Investigation of the Signalling Network of the Nuclear Β-Amylases in Arabidopsis Thaliana

Research Collection

Doctoral Thesis

Investigation of the signalling network of the nuclear β-amylases in Arabidopsis thaliana

Author(s): Assenza, Federica

Publication Date: 2017

Permanent Link: https://doi.org/10.3929/ethz-b-000251921

Rights / License: Creative Commons Attribution 4.0 International

This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use.

ETH Library

DISS. ETH NO. 24649

INVESTIGATION OF THE SIGNALLING NETWORK OF THE NUCLEAR β-AMYLASES IN Arabidopsis thaliana

A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich)

presented by Federica Assenza

Dott. Magistrale in Biotecnologie Industriali, Università di Parma

born on 29.10.1987

citizen of Italy

Accepted on recommendation of

Prof. Dr. Samuel C. Zeeman (examiner) Prof. Dr. Olivier Voinnet (co-examiner) Prof. Dr. Ottoline Leyser (co-examiner)

2017

TABLE OF CONTENTS

TABLE OF CONTENTS ...... 1 ABSTRACT ...... 3 SOMMARIO ...... 5 1 INTRODUCTION ...... 7 1.1 Starch fuels plants growth at night ...... 7 Starch biosynthesis and degradation ...... 7 1.2 The β-amylase family ...... 8 BAM7 and BAM8: the nuclear β-amylases ...... 9 1.3 Sugar sensing and signalling in plants ...... 14 1.4 Integration of metabolic and hormonal signals ...... 16 1.5 Brassinosteroid: regulator of plant development ...... 18 The BR signalling pathway ...... 18 Physiological roles of brassinosteroids ...... 20 1.6 Protein post-translational modifications ...... 22 Protein phosphorylation ...... 23 1.7 Casein Kinase 2: biochemistry and physiological roles ...... 25 1.9 Aim of my study ...... 29 2 MATERIALS AND METHODS ...... 30 2.1 Plant methods ...... 30 Plant growth ...... 30 Stable transformation of Arabidopsis thaliana by floral dip ...... 30 Arabidopsis seed mutagenesis ...... 31 Transient transformation of Nicotiana bethamiana by leaf infiltration ...... 31 2.2 Molecular methods ...... 32 Transactivation assay in Arabidopsis mesophyll protoplasts ...... 32 Protein methods ...... 32 Nucleic acids methods ...... 36 2.3 Microscopy methods ...... 42 Fluorescence confocal laser scanning microscopy ...... 42 2.4 Bioinformatics analyses ...... 43 Identification of phosphorylated peptides and amino acids from LC-MS2 analyses ...... 43 Identification of single nucleotide variants from whole genome resequencing ...... 43 Identification of differentially expressed genes from RNA sequencing ...... 43

3 RESULTS AND DISCUSSION ...... 45 3.1 A forward genetics screen for the identification of novel components of the BZR1-BAMs signalling pathway ...... 45 Generation of a reporter line for the forward genetic screen ...... 45 The reporter gene is expressed from the onset of seedling development and best assessable 7 dpg ...... 47

Selection of EMS-mutagenized M2 lines based on the luminescence phenotype ...... 50

A second layer of selection of M2 lines through expression analyses of selected marker genes 52 A single backcrossing scheme for the generation of mapping populations ...... 55 Identification of the cause of the enhanced luminescence phenotype by whole genome resequencing ...... 56 Discussion ...... 65 3.2 Study of the phosphorylation of BZR1-BAMs ...... 69 BAM8 interacts with several kinases and is a phosphorylated protein ...... 69 CK2 interacts and phosphorylates BAM8 ...... 71 Multiple BAM8 residues are phosphorylated by CK2 ...... 73 In protoplasts CK2 seems not to modulate BAM8 TF activity ...... 75 Overexpression of phospho-impaired BAM8 mutants strongly affects plant development 77 Overexpression of BAM8 phospho-impaired variants causes large transcriptional changes 81 The transcriptional profiles of the BAM8 phospho-impaired lines resemble that of dark- grown plants ...... 87 Altered levels of trehalose 6-phosphate impose transcriptional changes that partly overlap with those of the BAM8 phospho-impaired lines ...... 89 Shading causes transcriptional changes resembling those imposed by overexpression of the BAM8 phospho-impaired mutants ...... 94 Discussion ...... 98 4 CONCLUSIONS ...... 107 REFERENCES ...... 113

This doctoral thesis is published under the Creative Commons license CC-BY.

ABSTRACT

The ability of plants to adapt to changing conditions has enabled them to colonize and thrive in very diverse and dynamic environments. One of the keys to their success is the capacity to perceive a wealth of internal and external cues and consequently fine-tune their developmental strategy, including the rate at which energy resources built-up through photosynthesis are utilized. Control over the allocation of assimilated carbon is of central importance, hence a number of sensing mechanisms exist that function under abundance or scarcity of carbohydrate and energy resources. Previously, two proteins of the β- amylase family, BAM7 and BAM8, were proposed as sugars sensors and signal transducers involved in adjusting plant growth. These proteins possess an inactive enzyme-like domain evolved from the starch degrading paralogs and presumed to bind a carbohydrate ligand. They also possess a DNA-binding domain, derived from the BZR1-family of transcription factors (TFs), and consequently are referred to as BZR1-BAMs. The preferred DNA element bound by BZR1-BAMs overlaps with TF-binding motifs including the brassinosteroid (BR) responsive motif and the G-box motif implicated in light and energy regulation. It was suggested that, through the similarity in DNA sequence recognition, the BZR1-BAMs exert an antagonistic effect to BR signalling. More recently, it was proposed that the BAM domain may bind the disaccharide trehalose 6-phosphate (Tre6P), a known sugar-derived signal metabolite, resulting in a change in TF activity. However, it remains unclear under which internal and/or environmental conditions the BZR1-BAMs’ function is most crucial. Furthermore, little is known about the network of interactions that enables BAM7 and BAM8 to play their role in the context of plant development. To start to address these unanswered questions, I designed and constructed a luciferase-based reporter line for assessing BZR1-BAM TF activity. This line was used as the basis for a forward genetic screen which led to the identification of several factors potentially involved in the regulation of the transcriptional output through BAM8. The identified proteins are involved in processes such as the control of gene expression and in the removal of post-translational modifications - known mechanisms for the regulation of TFs. Although these findings will need to be validated through further investigation, this proof-of-concept study is of significant interest and will allow BZR1-BAMs function to be explored and contextualised in the future. In a second approach, I used tandem mass spectrometry to show that several residues of the BAM8 transcription factor domain are phosphorylated in vivo. Through different interaction studies, protein sequence analysis, and in vitro phosphorylation assays I provide evidence that Casein Kinase 2 is one of the cellular factors responsible for BAM8 modification. By observing that the development of

Arabidopsis plants stably overexpressing BAM8 phospho-impaired variants is greatly altered compared with plants overexpressing the wild-type BAM8 protein, I hypothesized that phosphorylation has a negative regulatory effect on BAM8 transcriptional activity. This observation is supported by the gene expression profiles of these lines, determined by RNA sequencing: the number of genes deregulated and the magnitude of the changes were greater than in a line overexpressing the wild-type BAM8 protein. Comparisons of the transcriptional profiles of BAM8 phospho-impaired mutants to those of starved or shaded plants, or to that of a line with increased Tre6P levels leads me to propose that the BZR1-BAMs function in the signalling network that regulates resources utilization in times of low energy availability and stress. This may occur through increased DNA binding when the levels of the putative ligand Tre6P are low. The findings presented in this study further support the idea that the BZR1-BAMs are metabolic sensors functioning to match resources availability to growth, integrating this information into the complex network used also in hormone signalling.

SOMMARIO

La capacità delle piante di adattarsi a condizioni mutevoli ha permesso loro di colonizzare e prosperare in una varietà di ambienti in costante cambiamento. Una delle chiavi del loro successo è l’abilità di percepire un gran numero di stimoli interni ed esterni e di modificare di conseguenza la propria strategia di sviluppo, ivi inclusa la velocità di utilizzo delle risorse energetiche acquisite attraverso la fotosintesi. Il controllo dell’assegnazione del carbonio assimilato ad uno o all’altro processo è di centrale importanza, dunque esistono un certo numero di meccanismi di percezione attivi in condizioni di abbondanza o scarsità di carboidrati e risorse energetiche. Due proteine della famiglia delle β-amilasi, BAM7 e BAM8, sono già state proposte in precedenza come sensori dei livelli di zuccheri e trasduttori del relativo segnale, con implicazioni nelle regolazione della crescita della pianta. Tali proteine posseggono un dominio di derivazione enzimatica, evolutosi da paraloghi attivi nell’idrolisi dell’amido, che è ipoteticamente in grado di riconoscere un ligando di natura glucidica. BAM7 e BAM8 sono dotate anche di un dominio di legame al DNA, derivato da fattori di trascrizione della famiglia BZR1. In funzione di tali caratteristiche strutturali BAM7 e BAM8 sono state denominate BZR1-BAM. La sequenza di DNA preferenzialmente riconosciuta dalle BZR1-BAM è sovrapposta ad un motivi di legame di fattori di trascrizione che includono l’elemento di risposta ai brassinosteroidi (BR) e la G-box, implicata nella regolazione di risposte alla luce ed ai livelli energetici. È stato proposto che attraverso la similarità nella sequenza di DNA riconosciuta, le BZR1-BAM antagonizzino l’effetto dei brassinosteroidi. Più di recente, è stato proposto che il dominio BAM leghi il disaccaride trealosio 6-fosfato (Tre6P), un noto metabolita di derivazione glucidica con funzione di segnale, così determinando un cambiamento dell’attività trascrizionale delle proteine. Tuttavia, non è ancora chiaro in quali condizioni interne e/o ambientali la funzione delle BZR1-BAM sia di maggior rilievo. Inoltre si conosce solo in parte il network di interazioni che consente a BAM7 e BAM8 di svolgere il proprio ruolo nel contesto dello sviluppo della pianta. Per cominciare rispondere a questi interrogativi tuttora irrisolti, facendo uso del gene reporter della luciferasi ho progettato e prodotto una linea per valutare l’attività delle BZR1-BAM. Tale linea è stata la base per uno screen fondato sui concetti della forward genetics che ha condotto all’identificazione di diversi fattori potenzialmente coinvolti nella regolazione dell’attività trascrizionale di BAM8. Le proteine identificate sono implicate in processi quali la regolazione dell’espressione genica e la rimozione di modificazioni post-traduzionali – meccanismi già noti nel controllo dei fattori di trascrizione. Nonostante questi risultati necessitino di prove aggiuntive per essere validati, il presente studio rappresenta una prova

5 di concetto di significativo interesse che permetterà la futura indagine e contestualizzazione dell’attività delle BZR1-BAM. Con un secondo approccio, utilizzando spettrometria di massa in tandem, ho mostrato che numerosi residui del dominio di attivazione trascrizionale di BAM8 sono fosforilati in vivo. Attraverso diversi studi di interazione proteina-proteina, analisi della sequenza proteica e assay di fosforilazione in vitro ho fornito delle prove che Casein Kinase 2 è uno dei fattori cellulari responsabili della modificazione di BAM8. Inoltre, avendo osservato che lo sviluppo di piante di Arabidopsis che over-esprimono versioni fosfo-mutate di BAM8 è fortemente alterato rispetto a quello di piante che over-esprimono la forma wild- type della proteina, sono giunta ad ipotizzare che la fosforilazione regoli negativamente la attività trascrizionale di BAM8. Quest’osservazione è supportata dal profilo di espressione genica delle linee succitate, studiato attraverso il sequenziamento dell’RNA: il numero di geni deregolati e la grandezza dei cambiamenti sono maggiori di quelli osservati in una linea che over-esprime la forma wild-type di BAM8. Il confronto tra i profili di espressione genica delle line che esprimono versioni fosfo-mutate di BAM8 e quelli di piante cresciute in assenza di luce o in condizioni che riproducono l’ombreggiamento, o ancora con quello di una linea che possiede elevate concentrazioni di Tre6P mi inducono a proporre che le BZR1- BAM agiscono nel network di trasduzione del segnale che regola l’utilizzo delle risorse in condizioni di scarsa disponibilità di energia e in situazioni di stress. È possibile che questo si verifichi attraverso il maggiore legame al DNA quando i livelli del supposto ligando, il Tre6P, sono bassi. I risultati presentati in questo studio costituiscono un’ulteriore linea di supporto all’idea che le BZR1-BAM siano sensori metabolici che agiscono per accoppiare la disponibilità di risorse alla crescita, integrando questo tipo di informazioni nel complesso network utilizzato anche dai sistemi di trasduzione di segnali ormonali.

INTRODUCTION

1 INTRODUCTION 1.1 Starch fuels plants growth at night

In all organisms, basal cellular metabolism is a continuum of reactions that enable the maintenance of homeostasis and ensure the progression of life. This is true also for plants that, as photo-autotrophic organisms, depend entirely on the energy acquired from light through photosynthesis. During dark phases, when photosynthesis cannot take place, plants rely on stored forms of energy. The molecule often used is starch, referred to as transitory starch when produced and broken down by the autotrophic tissues of the plant during the diel cycle. Through the Calvin-Benson cycle, carbon is assimilated into organic molecules. Part of the photo-assimilates are used directly as fuel to sustain the cellular metabolism and as building blocks for growth, while the rest is funnelled into the biosynthesis of starch (Streb and Zeeman, 2012). The central importance of starch in plant metabolism is testified also by the multiple layers of control, including allosteric and redox regulation, complex formation and post translational modifications that its biosynthetic enzymes undergo (Kötting et al., 2010; Geigenberger, 2011). These mechanisms allow the coordination of cellular metabolism in response to important environmental cues such as light.

