DOCSLIB.ORG

Pelistega Europaea Gen. Nov., Sp. Nov., a Bacterium Associated with Respiratory Disease in Pigeons: Taxonomic Structure and Phylogenetic Allocation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pelistega Europaea Gen. Nov., Sp. Nov., a Bacterium Associated with Respiratory Disease in Pigeons: Taxonomic Structure and Phylogenetic Allocation International Journal of Systematic Bacteriology (1 998), 48,43 1-440 Printed in Great Britain Pelistega europaea gen. nov., sp. nov., a bacterium associated with respiratory disease in pigeons: taxonomic structure and phylogenetic allocation P. Vandamme,'#' P. Segers,' M. RYII,~J. horn me^,^ M. Vancanneyt,' R. Coopman,' R. De Bae~e,~Y. Van De Peer,5 K. Kersters,' R. De Wachter5and K. H. Him3 Author for correspondence: P. Vandamme. Tel: + 32 9 264 51 13. Fax: + 32 9 264 50 92. e-mail : [email protected] ~ 1 Laboratorium voor Twenty-four strains isolated mainly from infected respiratory tracts of pigeons Microbiologie, were characterized by an integrated genotypic and phenotypic approach. An Ledeganckstraat 35, Universiteit Gent, 6-9000 extensive biochemical examination using conventional tests and several API Gent, Belgium microtest systems indicated that all isolates formed a phenotypically Department of Medical homogeneous taxon with a DNA G+C content between 42 and 43 mol%. Microbiology, University Whole-cell protein and fatty acid analysis revealed an unexpected Hospital Antwerp UIA, heterogeneity which was confirmed by DNA-DNA hybridizations. Four main Belgium genotypic sub-groups (genomovars) were delineated. 165 rDNA sequence 3 Klinik fur Geflugel der analysis of a representative strain indicated that this taxon belongs to the Tierarztlichen Hochschule, Hannover, Germany beta-subclass of the Proteobacteria with Taylorella equigenitalis as its closest neighbour (about 94.8% similarity). A comparison of phenotypic and 4 Provinciaal Verbond voor Dierenziektenbestrijding, genotypic characteristics of both taxa suggested that the pigeon isolates Tor hou t, Be1g iu m represented a novel genus for which the name Pelistega is proposed. In the 5 Department of absence of differential phenotypic characteristics between the genomovars, it Biochemistry, University of was preferred to include all of the isolates into a single species, Pelistega Antwerp UIA, Belgium europaea, and strain LMG 10982 was selected as the type strain. The latter strain belongs to fatty acid cluster Iand protein electrophoretic sub-group 1, which comprise 13 and 5 isolates, respectively. It is not unlikely that the name P. eumpaea will be restricted in the future to organisms belonging to fatty acid cluster I, or even to protein electrophoretic sub-group 1, upon discovery of differential diagnostic features. Keywords: Pelistega europaea, taxonomic structure, pigeon INTRODUCTION METHODS Bacterial strains and growth conditions. Pelistega europaea The present study was undertaken to fully characterize strains were grown on Trypticase Soy agar (BBL) and a collection of 24 strains isolated mainly from the incubated at 36-37 "C in a microaerobic atmosphere con- respiratory tract of pigeons in Belgium and Germany. taining approximately 5% 0,, 3.5% CO,, 7.5% H, and These strains were obtained at necroscopy from 84 YO N,. Taylorella equigenitalis strains were grown on diseased pigeons and could not be identified by Columbia agar (Becton Dickinson) supplemented with 5 YO conventional biochemical analysis or whole-cell fatty horse blood and incubated under the same conditions acid analysis. The present report describes the poly- described above, except when stated otherwise. phasic approach which was used to determine the The strains and their sources are listed in Table 1. Bac- taxonomic relationships of these isolates and their teriological purity was checked by plating and examining phylogenetic allocation. living and Gram-stained cells. Fatty acid methyl ester