Development of Microsatellite Loci in Mediterranean

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Development of Microsatellite Loci in Mediterranean Sarsaparilla (Smilax aspera; Smilacaceae) Using Transcriptome Data Author(s): Zhe-Chen Qi, Chao Shen, Yu-Wei Han, Wei Shen, Man Yang, Jinliang Liu, Zong-Suo Liang, Pan Li, and Cheng-Xin Fu Source: Applications in Plant Sciences, 5(4) Published By: Botanical Society of America DOI: http://dx.doi.org/10.3732/apps.1700005 URL: http://www.bioone.org/doi/full/10.3732/apps.1700005 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Applications in Plant Sciences 2017 5(4): 1700005 Applications in Plant Sciences PRIMER NOTE DEVELOPMENT OF MICROSATELLITE LOCI IN MEDITERRANEAN SARSAPARILLA (SMILAX ASPERA; SMILACACEAE) USING 1 TRANSCRIPTOME DATA ZHE-CHEN QI2,3, CHAO SHEN2,3, YU-WEI HAN2, WEI SHEN2, MAN YANG2, JINLIANG LIU2, ZONG-SUO LIANG2,3,5, PAN LI4,5, AND CHENG-XIN FU4 2College of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018, People’s Republic of China; 3Zhejiang Province Key Laboratory of Plant Secondary Metabolism and Regulation, Hangzhou 310018, People’s Republic of China; and 4Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education, and Laboratory of Systematic and Evolutionary Botany and Biodiversity, College of Life Sciences, Zhejiang University, Hangzhou 310058, People’s Republic of China • Premise of the study: Although several microsatellite markers of Smilax aspera (Smilacaceae) have been reported in a previous study, due to universality issues in cross-population amplification, we have newly developed microsatellite markers for S. aspera based on transcriptome data to further investigate gene flow and genetic structure of its circum-Mediterranean, East African, and South Asian populations. • Methods and Results: A total of 4854 simple sequence repeat (SSR) primer pairs were designed from 99,193 contigs acquired from public transcriptome data of S. bona-nox. Forty-six microsatellite loci were selected for further genotyping in 12 S. aspera populations. The number of alleles varied from three to 28, and 93.5% of the developed microsatellite markers could be cross- amplified in least one of three congeneric Smilax species. • Conclusions: The SSR markers developed in this study will facilitate further studies on genetic diversity and phylogeographic patterns of S. aspera in intercontinental geographical scales. Key words: deep lineage divergence; intercontinental disjunction; microsatellites; Smilacaceae; Smilax aspera; Tethyan veg- etation; transcriptome. Smilax aspera L. (Smilacaceae) is a prickly woody climber insights into intra- and interpopulation gene flow and genetic with sclerophyllous leaves, small dioecious flowers, and fleshy drift. Therefore, more efficient codominant markers such as mi- red berries. This species is widespread throughout the circum- crosatellites should be developed to allow further