Starch biosynthesis and degradation Starch is made of two types of glucose polymer: branched amylopectin and near-linear amylose. The linear parts of these molecules form helices – double helices in the case of amylopectin and single helices in the case of amylose. The double helices of amylopectin align into layers thereby creating the insoluble starch granule. In leaves, starch is synthetized and degraded in the chloroplast, where all the required biosynthetic enzymes localize. In Arabidopsis, multiple starch synthases (SS) were reported that can initiate amylopectin and participate in the elongation of its constituent chains. In addition, granule bound starch synthase (GBSS) is responsible for the formation of amylose within the developing starch granule. However, these enzymes are not sufficient for the production of the insoluble starch granule which needs in addition branching enzymes (BEs) to create branch points and debranching enzymes (DBE) to tailor its final structure such that it can crystallise efficiently (Streb and Zeeman, 2012). The coordinated action of multiple enzymes is required also for starch degradation at night. Transient starch is broken down at a more-or-less constant rate to produce maltose and glucose that fuel plant metabolism (Zeeman et al., 2010). An important class of enzymes for starch breakdown is β-amylase (BAM). BAMs are exo-acting enzymes that release maltose units from the non-reducing ends of glucan

INTRODUCTION chains. However, BAMs are unable to act at and in proximity of the branching points of amylopectin that are instead hydrolysed by debranching enzymes (DBEs). α-Amylases also participate in the degradation of starch by cleaving internal bonds, thereby producing a mixture of linear and branched malto- oligosaccharides that will be further degraded by BAMs and other enzymes such as disproportionating enzymes (DPEs). Starch degradation is a highly controlled process. One of the mechanism regulating its hydrolysis is the reversible phosphorylation of the glucan chains at the granule surface. The semi- crystalline structure of the starch granule makes access to the degrading enzymes difficult. By addition of phosphate groups to the ordered amylopectin double helices these are disrupted and become available to the action of hydrolytic enzymes (Engelsen et al., 2003). Two enzymes, glucan, water dikinase (GWD) and phosphoglucan, water dikinase (PWD) act in series by adding phosphate groups at the C6 and C3 position of glucosyl residues, respectively (Ritte et al., 2002; Koetting et al., 2004). However, glucan phosphatases are also fundamental players in starch degradation, as only dephosphorylated oligosaccharides are substrates for β-amylases. The glucan phosphatases SEX4 (STARCH EXCESS 4) and LSF2 (LIKE SEX FOUR 2) remove the phosphate groups and enable starch degradation to proceed (Kötting et al., 2009; Santelia et al., 2011).

1.2 The β-amylase family

Maltose produced by β-amylases is the major product of starch degradation at night. Arabidopsis possesses a family of nine genes encoding β-amylase isoforms. However, not all the proteins localize to the chloroplast and are active in starch breakdown. Instead, some family members perform regulatory roles. Phylogenetic analyses according to the alignment of the glycosyl-hydrolase domain led to the classification of plant β-amylases into four clades (Figure 1-1; Fulton et al., 2008). Measurements of starch and maltose levels of β-amylase mutants allowed the isoforms implicated in starch degradation to be identified. BAM1 and BAM3 form the subfamily II. BAM3 functions in the hydrolysis of transitory starch and the mutant exhibits elevated starch levels and reduced amounts of maltose at night, relative to wild-type plants. However, the double mutant bam1bam3 shows an even more severe starch accumulation and reduced maltose levels than bam3, indicating BAM1 as an active isoform in the leaves, even though starch and maltose levels are unaltered in the bam1 single mutant. Recent studies demonstrated that under normal conditions BAM1 expression is higher in guard cells than in leaves. There, starch degradation is implicated in regulating stomata opening (Valerio et al., 2011; Horrer et al., 2016).

INTRODUCTION

Despite the apparent lack of activity, BAM4 also seems to be required for efficient starch degradation, as the bam4 mutant has a slight starch excess phenotype that, when crossed into other backgrounds, worsens the sex phenotype (e.g. of bam3 and of bam1bam3; Fulton et al. 2008). BAM4, as well as BAM9, resides in the chloroplast. Together, they are members of subfamily III in Arabidopsis, which comprises the most diverged isoforms. Presently, the role of BAM9 remains elusive. Other isoforms include the paralogs BAM5 and BAM6, both belonging to subfamily I. BAM5 was proposed to be cytosolic, thus not active in starch degradation (Laby et al., 2001). To neither of these proteins was a clear physiological role assigned to date. BAM2, BAM7 and BAM8 are members of subfamily IV. Despite the conservation in the active site of two glutamic acid residues important for catalysis, BAM7 and BAM8 were shown to have essentially no hydrolytic activity (Reinhold et al., 2011). Phylogenetic analyses showed that BAM2 and BAM7 are paralogs resulting from a recent duplication event, however extensions at both ends of the gene differentiate BAM7 from BAM2 (Figure 1-1; Fulton et al. 2008).

BAM7 and BAM8: the nuclear β-amylases As opposed to most members of the BAM family that localize to the chloroplast, BAM7 and BAM8 are nuclear proteins with a remarkable two-domain structure (Reinhold et al., 2011). In addition to a conserved BAM domain, in the N-terminus of the protein they possess a transcription factor (TF) domain homologous to BRZ1 (BRASSINAZOLE-RESISTANT 1), the central regulator of the brassinosteroid (BR) signalling pathway. As a result of this structure, BAM7 and BAM8 are referred to as BZR1-BAMs. Arabidopsis BAM7 and BAM8 are 50% identical in sequence overall. However, from alignment of BZR1- BAMs orthologues of vascular plants, it is apparent that conservation is highest in the DNA-binding region and in the enzyme-like domain (Figure 1-3 A; Soyk et al., 2014).

III Figure 1-1 Members of the β–amylase family in Arabidopsis thaliana. A. thaliana possess nine β–amylase isoforms that IV are classified into four clades. The gene structure and synteny are shown. Adapted from Fulton et al., 2008.

INTRODUCTION

Both proteins were shown to have high affinity for an 8-nucleotide motif, then referred as to BZR1-BAMs responsive element (BBRE, CACGTGTG). This DNA motif was initially identified in vitro by random binding site selection experiments coupled to electrophoretic mobility shift assays (Reinhold et al., 2011). BZR1-BAMs preferential binding was subsequently confirmed in vivo by the overrepresentation of this element within the 500 bp promoter sequence of genes up-regulated in a line overexpressing BAM8 and down-regulated in the bam7bam8 mutant, while a mutated version of the BBRE (mBBRE, CACTTGTG), considered as control, was not enriched (Reinhold et al., 2011). The gene expression analyses also suggested that BAM8 functions as a transcriptional activator in vivo, while the role of BAM7 still remains ambiguous, in that it seems to counteract BAM8 activity, probably by forming inhibitory heterodimers. This hypothesis derives from multiple observations. First, BAM7 and BAM8 were shown to form homo- and heterodimers, both in vitro and in vovo (Soyk et al., 2014). However, while BAM8 can alone activate transcription from the BBRE, for BAM7 no detectable expression of a reporter gene was seen in transactivation assays performed in protoplasts. Furthermore, when the two proteins were co-expressed a reduced expression of the reporter gene was observed (Luginbühl, MSc thesis 2012). This led to hypothesize a suppressive effect of BAM7 on BAM8. It was also observed that in planta BAM7 overexpression does not cause large transcriptional changes (Soyk et al., 2014). The BAM domain of BZR1-BAMs was shown to be essentially catalytically inactive in starch and oligosaccharides degradation. However, its high conservation suggests a crucial role for this domain in the function of the proteins (Figure 1-3 A; Reinhold et al., 2011). Indeed, in vitro and in vivo transcriptional studies demonstrated that the BAM domain regulates the TF activity of the BZR1-BAMs as well as influencing their DNA-binding specificity. When the BAM domain of BAM7 was fused to the N-terminal part of BAM8, the resulting protein was unable to activate the transcription of a reporter gene and was like the full-length BAM7. On the contrary, fusion of the TF domain of BAM7 to the BAM domain of BAM8 resulted in transactivation levels similar to that of the wild-type BAM8 protein. Further evidence for the importance of the BAM domain derived from experiments where just the N-terminal portion, that included the DNA-binding domain, of the proteins were overexpressed in transgenic Arabidopsis lines (BAM7-N-OX and BAM8-N-OX). Transcriptional profiling of these plants revealed the deregulation of numerous genes, irrespective of the presence of a BBRE motif in their promoters. This was quite unlike what was observed in lines overexpressing the full-length wild-type BAM8, where, as mentioned above, the BBRE was specifically overrepresented in the promoters of up-regulated genes (Soyk et al., 2014). The rosettes of the N-termini overexpressing lines were dwarfed compared to those of the respective full-

INTRODUCTION length over-expressors, correlating with the greater alteration in their global transcriptional profiles (Figure 1-2 A). From analysis of the crystal structure of the soybean enzyme β-amylase 1 (GmBMY1) it is known that the active site of BAMs possess a pair of highly conserved glutamic acid (Glu) residues that are required for starch hydrolysis. Chance of one of these residues to glutamine led to a decrease of 16,000 fold in protein activity. The substrate binding cleft of BAM8, despite being generally less electro-negative than the active enzymes, still possesses those residues (Glu186, Glu380), thus it was hypothesized that they might be functional to binding of the putative ligand. Glu380 was mutated to arginine in the BAM domain of BAM8 (Figure 1-3 C), so as to impede the binding of the putative ligand by introduction of a bulky side chain. The resulting protein was unable to activate gene transcription both in vitro and in vivo, thereby substantiating the importance of the BAM domain also for the TF activity (Soyk et al., 2014). Currently, it is hypothesized that the conservation of the BAM domain is crucial for the function of BAM8, and the role of the domain is as a receptor for an as-yet unidentified carbohydrate-derived molecule. The BZR1-BAMs are proposed to input sugar signals that help to coordinate plant growth by interfacing with other internal stimuli, such as those dictated by plant hormones (Soyk et al., 2014). A feature of the DNA motif recognized by BAM7 and BAM8 is that it contains two shorter known

DNA motifs, the G-box (CACGTG) and the BRRE (Brassinosteroid responsive element, CGTGT/CG) motif (Reinhold et al., 2011). The first is found in the promoters of several light- and low energy- responsive genes, while the second controls genes in the BR transcriptional module (Chattpadhyay et al., 1998; He et al., 2005; Baena-González et al. 2007). This DNA specificity is not surprising considering the conservation of the TF domain with BR regulatory proteins (Figure 1-3). Furthermore, the phenotypic traits resulting from mutating both BZR1-BAMs (bam7bam8) or overexpressing BAM8 (BAM8-OX; Figure 1-2) bear some similarities to mutants affected in light and/or BR signalling. The double knockout mutant shows altered growth of the rosette leaves that are reminiscent of shaded plants (Figure 1-2 A): leaf petioles are elongated and the leaf blades are epinastic compared to the wild type. On the other hand, lines that overexpress BAM8 are dark green and have smaller rosettes, with shorter petioles and rounded, hyponastic leaves (Figure 1-2 A). These latter traits are often associated with impaired BR signalling. The putative crosstalk with the BR signalling pathway was substantiated by additional phenotypic and genetic observations. BAM8-OX was found to be hypersensitive to brassinazole (BRZ, a BRs synthesis inhibitor) in a hypocotyl-growth assay in the light and to develop fewer lateral roots, similarly to the bri1 (BR INSENSITIVE 1) mutant (Figure 1-2 B). Furthermore, the bam7bam8 double mutant resembles the short root phenotype of bes1-D, an hypermorphic version of the TF BES1 (BRI1-EMS-SUPPRESSOR 1),

INTRODUCTION homologous to BZR1 and also involved in BR signalling (Figure 1-2 B; Soyk et al., 2014; Soyk, PhD thesis 2013). Thus it seems that the BZR1-BAMs mediate responses antagonistic to those activated by BR. At the transcriptional level, microarray analyses, conducted both on dark and light-grown plants, reveal that a substantial number of genes are controlled by both the BZR1-BAMs and BR transcription factors, but in opposing directions, consistent with the phenotypic observations. Comparisons of the transcriptomes of BAM8 overexpressing lines and of the double knockout mutant bam7bam8, revealed that the transcriptional profiles of these lines change in a largely inverse manner. Both studies showed that BR mostly represses genes induced by the overexpression of BAM8, while BR-induced genes are up- regulated in the bam7bam8 mutant (Reinhold et al., 2011; Soyk, PhD thesis 2013). The overlap between the BR and the BZR1-BAMs deregulated genes includes direct and indirect targets of the respective TFs. A subset of the genes whose promoters are bound by BZR1 are also regulated by the BZR1-BAMs (Sun et al., 2010; Soyk, PhD thesis, 2013). Among these, one (AT5G57785) was also shown to be directly recognised by BAM8 in chromatin immunoprecipitation (ChIP) experiments (Dankwa-Egli, PhD thesis

Wild type BAM8-OX bam7bam8

Figure 1-2 Lack of overexpression of BZR1-BAMs has effects on shoot and root development. A. Rosette phenotype of 3-weeks old BZR1-BAMs mutants and transgenic lines. BAM7-OX: line overexpressing the full- length protein; BAM7-N-OX: line overexpressing the N- terminal portion of the protein, including the BZR1 domain. The same nomenclature is used for BAM8 transgenic lines. Adapted from Soyk et al., 2014. B. Root phenotype of seedlings grown vertically on synthetic medium for 7 days. Adapted from Soyk, PhD thesis, 2013.