analysis. P. europaea strains were The EMBL accession number for the strain LMG 10982Tsequence reported grown for 48 h. T. equigenitalis strains were grown for 48 h in this paper is Y11890. on a chocolate agar base (Oxoid CM55) supplemented with 00632 0 1998 IUMS 43 1 P. Vandamme and others Table 1. List of strains studied ~ ~ ~ Strain" Other strain no.? Fatty acid Source clusterlprotein electrophoretic sub-group ~ ~~ Pelistega euvopaea strains LMG 10982T Hommez N57 Pigeon (Belgium) LMG 12980 x2 12-90, HinzH6 Pigeon, lung, pneumonia, airsacculitis (Germany) LMG 12988 x858-83, HinzM19 Pigeon, lung (Germany) LMG 15727 ~993-85 Pigeon, trachea, tracheitis, bronchitis (Germany) LMG 15943 Hommez 4 Pigeon (Belgium) LMG 15725 ~708-82 Pigeon, trachea, tracheitis, bronchltis (Germany) LMG 15726 ~707-82 Pigeon, trachea, rhinitis, tracheitis (Germany) LMG 15728 ~207-85 Pigeon, air sac, airsacculitis, salpingitis (Germany) LMG 15934 Hommez 17 Pigeon (Belgium) LMG 16152 ~706B-82 Pigeon, trachea, exudative rhinitis, tracheitis (Germany) LMG 10983 Hommez 118 Pigeon (Belgium) LMG 11609 ~227-90 Pigeon, lung, pneumonia, airsacculitis (Germany) LMG 10986 Hommez 119 Pigeon (Belgium) LMG 12981 x101-90, HinzH7 Pigeon, palatine cleft, respiratory disease (Germany) LMG 12982 x121-90, HinzH8 Pigeon, lung, pneumonia, oophoritis (Germany) LMG 12985 x554-85, HinzM 11 Pigeon, trachea, respiratory disease (Germany) LMG 12991 x433-84, HinzM24 Pigeon, lung, bronchitis (Germany) LMG 15936 Hommez 25 Pigeon (Belgium) LMG 15942 Hommez 1 Pigeon (Belgium) LMG 15944 Hommez 24 Pigeon (Belgium) LMG 12990 x 567- 86, HinzM2 3 Pigeon, lung, pneumonia, airsacculitis (Germany) LMG 15729 ~636-85 Pigeon, lung (Germany) LMG 15730 ~657- 85 Pigeon, liver (Germany) LMG 15731 ~1-85 Pigeon, lung, crop inflammation, nephrosis (Germany) Taylovella equigenitalis strains LMG 6222T CCUG 10786T Horse, contagious metritis LMG6223 CCUG 16464 Horse (Sweden) LMG 6224 CCUG 16465 Horse (Sweden) B 1938-89 Horse (Germany) . LMG, BCCMILMG Culture Collection, Laboratorium voor Microbiologie Gent, Universiteit Gent, Belgium. t CCUG, Culture Collection University of Goteborg, Department of Clinical Bacteriology, Goteborg, Sweden. 10% (v/v) defibrinated horse blood. A loopful of well- DNA base compositions. All of the mean mol % G + C values grown cells was harvested and preparation, separation, were determined by thermal denaturation and calculated by identification and numerical comparison of the fatty acid using the equation of Marmur & Doty (16), as modified by methyl esters was performed using the Microbial Iden- De Ley (4). tification System (Microbial ID) as described previously DNA-DNA hybridization experiments. The degree of DNA- (25). DNA binding, expressed as a percentage, was determined Analysis of protein electrophoreticpatterns. P. europaea and spectrophotometrically by the initial renaturation rate T. equigenitalis strains were incubated for 48 and 96 h, method of De Ley et al. (5). Each value is the mean of at least respectively. Preparation of cellular protein extracts, PAGE, two hybridization experiments. Values of 30 % DNA bind- densitometric analysis, normalization and interpolation of ing and less do not represent significant DNA homology. the protein profiles, and numerical analysis were performed The total DNA concentration was about 63 pg ml-', and the as described by Pot et al. (20) using the GelCompar 4.0 optimal renaturation temperature in 1 x SSC was 63.9 "C. software package (Applied Maths). The profiles were re- corded and stored on a PC computer. The similarity between 16s rRNA sequencing. Part of the rDNA operon, comprising all pairs of traces was expressed by the Pearson product- the almost complete 16s DNA, was amplified by PCR. The moment correlation coefficient converted for convenience to forward primer was AGAGTTTGATCCTGGCTCAG, a percentage value. corresponding to positions 8-27 in 16s rRNA. The reverse Drimer was