study. Mediterranean region and has a disjunct distribution into the Xu et al. (2011) reported 14 simple sequence repeat (SSR) East African upland evergreen forest and South Asian seasonal markers of S. aspera developed in Greek and Italian popula- forest. With its Tethyan disjunction pattern, S. aspera represents tions using dual-suppression PCR, but three of the published an ideal model to test the dynamics and evolutionary history primers were not polymorphic. Also, through subsequent cross- of laurel forests in the Late Tertiary period (Mai, 1995; Chen population amplification investigation in eight populations from et al., 2014). A previous phylogeographic study (Chen et al., Africa, Asia, and the Mediterranean, they showed lack of univer- 2014) detected a deep lineage split between Mediterranean and sality. Our testing of these markers showed average amplification African-Asian populations of S. aspera and a complex biogeo- efficiency of 48.8%, and 71.4% of the markers had amplifica- graphical range evolution history based on cpDNA and ITS se- tion efficiency below 60%. Hence more reliable microsatellite quences. However, these markers could not reveal the recent markers are needed. Here, we developed 46 variable microsat- gene flow by pollen dispersal, and they did not provide detailed ellite markers for S. aspera based on transcriptome data of S. bona-nox L. (Matasci et al., 2014), and further tested their 1 Manuscript received 24 January 2017; revision accepted 7 March 2017. cross-amplification in three congeneric Smilax L. species. These The project was supported by the National Natural Science Foundation of additional microsatellite markers will secure enough polymor- China (grant no. 31400194, 31500184, 30830011), the Zhejiang Provincial phic loci and provide powerful information to assess genetic Public Welfare Technology and Application Research Project (grant no. characteristics and lineage divergence in natural populations of 2017C32044), the Science Foundation of Zhejiang Sci-Tech University S. aspera. (grant no. 14042010-Y), 521 Distinguished Young Scientist Foundation of Zhejiang Sci-Tech University (grant no. 11610132521509), and Basic Work Project of Ministry of Science and Technology (grant no. 2015FY110200). METHODS AND RESULTS 5 Authors for correspondence: [email protected] (Z.S.L.), panli@ zju.edu.cn (P.L.) A total of 96 individuals of S. aspera from 12 populations (eight individuals per population) and three congeneric species were used in this study (Appendix 1). doi:10.3732/apps.1700005 The populations of S. aspera encompass seven in the Mediterranean region, Applications in Plant Sciences 2017 5(4): 1700005; http://www.bioone.org/loi/apps © 2017 Qi et al. Published by the Botanical Society of America. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC-BY-NC-SA 4.0), which permits unrestricted noncommercial use and redistribution provided that the original author and source are credited and the new work is distributed under the same license as the original. 