INTRODUCTION

2017) and, together with AT5G22580, it was used as marker gene for the activity of the BZR1-BAMs. These two genes, annotated as of unknown function (TAIR10), are referred to as BZR1-BAMs UPREGULATED (BUP; BUP2 and BUP1, respectively), as their expression is increased in BAM8-OX and reduced in bam7bam8 compared to wild-type levels. Of note, the promoters of BUP1 and BUP2 possess one and two BBRE motives, respectively. Transactivation assays performed in Arabidopsis protoplasts, using BAM8, BES1 and BZR1 to drive the expression of a reporter gene under the control of a synthetic BBRE promoter have provided a further line of evidence for BAM8 TF activity and BR antagonism (Soyk, PhD thesis 2013). When co-expressed with either BES1 or BZR1, BAM8 ability to activate gene transcription is drastically reduced compared to when it is the only TF transfected into the protoplasts, while BES1 or BZR1 inhibited reporter gene expression below wild-type levels. Clear developmental phenotypes were observed only for BAM8-OX and bam7bam8: neither single mutants of BAM7 (bam7-1) or BAM8 (bam8-1), nor lines overexpressing BAM7 (BAM7-OX) differ from wild-type plants (Figure 1-2). Some of these observations are difficult to interpret: the lack of phenotypes

Figure 1-3 BAM7 and BAM8 alternate highly conserved regions to variable features that may account for the observed differences in activity of the two isoforms. A. Degree of conservation of protein sequences of BAM7 (31 sequences) and BAM8 (27 sequences) orthologues as aligned by ClustalW. Highly conserved regions and variable features of the BZR-family transcription factor and active BAMs domain are annotated. The x axis indicates amino acid position in the alignment and should not be confused with the specific numbering of the Arabidopsis proteins (Soyk et al., 2014). B. Protein sequences of 31 BAM7 orthologues. BAM7-specific acidic and glutamine (Q)/glycine (G)-rich regions are indicated. C. Amino acid sequences of 27 BAM8 orthologues. The BAM8-specific arginine (R)/alanine (A)-rich region is additionally shown. Adapted from Soyk et al., 2014.

INTRODUCTION of the single null-mutants, as well their transcriptional profiles - similar to the wild type - suggests a redundant role for the two TFs, however the difference in the transcriptional profile of BAM8-OX and that of BAM7-OX and the evidence that BAM7 inhibits the molecular function of BAM8 contradict this idea.

1.3 Sugar sensing and signalling in plants

Growth and development are costly processes, both in terms of building blocks necessary to assemble new organs and cellular components, and in terms of energy requirements to fuel the underling anabolic metabolism. Sugars are the basic reserves for both the aforementioned processes, thus their availability needs to be constantly monitored in order to maintain growth and prevent energy stress. Several mechanisms have evolved in plants to sense the levels of a variety of sugars from which even more signalling pathways derive. Abundance of resources is sensed and communicated through HEXOKINASE 1 (HXK1), trehalose 6-phosphate and TARGET OF RAPAMYCIN (TOR), considered the growth promoting systems, whereas at times of resources scarcity growth is inhibited through SnRK1 (SNF1- related kinase 1) and the S1/c bZIP transcription factors. In source tissues like leaves, activities such as photosynthesis and nutrient remobilization, are stimulated through signalling of sugar scarcity, whereas in storage tissues, sugar abundance promotes sink functions, such as growth and carbon storage (Rolland et al., 2006). Contrary to heterotrophic organisms, plants are able to obtain their carbohydrates only in the presence of light, water and carbon dioxide, through daytime photosynthesis, while at night they must respire some of these photoassimilates heterotrophically. This presumably complicates the coordination of resources acquisition and usage even further. A central matter in the life of plants is the allocation of the assimilated carbon to soluble sugars, utilized for immediate biomass production and as fuel, or to storage as compounds like starch, which are consumed during the dark phase (Stitt and Zeeman, 2012). In this scenario, sugars may act also as signalling molecules to coordinate growth with the internal energy availability and external environmental cues, such as diel changes in light. Glucose and sucrose are the most established sugar signals, and recently, trehalose 6-phosphate (Tre6P) has emerged as a signal metabolite whose levels are closely linked with sucrose. However, it is likely that other saccharides (e.g. fructose), or their derivatives, play signalling roles. The first sugar sensing system to be identified in Arabidopsis was HXK1, which perceives and responds to glucose availability. The use of glucose-insensitive mutants and the molecular characterization of the protein allowed the enzymatic kinase activity of HXK1 to be uncoupled from its glucose sensing and signal transducing role, as it had already been discovered for the yeast protein

INTRODUCTION

HEXOKINASE 2 (ScHXK2) (Moreno et al., 2005). Surprisingly, HXK1, traditionally regarded as a cytosolic enzyme of glycolysis, was found to form a nuclear complex with VHA-B1 and RPT5B, a vacuolar H+-ATPase and a regulatory subunit of the 19S proteasome, respectively. The nuclear HXK1 complex was proposed to interact with the promoters of specific target genes to directly regulate their glucose-dependent expression, ultimately stimulating plant growth (Cho et al., 2006; Smeekens et al., 2010). The HXK1 system represents an example of the remarkable ability of some proteins to adopt multiple functions: metabolic enzymes on the one hand and signalling effectors on the other. Plants possess also glucose-sensing mechanisms independent of HXK1. One system is proposed to depend on a G-proteins coupled receptor and involving the subunits GPA1 and RGS1, the sensor and regulator, respectively (Huang et al., 2006; Grigston et al., 2008). TOR, a serine-threonine protein kinase conserved in all eukaryotes, is an important integrator of nutrient, energy and stress signalling networks (Xiong and Sheen, 2015). Glucose and sucrose abundance activate TOR signalling network leading to enhanced cell division and expansion via the stimulation of translation, through polysome assembly and translation reinitiation after µORF, and the inhibition of autophagy (Xiong et al., 2013; Ahn et al., 2011). In addition to the reported interaction with the aforementioned sugar signalling pathways, TOR was also hypothesized to play a role in the regulation of starch metabolism, as Arabidopsis TORC1 knockdown lines have a starch excess phenotype (Dobrenel et al., 2013). However, it is not yet clear whether this is a direct or secondary phenotype, or whether it is attributable to reduced starch degradation or greater biosynthesis. Like for glucose, a growth-promoting role has been reported also for sucrose, but the sensing mechanisms remain unknown. Sucrose is a direct product of photo-assimilation and is transported throughout the plant, from source to sink organs. It represses the translation of the S1-group of bZIP transcription factors, which activate catabolic processes and photosynthesis when resources are low leading to a stimulation of alternative resources utilization (Wiese et al., 2005). In addition, sucrose exerts a positive effect on many basic cellular processes such as cell cycle progression, transcription, translation and starch biosynthesis (Horacio and Martinez-Noel, 2013). The levels of sucrose, as well as those of trehalose 6-phosphate (Tre6P), follow a diel pattern, rising during the day and decreasing upon onset of the dark phase. The concentrations of the two metabolites were found to correlate closely both in source leaves and in sink organs (Lunn et al. 2006). However, Tre6P is found only at very low concentrations in plant cells, advocating for a purely signalling role (Paul et al., 2008). In Arabidopsis, Tre6P is an essential metabolite during embryogenesis, as demonstrated by the lethal phenotype of the tps1 (TREHALOSE SHYNTASE1) mutant that has lost the

INTRODUCTION ability to synthesise it. However, Tre6P is important also during vegetative growth, where a lack of a functional TPS1 causes growth retardation (Gómez et al., 2010). Tre6P has important roles in controlling several other physiological processes, such as sensitivity to the hormone abscisic acid (ABA), starch metabolism, and the transition to flowering (van Dijken et al., 2004; Gómez et al., 2006; Wahl et al., 2013; Avonce et al., 2004). Tre6P was found to inhibit another signalling pathway that is pivotal to the control of plant primary metabolism: the kinase SnRK1 (Baena-González et al., 2007). The SnRK1 kinase complex is conserved among eukaryotes where it functions as a tetramer composed of a catalytic α-subunit and two regulatory β- and γ-subunits (Hanson and Smeekens, 2009). Glucose 1-phosphate and glucose 6- phosphate are other repressors of SnRK1, which is activated in conditions of low energy availability. Upon activation, SnRK1 halts development and catabolic metabolism is switched on to ensure plant survival also during times of limited resources availability or starvation (Smeekens et al., 2010). To reinforce this mechanism, the transcriptional activity of S1-group of bZIP TFs, involved in the regulation of SnRK1 targets, is activated by the catalytic subunit of SnRK1, KIN10 (Baena-González et al., 2007). Interestingly, TOR and KIN10 regulated a common set of genes in an antagonistic fashion, reinforcing the notion of highly coordinated responses to nutrients availability (Baena-González et al. 2007; Lunn et al. 2014).

1.4 Integration of metabolic and hormonal signals

Plant development and growth demand high amounts of energy and there is a tight spatio-temporal coordination of events among different source and sink organs. In this context, metabolic signals inform the organism about resource availability, while hormonal signals are fundamental to impose transition changes and spatial organization of the ongoing and upcoming events. Thus, it is apparent that crosstalk between sugar and hormonal signalling is important throughout the life of the plant. To date, interaction with sugars signals has been reported for virtually all known classes of hormones with different outcomes depending on the developmental stage and on the tissue under study. However, we still lack a complete understanding of the functioning of these pathways: experimental evidence is fragmentary and, at times, contradictory. The link between sugars and ABA is long known. The first evidence came from genetic screens where several glucose (gin) and sucrose-insensitive (isi) mutants were found to be impaired in ABA synthesis or signalling. Mutants in the ABA biosynthetic genes ABA1-ABA3 (ABA DEFICIENT 1-3) are insensitive to elevated glucose levels and it is known that high concentration of this sugar induces their

INTRODUCTION expression, leading to increased ABA levels (Arenas-Huertero et al., 2000; Laby et al., 2000; Rook et al., 2001; Luo et al., 2010; Cheng et al., 2002). On the other hand, there is evidence that the glucose sensor HXK1 requires ABA to carry out its glucose-mediated responses (Arenas-Huertero et al., 2000). The glucose insensitive gin6 mutant and the sucrose insensitive isi3 mutant are both alleles of abi4 (ABA- INSENSITIVE 4) (Laby et al., 2000; Rook et al., 2001). This gene encodes a TF of the APETALA2 family and it is one of the major players in the ABA signalling pathway. ABI4 can bind to both ABA and sugars- responsive elements, and its role is most relevant in seeds, during germination and early seedling development, while it is low in abundance in vegetative tissues (Rook et al., 2006). Like ABI4, ABI5 is a second TF involved in ABA signalling. When ABI5 is mutated, it also confers glucose insensitivity and resistance to high mannose concentrations, while the other ABI mutants (abi1-abi3) are sensitive to high sugars levels and do not grow in their presence. These observations suggest that the interplay between ABA and glucose makes use of a dedicated branch of the ABA signalling pathway (Arenas-Huertero et al., 2000). During embryo development, sugars and ABA act synergistically to regulate cell division and expansion (Wobus and Weber, 1999; Finkelstein and Gibson, 2002), while during seed germination and seedling growth, glucose and ABA counteract each other’s effect (León and Sheen, 2003). Mutants impaired in trehalose metabolism (tppg and tre1) are insensitive to the effects of ABA (e.g. on stomata closure and on seed germination), suggesting a link also between these two pathways (Vandesteene et al., 2012; Van Houtte et al., 2013). In recent years, the idea of crosstalk between sugar metabolism and the phytohormone auxin was advanced by a series of observations that correlate the abundance of the auxin with the levels of various sugars. It was found that the levels of IAA (indole-3-acetic acid, the major form of auxin) fluctuate with a diel frequency and that the maximum and minimum correspond to the accumulation of sugars at the end of the light phase and with their depletion towards the end of the subsequent night, respectively. The level of auxin biosynthesis correlated with the length of the illuminated period, and was also increased in the mutant dpe2-3 that accumulates high amounts of hexoses (Sairanen et al., 2012). The same study established a link between the increased auxin levels and the induction of several of its biosynthetic genes by exogenous glucose and showed reduced basal and glucose-induced IAA levels in the gin2 mutant, impaired in the HXK1 functions. Conversely, auxin signalling mutants were found to be insensitive to glucose concentrations that inhibited growth of the wild type (Moore et al., 2003). Expression analyses showed that a subset of auxin-regulated genes are affected by glucose alone, while others are regulated by glucose only in the presence of auxin (Mishra et al., 2009). At the phenotypic level, the alterations in the root architecture of auxin sensing and signalling mutants were exacerbated by glucose, suggesting

INTRODUCTION that its effect might be due to the convergence of the two response pathways. Sucrose was also found to increase auxin levels and alter its distribution. This resulted in the stimulation of growth of Arabidopsis hypocotyls and in increased root-ward transport of sucrose (Lilley et al., 2012).The induction of auxin biosynthetic genes by glucose and sucrose was proposed to be due to the relief of the negative regulation carried out by transcription factors of the PIF (PHYTOCHROME INTERACTIONG FACTOR) family, that would mediate the sugar-induced auxin biosynthesis (Sairanen et al., 2012; Lilley et al., 2012). The crosstalk between brassinosteroids and sugar signalling has emerged only recently. BRs are the steroid plant hormones pivotal in the promotion of cell elongation and expansion, hence they have a central role in plant development. Because of this function, their involvement in sugar-mediated growth promotion of both shoot and root was investigated in Arabidopsis seedlings by several studies. It was shown that glucose-induced hypocotyl elongation in the dark is mediated by HXK1 and requires intact BR synthesis and signalling. The HXK1 mutant gin2-1 was shown to have reduced sensitivity to BR and glucose in terms of hypocotyl elongation, and BR biosynthetic and sensing mutants remained short in the presence of increasing concentrations of glucose, whereas bzr1-D and bes1-D had longer hypocotyls than the wild type. By generating a double mutant gin2bri1 and observing a similar elongation in response to glucose to that of the single bri1 mutant it was concluded that BR signalling occurs downstream of the sugar- mediated elongation response (Gupta et al., 2015b). Furthermore, glucose induces the expression of several genes in the BR pathway, including BZR1 and BES1, and stabilizes BZR1 protein (Zhang et al., 2015; Zhang & He, 2015). More recently, the involvement of TOR in the sugar signalling cascade that culminates in BR-mediated hypocotyl elongation in the dark was demonstrated. This study revealed that the effect of TOR impairment is greater than that of HXK1 on hypocotyl growth owing to the stabilization of BZR1 (Zhang et al., 2016). An interplay among light, sugars and BRs was proposed earlier, upon the isolation of the bls1 (Br, light, sugar) mutant that displayed de-etiolation in the dark and hypersensitivity to sugars, phenotypes that could be rescued by BR treatment (Laxmi et al., 2004).