TCTGTGTGCCTAGGTATCC. comdemen- Preparation of high-molecular-mass DNA. High-molecular- iary to positions 45-26 in 23s rRNA. The PCR reachon was mass native DNA was prepared as described previously (25). carried out in a volume of 100 pl, using 2.5 U Taq polymerase 432 International Journal of Systematic Bacteriology 48 Pelistega europaea gen. nov., sp. nov. (Boehringer Mannheim), about 350ng DNA, 500nM of sterilized chicken serum. Final readings were done after 3 each primer and 200 JAMdNTPs, in the appropriate buffer. and 5 d incubation at 37 "C. Before addition of Tag polymerase and DNA, the mixture Oxidase activity was tested with a freshly prepared 1 YO was irradiated for 5 min on a UV transilluminator. After solution of N,N-dimethyl-p-phenylene monochloride 2min denaturation at 94"C, the following cycle was (Sigma) on reagent-impregnated filter paper as described by repeated 30 times: 1 min denaturation at 94 "C, 1 min Kersters & De Ley (12). The reactions were read within 30 s. annealing at 50 "C and 2 min polymerization at 72 "C. The Catalase was tested as described by Kersters et al. (13) and last cycle was followed by 10 min elongation at 72 "C. by using the ID-COLOUR-CATALASE test (bioM6rieux). The amplification product was purified by agarose gel Urea hydrolysis was determined as described by Lautrop electrophoresis, ligated in T-tailed pBluescript I1 SK( + ) (15) and on Christensen urea agar (Merck) with daily (Stratagene) as described by Holton & Graham (8), and readings up to 5 d. Nitrate reduction was done in nitrate electroporated into Escherichia coli DH5a cells. The plasmid broth cultures (Merck) and indole production was done in was isolated from 13 single clones according to Birnboim & standard I1 nutrient broth (Merck) with and without 2% Doly (2). This mixture was sequenced with the Pharmacia inactivated filter-sterilized chicken serum after 24 and 48 h Sequencing kit using a set of primers described previously by incubation at 37 "C. Wilmotte et al. (31). Part of the sequence was obtained by Determination
Load more

Recommended publications
  • Phenotypic and Microbial Influences on Dairy Heifer Fertility and Calf Gut Microbial Development
    Phenotypic and microbial influences on dairy heifer fertility and calf gut microbial development Connor E. Owens Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy In Animal Science, Dairy Rebecca R. Cockrum Kristy M. Daniels Alan Ealy Katharine F. Knowlton September 17, 2020 Blacksburg, VA Keywords: microbiome, fertility, inoculation Phenotypic and microbial influences on dairy heifer fertility and calf gut microbial development Connor E. Owens ABSTRACT (Academic) Pregnancy loss and calf death can cost dairy producers more than $230 million annually. While methods involving nutrition, climate, and health management to mitigate pregnancy loss and calf death have been developed, one potential influence that has not been well examined is the reproductive microbiome. I hypothesized that the microbiome of the reproductive tract would influence heifer fertility and calf gut microbial development. The objectives of this dissertation were: 1) to examine differences in phenotypes related to reproductive physiology in virgin Holstein heifers based on outcome of first insemination, 2) to characterize the uterine microbiome of virgin Holstein heifers before insemination and examine associations between uterine microbial composition and fertility related phenotypes, insemination outcome, and season of breeding, and 3) to characterize the various maternal and calf fecal microbiomes and predicted metagenomes during peri-partum and post-partum periods and examine the influence of the maternal microbiome on calf gut development during the pre-weaning phase. In the first experiment, virgin Holstein heifers (n = 52) were enrolled over 12 periods, on period per month. On -3 d before insemination, heifers were weighed and the uterus was flushed.
