendelian disorders of cornification progressive with extracutaneous signs (hair, nail, teeth, bones and exocrine glands etc.) are classified as syndromic or associated ichthyosis (Yoneda et al., 2003; Oji et al., 2010). There is a long list of syndromic form of ichthyosis which are classified on the basis of recessive and dominant inheritance pattern and type of the affected organs (Oji et al., 2010). Some of the most prevalent forms of associated ichthyosis include: Chanarin-Dorfman syndrome (MIM 275630) is produced by mutations in abhydrolase domain containing 5 (ABHD5) gene (Ghosh et al., 2008), Kindler syndrome (MIM 173650) triggered by mutations in kindlin-1 (KIND1/ FERMT1) gene (Rognoni et al., 2016), Netherton syndrome (MIM 256500) caused by mutations in serine protease inhibitor, Kazal-type 5 (SPINK5), Keratitis–ichthyosis–deafness (KID) syndrome (MIM 148210) caused by pathogenic variants in GJB2 gene (Bitoun et al., 2002; Bale et al., 2002). Aims and Objectives of the Studies Presented in the Dissertation The present study was aimed to investigate disorders of ectodermal appendages at clinical and molecular levels. The study comprised characterization of the contender genes and causative sequence variants responsible for producing human hereditary ectodermal dysplasias in Pakistani families.
DNA samples were genetically analyzed through classical genotyping along with modern techniques like SNP microarray. Shared homozygous regions identified in all affected individuals were evaluated to identify the potential causative gene. Sanger sequencing and whole exome sequencing (WES) were used to unravel the disease causing pathogenic variants. Pathogenic influence of the reported mutations were verified by using in silico protein modeling, molecular docking techniques and online tools. The identification of novel genes responsible for the monogenic disorders of ectoderm will not only help in bridging the existing gaps in accounting for phenotypic heterogeneity for these group of disorders and a step forward in functional annotation of human genome.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 20
Chapter 1 Introduction
More-over these findings may possibly unveil the undescribed molecular pathology. This study will also help to provide better care and treatment for patients who are suffering from this disabling condition.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 21
Chapter 2 Materials and Methods
Materials and Methods.
Study Authorization
The research work presented here comprises clinical and molecular characterization of human genetic disorders of ectodermal appendages. The Institutional Review Board (IRB) of Quaid-i-Azam University, Islamabad, Pakistan approved the presented research.
Recruitment of Families with Written Consents
Present study covers investigation of eighteen consanguineous families, originated from different ethnic backgrounds, and segregated disorders of ectodermal appendages. Families were recognized in remote regions in Punjab, Sindh, Baluchistan and Khyber Pakhtunkhwa provinces of the country. Family members and their legal guardians provided written informed consent for participation in the study.
Pedigree Construction and Clinical Inspection
Thorough family history and clinical information were obtained by visiting their settled areas. In order to approve the Mendelian inheritance pattern in families under study, their pedigree sketches were drawn. The elder members of each family were questioned about the disease onset, severity, relationship among the couple and parents of the partners. Pedigrees were designed following standards defined by (Bennett et al., 1995). The purpose of pedigree was to clarify the genetic relationships and inheritance pattern of the disorder among the family members. Circles and squares denote females and males while dual lines meant for consanguineous marriages. Correspondingly, the shaded squares and circles symbolize affected male and female members whereas colorless squares and circles represent the normal individuals. Inclined crossed lines over squares and circles indicate deceased members. Each generation is indicated by Roman numerals from top to bottom, while members and their position are denoted by Arabic numerals within each generation. Examination of affected participants in each family was done at local district hospital. Skin biopsies were obtained for histopathological studies from selected individuals by Dermatologists at the Dermatology Department, Military Hospital (MH) Rawalpindi.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 22
Chapter 2 Materials and Methods
Extraction of Genomic DNA
Both normal and affected participants of the families were subjected for blood sample collection in EDTA containing vacutainer tubes using 10 ml syringes (BD 0.8 mm X 38 mm 21 G X 11/2 TW). Collected blood samples were stored in refrigerator (4°C) and before DNA extraction blood was incubated at room temperature for one hour. Standard phenol chloroform method (Sambrook et al., 1989) was applied for genomic DNA extraction. Composition of Solutions Used in Genomic DNA Extraction Table 2.1: The compositions of solutions used in genomic DNA extraction
Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) is the most used method to amplify desired DNA sequences for several purposes like sequence analysis and restriction analysis.
Standard protocol
PCR in 12.5 μl volume (on ice, in this order): 7.75 μl PCR water, 1.25 μl 10X PCR buffer + MgCl2 (concentration = 1.5mM) 0.5 μl 25 mM MgCl2 (final concentration 2.5 mM), 0.25 μl dNTP mix (from work solution with each nucleotide 10 mM), 0.25 μl forward primer (from 10 μmol work solution), 0.25 μl reverse primer (from 10 μmol work solution), 0.25 μl Taq polymerase (Roche, 1 U/μl), 2.0 μl genomic DNA (25 ng/μl (total of 50 ng DNA).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 23
Chapter 2 Materials and Methods
PCR program
Regular PCR-program for fragments < 500 bp: 3 min 94°C, Melting 20 sec 94°C, Annealing 20 sec at Tann 35 cycles, Extension 30 sec 72°C, 6 min 72°C, ∞ 16°C.
Touch Down PCR-program for fragments < 500bp: 3 min 94°C, Melting 20 sec 94°C, Annealing 20 sec at Tann+6°C 12 cycles (-0.5°C/cycle), Extension 30 sec 72°C, Melting 20 sec 94°C, Annealing 20 sec at Tann 23 cycles, Extension 30 sec 72°C, 6 min 72°C, ∞ 16°C. PCR amplified products were stored at -20oC for future experiments
PCR Optimization
1. No bands: Lowering the annealing temperature and/or increasing the MgCl2 concentration will decrease specificity of the PCR and thus increase the amount of PCR product.
2. Too many bands: Increasing the temperature or lowering the MgCl2 concentration will increase specificity of the PCR and thus reduce the amount of PCR product and side products.
Linkage Analysis to Known Loci
To find Homozygosity of any known gene for hereditary skin and hair disorders in the selected three families, linkage analysis was performed with highly polymorphic microsatellite markers (Invitrogen Genelink, USA) flanking the known autosomal recessive genes/loci. At least five microsatellite markers were used for each loci associated with gene responsible for hereditary ectodermal disorders. The genetic map distance of microsatellite markers was obtained from recommended source (Matise.et.al., 2007). After establishing a promising known linkage, corresponding gene were sequenced to figure out causative variants for disease phenotype.
Gel Electrophoesis
Agarose Gel Electrophoresis
Agarose gel of total volume 50ml was prepared by using 5ml 10X TBE buffer in 45ml of distilled water. Mixture was poured in 100 ml conical flask containing 0.5g of agarose in it. Microwave was used to melt all the contents unto transparent solution by heating for 1-
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 24
Chapter 2 Materials and Methods
2 minutes. In order to stain the DNA 5 μl of 10g/ml ethidium bromide was added into mixture. Gel mixture was poured into gel casting tray and left for 10 minutes to solidify. After solidification gel was shifted into electrophoresis tank containing 1 X running buffer in it. Prior to add the DNA samples into the gel, DNA was mixed with equal volume of loading dye (0.25% bromophenol blue with 40% sucrose). The electrophoresis was performed at 120 Volts for 20-30 minutes.
Composition of Solutions Used in Agarose Gel Preparation
Table 2.2: The compositions of solutions used in agarose gel
Polyacrylamide Gel Electrophoresis (PAGE) PCR amplified DNA was resolved on 8% non-denaturing polyacrylamide gel prepared by using the following chemicals listed in the table 2.3. Table 2.3: Polyacrylamide Gel Composition
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 25
Chapter 2 Materials and Methods
Genome Scan via SNP DNA Microarray
The panel comprises 6,008 SNP markers evenly dispersed throughout the genome. The high-resolution STR genetic deCODE map and a linear interpolation using NCBI build 35physical map position has been used for determining the genetic map position of each SNP in the panel . The 488 Kb (0.62 cM) and 315 Kb (0.38 cM) mean and median intervals were present between the markers. Illumina Nextera rapid enrichment kit was used to prepare libraries for whole exome sequencing.
Exome Sequencing and Data Interpretation
To focus next-generation sequencing workflow on crucial genomic regions of interest, while reducing costs per sample: Agilent's SureSelect platform was used, by using dedicated oligo libraries. Protocols and kits have been optimized for in-solution work, to target and enrich the human exome. The kit targets approximately 50 Mb of exon- sequences with 3 µg gDNA as input. Overnight hybridization enables faster time to results. The platform is automatable and scalable to enable high-througput sequencing. If needed custom libraries can be created for target enrichment applications.
To annotate Variants, the in-house established software suite was used, which makes use of the Alamut (http://www.interactive-biosoftware.com/software/alamut/overview). According to the disease prevalence and availability of reference population, an allele frequency <1% and 0.001% were applied for NGS data filtration in the respected families.
To limit the number of potential variants following basic variables were applied:
Table 2.4: List of variable applied for screening exome variants
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 26
Chapter 2 Materials and Methods
RNA Extraction and cDNA Synthesis
3 mL of fresh blood samples were taken in tubes (RNA Tempus; Applied Biosystems, Foster City, CA, USA) for RNA extraction through commercially provided kit. To remove traces of genomic DNA present during RNA preparation, 10 X DNase (New England Biolabs, Ipswich, MA, USA containing 100 mmol/L Tris-HCl (pH 7.5), 25 mmol/L MgCl2 and 1 mmol/L CaCl2 was applied. Total RNA was then processed for cDNA synthesis by reverse transcription (RT)-PCR reaction using Taq Man® Pre Amp Master Mix Kit (Applied Biosystems) in accord with the manufacturer’s instruction. RT-PCR-amplified products were resolved on 2.5% denaturing agarose gels.
For studying skin diseases, the most suitable tissue for RNA extraction is skin obtained through skin biopsy. But after refusal to provide biopsies by family members, blood was used for extraction of RNA and cDNA synthesis for the genes expressing in the both blood and the skin. However genes causing skin disorders but lack expression in blood cannot be characterized using RNA from blood.
Protein Modeling and Molecular Docking Secondary structure of wild type and mutated peptide was evaluated using PSIPRED protein sequence analysis workbench (Buchan et al., 2013). 3D structure prediction of peptide was accomplished through ab-initio approach using multi-threaded server MUSTER and refined through KoBaMIN server. Peptide structural validation was performed through Molprobitiy, Rampage (http://mordred.bioc.cam.ac.uk/~rapper/rampage.php) and Errat servers (Colovos et al., 1993). 3D structure of RNA sequence was modeled using RNA Composer (http://rnacomposer.cs.put.poznan.pl). IRE Site (http://iresite.org/ database of experimentally known IRE sites) was employed to annotate the functional. Peptide-RNA docking studies were performed through PatchDock server (Schneidman-Duhovny et al., 2005). PatchDock provides structural flexibility at side chain level and also employs ab- initio docking protocols (Wallace et al., 1995). Best docked conformations were analyzed through LigPlot and UCSF Chimera (Pettersen et al., 2004), whereas intermolecular energy calculations were performed by SITEHOUND (Hernandez et al., 2009).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 27
Chapter 2 Materials and Methods
Table. 2.5: Primers designed to sequence the coding exons of LIPH gene Exon Gene Primer Sequence 5’→3’ Product Tm (OC) No. Size (bp) 1 LIPH_1F CTATGGACTTAAGTTCACCG 332 52.1 LIPH_1R CTATGGACTTAAGTTCACCG 52.3 2 LIPH_2F TAGAACAGCACTCTTGCTTG 528 53.9 LIPH_2R GCTCACTGTAGCTATCTCTTG 53.6 3 LIPH_3F CTCCAAAGTCAACAGCCAGG 326 54.8 LIPH_3R TAGAACAGCACTCTTGCTTC 54.2 4 LIPH_4F CTATGGACTTAAGTTCACCG 278 55.6 LIPH_4R TAGAGGAACCTGATCTGCTC 55.9 5 LIPH_5F CTATGGACTTAAGTTCACCC 315 54.8 LIPH_5R TCGTCTCAAACTCCTGACCTC 53.0 6 LIPH_6F ATACACTGAAAGAGCGCAGG 432 54.0 LIPH_6R GGATTACAGGCATGAGCCAC 54.1 7 LIPH_7F CTCTCAGAAGTGGTGGATAC 327 56.6 LIPH_7R TCCAGCTCCAAAGTTGATGC 55.7 8 LIPH_8F CTTTGCAGAGAAACCAGAGAG 388 58.4 LIPH_8R CAACTAAGCAATAGTTCCCC 57.9 9 LIPH_9F TACCAGTGACTTGCAGGCTTC 376 55.0 LIPH_9R CCATCATGTCCCTCATTGTG 54.9 10 LIPH_10F TGGGATTACAGGCATGAGTC 394 53.4 LIPH_10R ATGTGACATCCATAGGACGC 54.1
Table. 2.6: Primers designed to sequence the coding exons of HR gene Exon Gene Primer Sequence 5’→3’ Product Tm (OC) No. Size (bp) 2-1 HR_2-1F GCCTTACTGGTTTGAGCTGC 548 58.1 HR_2-1R TGAGATGGCCACCACTATGC 58.3
Continued…
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 28
Chapter 2 Materials and Methods
2-2 HR_2-2F TCCTGAGCACCCCAGACTCC 614 59.9 HR_2-2R CTTGGGGTTGACTGTGGGGC 61.6 3-1 HR_3-1F GAGGGCTTCAGTATTCTCCC 494 61.8 HR_3-1R AGTGGGTGGGTAGGATGAAC 60.2 3-2 HR_3-2F GAATCCTTGCCCGCTCTTCC 757 59.6 HR_3-2R CTGAGGAACTCCCAGAGAGC 59.9 4 HR_4F CATCCTCAGACTCCCTGCTC 474 59.8 HR_4R TGGCTGTGTCTTCCTCCTGC 58.0 5 HR_5F CTGCCACTCTCAGCAAGTGC 393 61.0 HR_5R C CTTAGGTCTAGGAGCTGGC 60.1 6 HR_6F CTCTCCATGGAAGCTGCTCC 360 57.6 HR_6R GCCAACGAATGACCACAGGC 58.7 7 HR_7F GCTGTGTCTCTATGTGACCC 393 60.4 HR_7R GGTGGTGAGTGTAGACCAAC 61.9 8 HR_8F AGCTTCCCGTCTGATTGTCC 370 61.0 HR_8R GGGAATTAGCCTGATCCCAC 59.9 9 HR_9F GTAGAAGTCCATGAGCAAC 430 60.4 HR_9R AAGGTGTTTGGAGGCATGTC 60.1 10 HR_10F GCAGGAAAAGCAGTAGAGC 358 58.5 HR_10R ATGTTGGTGATGCGGTCATC 58.7 11 HR_11F AGCGAATACACATGGCCTTC 529 60.2 HR_11R TAAGGGCAGTAGAACAGCTC 60.5 12 HR_12F TCCCCGAGCTGTTCTACTGC 430 58.1 HR_12R ACAGGAGGAGACAGAACGGC 60.8 13 HR_13F AGCGTAAGTGTCCCCAACAC 339 61.2 HR_13R ACATGAGAGTACCAGGGACC 59.5 14 HR_14F CCTGGTACTCTCATGTTTGC 337 61.2 HR_14R TGGAATCAGAGAAGCGCTTC 59.5 15 HR_15F ACTCCTGACCTCAGGTGATC 358 61.2 HR_15R TCCAGGCCTGAAAGGAAGTC 59.5
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 29
Chapter 2 Materials and Methods
16 HR_16F TCAGCATCCTGGTGCATGCC 400 61.2 HR_16R TTGGGTCTGTGCAGCTCACC 59.5 17 HR_17F CTGCCCTTCAAGACTTGACC 465 61.2 HR_17R CTCAGTGACTTCAAGGCCTC 59.5 18 HR_18F GAATCTGCTCTCTGAGAGCC 347 61.2 HR_18R AGGGTGGGATCTGCTATGTC 59.5 19 HR_19F CTGGGATTACAGGTGTGAGC 377 61.2 HR_19R AGATCTTTTGGCAGGAGGGC 59.5
Table. 2.7: Primers designed to sequence the coding exons of U2HR region. No. Gene Primer Sequence 5’→3’ Product Tm (OC) Size (bp) 1 U2HR-F GCACCCGCTGGCTAGC 225 60.5 U2HR-R CCCGCTTCCTCTGCTCA 59.8
Table. 2.8: Primers designed to sequence the coding exons of DSG4 gene Exon Gene Primer Sequence 5’→3’ Product Tm (OC) No. Size (bp) 2 DSG4_2F GTATCCCAACCTGCTGTAGA 708 55.0 DSG4_2R GAGATAGAGGACAGCAGCT 52.3 3 DSG4_3F CTCACACTGTAAGACACCTG 236 59.2 DSG4_3R AGCAGTGAAGCCTGCAAAT 58.4 4 DSG4_4F TGGTAAAGAAACCCACTCCC 362 57.2 DSG4_4R TTTGGGTTCAGTCTGCCATG 57. 0 5-6 DSG4_5-6F CTACAGTCTGAATTCACTGG 353 58.4
Continued…
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 30
Chapter 2 Materials and Methods
DSG4_5-6R CAAGTGTGGCTTTTTCTGTC 58.7 7 DSG4_7F AATTCAGGAGAAGGCCAAC 751 57.1 DSG4_7R TCCACACATAGGACAGAAC 58.6 8 DSG4_8F TCTCCTGATTGGACTATGGG 377 58.1 DSG4_8R GCAGATTCTGTCTCTAAGG 57.5 9 DSG4_9F AACAGCGTATCTCCTGGACC 650 58.0 DSG4_9R GGTAGAACAAACTGGCCAC 59.9 10 DSG4_10F GTTTCGCACATTGTAGCTG 342 59.0 DSG4_10R AAGGTGTTTAGGGCTTTCC 57.0 11 DSG4_11F CTACAAGTTCCATGGCATC 405 61.2 DSG4_11R GCAAGAACTGTGGAAACAG 59.4 12 DSG4_12F CCCACCAAGGAATTTCCAT 409 57.0 DSG4_12R CATGAACCTAACCATCCCA 56.9 13-14 DSG4_13-14F TGACTTCCTAAACCGAGCA 520 55.0 DSG4_13-14R CCAAAGAGACTGACAGACT 57.0 15 DSG4_15F CAGCGCTGTTAAACCAACA 313 55.2 DSG4_15R GGCCTACTACCATTGTGAG 54.4
Table. 2.9: Primers designed to sequence the coding exons of PLCD1 gene No. Gene Primer Sequence 5’→3’ Product Tm (OC) Size (bp) 1 PLCD-1F GAGCAGAGGGTGTTGTGAGC 398 62.6 PLCD-1R GTCCAATTAAAGGCTCCAAGG 62.9
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 31
Chapter 2 Materials and Methods
Table. 2.10: Primers designed to sequence the coding exons of HOXC13 gene. Exon Gene Primer Sequence 5’→3’ Product Tm (OC) No. Size (bp) 1 HOXC13-1F1 ATGCGTAGAGGGAATGTAGG 450 56.8 HOXC13-1R1 GAGCAGAGGGTGTTGTGAGC 59.0 1 HOXC13-1F2 GTCCAATTAAAGGCTCCAAGG 750 60.7 HOXC13-1R2 GCGCTCGGGTCCCTTCCTTA 62.9 2 HOXC13-2F1 GAGCAGAGGGTGTTGTGACC 495 55.5 HOXC13-2R1 GTCCAATTAAAGGCTCCCCG 54.8
Table. 2.11: Primers designed to sequence the coding exons of GJB6 gene No. Gene Primer Sequence 5’→3’ Product Tm (OC) Size (bp) 1 GJB6-1F GACCCCTCTATCCGAACCTTCT 360 59.5 GJB6-1R GGGTGTCAACAAACACTCCA 59.4
Table. 2.12: Primers designed to sequence the coding exons of FERMT1 gene No. Gene Primer Sequence 5’→3’ Product Tm (OC) Size (bp) 1 FRMT1_Ex2F CTCTGCAAGTCTACTGACAAGTC 390 59.5 FRMT1_Ex2R TTAGTGGTGATGCACCAGAC 59.4 2 FRMT1_Ex13F AGCTAACAGGGTGATCACAG 368 59.5 FRMT1_Ex13R AGCCCAAAGTGTCAGGACT 59.4
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 32
Chapter 2 Materials and Methods
Table. 2.13: Primers designed to sequence the coding exons of EXPH5 gene No. Gene Primer Sequence 5’→3’ Product Tm (OC) Size (bp) 1 EXPH5_1F GTAGGCTCAGGGAACAGTGG 347 59.7 EXPH5_1R AGTCTGCAGTCTGAACCAAGAG 59.4 2 EXPH5_2F TCTTCCAGTTGAGGCATGTG 346 59.6 EXPH5_2R CCTTGCCAAGAAAATCAAGC 59.5
Table. 2.14: Primers designed to sequence the coding exons of XRCC5 gene No. Gene name Sequence 5’→3’ Product Tm (OC) Size (bp) 1 XRCC5_1F AAGGGGCAGTCATCTGATTC 347 59.7 XRCC5_1R GCAACATTAACCCCCAGACT 59.4
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 33
Chapter 3 Isolated Hereditary Hypotrichosis
Isolated Hereditary Hypotrichosis.
Genetic mutations in any of the crucial player of hair morphogenesis and hair growth cycle can lead to various congenital hair abnormalities. Hypotrichosis (HYPT) is a dynamic term representing group of hair abnormalities including sparse to complete absence of hairs from different parts of the body, patchy hair loss especially on scalp, tightly curled or woolly hair phenotype and complete hair loss (Alopecia) (Mehmood et al., 2015a). Affected hairs are normally short, weak, less dense and deficient in normal hair pigment. Various associated anomalies are reported like skin problems at affected areas showing redness (erythema), missing patches of skin (erosions), itchiness (pruritus) and development of bumps near hair follicles designated as hyperkeratotic follicular papules (Kljuic et al., 2003), which damages main structures (hair follicles) of hair growth (Shimomura et al., 2009).