1.5 Brassinosteroid: regulator of plant development The BR signalling pathway Genetic and biochemical studies have led to a good understanding of the core steps in the BR signalling cascade (Figure 1-4). Nevertheless outstanding questions remain, particularly regarding the coordination

INTRODUCTION of the molecular events occurring from the cell surface, where BRs are perceived, to the nucleus and the connectivity of this to other pathways. BR signalling is initiated at the plasma membrane by the binding of the hormone molecule to the transmembrane leucine-rich repeat receptor-like kinase BRI1 or to other members of this family of receptors (BRI1-LIKE 1 and BRI1-LIKE3) (Caño-Delgado et al., 2004). This event results in the fast activation of the intracellular kinase domain of BRI1 by phosphorylation (Zhu et al., 2013). Activated BRI1 forms a heterodimer with BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE1) and in turn activates two kinases, BSK1 (BRASSINOSTEROID-SIGNALING KINASE1) and CDG1 (CONSTITUTIVE DIFFERENTIAL GROWTH 1) that will then interact and phosphorylate BSU1 (BRI-SUPPERSSOR1) a serine/threonine phosphatase. BSU1 in turn dephosphorylates, and thereby inactivates, BIN2 (BRASSINOSTEROID INSENSITIVE 2). BIN2 is a cytoplasmic GSK3/Shaggy-like protein kinase that negatively regulates BR signalling by phosphorylating and inactivating the two central transcription factors involved in the BR signalling cascade (Figure 1-5): BZR1 and BES1 (Wang et al., 2012; Zhu et al., 2013). In the presence of BR, PP2A (PROTEIN PHOSPHATASE 2A) dephosphorylates BZR1 and BES1, resulting in their activation. BZR1 and BES1 are atypical basic helix- loop-helix (bHLH) TFs. They regulate an extensive number of genes (up to 20 % of the genome) as shown by microarray experiments and CHIP-Seq studies have reported their binding to two DNA cis elements: the E-box (CANNTG), predominantly associated to BR-induced genes, and the BR response element (BRRE,

CGTGT/CG) mostly found in the promoters of BR-repressed targets (He et al. 2005; Yin et al. 2005; Sun et al. 2010; X. Yu et al. 2011 ).

INTRODUCTION

Physiological roles of brassinosteroids Brassinosteroids play roles in many developmental stages throughout plant growth and participate in the responses to a variety of stresses, both biotic and abiotic. BRs promote seed germination when supplied at low concentration. Moreover, it was observed that BR mutants det2-1 (DEETIOLATED 2) and bri1-1 are more sensitive to the action ABA, which antagonizes germination (Steber and McCourt, 2001). One of the first recognised effects of BRs was their involvement in post-germinative growth, specifically skotomorphogenesis in the dark. BR defective mutants grown in darkness show short hypocotyl, open apical hook and cotyledon expansion, resembling the phenotype of seedlings germinated in the light (Chory et al., 1991). These traits derive from the involvement of BRs in the promotion of cell expansion and division. It was observed that BRs control several enzymes involved in cell wall loosening and organization, and channels responsible for cell turgor, such as aquaporins (Goda et al., 2002; Morillon et al., 2001). In addition, a role of BRs in cell cycle progression was suggested, as mutants show altered expression of cell cycle markers and reduced root meristem size (González-García et al., 2011). However, further studies are required to corroborate these observations.

Figure 1-4 Schematic representation of the current model for the brassinosteroid signalling pathway. Inactive pathway (“off”) and activated pathway (“on”) in the presence of brassinolide (BL). Phosphorylation is represented by the letter P circled in orange, kinases by kidney-shaped figures, transcription factors by hexagons and phosphatases by rectangles. BKI1, BRI1 KINASE INHIBITOR 1; CDL, CDG-LIKE; BSU1, BRI1 SUPPRESSOR 1; BSL, BSU1-LIKE. Adapted from Belkhadir and Jaillais, 2015.

INTRODUCTION

In the early stages of seedling growth, the transition between darkness and light imposes two distinct developmental programs, since light exerts a strong signalling role. In this context, signals deriving from BRs need to be integrated with those coming directly from light and from other hormones, such as gibberellins (GA). BRs control the expression of many light-regulated genes via the TFs BZR1 and BES1. The activity of these proteins is fine-tuned by the interaction with key regulators of light responses, such as the TF PHYTOCHROME-INTERACTING FACTORS 4 (PIF4), and by the DELLA proteins that respond to GA stimulations. This molecular network allows the two hormones and light to synergistically regulate the transcription of a common set of genes, inducing those with roles in cell wall synthesis, and to repress the ones implicated in photosynthesis and chloroplast functions (Oh et al., 2014; Bai et al., 2012). BR signalling and biosynthetic mutants have defects in root growth suggesting a role for this hormone in the development below ground. Indeed, several BR mutants, including bri1 and bak1 were initially identified for their root phenotype in a primary root growth bioassay in the presence of epi- brassinolide (Clouse et al., 1996). The involvement of BRs in shaping the root has led to its extensive use as a model to study the influence of BRs on cell cycle activity, cell differentiation and the basis of differential sensitivity of various cell types to the hormone (Fridman and Savaldi-Goldstein, 2013). BRs positively influence the size of the root meristem via their action on cell cycle progression and are important for the establishment of the transition zone above the root apical meristem (Hacham et al., 2011; González-García et al., 2011). BRs are also important for epidermal cell patterning, as demonstrated by the BIN2-mediated control of the TFs TTG1 (TRANSPARENT TESTA GLABRA 1) and EGL3 (ENHANCER OF GLABRA 3) and their involvement in root hair formation (Figure 1-5; Cheng et al., 2014). Several BR biosynthetic (e.g. det2, dwf4, cpd) and sensing (bri1) mutants were reported to be delayed in flowering. Multiple points of contact between the flowering and BR pathways have been identified thus far. First, BR mutants are impaired in the circadian clock system that influences the transition to flowering. Second, BRs negatively regulate the expression of FLC (FLOWERING LOCUS C) that in turn represses flowering. Third, the brassinosteroid TF BES1 recruits two histone demethylases ELF6 (EARLY FLOWERING 6) and REF6 (RELATIVE OF ELF 6) to regulate target genes. Finally, SVP (SHORT VEGETATIVE PHASE) and AGL24 (AGAMOUS-LIKE 24) repress and promote flowering, respectively, while in rice the SVP-group of TFs downregulates BR responses in an age-dependent manner, thus creating an additional link between BR and flowering time (Domagalska et al., 2007; Yu et al., 2008; Duan et al., 2006; Lee et al., 2008). Although many hints are available, the precise mechanism governing the interplay between BRs and the transition to flower has not been fully elucidated to date (Li et al., 2010).

INTRODUCTION

Examination of flowers of several BR mutants in Arabidopsis suggests that this class of hormones is essential for the correct development of the male flower structures and their functionality. The cpd, bin2 and bri1-201 mutants were reported to have drastically reduced fertility (Li et al., 2001; Bouquin et al., 2001; Szekeres et al., 1996). In cpd the cause of male sterility was attributed to the failure of pollen tube elongation, whereas in dwf4 it might be due to reduced filament elongation and thus scarce pollen delivery to the stigma (Kim et al., 2005; Szekeres et al., 1996). A comprehensive study has reported that brassinosteroid biosynthetic and signalling mutants have the previously-observed cell-expansion and pollen-release defects, but also have reduced pollen production and viability. Furthermore, the study showed that in those mutants, genes required for anther and pollen development were downregulated and that BES1 binds the promoter of genes encoding TFs essential for anther and pollen development (Ye et al., 2010).

1.6 Protein post-translational modifications

Ever-changing internal cues and environmental conditions require that swift adaptation of the cellular processes occur to adapt to the new state (Benayoun and Veitia, 2009). In eukaryotic cells, transcription and translation are both performed by complex molecular machines which need to be recruited and assembled at the site of initiation before messenger RNAs and proteins can be produced, respectively. The timing of complex assembly and subunit composition are fundamental control points. However, the adjustment of the latter is too slow to respond to the sudden changes organisms are often confronted with. To adapt promptly using pre-existing cellular components, a suite of post-translational modifications (PTMs) are employed (Deribe et al., 2010). Proteins are modified through the addition of small chemical moieties, such as phosphate and acetyl groups, or by the removal or conjugation of amino acids, small proteins, lipids and sugars (Yu et al., 2015). The enzymes that catalyse the specific conjugation or cleavage reactions are often constitutively expressed, but are themselves regulated, so that PTM patterns can be rapidly altered. An example of this phenomenon can be seen in the BR signalling pathway, where binding of the hormone to its receptor triggers a phosphorylation cascade that culminates at the level of the TFs (see section 1.5.1). PTMs can be regarded as the focal point where the wealth of cues triggering signalling pathway converge to orchestrate the appropriate response given the cellular context, the developmental stage and the environmental stimuli (Benayoun and Veitia, 2009). An exemplary case is the Arabidopsis TF ABI5, which controls gene expression in response to the different seasonal cues, determining seed germination

INTRODUCTION and flowering initiation, through the action of the hormone abscisic acid (Wang et al., 2013). It was reported that ABI5 is modified by phosphorylation/dephosphorylation, poly-ubiquitination and sumoylation (Yu et al., 2015). During seed development and inhibition of germination, ABI5 is phosphorylated by three ABA-activated SNF1-related protein kinases 2 (SnRK2s) in its C2 motif. This results in TF stabilization and activation (Nakashima et al., 2009). The PROTEIN KINASE SOS2-LIKE 5 (PKS5) also controls ABI5 activity during the inhibition of seed germination, by modifying one residue in the C1 motif (Zhou et al., 2015). The action of the SnRK2s kinases is not confined to seed development, but it is required also later, during floral transition, when phosphorylated ABI5 is necessary to activate FLC expression (Wang et al., 2013). Similarly, several phosphatases target ABI5 reducing its activity (Yu et al., 2015). The rate at which ABI5 is degraded through the ubiquitin-26S proteasome is an additional regulatory mechanism of this TF, as suggested by the association with several E3 ubiquitin ligase enzymes. The extent of ABI5 poly-ubiquitination is in turn dependent on its sumoylation status, controlled by SUMO E3 ligases. This PTM protects it from ubiquitin-mediated degradation. Thus, ABI5 can participate in multiple cellular processes occurring at different stages of plant development thanks to the combinatorial presence of several kinds of PTMs. It has been proposed that PTMs allow the multiplication of cellular functions by the coexistence of different proteoforms of the same gene product. These proteoforms will perform different roles, depending on the state of modification and cellular context (Benayoun and Veitia, 2009). This seems to be a mechanism adopted through evolution to overcome the limitations imposed by the relative small number of genes of many genomes. Moreover, through the combinatorial use of signalling cascades and protein PTMs, multiple stimuli can be simultaneously perceived, discriminated between, and appropriately responded to, using a relatively small number of pathways.

Protein phosphorylation Protein phosphorylation is one of the most frequent PTMs and intensely studied (Deribe et al., 2010). Protein kinases and phosphatases are responsible for the transfer and removal, respectively, of a phosphate group on serine, threonine and tyrosine residues. Phosphorylation introduces a negative charge thereby modifying the physico-chemical properties of the target. This has the potential to affect the activity of the cognate protein by altering protein conformation and/or its interactions with other molecules. Interactions, especially with other proteins, can affect sub-cellular localization (e.g. when the partner proteins elicit translocation or expose localization signals that were previously buried), protein

INTRODUCTION stability (i.e. by modulating interaction with the E3 ligase that control ubiquitination/sumoylation), or directly regulate the protein activity (e.g. by covering the active site of an enzyme; Hunter, 2007). Multisite phosphorylation has been described for many proteins and it has been proposed as a way to coordinate multiple signals or to achieve different stages of protein activation (Cohen, 2000). The number of kinases encoded in eukaryotic genomes (more than one hundred in the yeast Saccharomyses cerevisiae and more than one thousandth in Arabidopsis) suggests the importance of this regulatory mechanism and also the potential complexity in the extent of fine-tuning achievable through dynamic protein phosphorylation (Wang, Harper, & Gribskov, 2003). The reversibility of phosphorylation makes this an ideal system to adapt the cellular status to predictable fluctuating external cues such as light/dark or temperature shifts. Not only signalling molecules like TFs (e.g. PHYTOCHROME-INTERACTING FACTOR 1/3; Bu et al. 2011; Ni et al. 2013) are subjected to this type of regulation, but also enzymes and transporters involved in metabolism (e.g. Sucrose Phosphate Synthase, SPS, Nitrate Reductase, NR; Huber, 2007; Su, Huber & Crawford, 1996). Phosphorylation affects the activity of TFs in a number of ways. It has been demonstrated that phosphorylation of TFs can affect their DNA-binding ability, as for ELONGATED HYPOCOTYL 5 (HY5; Smykowski et al., 2015). Moreover, nuclear localization signals (NLSs) and nuclear export signals (NESs) can become exposed or hidden upon phosphorylation-induced conformational changes or protein- protein interactions, thereby modifying subcellular localization (Holmberg et al., 2002; Wang et al., 2012). Multisite phosphorylation has been reported to influence the magnitude of transactivation activity and to be a means by which multiple signals are integrated into a coherent response. Given their terminal position in signal transduction pathways, TFs are the most suitable proteins to act as integrators of co- occurring signals (Holmberg et al., 2002).