1 of 6 Applications in Plant Sciences 2017 5(4): 1700005 Qi et al.—Smilax aspera microsatellites doi:10.3732/apps.1700005 TABLE 1. Characteristics of 46 microsatellite loci developed for Smilax aspera. Locus Primer sequences (5′–3′) Repeat motif Allele size (bp) Ta (°C) A GenBank accession no. S003 F: TCCCCATTTCTCCTCACTTG (TTTTC)5 100 53 4 KY358008 R: GCCACTACAACAACTTAGTGATTTTG S004 F: GCCCACTTTCATTGCCTTTA (TCA)8 111 53 15 KY358009 R: AATGTGGGCGTGGTAAAAAG S006 F: AAAGGGGATGAGGAGAAGGA (AAG)7 133 59 9 KY358010 R: AAACCACCATGACTCCTCCA S007 F: CTGCTTCCAGACAGAGGAGG (TGGTT)5 139 59 8 KY358011 R: ACACTTCTTGGGTTGGCATC S009 F: GAGTGAGGAGGGAGGAGCTT (TC)33 159 58 23 KY358012 R: CCGGAGAACCAGATGAAGAC S016 F: AGAACTTGAGGGTGTGTGGG (T)10(TC)6 230 58 16 KY358013 R: TTCATGCATACTTTTGCCGA S028 F: TAATCCCTCGCGAAATCAAG (GATC)5 120 53 3 KY358014 R: CCCAAAATCGATCGAGAAAA S030 F: AAGCCAAGCAAACCCATTTA (GA)14 126 59 15 KY358015 R: CACCCTCTGACTCCGAAGAG S034 F: CAGGGAGTTGGTCCTCAAAA (T)21 154 59 12 KY358016 R: ATGGTTGCAAAGAAACACCC S046 F: CTAAGGCGATATCCTCAGCG (GTGGGC)5 226 59 7 KY358017 R: CAGCCACTTGGTATCCACCT S049 F: AAGGGACATTTTTGTTCCCC (TAAA)6 248 59 4 KY358018 R: GCAAGTTAAGCAACACAGTTAAGG S052 F: AGATCCACAGTTCCACCTGC (AAACTAT)10 266 59 8 KY358019 R: GCGCTTGATGTGCTCAAATA S053 F: GATCTGGGTTTCTCGTTGGA (CTGGGA)5 269 59 6 KY358020 R: GGCCATTTGGAAGAGACTGA S057 F: GAGATTTCCAGCAAAACCCA (CGAG)4 291 58 5 KY358021 R: AGTTTCTGGGCCCTCTGTCT S060 F: CCATGGTGGACGACTTTCTT (GAT)6 311 59 3 KY358022 R: GCATGGAAACGCCTATGATT S062 F: CTTGGCAACACCAATCAATG (TCCT)7 326 59 9 KY358023 R: TGCACGTGATCACTGGATCT S063 F: CATTTCGATGAATCGTGTGG (CATCT)5(TC)23 332 59 21 KY358024 R: GTAGGGTTCGGTGCTGATGT S066 F: TCGATTTCCACCCATTTCTC (CGCCAC)5 354 59 10 KY358025 R: GCTGAGTACTTGAGGGCGTC S072 F: CAGTGCCTCTTCCTTGCTTC (TGG)5(GTGGCC)3 402 59 16 KY358026 R: TATACCCAGGTCTCCGAACG S081 F: ATTTCGCCACTACCTTGCAC (CCCT)6 103 50 8 KY358027 R: ATCCTTCATTCAATGCCGAG S083 F: GGACTGGATTCCGTTTTGCT (CCTCTA)4 105 50 4 KY358028 R: AGCCAGGACATTGCCTTTAC S085 F: TGTTGGGTGAGCAAAACAAA (T)16 109 53 16 KY358029 R: ACCTTTCTCCCCACTTGCTT S086 F: TAATTGGCTTCGGATTGACC (AG)9 112 50 28 KY358030 R: GGAATTCGTTCTTCCCCATT S087 F: GGACTTGGTCATCAGGTCGT (TC)12TAGGTC(TCGGA)3 116 55 21 KY358031 R: TTGTGCAACCAAACTCCAGA S089 F: CACAAGCTTGATGAGGTCCA (TGGTT)3 125 53 7 KY358032 R: AAGGACACGGACCATGAAAG S090 F: AGCAGCCTTGGGCTTATTTT (TAAAC)3 132 53 5 KY358033 R: TTCTGTTGTGCGGATATTGG S093 F: GAAGGGAGGGAGGAGAAGTG (AG)12 135 53 7 KY358034 R: CCGTTTAAAGATCCCGTCAA S094 F: TGCTGGAAGAACAACGACTG (GCTGTT)4 143 50 4 KY358035 R: GTTACCGTTGGTCACCTGCT S096 F: TGGATTCATGTGTTTGGCTG (A)22 145 55 8 KY358036 R: AAATCAGGCCTCCTCATTGTAA S097 F: CACCTTCTCCTCCTCTTCCC (TTC)8 148 51 9 KY358037 R: TCATCTCCCCTCTTCTTCCC S100 F: CTGGAGATCTCACCCTCTCG
Recommended publications
  • Natural Heritage Program List of Rare Plant Species of North Carolina 2016