Many genes have been reported and loci have been mapped for isolated hereditary hypotrichosis on different chromosomes (Basit et al., 2015). Localized autosomal recessive Hypotrichosis (LAH) is represented in different forms, LAH1 is mapped to chromosome: 18q12 caused by mutations in DSG4 gene (Kljuic et al., 2003), LAH2 is mapped to chromosome: 3q27.2 caused by mutations in LIPH gene. LAH3 is mapped to chromosome: 13q14 caused by mutations in LPAR6 gene (Shimomura et al., 2008; Pasternack et al., 2008; Azeem et al., 2008; Tariq et al., 2009), LAH4 and LAH5 are mapped to chromosome: 10q11.23-q22.3 and 7p22.3-p21.3 respectively, but genes responsible for producing these hypotrichosis phenotypes are still unknown (Naz et al., 2010; Basit et al., 2010; Basit et al., 2011a). Pathogenic mutations in the Hairless (HR) gene and its upstream open reading frame (U1HR, U2HR) are responsible for producing alopecia with papular lesions (APL) and Marie Unna hereditary hypotrichosis (MUHH) phenotypes, which can be inherited in autosomal recessive and dominant manner (Ahmad et al., 1998a; Cichon et al., 1998; Wen et al., 2009; Duzenli et al., 2009; Mehmood et al., 2016). Digenic autosomal recessive hypotrichosis is reported to be caused by CDH3 and an unknown gene on chromosome: 16q22.1 and 12q21.2-q22 respectively (Basit et al., 2010). Hypotrichosis Simplex of Scalp Type 1-4 (HSS1-4) is an outcome of mutations in the genes: APCDD1, CDSN, SNRPE and RPL21 mapped to chromosomes: 18p11.22,
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 34
Chapter 3 Isolated Hereditary Hypotrichosis
6p21.3, 1q32.1 and 13q12.2 inherited in autosomal dominant fashion (Shimomura et al., 2010a; Levy-Nissenbaum et al., 2003; Pasternack et al., 2013; Zhou et al., 2011). Several type II Keratin genes including keratin 71 and keratin 74 located at chromosome 12q13 are mapped to cause isolated hereditary hypotrichosis phenotypes (Shimomura et al., 2010b; Wasif et al., 2010; Fujimoto et al., 2012). Recently another novel locus has been mapped on chromosome 2q31.1–q32.2 exhibiting features of autosomal recessive hypotrichosis (Jan et al., 2015).
Seven consanguineous families, of Pakistani origin, demonstrating recessively inherited form of isolated hypotrichosis, have been studied and presented in this chapter. Genotyping and sequencing possible causative genes were applied to pursuit for potential genetic variants.
Family A
Family Recruitment and Clinical Investigation
Family A segregating a non-syndromic form of hypotrichosis in autosomal recessive pattern, was recruited from a rural area of Baluchistan province, Pakistan (Figure 3.1). The pedigree drawing showed a small four generations family with an affected male individual (IV-1). Affected member presented patchy hair loss of scalp, sparse woolly hairs on facial margins (eyebrows and eyelashes) and body. Papules were not seen (Figure. 3.2).
For genetic analysis, four individuals including a female (III-2) and three males including an affected male (III-1, IV-1, IV-2) were subjected for blood sampling.
Family B
Family Recruitment and Clinical Investigation
Family B, demonstrating four generation non-syndromic hypotrichosis, was sampled from Baluchistan province of Pakistan (Figure 3.3). At the time of study affected individuals had tightly curled, sparsely grown thin woolly hairs on scalp, which were light in color due to hypopigmentation (Figure 3.4). Sparse eyebrows and eyelashes were observed. Under light microscopy, hairs showed a monilethrix type of hair shaft
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 35
Chapter 3 Isolated Hereditary Hypotrichosis abnormality with multiple breaks at certain points (Figure. 3.5). Other ectodermal erections were normal. The affected individuals were in good overall health without any cardio and neuro anomalies.
Blood samples were taken from six individuals including two females (III-2, IV-4) and four males (III-1, IV-1, IV-2, IV-3) which were available for the study.
Genetic Characterization of Family A and B
Linkage to Known Genes
In accordance to clinical features observed in affected members in both the families (A, B), linkage was tested by typing microsatellite markers flanking three genes including LIPH on chromosome 3q26.33-q27.3, DSG4 on 18q12.1 and LPAR6 on 13q14.2. Genotyping data and haplotype analysis established a linkage to LIPH gene on Chr: 3q26.33 in both the families.
Sequencing LIPH Gene
Following the linkage, the sequence results of the gene LIPH in affected individuals of the family A revealed a novel non-sense mutation involving a C to T change at nucleotide position 328 (c.328C>T) resulting in the substitution of a codon for arginine, at amino acid position 110, with stop codon (p.Arg110*) (Figure 3.6). Screening of the LIPH gene in family B revealed another novel homozygous frameshift 1-bp deletion variant (c.932delC, p.Pro311Leufs*3) (Figure 3.7). Both the novel variants were excluded from panel of 200 ethnically match controlled individuals and these were not found in any available databases (Ensemble, HGMD, dbSNP, EVS, EXAC genome browser).
Family C
Family Recruitment and Clinical Investigation
The family belongs to district Dir, Khyber Pakhtunkhwa province of Pakistan. Four generation family (Figure 3.8) has eight individuals including one female (III-2) and seven males. Affected individuals showed typical features of thick wooly hair phenotype of hypotrichosis nature segregating in autosomal recessive manner. (Figure 3.9). All the affected individuals were clinically examined by an expert dermatologist at local district
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 36
Chapter 3 Isolated Hereditary Hypotrichosis hospital. Age of the patients appeared between five to fifteen years. Hairs on scalp were very thick woolly, rough in texture, which were easily broken. Other anomalies including neurological, cardiac and ectodermal disorders other than hair were not seen.
Blood samples were taken from six participants including three unaffected (III-2, III-3, IV-4) available for the study.
Genetic Characterization of Family C
Linkage to Known Genes and Loci
In family C, as per recommended methods, initially linkage analysis was performed using polymorphic microsatellite markers flanking the previously reported genes involved in causing hypotrichosis/Wooly hair (WH) phenotype. All the previously reported genes were tested. Haplotype analysis (not shown) in the family unsuccessful to establish linkage to aforementioned genes.
Whole Genome Scan
After failing to establish linkage to all known genes, human genome was scanned to search for the disease causing gene. Depending on quantity and quality of DNA available, three affected and two unaffected participants were processed to human genome scan. The panel comprises 6,008 SNP markers evenly dispersed throughout the genome. The high-resolution STR genetic deCODE map and a linear interpolation using NCBI build 35physical map position has been used for determining the genetic map position of each SNP in the panel . SNP based genome scan identified two major homozygous regions on chromosome 1 (Chr1: 235766913- 246363125/ rS16832720- rS10924544), chromosome 5 (Chr5:115975127-133844545/ rs17140254- rs4997055). For profound evaluation of these mapped LOH regions, two affected individuals (IV-2, IV-3) of family C were decided to proceed for whole exome sequencing.
Whole Exome Sequencing
Exome sequencing, using DNA of two affected individuals (IV-2, IV-3), was performed. To focus next-generation sequencing workflow on crucial genomic regions of interest, while reducing costs per sample: Agilent's SureSelect platform was used, by using dedicated oligo libraries. The platform is automatable and scalable to enable high-
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 37
Chapter 3 Isolated Hereditary Hypotrichosis througput sequencing. More specifically, the analysis viewed for candidate variants present in homozygous state in IV-2 ans IV-3 supposing at least a partially common genetic cause of isolated hypotrichosis in both affected participants, only variants located within genes (exonic and intronic) or promoter regions were considered. Furthermore, some quality parameters were taken into account based on pathogenic estimate by in- silico tools, which reduced the number of probable pathogenic sequence variant list into 5. These variants were selected by making sequencing data overlap studies of filtered variants in both affected individuals (IV-2, IV-3) preferably within the mapped LOH regions and further processed manually for segregation testing through Sanger’s sequencing. LYST gene (OMIM: 606897) was considered as strongest candidate as it was located within the mapped LOH region on chromosome 1 (Chr1: 235766913- 246363125). LYST is a lysosomal trafficking regulator gene shows strong expression in skin and mutations reported in LYST gene are responsible for causing pigmentary ailment of the skin. However LYST variant (c.10744A>T) was found in all members of the family C, which ruled out its pathogenic effects. Hence exome data was further explored for all the possible rare variant with strong expression in skin and related phenotype (Table. 3.1). However not a single sequence variant have shown segregation, conceding the disease phenotype in members of the family C.
Family D
Family Recruitment and Clinical Investigation
The family D (Figure 3.10) was large kindred, with multiple affected loops, representing autosomal recessive inheritance pattern of hypotrichosis, was ascertained from KPK province of the country. The family members, available for the study, were examined by an expert dermatologist serving local district hospital. Three affected individuals (V-1, VI-1, VI-3) in the family exhibited phenotypes characteristic of hypotrichosis with wooly hair (Figure 3.11). Severity of the disorder varied among the affected individuals of the family. The affected individuals had no family history of other associated anomalies.
Blood samples of four unaffected (IV-1, V-2, V-7, VI-2) and three affected participants (V-1, VI-1, VI-3) of the family were taken for genetic analysis.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 38
Chapter 3 Isolated Hereditary Hypotrichosis
Family E
Family Recruitment and Clinical Investigation
This family, segregating isolated form of hypotrichosis, was located in district Dir in KPK province of the country. The four generation family had 15 members including three affected (Figure 3.12). Pedigree illustrations of the family provided convincing evidence of an autosomal recessive mode of inheritance of the phenotype. In three members of the family, hypotrichosis condition was presented with patchy loss of hair on scalp and rest of the body (Figure 3.13). Sweating, teeth and nails structures were normal. All affected members were healthy, and physically and mentally active. Heterozygous carrier individuals in the family showed normal hair on scalp and other parts of the body and were indistinguishable from genetically normal members.
Three unaffected (III-2, IV-1, IV-2) and three affected members of the family provided blood samples for genetic studies.
Family F
Family Recruitment and Clinical Investigation
The family E (Figure 3.14), representing the most prevalent features of atrichia, was recruited from KPK province, Pakistan. An affected female (V-1) showed tuft of dry, dull and easily breakable hairs on scalp whereas her younger brother (V-2) were visible for depigmented, thin and fragile hairs on the scalp. The perfect hair loss on scalp, facial areas (eyebrows, eyelashes) and other body (axial, pubic) parts. Papular lesions were not observed, allied anomalies of other ectodermal appendages, intelligence and skeletal were not observed. However segregation of hearing loss was reported in family ancestors.
Genetic Characterization of Families D, E and F
All the three families (D, E, F) were subjected for finding linkage to the already reported genes for causing comparable phenotypes. This included (LIPH, LPAR6, HR, DSG4, DSC3) using 6-9 microsatellite markers. After constructing haplotypes of all the three families via genotyping, none of the family showed linkage to any of the genes/loci verified, assuming the participation of a novel gene in producing the three discrete
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 39
Chapter 3 Isolated Hereditary Hypotrichosis phenotypes in these families. Depending on availability of funds, further characterization of these three families by exome sequencing will be performed in the near future.
Family G
Family Recruitment and Clinical Investigation
The family G (Figure 3.16), featuring recessively inherited isolated hypotrichosis, was sampled from a village located in the Punjab province of Pakistan. Affected members (IV-1, IV-2), in the fourth generation, were born to phenotypically normal parents. The family pedigree drawing revealed a severe form of hair loss (atrichia) in the affected members (Figure 3.17). Atrichia is accompanied by sparse to absent facial (eyebrows, eyelashes) and body hairs. No connected defects of other ectodermal appendages, intelligence and skeletal were detected. Out of total six participants of the family, four normal and two affected (IV-1, IV-2) were acquired for genetic analysis.
Genetic Characterization of Family G
Linkage to Known Genes and Loci
As per recommended methods, in family G, initially linkage analysis was performed using polymorphic microsatellite markers flanking the previously reported genes involved in producing hypotrichosis phenotype. Haplotype analysis (not shown) in the family was unsuccessful to display linkage to any of the genes verified.
Whole Genome Sequencing
After failing to establish linkage to aforementioned genes, human genome was scanned to search for the disease causing gene. Depending on quantity and quality of DNA available, two affected and four unaffected individuals were subjected to human genome scan. Multiple homozygous stretches were mapped on distant chromosomes: Chr 2, 145 Mb to 169 Mb, Chr 2, 182-189 Mb, Chr 5, 32 Mb - 58 Mb, Chr 8, 18 -27 Mb, Chr 11, 105 - 111 Mb, Chr 12, 66 - 72 Mb, Chr 12, 118 -127 Mb and Chr 13, 26 - 37 Mb. For convenience and quick search for most suitable causative pathogenic variant, an affected individual (IV-1) was decided to refer for whole exome sequencing.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 40
Chapter 3 Isolated Hereditary Hypotrichosis
Exome Sequencing
Exome sequencing, using DNA of two affected individuals (IV-2, IV-3), was performed. To focus next-generation sequencing workflow on crucial genomic regions of interest, while reducing costs per sample: Agilent's SureSelect platform was used, by using dedicated oligo libraries. The platform is automatable and scalable to enable high- througput sequencing. Different filter variables according to described method were practical to search for potential candidate variants. Furthermore, some quality parameters were taken into account based on pathogenic estimate by in-silico tools, which reduced the number of probable pathogenic sequence variant list into 9, which were further explored through Sanger’s sequencing for segregation test. A novel compound heterozygous variant (Chr 11: 108381468 G>T, c.4766C>A, p.Ser1589Tyr and Chr 11: 108382959 G>T, c.3275C>A, p.Ala1092Glu) in EXPH5 gene was found, which was in accordance with the haplotype/disease observed in the members of the family G (Figure 3.18).
Discussion
The presented research in the chapter describes genetic characterization of seven consanguineous families segregating isolated hereditary hypotrichosis in autosomal recessive manner. The families originated from three major provinces of Pakistan (family A, B from Baluchistan, C-F from KPK and family G from Punjab). Affected members in the families showed features of at least one of the four types (LAH1, LAH2, LAH3, LAH4) of hypotrichosis. These features were similar to those previously reported by several groups (Jelani et al., 2008; Shimomura et al., 2008; Pasternack et al., 2008; Naz et al., 2010; Basit et al., 2010; Basit et al., 2011a). Affected participants of the both families (A, B) showed similar features of hypotrichosis including tightly curled, sparsely grown thin woolly hairs on scalp, and face. Scalp hairs were light in color due to hypopigmentation in affected individuals of family B. Whereas affected individuals in two other families (C, D) showed varying features of dark, thick curly woolly hairs on the scalp and the facial margins. However affected members of families (E, F, G) showed varying degree of patchy to complete hair loss of the scalp, eyebrows, eyelashes and on other parts of the body.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 41
Chapter 3 Isolated Hereditary Hypotrichosis
Linkage, using microsatellite markers, was established in two families (A, B) to previously known gene (LIPH). Other five families were unsuccessful to show linkage to any of the several known genes tested here. Two of the families (C, G) were subjected to human exome sequencing to search for the disease causing gene. However due to funds limitations and time constraints attempt was not made to further characterize three other families (D, E, F).
Sequence analysis of the gene LIPH revealed two novel mutations including a non-sense (p.Arg110*) in the family A (Figure 3.7) and a frameshift 1-bp deletion variant (p.Pro311Leufs*3) in the family B (Figure 3.8). Authenticity of the sequence variant (p.Pro311Leufs*3) was further validated using restriction enzymes and RT-PCR analysis using RNA template extracted from blood. Analysis showed absence of LIPH cDNA in three affected individuals in the family B. However, amplification of the LIPH RNA was observed in carriers and normal members (Figure 3.6). In addition, both the novel variants were not found in any available databases (Ensemble, HGMD, dbSNP, EVS, EXAC genome browser).
Previously, LIPH gene, encoding enzyme lipase H, was mapped to chromosome 3q27.3 (LAH2; MIM 604379). This acts as a lipid mediator for various biological reactions. Expression of LIPH is found along with LPAR6 as both are involved in the same molecular pathway (Shimomura et al., 2008). Its expression is notable in several tissues but strongly observed in the hair shaft cuticle, precortex, and prominently in the outer and inner root sheath (ORS, IRS) of hair follicles (Diribarne et al., 2012). To date, several disease causing mutations have been reported in the LIPH gene (Table 3.2).
The LIPH gene possesses 10 exons spanning 46.3Kb genomic region encoded 55Kdal protein encoded by exon 5-6, hinge region encoded by exon 6-7 and plate domain encoded by exon 8-9 (Roger and Laura, 2012). The novel mutation (p.Arg110*), identified in the family A, resulted in a premature termination codon in exon-2 of the gene, which may lead to either mRNA decay through NMD or in instability of the truncated protein with the deletion of all functional domains including three critical amino acids (ser154, asp178, his248) required for LIPH catalytic activity. A second novel pathogenic frameshift deletion mutation (c.932delC) in exon-7 of the LIPH gene,
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 42
Chapter 3 Isolated Hereditary Hypotrichosis identified in the family B, encodes hinge region of the protein. Hinge region is believed to be involved in making a link between N and C terminals of LIPH protein (Jin et al., 2002). Due to 1bp deletion in this region frameshift occurred, which lead to mismatch of base-pairs resulted in incomplete processing and disintegration of mRNA in affected individuals of family B. This frameshift probably caused hindrance to achieve functional conformation of LIPH made it vulnerable to proteasomes or impaired signaling connection was established between the alpha-helixes and beta-sheets of LIPH protein.
Despite of genotyping more than 400 microsatellite markers, linkage in rest of the five families (C, D, E, F and G) was not established. In the family C, SNP based genome scan identified two major homozygous regions on chromosome 1 (Chr1: 235766913- 246363125/ rS16832720-rS10924544) and chromosome 5 (Chr5:115975127-133844545/ rs17140254- rs4997055). These regions were explored specifically for the genes expressing in the human skin. For convenience gene panels containing all known genes with known skin expression and/or skin related function were used to found potential causative variants in the genes lying in the these homozygous regions. However, none of the tested variants was segregating according to disease phenotype.
In family G, whole genome scan was performed with SNP-based microarray chips, which was followed by scanning of derma gene’s variant through specially designed gene panels with expression profile in skin only. Genome scan identified eight major homozygous regions on different chromosomes: Chr 2, 145 Mb to 169 Mb, Chr 2, 182- 189 Mb, Chr 5, 32 Mb - 58 Mb, Chr 8, 18 -27 Mb, Chr 11, 105 - 111 Mb, Chr 12, 66 - 72 Mb, Chr 12, 118 -127 Mb and Chr 13, 26 - 37 Mb.
9 variants were filtered out after applying strict filters, and deliberated as 'new' variants. Genes in which these 9 variants are placed were then sequenced manually through sanger’s sequencing to validate the variant’s segregation through all the affected individuals of the family G. 7 variants present in all family members were not segregated according to family tree whereas the two potential variants filtered out of derma genes lead to the identification of a novel compound heterozygous variant in EXPH5 gene within the candidate region on chromosome 11 (Chr 11: 108381468 G>T, c.4766C>A, p.Ser1589Tyr and Chr 11: 108382959 G>T, c.3275C>A, p.Ala1092Glu). Sanger
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 43
Chapter 3 Isolated Hereditary Hypotrichosis sequencing validated the perfect co-segregation of both variants on distinct alleles in all affected participants, whereas all unaffected individuals were homozygous for wild-type allele (Figure 3.18). In addition, this novel variants were not found in any available databases (Ensemble, HGMD, dbSNP, EVS, EXAC genome browser). The gene EXPH5 (MIM 612878) encodes for the Slac2-b (also known as exophilin-5) protein. It is an effector proteins, which plays apparent role in intracellular vesicle trafficking (Ostrowski et al., 2010). Mutations in the EXPH5 gene have been reported in cases of skin fragility syndromes including epidermolysis bullosa of varying phenotypes. Clinical features associated with such syndromes had shown blisters on the skin due to sensitivity to minor traumas, scaly and fragile skin with pigmentary ailments. Slac2-b knockout mice models have shown that this protein plays crucial role in formation and maintenance of keratinocytes in making adhesions with lower epidermis by assembling complexes through series of protein-protein interactions along with cytoskeletal filaments
(McGrath et al., 2012). Keratinocytes are the specialized epithelial cells responsible for regulating and maintaining normal skin morphogenesis, melanocytes differentiation, normal skin pigment (melanin) formation as well as the hair follicle differentiation and proliferation. At molecular level, keratinocyte growth factors (KGF’s) and their receptors (KGFR) are the endogenous mediator for controlling normal epithelial keratinocytes development and homeostasis. KGF’s belongs to Fibroblast growth factors family and highly expressed in epidermal, sebaceous and hair follicular keratinocytes (Danilenko et al., 1995). Exophilin 5 (EXPH5) mutations in specific domains reported so far had shown characteristic destruction of keratinocytes with loss of cell adhesions formation leading to skin fragility syndromes. Moreover in our present findings we assumed that, mutations in EXPH5 specific domain can also lead to retarded hair follicle’s growth by reduced expression of KGF’s and KGFR at molecular level due to keratinocytes destruction ultimately ends up with alopecia, which is also supported by various mouse model experiments previously stated by Danilenko et al., 1995 and McGrath et al., 2012 and online available database like MGi (Mouse Genome informatics http/: www.informatics.jax.org). However depending on availability of funds experimental work will be performed in near future.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 44
Chapter 3 Isolated Hereditary Hypotrichosis
In summary, the present chapter of the dissertation represents description of various forms of isolated hereditary hypotrichosis in seven consanguineous families originated from different ethnic groups settled in Pakistan. The genetic mapping, SNP genotyping, exome and Sanger sequencing recognized two novel mutations in a previously reported gene LIPH and another potential novel compound heterozygous variant in the EXPH5 gene responsible for causing hereditary hair loss. Still there are four other families for which SNP genotyping and exome/Sanger sequencing are needed to find disease causing variants. The presented work not only expanded the spectrum of mutations responsible for isolated forms of hair loss disorders but also predicted that the published mutations (Table 3.2) are found with very low allele frequency (<1%), verifying their status of being pathogenic through deep evaluation study of 50 in-house exome data files of ethnically matched individuals. In addition, failure to establish linkage to known genes in four families indicated presence of undiscovered genes in the human genome causing hair loss phenotypes.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 45
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.1: Haplotype sketch of the family A segregating isolated hairloss. For each individual, haplotypes of the most closely linked microsatellite markers are shown below the symbol.
Figure 3.2: Clinical manifestations of an affected individual in family A. An affected individual (IV-1) showing patchy hair loss of scalp (A), thin, sparse woolly hairs on fronto-facial margins (B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 46
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.3: Haplotype sketch of the family B segregating isolated hairloss. For each individual, haplotypes of the most closely linked microsatellite markers are shown below the symbol.
Figure 3.4: Clinical manifestations of affected individuals in family B. Two affected individuals (IV-1) showing thin, sparse woolly hairs on fronto-facial margins (A) and (IV-2) showing sparse depigmented hairs of scalp (B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 47
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.5: Under light microscopy, hair shafts of an affected individual in family B show (A) irregular width, twisting, and irregular contour with (B) swelling (node), (C) constriction (internode), and (D) a clear break in the cortex.