    [Show full text]
  • Evaluation of MALDI Biotyper for Identification of Taylorella Equigenitalis and Taylorella Asinigenitalis Kristina Lantz Iowa State University
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2017 Evaluation of MALDI Biotyper for identification of Taylorella equigenitalis and Taylorella asinigenitalis Kristina Lantz Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Microbiology Commons, and the Veterinary Medicine Commons Recommended Citation Lantz, Kristina, "Evaluation of MALDI Biotyper for identification of Taylorella equigenitalis and Taylorella asinigenitalis" (2017). Graduate Theses and Dissertations. 16520. https://lib.dr.iastate.edu/etd/16520 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Evaluation of MALDI Biotyper for identification of Taylorella equigenitalis and Taylorella asinigenitalis by Kristina Lantz A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Veterinary Microbiology Program of Study Committee: Ronald Griffith, Major Professor Steve Carlson Matthew Erdman Timothy Frana The student author and the program of study committee are solely responsible for the content of this thesis. The Graduate College will ensure this thesis is globally accessible and will not permit
    [Show full text]
  • Genome of Ca. Pandoraea Novymonadis, an Endosymbiotic Bacterium of the Trypanosomatid Novymonas Esmeraldas
    fmicb-08-01940 September 30, 2017 Time: 16:0 # 1 ORIGINAL RESEARCH published: 04 October 2017 doi: 10.3389/fmicb.2017.01940 Genome of Ca. Pandoraea novymonadis, an Endosymbiotic Bacterium of the Trypanosomatid Novymonas esmeraldas Alexei Y. Kostygov1,2†, Anzhelika Butenko1,3†, Anna Nenarokova3,4, Daria Tashyreva3, Pavel Flegontov1,3,5, Julius Lukeš3,4 and Vyacheslav Yurchenko1,3,6* 1 Life Science Research Centre, Faculty of Science, University of Ostrava, Ostrava, Czechia, 2 Zoological Institute of the Russian Academy of Sciences, St. Petersburg, Russia, 3 Biology Centre, Institute of Parasitology, Czech Academy of Sciences, Ceskéˇ Budejovice,ˇ Czechia, 4 Faculty of Sciences, University of South Bohemia, Ceskéˇ Budejovice,ˇ Czechia, 5 Institute for Information Transmission Problems, Russian Academy of Sciences, Moscow, Russia, 6 Institute of Environmental Technologies, Faculty of Science, University of Ostrava, Ostrava, Czechia We have sequenced, annotated, and analyzed the genome of Ca. Pandoraea novymonadis, a recently described bacterial endosymbiont of the trypanosomatid Novymonas esmeraldas. When compared with genomes of its free-living relatives, it Edited by: has all the hallmarks of the endosymbionts’ genomes, such as significantly reduced João Marcelo Pereira Alves, University of São Paulo, Brazil size, extensive gene loss, low GC content, numerous gene rearrangements, and Reviewed by: low codon usage bias. In addition, Ca. P. novymonadis lacks mobile elements, Zhao-Rong Lun, has a strikingly low number of pseudogenes, and almost all genes are single Sun Yat-sen University, China Vera Tai, copied. This suggests that it already passed the intensive period of host adaptation, University of Western Ontario, Canada which still can be observed in the genome of Polynucleobacter necessarius, a *Correspondence: certainly recent endosymbiont.
