International Journal of Systematic Bacteriology (1 998), 48,43 1-440 Printed in Great Britain Pelistega europaea gen. nov., sp. nov., a bacterium associated with respiratory disease in pigeons: taxonomic structure and phylogenetic allocation P. Vandamme,'#' P. Segers,' M. RYII,~J. horn me^,^ M. Vancanneyt,' R. Coopman,' R. De Bae~e,~Y. Van De Peer,5 K. Kersters,' R. De Wachter5and K. H. Him3 Author for correspondence: P. Vandamme. Tel: + 32 9 264 51 13. Fax: + 32 9 264 50 92. e-mail : [email protected] ~ 1 Laboratorium voor Twenty-four strains isolated mainly from infected respiratory tracts of pigeons Microbiologie, were characterized by an integrated genotypic and phenotypic approach. An Ledeganckstraat 35, Universiteit Gent, 6-9000 extensive biochemical examination using conventional tests and several API Gent, Belgium microtest systems indicated that all isolates formed a phenotypically Department of Medical homogeneous taxon with a DNA G+C content between 42 and 43 mol%. Microbiology, University Whole-cell protein and fatty acid analysis revealed an unexpected Hospital Antwerp UIA, heterogeneity which was confirmed by DNA-DNA hybridizations. Four main Belgium genotypic sub-groups (genomovars) were delineated. 165 rDNA sequence 3 Klinik fur Geflugel der analysis of a representative strain indicated that this taxon belongs to the Tierarztlichen Hochschule, Hannover, Germany beta-subclass of the Proteobacteria with Taylorella equigenitalis as its closest neighbour (about 94.8% similarity). A comparison of phenotypic and 4 Provinciaal Verbond voor Dierenziektenbestrijding, genotypic characteristics of both taxa suggested that the pigeon isolates Tor hou t, Be1g iu m represented a novel genus for which the name Pelistega is proposed. In the 5 Department of absence of differential phenotypic characteristics between the genomovars, it Biochemistry, University of was preferred to include all of the isolates into a single species, Pelistega Antwerp UIA, Belgium europaea, and strain LMG 10982 was selected as the type strain. The latter strain belongs to fatty acid cluster Iand protein electrophoretic sub-group 1, which comprise 13 and 5 isolates, respectively. It is not unlikely that the name P. eumpaea will be restricted in the future to organisms belonging to fatty acid cluster I, or even to protein electrophoretic sub-group 1, upon discovery of differential diagnostic features. Keywords: Pelistega europaea, taxonomic structure, pigeon INTRODUCTION METHODS Bacterial strains and growth conditions. Pelistega europaea The present study was undertaken to fully characterize strains were grown on Trypticase Soy agar (BBL) and a collection of 24 strains isolated mainly from the incubated at 36-37 "C in a microaerobic atmosphere con- respiratory tract of pigeons in Belgium and Germany. taining approximately 5% 0,, 3.5% CO,, 7.5% H, and These strains were obtained at necroscopy from 84 YO N,. Taylorella equigenitalis strains were grown on diseased pigeons and could not be identified by Columbia agar (Becton Dickinson) supplemented with 5 YO conventional biochemical analysis or whole-cell fatty horse blood and incubated under the same conditions acid analysis. The present report describes the poly- described above, except when stated otherwise. phasic approach which was used to determine the The strains and their sources are listed in Table 1. Bac- taxonomic relationships of these isolates and their teriological purity was checked by plating and examining phylogenetic allocation. living and Gram-stained cells. Fatty acid methyl ester analysis. P. europaea strains were The EMBL accession number for the strain LMG 10982Tsequence reported grown for 48 h. T. equigenitalis strains were grown for 48 h in this paper is Y11890. on a chocolate agar base (Oxoid CM55) supplemented with 00632 0 1998 IUMS 43 1 P. Vandamme and others Table 1. List of strains studied ~ ~ ~ Strain" Other strain no.? Fatty acid Source clusterlprotein electrophoretic sub-group ~ ~~ Pelistega euvopaea strains LMG 10982T Hommez N57 Pigeon (Belgium) LMG 12980 x2 12-90, HinzH6 Pigeon, lung, pneumonia, airsacculitis (Germany) LMG 12988 x858-83, HinzM19 Pigeon, lung (Germany) LMG 15727 ~993-85 Pigeon, trachea, tracheitis, bronchitis (Germany) LMG 15943 Hommez 4 Pigeon (Belgium) LMG 15725 ~708-82 Pigeon, trachea, tracheitis, bronchltis (Germany) LMG 15726 ~707-82 Pigeon, trachea, rhinitis, tracheitis (Germany) LMG 15728 ~207-85 Pigeon, air sac, airsacculitis, salpingitis (Germany) LMG 15934 Hommez 17 Pigeon (Belgium) LMG 16152 ~706B-82 Pigeon, trachea, exudative rhinitis, tracheitis (Germany) LMG 10983 Hommez 118 Pigeon (Belgium) LMG 11609 ~227-90 Pigeon, lung, pneumonia, airsacculitis (Germany) LMG 10986 Hommez 119 Pigeon (Belgium) LMG 12981 x101-90, HinzH7 