Figure 3.6: Restriction enzyme (Bg1II) digestion analysis of exon-7 identified 3 DNA bands of 326bp, 173bp and 153bp in heterozygous carriers, 2 DNA bands of 173bp and 153bp in homozygous affected while unaffected and controls had a single DNA band of 326bp. (b) RT-PCR using mRNA template from carriers, normal and controls blood samples presented cDNA bands while it was not observed in 3 affected individuals of the family A.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 48
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.7: Sequence analysis of the LIPH gene. a: A novel non-sense mutation (c.328C>T, p.Arg110*) detected in the family A. Homozygous affected member (upper panel), heterozygous carrier (middle panel) and homozygous unaffected member (lower panel). Arrow in each panel indicates position of the mutation.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 49
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.8: Sequence analysis of the LIPH gene showing a novel frameshift 1bp deletion mutation (c.932delC, p.Pro311Leufs*3) detected in family B. Upper panel (a) represents nucleotide sequence in an affected member, middle panel (b) in a heterozygous carrier and lower panel (c) in an unaffected member. Panel d shows schematic representation of human LIPH structural and functional domains. Position of the mutant residue identified in the present family are shown in lower panel.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 50
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.9: Pedigree illustration of family C segregating thick woolly hair phenotype in autosomal recessive manner. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 3.10: Clinical manifestations of affected individuals in family C. An affected individual (IV-1) showing thick curly woolly hairs of the scalp, eyebrows and eyelashes (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 51
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.11: Pedigree illustration of family D segregating thick wooly hair phenotype in autosomal recessive manner. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 3.12: Clinical manifestations of two affected individuals in family D. Both affected individuals (V-1, VI-3) showing thick curly woolly hairs of the scalp and facial margins (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 52
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.13: Pedigree illustration of family E segregating patchy hair loss phenotype in autosomal recessive manner. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 3.14: Clinical manifestations of affected individuals in family E. Two affected individuals (IV-4, IV-5) showing sparse, patchy hair loss of the scalp (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 53
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.15: Pedigree illustration of family F segregating patchy to complete hair loss phenotype in autosomal recessive manner. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 3.16: Clinical manifestations of affected individual in family F. An affected female (V-1) showing patchy to complete hair loss of the scalp, eyebrows and eyelashes (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 54
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.17: Pedigree illustration of family G segregating complete hair loss phenotype in autosomal recessive manner. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 3.18: Clinical manifestations of affected individual in family G. An affected female (IV-1) showing complete hair loss of the scalp, eyebrows and eyelashes (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 55
Chapter 3 Isolated Hereditary Hypotrichosis
Figure 3.19: Sequencing analysis of the EXPH5 gene. a: A novel compound heterozygous variant (Chr: 11-108381468, G>T; p.Ser1589Tyr and Chr:11-108382959, G>T; p.Ala1092Glu) detected in the family G. Heterozygous affected members (upper panel), and homozygous unaffected members (lower panel). Arrow in each panel indicates position of the variant.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 56
Chapter 3 Isolated Hereditary Hypotrichosis
Table 3.1: List of filtered variants tested in family C Serial Chr Gene Gene Variant cDNA Exac no. no. component type AF homo 1 1 LYST Exonic Missense c.10744A>T 0 2 4 SMARCAD1 Exonic Missense c.854T>A 0 3 8 RECQL4 Exonic Missense c.1994A>T 0 4 15 SPRED1 Exonic Missense c.893A>C 0 5 18 COL17A1 Exonic Missense c.1511G>A 0
Table 3.2: List of LIPH mutations identified so far
Mutation Reference Nucleotide Consequence Exon Type Disease Protein change change Kazantseva et Deletion of 34 Ex4del 34 aa del 04 Inframe HT al., 2006 amino acids c.346_350del Ali et al., (2007) p.I116YfsX5 FS/PTC 02 FS HT ATATA
Shimomura et Ex7_8del Gross del FS/PTC 7, 8 Gross del WH al., 2009(a)
Jelani et al., c.659_660del WH/ p.I220RfsX29 FS/PTC 05 FS 2008 TA HT
Kamran-ul- Hassan Naqvi et c.682delT p.L228WfsX32 FS/PTC 05 FS HT al., 2009
a a Naz et al., 2009 c.2T > C p.M1T 01 missense HT Substitution a a Naz et al., 2009 c.322T > C p.W108R 02 missense HT Substitution Nahum et al., in-frame WH/ c.280_369dup p.G94_L123dup 30 aa Ins 02 2009 ins HT c.620_627del Horev et al., p.207_209del WH/ ACACTGAT FS/PTC 04 Del/ins 2009 DTDinsAPFLV HT insCTCCTTT Kalsoom et al., Intron Splice- IVS4-1G > C Exon 5 skipping FS/PTC HT 2010 04 site Ex7_8del, Shimomura et c.1303_1309d PTC/p.Val437- Del/Ins WH/ FS/PTC 07,0 8 al., 2009(b) upGAAAAC GlyfsX4 (comp) HT G Continued…
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 57
Chapter 3 Isolated Hereditary Hypotrichosis
p.Gln137HisfsX Pasternack et c.403_409dup, 1, Dup FS/PTC 02 HT al., 2009 c.280_369dup p.Gly94_Lys123 (Comp) dup
Shimomura et p.Asp209Glufs WH/ c.624delT FS/PTC 04 deletion al., 2009(a) X9 HT
Shimomura et c.736T > A, p.C246S, a a Missense WH/ 06 al., 2009(c) c.742C > A p.H248N Substitution (Comp) HT
a a WH/ Tariq et al.,2012 c.778A>T p.Arg260X 06 Nonsense Substitution HT Shinkuma et al., c.619G>C, p.Asp207His, a a Missense WH/ 04, 06 2012 c.742C>A p.His248Asn Substitution (Comp) HT Harada et al., a a WH/ c.736T > A p.Cys246Ser 06 Missense 2013 Substitution HT Yoshizawa et a a WH/ c.699C>G p.C233W 05 Missense al., 2013 Substitution HT c.460_461AG Hayashi R et al., p.Ser154Asp, a a Missense WH/ >GA, 03, 06 2014(a) p.His248Asn Substitution (Comp) HT c.742C>A Cys246Ser, Hayashi et al., c.736T>A, Missense WH/ p.Met328Serfs* FS/PTC 06, 07 2014(b) c.982+5G>T (Comp) HT 41 Mehmood et al., a a WH/ c.328C>T p.Arg110X 02 Missense 2015 Substitution HT Del/Ins, c.686delAins1 p.Asp229Glyfs* WH/ Ito et al., 2015 FS/PTC 05, 06 missense 8, c.736T>A 22, p.Cys246Ser HT (Comp) Mehmood et al., p.Pro311Leufs* WH/ c.932delC FS/PTC 07 deletion 2016 3 HT Splice/ Matsuo et al., c.417+1G>C, WH/ FS/ p.Cys246Ser FS/PTC 02, 06 missense 2016 c.736T>A HT (Comp)
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 58
Chapter 4 Atrichia with Papular Lesion
Atrichia with Papular Lesions.
There are several forms of alopecias, but the most severe form of alopecia leading to complete absence of all types of hairs is known as atrichia or alopecia with papular lesion (APL). Early defects in hairs morphogenesis are responsible for producing such severe phenotype, in which mutations in transcriptional regulators are reported to disturb whole differentiation/development program (Olivier and Maria, 2014). Atrichia is one of the characteristic forms of alopecia, which is diverse term used to present entire body hair loss (Ahmad et al., 1998). Atrichia is often evident with appearance of multiple follicular lesions on the scalp or keratin filled cysts or papules on facial margins and different parts of the body defined as APL (Mehmood et al., 2016). Phenotypes associated with APL include sparse to absence of eyebrows and eyelashes, loss of axillary, pubic and body hair where as other ectodermal constructions are not affected (Sprecher et al., 1999; Cichon et al., 2006). Hairless gene (HR) on chromosome: 8p21.3 has been marked as nuclear receptor co-repressor responsible for producing APL phenotype (Ahmad et al., 1999).
APL most frequently inherits in autosomal recessive fashion however it is also explained as associated phenotype with Marie Unna hereditary hypotrichosis (MUHH). This has distinctive type of hair loss pattern and inherits in an autosomal dominant manner, and was mapped to the same chromosomal region 8p21 where HR gene resides (Unna M, 1925; Van Steensel et al., 1999). Clinical features associated to MUHH include scarcity of hair especially on the scalp. At the time of birth, hairs are sparse to absent, that develop to stiff, wiry, twisted hair in early childhood and progress to alopecia at the time of puberty. Hair loss is most evident at vertex and scalp margins, which is suggestive pattern for androgenic alopecia (Cai et al., 2009). The hair-loss ranges from patchy to complete baldness.
Interestingly, mutations in HR and U2HR produce clinically distinct types of hair disorders suggesting that the particular genomic region/ domain mutated in each disorder have distinctive functional influence at the protein level. Moreover, either loss of functional mutations in U2HR or gain in function mutations in HR result in an amplified translation of the HR main open reading frame (ORF) producing APL phenotype (Wen et
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 59
Chapter 4 Atrichia with Papular Lesion al., 2009; Mehmood et al., 2017), suggesting that strict regulation of HR protein levels is crucial for normal hair development and maintenance.
Family H
Family Recruitment and Clinical Investigation
Family H segregating non-syndromic severe form of alopecia i.e. APL was recruited from a remote area in district Swat, KPK province of Pakistan (Figure 4.1). Conventionally rate of consanguineous marriages was high due to tribal preferences. Two affected brothers (IV-4, IV-5) were clinically examined by expert dermatologists at local district hospital. Both affected members were completely devoid of body hairs, eyebrows and eyelashes. At birth hairs were present on the scalp, but gradually within a couple of weeks all the hairs disappeared. Papules were detected on scalp and facial margins of the affected members of the family (Figure 4.2). Other ectodermal erections were normal. Blood samples were taken from seven participants including four females and three males (III-2, IV-4, IV-5) for genetic inference.
Family I
Family Recruitment and Clinical Investigation
The family I (Figure 4.3), demonstrating complete alopecia, was ascertained from KPK province, Pakistan. Four affected participants of the family exhibited characteristic features of Atrichia with papular lesions (Figure 4.4). Pedigree, built for the family I, revealed recessive mode of inheritance of the hair loss phenotype. Affected members showed complete absence of all types of body hairs. Papules were witnessed on scalp, face and other body parts of affected members (Figure 4.5). Both genders were equally affected. Other anomalies including neurological, cardiac and ectodermal disorders other than hair were not seen. For DNA analysis, blood samples were taken from seven members including three females (IV-1, V-3, V-5) and four males (III-2, V-1, V-2, V-4).
Family J
Family Recruitment and Clinical Investigation
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 60
Chapter 4 Atrichia with Papular Lesion
The four generation pedigree of family J (Figure 4.6), segregating APL in autosomal recessive manner, KPK province, Pakistan. Two pretentious brothers (IV-2, IV-3) showed distinguishing features of atrichia with equal penetrance of disorder (Figure 4.7). Hairs were observed on the scalp of affected members at the time of birth but afterwards they failed to grow. The perfect hair loss from all parts of the body including facial (eyebrows, eyelashes) and other hairs. Papular lesions were observed on facial margins of affected brothers. Associated anomalies were not observed. Blood of five normal and two affected members (IV-2, IV-3) were taken for the current study.
Genetic Characterization of Families H, I and J
Linkage to Hairless Gene
In accordance to observed phenotypes of the three families (H, I, J), hairless (HR) defected protein was considered as the most potential disease causing factor. Therefore, microsatellite markers (D8S280, D8S282, D8S560, D8S298, D8S1733, D8S1734), flanking the HR gene were typed using genomic DNA of both pretentious and normal members of the three families. As expected, linkage in the families was observed to the said gene (HR).
Sequencing HR Gene and its Upstream Open Reading Frames
To search for the underlying pathogenic variant, all 19 exons, splice sites and a regulatory regions (U1HR, U2HR) of the gene HR were sequenced for at least two affected and one unaffected member in each family. Once the sequence was identified, the same exon was amplified for rest of the members of the same family. The primers were designed from intronic sequences of each exon of HR gene which are listed in Table 2.6. The PCR- amplified products were then sequenced following Sanger Cycle Sequencing as described in Chapter-2. In family H, screening of the HR gene using dideoxy-chain termination sequencing revealed a novel non-sense mutation in exon 11.This involved a G to T change at nucleotide position 2541 (c. 2541G>T) resulting in replacement of a codon for amino acid tryptophan at position 847 with stop codon (p.Trp847*) (Figure 4.8)
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 61
Chapter 4 Atrichia with Papular Lesion
In two families, I and J, sequence study of the HR gene failed to reveal any pathogenic variant. Upstream open reading frame (U1HR, U2HR) from 5' to 3' were then sequenced which identified a novel variant in the U2HR ORF involving G>T change at nucleotide position 59 (c.59G>T). This change replaced arginine with leucine at amino acid position 20 of the U2HR peptide (p.Arg20Leu) (Figure 4.9a-c). This variant was present in homozygous form in the pretentious sibling and in heterozygous form in respective carriers in the two families. The segregation of the variant in the families was verified using PCR–RFLP assay, as normal restriction site (GCATC) for SfaN1 enzyme was aborted in mutant sequence (TCATC), which was verified by incubating PCR-amplified U2HR region (487bp) with type-II restriction endonuclease SfaN1. Heterozygous carriers have shown 3 bands (487bp, 377bp, and 110bp), homozygous affected have shown single band (487bp) and homozygous normal/controls have shown two bands (377bp, 110bp) on agarose gel respectively (Figure 4.9d). Both the novel variants p.Trp847* and p.Arg20Leu were also excluded from a group of 450 unrelated ethnically matched control persons. These variants were absent in all available databases (dbSNP, EVS, EXAC genome browser).
Discussion
The presented work displayed molecular characterization of three families segregating APL. The three consanguineous families (H, I, J) showed typical APL features including perfect hair loss on scalp, facial (eyebrows, eyelashes) and body (axial, pubic) hairs. Papular lesions were observed on facial margins of affected individuals. The topographies observed in these families were similar to those reported formerly by several groups (Ahmad et al., 1998; Ahmad et al., 1999; Kruse et al., 1999; Kim et al., 2007; Azeem et al., 2011; Wang et al., 2013; Mehmood et al., 2016). Abnormalities pertaining to nails, sweating, teeth, skeletal and intelligence were missing in the three families. Hairless is a putative zinc finger transcription factor due to the presence of single zinc finger domain composed of cysteine residues (Ahmad et al., 1998). The JmjC domain towards C terminus influences hairless protein to act like a co-repressor for chromatin remodeling. The 5′ untranslated region (5′‐UTR) of HR mRNA plays an important role in
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 62
Chapter 4 Atrichia with Papular Lesion translation regulation by persuading mRNA stability and translation efficiency. Genetic alterations (mutations and SNP’s) in the 5′‐UTR are associated with a number of human diseases. Such pathological aberrations disrupt the structural and functional motifs at the 5′‐UTR and cause diseases such as Marie Unna hereditary hypotrichosis (MUHH) (Nagy and Kinyo, 2012).
The novel nonsense mutation (p.Trp847*), identified in the family H, resides in RD2 domain which most probably would lead to synthesis of truncated protein without co- repressor and chromatin remodeling activity following by abrupt hair growth signaling and chromatin remodeling resulted in alopecia Universalis. To exclude non-polymorphic nature and to verify recessive mode of inheritance of the novel mutation identified in family H, sequence variant was examined in 450 ethnically matched control individuals using restriction enzymes SfaN1 (Waltham, MA, USA) analysis. This novel variant was not found in any available databases (Ensemble, HGMD, dbSNP, EVS, EXAC genome browser).
APL is an autosomal recessive genetic disorder resulted due to loss-of-function mutations in HR. Whereas, Marie Unna Hereditary Hypotrichosis MUHH (OMIM 146550) is an autosomal dominant form of genetic hair loss in which HR overexpression is observed. ORFs or whether some other hidden mechanism is responsible to generate this HR overexpression. The 5′‐UTR of HR gene contains four upstream open reading frames (uORFs) from 5' to 3' (U1HR, U2HR, U3HR,U4HR) but most of pathogenic variants are reported in U2HR thus suggesting that it modulates translational efficiency of the downstream HR gene. U2HR encodes 34 amino acid peptide which has inhibitory control on main HR physiological ORF, as most of the loss of functional mutations reported in U2HR are responsible to enhanced the translation of HR protein which resulted in an irregular transcription of series of the target genes leading to faulty Wnt signaling and abnormal hair follicle morphogenesis, which plays crucial role in development of MUHH (Ahmad et al., 1999; Kim et al., 2010; Li et al., 2014). Upstream open reading frames (uORFs) acts as a site for assembly and disassembly of ribosomes in uORFs and serves as a barrier translation initiation often causes hindrance for ribosomes in reaching the main ATG (Morris and Geballe, 2000; Scheper et al., 2007). In some cases, uORFs
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 63
Chapter 4 Atrichia with Papular Lesion expressed a short peptides which regulate downstream gene expression (Janzen et al., 2002).
Both families (I, J) were genotyped and linked to HR gene on chromosome 8p21. Mutation screening of exon and intron boundaries of HR gene was unsuccessful to identify any functional sequence variant. Sequence analysis of U2HR identified a novel homozygous missense mutation (c.59G>T, p.Arg20Leu) in all affected participants of both families (Figure 4.9) resulting in the replacement of amino acid arginine to leucine at position 20 inherited in autosomal recessive manner. Whereas, all previously missense heterozygous mutations were reported in codons 24-28 of U2HR, signifying the functional reputation of the conforming amino acid residues (Colovos and Yeates, 1993). This is the first homozygous recessive missense mutation reported in U2HR in Pakistani population.
Secondary and tertiary structures of U2HR peptide consist of an alpha helix with a loop tail (Figure 4.10). Additionally, normal and mutated residues were shown in the superimposed 3D coordinates. Internal Ribosome Entry Site (IRES) was found at 29-39 position of RNA. Table 4.1 showed the structural validation of wild-type and mutated U2HR. Normal and mutated U2HR peptides were docked against modeled RNA strand (Table 4.2) and bound complexes were depicted in (figure 4.11), respectively. It was observed that normal U2HR showed binding at the ribosomal binding site (A29C30C31C32C33C34C35U36C37U38G39). U2HR residues including MET1 - THR5, ALA8, GLN9, ALA17, VAL18, ARG20, ILE21, SER27, SER30 and ASN31 formed hydrogen bonds with RNA at G2, C3, C4, G18, A20, U38, G39, G40, A44 and C47 positions (Figure 4.12a). In case of mutated U2HR (p.Arg20Leu), binding position was completely shifted, slightly distant from IRES. As a consequence of mutation, SER7, LYS10, ARG13, PRO14, ILE15, VAL18, LEU20, GLU26, SER27, ASN31 residues of U2HR showed hydrogen bonding with G40, G45, C47, C48, G56, C57, G60 of RNA (Figure 4.13b).
At structural level, modeling analysis revealed a clear change in the ribosomal binding site (A29-G39) of U2HR peptide, resulting in an abnormal regulation of HR gene translation, leading to MUHH. In normal conditions, binding of U2HR occurred at
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 64
Chapter 4 Atrichia with Papular Lesion upstream ribosomal binding site of HR gene (U38 and G39 nucleotides of ribosomal binding site were occupied). However, as a consequence of loss-of-function mutation in U2HR, its binding was shifted to downstream (G45-G60) of ribosomal binding site, thus allowing the binding of ribosome and resulting in the increased translation of HR (Fig 4.12b) gene. Possibly, such alterations in the binding of U2HR peptide may induce translational disturbances of main ORF of HR, eventually leading to apparent change in hair phenotype.
In conclusion in family H, we have recognized a novel nonsense mutation (p.Trp847*) in the coding region of gene HR, and in families I and J, a first recessively inherited variant (c.59G>T, p.Arg20Leu) in U2HR region. This research will not only extended the mutation spectrum of the disease but also suggested that APL can also be caused by homozygous recessive missense mutation in U2HR region. Additionally a study of 50 in- house exome data files of ethnically matched individuals was performed. This predicted that the published mutations are found with very low allele frequency (<1%), validating status of these mutations as pathogenic.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 65
Chapter 4 Atrichia with Papular Lesion
Figure 4.1: Haplotype sketch of the family H segregating APL. For each individual, haplotypes of the most closely linked microsatellite markers are shown below the symbol.
Figure 4.2: Clinical manifestations of affected individuals in family H. Two affected individuals (IV-4, IV-5) showing complete hair loss (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 66
Chapter 4 Atrichia with Papular Lesion
Figure 4.3: Close up view of phenotypic appearance of numerous skin-colored papules on the facial surface in an affected member in the family H.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 67
Chapter 4 Atrichia with Papular Lesion
Figure 4.4: Haplotype sketch of the family I segregating APL. For each individual, haplotypes of the most closely linked microsatellite markers are shown below the symbol.
Figure 4.5: Clinical manifestations of affected individuals in family I. Two affected individuals (V-2, V-3) showing complete hair loss (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 68
Chapter 4 Atrichia with Papular Lesion
Figure 4.6: Haplotype sketch of the family J segregating APL. For each individual, haplotypes of the most closely linked microsatellite markers are shown below the symbol.
Figure 4.7: Clinical manifestations of affected individuals in family J. An affected individuals (IV-2) showing complete hair loss (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 69
Chapter 4 Atrichia with Papular Lesion
Figure 4.8: Sequence analysis of the HR gene showing a novel non-sense mutation (c. 2541G>T, p.Trp847*) detected in family H. Upper panel (a) represents nucleotide sequence in a homozygous affected member, middle panel (b) a heterozygous carrier and lower panel (c) a homozygous unaffected member
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 70
Chapter 4 Atrichia with Papular Lesion
Figure 4.9: Sequence analysis of the U2HR showing a novel homozygous missense variant (c.59G>T, p.Arg20Leu) in affected individuals in both the families (I, J). Upper panel (A) represents nucleotide sequence in an affected member, middle panel (B) in a heterozygous carrier and lower panel (C) in an unaffected member. (D) PCR-amplified U2HR region (487bp) digested with type-II restriction endonuclease SfaN1. Heterozygous carriers have shown 3 bands (487bp, 377bp, and 110bp), homozygous affected single band (487bp) and homozygous normal/controls two bands (377bp, 110bp). (E) Panel shows schematic representation of human HR gene structure and upstream open reading frame representing position of U2HR.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 71
Chapter 4 Atrichia with Papular Lesion
Figure 4.10: Predicted 3D structure of U2HR peptide. C, coil; H, helix.
Figure 4.11: Proposed mechanism of U2HR’s involvement in HR translational regulation. (A) Under normal conditions, ribosomal translational subunits (40S and 60S) disassemble after encoding U2HR (uORF) peptide. Binding of U2HR peptide to ribosomal binding site (RBS) of primary ORF inhibits the assemblage of translational apparatus, resulting in silencing of HR gene. (B) Mutated U2HR peptide binds slightly at distal position to RBS, allowing binding of the ribosomal subunits and increased translation of HR main ORF which may be causative for the disease phenotype.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 72
Chapter 4 Atrichia with Papular Lesion
Figure 4.12: Normal (A) and mutated (B) U2HR-RNA docking complexes. RNA strand is shown in green and U2HR peptide in pink.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 73
Chapter 4 Atrichia with Papular Lesion
Table 4.1: 3D structural validation of normal and mutated U2HR peptides.