    Natural Heritage Program List of Rare Plant Species of North Carolina 2016

    Natural Heritage Program List of Rare Plant Species of North Carolina 2016 Revised February 24, 2017 Compiled by Laura Gadd Robinson, Botanist John T. Finnegan, Information Systems Manager North Carolina Natural Heritage Program N.C. Department of Natural and Cultural Resources Raleigh, NC 27699-1651 www.ncnhp.org C ur Alleghany rit Ashe Northampton Gates C uc Surry am k Stokes P d Rockingham Caswell Person Vance Warren a e P s n Hertford e qu Chowan r Granville q ot ui a Mountains Watauga Halifax m nk an Wilkes Yadkin s Mitchell Avery Forsyth Orange Guilford Franklin Bertie Alamance Durham Nash Yancey Alexander Madison Caldwell Davie Edgecombe Washington Tyrrell Iredell Martin Dare Burke Davidson Wake McDowell Randolph Chatham Wilson Buncombe Catawba Rowan Beaufort Haywood Pitt Swain Hyde Lee Lincoln Greene Rutherford Johnston Graham Henderson Jackson Cabarrus Montgomery Harnett Cleveland Wayne Polk Gaston Stanly Cherokee Macon Transylvania Lenoir Mecklenburg Moore Clay Pamlico Hoke Union d Cumberland Jones Anson on Sampson hm Duplin ic Craven Piedmont R nd tla Onslow Carteret co S Robeson Bladen Pender Sandhills Columbus New Hanover Tidewater Coastal Plain Brunswick THE COUNTIES AND PHYSIOGRAPHIC PROVINCES OF NORTH CAROLINA Natural Heritage Program List of Rare Plant Species of North Carolina 2016 Compiled by Laura Gadd Robinson, Botanist John T. Finnegan, Information Systems Manager North Carolina Natural Heritage Program N.C. Department of Natural and Cultural Resources Raleigh, NC 27699-1651 www.ncnhp.org This list is dynamic and is revised frequently as new data become available. New species are added to the list, and others are dropped from the list as appropriate.
  • Natural Heritage Program List of Rare Plant Species of North Carolina 2012

    Natural Heritage Program List of Rare Plant Species of North Carolina 2012

    Natural Heritage Program List of Rare Plant Species of North Carolina 2012 Edited by Laura E. Gadd, Botanist John T. Finnegan, Information Systems Manager North Carolina Natural Heritage Program Office of Conservation, Planning, and Community Affairs N.C. Department of Environment and Natural Resources 1601 MSC, Raleigh, NC 27699-1601 Natural Heritage Program List of Rare Plant Species of North Carolina 2012 Edited by Laura E. Gadd, Botanist John T. Finnegan, Information Systems Manager North Carolina Natural Heritage Program Office of Conservation, Planning, and Community Affairs N.C. Department of Environment and Natural Resources 1601 MSC, Raleigh, NC 27699-1601 www.ncnhp.org NATURAL HERITAGE PROGRAM LIST OF THE RARE PLANTS OF NORTH CAROLINA 2012 Edition Edited by Laura E. Gadd, Botanist and John Finnegan, Information Systems Manager North Carolina Natural Heritage Program, Office of Conservation, Planning, and Community Affairs Department of Environment and Natural Resources, 1601 MSC, Raleigh, NC 27699-1601 www.ncnhp.org Table of Contents LIST FORMAT ......................................................................................................................................................................... 3 NORTH CAROLINA RARE PLANT LIST ......................................................................................................................... 10 NORTH CAROLINA PLANT WATCH LIST ..................................................................................................................... 71 Watch Category
  • Ecological Sustainability Will Probably Always Be Limited by Its Small Size and Fragmented Condition (See Section 3.5)

    Ecological Sustainability Will Probably Always Be Limited by Its Small Size and Fragmented Condition (See Section 3.5)

    United States Department of Agriculture Forest Service May 2011 Terrestrial Species Viability Evaluation for The Uwharrie National Forest Land and Resource Management Plan Environmental Impact Statement Contents 1.0 Introduction ................................................................................................................... 1 2.0 Purpose .......................................................................................................................... 1 2.1 Requirements in the National Forest Management Act (NFMA) ............................. 1 3.0 Ecosystem Diversity ..................................................................................................... 2 3.1 Spatial Scales for Ecosystem Diversity ................................................................... 4 3.2 Characteristics of Ecosystem Diversity ................................................................... 7 3.3 Range of Variation .................................................................................................... 9 3.4 Current Condition and Trend of Ecosystem Characteristics and Status of Ecosystem Diversity ..................................................................................................... 15 3.5 – Risks to Selected Characteristics of Ecosystem Diversity ................................... 20 3.6 Recommended Forest Plan Components ............................................................... 21 3.7 Assessing effects of Forest Plan alternatives on viability ....................................
  • Temporal Change Within and Among Forest Communities of Great Smoky Mountains National Park: the Influence of Historic Disturbance and Environmental Gradients