1.6.1.1 Phosphorylation of TFs links BR and other hormonal and developmental signalling pathways Cascades of phosphorylation and dephosphorylation are common and, as outlined above, play an essential role in controlling the activation state of the whole BR signalling pathway, from receptors to transcription factors (Figure 1-4; Kim et al. 2009). The kinase BIN2, which lies several steps downstream of BR perception, exerts an intricate regulatory role. It not only phosphorylates BZR1 and BES1 to downregulate their activity, but also targets other TFs and kinases to indirectly control the outcome of BR signalling and the interplay with multiple hormonal and developmental pathways (Figure 1-5; Belkhadir & Jaillais, 2015). BIN2-mediated phosphorylation stabilizes the transcription factors ABI5 (ABA INSENSITIVE

INTRODUCTION

5), MYBL2 (MYB LIKE 2) and HAT1 (HISTONE ACETYLTRANSFERASE 1), while its phosphorylation of PIF4 and CES (CESTA) targets them for degradation by the 26S-proteasome (Bernardo-García et al., 2014; Khan et al., 2014; Ye et al., 2012; Zhang et al., 2014). Furthermore, BIN2 was shown to regulate epidermal cell patterning by the phosphorylation of two TFs involved in this developmental process. The distribution of the TF EGL3 to root hair and non-root hair cells is controlled by its BIN2-mediated phosphorylation and so is transcriptional activity of TTG1 (Cheng et al., 2014). The coordination between brassinosteroid and auxin responses might start with the targeting of several auxin response factors (ARFs) by BIN2. ARF2 phosphorylation inhibits its DNA-binding affinity, while the activity of ARF7 and ARF19 is promoted by impeding their association with repressors of the Aux/IAA class (Cho et al., 2014; Vert et al., 2008). BR mutants display impairment in stomata density. One possible explanation for this observation is that BIN2 phosphorylates the TF SPEECHLESS (SPCH) leading to its destabilization (Gudesblat et al., 2012). However, BIN2 was also found to phosphorylate and inactivate two protein kinases (YOD and MKK4) both of which also participate in the phosphorylation and stabilization of SPCH (Kim et al., 2012; Khan et al., 2013). These examples serve to illustrate the ways in which phosphorylation patterns integrate environmental and internal cues into a coherent developmental program.

1.7 Casein Kinase 2: biochemistry and physiological roles

Casein kinase 2 (CK2) is a highly conserved, ubiquitous serine/threonine kinase present in all eukaryotes, where it plays essential roles for cell viability. To date, CK2 has been shown to participates in many basic cellular processes, including cell cycle regulation, proliferation, differentiation and apoptosis, as well as in the regulation of development and stress responses (Salinas et al., 2006). The first hints about the essential physiological role of CK2 came from studies conducted in S. cerevisiae, where knockouts of the two CK2α genes caused lethality. Later experiments revealed that the CK2 carries out crucial functions also in plants, as indicated by the reduced viability of Arabidopsis lines that express an inducible dominant- negative mutant form of the protein over an extended period of time (Moreno-Romero et al., 2008).

INTRODUCTION

In Arabidopsis, the holoenzyme is a tetramer composed of two catalytic (α) and two regulatory (β) subunits. The Arabidopsis genome contains four genes encoding each type of subunit that are, at least to some extent, functionally redundant. This is indicated by the wild-type phenotypes of the single mutants (Salinas et al., 2006). Holoenzymes with different combinations of catalytic and regulatory subunits have been reported. However, each monomer can also function independently from the others and perform distinct roles (Mulekar and Huq, 2014). It is of note that, unlike most protein kinases, both ATP and GTP can be used by CK2 as phosphate donors (Park et al., 2008).

Figure 1-5 BIN2 phosphorylates effectors of the BR and other signalling pathways, thereby playing a central role in coordinating responses to multiple stimuli. Green arrows indicate phosphorylation that activate or stabilize substrate proteins and red arrows indicate inhibition or degradation. Lines with black bullets indicate protein–protein interactions between TFs (irrespective of phosphorylation). Phosphorylation is represented by the letter P circled in orange, kinases by kidney-shaped figures, and TFs by hexagons. TDIF, TRACHEARY ELEMENT DIFFERENTIATION INHIBITORY FACTOR; TDR, TDIF RECEPTOR; ABF, ABRE BINDING FACTORS; ER, ERECTA; ERL ERECTA-LIKE; EPF, EPIDERMAL PATTERNING FACTOR; TMM, TOO MANY MOUTH; YDA, YODA; MKK, MITOGEN-ACTIVATED PROTEIN KINASE KINASE; MAPK, MITOGEN-ACTIVATED PROTEIN KINASE. Adapted from Belkhadir and Jaillais, 2015.

INTRODUCTION

It is thought that regulation of the CK2 kinase activity is achieved through the spatial separation of the different subunits rather than at the transcriptional level, as the expression levels of all genes showed only slight differences in different tissues (Salinas et al., 2006). The same study tested the subcellular localization of all the Arabidopsis subunits. Three out of four CK2α are nuclear proteins, with αA and αB being more concentrated in the nucleolus, while a single CK2α subunit, termed αcp, is present in the chloroplasts. The regulatory subunits follow a different pattern: β1 and β3 are both cytosolic and nuclear, β2 is exclusively nuclear while β4 is only cytosolic. Given the preeminent nuclear localization it is unsurprising that many target proteins of CK2 phosphorylation are TFs and other effectors present there (Meggio and Pinna, 2003). Among the basal processes in which CK2 is implicated are DNA repair, circadian rhythms regulation, protein translation and cell cycle progression. However, it was found that CK2 influences numerous plant-specific developmental processes, particularly photomorphogenesis, flowering time and hormone signalling cascades (salicylic acid, GA, ABA, auxin and BR; Mulekar and Huq 2014). Through genetic and biochemical studies that made use of the dominant-negative and CK2α triple knockout (ck2α1α2α3) mutants, a role for CK2 in auxin transport and auxin-mediated lateral root development was demonstrated (Marquès-Bueno et al., 2011; Moreno-Romero et al., 2008). A recent phosphoproteomics study correlated BR responses with CK2 phosphorylation, proposing this kinase as an important element in the BR signalling pathway (Lin et al., 2015). The involvement of CK2 in the regulation of TFs acting in light signalling is well established (Figure 1-6). HY5 was the first of a series of positive and negative regulators of photomorphogenesis to be identified as a substrate of CK2 in Arabidopsis. HY5 is present in phosphorylated and dephosphorylated states, both in the dark and in the light. In darkness, the E3 ubiquitin ligase COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1) targets the dephosphorylated and the more active form of the TF for degradation. Upon light exposure, phosphorylated HY5 is the prevalent form and it activates transcription of target genes required for photomorphogenesis. This mode of HY5 regulation represents a way to respond promptly to the dark-light transition, owing to the accumulation of the less active HY5 proteoform only in the light (Hardtke et al., 2000). Similarly, the bHLH TF HFR1 (LONG HYPOCOTYL IN FAR- RED) is degraded in the dark, while light-induced multisite phosphorylation stabilizes the protein. Although at least six residues are targeted by CK2 in vivo, a single amino acid seems to be the major phosphorylation site both in the dark and in the light (Park et al., 2008). One member of the PIF family was also identified as CK2 substrate. Unlike HY5 and HFR1, the PIFs are negative regulators of photomorphogenesis. In the light, PIF1 was shown to be phosphorylated by CK2 on at least three amino

INTRODUCTION acids in the protein’s C-terminal region, leading to its rapid degradation (Bu et al., 2011). This study also showed that the CK2 regulatory subunits have a significant impact on the phosphorylation rate of PIF1.

Figure 1-6 CK2 phosphorylates positive and negative regulators of photomorphogenesis. In the dark (left panels), the positively acting transcription factors (HY5 and HFR1) are degraded through the 26S proteasome, while PIF1, a negatively acting transcription factor, is highly abundant and represses photomorphogenesis, leading to etiolated growth. In response to light (right panels), HY5 and HFR1 are stabilized, while light promotes rapid degradation of PIF1 and other PIFs to promote photomorphogenesis. CK2-mediated phosphorylation stabilizes HY5 and HFR1, while it promotes rapid light-induced degradation of PIF1. A balance between the level of the positive and negative factors optimizes photomorphogenesis. Adapted from Mulekar and Huq, 2014.

INTRODUCTION

1.9 Aim of my study

It has been suggested that the BZR1-BAMs proteins function as sensors of the metabolic status of the cell via their BAM domain and that they are able to translate this information into changes in the expression of genes that possess a BBRE motif in their promoters (Reinhold et al., 2011). The nature of this DNA cis element seems to result in an antagonistic relationship between the BZR1-BAMs pathway and that downstream of BRs perception. Although we know which genes respond to the BZR1-BAMs, the signalling pathway culminating in these two TFs remains largely elusive (Reinhold et al., 2011; Soyk et al., 2014). A major aim of the present study was to identify factors acting both upstream and concomitantly with the BZR1-BAMs, either to regulate their function or to fine-tune the transcriptional output of their target genes. To this end, I created a reporter line, making use of a previously identified BAM8 target gene (BUP2) and the luciferase reporter, and then performed an unbiased forward genetic screen. Since phosphorylation is a well know post-translational modification affecting numerous TFs and since phosphopeptides derived from BAM8 were already detected in large scale phosphoproteomic studies (Wang et al., 2013), I also worked to understand whether this PTM affects BAM8 activity. Therefore, I studied its phosphorylation by means of tandem mass spectrometry and assessed its significance using biochemical assays, molecular genetics and physiological methods.

MATERIALS AND METHODS

2 MATERIALS AND METHODS 2.1 Plant methods Plant growth Arabidopsis thaliana was grown in 5x5-cm pots in a nutrient rich, medium-grade, peat-based compost in a Percival AR95 growth chambers (CLF Plant Climatics). Seeds were stratified for 48 h at 4 °C prior to exposure to final growth conditions. Temperature was kept constant at 20 °C and relative humidity at 70 %. Plants were exposed to photoperiods of 12 or 16 h, at an irradiance of 150 μmol photons/ m2/ s.

For screening of M2 mutant lines derived from EMS mutagenesis, subsequent generations and crosses, plants were grown in sterile conditions. Seeds were sterilized by vapor-phase sterilization as described by Clough and Bent (http://www.plantpath.wisc.edu/fac/afb/vapster.html). Seeds were placed on half-strength Murashige & Skoog medium including MES buffer and vitamins (Duchefa, Haarlem, Netherlands; pH 5.7), containing 0.8 % [w/v] phyto agar (Duchefa, Haarlem, Netherlands) and 100 μM firefly D-Luciferin (potassium salt; Biosynth, Staad, Switzerland) and stratified for 48 h at 4 °C. Screening for reporter gene expression was performed 7 and 14 days post-germination in an Hamamatsu A4178 specimen chamber (Hamamatsu, Solothurn, Switzerland) with an electron multiplying CCD camera ImagEM C9100 (Hamamatsu, Solothurn, Switzerland). For segregation analyses of transgenic lines carrying the resistance to the herbicide glyphosate as selectable marker, seeds were grown in sterile conditions as specified above. The solid medium was supplemented with 20 mg/L ammonium glyphosate (Sigma- Aldrich, Buchs, Switzerland). For hypocotyl elongation assays, seedlings were grown in sterile conditions as specified above. For dark experiments, germination was induced by 4 h light exposure, after which the seeds were moved to darkness and grown for 7 days. For shading experiments, seedling were grown for 5 days in white light (150 μmol photons/m2/s; R/FR: 1.01 ) and subsequently moved for 3 days in low red/far-red regime, obtained by supplementing white light with FR light (150 μmol photons/m2/s; R/FR: 0.20). For hypocotyl elongation assay in the dark, differences among genotypes were evaluated by one-way ANOVA and Tukey- Kramer’s test. For shading experiments two-ways ANOVA and Tukey-Kramer’s test were used.

Stable transformation of Arabidopsis thaliana by floral dip Flowering plants were transformed using the Agrobacterium tumefaciens strain GV3101 harbouring distinct plant expression vectors (see section 2.2.3.1). Half-litre bacterial suspensions were grown for 16 h in LB medium (Brunschwig, Basel, Switzerland) supplemented with antibiotics. Bacteria were

MATERIALS AND METHODS sedimented at 4,000 g for 30 min and pellets were resuspendend in dipping solution (sucrose 25 g/L,

Silwet L-77 300 μl/L [Leu+Gygax, Birmenstorf, Switzerland]) to an OD600 of 1. Flowers were submerged in the suspension. Plants were kept in a moist environment, in darkness, for 1 day before being moved to normal growth conditions for seeds production. Transgenic plants were isolated following BASTA selection performed on soil watered with 0.1% [v/v] BASTA (Bayer, Zollikofen, Switzerland) solution. For each transformation construct, 28 transgenic (T1) plants were selected. These were tested by segregation

analyses on MS medium plates containing 25 mg/LBASTA at the T2 generation to identify lines with single- locus transgene insertions, and at the T3 generation to obtain lines homozygous for the transgene. The reporter gene construct pBUP2::Luc (see section 2.2.3.1) was transformed in the wild type Col-0 background. Constructs encoding BAM8 phospho-mutant overexpression variants (see section 2.2.3.1) were transformed in the bam8-1 mutant background.

Arabidopsis seed mutagenesis To obtain a sufficient coverage of mutants, 10,000 (0.2 g) seeds of the line pBUP2:Luc #12-3, were used.

On a rotary shaker, seeds were washed in 25 mL H2O for 4 h, in 25 mL 0.1 % [v/v] Tween 20 solution for

15 min and again in 25 mL H2O for 15 min. Ethyl methanesulfonate (EMS; Sigma, Buchs, Switzerland) was diluted in 25 mL H2O to a final concentration of 0.25 % [v/v]. Seeds were re-suspended in the EMS solution and rotated at 10 rpm for 12 h in a fume hood. The EMS solution was decanted and treated with NaOH to a final concentration of 2 M to inactivate it. Seeds were rinsed twice in 40 mL 100 mM Na2S2O3 solution for 15 min and 10 times in 25 mL H2O for 10 min each time. Seeds were re-suspended in 12 mL H2O. One millilitre of seeds suspension was mixed with in 50 mL of sterile 0.1 % [w/v] agar solution. Two hundred microliters agar suspension were sown in single pots (5x5-cm). Plants were grown in greenhouse until maturity, when M2 seeds were harvested for the subsequent selection procedure.

Transient transformation of Nicotiana bethamiana by leaf infiltration A. tumefaciens strain GV3101 bearing plant expression binary vectors were grown overnight at 30 °C at 260 rpm in LB medium supplemented with appropriate antibiotics. Bacterial cells were precipitated by centrifugation at 3,500 g for 15 min. Pellets were washed with infiltration medium (50 mM MES pH 5.7, 2 mM NaH2PO4, 0.5 % [w/v] glucose, 100 μM acetosyringone) prior to be re-suspended to an OD600 of 0.5. Bacterial suspensions were incubated at 20 °C for 1 h under gentle shaking. For co-expression of two or

MATERIALS AND METHODS more constructs, bacterial suspensions were mixed in equal volumes. For each Nicotiana benthamiana, the lower surface of two leaves was infiltrated manually using a 1-mL syringe without needle. Microscopy imaging (see section 2.3.1) was performed 3 days post-infiltration.