Bad Bad Poor Core Allowed Disallowed Z- Errat backbone backbone Rotamers (%) (%) (%) score Score bonds (%) angles (%) (%) U2HR 94 6 0 0 <1 -1.41 <2 80 (normal) U2HR 94 6 0 0 <1 -1.62 0 92 (mutated)
Table 4.2: Docking analysis of normal and mutated U2HR peptide with single stranded
RNA.
Intermolecular energy Complexes Binding score (kcal/mol)
U2HR-RNA (normal) 12884 -296.48
U2HR-RNA (mutated) 15150 -201.33
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 74
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Ectodermal Dysplasia of Nail Phenotype
Ectodermal appendages (hair, nail, teeth, exocrine glands) acquired diverse structures and functions during human evolution, however they resemble a lot at embryonic level during development and morphogenesis (Panganiban et al., 1997). These structures are evolved to serve for variety of functions like feeding, locomotion, thermoregulation and other purposes. Nails are the specified miniorgan for protecting soft tissues at the distal ends of toe and hand digits.
Ectodermal dysplasia are the large group of heterogeneous congenital disorders of ectodermal structures in which one or more ectodermal appendages can be affected (Itin, 2014). Ectodermal dysplasia of the nail is an outcome of nail development and morphogenesis defects. It can be inherited as isolated deformity or associated with other anomalies and can be segregated in both autosomal recessive and dominant fashion.
Isolated nail dysplasia or nail disorder non-syndromic congenital (NDNC) are classified in ten different categories (NDNC1-10) according to disease phenotype and gene mapped for particular nail deformity. The most commonly mutated genes responsible for producing NDNC phenotype are: PLCD1, RSPO4, FZD6, COL7A and HPGD. For rest of the loci, genes are not still discovered (Strandskov 1939; Bumpers and Bishop, 1980; Bazex et al., 1990; Shimizu et al., 1999; Sehgal, 2007; Chishti et al., 2008; Farooq et al., 2012; Mir et al., 2012; Naz et al., 2012; Raza et al., 2013; Wasif et al., 2013). Koilonychia (spoon-shaped nails) is a rare form of non-syndromic congenital nail disorder as no locus or gene is mapped for this phenotype, only few universal cases have been reported so far (Hellier, 1950; Bergeson and Stone, 1967; Bumpers and Bishop, 1980).
In case of syndromic congenital ectodermal dysplasias abnormality of two or more ectodermal appendages is commonly observed, in which dysplasia of the nail is remarkably inherited along with hypotrichosis/hair deformity (pure hair and nail ED; Trichothiodystrophy; Monilethrix; Netherton syndrome), exocrine gland defects (anhidrotic/hypohidrotic ED), keratoderma (Clouston syndrome; Pychyonychia congenita), dental disorders (Odonto-onycho dental dysplasia; Witkop syndrome), intellectual disability, immunodeficiency (Human nude phenotype), musculoskeletal
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 75
Chapter 5 Ectodermal Dysplasia of Nail Phenotype deformities (Menkes Kinky hair syndrome), kidney abnormalities (Nail patella syndrome), cleft lip palate (Cleft lip palate syndrome) and skin fragility syndromes (Clouston, 1939; Hart, 1983; Judge et al., 1994; Richard et al., 1996; Mclntosh et al., 1997; McGrath et al., 1999; Stratigos et al., 2001; Richetta et al., 2001; Simmons et al., 2016).
Pure hair and nail ED is a rare heterogeneous genodermatoses of hair and nail, which are two physically distinct however embryonically similar ectodermal appendages. This genetic condition represents sparse to absence of hairs from the scalp and/or other parts of the body followed by mild to severe dysmorphic nails, without any other ectodermal appendages (teeth, sweat glands) disorder manifestation. Till now three loci have been mapped for PHNED phenotype. Autosomal recessively inherited ectodermal dysplasia 4 of pure hair/nail type (MIM 602032) was mapped to chromosome 12q13 caused by pathogenic mutations in the KRT85 gene (Calzavara-Pinton et al., 1991; Naeem et al., 2006; Shimomura et al., 2010). Ectodermal dysplasia 5 of hair/nail type (MIM 614927) was mapped to chromosome 10q24.32-q25.1 harboring an unknown gene responsible for producing PHNED (Rafiq et al., 2005). Ectodermal dysplasia 6 of hair/nail phenotype (MIM 614928) mapped to chromosome 17p12-q21.2 inherited in autosomal recessive manner (Naeem et al., 2006), however genes responsible for this phenotype are not yet discovered. Ectodermal dysplasia 9 of hair/nail phenotype (MIM 614931) was mapped to chromosome 12q13 harboring HOXC13 gene which is located in the vicinity of the type- II keratin cluster. Mutations in HOXC13 are responsible for causing pure hair and nail ED (Mehmood et al., 2017).
In the current chapter of the dissertation, three families presenting different types of nail dysplasias, segregating either in autosomal recessive or autosomal dominant pattern, were ascertained and investigated at clinical and molecular levels.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 76
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Family with Isolated Nail Dysplasia Family K
Family Recruitment and Clinical Investigation
A large four generation family K was found in a remote area of province Sindh, Pakistan. Traditionally family members prefer to marry within tribe leading to high rate of consanguinity. Pedigree structure is complex and suggestive of more chances of dominant mode of inheritance due to multiple affected individuals in each generation (Figure 5.1). Affected male and female participants underwent detailed clinical examinations at local district hospital. The patients had unique and very rare phenotype of isolated nail dysplasia. Abnormalities observed included spoon shaped, thick and highly dystrophic nail plate in both hands and toes (Figure 5.2). Progressive deterioration of the nails was reported. All the seven affected members had normal skin, hair and teeth. For genetic inference, three affected females (III-5, IV-6, IV-8) and four affected males of the family participated to give blood samples.
Genetic Characterization of Family K
Linkage Analysis to Known Genes
Initially, linkage in the family was tested to previously known genes triggering hereditary nail disorders. The candidate genes tested for linkage included phospholipase C, delta-1 (PLCD1) mapped on chromosome 3p21.3-p22, NAD+ dependent 15- hydroxyprostaglandin dehydrogenase (HPGD) on 4q32.3-q34.1, R-spondin family member 4 (RSPO4) on 20p13 and frizzled-6 (FZD6) on 8q22.3. Genotyping data and careful haplotype study was unsuccessful to show linkage of the family to aforementioned genes.
Sequencing PLCD1 gene
To unravel the disease causing variant all seven exons with in line sequences of exon- intron boundaries of PLCD1 were PCR amplified and sequenced according to protocol described in Materials and Methods (Chapter 2) of the present dissertation. However, sequencing was not successful for finding any potential sequence deviation, which could be responsible for the spoon-shaped nail phenotype.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 77
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Whole Exome Sequencing
Exome sequencing, using DNA of two affected individuals (IV-4, IV-6), was performed at Radboud University Medical Center for Genetics Nijmegen, Netherlands. Data produced negate the presence of any compound heterozygous sequence variants in the previously known genes. Furthermore, some quality parameters were considered based on pathogenic estimate by in-silico tools, which reduced the number of potential pathogenic sequence aberrations list into 6 (Table. 5.1). However the attempt made was unsuccessful for finding the causative variant responsible for the disease phenotype in members of the family K. Families with Pure Hair and Nail Ectodermal Dysplasia (PHNED)
Family L
Family Recruitment and Clinical Investigation
The family L, was inhabitant of Punjab province, Pakistan. The unaffected parents (I-1, I- 2, III-1, III-2, III-5, III-6) denied the autosomal dominant mode of inheritance in the present family (Figure 5.3). The four generation family, included eleven affected participants with clinical assessment was made on two affected individuals (IV-7, IV-8). Adult pretentious individuals have shown complete loss of all types of body hairs. Nails of both hand and toes were dysmorphic, with uneven appearance (Figure 5.4). Other anomalies including neurological, cardiac and ectodermal disorders other than hair were not seen.
Blood samples were taken from seven participants including five females and two (III-6, IV-7) males.
Genetic Characterization of Family L
Linkage Analysis to Known Genes
Based on clinical phenotypes of AR-PHNED observed in the affected participants of the family, linkage analysis was performed on previously reported genes and loci. Haplotype study revealed a strong linkage of the family at chromosome 12p11.1-q21 containing the type II keratin gene cluster. All the possible candidate genes in the linked region were
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 78
Chapter 5 Ectodermal Dysplasia of Nail Phenotype sequenced and found unsuccessful for predicting any disease causing variant in the Keratin genes.
Sequencing HOXC13 Gene for Family L
As the sequencing failed to identify any pathogenic variant in the coding region of the KRT genes, therefore genomic sequence of HOXC13 gene was explored. Initially, the Sequence analysis of the HOXC13 identified a novel nonsense variant (c.265C>T, p.Gln89*) (Figure 5.5). This variant was excluded from a panel of 250 unrelated ethnically matched control individuals. In addition, the variant (c.265C>T) was not found in all available databases (Alamut, Ensemble, HGMD, dbSNP, EVS, EXAC genome browser).
Family M
Family Recruitment and Clinical Investigation
Family M is a four generation consanguineous family recruited from the Khyber Pakhtunkhwa province, Pakistan. The family had fourteen members with eight members available for the present study. Pedigree construction revealed an obvious autosomal dominant form of nail dysplasia and complete alopecia in all affected individuals of the family with equal disease penetrance in both sexes (Figure 5.6). For detailed clinical investigation, affected members were examined at local government hospital Peshawar district in Khyber Pakhtunkhwa province. At the time of the study, ages of the patient ranged between 5-50 years. All the affected members account for severe hypotrichosis with complete absence of all types of the hairs on scalp, face and other body parts. Highly dysmorphic nails were seen in all affected individuals which were thick nails (onychauxis) and elongation of finger and toenails from the nail bed (hyponychia/onycholysis). Both the finger and toenails were hyperkeratotic and appeared black from the margins (Figure 5.7), which was remarkably different dysmorphic nail phenotype as observed in family L. No other associated abnormality including hyperkeratosis of the skin, mental retardation, hearing impairment were detected in affected member of the family. Blood samples were taken from eight members including five unhealthy and three healthy members (III-1, IV-1, IV-4).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 79
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Genetic Characterization of Family M
Linkage Analysis to Known Genes
Based on the clinical finding of AR-PHNED in the family, as per recommended methods, genotyping data and careful haplotype analysis failed to show linkage of the family to aforementioned genes. Whole Exome Sequencing
Exome sequencing, using DNA of two affected individuals (IV-4, IV-6), was performed at Radboud University Medical Center for Genetics Nijmegen, Netherlands some quality parameters were taken into account based on pathogenic estimate by in-silico tools, which reduced the number of probable pathogenic sequence alternation list into 15. These variants were selected by making sequencing data overlap studies of filtered variants in both affected individuals (IV-4, IV-6) and further processed manually for segregation testing through Sanger’s sequencing. However none of the homozygous variants were found in accordance with the disease phenotype.
Sequencing GJB6 Gene
Thus exome data was further explored for heterozygous variants, which lead to the identification of recurrent heterozygous, dominantly segregating variant (c.263C>T, p. A88V) in GJB6 gene responsible for causing Clouston syndrome having prominent defects of hair and nail phenotype. The recurrent mutation (c.263C>T, p. A88V) perfectly segregated along the pedigree haplotype (Figure 5.8).
Discussion
The first dermal signal of epithelium and mesenchymal contents interaction drives the hair and nail morphogenesis in much similar fashion at embryonic level. There are multiple signaling molecules that act as crucial player for hair and nail development and morphogenesis. Out of these too many players, HOX gene clusters attain a marked position in molecular signaling cascade for hair follicle development and morphogenesis. The present chapter emphases on clinical and molecular characterization of families segregating nail phenotype in autosomal recessive or dominant fashion. The three consanguineous families (K, L, M) were investigated, which originated from different
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 80
Chapter 5 Ectodermal Dysplasia of Nail Phenotype areas of major provinces (Sindh, Punjab, Khyber Pakhtunkhwa) of Pakistan. All the families were identified at their native areas and then examined by expert dermatologists at local district hospitals. Affected individuals in family K were diagnosed with isolated nail dysplasia of rare phenotype without any other ectodermal anomaly. Whereas affected individuals in two other families (L, M) were marked to carry pathophysiological condition of all body hairs and distinctive nail deformities. Similar features were reported previously by several groups (Naeem et al., 2006, 2007; Shimomura et al., 2010; Rasool et al., 2010; Lin et al., 2012, Farooq et al., 2013; Raykova et al., 2014; Ali et al., 2015). Affected individuals in family K showed a rare spoon-shaped nail deformity i-e koilonychia of both hands and toes, classified under NDNC2 (MIM 149300) nail dysplasia. Till now only cases are reported for such rare phenotype without any suspected genetic mapping (Hellier, 1950; Bergeson and Stone, 1967; Bumpers and Bishop, 1980). In the present study, an attempt was made to figure out causative pathogenic variant through whole exome sequencing but unfortunately could not found any convincing variant. As only splice junction sites and coding part of these genes were sequenced, the likelihood of incidence of efficient regulatory regions aberrations responsible for disease phenotype cannot be ignored. In the family L, affected individuals showed perfect hairloss from all parts of the body (Figure 5.4A, B). Nails were highly dysmorphic with black ridges, showed loss of luster and slightly concave from the middle representing koilonychia of both fingers and toenails (Figure 5.4C, D). Other ectodermal structures were normal. Interestingly, the same phenotypes were previously reported to be related with mutations in the KRT85 and HOXC13 genes on chromosome 12q13. Following candidate gene approach, haplotype and linkage analysis revealed strong linkage of the family to Chr: 12q13. Sequencing of the two genes identified a novel nonsense variant (p.Gln89*) in the HOXC13 (Figure 5.5). The variant is more likely to undergo nonsense-mediated RNA decay or predicted to produce truncated protein lacking essential DNA binding homeodomain (Fig. 2d). In either case this will disrupt a series of HOXC13 mediated signaling cascade leading to alterations in hair and nail morphogenesis. To date, six mutations including the one identified here have been reported in the HOXC13 gene (Table 5.2).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 81
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
In humans, there is a set of 39 homeobox genes, arranged in four genomic clusters of ~100 kb in length designated as HOX loci, which encode evolutionarily conserved transcription factors. Every cluster exist on different genetic locations i-e HOX A on chromosome 7p15.3, HOX B on chromosome 17p21.3, HOX C on chromosome 12q13.3 and HOX D on chromosome 2q31 respectively (Apiou et al., 1996). All of these genes are believed to be involved in regulating signaling events of hair and nail development and maintenance. HOXC13 in particular is crucial player of hair and nail growth and morphogenesis. The HOXC13 gene encodes for 330 a.a protein which possess highly conserved DNA binding homeodomain (258-318 a.a) (Ali et al., 2013). It acts as a transcriptional regulator of series of downstream target genes including keratins (KRT) and keratin associated proteins (KRTAP) in a tightly controlled fashion. Any disequilibrium (either over or down regulation) in HOXC13 expression may lead to severe keratin related abnormalities including hairloss and brittle hair and nail phenotypes (Awgulewitsch, 2003). HOXC13 mutant mice have also shown severe skin malformation, hairless phenotype, defects in nail, filiform papilla development and skeletal deformities (Apiou et al., 1996), which strongly suggests unique function of HOXC13 gene at distinct expression areas in mammalian body. In family M, exome sequencing lead to the identification of a heterozygous, dominantly segregating, recurrent variant (c.263C>T, p. Ala88Val) in GJB6 gene responsible for causing hidrotic ectodermal dysplasia/Clouston syndrome leading to prominent defects in hair and nail phenotypes. Hidrotic ectodermal dysplasia (HED, OMIM #129500) or Clouston syndrome (CS) is a rare autosomal dominant form of ectodermal dysplasia which embraces the key features of diffuse to complete alopecia of the scalp, missing eyebrows, eyelashes with marked nail dystrophy, which may followed by hyper pigmentation of the skin related to palmoplantar keratoderma (Clouston 1929; Lamartine et al., 2000; Smith et al., 2002; Spitz et al., 2005; Avshalumova et al., 2014). Functions of the sweat and sebaceous glands are found to be normal, hearing impairment or dental disorders are also not observed. However there is high variability in these phenotypes in Clouston syndrome even within the individuals of the same family (Hazen et al., 1980; Robinson et al., 1962;
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 82
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Hassesd et al., 1996; Tan et al., 2000). One of the genetic cause of Clouston syndrome is genetic aberration in gap junction protein product of the gene GJB6. The gene GJB6 is mapped to chromosome 13q11-q12, which resides in the cluster of Connexin genes, which encodes for the gap junction protein Connexin 30 (Cx30). There are 21 different Connexin proteins known to be found in humans, which plays crucial role in gap junctions buildup by making a connections between intracellular connexon (6 connexins oligomer) of neighboring cells (Goodenough et al., 1996; Unger et al., 1999;
Harris 2001; Willecke et al., 2002; Richard 2005). Gap junctions are cell-cell communication and channel proteins responsible for the diffusion or exchange of the ions/molecules between the adjacent cells. Each Connexin has shown cell specific expression and distinctive contribution to tissue morphogenesis, cell homeostasis, differentiation, cell growth, response to stimuli and channel permeability properties
(Elfgang et al., 1995; Kumar and Gilula, 1996; Yeager 1998; Kelsell et al., 2001; Essenfelder et al., 2004; Scott et al., 2012). Connexin30 like all other connexins, functions as an integral membrane protein which possess 4 transmembrane domains separated by 2 extracellular loops and 3 cytoplasmic loops (Figure 5.9). Genetic mutation in any of the central domain of Cx30 may lead to severe cell gap junction’s abnormalities including cells permeability loss for specific ions which may lead to serious genetic anomalies like hairloss from different parts of the body, nail defects or improper skin pigmentation with varying degree of severity of related pathophysiological conditions (Fujimoto et al., 2013; Liu et al., 2015). Till now four missense mutations (Cx30G11R, Cx30A88V, Cx30V37E and Cx30D50N) in GJB6 gene have been reported by several groups which are responsible causing HED/CS (Common et al., 2002; van Steensel et al.,
2004; Baris et al., 2008; Chen et al., 2010; Liu et al., 2015). GJB6 protein 3D modelling revealed that, there is no any interaction involved between Ala88 residue with surrounding residues of normal protein, while, in case of mutant protein, the substituted Val88 interact hydrophobically with Phe29 in nearby residues (Figure 5.10). The difference in hydrophobic interaction may cause alteration in protein folding and ultimately altered the protein function, which is responsible for triggering diseased phenotype. Up to our best knowledge, our present finding (Cx30, c.263C>T, p. Ala88Val)
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 83
Chapter 5 Ectodermal Dysplasia of Nail Phenotype in family N is the first case report of rare Clouston syndrome phenotype found in Pakistani population so far. In conclusion our present findings will expand spectrum of mutations in HOXC13 and GJB6 genes, which resulted in PHNED and Clouston syndrome, respectively. It will help to establish international network of clinicians, researchers and patients. It will also provide an insight to seekers of knowledge for a better understanding of genetic heterogeneity of ectodermal dysplasias of nail phenotype and also extends the preexisting human genomic database related to Asian population. More-over a study of 50 in-house exome data files of ethnically matched individuals specified that these published mutations (Table 5.2) were reported with very low allele frequency (<1%), indicating the mutations are highly likely to be pathogenic.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 84
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.1: Pedigree illustration of family K segregating koilonychia (spoon-shaped nails) phenotype. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 5.2: Clinical manifestations of affected individuals in family K. Affected individuals (IV-3, IV-4) showing thick and highly dystrophic nail plate in both hands and toes (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 85
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.3: Pedigree illustration of family L segregating pure hair and nail ectodermal dysplasia (PHNED) phenotype. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 86
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.4: Clinical manifestations of affected individuals in family L. Two affected individual (IV-7, IV-8) showing complete hair loss from scalp, eyebrows and eyelashes (A, B). Hair loss is accompanied by highly dystrophic nails in all digits of both hands and toes (C, D).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 87
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.5: Sequence analysis of the HOXC13 gene showing a novel non-sense mutation (c.265C>T, p.Gln89*) detected in family L. Upper panel (a) represents nucleotide sequence in a homozygous affected member, middle panel (b) a heterozygous carrier and lower panel (c) a homozygous unaffected member (d) Schematic representation of human HOXC13 structural and functional domains. Position of the mutant residues are shown in lower panel.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 88
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.6: Pedigree illustration of family M segregating hair and nail ectodermal dysplasia. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 5.7: Clinical manifestations of affected individuals in family M. Two affected individuals (IV-5, IV-6) showing complete hairloss from scalp, eyebrows and eyelashes. Hair loss is accompanied by highly dystrophic nails in all digits of both hands (A, B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 89
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.8: Sequence analysis of the GJB6 gene showing a recurrent missense mutation (c.263C>T, p.Ala88Val) detected in family M. Upper panel represents complimentary nucleotide sequence in a heterozygous affected member and lower panel represents a complimentary wild type sequence in homozygous unaffected member.
E1 and E2, extracellular loops; CL, cytoplasmic loop
Figure 5.9: Schematic representation of human GJB6 structural and functional domains. Position of the mutant residues are shown by yellow stars.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 90
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Figure 5.10: The three dimensional structure of GJB6. Close up view of interaction pattern of normal Ala88 residue (A) and mutant Val88 residue (B) with nearby Phe29 residue in the protein transmembrane loops.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 91
Chapter 5 Ectodermal Dysplasia of Nail Phenotype
Table 5.1: List of filtered variants tested in family K S. Chr Gene Gene Variant mRNA/ %age of Exac SNP no. no. component type protein Homo. AF Freq. 1 2 STK39 Exonic Missense 80>GGC 100% 0 0 /A27AA 2 7 AGAP Exonic Deletion 92TCT>/ 100% 0 0 VC31G 3 18 TAF4B Exonic Missense 2212C>G 100% 0 0 /Q738E 4 20 TLDC2 Exonic Missense 514G>A 100% 0 0 /G172S 5 21 PAXBP1 Exonic Missense 1700T>C/ 100% 0 0 I567T 6 6 GJA1 Exonic Frameshift 932delC/ 50% 0 0 A311fs
Table 5.2: List of mutations reported in the gene HOXC13 so far
Mutation cDNA Protein Effect Phenotype Reference Nonsense c.390C>A p.Tyr130* FS and PHNED Lin et al PTC Deletion 27.6 kb No protein FS and PHNED Lin et al PTC Deletion c.355delC p.Leu119Trpfs∗20 FS and PHNED Farooq et al PTC Nonsense c.404C>A p.Ser135* FS and PHNED Ali et al PTC Duplication c.200–203dupGCCA p.His68Glnfs*84 FS and PHNED Ali et al PTC Nonsense c.265C>T p.Gln89* FS and PHNED Mehmood S et al PTC Present study* FS, Frame shift; PTC, Premature termination codon; PHNED, Pure Hair and Nail Ectodermal Dysplasia
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 92
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Genetics of Ichthyosis and Kindler Syndrome
At the surface of the human’s body, skin is the prime organ system which provides barrier between external environment, body fluid and the systems inside (Elaine Fuchs, 2007). To provide dynamic protection and functions to the body, it gives rise to various structures and appendages which collectively built up the whole integumentary system (Leah and Mikkola, 2014). Deep inside the skin multiple molecular players (WNT, β- catenin, EGFR, FGF, SHH, NOTCH) play their crucial role to ensure its proper functioning. Any disequilibrium or improper working of any of these players can lead to various acquired or congenital skin disorders.