    [Show full text]
  • And Gastrointestinal Disturbances Samples from Children with Autism
    Downloaded from Application of Novel PCR-Based mbio.asm.org Methods for Detection, Quantitation, and Phylogenetic Characterization of Sutterella Species in Intestinal Biopsy on January 10, 2012 - Published by Samples from Children with Autism and Gastrointestinal Disturbances Brent L. Williams, Mady Hornig, Tanmay Parekh, et al. 2012. Application of Novel PCR-Based Methods for Detection, Quantitation, and Phylogenetic Characterization of Sutterella Species in Intestinal Biopsy Samples from Children with Autism and Gastrointestinal Disturbances . mBio 3(1): . doi:10.1128/mBio.00261-11. mbio.asm.org Updated information and services can be found at: http://mbio.asm.org/content/3/1/e00261-11.full.html SUPPLEMENTAL http://mbio.asm.org/content/3/1/e00261-11.full.html#SUPPLEMENTAL MATERIAL REFERENCES This article cites 43 articles, 23 of which can be accessed free at: http://mbio.asm.org/content/3/1/e00261-11.full.html#ref-list-1 CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more>> Information about commercial reprint orders: http://mbio.asm.org/misc/reprints.xhtml Information about Print on Demand and other content delivery options: http://mbio.asm.org/misc/contentdelivery.xhtml To subscribe to another ASM Journal go to: http://journals.asm.org/subscriptions/ Downloaded from RESEARCH ARTICLE Application of Novel PCR-Based Methods for Detection, Quantitation, mbio.asm.org and Phylogenetic Characterization of Sutterella Species in Intestinal Biopsy Samples from Children with Autism and Gastrointestinal on January 10, 2012 - Published by Disturbances Brent L. Williams, Mady Hornig, Tanmay Parekh, and W. Ian Lipkin Center for Infection and Immunity, Mailman School of Public Health, Columbia University, New York, New York, USA ABSTRACT Gastrointestinal disturbances are commonly reported in children with autism and may be associated with composi- tional changes in intestinal bacteria.
    [Show full text]
  • A Genomic Perspective on a New Bacterial Genus and Species from the Alcaligenaceae Family, Basilea Psittacipulmonis
    UC Irvine UC Irvine Previously Published Works Title A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis. Permalink https://escholarship.org/uc/item/0f60f7jm Journal BMC genomics, 15(1) ISSN 1471-2164 Authors Whiteson, Katrine L Hernandez, David Lazarevic, Vladimir et al. Publication Date 2014-03-01 DOI 10.1186/1471-2164-15-169 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Whiteson et al. BMC Genomics 2014, 15:169 http://www.biomedcentral.com/1471-2164/15/169 RESEARCH ARTICLE Open Access A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis Katrine L Whiteson1,5*, David Hernandez1, Vladimir Lazarevic1, Nadia Gaia1, Laurent Farinelli2, Patrice François1, Paola Pilo3, Joachim Frey3 and Jacques Schrenzel1,4 Abstract Background: A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. Results: Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp.
    [Show full text]
  • Metabolic Roles of Uncultivated Bacterioplankton Lineages in the Northern Gulf of Mexico 2 “Dead Zone” 3 4 J
    bioRxiv preprint doi: https://doi.org/10.1101/095471; this version posted June 12, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Metabolic roles of uncultivated bacterioplankton lineages in the northern Gulf of Mexico 2 “Dead Zone” 3 4 J. Cameron Thrash1*, Kiley W. Seitz2, Brett J. Baker2*, Ben Temperton3, Lauren E. Gillies4, 5 Nancy N. Rabalais5,6, Bernard Henrissat7,8,9, and Olivia U. Mason4 6 7 8 1. Department of Biological Sciences, Louisiana State University, Baton Rouge, LA, USA 9 2. Department of Marine Science, Marine Science Institute, University of Texas at Austin, Port 10 Aransas, TX, USA 11 3. School of Biosciences, University of Exeter, Exeter, UK 12 4. Department of Earth, Ocean, and Atmospheric Science, Florida State University, Tallahassee, 13 FL, USA 14 5. Department of Oceanography and Coastal Sciences, Louisiana State University, Baton Rouge, 15 LA, USA 16 6. Louisiana Universities Marine Consortium, Chauvin, LA USA 17 7. Architecture et Fonction des Macromolécules Biologiques, CNRS, Aix-Marseille Université, 18 13288 Marseille, France 19 8. INRA, USC 1408 AFMB, F-13288 Marseille, France 20 9. Department of Biological Sciences, King Abdulaziz University, Jeddah, Saudi Arabia 21 22 *Correspondence: 23 JCT [email protected] 24 BJB [email protected] 25 26 27 28 Running title: Decoding microbes of the Dead Zone 29 30 31 Abstract word count: 250 32 Text word count: XXXX 33 34 Page 1 of 31 bioRxiv preprint doi: https://doi.org/10.1101/095471; this version posted June 12, 2017.