2.2 Molecular methods Transactivation assay in Arabidopsis mesophyll protoplasts Protoplasts were isolated from leaves of 4 weeks-old Arabidopsis plants and transfected as described earlier (Yoo et al., 2007; Reinhold et al., 2011) with slight modifications. Twenty micrograms of DNA were used for PEG-mediated transformation of 5x104 protoplasts in 100 μL MMg solution (4 mM MES pH 5.7,

400 mM mannitol, 15 mM MgCl2). The DNA mix contained 10 μg effector plasmid, 8 μg reporter plasmid and 2 μg transfection control. Genes encoding the effectors were introduced into pEarleyGate201 plasmids (Earley et al., 2006). The reporter construct was a pUC18 vector carrying the LUC gene under the control three or twelve (see section 3.2.4) repetitions of the BBRE (CACGTGTG) upstream of a minimal CaMV35S promoter. A Ubq10:GUS:nosT construct (Yoo et al., 2007) was used as transfection control. Negative controls were performed using empty pEarleyGate201 vectors instead of the effector plasmid. Following transfection, the protoplasts were incubated for 16 h in continuous light in WI solution (4 mM MES, pH 5.7, 500 mM mannitol, 20 mM KCl) supplemented with 15 mM sucrose in sterile, transparent 24- well plates (Greiner Bio-one, Frickenhausen, Germany). Enzymatic luciferase and β-glucoronidase assays were performed as described earlier (Yoo et al., 2007). Three technical replicates were performed per plasmid combination and the transactivation assay experiment was repeated three times.

Protein methods

2.2.2.1 Mass spectrometry analyses for the identification of phosphorylated peptides Immunoprecipitated proteins were run on a gradient Ready Gel Tris-HCl Gel 4-20 % (BioRad, Cressier, France) and stained with Comassie Brillian Blue G-250. The part of the gel containing the band corresponding to BAM8-YFP was excised and cut into small pieces. Gel pieces were distained in 50 % [v/v] methanol for 90 min at 37 °C and rinsed once in H2O. Protein disulphide bonds were reduced in reducing buffer (50 mM Tris-HCl pH 8.5, 5 mM DTT) for 45 min at 37 °C. Cysteine residues were alkylated in 20 mM iodoacetamide buffered with 50 mM Tris-HCl pH 8.5 for 45 min at 20 °C in darkness. Gel pieces were

MATERIALS AND METHODS

washed twice in H2O and once in 50 mM Tris-HCl pH 8.5, prior to be dehydrated in a solution of 80 % [v/v] acetonitrile for 10 min. Residual solvent was removed by evaporation in vacuo for 5 min at 30 °C. Eighty nanograms of trypsin (Promega, Wallisellen, Switzerland) were used to digest proteins for 5 h at 37 °C, with orbital shaking at 300 rpm. The samples were acidified using 10 % [v/v] TFA and peptides were extracted from the gel by sonication in Ultrasonic Cleaner (VWR, Dietikon, Switzerland) for 5 min. At this stage, samples were either enriched in phosphorylated peptides using Phos-Trap 24 Kit (Perkin Elmer, Schwerzenbach, Switzerland) or directly desalted with Ziptip C18 columns (Millipore, Darmstadt, Germany) according to manufacturer’s instructions and eluted in elution solution (60 % [v/v] acetonitrile, 0.1 % [v/v] TFA). Peptides were dried in vacuo prior to be dissolved in LC-MS solvent (3 % [v/v] acetonitrile, 0.1 % [v/v] formic acid). All proteome data were acquired on an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific, San Jose, USA), to which an Easy-nLC 1000 HPLC system (Thermo Scientific, San Jose, USA) was connected. Four microlitres or 6 µL of the peptide samples were loaded onto a frit column (75 µm inner diameter) packed with reverse phase C18 material (AQ, particle size 1.8 μm, pore size 200 Å; Bischoff GmbH, Leonberg, Germany), and separated at a flow rate of 250 nL/min. Solvent composition of buffer A was 0.1 % [v/v] formic acid in water, and buffer B contained 0.1 % [v/v] formic acid in acetonitrile. The following LC gradient was applied: 0 min: 2 % buffer B, 45 min: 30 % B, 51 min: 50 % B, 54 min: 95 % B, 60 min: 95 % B. Survey scans were recorded in the Orbitrap mass analyzer in the m/z range of 350-2000, with a resolution of 120,000 and a maximum injection time of 50 ms. Higher energy collisional dissociation (HCD) spectra were acquired in the ion trap, in the top speed mode from signals with intensities above a threshold of 5,000 counts. A normalized collision energy of 30 % was used and the precursor ion isolation width was set to m/z 2.0. Charge state screening was enabled and charge states 2-7 were included. Precursor masses already selected for MS/MS acquisition 3 times within 15 s were excluded for further selection during 45 s, and the exclusion window was ± 10 ppm.

2.2.2.2 Immunoprecipitation of BAM8 from leaves extracts Four week-old rosettes of an Arabidopsis line overexpressing a YFP-tagged version of BAM8 were ground in 10 volumes of IP-extraction buffer (50 mM Tris-HCl pH7.5, 150 mM NaCl, 15 mM MgCl2, 1 % [v/v] Triton X-100, 1x Complete Protease Inhibitor [Roche, Basel, Switzerland], 1 mM DTT, 5 mM EGTA, 100x diluted Phosphatase Inhibitor Cocktail 2 and 3 [Sigma, Buchs, Switzerland] with a precooled all-glass homogenizer. The tissue homogenate was subject to centrifugation twice at 20,000 g for 10 min at 4 °C. One millilitre of clarified soluble protein extract was transferred to a fresh 2 mL-tube and 50 µL of αGFP MACS magnetic beads (Milteny Biotech, Bergisch Gladbach, Germany) were added. The sample was incubated on a

MATERIALS AND METHODS rotating wheel for 1 h at 4 °C prior to be applied to a pre-washed μ-columns (Milteny Biotech, Bergisch Gladbach, Germany). The column was washed 4 times with 200 µL IP-extraction buffer to remove low- affinity binding molecules. For the elution of proteins specifically interacting with the anti-GFP antibody, the column was loaded with 20 µL elution buffer (63 mM Tris-HCl, pH 6.8, 15 % [v/v] glycerol, 2 % [w/v] SDS, 0.15 % [w/v] bromophenol blue, 7 mM DTT) pre-heated at 65 °C and incubated for 5 min. Subsequently, 50 µL elution buffer were applied to the column and the flow through was collected. Protein samples were snap-frozen in liquid nitrogen and stored at -80 °C.

2.2.2.3 Purification of recombinant proteins from E. coli Recombinant HIS-tagged proteins were expressed in E. coli BL21 (DE) (Stratagene, Basel, Switzerland) from pET21a(+) vector (Novagene, Darmstadt, Germany). A 5-mL starter culture was grown in LB medium (Brunschwig, Basel, Switzerland) supplemented with antibiotics at 37 °C and 220 rpm for 16 h. Half a litre of fresh LB medium supplemented with antibiotics was inoculated with 1 mL of starter culture. The culture was grown at 37 °C and 220 rpm to an OD600 of 0.8-1. Cells were transferred to 16 °C and protein expression was induced with 1 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG; Roche, Basel, Switzerland) overnight at 220 rpm. Cells were harvested by centrifugation at 5,000 g for 15 min at 4 °C and re-suspended in lysis buffer (50 mM Tris-HCl pH 7.5, 0.5 M NaCl, 10 % [v/v] glycerol, 15 mM imidazole, 1x complete protease inhibitor cocktail [Roche, Basel, Switzerland]). Cells were disrupted using an M-110P Microfluidizer fluid processor (Microfluidics, Lampertheim, Germany). Crude extracts were cleared by centrifugation at 15,000 g for 15 min at 4 °C. HIS-tagged proteins were bound to 3 mL pre-equilibrated Protino Ni-NTA Agarose resin (MN, Düren, Germany) during a 1-h incubation on a rotating wheel at 4 °C. The bead slurry was loaded on Micro Bio-Spin Column (BioRad, Cressier, France), washed with 25 mL wash buffer (50 mM Tris-HCl pH 7.5, 0.5 M NaCl, 40 mM imidazole, 10 % [v/v] glycerol, 2 mM DDT) and 25 mL Triton buffer (50 mM Tris-HCl pH 7.5, 0.5 M NaCl, 40 mM imidazole, 10 % [v/v] glycerol, 2 mM DDT, 0.05 % [v/v] Triton-X 100) and the bound proteins were eluted with 10 mL elution buffer (50 mM Tris-HCl pH 7.5, 0.5 M NaCl, 10 % [v/v] glycerol, 250 mM imidazole). Buffer exchange into storage buffer (50 mM Tris- HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 10 % [v/v] glycerol, 0.05 % [v/v] Tween-20) and protein concentration were performed in one step using Amicon Ultra 10 kDa filter units (Millipore, Merck, Darmstadt, Germany) according to the manufacture’s protocol. Recombinant proteins were divided into aliquots, flash-frozen stored at - 80 °C.

MATERIALS AND METHODS

2.2.2.4 In vitro kinase assay Two micrograms of recombinant protein were reacted with 200 units of CK2 (NEB, Ipswich, Massachussetts, USA) in a total volume of 25 L containing 1x kinase buffer (50 mM Tris-HC pH 7.5, 10 mM MgCl2, 0.1 mM EDTA, 2 mM DTT, 0.01 % Brij 35) and 200 M ATP (Sigma, Buchs, Switzerland) supplemented with -[32P]ATP (Hartmann Analytic, Braunschweig, Germany) to a final specific activity of 500 Ci/mol. The reaction was incubated at 30 °C for 30 min and terminated by addition of 5x SDS sample buffer (315 mM Tris-HCl pH 6.8, 75 % [v/v] glycerol, 10 % [w/v] SDS, 0.75 % [w/v] bromophenol blue, 35 mM DTT). Samples were heated at 95 °C for 3 min and separated on 10 % SDS-PAGE gels. Gels were dried in Gel Drier model 583 (Biorad, Cressier, France) and exposed to Amersham Hyperfilm MP (GE Healthcare, Glattbrugg, Switzerland). Films were developed after 48 h with CURIX60 processor (Agfa-Gevaert N.V., Mortsel, Belgium).

2.2.2.5 Western blot of plant proteins Plant material was frozen in liquid nitrogen in 2-mL tubes containing glass beads and homogenized using mixer-mill (Retch, Haan, Germany) to obtain a fine powder. Plant proteins were extracted in 10 volumes [w/v] Laemmli buffer (63 mM Tris-HCl pH 6.8, 15 % [v/v] glycerol, 2 % [w/v] SDS, 0.15 % [w/v] bromophenol blue, 7 mM DTT) by vigorous vortexing and heating to 95 °C for 5 min. Samples were clarified by centrifugation at 11,000 g for 3 min and loaded on 10 % [w/v] SDS-PAGE gels. Electrophoresis was performed at a constant current (20 mA per gel). Proteins transfer to Millipore Immobilon-P or Immobilion-FL (Merck, Darmstadt, Germany) membranes was carried out at 100 V for 90 min at 4 °C in blotting buffer (25 mM Tris-HCl, 192 mM glycine, 10 % [v/v] methanol). Membranes were blocked in TBST buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.05 % [v/v] Tween-20) supplemented with 5 % [w/v] milk powder for 1 h at 20 °C. Primary antibodies were diluted in TBST supplemented with 1 % [w/v] milk powder as indicated in Table 2-1 and incubated with the membrane for 16 h at 4 °C with orbital shaking. Membranes were washed in TBST for 1 h at 20 °C. Secondary antibodies conjugated with horseradish peroxidase or with fluorescent dye were diluted as reported in Table 2-1 in TBST supplemented with 1 % [w/v] milk powder and incubated with the membrane for 1 h at 20 °C. Membranes were washed for 1 h at 20 °C in TBST. All steps were performed with gentle agitation. For chemiluminescent detection membranes were developed with ChemiGlow West Chemiluminescence substrate (Bucher Biotech, Basel, Switzerland) according to the manufacturer’s instructions and imaged using the ChemiDoc imaging system

MATERIALS AND METHODS

(Biorad, Cressier, France). For detection of fluorescent signals, the membranes were directly scanned using a Li-Cor Odyssey imaging system (Li-Cor, Lincoln, USA), following washing.

Table 2-1 – Antibodies used in this study for western blot.