Ichthyosis is a universal scaling disorder often known as Mendelian disorders of cornification (MEDOC). It is clinically and etiologically enormously heterogeneous group (Takeichi and Akiyama, 2016). Clinically ichthyosis can be distinguished into associated and non-associated forms. Non-associated ichthyoses are further classified into common ichthyoses including ichthyosis vulgaris (IV), recessive X-linked ichthyosis (RXLI); autosomal recessive congenital ichthyosis (ARCI) and keratinopathic ichthyosis which is an outcome of mutations in keratin family genes (Oji et al., 2010).
The X-linked recessive ichthyosis is a sex biased disorder of cutaneous keratinization, which occur due to deficiency of microsomal enzyme steroid sulfatase, encoded by the STS gene located on chromosome Xp22.31 (Van Esch et al., 2005). (Williams et al., 1985; Griffith et al., 1998; Kelsell et al., 2005; Vahlquist et al., 2010; Sugiura et al., 2013; Radner et al., 2013; Wasio et al., 2014; Ali et al., 2015; Cottle et al., 2015; Sugiura et al., 2015; Sugiura and Akiyama 2015; Takeichi and Akiyama, 2016).
Recent chapter of dissertation defines study of five consanguineous families, presenting different forms of recessively inherited skin disorders. One of these families (family N) displayed topographies of recessive X-linked ichthyosis (XLI), while the other two (O and P) presented skin blistering which are characteristic feature of Kindler syndrome. Remaining two families (Q and R) showed different forms of autosomal recessive congenital ichthyosis.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 93
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Family N
Family Recruitment and Clinical Investigation
Family N, was identified in KPK province of the country. The family had two affected individuals (V-1, V-2) (Figure 6.1). Presence of scales and severe hyperkeratosis in all affected males of the family were clear indication of X-linked ichthyosis. Dark colored, thick, adherent scales were seen on facial margins, neck, thorax, abdomen and limbs of the affected males (Figure 6.2). Other associated abnormalities were not seen. The carrier females of the family were phenotypically normal.
For DNA extraction, blood samples were collected from two affected brothers (V-1, V-2) and four healthy individuals (IV-3, IV-4, V-3, V-4) of the family.
Genetic Characterization of Family N
Screening STS Gene and its Flanking Region
Comparative analysis of the specific genomic region on chromosome Xp22.3 was performed. The gross deletion of the STS along with neighboring region was predicted via amplification of exons between control and healthy subjects of the family. The marker sequencing intensely suggested an interstitial deletion of ~1.94 Mb flanked by VCX3A-dis and VCX2-prox, incorporating six reference sequence genes (VCX3A, HDHD1, STS, VCX, PNPLA4, VCX2) in the family. For clear evaluation of deleted region SNP genotyping was performed, SNP data interpretation finely manifest this deleted region to 1.67 Mb flanked between rs16984199 (6.51 Mb) and rs7888692 (8.18 Mb) (Figure 6.3).
Families O and P
Families’ Recruitment and Clinical Investigation
Family O, segregating non-syndromic form of ichthyosis in autosomal recessive pattern was recruited from rural area in Sindh province, Pakistan (Figure 6.4). The pedigree structure indicates a small four generations family (O) with three affected individuals (IV-2, IV-4, IV-5) (Figure 6.4). Whereas family P was recruited from Baluchistan province of Pakistan (Figure 6.6). Six affected individuals in families O (Figure 6.5) and
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 94
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
P (Figure 6.7) showed mild skin blistering mostly over joint regions, cutaneous atrophy, photosensitivity, random hypopigmentation & hyperpigmentation, and telangiectasia throughout the body, which was consistent with kindler syndrome phenotypes. However, the severity of the disease varied among affected individuals of the same family and on different places in the same patient. The irregular pigmentation, cutaneous atrophy and telangiectasia were reported to be progressive in affected members of both the families. While reduction in the number of blisters with increasing age was also noted. No associated abnormalities of other ectodermal appendages, intelligence and skeletal were not observed.
Family O: seven participants including four females (III-2, IV-2, IV-3, IV-4) and three males (III-1, IV-1, IV-5) gave blood samples.
Family P: In total six individuals including three affected ladies (IV-1, IV-2, V-2) provided blood samples for the genetic inference.
Genetic Characterization of Families O and P
Whole Genome Scan
The genome scan containing 2.44 M SNPs at mean and median intervals of 0.62 cM and 0.38 cM, respectively and spaced at 0.35 cM on the human genome was performed. The data generated was analyzed using Genome studio (Illumina, San Diego, CA, USAThe SNP mapviewer annotation 105 (www.ncbi.nim.gov/mapviewer) was used to determine physical and genetic map positions of each SNP. Using genome-wide genotypes from the family O, LOH mapping and linkage study identified 17.46-MB (0.63—17.52 MB) single homozygous region on chromosome 20p13-p12.1, with maximum multipoint LOD score of 2.65. While the analyses of family P revealed 3.25 MB (4.82—8.07 MB) single homozygous region on chromosome 20p13-p12.3, with maximum multipoint LOD score of 3.31. To infer the mapped LOH region, two affected participants (IV-4, IV-5) of family O were decided to proceed for whole exome sequencing.
Whole Exome Sequencing in Family O
Exome sequencing, using DNA of two affected individuals (IV-4, IV-5), was performed. Strict quality parameters were taken into account based on pathogenic prediction by in-
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 95
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome silico tools, revealed a novel homozygous deletion c.27_27delT (p.F9Lfs*23) in FERMT1 gene within the mapped homozygous region (Figure 6.8) followed by Sanger sequencing to confirm the segregation pattern of the variant reported in the family O. This variant was excluded from a panel of 250 unrelated ethnically matched control individuals. In addition, the variant c.27_27delT (p.F9Lfs*23) was not found in all available databases (Alamut, Ensemble, HGMD, dbSNP, EVS, EXAC genome browser).
Sequencing FERMT1 Gene in Family P
In family P, on the basis of phenotypes and homozygous region similarity with family O, the FERMT1 gene was directly sequenced by Sanger sequencing method. The Sanger sequencing recognized a homozygous splice site variant c.1718+2A>G in FERMT1 gene in family P (Figure 6.9), which was previously reported by Fassihi et al (2005). The co- segregation of the sequence variants with kindler syndrome were confirmed in all the available individuals in the both families O and P.
Family Q
Family Recruitment and Clinical Investigation
The family Q (Figure 6.10) with multiple affected individuals in fourth and fifth generation, segregating autosomal recessive form of ichthyosis, and belonged to Sindh province, Pakistan. The family had seven affected members (IV-6, IV-7, IV-8, V-1 V-9, V-10, V-11). Clinical assessment revealed dryness of the skin, scales of variable size (Figure 6.11).
In total twelve individuals including five affected (IV-6, IV-7, IV-8, V-1, V-9) provided blood samples for the present study.
A family with Congenital Ichthyosis and Hair Loss Syndrome
Family R
Family Recruitment and Clinical Investigation
The family R (Figure 6.12), demonstrating autosomal recessive form of ichthyosis concomitant with hypotrichosis (sparse hairs) was originated from district Gujarkhan, Punjab province, Pakistan. Severe clinical features were seen representing highly dry skin
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 96
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome along with uniform scaling on entire body (Figure 6.13). Ichthyosis associated features were not observed. Moreover, patients were normal for mental health. Blood samples were taken from eight individuals including six affected (IV-5, V-4, V-6, V-7, V-9, VI-3) and two unaffected (IV-4, V-10) participants. Genetic Characterization of Families Q and R Linkage Analysis to Known Genes and Loci and Whole Exome Sequencing
After excluding known genes in the family Q, whole genome homozygosity mapping was carried out using Illumina 2.5 M BeadChip array. Analysis of SNP data to detect LOH was conducted using GenomeStudio software, HomozygosityMapper and AutoSNP. Moreover, single homozygous region (LOH) was identified on chromosome 2- 212,483,500-216,116,200 (212-216 Mb) (Figure 6.14). In order to identify any causative variant residing within the mapped LOH region responsible for producing diseased skin phenotype in the affected individuals of the family Q, two affected participants (V-1, V- 9) were progressed through WES. Family R was also tested for linkage to the genes included (LIPH, LPAR6, HR, DSG4, DSC3) formerly reported for causing isolated hair loss phenotype. Linkage was found on chromosome 13 and subsequently sequencing of lysophosphatidic acid receptor-6 (LPAR6) lead to the identification of recurrent mutation (c.188A>T, p.Asp63Val) segregated in autosomal recessive fashion (Figure 6.15). Whereas, the resulting haplotypes failed to reveal linkage to the genes tested for isolated ichthyosis, implying a possible involvement of novel gene together with LPAR6 in causing the diseased skin and hair loss phenotypes. Whole Exome Sequencing in Families Q and R In family Q, within this mapped LOH region on chromosome 2-212,483,500- 216,116,200 (212-216 Mb), the strongest candidate gene ABCA12 was expected to be potentially mutated as it was previously reported to produce similar phenotypes of congenital ichthyosis as observed in the pretentious members of family Q. However strict filtering of exome data according to described protocol (Chapter 2: Materials and Methods) reduced the number of rare variants to 7, out of which two variants were marked under the coding sequence of ABCA12 gene. Additional investigation of these
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 97
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome variants in EXAC genome browser excluded out ABCA12 variants due to their high allele frequency, suggesting both the variants as polymorphisms tolerated by Asian population (Table 6.1). Therefore, indicating the involvement of any potential novel gene located in the vicinity of the ABCA12 responsible for producing the scaling of the skin. Hence rest of the rare variants were decided to examine manually through Sanger’s sequencing. In the family R, genotyping via microsatellite markers was unsuccessful for establishing linkage to known genes causing ichthyosis. Subsequently, exome sequencing was performed at the Radboud University Medical Center, Nijmegen Netherlands. The data generated from in-house pipe line (Hcdiff files) was analyzed by applying standard filtration steps designed for autosomal recessive phenotype (discussed in Materials and Methods) as per suggestive family pedigree. Data produced negate the presence of any compound heterozygous sequence variants in the previously known genes. Some quality parameters were taken into account based on pathogenic estimate by in-silico tools, which reduced the number of probable pathogenic sequence changes list into 9. However downstream investigation of these rare variants in EXAC genome browser excluded them from possible pathogenic variant list due to high allele frequency and tolerance by Asian population. Follow-up sequencing of two rare variants in the genes CYCL1 and MAGEA11 (due to their exponential expression in skin) were tested for segregation in the members of family R. However Sanger’s sequencing failed to show suitable segregation with the disease phenotype. Since regulatory sequences of all the filtered genes were not checked therefore chances of the presence of probable sequence alterations in such genomic regions cannot be ignored.
Discussion
The presented work designates study of the families segregating various forms of isolated and syndromic form of ectodermal dysplasias. The five consanguineous families were investigated, which originated from all four provinces of Pakistan. This included family N from KPK, family O and Q from Sindh, family P from Baluchistan and family R from Punjab. All the families were identified at their native areas and then examined by expert dermatologists at local district hospitals. After detailed examination and pedigree illustration, affected individuals of family N were diagnosed with x-linked recessive
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 98
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome ichthyosis, showing severe scaling of the skin. Whereas affected individuals of the families O and P, showed fragile, hyperpigmented skin predominantly on facial areas, and both hands and toes, which marked features of kindler syndrome. Clinical features of both the families were mostly similar to those reported previously by several groups (Kindler 1954; Jobard et al., 2003; Siegel et al., 2003; Fassihi et al., 2005; Lai-Cheong et al., 2008; Heinemann et al., 2011). Whereas in two other families (Q and R), clinical phenotypes exposed extreme dry and scaly skin.
The genetic investigation via SNP microarray presented here, lead to identification of a discrete interstitial deletion of ~1.67 Mb in family N (Figure 6.3). The clinical investigation in family N was suggestive of ichthyosis vulgaris: although with substantial severity in form of xerosis, large many-sided scales on face, profound dryness and hyperkeratosis on some body parts (Figure 6.2). Most of the cases with RXLI (˃90%), have deletion of the entire STS gene and flanking sequences this may happen because Xp22.3 is rich in low-copy repeats (LCRs), having multiple recombination hot spot motifs. These repeats are responsible for the micro-deletions in this region due to non- allelic homologous recombination (NAHR).
In family O, a novel frameshift variant (c.27delT, p.F9Lfs*23) was detected in the FERMT1 gene (Figure 6.8). FERMT1 or KIND1 localized on chromosome 20p13, spans 48.5 kb of genomic DNA and consists of 15 exons (Warnich et al., 1996). FERMT1 or KIND1 encodes kindlin-1, a 677-amino acid protein primarily expressed in basal keratinocytes, intestine, kidney and skin (Siegel et al., 2003; Jobard et al., 2003; Lai- Cheong et al., 2008). Homozygous mutations in KIND1 gene leads to first skin fragility disorder termed as Kindler syndrome (Herz et al., 2006). The sequence variant c.27delT, identified in the family O, is predicted to produce a nonfunctional small peptide of 30 amino acids Or else, nonsense-mediated RNA decay may outcome in complete loss of functional protein. Whereas in family P, the homozygous recurrent variant c.1718+2A>G within the intron 13 donor splice site of FERMT1 gene was identified (Figure 6.9), which may result in exon skipping, cryptic splice site activation and retention of an intron (Nakai et al., 1994; Herz et al., 2006).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 99
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
In family Q, a single potential homozygous region was mapped on chromosome 2 through SNP microarray. Consequently, exome sequencing lead to the identification of some rare and potentially causative variants, which need further sequencing and characterization.
In family R, a recurrent variant (p.Asp63Val) in the LPAR6 gene was identified to be responsible for producing sparse hairs concomitant with ichthyosis. The gene LPAR6 encodes P2Y5 protein (344 amino acid) (Herzog et al., 1996). The mutation p.Asp63Val, recognized in a family R, is located in the third potential extracellular domain (Figure 6.16). All the mutations in DNA sequence of LPAR6 gene reported so far had shown characteristic signaling defects in LPAR6-LPA binding resulting in hypotrichosis/wooly hair phenotype (Pasternack et al., 2009; Shinkuma et al., 2010; Raza et al., 2014). Molecular modeling and docking analysis showed LPA binding aberrations (Raza et al., 2014) However attempts to figure out any other variant for triggering ichthyosis phenotype concomitant with hypotrichosis in affected individuals of family R was not successful. As only splice junction sites and coding part of these genes were sequenced, the likelihood of incidence of effective genetic deviations in the regulatory regions of the examined genes cannot be ignored. Additionally it can be assumed by supporting online available databases including MGi (Mouse Genome informatics http/: www.informatics.jax.org), JensenLab (http://diseases.jensenlab.org) and Gene distiller 2014 (http://www.genedistiller.org/) that LPAR6 alone can be responsible for producing this unique hair and skin phenotypes together (sparse hair with hyperkeratosis). Due to limited funds, such functional analysis was not performed during the present study, however it can be potential rare case report for intense investigation at molecular level in future.
Collectively, the presented research described study of different forms of isolated and associated skin phenotypes in five consanguineous families. The genetic mapping via microsatellite markers, SNP genotyping, exome and Sanger sequencing were applied as major diagnostic techniques. Genetic investigation discovered four mutations in these families including one novel and three formerly stated. In all four families the homozygous mutations were responsible for causing particular skin abnormality.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 100
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.1: Pedigree illustration of family N segregating XLI phenotype. Double lines are suggestive of consanguineous union, squares for males and circle for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 6.2: Clinical phenotypes of affected male members (V-1, V-2) in family N. Dark brown, small circular, dark colored tightly adhesive scales of variable sizes are clearly evident on the head, facial margins, neck, fore limbs and abdominal regions of the body (A,B).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 101
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 102
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.4: Pedigree illustration of family O segregating Kindler syndrome phenotype. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 6.5: Clinical phenotypes of affected members (IV-4, IV-5) in family O. (A) hypo and hyper pigmented patches over the face of affected individual IV-5, (B, C) cutaneous atrophy and poikiloderma over dorsal side of hand and foot in affected individual IV-4.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 103
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.6: Pedigree illustration of family P segregating Kindler syndrome phenotype. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 6.7: Clinical findings in family P affected with kindler syndrome. (A, B) Cutaneous atrophy, hypo and hyper pigmentation, and telangiectasia on the hand and foot of affected individual IV-1.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 104
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.8: Sequence analysis of the FERMT1 gene showing a novel frameshift deletion mutation (c.27_27delT, p.F9Lfs*23) detected in family O. Upper panel represents nucleotide sequence in a homozygous affected member, middle panel represents a heterozygous carrier and lower panel represents a homozygous unaffected member. Arrow head indicates the point of potential variant.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 105
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.9: Sequence analysis of the FERMT1 gene showing a recurrent missense mutation (c.1718+2A>G) detected in family P. Upper panel represents a nucleotide sequence in a homozygous affected member, middle panel represents a heterozygous carrier and lower panel represents a homozygous unaffected member. Arrow head indicates point of potential variant.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 106
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.10: Pedigree illustration of family Q segregating ichthyosis phenotype. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 6.11: Clinical phenotypes in family Q affected with ichthyosis, (A, B) revealed generalized dryness of skin, scales of variable size and intensity ranging from unnoticeable white to large hyperkeratotic scales on the front and back sides of the body. (C) Hyper linearity of palms along with mild erythroderma were observed in all the affected individuals of the family Q.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 107
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.12: Pedigree illustration of family R segregating defected skin and hair phenotype. Double lines are suggestive of consanguineous union, squares for males and circles for females. Clear and filled icons symbolize unaffected and affected individuals, respectively.
Figure 6.13: Clinical phenotypes in family R demonstrating autosomal recessive form of ichthyosis concomitant with hypotrichosis (A, B), including uniform scaling on entire body accompanied with generalized dryness of skin, scales in the form of dark streaks on flexor surface of forearm, surface of feet and neck, hyperkeratosis on knees and lower legs.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 108
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.14: Homozygous region marked on chromosome 2 (212-216 Mb approx.) by SNP microarray in all the affected individuals and XRCC5 variant (c.938-7T>C) sequence chromatogram of family Q.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 109
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Figure 6.15: Sequence analysis of the LPAR6 gene showing a recurrent missense mutation (c.188A>T, p.Asp63Val) detected in family R. Upper panel represents complimentary nucleotide sequence in a homozygous affected member, middle panel a heterozygous carrier and lower panel a homozygous unaffected member. Arrow head indicates a point of potential variant.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 110
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 111
Chapter 6 Genetics of Ichthyosis and Kindler Syndrome
Table 6.1: List of filtered variants tested for family Q S. Chr Gene Gene Variant mRNA/ %age of Exac SNP no. no. component type protein Homo. Allele Freq. count 1 2 CPS1 Exonic Missense c.2641A>G 100% 0 0 p.Lys881Glu 2 2 ERBB4 Intronic Splice c.884-7delT 100% 0 0 region 3 2 LOC100 Exonic Stop c.245C>G 100% 0 0 130451 gained p.Ser82* 4 2 ABCA12 Intronic 3’ UTR c.*26G>A 100% 492 High 5 2 ABCA12 Exonic Missense c.2329T>A 100% 8240 High p.Ser777Thr 6 2 PECR Intronic 3’ UTR c.*36C>T 100% 0 0 7 2 XRCC5 Intronic Splice c.938-7T>C 100% 0 0 region
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 112
Chapter 7 Conclusion
Conclusion
Up to appraised evidence more than one third Mendelian disorders possess malformation and disorders of the skin and its appendages, which are often monogenic defects. (Costa et al., 1985; Itin, 2014). According to WHO more than 3000 genes have been isolated or cloned, out of which more than 1000 genes are associated with monogenic disorders and overall out of 3000 isolated genes: 1000 genes are extensively studies for their molecular pathway and interactions, whereas rest are still under investigation (Itin, 2014). Approximately 8% of all new born constitutes Mendelian phenotypes (Baird et al., 1998).
Consanguineous unions are the most prevailing way of matrimonies representing by almost half of the world’s population (20-50% of marriages) (Bittles, 2001). The high rate of consanguinity is responsible for more common incidence of recessive genetic disorders in Pakistani population. Which is evident from an assessment that almost every year 700 infants face genetic incapacities due to cousin weddings in Pakistan (Khan, 2015). Cultural, tribal and religious diversities among different ethnic communities are the key factors for trending these consanguineous unions in Pakistani population (Schulpen et al., 2006, Hamamy et al., 2011), which indicates a favorable high compatibility of the wife with her spouse as well as with other members of the connecting family, so marrying within the tribe is facilitated by several shared social and economic links which strengthened the family ties and endures family solidarity (Sandridge et al., 2010).
Hereditary ectodermal disorders are rationally common that almost every month new genetic condition belonging to the ectodermal dysplasias are reported (Sarig et.al., 2012). Pakistani community offers a perfect situation for disorders like hair and skin phenotypes with autosomal recessive penetrance. Ectodermal disorders inherited in autosomal recessive pattern are fairly recurrent in consanguineous families. It is estimated that the risk for inborn recessive genetic anomalies in the offspring from first cousins has been raised by 1.7-2.8% (Bennett et al., 2002).
The molecular analysis of rare monogenic ectodermal diseases is very important, because documentation of their genetic bases provides insight into disease mechanisms, biological pathways and potential therapeutic targets. But due to less number of patients and locus heterogeneity, less than half of all monogenic disorders are diagnosed at molecular level by using traditional strategies. Sequencing the whole genome for discovery of allelic variants could
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 113 Chapter 7 Conclusion potentially identify the pathogenic variant underlying any given rare monogenic disease, but cost remains a main attention. An alternative approach involves sequencing of exome, Protein-coding regions constitute, 1-2% of the human genome or, 30 mega bases (Mb), split across, 180,000 exons (Choi et al. 2009; Hodges et al., 2007). Large-scale sequencing studies have repeatedly shown that ExAC genome browser is the most enriched and reliable database comprised of approx. 6500 individual exomes (13000 AC approx.), deeply evaluated for high quality variants (HQ) after applying different steps for optimizing the database for predicting potential pathogenic variant (99% frequency less than 1%, 54% singletons and 72% variants absent from both 1000G and ESP). This ensures the high quality variant assessment after applying some number of variables including low allele frequency commonly found in less than 1% for causative variants.
The work presented here comprised the genetic/ molecular studies of 18 Pakistani families (South Eastern), which were processed for genetic inference in Pakistan and Netherlands therefore depending upon the availability of ethnically matched controls, different no. of controls were used to detect “Neutral polymorphism” in different families. These families featured distinct forms of inherited irregularities of hair, hair-nail, nail, skin and syndromic form of hair loss. Both conventional and modern diagnostic tools were applied for molecular delineation of the genetic ailments inheriting in considered families. The genetic research lead to the identification of two novel genes EXPH5 and XRCC5 in a families segregating isolated hypotrichosis and congenital ichthyosis in an autosomal recessive manner. Sequence exploration exposed novel pathogenic variants in five genes LIPH, HR, U2HR, FERMT1 and HOXC13 and a previously reported variant in the genes STS, FERMT1, LPAR6 and GJB6 in respective families. The presented research effort however was unsuccessful in interpreting the genetic basis in five consanguineous families.