    Temporal Change Within and Among Forest Communities of Great Smoky Mountains National Park: the Influence of Historic Disturbance and Environmental Gradients

    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Masters Theses Graduate School 8-2008 Temporal Change Within and Among Forest Communities of Great Smoky Mountains National Park: The Influence of Historic Disturbance and Environmental Gradients Windy A. Bunn University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_gradthes Part of the Ecology and Evolutionary Biology Commons Recommended Citation Bunn, Windy A., "Temporal Change Within and Among Forest Communities of Great Smoky Mountains National Park: The Influence of Historic Disturbance and Environmental Gradients. " Master's Thesis, University of Tennessee, 2008. https://trace.tennessee.edu/utk_gradthes/3658 This Thesis is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Masters Theses by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a thesis written by Windy A. Bunn entitled "Temporal Change Within and Among Forest Communities of Great Smoky Mountains National Park: The Influence of Historic Disturbance and Environmental Gradients." I have examined the final electronic copy of this thesis for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Master of Science, with a major in Ecology and Evolutionary Biology. Nathan J. Sanders, Major Professor We have read this thesis and recommend its acceptance: Aimée T. Classen, Daniel Simberloff Accepted for the Council: Carolyn R. Hodges Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) To the Graduate Council: I am submitting herewith a dissertation written by Windy A.
  • Vegetation Community Monitoring at Congaree National Park: 2014 Data Summary

    Vegetation Community Monitoring at Congaree National Park: 2014 Data Summary

    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science Vegetation Community Monitoring at Congaree National Park 2014 Data Summary Natural Resource Data Series NPS/SECN/NRDS—2016/1016 ON THIS PAGE Tiny, bright yellow blossoms of Hypoxis hirsuta grace the forest floor at Congaree National Park. Photograph courtesy of Sarah C. Heath, Southeast Coast Network. ON THE COVER Spiraling compound leaf of green dragon (Arisaema dracontium) at Congaree National Park. Photograph courtesy of Sarah C. Heath, Southeast Coast Network Vegetation Community Monitoring at Congaree National Park 2014 Data Summary Natural Resource Data Series NPS/SECN/NRDS—2016/1016 Sarah Corbett Heath1 and Michael W. Byrne2 1National Park Service Southeast Coast Inventory and Monitoring Network Cumberland Island National Seashore 101 Wheeler Street Saint Marys, GA 31558 2National Park Service Southeast Coast Inventory and Monitoring Network 135 Phoenix Drive Athens, GA 30605 May 2016 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Data Series is intended for the timely release of basic data sets and data summaries. Care has been taken to assure accuracy of raw data values, but a thorough analysis and interpretation of the data has not been completed.
  • Vascular Flora of The

    Vascular Flora of The

    VASCULAR FLORA OF THE UPPER ETOWAH RIVER WATERSHED, GEORGIA by LISA MARIE KRUSE (Under the Direction of DAVID E. GIANNASI) ABSTRACT The Etowah River Basin in North Georgia is a biologically diverse Southern Appalachian River system, threatened by regional population growth. This is a two-part botanical study in the Upper Etowah watershed. The primary component is a survey of vascular flora. Habitats include riparian zones, lowland forest, tributary drainages, bluffs, and uplands. A total of 662 taxa were inventoried, and seventeen reference communities were described and mapped. Small streams, remote public land, and forested private land are important for plant conservation in this watershed. In the second component, cumulative plant species richness was sampled across six floodplain sites to estimate optimal widths for riparian buffer zones. To include 90% of floodplain species in a buffer, 60-75% of the floodplain width must be protected, depending on the stream size. Soil moisture influences species richness, and is dependent on upland water sources. An optimal buffer would protect hydrologic connections between floodplains and uplands. INDEX WORDS: Etowah River, Southeastern United States, floristic inventory, riparian buffer zone, floodplain plant species, plant habitat conservation VASCULAR FLORA OF THE UPPER ETOWAH RIVER WATERSHED, GEORGIA by LISA MARIE KRUSE B.S., Emory University, 1996 A Thesis Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE
  • Appendix B. Plant Species Detected in Sampling Locations