Antibody Origin Dilution Producer Anti-HA Peroxidase Mouse 1:4,000 Sigma, Buchs, Switzerland Anti-GFP Mouse 1:5,000 Clontech, Mountain View, USA Anti- Actin Rabbit 1:2,500 Agrisera, Vännäs, Sweden Anti-BAM8 Rabbit 1:3,000 Anti-rabbit IgG-HRP Goat 1:10,000 BioRad, Cressier, France IRDye800CW anti-mouse Donkey 1:20,000 Li-Cor, Lincoln, USA IRDye680RD anti-rabbit Donkey 1:20,000 Li-Cor, Lincoln, USA

Nucleic acids methods

2.2.3.1 Molecular cloning To obtain the promoter-reporter gene fusion constructs, 1,000 bp and 1,040 bp upstream of the transcription start site of AtBUP1 (AT5g22580) and AtBUP2 (AT5G57785), respectively, were amplified from genomic DNA of A. thaliana ecotype Col-0 using the iProof high fidelity DNA polymerase (BioRad, Cressier, France). The PCR fragments were introduced into pDONR221 P4-P1r vector (Thermos Fischer Scientific, Reinach, Switzerland) by Gateway cloning (Thermos Fischer Scientific, Reinach, Switzerland) in order to fuse them at the 5’-end of the firefly luciferase gene. The pENTR-promoters vectors and the pENTR-Luciferase vector (courtesy of Dr. Florian Brioudes) were combined with the destination vector pB7m24GW,3 (https://gateway.psb.ugent.be/; Karimi, Inzé, and Depicker 2002) to generate the final reporter constructs following manufacturer’s instructions (Table 2-2 and Table 2-3). To produce mutated versions of BAM8 for HA, YFP or HIS tags fusions, an overlap extension strategy was used. The wild-type BAM8 coding sequence (CDS) present in a pENTR221 vector (courtesy of Dr. Sebastian Soyk) was used as template for PCR amplification carried out with M13 forward and mutagenic reverse primers and with mutagenic forward and M13 reverse primers, respectively. The two halves of the CDS were subsequently fused by overlap extension and the reconstituted fragment was recombined with the Gateway-compatible vector pB7YWG2.0 (https://gateway.psb.ugent.be/, Karimi, Inzé, and Depicker 2002) for fusion with a C-terminal YFP tag or with pEarleyGate201 (Earley et al., 2006)

MATERIALS AND METHODS to generate the N-terminal HA-tagged version of the protein. These constructs were used for expression in plants. For the production of recombinant proteins, a classical cloning method was used. Briefly, the wild- type and mutated versions of BAM8 CDS were amplified from Gateway destination vectors using gene- specific primers with extensions matching the restriction enzymes EcoRI and NotI recognition sites. The amplicons were cloned into the pJet vector (Thermos Fischer Scientific, Reinach, Switzerland) by blunt- end ligation prior to be inserted into pET21a(+) vector (Novagen, Merck, Darmstadt, Germany) that features a C-terminal 6xHIS tag, by specific restriction digestion and ligation. For the analysis of the subcellular localization of the kinase CK2α2 a construct encoding a YFP- tagged version of the protein was produced by amplification of cDNA obtained from wild-type A. thaliana. The construct was generated by Gateway cloning using pB7YWG2.0 as destination vector. To test for an interaction with BAM8, CK2α2 was also cloned at the 3’-end of the N-terminal or C-terminal halves of YFP in the vectors pSPYNE-35SGW and pSPYCE-35SGW (Schuetze et al., 2009), respectively, for Bi-molecular fluorescence complementation experiments (BiFC).

Table 2-2 – Combination of vectors recombined by MultiSite Gateway cloning for the production of BUP1 and BUP2 reporter gene constructs.

Expression pENTR pENTR pDEST construct pBUP1:Luc_1 pENT attL4-pBUP1_3-attL1r pENT attL1-Luciferase-attL2 pB7m24GW,3 pBUP2:Luc_3 pENT attL4-pBUP2_10-attL1r pENT attL1-Luciferase-attL2 pB7m24GW,3

MATERIALS AND METHODS

Table 2-3 – Primers used in this study to obtain expression clones.

Product Forward primer sequence (5'-3') N. Reverse primer sequence (5'-3') N. Vector pBUP1 GGGGACAACTTTGTATAGAAAAGTTGT 1596 GGGGACTGCTTTTTTGTACAAACTTGT 1597 pDONR221 CCTGTCAAATCAGGGAAAATTG TAATTTTATTACTTTAGCCTCACT P4-P1r pBUP2 GGGGACAACTTTGTATAGAAAAGTTGT 1598 GGGGACTGCTTTTTTGTACAAACTTGT 1599 pDONR221 CGTGATATGCTCTACATATGCA GTTTTTGCACACGAACGGT P4-P1r BAM8 AAACTTGCTCCTGTGGCTCTTGATGCT 2050 CTCGGCAATACCAATAGCATCAAGAGC 2051 pB7YWG2.0 S202-205A ATTGGTATTGCCGAG CACAGGAGCAAGTTT pEG201 BAM8 AAACTTGCTCCTGTGGAGCTTGATGAG 2052 CTCGGCAATACCAATCTCATCAAGCTC 2053 pB7YWG2.0 S202-205E ATTGGTATTGCCGAG CACAGGAGCAAGTTT pEG201 BAM8 ATTGGTATTGCCGAGGCTGATCATCCC 2510 ATTCCCGGGATGATCAGCCTCGGCAAT 2511 pB7YWG2.0 S211A GGGAAT ACCAAT pEG201 pET21a(+) BAM8 ATTGGTATTGCCGAGGAGGATCATCCC 2512 ATTCCCGGGATGATCCTCCTCGGCAAT 2513 pB7YWG2.0 S211E GGGAAT ACCAAT pEG201 pET21a(+) BAM8 GTGGTACAGTTTCCGGCTAGATCTATT 2643 ACTCTCAATAGATCTAGCCGGAAACTG 2644 pET21a(+) 164A GAGAGT TACCAC BAM8 GAGAGTCCACTTGCTTCTAGTACATTG 3071 GTTCTTCAATGTACTAGAAGCAAGTGG 3072 pET21a(+) 172A AAGAAC ACTCTC BAM8 GGCTGCAATTGAAGCTCAGCAGCATTC 3073 AGAACTGAATGCTGCTGAGCTTCAATT 3074 pET21a(+) 186A AGTTCT GCAGCC BAM8 CCTGTGTCTCTTGATGCTATTGGTATTG 2635 CTCGGCAATACCAATAGCATCAAGAGA 2636 pET21a(+) 205A CCGAG CACAGG CK2α2 GGGGACAAGTTTGTACAAAAAAGCAG 2184 GGGGACCACTTTGTACAAGAAAGCTG 2185 pB7YWG2.0 woStop GCTTCATGCACCTAATCTTCTTCTTCTC GGTCTTGAGTCCTCATTCTGCTGCTTTC CT CK2α2 GGGGACAAGTTTGTACAAAAAAGCAG 2184 GGGGACCACTTTGTACAAGAAAGCTG 2186 pSPYNE- Stop GCTTCATGCACCTAATCTTCTTCTTCTC GGTCCTATTGAGTCCTCATTCTGCTGCT 35SGW CT pSPYCE- 35SGW

2.2.3.2 Purification of plasmid DNA by CsCl2 gradient For the transfection of Arabidopsis protoplasts (see section 2.2.1) contaminant-free plasmid DNA was purified on CsCl2 gradient. This purification method was chosen in order to ensure maximal efficiency of plant cell transformation. Large amount of plasmid DNA were produced in E. coli cells (strain DH5α). Half a litre of LB medium supplemented with antibiotics was inoculated with 5 mL overnight pre-culture and

MATERIALS AND METHODS grown for 16 h at 37 °C. Cells were pelleted by centrifugation at 5,000 g for 20 min at 4 °C and re- suspended in 15 mL solution I (10 mM Tris-HCl, pH 8, 1 mM EDTA). Cells were lysed by addition of 50 mL solution II (0.1 M NaOH, 1 % [w/v] SDS). The cell lysate was mixed by inverting and incubated for 15 min at 20 °C. Subsequently, 25 mL solution III (3 M potassium acetate, 5 M acetic acid) were added and samples were incubated for 10 min at 20 °C prior to centrifugation at 10,000 g for 10 min. The supernatant was filtered through a 100-μm pore-size nylon mesh and 54 mL isopropanol were added to precipitate DNA. The DNA was collected by centrifugation at 10,000 g for 30 min, the pellet rinsed with 95 % [v/v] ethanol, and then air-dried. The pellet was re-suspended in 3.5 mL solution I with 7 μL of RNAse H (Invitrogen, Zug, Switzerland) and incubated for 20 min at 37°C. The DNA solution was transferred to a 15-mL falcon tube and 1 mL Roti-Aqua-Phenol (Roth, Karlsruhe, Germany) was added and mixed by vortexing. The emulsion was separated by centrifugation at 5,000 g for 5 min at 20 °C, and the aqueous phase transferred to a new

15-mL tube and mixed with 5.5 g CsCl2. Once the salt had completely dissolved, 100 μL ethidium bromide (EtBr; 10 mg/mL; Sigma-Aldrich, Buchs, Switzerland) was added. Following centrifugation for 5 min at 5,000 g, the red floating EtBr disc was removed. The DNA solution was transferred to Quick Seal ultracentrifugation tubes (Beckmann Coulter, Nyon, Switzerland) and spun at 332,000 g for 20 h in a NVT65.2 ultra-near vertical rotor (Beckmann Coulter, Nyon, Switzerland). A hole was punched into the centrifuge tube with a capillary needle and the red-stained DNA band was isolated with a syringe. After addition of 1 volume of H2O, EtBr was extracted twice with n-butanol (saturated with 1 M NaCl) and discarded. DNA was precipitated with 3 volumes of 95 % [v/v] ethanol, washed once with 70 % [v/v] ethanol and dissolved in 1 mL H2O. Pure DNA solutions were aliquoted and kept at -20 °C.

2.2.3.3 DNA purification for whole genome resequencing for mutation detection

Plants of the F2 generation following a backcross with the parental transgenic line were screened for the reporter gene signal. Equal amounts of plant material from at least 110 positive individuals were pooled for DNA extraction. Plant material was ground with a mortar and pestle pre-cooled with liquid nitrogen. About 1 mL of leaf powder was incubated with 5 volumes of CTAB buffer (58 mM Cetyl-trimethyl- ammonium-bromide, 1.4 M NaCl, 100 mM Tris-HCl, pH 8, 20 mM EDTA) at 60 °C for 30 min. The suspension was mixed with 5 volumes of chloroform:isoamylalcohol (24:1) and the tube was inverted to create a uniform emulsion prior to centrifugation at 6,800 g for 10 min at 4 °C. The aqueous phase was transferred to new tubes and RNA was digested at 37 °C for 30 min using 10 mg RNase A (Macherey-Nagel, Oensingen, Switzerland) per mL of solution. To precipitate the DNA, 0.6 volumes of isopropanol were added to the DNA solution and the sample was incubated for 16 h at -20 °C. After centrifugation at 3,800 g for 6 min at

MATERIALS AND METHODS

4°C the DNA pellet was collected and washed with 70 % [v/v] ethanol. Following a repeated centrifugation, the ethanol was discarded and the pellet air-dried. DNA was resuspendend in H2O at 100 ng/µL.

2.2.3.4 DNA library preparation and sequencing The TruSeq DNA NanoSample Prep Kit v2 (Illumina, San Diego, USA) was used in the succeeding steps. DNA samples (1 μg) were sonicated with Covaris ultrasonicator (Covaris, Brighton, UK) using settings specific to create an average fragment size of 550 bp. The fragmented DNA samples were size selected using AMpure beads (Beckmann Coulter, Nyon, Switzerland), end-repaired and polyadenylated. TruSeq adapters containing the index for multiplexing were ligated to the fragmented DNA samples. Fragments containing TruSeq adapters on both ends were selectively enriched by PCR. The quality and quantity of the enriched libraries were validated using Qubit (1.0) Fluorometer (Thermo Fischer Scientific, Reinach, Switzerland) and Tapestation (Agilent, Waldbronn, Germany). The product was a smear with an average fragment size of approximately 700 bp. The libraries were normalized to 10 nM in 10 mM Tris-HCl, pH 8.5 with 0.1 % [v/v] Tween 20. Sequencing was performed on the Illumina Nextseq 500 system (Illumina, San Diego, USA) using 300-cycle high output kit with 2x150 cycles (Illumina, San Diego, USA). Reads were quality-checked with fastqc which computes various quality metrics for the raw reads.

2.2.3.5 RNA purification Frozen plant material was ground to a powder using a mixer mill and glass beads. Up to 100 mg of tissue were extracted with 1 mL of TRIZOL reagent (Invitrogen, Zug, Switzerland) by vortexing and incubated at 30°C for 6 min. Two hundred microliters of chloroform were added, the samples shaken for 15 s and incubated for 3 min at 20°C. Phases were separated by centrifugation at 13,800 g for 15 min at 4°C. The upper, aqueous phase was transferred to a fresh 1.5-mL tube and mixed with 0.5 mL isopropanol. Samples were kept at 20 °C for 10 min and the precipitated RNA collected by centrifugation at 13,800 g for 10 min at 4 °C. After removal of the supernatant, the RNA pellet was washed with 80 % [v/v] ethanol and spun at

10,000 g for 5 min at 4 °C. Pellets were air-dried and re-suspended in 30 μL of H2O. The quality of the purified RNA was checked on 2 % [w/v] agarose gels. Three micrograms RNA were treated with DNase I (Roche, Basel, Switzerland) for 20 min at 37 °C and then purified by phenol-chloroform extraction. Briefly, samples were adjusted to a volume of 50 µL with RNase-free H2O, 50 µL of Aqua-Roti phenol (Carl Roth, Karsruhe, Germany) were added and samples were vigorously vortexed. The aqueous phase was transferred to a new tube following centrifugation at 12,000 g for 1 min at 4°C. The phenol extraction was

MATERIALS AND METHODS repeated once more prior to acidification of the solution with 5 μL 3M sodium acetate NaOAc, pH 5.2. RNA was precipitated by adding of 125 μL absolute ethanol and incubating at -20 °C for 10 min, then collected by centrifugation at 12,000 g for 15 min at 4°C. RNA pellets were washed with 125 μL 75 % [v/v] ethanol, centrifuged again, the ethanol aspirated and the pellets air-dried. RNA was dissolved in 11 μL RNase-free water. Synthesis of cDNA from 2 μg DNase I treated-RNA was conducted with the RevertAid First Strand cDNA Synthesis Kit (Thermo Fischer Scientific, Reinach, Switzerland) according to the manufacturer`s instructions.

2.2.3.6 Quantitative real time PCR Quantitative PCR was performed with 1 μL of cDNA, 5 μL of KAPA SYBER FAST qPCR Master Mix (KAPA Biosystems, Basel, Switzerland), 1 μL of primer mix (5 μM of each forward and reverse primer) and 3 μL of H2O. PCR reactions were carried out in LightCycler 480 Instrument II (Roche, Basel, Switzerland). Primers used for qPCR are listed in Table 2-4.

Table 2-4 – Primers used for quantitative real time PCR. Primers were designed by: (1) H. Reinhold, (2) K. Simkova, (3) S. Soyk, (4) G. George, (5) F. Assenza.