This study will not only expand the spectrum of mutations responsible for hereditary ectodermal dysplasias of diverse phenotypes but also represents a recommendation regarding the ideal threshold for allele frequency filtering (<1%), which is applied as the first step towards NSG data filtration. The represented variables are (variant read, percentage of variant, SNP Allele frequency global, Causative allele frequency local, gene components and excluding the variant as synonymous). According to the disease prevalence and availability of reference population, an allele frequency <1% and 0.001% were applied for NGS data filtration in the subjected families.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 114 Chapter 7 Conclusion
In addition, a study of 50 in-house exome data files of ethnically matched individuals was performed, from which it is predicted that the published mutations (Table 3.2 and 5.2) are found with very low allele frequency (<1%), which is indicating these mutations are more likely to be pathogenic.
As a final view, the study presented in the dissertation will assist in building an international network of patients, research seekers and clinicians with an appreciative knowledge of genetic heterogeneity of ectodermal disorders and offers further insight into molecular analysis and molecular therapeutics. It will extend the preexisting human genomic databases and may benefit to advance a community-generated awareness that will expressively progress management and diagnosis of hereditary ectodermal disorders. Our understanding of the molecular basis of ectodermal illnesses may allow us to further clarify the phenotypic differences to better categorize them and facilitate proper genetic counseling by bringing awareness for carrier testing in the patients from the families preferring consanguineous matrimonies.
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 115 Chapter 8 References
References
Abdul-Wahab A, Takeichi T, Liu L, Stephens C, Akiyama M, McGrath JA (2016). Intrafamilial phenotypic heterogeneity of epidermolytic ichthyosis associated with a new missense mutation in keratin 10. Clin Exp Dermatol 41: 290-3
Ahmad W, Faiyaz ul Haque M, Brancolini V, Tsou HC, ul Haque S, Lam H, Aita VM, Owen J, deBlaquiere M, Frank J, Cserhalmi-Friedman PB, Leask A, McGrath JA, Peacocke M, Ahmad M, Ott J, Christiano AM (1998). Alopecia universalis associated with a mutation in the human hairless gene. Science 279: 720-4
Ahmad W, Panteleyev AA, Christiano AM (1999). The molecular basis of congenital atrichia in humans and mice: mutations in the hairless gene. J Investig Dermatol Symp Proc 4: 240- 3
Akiyama M, Takizawa Y, Suzuki Y, Shimizu H (2003). A novel homozygous mutation 371delA in TGM1 leads to a classic lamellar ichthyosis phenotype. Br J Dermatol 148: 149-53
Alexandre C, Baena-Lopez A, Vincent JP (2014). Patterning and growth control by membrane- tethered Wingless. Nature 505: 180-5
Ali G, Chishti MS, Raza SI, John P, Ahmad W (2007). A mutation in the lipase H (LIPH) gene underlie autosomal recessive hypotrichosis. Hum Genet 121: 319-25
Ali RH, Habib R, Ud-Din N, Khan MN, Ansar M, Ahmad W (2013). Novel mutations in the gene HOXC13 underlying pure hair and nail ectodermal dysplasia in consanguineous families. Br J Dermatol 169: 478-80
Ali RH, Mahmood S, Raza SI, Aziz A, Irfanullah, Naqvi SK, Wasif N, Ansar M, Ahmad W, Shah SH, Khan BT, Zaman Q, Gul A, Wali A, Ali G, Khan S, Khisroon M, Basit S (2015). Genetic analysis of Xp22.3 micro-deletions in seventeen families segregating isolated form of X-linked ichthyosis. J Dermatol Sci 80: 214-7
Alonso L, Fuchs E (2006). The hair cycle. J Cell Sci 119: 391-3
Ansar M, Jan A, Santos-Cortez RL, Wang X, Suliman M, Acharya A, Habib R, Abbe I, Ali G, Lee K, Smith JD, Nickerson DA, Shendure J, Bamshad MJ, Ahmad W, Leal SM (2016).
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 116
Chapter 8 References
Expansion of the spectrum of ITGB6-related disorders to adolescent alopecia, dentogingival abnormalities and intellectual disability. Eur J Hum Genet 24: 1223-7
Aoki J, Inoue A, Makide K, Saiki N, Arai H (2007). Structure and function of extracellular phospholipase A1 belonging to the pancreatic lipase gene family. Biochimie 89: 197-204
Apiou F, Flagiello D, Cillo C, Malfoy B, Poupon MF, Dutrillaux B (1996). Fine mapping of human HOX gene clusters. Cytogenet Cell Genet 73: 114-5
Aslam M, Chahrour MH, Razzaq A, Haque S, Yan K, Leal SM, Ahmad W (2004). A novel locus for autosomal recessive form of hypotrichosis maps to chromosome 3q26.33-q27.3. J Med Genet 41: 849-52
Atukorala AD, Inohaya K, Baba O, Tabata MJ, Ratnayake RA, Abduweli D, Kasugai S, Mitani H, Takano Y (2010). Scale and tooth phenotypes in medaka with a mutated ectodysplasin-A receptor: implications for the evolutionary origin of oral and pharyngeal teeth. Arch Histol Cytol 73: 139-48
Avshalumova L, Fabrikant J, Koriakos A (2014). Overview of skin diseases linked to connexin gene mutations. Int J Dermatol 53: 192-205
Awgulewitsch A (2003). Hox in hair growth and development. Naturwissenschaften 90: 193– 211
Ayub M, Basit S, Jelani M, Ur Rehman F, Iqbal M, Yasinzai M, Ahmad W (2009). A homozygous nonsense mutation in the human desmocollin-3 (DSC3) gene underlies hereditary hypotrichosis and recurrent skin vesicles. Am J Hum Genet 85: 515-20
Azeem Z, Jelani M, Naz G, Tariq M, Wasif N, Kamran-Ul-Hassan Naqvi S, Ayub M, Yasinzai M, Amin-Ud-Din M, Wali A, Ali G, Chishti MS, Ahmad W (2008). Novel mutations in G protein-coupled receptor gene (P2RY5) in families with autosomal recessive hypotrichosis (LAH3). Hum Genet 123: 515-9
Baran R, Kechijian P (2001). Understanding nail disorders. Eur J Dermatol 11: 159-62
Baris HN, Zlotogorski A, Peretz-Amit G, Doviner V, Shohat M, Reznik-Wolf H, Pras E (2008). A novel GJB6 missense mutation in hidrotic ectodermal dysplasia 2 (Clouston syndrome) broadens its genotypic basis. Br J Dermatol 159: 1373-6
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 117
Chapter 8 References
Basit S, Ali G, Wasif N, Ansar M, Ahmad W (2010). Genetic mapping of a novel hypotrichosis locus to chromosome 7p21.3-p22.3 in a Pakistani family and screening of the candidate genes. Hum Genet 128: 213-20
Basit S, Khan S, Ahmad W (2015). Genetics of human isolated hereditary hair loss disorders. Clin Genet 88: 203-12
Basit S, Wali A, Aziz A, Muhammad N, Jelani M, Ahmad W (2011). Digenic inheritance of an autosomal recessive hypotrichosis in two consanguineous pedigrees. Clin Genet 79: 273- 81
Bazex J, Baran R, Monbrun F, Grigorieff-Larrue N, Marguery MC (1990). Hereditary distal onycholysis--a case report. Clin Exp Dermatol 15: 146-8
Beaudoin GM, 3rd, Sisk JM, Coulombe PA, Thompson CC (2005). Hairless triggers reactivation of hair growth by promoting Wnt signaling. Proc Natl Acad Sci U S A 102: 14653-8
Bennett RL, Steinhaus KA, Uhrich SB, O'Sullivan CK, Resta RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J (1995). Recommendations for standardized human pedigree nomenclature. Pedigree Standardization Task Force of the National Society of Genetic Counselors. Am J Hum Genet 56: 745-52
Bergeson JR, Stone OJ (1967). Koilonychia. A report of familial spoon nails. Arch Derm 95: 351–3
Biggs LC, Mikkola ML (2014). Early inductive events in ectodermal appendage morphogenesis. Semin Cell Dev Biol 25-26: 11-21
Bitoun E, Chavanas S, Irvine AD, Lonie L, Bodemer C, Paradisi M, Hamel-Teillac D, Ansai S, Mitsuhashi Y, Taieb A, de Prost Y, Zambruno G, Harper JI, Hovnanian A (2002). Netherton syndrome: disease expression and spectrum of SPINK5 mutations in 21 families. J Invest Dermatol 118: 352-61
Bosen F, Schutz M, Beinhauer A, Strenzke N, Franz T, Willecke K (2014). The Clouston syndrome mutation connexin30 A88V leads to hyperproliferation of sebaceous glands and hearing impairments in mice. FEBS Lett 588: 1795-801
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 118
Chapter 8 References
Botchkarev VA, Fessing MY (2005). Edar signaling in the control of hair follicle development. J Investig Dermatol Symp Proc 10: 247-51
Bruchle NO, Frank J, Frank V, Senderek J, Akar A, Koc E, Rigopoulos D, van Steensel M, Zerres K, Bergmann C (2008). RSPO4 is the major gene in autosomal-recessive anonychia and mutations cluster in the furin-like cysteine-rich domains of the Wnt signaling ligand R-spondin 4. J Invest Dermatol 128: 791-6
Buchan DW, Minneci F, Nugent TC, Bryson K, Jones DT (2013). Scalable web services for the PSIPRED Protein Analysis Workbench. Nucleic Acids Res 41: W349-57
Bumpers RD, Bishop ME (1980). Familial koilonychia. A current case history. Arch Dermatol 116: 845
Burg G (1975). [Procceedings: Hereditary onycholysis mit scleronychia]. Hautarzt 26: 386
Cai LQ, Wang PG, Gao M, Lu WS, Xu SX, Fang QY, Zhou WM, Lin D, Du WH, Zhang SM, Yang S, Zhang XJ (2009). A novel U2HR non-synonymous mutation in a Chinese patient with Marie Unna Hereditary Hypotrichosis. J Dermatol Sci 55: 125-7
Calzavara-Pinton P, Carlino A, Benetti A, De Panfilis G (1991). Pili torti and onychodysplasia. Report of a previously undescribed hidrotic ectodermal dysplasia. Dermatologica 182: 184-7
Charteris F (1918). A case of partial hereditary anonychia. Glasgow Med J 89: 207–9
Chen D, Jarrell A, Guo C, Lang R, Atit R (2012). Dermal beta-catenin activity in response to epidermal Wnt ligands is required for fibroblast proliferation and hair follicle initiation. Development 139: 1522-33
Chen N, Xu C, Han B, Wang ZY, Song YL, Li S, Zhang RL, Pan CM, Zhang L (2010). G11R mutation in GJB6 gene causes hidrotic ectodermal dysplasia involving only hair and nails in a Chinese family. J Dermatol 37: 559-61
Chishti MS, Kausar N, Rafiq MA, Amin M, Ahmad W (2008). A novel missense mutation in RSPO4 gene underlies autosomal recessive congenital anonychia in a consanguineous Pakistani family. Br J Dermatol 158: 621-3
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 119
Chapter 8 References
Chuong CM, Bhat R, Widelitz RB, Bissell MJ (2014). SnapShot: Branching Morphogenesis. Cell 158: 1212- e1
Chuong CM, Randall VA, Widelitz RB, Wu P, Jiang TX (2012). Physiological regeneration of skin appendages and implications for regenerative medicine. Physiology (Bethesda) 27: 61-72
Cichon S, Anker M, Vogt IR, Rohleder H, Putzstuck M, Hillmer A, Farooq SA, Al-Dhafri KS, Ahmad M, Haque S, Rietschel M, Propping P, Kruse R, Nothen MM (1998). Cloning, genomic organization, alternative transcripts and mutational analysis of the gene responsible for autosomal recessive universal congenital alopecia. Hum Mol Genet 7: 1671-9
Cichon S, Hillmer AM, Betz RC, Kruse R, Nothen MM (2006). Congenital atrichia. New York. Pp: 77–90
Clevers H, Loh KM, Nusse R (2014). Stem cell signaling. An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control. Science 346: 1248012
Colovos C, Yeates TO (1993). Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci 2: 1511-9
Common JE, Becker D, Di WL, Leigh IM, O'Toole EA, Kelsell DP (2002). Functional studies of human skin disease- and deafness-associated connexin 30 mutations. Biochem Biophys Res Commun 298: 651-6
Costa T, Ramsby G, Cassia F, Peters KR, Soares J, Correa J, Quelce-Salgado A, Tsipouras P (1998). Grebe syndrome: clinical and radiographic findings in affected individuals and heterozygous carriers. Am J Med Genet 75:523-529
Costa T, Scriver CR, Childs B (1985). The effect of Mendelian disease on human health: a measurement. Am J Med Genet 21: 231-42
Cottle DL, Ursino GM, Ip SC, Jones LK, Ditommaso T, Hacking DF, Mangan NE, Mellett NA, Henley KJ, Sviridov D, Nold-Petry CA, Nold MF, Meikle PJ, Kile BT, Smyth IM (2015). Fetal inhibition of inflammation improves disease phenotypes in harlequin ichthyosis. Hum Mol Genet 24: 436-49
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 120
Chapter 8 References
Courtney JM, Blackburn J, Sharpe PT (2005). The Ectodysplasin and NFkappaB signalling pathways in odontogenesis. Arch Oral Biol 50: 159-63
Cui CY, Schlessinger D (2006). EDA signaling and skin appendage development. Cell Cycle 5: 2477-83
Cui CY, Yin M, Sima J, Childress V, Michel M, Piao Y, Schlessinger D (2014a). Involvement of Wnt, Eda and Shh at defined stages of sweat gland development. Development 141: 3752-60
Cui M, Jin H, Shi X, Qu G, Liu L, Ding X, Wang Y, Niu C (2014b). Lipase member H is a novel secreted protein associated with a poor prognosis for breast cancer patients. Tumour Biol 35: 11461-5
Diribarne M, Mata X, Riviere J, Bouet S, Vaiman A, Chapuis J, Reine F, Fleurot R, Auvinet G, Deretz S, Allain D, Schibler L, Cribiu EP, Guerin G (2012). LIPH expression in skin and hair follicles of normal coat and Rex rabbits. PLoS One 7: e30073
Dunphy KA, Schneyer AL, Hagen MJ, Jerry DJ (2011). The role of activin in mammary gland development and oncogenesis. J Mammary Gland Biol Neoplasia 16: 117-26
Duverger O, Morasso MI (2014). To grow or not to grow: hair morphogenesis and human genetic hair disorders. Semin Cell Dev Biol 25-26: 22-33
Duzenli S, Redler S, Muller M, Polat M, Dogruer D, Pasternack SM, Betz RC (2009). Identification of a U2HR gene mutation in Turkish families with Marie Unna hereditary hypotrichosis. Clin Exp Dermatol 34: e953-6
Elfgang C, Eckert R, Lichtenberg-Frate H, Butterweck A, Traub O, Klein RA, Hulser DF, Willecke K (1995). Specific permeability and selective formation of gap junction channels in connexin-transfected HeLa cells. J Cell Biol 129: 805-17
Essenfelder GM, Bruzzone R, Lamartine J, Charollais A, Blanchet-Bardon C, Barbe MT, Meda P, Waksman G (2004). Connexin30 mutations responsible for hidrotic ectodermal dysplasia cause abnormal hemichannel activity. Hum Mol Genet 13: 1703-14
Ezer S, Bayes M, Elomaa O, Schlessinger D, Kere J (1999). Ectodysplasin is a collagenous trimeric type II membrane protein with a tumor necrosis factor-like domain and co-
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 121
Chapter 8 References
localizes with cytoskeletal structures at lateral and apical surfaces of cells. Hum Mol Genet 8: 2079-86
Farkas K, Nagy N, Kinyo A, Kemeny L, Szell M (2012). A newly identified missense mutation of the HR gene is associated with a novel, unusual phenotype of Marie Unna Hereditary Hypotrichosis 1 including limb deformities. Arch Dermatol Res 304: 679-81
Farooq M, Kurban M, Abbas O, Obeidat O, Fujikawa H, Kibbi AG, Fujimoto A, Shimomura Y (2012). A novel mutation in the PLCD1 gene, which leads to an aberrant splicing event, underlies autosomal recessive leuconychia. Br J Dermatol 167: 946-9
Farooq M, Kurban M, Fujimoto A, Fujikawa H, Abbas O, Nemer G, Saliba J, Sleiman R, Tofaili M, Kibbi AG, Ito M, Shimomura Y (2013). A homozygous frameshift mutation in the HOXC13 gene underlies pure hair and nail ectodermal dysplasia in a Syrian family. Hum Mutat 34: 578-81
Fassihi H, Wessagowit V, Jones C, Dopping-Hepenstal P, Denyer J, Mellerio JE, Clark S, McGrath JA (2005). Neonatal diagnosis of Kindler syndrome. J Dermatol Sci 39: 183-5
Fenton AD (1995). Nail disorders associated with general medical conditions. In: Samman’s the Nails in Disease (Fenton AD, ed.), 5th edn. Oxford: Butterworth-Heinemann, 113–14
Feramisco JD, Sadreyev RI, Murray ML, Grishin NV, Tsao H (2009). Phenotypic and genotypic analyses of genetic skin disease through the Online Mendelian Inheritance in Man (OMIM) database. J Invest Dermatol 129: 2628-36
Fernandes NF, Janniger CK, Schwartz RA (2010). X-linked ichthyosis: an oculocutaneous genodermatosis. J Am Acad Dermatol 62: 480-5
Foitzik K, Lindner G, Mueller-Roever S, Maurer M, Botchkareva N, Botchkarev V, Handjiski B, Metz M, Hibino T, Soma T, Dotto GP, Paus R (2000). Control of murine hair follicle regression (catagen) by TGF-beta1 in vivo. FASEB J 14: 752-60
Fonseca DJ, Rojas RF, Vergara JI, Rios X, Uribe C, Chavez L, Velandia F, Vargas CI, Restrepo CM, Laissue P (2013). A severe familial phenotype of Ichthyosis Curth-Macklin caused by a novel mutation in the KRT1 gene. Br J Dermatol 168: 456-8
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 122
Chapter 8 References
Frojmark AS, Schuster J, Sobol M, Entesarian M, Kilander MB, Gabrikova D, Nawaz S, Baig SM, Schulte G, Klar J, Dahl N (2011). Mutations in Frizzled 6 cause isolated autosomal- recessive nail dysplasia. Am J Hum Genet 88: 852-60
Fuchs E (2007). Scratching the surface of skin development. Nature 445: 834-42
Fuchs E, Chen T (2013). A matter of life and death: self-renewal in stem cells. EMBO Rep 14: 39-48
Fujimoto A, Farooq M, Fujikawa H, Inoue A, Ohyama M, Ehama R, Nakanishi J, Hagihara M, Iwabuchi T, Aoki J, Ito M, Shimomura Y (2012). A missense mutation within the helix initiation motif of the keratin K71 gene underlies autosomal dominant woolly hair/hypotrichosis. J Invest Dermatol 132: 2342-9
Fujimoto A, Kurban M, Nakamura M, Farooq M, Fujikawa H, Kibbi AG, Ito M, Dahdah M, Matta M, Diab H, Shimomura Y (2013). GJB6, of which mutations underlie Clouston syndrome, is a potential direct target gene of p63. J Dermatol Sci 69: 159-66
Garcin CL, Huttner KM, Kirby N, Schneider P, Hardman MJ (2016). Ectodysplasin A Pathway Contributes to Human and Murine Skin Repair. J Invest Dermatol 136: 1022-30
Ghosh AK, Ramakrishnan G, Chandramohan C, Rajasekharan R (2008). CGI-58, the causative gene for Chanarin-Dorfman syndrome, mediates acylation of lysophosphatidic acid. J Biol Chem 283: 24525-33
Goodenough DA, Goliger JA, Paul DL (1996). Connexins, connexons, and intercellular communication. Annu Rev Biochem 65: 475-502
Greenblatt MB, Kim JM, Oh H, Park KH, Choo MK, Sano Y, Tye CE, Skobe Z, Davis RJ, Park JM, Bei M, Glimcher LH, Shim JH (2015). p38alpha MAPK is required for tooth morphogenesis and enamel secretion. J Biol Chem 290: 284-95
Griffiths WAD, Judge MR, Leigh IM. Disorders of keratinization (1998). In: Champion RH, Burton JL, Burns DA, Breathnach SM, eds. Rooks Textbook of Dermatology, 6th edn. Oxford, London: Blackwell Science, 1483–1588
Hamamy H (2012). Consanguineous marriages, Preconception consultation in primary health care settings. J Community Genet 3:185-192
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 123
Chapter 8 References
Hammami-Hauasli N, Raghunath M, Kuster W, Bruckner-Tuderman L (1998). Transient bullous dermolysis of the newborn associated with compound heterozygosity for recessive and dominant COL7A1 mutations. J Invest Dermatol 111: 1214-9
Hansen LA, Alexander N, Hogan ME, Sundberg JP, Dlugosz A, Threadgill DW, Magnuson T, Yuspa SH (1997). Genetically null mice reveal a central role for epidermal growth factor receptor in the differentiation of the hair follicle and normal hair development. Am J Pathol 150: 1959-75
Harris AL (2001). Emerging issues of connexin channels: biophysics fills the gap. Q Rev Biophys 34: 325-472
Harris MP, Rohner N, Schwarz H, Perathoner S, Konstantinidis P, Nusslein-Volhard C (2008). Zebrafish eda and edar mutants reveal conserved and ancestral roles of ectodysplasin signaling in vertebrates. PLoS Genet 4: e1000206
Hashimoto T, Cui CY, Schlessinger D (2006). Repertoire of mouse ectodysplasin-A (EDA-A) isoforms. Gene 371: 42-51
Hassed SJ, Kincannon JM, Arnold GL (1996). Clouston syndrome: an ectodermal dysplasia without significant dental findings. Am J Med Genet 61: 274-6