    [Show full text]
  • A Genomic Perspective on a New Bacterial Genus and Species From
    Whiteson et al. BMC Genomics 2014, 15:169 http://www.biomedcentral.com/1471-2164/15/169 RESEARCH ARTICLE Open Access A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis Katrine L Whiteson1,5*, David Hernandez1, Vladimir Lazarevic1, Nadia Gaia1, Laurent Farinelli2, Patrice François1, Paola Pilo3, Joachim Frey3 and Jacques Schrenzel1,4 Abstract Background: A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. Results: Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp. and Taylorella spp. High-throughput sequencing reads from the Illumina-Solexa platform were assembled with the Edena de novo assembler to form 195 contigs comprising the ~2 Mb genome. Genome annotation with RAST, construction of phylogenetic trees with the 16S rDNA (rrs) gene sequence and the rpoB gene, and phylogenetic placement using other highly conserved marker genes with ML Tree all suggest that the bacterial species belongs to the Alcaligenaceae family.
    [Show full text]
  • Bioprospection and Genetic Diversity of Endophytic Bacteria Associated with Cassava Plant1
    Universidade Federal Rural do Semi-Árido ISSN 0100-316X (impresso) Pró-Reitoria de Pesquisa e Pós-Graduação ISSN 1983-2125 (online) https://periodicos.ufersa.edu.br/index.php/caatinga http://dx.doi.org/10.1590/1983-21252018v31n207rc BIOPROSPECTION AND GENETIC DIVERSITY OF ENDOPHYTIC BACTERIA ASSOCIATED WITH CASSAVA PLANT1 MARIA CAMILA DE BARROS SILVA LEITE2*, ARTHUR PRUDÊNCIO DE ARAUJO PEREIRA3, ADIJAILTON JOSÉ DE SOUZA3, FERNANDO DINI ANDREOTE3, FERNANDO JOSÉ FREIRE4, JÚLIA KUKLINSKY SOBRAL2 ABSTRACT - Cassava is mostly planted in sandy soils which are usually of low fertility, thereby making it necessary to perform beneficial associations with microorganisms that can promote their growth. In this perspective, the possibility of selecting bacterial isolates efficient in promoting the growth of the culture is evident, which can provide subsidies for future inoculants. The objective of this study was to isolate, identify, select and evaluate the genetic diversity of endophytic bacteria in roots and stems of cassava grown in Garanhuns - PE, with features involved in promoting plant growth. The isolation was performed on culture medium semisolid LGI-P. The selected isolates were evaluated for the potential to fix N2, as the ability to produce indole acetic acid, for their ability to solubilize inorganic phosphate and produce exopolysaccharides. Some bacterial isolates had their 16S rRNA gene sequenced by the Sanger method. A total of 52 endophytic bacteria isolates were obtained from cassava. Regarding the potential to fix N2, 15% of the isolates were positive. As for the production of IAA, 78% of the isolates produced this phytohormone in a medium with increased L-tryptophan. Approximately 31% of the isolates were able to solubilize inorganic phosphate and 60% had exopolysaccharide.