Pigeon, palatine cleft, respiratory disease (Germany) LMG 12982 x121-90, HinzH8 Pigeon, lung, pneumonia, oophoritis (Germany) LMG 12985 x554-85, HinzM 11 Pigeon, trachea, respiratory disease (Germany) LMG 12991 x433-84, HinzM24 Pigeon, lung, bronchitis (Germany) LMG 15936 Hommez 25 Pigeon (Belgium) LMG 15942 Hommez 1 Pigeon (Belgium) LMG 15944 Hommez 24 Pigeon (Belgium) LMG 12990 x 567- 86, HinzM2 3 Pigeon, lung, pneumonia, airsacculitis (Germany) LMG 15729 ~636-85 Pigeon, lung (Germany) LMG 15730 ~657- 85 Pigeon, liver (Germany) LMG 15731 ~1-85 Pigeon, lung, crop inflammation, nephrosis (Germany) Taylovella equigenitalis strains LMG 6222T CCUG 10786T Horse, contagious metritis LMG6223 CCUG 16464 Horse (Sweden) LMG 6224 CCUG 16465 Horse (Sweden) B 1938-89 Horse (Germany) . LMG, BCCMILMG Culture Collection, Laboratorium voor Microbiologie Gent, Universiteit Gent, Belgium. t CCUG, Culture Collection University of Goteborg, Department of Clinical Bacteriology, Goteborg, Sweden. 10% (v/v) defibrinated horse blood. A loopful of well- DNA base compositions. All of the mean mol % G + C values grown cells was harvested and preparation, separation, were determined by thermal denaturation and calculated by identification and numerical comparison of the fatty acid using the equation of Marmur & Doty (16), as modified by methyl esters was performed using the Microbial Iden- De Ley (4). tification System (Microbial ID) as described previously DNA-DNA hybridization experiments. The degree of DNA- (25). DNA binding, expressed as a percentage, was determined Analysis of protein electrophoreticpatterns. P. europaea and spectrophotometrically by the initial renaturation rate T. equigenitalis strains were incubated for 48 and 96 h, method of De Ley et al. (5). Each value is the mean of at least respectively. Preparation of cellular protein extracts, PAGE, two hybridization experiments. Values of 30 % DNA bind- densitometric analysis, normalization and interpolation of ing and less do not represent significant DNA homology. the protein profiles, and numerical analysis were performed The total DNA concentration was about 63 pg ml-', and the as described by Pot et al. (20) using the GelCompar 4.0 optimal renaturation temperature in 1 x SSC was 63.9 "C. software package (Applied Maths). The profiles were re- corded and stored on a PC computer. The similarity between 16s rRNA sequencing. Part of the rDNA operon, comprising all pairs of traces was expressed by the Pearson product- the almost complete 16s DNA, was amplified by PCR. The moment correlation coefficient converted for convenience to forward primer was AGAGTTTGATCCTGGCTCAG, a percentage value. corresponding to positions 8-27 in 16s rRNA. The reverse Drimer was TCTGTGTGCCTAGGTATCC. comdemen- Preparation of high-molecular-mass DNA. High-molecular- iary to positions 45-26 in 23s rRNA. The PCR reachon was mass native DNA was prepared as described previously (25). carried out in a volume of 100 pl, using 2.5 U Taq polymerase 432 International Journal of Systematic Bacteriology 48 Pelistega europaea gen. nov., sp. nov. (Boehringer Mannheim), about 350ng DNA, 500nM of sterilized chicken serum. Final readings were done after 3 each primer and 200 JAMdNTPs, in the appropriate buffer. and 5 d incubation at 37 "C. Before addition of Tag polymerase and DNA, the mixture Oxidase activity was tested with a freshly prepared 1 YO was irradiated for 5 min on a UV transilluminator. After solution of N,N-dimethyl-p-phenylene monochloride 2min denaturation at 94"C, the following cycle was (Sigma) on reagent-impregnated filter paper as described by repeated 30 times: 1 min denaturation at 94 "C, 1 min Kersters & De Ley (12). The reactions were read within 30 s. annealing at 50 "C and 2 min polymerization at 72 "C. The Catalase was tested as described by Kersters et al. (13) and last cycle was followed by 10 min elongation at 72 "C. by using the ID-COLOUR-CATALASE test (bioM6rieux). The amplification product was purified by agarose gel Urea hydrolysis was determined as described by Lautrop electrophoresis, ligated in T-tailed pBluescript I1 SK( + ) (15) and on Christensen urea agar (Merck) with daily (Stratagene) as described by Holton & Graham (8), and readings up to 5 d. Nitrate reduction was done in nitrate electroporated into Escherichia coli DH5a cells. The plasmid broth cultures (Merck) and indole production was done in was isolated from 13 single clones according to Birnboim & standard I1 nutrient broth (Merck) with and without 2% Doly (2). This mixture was sequenced with the Pharmacia inactivated filter-sterilized chicken serum after 24 and 48 h Sequencing kit using a set of primers described previously by incubation at 37 "C. Wilmotte et al. (31). Part of the sequence was obtained by Determination