Hayashi R, Inoue A, Suga Y, Aoki J, Shimomura Y (2015). Analysis of unique mutations in the LPAR6 gene identified in a Japanese family with autosomal recessive woolly hair/hypotrichosis: Establishment of a useful assay system for LPA6. J Dermatol Sci 78: 197-205
Hazelrigg DE, Duncan WC, Jarratt M (1977). Twenty-nail dystrophy of childhood. Arch Dermatol 113: 73-5
Hazen PG, Zamora I, Bruner WE, Muir WA (1980). Premature cataracts in a family with hidrotic ectodermal dysplasia. Arch Dermatol 116: 1385-7
Headon DJ (2009). Ectodysplasin signaling in cutaneous appendage development: dose, duration, and diversity. J Invest Dermatol 129: 817-9
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 124
Chapter 8 References
Headon DJ, Emmal SA, Ferguson BM, Tucker AS, Justice MJ, Sharpe PT, Zonana J, Overbeek PA (2001). Gene defect in ectodermal dysplasia implicates a death domain adapter in development. Nature 414: 913-6
Heinemann A, He Y, Zimina E, Boerries M, Busch H, Chmel N, Kurz T, Bruckner-Tuderman L, Has C (2011). Induction of phenotype modifying cytokines by FERMT1 mutations. Hum Mutat 32: 397-406
Hellier FF (1950). Hereditary koilonychia. Br J Dermatol 62: 213–14
Hernandez M, Ghersi D, Sanchez R (2009). SITEHOUND-web: a server for ligand binding site identification in protein structures. Nucleic Acids Res 37: W413-6
Herz C, Aumailley M, Schulte C, Schlotzer-Schrehardt U, Bruckner-Tuderman L, Has C (2006). Kindlin-1 is a phosphoprotein involved in regulation of polarity, proliferation, and motility of epidermal keratinocytes. J Biol Chem 281: 36082-90
Herzog H, Darby K, Hort YJ, Shine J (1996). Intron 17 of the human retinoblastoma susceptibility gene encodes an actively transcribed G protein-coupled receptor gene. Genome Res 6: 858-61
Hobbs ME (1935). Hereditary onychial dysplasia. Am J Med Sci 190: 200–6
Holmes RS, Cox LA (2011). Comparative Structures and Evolution of Vertebrate Carboxyl Ester Lipase (CEL) Genes and Proteins with a Major Role in Reverse Cholesterol Transport. Cholesterol 2011: 781643
Hundeiker M (1969). [Hereditary dysplasia of the 5th toe]. Hautarzt 20: 281-2
Ingham PW, Nakano Y, Seger C (2011). Mechanisms and functions of Hedgehog signalling across the metazoa. Nat Rev Genet 12: 393-406
Inoue A, Arima N, Ishiguro J, Prestwich GD, Arai H, Aoki J (2011). LPA-producing enzyme PA-PLA(1)alpha regulates hair follicle development by modulating EGFR signalling. EMBO J 30: 4248-60
Ishida-Yamamoto A, McGrath JA, Lam H, Iizuka H, Friedman RA, Christiano AM (1997). The molecular pathology of progressive symmetric erythrokeratoderma: a frameshift mutation
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 125
Chapter 8 References
in the loricrin gene and perturbations in the cornified cell envelope. Am J Hum Genet 61: 581-9
Ishii Y, Wajid M, Bazzi H, Fantauzzo KA, Barber AG, Blaydon DC, Nam JS, Yoon JK, Kelsell DP, Christiano AM (2008). Mutations in R-spondin 4 (RSPO4) underlie inherited anonychia. J Invest Dermatol 128: 867-70
Ishimine H, Zhou R, Sumitomo K, Ito Y, Seki Y, Yoshida Y, Kurisaki A (2016). Lipase member H frequently overexpressed in human esophageal adenocarcinomas. Tumour Biol 37: 2075-81
Itin PH (2014). Etiology and pathogenesis of ectodermal dysplasias. Am J Med Genet A 164A: 2472-7
Itin PH, Fistarol SK (2004). Ectodermal dysplasias. Am J Med Genet C Semin Med Genet 131C: 45-51
Jan A, Basit S, Wakil SM, Ramzan K, Ahmad W (2015). Whole-genome SNP genotyping mapped a novel locus for hereditary hypotrichosis on chromosome 2q31.1-q32.2. J Dermatol Sci 79: 173-5
Janda CY, Waghray D, Levin AM, Thomas C, Garcia KC (2012). Structural basis of Wnt recognition by Frizzled. Science 337: 59-64
Janzen DM, Frolova L, Geballe AP (2002). Inhibition of translation termination mediated by an interaction of eukaryotic release factor 1 with a nascent peptidyl-tRNA. Mol Cell Biol 22: 8562-70
Jen M, Nallasamy S (2016). Ocular manifestations of genetic skin disorders. Clin Dermatol 34: 242-75
Jimenez-Rojo L, Granchi Z, Graf D, Mitsiadis TA (2012). Stem Cell Fate Determination during Development and Regeneration of Ectodermal Organs. Front Physiol 3: 107
Jin W, Broedl UC, Monajemi H, Glick JM, Rader DJ (2002). Lipase H, a new member of the triglyceride lipase family synthesized by the intestine. Genomics 80: 268-73
Jobard F, Bouadjar B, Caux F, Hadj-Rabia S, Has C, Matsuda F, Weissenbach J, Lathrop M, Prud'homme JF, Fischer J (2003). Identification of mutations in a new gene encoding a
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 126
Chapter 8 References
FERM family protein with a pleckstrin homology domain in Kindler syndrome. Hum Mol Genet 12: 925-35
John P, Ali G, Chishti MS, Naqvi SM, Leal SM, Ahmad W (2006). Localization of a novel locus for alopecia with mental retardation syndrome to chromosome 3q26.33-q27.3. Hum Genet 118: 665-7
Judge MR, McLean WH, Munro CS (2010). Disorders of keratinization. In: Burns T, Breathnach S, Cox N, Griffiths C, eds. Rooks Textbook of Dermatology, 8th edn. Oxford, London: Blackwell Science, 19: 29–19.33
Jussila M, Thesleff I (2012). Signaling networks regulating tooth organogenesis and regeneration, and the specification of dental mesenchymal and epithelial cell lineages. Cold Spring Harb Perspect Biol 4: a008425
Karakayali G, Lenk N, Gungor E, Gur G, Alli N (1999). Twenty-nail dystrophy in monozygotic twins. J Eur Acad Dermatol Venereol 12: 192-3
Kazantseva A, Goltsov A, Zinchenko R, Grigorenko AP, Abrukova AV, Moliaka YK, Kirillov AG, Guo Z, Lyle S, Ginter EK, Rogaev EI (2006). Human hair growth deficiency is linked to a genetic defect in the phospholipase gene LIPH. Science 314: 982-5
Kelsell DP, Di WL, Houseman MJ (2001). Connexin mutations in skin disease and hearing loss. Am J Hum Genet 68: 559-68
Kelsell DP, Norgett EE, Unsworth H, Teh MT, Cullup T, Mein CA, Dopping-Hepenstal PJ, Dale BA, Tadini G, Fleckman P, Stephens KG, Sybert VP, Mallory SB, North BV, Witt DR, Sprecher E, Taylor AE, Ilchyshyn A, Kennedy CT, Goodyear H, Moss C, Paige D, Harper JI, Young BD, Leigh IM, Eady RA, O'Toole EA (2005). Mutations in ABCA12 underlie the severe congenital skin disease harlequin ichthyosis. Am J Hum Genet 76: 794-803
Kere J, Srivastava AK, Montonen O, Zonana J, Thomas N, Ferguson B, Munoz F, Morgan D, Clarke A, Baybayan P, Chen EY, Ezer S, Saarialho-Kere U, de la Chapelle A, Schlessinger D (1996). X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat Genet 13: 409-16
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 127
Chapter 8 References
Khan S, Basit S, Habib R, Kamal A, Muhammad N, Ahmad W (2015). Genetics of human isolated hereditary nail disorders. Br J Dermatol 173: 922-9
Khan S, Habib R, Mir H, Umm e K, Naz G, Ayub M, Shafique S, Yamin T, Ali N, Basit S, Wasif N, Kamran-Ul-Hassan Naqvi S, Ali G, Wali A, Ansar M, Ahmad W (2011). Mutations in the LPAR6 and LIPH genes underlie autosomal recessive hypotrichosis/woolly hair in 17 consanguineous families from Pakistan. Clin Exp Dermatol 36: 652-4
Kim BK, Lee HY, Choi JH, Kim JK, Yoon JB, Yoon SK (2012). Hairless plays a role in formation of inner root sheath via regulation of Dlx3 gene. J Biol Chem 287: 16681-8
Kim JK, Kim E, Baek IC, Kim BK, Cho AR, Kim TY, Song CW, Seong JK, Yoon JB, Stenn KS, Parimoo S, Yoon SK (2010). Overexpression of Hr links excessive induction of Wnt signaling to Marie Unna hereditary hypotrichosis. Hum Mol Genet 19: 445-53
Kindler T (1954). Congenital poikiloderma with traumatic bulla formation and progressive cutaneous atrophy. Brit. J. Derm. 66: 104-111.
Kiuru M, Kurban M, Itoh M, Petukhova L, Shimomura Y, Wajid M, Christiano AM (2011). Hereditary leukonychia, or porcelain nails, resulting from mutations in PLCD1. Am J Hum Genet 88: 839-44
Kljuic A, Bazzi H, Sundberg JP, Martinez-Mir A, O'Shaughnessy R, Mahoney MG, Levy M, Montagutelli X, Ahmad W, Aita VM, Gordon D, Uitto J, Whiting D, Ott J, Fischer S, Gilliam TC, Jahoda CA, Morris RJ, Panteleyev AA, Nguyen VT, Christiano AM (2003). Desmoglein 4 in hair follicle differentiation and epidermal adhesion: evidence from inherited hypotrichosis and acquired pemphigus vulgaris. Cell 113: 249-60
Kojima T, Morikawa Y, Copeland NG, Gilbert DJ, Jenkins NA, Senba E, Kitamura T (2000). TROY, a newly identified member of the tumor necrosis factor receptor superfamily, exhibits a homology with Edar and is expressed in embryonic skin and hair follicles. J Biol Chem 275: 20742-7
Krebsova A, Hamm H, Karl S, Reis A, Hennies HC (2000). Assignment of the gene for a new hereditary nail disorder, isolated congenital nail dysplasia, to chromosome 17p13. J Invest Dermatol 115: 664-7
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 128
Chapter 8 References
Kumar A, Eby MT, Sinha S, Jasmin A, Chaudhary PM (2001). The ectodermal dysplasia receptor activates the nuclear factor-kappaB, JNK, and cell death pathways and binds to ectodysplasin A. J Biol Chem 276: 2668-77
Kumar NM, Gilula NB (1996). The gap junction communication channel. Cell 84: 381-8
Kurban M, Wajid M, Shimomura Y, Christiano AM (2013). Mutations in LPAR6/P2RY5 and LIPH are associated with woolly hair and/or hypotrichosis. J Eur Acad Dermatol Venereol 27: 545-9
Lai-Cheong JE, Ussar S, Arita K, Hart IR, McGrath JA (2008). Colocalization of kindlin-1, kindlin-2, and migfilin at keratinocyte focal adhesion and relevance to the pathophysiology of Kindler syndrome. J Invest Dermatol 128: 2156-65
Lamartine J (2003). Towards a new classification of ectodermal dysplasias. Clin Exp Dermatol 28: 351-5
Lamartine J, Munhoz Essenfelder G, Kibar Z, Lanneluc I, Callouet E, Laoudj D, Lemaitre G, Hand C, Hayflick SJ, Zonana J, Antonarakis S, Radhakrishna U, Kelsell DP, Christianson AL, Pitaval A, Der Kaloustian V, Fraser C, Blanchet-Bardon C, Rouleau GA, Waksman G (2000). Mutations in GJB6 cause hidrotic ectodermal dysplasia. Nat Genet 26: 142-4
Langton AK, Graham HK, McConnell JC, Sherratt MJ, Griffiths CE, Watson RE (2017). Organisation of the dermal matrix impacts the biomechanical properties of skin. Br J Dermatol
Levy-Nissenbaum E, Betz RC, Frydman M, Simon M, Lahat H, Bakhan T, Goldman B, Bygum A, Pierick M, Hillmer AM, Jonca N, Toribio J, Kruse R, Dewald G, Cichon S, Kubisch C, Guerrin M, Serre G, Nothen MM, Pras E (2003). Hypotrichosis simplex of the scalp is associated with nonsense mutations in CDSN encoding corneodesmosin. Nat Genet 34: 151-3
Li L, Clevers H (2010). Coexistence of quiescent and active adult stem cells in mammals. Science 327: 542-5
Li Q, Liu LH, Chang RX, Pan GB, Chen G, Gao M, Cai LQ, Wang PG, Pimentel JD, Pittelkow MR, Yang S, Zhang XJ (2014). Two cases of Marie Unna hereditary hypotrichosis:
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 129
Chapter 8 References
clinical features and mutation analysis of the U2HR and EPS8L3 genes. Clin Exp Dermatol 39: 225-7
Lim X, Nusse R (2013). Wnt signaling in skin development, homeostasis, and disease. Cold Spring Harb Perspect Biol 5
Lin Z, Chen Q, Shi L, Lee M, Giehl KA, Tang Z, Wang H, Zhang J, Yin J, Wu L, Xiao R, Liu X, Dai L, Zhu X, Li R, Betz RC, Zhang X, Yang Y (2012). Loss-of-function mutations in HOXC13 cause pure hair and nail ectodermal dysplasia. Am J Hum Genet 91: 906-11
Liu YT, Guo K, Li J, Liu Y, Zeng WH, Geng SM (2015). Novel mutations in GJB6 and GJB2 in Clouston syndrome. Clin Exp Dermatol 40: 770-3
Matise TC, Chen F, Chen W, De La Vega FM, Hansen M, He C, Hyland FC, Kennedy GC, Kong X, Murray SS, Ziegle JS, Stewart WC, Buyske S (2007). A second-generation combined linkage physical map of the human genome. Genome Res 17: 1783-6
McGrath JA, Stone KL, Begum R, Simpson MA, Dopping-Hepenstal PJ, Liu L, McMillan JR, South AP, Pourreyron C, McLean WH, Martinez AE, Mellerio JE, Parsons M (2012). Germline Mutation in EXPH5 Implicates the Rab27B Effector Protein Slac2-b in Inherited Skin Fragility. Am J Hum Genet 91: 1115-21
Mehmood S, Jan A, Muhammad D, Ahmad F, Mir H, Younus M, Ali G, Ayub M, Ansar M, Ahmad W (2015). Mutations in the lipase-H gene causing autosomal recessive hypotrichosis and woolly hair. Australas J Dermatol 56: e66-70
Mehmood S, Jan A, Raza SI, Ahmad F, Younus M, Irfanullah, Shahi S, Ayub M, Khan S, Ahmad W (2016a). Disease causing homozygous variants in the human hairless gene. Int J Dermatol 55: 977-81
Mehmood S, Raza SI, Van Bokhoven H, Ahmad W (2017). Autosomal recessive transmission of a rare HOXC13 variant causes pure hair and nail ectodermal dysplasia. Clin Exp Dermatol doi: 10.1111/ced.13115.
Mehmood S, Shah SH, Jan A, Younus M, Ahmad F, Ayub M, Ahmad W (2016b). Frameshift Sequence Variants in the Human Lipase-H Gene Causing Hypotrichosis. Pediatr Dermatol 33: e40-2
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 130
Chapter 8 References
Mikkola ML (2007). Genetic basis of skin appendage development. Semin Cell Dev Biol 18: 225-36
Mikkola ML (2008). TNF superfamily in skin appendage development. Cytokine Growth Factor Rev 19: 219-30
Mikkola ML, Millar SE (2006). The mammary bud as a skin appendage: unique and shared aspects of development. J Mammary Gland Biol Neoplasia 11: 187-203
Mikkola ML, Thesleff I (2003). Ectodysplasin signaling in development. Cytokine Growth Factor Rev 14: 211-24
Mina M, Kollar EJ (1987). The induction of odontogenesis in non-dental mesenchyme combined with early murine mandibular arch epithelium. Arch Oral Biol 32: 123-7
Mir H, Khan S, Arif MS, Ali G, Wali A, Ansar M, Ahmad W (2012). Mutations in the gene phospholipase C, delta-1 (PLCD1) underlying hereditary leukonychia. Eur J Dermatol 22: 736-9
Moore KA, Lemischka IR (2006). Stem cells and their niches. Science 311: 1880-5
Morris DR, Geballe AP (2000). Upstream open reading frames as regulators of mRNA translation. Mol Cell Biol 20: 8635-42
Mou C, Jackson B, Schneider P, Overbeek PA, Headon DJ (2006). Generation of the primary hair follicle pattern. Proc Natl Acad Sci U S A 103: 9075-80
Mueller TD, Nickel J (2012). Promiscuity and specificity in BMP receptor activation. FEBS Lett 586: 1846-59
Myers KA, Farquhar DR (2001). The rational clinical examination. Does this patient have clubbing? JAMA 286: 341-7
Myung PS, Takeo M, Ito M, Atit RP (2013). Epithelial Wnt ligand secretion is required for adult hair follicle growth and regeneration. J Invest Dermatol 133: 31-41
Naeem M, Jelani M, Lee K, Ali G, Chishti MS, Wali A, Gul A, John P, Hassan MJ, Leal SM, Ahmad W (2006a). Ectodermal dysplasia of hair and nail type: mapping of a novel locus to chromosome 17p12-q21.2. Br J Dermatol 155: 1184-90
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 131
Chapter 8 References
Naeem M, Wajid M, Lee K, Leal SM, Ahmad W (2006b). A mutation in the hair matrix and cuticle keratin KRTHB5 gene causes ectodermal dysplasia of hair and nail type. J Med Genet 43: 274-9
Naz G, Ali G, Naqvi SK, Azeem Z, Ahmad W (2010). Mapping of a novel autosomal recessive hypotrichosis locus on chromosome 10q11.23-22.3. Hum Genet 127: 395-401
Naz G, Pasternack SM, Perrin C, Mattheisen M, Refke M, Khan S, Gul A, Simons M, Ahmad W, Betz RC (2012). FZD6 encoding the Wnt receptor frizzled 6 is mutated in autosomal- recessive nail dysplasia. Br J Dermatol 166: 1088-94
Niehrs C (2012). The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol 13: 767-79
Ogawa M, Akiyama M (2014). Successful topical adapalene treatment for the facial lesions of an adolescent case of epidermolytic ichthyosis. J Am Acad Dermatol 71: e103-5
Oji V, Tadini G, Akiyama M, Blanchet Bardon C, Bodemer C, Bourrat E, Coudiere P, DiGiovanna JJ, Elias P, Fischer J, Fleckman P, Gina M, Harper J, Hashimoto T, Hausser I, Hennies HC, Hohl D, Hovnanian A, Ishida-Yamamoto A, Jacyk WK, Leachman S, Leigh I, Mazereeuw-Hautier J, Milstone L, Morice-Picard F, Paller AS, Richard G, Schmuth M, Shimizu H, Sprecher E, Van Steensel M, Taieb A, Toro JR, Vabres P, Vahlquist A, Williams M, Traupe H (2010). Revised nomenclature and classification of inherited ichthyoses: results of the First Ichthyosis Consensus Conference in Soreze 2009. J Am Acad Dermatol 63: 607-41
Okabe K, Hayashi M, Kato K, Okumura M, Fukui R, Honoki K, Fukushima N, Tsujiuchi T (2013). Lysophosphatidic acid receptor-3 increases tumorigenicity and aggressiveness of rat hepatoma RH7777 cells. Mol Carcinog 52: 247-54
Ostrowski M, Carmo NB, Krumeich S, Fanget I, Raposo G, Savina A, Moita CF, Schauer K, Hume AN, Freitas RP, Goud B, Benaroch P, Hacohen N, Fukuda M, Desnos C, Seabra MC, Darchen F, Amigorena S, Moita LF, Thery C (2010). Rab27a and Rab27b control different steps of the exosome secretion pathway. Nat Cell Biol 12: 19-30; sup pp 1-13
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 132
Chapter 8 References
Panganiban G, Irvine SM, Lowe C, Roehl H, Corley LS, Sherbon B, Grenier JK, Fallon JF, Kimble J, Walker M, Wray GA, Swalla BJ, Martindale MQ, Carroll SB (1997). The origin and evolution of animal appendages. Proc Natl Acad Sci U S A 94: 5162-6
Pasternack SM, Refke M, Paknia E, Hennies HC, Franz T, Schafer N, Fryer A, van Steensel M, Sweeney E, Just M, Grimm C, Kruse R, Ferrandiz C, Nothen MM, Fischer U, Betz RC (2013). Mutations in SNRPE, which encodes a core protein of the spliceosome, cause autosomal-dominant hypotrichosis simplex. Am J Hum Genet 92: 81-7
Pasternack SM, von Kugelgen I, Al Aboud K, Lee YA, Ruschendorf F, Voss K, Hillmer AM, Molderings GJ, Franz T, Ramirez A, Nurnberg P, Nothen MM, Betz RC (2008). G protein-coupled receptor P2Y5 and its ligand LPA are involved in maintenance of human hair growth. Nat Genet 40: 329-34
Pasternack SM, von Kugelgen I, Muller M, Oji V, Traupe H, Sprecher E, Nothen MM, Janecke AR, Betz RC (2009). In vitro analysis of LIPH mutations causing hypotrichosis simplex: evidence confirming the role of lipase H and lysophosphatidic acid in hair growth. J Invest Dermatol 129: 2772-6
Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE (2004). UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25: 1605-12
Pinheiro M, Freire-Maia N (1994). Ectodermal dysplasias: a clinical classification and a causal review. Am J Med Genet 53: 153-62
Pispa J, Pummila M, Barker PA, Thesleff I, Mikkola ML (2008). Edar and Troy signalling pathways act redundantly to regulate initiation of hair follicle development. Hum Mol Genet 17: 3380-91
Priolo M (2009). Ectodermal dysplasias: an overview and update of clinical and molecular- functional mechanisms. Am J Med Genet A 149A: 2003-13
Priolo M, Silengo M, Lerone M, Ravazzolo R (2000). Ectodermal dysplasias: not only 'skin' deep. Clin Genet 58: 415-30
Proksch E, Brandner JM, Jensen JM (2008). The skin: an indispensable barrier. Exp Dermatol 17: 1063-72
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 133
Chapter 8 References
Radner FP, Marrakchi S, Kirchmeier P, Kim GJ, Ribierre F, Kamoun B, Abid L, Leipoldt M, Turki H, Schempp W, Heilig R, Lathrop M, Fischer J (2013). Mutations in CERS3 cause autosomal recessive congenital ichthyosis in humans. PLoS Genet 9: e1003536
Rafiq MA, Ansar M, Pham T, Amin-ud-Din M, Anwar M, Haque S, Chahrour MH, Yan K, Leal SM, Ahmad W (2004). Localization of a novel locus for hereditary nail dysplasia to chromosome 17q25.1-17q25.3. Clin Genet 66: 73-8
Rafiq MA, Faiyaz-Ul-Haque M, Ud Din MA, Malik S, Sohail M, Anwar M, Haque S, Paterson AD, Tsui LC, Ahmad W (2005). A novel locus of ectodermal dysplasia maps to chromosome 10q24.32-q25.1. J Invest Dermatol 124: 338-42
Ramot Y, Horev L, Smolovich I, Molho-Pessach V, Zlotogorski A (2010). Marie Unna hereditary hypotrichosis caused by a novel mutation in the human hairless transcript. Exp Dermatol 19: e320-2