    Appendix B. Plant Species Detected in Sampling Locations

    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science Vegetation Community Monitoring at Chattahoochee River National Recreation Area, 2011 Natural Resource Data Series NPS/SECN/NRDS—2014/707 ON THE COVER Bright blue fruits of silky dogwood (Cornus amomum) at Chattahoochee River National Recreation Area. Photograph by: Sarah C. Heath, SECN Botanist. Vegetation Community Monitoring at Chattahoochee River National Recreation Area, 2011 Natural Resource Data Series NPS/SECN/NRDS—2014/707 Sarah Corbett Heath1 Michael W. Byrne2 1USDI National Park Service Southeast Coast Inventory and Monitoring Network Cumberland Island National Seashore 101 Wheeler Street Saint Marys, Georgia 31558 2USDI National Park Service Southeast Coast Inventory and Monitoring Network 135 Phoenix Road Athens, Georgia 30605 October 2014 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Data Series is intended for the timely release of basic data sets and data summaries. Care has been taken to assure accuracy of raw data values, but a thorough analysis and interpretation of the data has not been completed. Consequently, the initial analyses of data in this report are provisional and subject to change. All manuscripts in the series receive the appropriate level of peer review to ensure that the information is scientifically credible, technically accurate, appropriately written for the intended audience, and designed and published in a professional manner.
  • The Vascular Flora of the Natchez Trace Parkway

    The Vascular Flora of the Natchez Trace Parkway

    THE VASCULAR FLORA OF THE NATCHEZ TRACE PARKWAY (Franklin, Tennessee to Natchez, Mississippi) Results of a Floristic Inventory August 2004 - August 2006 © Dale A. Kruse, 2007 © Dale A. Kruse 2007 DATE SUBMITTED 28 February 2008 PRINCIPLE INVESTIGATORS Stephan L. Hatch Dale A. Kruse S. M. Tracy Herbarium (TAES), Texas A & M University 2138 TAMU, College Station, Texas 77843-2138 SUBMITTED TO Gulf Coast Inventory and Monitoring Network Lafayette, Louisiana CONTRACT NUMBER J2115040013 EXECUTIVE SUMMARY The “Natchez Trace” has played an important role in transportation, trade, and communication in the region since pre-historic times. As the development and use of steamboats along the Mississippi River increased, travel on the Trace diminished and the route began to be reclaimed by nature. A renewed interest in the Trace began during, and following, the Great Depression. In the early 1930’s, then Mississippi congressman T. J. Busby promoted interest in the Trace from a historical perspective and also as an opportunity for employment in the area. Legislation was introduced by Busby to conduct a survey of the Trace and in 1936 actual construction of the modern roadway began. Development of the present Natchez Trace Parkway (NATR) which follows portions of the original route has continued since that time. The last segment of the NATR was completed in 2005. The federal lands that comprise the modern route total about 52,000 acres in 25 counties through the states of Alabama, Mississippi, and Tennessee. The route, about 445 miles long, is a manicured parkway with numerous associated rest stops, parks, and monuments. Current land use along the NATR includes upland forest, mesic prairie, wetland prairie, forested wetlands, interspersed with numerous small agricultural croplands.
  • Vegetation Classification and Mapping Project Report