    [Show full text]
  • 237158160007.Pdf
    Revista Caatinga ISSN: 0100-316X ISSN: 1983-2125 Universidade Federal Rural do Semi-Árido LEITE, MARIA CAMILA DE BARROS SILVA; PEREIRA, ARTHUR PRUDÊNCIO DE ARAUJO; SOUZA, ADIJAILTON JOSÉ DE; ANDREOTE, FERNANDO DINI; FREIRE, FERNANDO JOSÉ; SOBRAL, JÚLIA KUKLINSKY Bioprospection and genetic diversity of endophytic bacteria associated with cassava plant1 Revista Caatinga, vol. 31, no. 2, April-June, 2018, pp. 315-325 Universidade Federal Rural do Semi-Árido DOI: 10.1590/1983-21252018v31n207rc Available in: http://www.redalyc.org/articulo.oa?id=237158160007 How to cite Complete issue Scientific Information System Redalyc More information about this article Network of Scientific Journals from Latin America and the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Project academic non-profit, developed under the open access initiative Universidade Federal Rural do Semi-Árido ISSN 0100-316X (impresso) Pró-Reitoria de Pesquisa e Pós-Graduação ISSN 1983-2125 (online) https://periodicos.ufersa.edu.br/index.php/caatinga http://dx.doi.org/10.1590/1983-21252018v31n207rc BIOPROSPECTION AND GENETIC DIVERSITY OF ENDOPHYTIC BACTERIA ASSOCIATED WITH CASSAVA PLANT1 MARIA CAMILA DE BARROS SILVA LEITE2*, ARTHUR PRUDÊNCIO DE ARAUJO PEREIRA3, ADIJAILTON JOSÉ DE SOUZA3, FERNANDO DINI ANDREOTE3, FERNANDO JOSÉ FREIRE4, JÚLIA KUKLINSKY SOBRAL2 ABSTRACT - Cassava is mostly planted in sandy soils which are usually of low fertility, thereby making it necessary to perform beneficial associations with microorganisms that can promote their growth. In this perspective, the possibility of selecting bacterial isolates efficient in promoting the growth of the culture is evident, which can provide subsidies for future inoculants. The objective of this study was to isolate, identify, select and evaluate the genetic diversity of endophytic bacteria in roots and stems of cassava grown in Garanhuns - PE, with features involved in promoting plant growth.
    [Show full text]
  • S1. the Genomes of the Order Burkholderiales (Taxid:80840) in The
    S1. The genomes of the order Burkholderiales (taxid:80840) in the NCBI Genome List (http://www.ncbi.nlm.nih.gov/genome/browse/) 05-09-2014 N Organism/Name Kingdom Group SubGroup Size (Mb) Chr Plasmids Assemblies 1. Burkholderiales bacterium JGI 0001003-L21 Bacteria Proteobacteria Betaproteobacteria 0,070281 - - 1 2. Comamonadaceae bacterium JGI 0001003-E14 Bacteria Proteobacteria Betaproteobacteria 0,113075 - - 1 3. Candidatus Zinderia insecticola Bacteria Proteobacteria Betaproteobacteria 0,208564 1 - 1 4. Comamonadaceae bacterium JGI 0001013-A16 Bacteria Proteobacteria Betaproteobacteria 0,295955 - - 1 5. Oxalobacteraceae bacterium JGI 0001004-J12 Bacteria Proteobacteria Betaproteobacteria 0,301938 - - 1 6. Oxalobacteraceae bacterium JGI 0001002-K6 Bacteria Proteobacteria Betaproteobacteria 0,368093 - - 1 7. Burkholderiales bacterium JGI 0001003-J08 Bacteria Proteobacteria Betaproteobacteria 0,394907 - - 1 8. Burkholderiales bacterium JGI 0001002-H06 Bacteria Proteobacteria Betaproteobacteria 0,415398 - - 1 9. Pelomonas Bacteria Proteobacteria Betaproteobacteria 0,507844 - - 2 10. Leptothrix ochracea Bacteria Proteobacteria Betaproteobacteria 0,510792 - - 1 11. Oxalobacteraceae bacterium JGI 0001012-C15 Bacteria Proteobacteria Betaproteobacteria 0,640975 - - 1 12. Burkholderiales bacterium JGI 0001003-A5 Bacteria Proteobacteria Betaproteobacteria 0,686115 - - 1 13. Oxalobacteraceae bacterium JGI 001010-B17 Bacteria Proteobacteria Betaproteobacteria 0,825556 - - 1 14. Rhizobacter Bacteria Proteobacteria Betaproteobacteria 1,05799 - -
    [Show full text]
  • Genomics of Blastocrithidia, a Trypanosomatid with All Three Stop Codons Reassigned