Rasool M, Nawaz S, Azhar A, Wajid M, Westermark P, Baig SM, Klar J, Dahl N (2010). Autosomal recessive pure hair and nail ectodermal dysplasia linked to chromosome 12p11.1-q14.3 without KRTHB5 gene mutation. Eur J Dermatol 20: 443-6
Raykova D, Klar J, Azhar A, Khan TN, Malik NA, Iqbal M, Tariq M, Baig SM, Dahl N (2014). Autosomal recessive transmission of a rare KRT74 variant causes hair and nail ectodermal dysplasia: allelism with dominant woolly hair/hypotrichosis. PLoS One 9: e93607
Raza SI, Muhammad D, Jan A, Ali RH, Hassan M, Ahmad W, Rashid S (2014). In silico analysis of missense mutations in LPAR6 reveals abnormal phospholipid signaling pathway leading to hypotrichosis. PLoS One 9: e104756
Raza SI, Muhammad N, Khan S, Ahmad W (2013). A novel missense mutation in the gene FZD6 underlies autosomal recessive nail dysplasia. Br J Dermatol 168: 422-5
Richard G (2005). Connexin disorders of the skin Clinics in Dermatology 23: 23–32
Richard G, Rouan F, Willoughby CE, Brown N, Chung P, Ryynanen M, Jabs EW, Bale SJ, DiGiovanna JJ, Uitto J, Russell L (2002). Missense mutations in GJB2 encoding connexin-26 cause the ectodermal dysplasia keratitis-ichthyosis-deafness syndrome. Am J Hum Genet 70: 1341-8
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 134
Chapter 8 References
Richardson ES, Lee JB, Hyde PH, Richard G (2006). A novel mutation and large size polymorphism affecting the V2 domain of keratin 1 in an African-American family with severe, diffuse palmoplantar keratoderma of the ichthyosis hystrix Curth-Macklin type. J Invest Dermatol 126: 79-84
Rishikaysh P, Dev K, Diaz D, Qureshi WM, Filip S, Mokry J (2014). Signaling involved in hair follicle morphogenesis and development. Int J Mol Sci 15: 1647-70
Robinson GC, Miller JR, Bensimon JR (1962). Familial ectodermal dysplasia with sensori-neural hearing loss and other anomalies. Pediatrics 30: 797–802
Rodriguez-Pazos L, Ginarte M, Vega A, Toribio J (2013). Autosomal recessive congenital ichthyosis. Actas Dermosifiliogr 104: 270-84
Roger S. Holmes, Laura A (2012). Cox. Comparative structures and evolution of mammalian lipase I (LIPI) genes and proteins: A close relative of vertebrate phospholipase LIPH. Nat Sci 12: 26151-14
Rognoni E, Ruppert R, Fassler R (2016). The kindlin family: functions, signaling properties and implications for human disease. J Cell Sci 129: 17-27
Rothnagel JA, Dominey AM, Dempsey LD, Longley MA, Greenhalgh DA, Gagne TA, Huber M, Frenk E, Hohl D, Roop DR (1992). Mutations in the rod domains of keratins 1 and 10 in epidermolytic hyperkeratosis. Science 257: 1128-30
Sadier A, Viriot L, Pantalacci S, Laudet V (2014). The ectodysplasin pathway: from diseases to adaptations. Trends Genet 30: 24-31
Sandridge AL, Takeddin J, Al-Kaabi E, Frances Y (2010) Consanguinity in Qatar: knowledge, attitude and practice in a population born between 1946 and 1991. J
Sato K, Kang WH, Saga K, Sato KT (1989). Biology of sweat glands and their disorders. I. Normal sweat gland function. J Am Acad Dermatol 20: 537-63
Sato-Matsumura KC, Yasukawa K, Tomita Y, Shimizu H (2002). Toenail dystrophy with COL7A1 glycine substitution mutations segregates as an autosomal dominant trait in 2 families with dystrophic epidermolysis bullosa. Arch Dermatol 138: 269-71
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 135
Chapter 8 References
Scheper GC, van der Knaap MS, Proud CG (2007). Translation matters: protein synthesis defects in inherited disease. Nat Rev Genet 8: 711-23
Schmidt-Ullrich R, Paus R (2005). Molecular principles of hair follicle induction and morphogenesis. Bioessays 27: 247-61
Schneidman-Duhovny D, Inbar Y, Nussinov R, Wolfson HJ (2005). PatchDock and SymmDock: servers for rigid and symmetric docking. Nucleic Acids Res 33: W363-7
Schulpen TW, van Wieringen JC, van Brummen PJ, van Riel JM, Beemer FA, Westers P, Huber J (2006). Infant mortality, ethnicity, and genetically determined disorders in The Netherlands. Eur J Public Health 16:291-294
Schulze HD (1966). [Hereditary partial onycholysis with scleronychia]. Dermatol Wochenschr 152: 766-75
Scott CA, Tattersall D, O'Toole EA, Kelsell DP (2012). Connexins in epidermal homeostasis and skin disease. Biochim Biophys Acta 1818: 1952-61
Sdobnov A, Darvin ME, Lademann J, Tuchin V (2017). A comparative study of ex vivo skin optical clearing using two-photon microscopy. J Biophotonics
Sehgal VN (2007). Twenty nail dystrophy trachyonychia: an overview. J Dermatol 34: 361-6
Seki Y, Yoshida Y, Ishimine H, Shinozaki-Ushiku A, Ito Y, Sumitomo K, Nakajima J, Fukayama M, Michiue T, Asashima M, Kurisaki A (2014). Lipase member H is a novel secreted protein selectively upregulated in human lung adenocarcinomas and bronchioloalveolar carcinomas. Biochem Biophys Res Commun 443: 1141-7
Shimizu H, Hammami-Hauasli N, Hatta N, Nishikawa T, Bruckner-Tuderman L (1999). Compound heterozygosity for silent and dominant glycine substitution mutations in COL7A1 leads to a marked transient intracytoplasmic retention of procollagen VII and a moderately severe dystrophic epidermolysis bullosa phenotype. J Invest Dermatol 113: 419-21
Shimomura Y, Agalliu D, Vonica A, Luria V, Wajid M, Baumer A, Belli S, Petukhova L, Schinzel A, Brivanlou AH, Barres BA, Christiano AM (2010a). APCDD1 is a novel Wnt inhibitor mutated in hereditary hypotrichosis simplex. Nature 464: 1043-7
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 136
Chapter 8 References
Shimomura Y, Wajid M, Ishii Y, Shapiro L, Petukhova L, Gordon D, Christiano AM (2008). Disruption of P2RY5, an orphan G protein-coupled receptor, underlies autosomal recessive woolly hair. Nat Genet 40: 335-9
Shimomura Y, Wajid M, Kurban M, Sato N, Christiano AM (2010b). Mutations in the keratin 85 (KRT85/hHb5) gene underlie pure hair and nail ectodermal dysplasia. J Invest Dermatol 130: 892-5
Shimomura Y, Wajid M, Petukhova L, Kurban M, Christiano AM (2010c). Autosomal-dominant woolly hair resulting from disruption of keratin 74 (KRT74), a potential determinant of human hair texture. Am J Hum Genet 86: 632-8
Shimomura Y, Wajid M, Petukhova L, Shapiro L, Christiano AM (2009). Mutations in the lipase H gene underlie autosomal recessive woolly hair/hypotrichosis. J Invest Dermatol 129: 622-8
Siegel DH, Ashton GH, Penagos HG, Lee JV, Feiler HS, Wilhelmsen KC, South AP, Smith FJ, Prescott AR, Wessagowit V, Oyama N, Akiyama M, Al Aboud D, Al Aboud K, Al Githami A, Al Hawsawi K, Al Ismaily A, Al-Suwaid R, Atherton DJ, Caputo R, Fine JD, Frieden IJ, Fuchs E, Haber RM, Harada T, Kitajima Y, Mallory SB, Ogawa H, Sahin S, Shimizu H, Suga Y, Tadini G, Tsuchiya K, Wiebe CB, Wojnarowska F, Zaghloul AB, Hamada T, Mallipeddi R, Eady RA, McLean WH, McGrath JA, Epstein EH (2003). Loss of kindlin-1, a human homolog of the Caenorhabditis elegans actin-extracellular-matrix linker protein UNC-112, causes Kindler syndrome. Am J Hum Genet 73: 174-87
Smith FJ, Irvine AD, Terron-Kwiatkowski A, Sandilands A, Campbell LE, Zhao Y, Liao H, Evans AT, Goudie DR, Lewis-Jones S, Arseculeratne G, Munro CS, Sergeant A, O'Regan G, Bale SJ, Compton JG, DiGiovanna JJ, Presland RB, Fleckman P, McLean WH (2006). Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris. Nat Genet 38: 337-42
Smith FJ, Morley SM, McLean WH (2002). A novel connexin 30 mutation in Clouston syndrome. J Invest Dermatol 118: 530-2
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 137
Chapter 8 References
Sonoda H, Aoki J, Hiramatsu T, Ishida M, Bandoh K, Nagai Y, Taguchi R, Inoue K, Arai H (2002). A novel phosphatidic acid-selective phospholipase A1 that produces lysophosphatidic acid. J Biol Chem 277: 34254-63
Spitz JL (2005). Genodermatoses: A Clinical Guide to Genetic Skin Disorders, 2nd edn. Philadelphia, PA: Lippincott Williams and Wilkins, 286.
Sprecher E, Lestringant GG, Szargel R, Bergman R, Labay V, Frossard PM, Friedman-Birnbaum R, Cohen N (1999). Atrichia with papular lesions resulting from a nonsense mutation within the human hairless gene. J Invest Dermatol 113: 687-90
Stamos JL, Chu ML, Enos MD, Shah N, Weis WI (2014). Structural basis of GSK-3 inhibition by N-terminal phosphorylation and by the Wnt receptor LRP6. Elife 3: e01998
Stoddard NC, Chun J (2015). Promising pharmacological directions in the world of lysophosphatidic Acid signaling. Biomol Ther (Seoul) 23: 1-11
Strandskov HH (1939). Inheritance of absence of thumb nails. J Hered 30: 53–4
Sugiura K, Akiyama M (2015a). Lamellar ichthyosis caused by a previously unreported homozygous ALOXE3 mutation in East Asia. Acta Derm Venereol 95: 858-9
Sugiura K, Akiyama M (2015b). Update on autosomal recessive congenital ichthyosis: mRNA analysis using hair samples is a powerful tool for genetic diagnosis. J Dermatol Sci 79: 4- 9
Sugiura K, Takeichi T, Tanahashi K, Ito Y, Kosho T, Saida K, Uhara H, Okuyama R, Akiyama M (2013). Lamellar ichthyosis in a collodion baby caused by CYP4F22 mutations in a non-consanguineous family outside the Mediterranean. J Dermatol Sci 72: 193-5
Sundberg JP, Boggess D, Sundberg BA, Eilertsen K, Parimoo S, Filippi M, Stenn K (2000). Asebia-2J (Scd1(ab2J)): a new allele and a model for scarring alopecia. Am J Pathol 156: 2067-75
Takahashi T, Kamimura A, Hamazono-Matsuoka T, Honda S (2003). Phosphatidic acid has a potential to promote hair growth in vitro and in vivo, and activates mitogen-activated protein kinase/extracellular signal-regulated kinase kinase in hair epithelial cells. J Invest Dermatol 121: 448-56
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 138
Chapter 8 References
Takeichi T, Akiyama M (2016). Inherited ichthyosis: Non-syndromic forms. J Dermatol 43: 242-51
Tan E, Tay YK (2000). What syndrome is this? Hereditary ectodermal dysplasia. Ped Dermatol 17: 65–67.
Tariq M, Ayub M, Jelani M, Basit S, Naz G, Wasif N, Raza SI, Naveed AK, ullah Khan S, Azeem Z, Yasinzai M, Wali A, Ali G, Chishti MS, Ahmad W (2009). Mutations in the P2RY5 gene underlie autosomal recessive hypotrichosis in 13 Pakistani families. Br J Dermatol 160: 1006-10
Thesleff I, Mikkola ML (2002). Death receptor signaling giving life to ectodermal organs. Sci STKE 2002: pe22
Thompson CC (2009). Hairless is a nuclear receptor corepressor essential for skin function. Nucl Recept Signal 7: e010
Tosti A, Bardazzi F, Piraccini BM, Fanti PA (1994). Idiopathic trachyonychia (twenty-nail dystrophy): a pathological study of 23 patients. Br J Dermatol 131: 866-72
Traupe H, Fischer J, Oji V (2014). Nonsyndromic types of ichthyoses - an update. J Dtsch Dermatol Ges 12: 109-21
Tsujiuchi T, Araki M, Hirane M, Dong Y, Fukushima N (2014). Lysophosphatidic acid receptors in cancer pathobiology. Histol Histopathol 29: 313-21
Tucker AS (2007). Salivary gland development. Semin Cell Dev Biol 18: 237-44
Turk D, Janjic V, Stern I, Podobnik M, Lamba D, Dahl SW, Lauritzen C, Pedersen J, Turk V, Turk B (2001). Structure of human dipeptidyl peptidase I (cathepsin C): exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases. EMBO J 20: 6570-82
Turner N, Grose R (2010). Fibroblast growth factor signalling: from development to cancer. Nat Rev Cancer 10: 116-29
Tzschach A, Bozorgmehr B, Hadavi V, Kahrizi K, Garshasbi M, Motazacker MM, Ropers HH, Kuss AW, Najmabadi H (2008). Alopecia-mental retardation syndrome: clinical and molecular characterization of four patients. Br J Dermatol 159: 748-51
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 139
Chapter 8 References
Unger VM, Kumar NM, Gilula NB, Yeager M (1999). Three-dimensional structure of a recombinant gap junction membrane channel. Science 283: 1176-80
Unna M (1925). Uber, Hypotrichosis congenita hereditaria, Dermatol. Wochenschr. 81: 1167– 1178
Vahlquist A, Bygum A, Ganemo A, Virtanen M, Hellstrom-Pigg M, Strauss G, Brandrup F, Fischer J (2010). Genotypic and clinical spectrum of self-improving collodion ichthyosis: ALOX12B, ALOXE3, and TGM1 mutations in Scandinavian patients. J Invest Dermatol 130: 438-43 van Amerongen R, Nusse R (2009). Towards an integrated view of Wnt signaling in development. Development 136: 3205-14
Van Esch H, Hollanders K, Badisco L, Melotte C, Van Hummelen P, Vermeesch JR, Devriendt K, Fryns JP, Marynen P, Froyen G (2005). Deletion of VCX-A due to NAHR plays a major role in the occurrence of mental retardation in patients with X-linked ichthyosis. Hum Mol Genet 14: 1795-803 van Steensel M, Smith FJ, Steijlen PM, Kluijt I, Stevens HP, Messenger A, Kremer H, Dunnill MG, Kennedy C, Munro CS, Doherty VR, McGrath JA, Covello SP, Coleman CM, Uitto J, McLean WH (1999). The gene for hypotrichosis of Marie Unna maps between D8S258 and D8S298: exclusion of the hr gene by cDNA and genomic sequencing. Am J Hum Genet 65: 413-9 van Steensel MA, Jonkman MF, van Geel M, Steijlen PM, McLean WH, Smith FJ (2003). Clouston syndrome can mimic pachyonychia congenita. J Invest Dermatol 121: 1035-8 van Steensel MA, Steijlen PM, Bladergroen RS, Hoefsloot EH, van Ravenswaaij-Arts CM, van Geel M (2004a). A phenotype resembling the Clouston syndrome with deafness is associated with a novel missense GJB2 mutation. J Invest Dermatol 123: 291-3 van Steensel MA, van Geel M, Steijlen PM (2004b). Molecular genetics of hereditary hair and nail disease. Am J Med Genet C Semin Med Genet 131C: 52-60
Verhelst K, Gardam S, Borghi A, Kreike M, Carpentier I, Beyaert R (2015). XEDAR activates the non-canonical NF-kappaB pathway. Biochem Biophys Res Commun 465: 275-80
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 140
Chapter 8 References
Voog J, Jones DL (2010). Stem cells and the niche: a dynamic duo. Cell Stem Cell 6: 103-15
Voutilainen M, Lindfors PH, Trela E, Lonnblad D, Shirokova V, Elo T, Rysti E, Schmidt-Ullrich R, Schneider P, Mikkola ML (2015). Ectodysplasin/NF-kappaB Promotes Mammary Cell Fate via Wnt/beta-catenin Pathway. PLoS Genet 11: e1005676
Wali A, Ali G, John P, Lee K, Chishti MS, Leal SM, Ahmad W (2007). Mapping of a gene for alopecia with mental retardation syndrome (APMR3) on chromosome 18q11.2-q12.2. Ann Hum Genet 71: 570-7
Wali A, John P, Gul A, Lee K, Chishti MS, Ali G, Hassan MJ, Leal SM, Ahmad W (2006). A novel locus for alopecia with mental retardation syndrome (APMR2) maps to chromosome 3q26.2-q26.31. Clin Genet 70: 233-9
Wallace AC, Laskowski RA, Thornton JM (1995). LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions. Protein Eng 8: 127-34
Warnich L, Kotze MJ, Groenewald IM, Groenewald JZ, van Brakel MG, van Heerden CJ, de Villiers JN, van de Ven WJ, Schoenmakers EF, Taketani S, Retief AE (1996). Identification of three mutations and associated haplotypes in the protoporphyrinogen oxidase gene in South African families with variegate porphyria. Hum Mol Genet 5: 981- 4
Washio K, Fukunaga A, Terai M, Hitomi K, Yamanishi K, Nishigori C (2014). Hypohidrosis plays a crucial role in the vicious circle of bathing suit ichthyosis: a case with summer exacerbation. Acta Derm Venereol 94: 349-50
Wasif N, Ahmad W (2013). A novel nonsense mutation in RSPO4 gene underlies autosomal recessive congenital anonychia in a Pakistani family. Pediatr Dermatol 30: 139-41
Wen Y, Liu Y, Xu Y, Zhao Y, Hua R, Wang K, Sun M, Li Y, Yang S, Zhang XJ, Kruse R, Cichon S, Betz RC, Nothen MM, van Steensel MA, van Geel M, Steijlen PM, Hohl D, Huber M, Dunnill GS, Kennedy C, Messenger A, Munro CS, Terrinoni A, Hovnanian A, Bodemer C, de Prost Y, Paller AS, Irvine AD, Sinclair R, Green J, Shang D, Liu Q, Luo Y, Jiang L, Chen HD, Lo WH, McLean WH, He CD, Zhang X (2009). Loss-of-function mutations of an inhibitory upstream ORF in the human hairless transcript cause Marie Unna hereditary hypotrichosis. Nat Genet 41: 228-33
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 141
Chapter 8 References
Willecke K, Eiberger J, Degen J, Eckardt D, Romualdi A, Guldenagel M, Deutsch U, Sohl G (2002). Structural and functional diversity of connexin genes in the mouse and human genome. Biol Chem 383: 725-37
Williams ML, Elias PM (1985). Heterogeneity in autosomal recessive ichthyosis. Clinical and biochemical differentiation of lamellar ichthyosis and nonbullous congenital ichthyosiform erythroderma. Arch Dermatol 121: 477-88
Wilson NJ, Hansen CD, Azkur D, Kocabas CN, Metin A, Coskun Z, Schwartz ME, Hull PR, McLean WH, Smith FJ (2013). Recessive mutations in the gene encoding frizzled 6 cause twenty nail dystrophy--expanding the differential diagnosis for pachyonychia congenita. J Dermatol Sci 70: 58-60
Wodarz A, Nusse R (1998). Mechanisms of Wnt signaling in development. Annu Rev Cell Dev Biol 14: 59-88
Woodley DT (2017). Distinct Fibroblasts in the Papillary and Reticular Dermis: Implications for Wound Healing. Dermatol Clin 35: 5-100.
Xie T, Li L (2007). Stem cells and their niche: an inseparable relationship. Development 134: 2001-6
Yan M, Wang LC, Hymowitz SG, Schilbach S, Lee J, Goddard A, de Vos AM, Gao WQ, Dixit VM (2000). Two-amino acid molecular switch in an epithelial morphogen that regulates binding to two distinct receptors. Science 290: 523-7
Yan M, Zhang Z, Brady JR, Schilbach S, Fairbrother WJ, Dixit VM (2002). Identification of a novel death domain-containing adaptor molecule for ectodysplasin-A receptor that is mutated in crinkled mice. Curr Biol 12: 409-13
Yanagida K, Masago K, Nakanishi H, Kihara Y, Hamano F, Tajima Y, Taguchi R, Shimizu T, Ishii S (2009). Identification and characterization of a novel lysophosphatidic acid receptor, p2y5/LPA6. J Biol Chem 284: 17731-41
Yeager M (1998). Structure of cardiac gap junction intercellular channels. J Struct Biol 121: 231- 45
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 142
Chapter 8 References
Yoneda K (2003). Ichthyotic syndromes. In: Tamaki K, Iizuka H, Shimizu H,Tomita Y, Miyachi Y, Hashimoto K, Furue M, eds. Comprehensive Handbook of Clinical Dermatology, 1st edn, Vol. 7. Tokyo: Nakayama Publishing Company, 103–127
Yoneda K (2016). Inherited ichthyosis: Syndromic forms. J Dermatol 43: 252-63
Yoneda K, Nakagawa T, Lawrence OT, Huard J, Demitsu T, Kubota Y, Presland RB (2012). Interaction of the profilaggrin N-terminal domain with loricrin in human cultured keratinocytes and epidermis. J Invest Dermatol 132: 1206-14
Yung YC, Stoddard NC, Chun J (2014). LPA receptor signaling: pharmacology, physiology, and pathophysiology. J Lipid Res 55: 1192-214
Zhang X, Guo BR, Cai LQ, Jiang T, Sun LD, Cui Y, Hu JC, Zhu J, Chen G, Tang XF, Sun GQ, Tang HY, Liu Y, Li M, Li QB, Cheng H, Gao M, Li P, Yang X, Zuo XB, Zheng XD, Wang PG, Wang J, Liu JJ, Yang S, Li YR, Zhang XJ (2012). Exome sequencing identified a missense mutation of EPS8L3 in Marie Unna hereditary hypotrichosis. J Med Genet 49: 727-30
Zhou C, Zang D, Jin Y, Wu H, Liu Z, Du J, Zhang J (2011). Mutation in ribosomal protein L21 underlies hereditary hypotrichosis simplex. Hum Mutat 32: 710-4
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 143
Chapter 8 References
Electronic Database Information
http://www.ncbi.nlm.nih.gov/omim/ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val= http://www.expasy.org/uniprot http://genome.ucsc.edu/cgi-bin/hgGateway http://www.ncbi.nlm.nih.gov/sites/entrez?db=homologene http://www.ensembl.org/Homo-sapiens http://au.expasy.org/uniprot/P43657 tools.invitrogen.com/content/sfs/manuals/pcdna3.1topota_man.pdf http://www.scholl.com/en-GB/Toenails/Page.raction
Clinical and Molecular Characterization of Human Hereditary Disorders of Ectodermal Appendages 144