    Vegetation Classification and Mapping Project Report

    National Park Service U.S. Department of the Interior Northeast Region Philadelphia, Pennsylvania Vegetation Classification and Mapping at Colonial National Historical Park, Virginia Technical Report NPS/NER/NRTR—2008/129 USGS-NPS Vegetation Mapping Program Colonial National Historical Park ON THE COVER Upper left: Tidal Mesohaline and Polyhaline Marsh; photograph by Karen D. Patterson. Upper right: Tidal Bald Cypress Forest / Woodland. Lower left: Coastal Plain Loblolly Pine – Oak Forest. Lower right: Coastal Plain / Piedmont Floodplain Swamp Forest (Green Ash – Red Maple Type). Photographs by Gary P. Fleming. 2 USGS-NPS Vegetation Mapping Program Colonial National Historical Park Vegetation Classification and Mapping at Colonial National Historical Park, Virginia Technical Report NPS/NER/NRTR—2008/129 Karen D. Patterson Virginia Department of Conservation and Recreation Division of Natural Heritage 217 Governor Street, 3rd Floor Richmond, VA 23219 June 2008 U.S. Department of the Interior National Park Service Northeast Region Philadelphia, Pennsylvania 3 USGS-NPS Vegetation Mapping Program Colonial National Historical Park The Northeast Region of the National Park Service (NPS) comprises national parks and related areas in 13 New England and mid-Atlantic states. The diversity of parks and their resources are reflected in their designations as national parks, seashores, historic sites, recreation areas, military parks, monuments and memorials, and rivers and trails. Biological, physical, and social science research results, natural resource inventory and monitoring data, scientific literature reviews, bibliographies, and proceedings of technical workshops and conferences related to these park units are disseminated through the NPS/NER Technical Report (NRTR) and Natural Resources Report (NRR) series. The reports are a continuation of series with previous acronyms of NPS/PHSO, NPS/MAR, NPS/BSO-RNR, and NPS/NERBOST.
  • Natural Heritage Program List of Rare Plant Species of North Carolina 2018 Revised October 19, 2018

    Natural Heritage Program List of Rare Plant Species of North Carolina 2018 Revised October 19, 2018

    Natural Heritage Program List of Rare Plant Species of North Carolina 2018 Revised October 19, 2018 Compiled by Laura Gadd Robinson, Botanist North Carolina Natural Heritage Program N.C. Department of Natural and Cultural Resources Raleigh, NC 27699-1601 www.ncnhp.org STATE OF NORTH CAROLINA (Wataug>f Wnke8 /Madison V" Burke Y H Buncombe >laywoodl Swain f/~~ ?uthertor< /Graham, —~J—\Jo< Polk Lenoii TEonsylvonw^/V- ^ Macon V \ Cherokey-^"^ / /Cloy Union I Anson iPhmonf Ouptln Scotlar Ons low Robeson / Blodon Ponder Columbus / New>,arrfver Brunewlck Natural Heritage Program List of Rare Plant Species of North Carolina 2018 Compiled by Laura Gadd Robinson, Botanist North Carolina Natural Heritage Program N.C. Department of Natural and Cultural Resources Raleigh, NC 27699-1601 www.ncnhp.org This list is dynamic and is revised frequently as new data become available. New species are added to the list, and others are dropped from the list as appropriate. The list is published every two years. Further information may be obtained by contacting the North Carolina Natural Heritage Program, Department of Natural and Cultural Resources, 1651 MSC, Raleigh, NC 27699-1651; by contacting the North Carolina Wildlife Resources Commission, 1701 MSC, Raleigh, NC 27699- 1701; or by contacting the North Carolina Plant Conservation Program, Department of Agriculture and Consumer Services, 1060 MSC, Raleigh, NC 27699-1060. Additional information on rare species, as well as a digital version of this list, can be obtained from the Natural Heritage Program’s website at www.ncnhp.org. Cover Photo of Allium keeverae (Keever’s Onion) by David Campbell. TABLE OF CONTENTS INTRODUCTION .................................................................................................................
  • Appendix B. Plant Species Detected in Macroplots