    Biology Centre, Institute of Parasitology, Czech Academy of Sciences, and University of South Bohemia, Faculty of Sciences, České Budějovice, Czech Republic Ph.D. Thesis Genomics of Blastocrithidia, a trypanosomatid with all three stop codons reassigned Anna Nenarokova, MSc Supervisor: Prof. RNDr. Julius Lukeš, CSc. České Budějovice, 2020 This thesis should be cited as: Nenarokova A., 2019: Genomics of Blastocrithidia, a trypanosomatid with all three stop codons reassigned. Ph.D. thesis. University of South Bohemia, Faculty of Science, School of doctoral studies in biological sciences, České Budějovice, Czech Republic. Annotation This work describes genomic studies of Blastocrithidia, the trypanosomatid with all three stop codons encoding amino acids and the only known euglenozoan with non-standard nuclear genetic code. We describe unique genomic features of Blastocrithidia and the sister clade "Jaculum", and discuss possible mechanisms of translation termination with ambiguous stop codons and the evolutionary path that may have established this system. Declaration I hereby declare that I did all the work presented in this thesis by myself or in collaboration with the mentioned co-authors and only using the cited literature. České Budějovice, .............................................................................................. Anna Nenarokova 2 Prohlášení Prohlašuji, že svoji disertační práci jsem vypracovala samostatně pouze s použitím pramenů a literatury uvedených v seznamu citované literatury. Prohlašuji, že v souladu s § 47b zákona č. 111/1998 Sb. v platném znění souhlasím se zveřejněním své disertační práce, a to v úpravě vzniklé vypuštěním vyznačených částí archivovaných Přírodovědeckou fakultou elektronickou cestou ve veřejně přístupné části databáze STAG provozované Jihočeskou univerzitou v Českých Budějovicích na jejích internetových stránkách, a to se zachováním mého autorského práva k odevzdanému textu této kvalifikační práce.
    [Show full text]
  • The Species Concept for Prokaryotes
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by MPG.PuRe FEMS Microbiology Reviews 25 (2001) 39^67 www.fems-microbiology.org Review The species concept for prokaryotes Ramon Rossello¨-Mora *, Rudolf Amann Department of Molecular Ecology, Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany Received 4 November 1999; received in revised form 23 August 2000; accepted 24 August 2000 Abstract The species concept is a recurrent controversial issue that preoccupies philosophers as well as biologists of all disciplines. Prokaryotic species concept has its own history and results from a series of empirical improvements parallel to the development of the techniques of analysis. Among the microbial taxonomists, there is general agreement that the species concept currently in use is useful, pragmatic and universally applicable within the prokaryotic world. However, this empirically designed concept is not encompassed by any of the, at least, 22 concepts described for eukaryotes. The species could be described as `a monophyletic and genomically coherent cluster of individual organisms that show a high degree of overall similarity in many independent characteristics, and is diagnosable by a discriminative phenotypic property'. We suggest to refer it as a phylo-phenetic species concept. Here, we discuss the validity of the concept in use which we believe is more pragmatic in comparison with those concepts described for eukaryotes. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords: Species concept; Phenetic analysis; Phylogenetic reconstruction; DNA^DNA similarity Contents 1. Introduction .......................................................... 40 2.
    [Show full text]