    Appendix B. Plant Species Detected in Macroplots

    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science Vegetation Community Monitoring at Congaree National Park, 2010 Natural Resource Data Series NPS/SECN/NRDS—2012/259 ON THE COVER Carolina wild petunia (Ruellia caroliniensis) at Congaree National Park, June 2010. Photograph by Sarah L. Corbett. Vegetation Community Monitoring at Congaree National Park, 2010 Natural Resource Report NPS/SECN/NRDS—2012/259 Michael W. Byrne and Sarah L. Corbett USDI National Park Service Southeast Coast Inventory and Monitoring Network Cumberland Island National Seashore 101 Wheeler Street Saint Marys, Georgia, 31558 and Joseph C. DeVivo USDI National Park Service Southeast Coast Inventory and Monitoring Network University of Georgia 160 Phoenix Road, Phillips Lab Athens, Georgia, 30605 March 2012 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado publishes a range of reports that address natural resource topics of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Data Series is intended for the timely release of basic data sets and data summaries. Care has been taken to assure accuracy of raw data values, but a thorough analysis and interpretation of the data has not been completed. Consequently, the initial analyses of data in this report are provisional and subject to change. All manuscripts in the series receive the appropriate level of peer review to ensure that the information is scientifically credible, technically accurate, appropriately written for the intended audience, and designed and published in a professional manner.
  • VASCULAR FLORA of the REMNANT BLACKLAND PRAIRIES and ASSOCIATED VEGETATION of GEORGIA by STEPHEN LEE ECHOLS, JR. (Under The

    VASCULAR FLORA of the REMNANT BLACKLAND PRAIRIES and ASSOCIATED VEGETATION of GEORGIA by STEPHEN LEE ECHOLS, JR. (Under The

    VASCULAR FLORA OF THE REMNANT BLACKLAND PRAIRIES AND ASSOCIATED VEGETATION OF GEORGIA by STEPHEN LEE ECHOLS, JR. (Under the Direction of Wendy B. Zomlefer) ABSTRACT Blackland prairies are a globally imperiled, rare plant community only recently discovered in central Georgia. A floristic inventory was conducted on six remnant blackland prairie sites within Oaky Woods Wildlife Management Area. The 43 ha site complex yielded 354 taxa in 220 genera and 84 families. Four species new to the state of Georgia were documented. Eight rare species, one candidate for federal listing, and one federally endangered species are reported here as new records for the Oaky Woods WMA vicinity. Twelve plant communities are described. A literature review was performed for six states containing blackland prairie within the Gulf and South Atlantic Coastal Plains of the United States. Geology, soils, and vegetation were compared, and cluster analysis was performed using floristic data to assess similarities. INDEX WORDS: Black Belt region, Blackland prairies, cluster analysis, floristics, grassland, Georgia, Oaky Woods Wildlife Management Area, prairie, rare species VASCULAR FLORA OF THE REMNANT BLACKLAND PRAIRIES AND ASSOCIATED VEGETATION OF GEORGIA by STEPHEN LEE ECHOLS, JR. B.S., Appalachian State University, 2002 A Thesis Submitted to the Graduate Faculty of The University of Georgia in Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE ATHENS, GEORGIA 2007 © 2007 Stephen Lee Echols, Jr. All Rights Reserved VASCULAR FLORA OF THE REMNANT BLACKLAND PRAIRIES AND ASSOCIATED VEGETATION OF GEORGIA by STEPHEN LEE ECHOLS, JR. Major Professor: Wendy B. Zomlefer Committee: Jim Affolter Rebecca Sharitz Electronic Version Approved: Maureen Grasso Dean of the Graduate School The University of Georgia August 2007 iv DEDICATION I dedicate this thesis to my girlfriend Lisa Keong, who despite my absence, has stood by me with patience and support throughout the final stages of this project.