Gene name Forward primer sequence (5'-3') N. Reverse primer sequence (5'-3') N. AT1G13320 CTCTTACCTGCGGTAATAACTG 917 (2) CATGGCCGTATCATGTTCTC 918 (2) (PP2AA3) AT5G08290 ATGACTGGGATGAGACCTGTATGC - (4) CATGGTGTTGAAGTCTGGAACCTC - (4) (YLS8) AT5G45300 GGTTGAGATTGGTCTTGGAG 929 (2) CAGACTCAATTGCGAATATTT 2985 (BAM8) AT5G57785 GTA ATG GTT AAT GTG AGC TCA AGG 1317 (3) TGA GTC GAT AAA GTG TAG CAC C 1318 (3) (BUP1) AT5G22580 TGGTGGTTGTGAAGTTTAAGG 709 (1) GTCTAAGCATATCGTGACTCTC 710 (1) (BUP2) AT2G44910 TTCAACACATGCACAATCAG 721 (1) GTTGTACGTTTAATCCCAGAAG 722 (1) (ATHB4)

AT1G56150 AGA GTA TGG ATA CGA GCA ACA AGG 3065 (5) GAG ATC GTG TAG GTC ATG TGA CTC 3066 (5) (SAUR71)

AT1G09500 CTC GGT AGC TGT GAT TGT GGA ACT 3067 (5) TTT TAT TGT CAC AAC CGG ACC ATC 3068 (5)

AT2G47560 TTG AAG GCT CAA ATC CGG GTC 3069 (5) CGC AAT CAG ATG CTC CAT AGC C 3070 (5)

MATERIALS AND METHODS

2.2.3.7 Whole transcriptome sequencing Two-week-old Arabidopsis seedlings were harvested 4 h into the light period and frozen in liquid nitrogen. Four pots, corresponding to about 30 seedlings were pooled for each replicate. Two experimental replicates per genotype were processed for the RNA sequencing analyses. RNA was isolated as described in section 2.2.3.5, with minor changes. Fifty micrograms RNA were used for DNase I (Roche, Basel, Switzerland) treatment for 20 min at 37 °C. Subsequently the RNA samples were further purified using RNeasy Mini Plants Kit (Qiagen, Hilden, Germany) according to the “RNA Cleanup” protocol of the manufacturer’s instructions manual. RNA sequencing was performed by Fasteris SA (Geneva, Switzerland) Libraries were prepared according to Illumina TruSeq stranded mRNA library protocol according to manufacture instructions. Library preparation included following steps: PolyA selection, transcripts fragmentation, first strand cDNA synthesis with random primers, second strand cDNA synthesis, 3’ adenylation, ligation of indexed adapters, amplification of the library. All 16 libraries were multiplexed in a single HiSeq 4000 1x150 lane with the average 22 million reads per library.

2.3 Microscopy methods Fluorescence confocal laser scanning microscopy For subcellular localization of proteins and protein-protein interaction studies conducted by BiFC, images were acquired with a Zeiss LSM 780 mounted with an argon laser (Carl Zeiss GmbH, Jena, Germany). YFP fluorescence was excited with the 514 nm argon laser line and detected between 518 nm and 557 nm. CFP fluorescence was excited with the 458 nm argon laser line and detected between 462 nm and 500 nm. For co-localization studies, CFP and YFP fluorescence were exited on two separate channels. Chlorophyll auto-fluorescence was excited with the 514 nm argon laser line and recorded between 662 nm and 721 nm. Image processing was done using the software ZEN 2011 (Carl Zeiss GmbH, Jena, Germany).

MATERIALS AND METHODS

2.4 Bioinformatics analyses Identification of phosphorylated peptides and amino acids from LC-MS2 analyses Identification of detected peptides and proteins was performed using thermo raw data files that were converted to Mascot generic files (.mgf) with Mascot Distiller (Matrix Science, London, UK) and searched with Mascot Server using the parameters 10 ppm for precursor ion mass tolerance and 0.7 Da for fragment ion tolerance. Trypsin was used as the protein-cleaving enzyme, and two missed cleavages were allowed. Carbamidomethylation of cysteine was specified as a fixed modification, and oxidation of methionine, pyroglutamate formation from N-terminal glutamine, N-terminal acetylation of proteins, and phosphorylation of serine, threonine or tyrosine were selected as variable modifications. Searches were performed against a forward and reversed Arabidopsis thaliana database (downloaded on 17/01/2011 from TAIR, 35386 forward protein sequences) concatenated to 261 protein contaminants. Uncertain identifications of peptides and of phosphorylation sites were resolved by visual inspection of the fragment ion spectra (performed by Dr. Peter Gehrig at the Functional Genomics Centre Zurich).

Identification of single nucleotide variants from whole genome resequencing Reads were processed with CLC Genomic Workbench (Qiagen Bioinformatics, Aarhus, Denmark) using the NGS Toolbox. Sequencing QC report were created for all libraries and sequences were trimmed according to quality parameters and to remove sequencing adaptors. Reads were mapped to the reference A. thaliana genome (release TAIR10) and a local realignment was performed. Sequence variants were detected assuming ploidy of 2, variant probability of 90 %, maximum coverage of 200, minimum coverage of 10 and variant frequency > 80 %. Variants were filtered against the parental line and their position in respect to exons and introns was annotated, as well as the changes in the coding sequence.

Identification of differentially expressed genes from RNA sequencing The Trimmomatic software package was used to remove the standard Illumina adapters sequences (Bolger et al., 2014). For this step seed matches (<16 bases) were searched, allowing maximally 2 mismatches. Bases were filtered by quality using a 4-base wide sliding window scan and cut when average quality per base was below 5. Reads with no insert or with ambiguities were removed. The suite TUXEDO

MATERIALS AND METHODS was used for subsequent analysis steps. Transcripts alignment was performed with BOWTIE (version 2.0.5; Langmead et al. 2009). Mapping to the A. thaliana genome (Ensembl TAIR10, from iGenome) was done with TOPHAT (version 2.0.6; http://tophat.cbcb.umd.edu/). For the estimation of transcripts abundance (read per kilobase of exon per million) CUFFLINKS (version 2.1.1; http://cufflinks.cbcb.umd.edu/) was utilized. Differential gene expression levels were calculated using CUFFDIFF (http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/) that tested for significant differences (FDR<0.05) against the wild-type. For gene lists comparison and assembly the function “vlookup” of Microsoft Excel was used. A custom R (https://cran.r-project.org/) script making use of the library “gplots” was utilized to obtain graphical output. Euclidean distances among gene expression levels were calculated. These were used for hierarchical clustering using the “ward D2” method. Heatmaps were generated using the function “heatmap 2”.

RESULTS AND DISCUSSION

3 RESULTS AND DISCUSSION 3.1 A forward genetics screen for the identification of novel components of the BZR1-BAMs signalling pathway

BZR1-BAMs are proteins with a proposed function as metabolite-sensing transcription factors. Previous studies have implicated them in the control of plant development and have identified antagonistic relationships with the BR signalling pathway. However, despite the body of knowledge about their transcriptional targets and the molecular function of their TF and BAM domains, little was elucidated regarding the regulatory network in which they act. I sought to broaden our understanding of the BZR1- BAMs signalling pathway in Arabidopsis thaliana by means of forward genetics, which allows the unbiased identification of factors involved in the examined cellular process. To this end, I built upon pre-existing data regarding the BZR1-BAMs target genes to assemble a reporter gene construct that was the basis for the molecular phenotype screen in plants subjected to random mutagenesis. I initiated the screen to demonstrate its functionality and sequenced the genome of selected lines. This enabled me to identify putative factors involved in BZR1-BAM signalling.

Generation of a reporter line for the forward genetic screen BZR1-BAMs function in regulating gene expression with consequences for both root and shoot development of the plant. Alterations in the plant phenotype are visible only when both BAM7 and BAM8 are knocked-out or when BAM8 is overexpressed (BAM8-OX). In the first case, the rosette leaves of Arabidopsis show elongated petioles and epinastic leaf blades, while the main root has a reduced overall length compared to the wild type (Reinhold et al., 2011; Soyk, PhD thesis 2013). In contrast, when BAM8 is ectopically overexpressed, the rosettes are smaller and characterized by dark-green rounded, hyponastic leaves with shorter petioles. Roots of a BAM8-OX line are less branched than the wild type, (Soyk, PhD thesis 2013). Similar morphological phenotypes were reported before for mutants affected in other processes, such as light or hormone responses (Martínez-García et al., 2010; Wang et al., 2002). Thus, these traits are not ideal to be scored in a forward genetic screen, given the lack of the necessary specificity towards the BZR1-BAM pathway (Chaiwanon et al., 2016; Page and Grossniklaus, 2002). To restrict the selection to mutants affected in the BZR1-BAMs pathway, a molecular reporter phenotype was utilized instead. To this end, the gene encoding the firefly luciferase was chosen for the design a of reporter gene construct.

RESULTS AND DISCUSSION

Previous transcriptional profiling identified genes regulated by the BZR1-BAMs (Reinhold et al., 2011). Among these, AT5G22580 and AT5G57785, had opposing expression changes in lines overexpressing BAM8 or in the bam7bam8 double mutant: they were up-regulated in the first case, while repressed in the latter. The observed transcriptional behaviour led to their classification as BZR1-BAMs UPREGULATED (BUP; BUP1 and BUP2, respectively) genes (Soyk, PhD thesis 2013). Interestingly, their promoter regions possess one and two BBRE motifs in the 500 bp preceding the transcriptional start site (TSS), respectively, and BUP2 has a third one further upstream. For these characteristics ⁓2kb upstream of the TSS of BUP1 and BUP2 were chosen to drive the expression of luciferase in the reporter gene constructs in vectors suitable for plant expression (Figure 3-1 A). As a result of the presence of BBRE motifs in their promoters and as a consequence of the antagonistic relationship between the BZR1-BAMs and the BR signalling, it was hypothesized that BUP1 and BUP2 could also be controlled by BR. The impairment of the hormone’s cues would lead to the induction of their expression, thus to an increased luciferase activity, thereby reducing the specificity of the screen. To test the effect of a reduction in BR signalling, quantitative real time PCR (qPCR) was used to assess the transcripts level in seedlings grown on synthetic medium supplemented with brassinazole (BRZ, a BR biosynthesis inhibitor) or DMSO as a control. The experiment showed that BRZ has small positive effect compared to the large impact of BAM8 overexpression on the expression of both BUP1 and BUP2. The BRZ-induced increase was larger for BUP2 (+2.60) than for BUP1 (+1.81) (Figure 3-1 B). Each reporter gene construct was introduced into the wild- type (Col-0) genetic background and single insertion locus lines were selected by segregation of the herbicide resistance. Among these, a further selection step was performed to assess the promoter activity. In the ideal reporter line, the promoter driving the luciferase expression should respond as the native promoter in its original genomic locus, for instance by being activated upon BAM8 overexpression. The selection was performed by crossing individual homozygous reporter lines with the BAM8-OX line and with the wild type, as a control. The luciferase signal was detected in plants of the F1 generation by imaging the photon emission with an electron multiplying CCD (EMCCD) camera and compared with the respective homozygous parental line. Line pBUP2:Luc #12-3 had the desired behaviour: the cross with BAM8-OX led to higher luciferase signal in the F1 seedlings, comparable to that observed for the parental reporter line, whereas the cross with the wild type showed a lower signal, as expected for hemizygous lines (Figure 3-1 D). In no transgenic line did the pBUP1:Luc construct respond as expected to BAM8 overexpression (data not shown), thus the construct was not further utilized in this study. The reason for the lack of response is unknown, as it was shown in transactivation assays performed in protoplasts using the same construct

RESULTS AND DISCUSSION that the promoter region cloned upstream of the luciferase gene was sufficient to activate expression of the reporter (data not shown).

The reporter gene is expressed from the onset of seedling development and best assessable 7 dpg The current model for the action of BAM7 and BAM8 implies their antagonism with the brassinosteroids TFs BZR1 and BES1 that play a fundamental role during developmental processes such as skotomorphogenesis. Via this mechanism, BZR1-BAMs influence the expression of BR regulated genes when the BR signalling pathway is not dominant, i.e. upon transition from dark to light (Soyk, PhD thesis

C D

Figure 3-1 The promoters of BUP1 and BUP2 possess the BBRE motif and respond positively to BAM8 overexpression. A. Schematic representation of the reporter constructs obtained by the fusion of ⁓2kb promoter region of BUP1 (2,100 bp) or BUP2 (2,040 bp) to the luciferase gene. The BBRE motif is indicated. Images in scale. B. Transcripts abundance of BUP1 and BUP2 measured by real time PCR relative to PP2A in 2 weeks-old seedlings grown on solid ½ MS medium supplemented with 1 µM BRZ or 0.05 % [v/v] DMSO. Error bars represent SD of three technical replicates. C. Seedlings of the F1 generation obtained from a cross between line pBUP2:Luc #12-3 (PL) and either BAM8-OX or the wild type (Col-0) D. Imaging of luciferase signal upon treatment with 0.8 mM luciferin. Seedlings as in C.

RESULTS AND DISCUSSION

2013). With this model in mind, the expression of the reporter gene was assayed during seed germination and the early phases of seedling development in order to identify the most suitable time window for the scoring of the luciferase molecular phenotype in the EMS-mutagenized populations. Seeds of the homozygous reporter line were placed on solid synthetic medium supplemented with luciferin and stratified for 2 days. The presence of the substrate for the reporter enzyme in the growth medium simplified the screening procedure by removing an additional handling step for its administration and guaranteed its homogeneous supply to all seedlings. Luciferase expression was recorded by imaging the photon emission daily between two and ten days after the transfer to the growth chamber, where the photoperiod was of 12 h (Figure 3-2). Between day 2 and 5 a large proportion of the signal was visible as an intense spot, probably deriving from the seed coat. In contrast, seven days after germination the luciferase activity was homogenous through the root whose architecture is simple, consisting only of the primary root. Later during seedling development, lateral roots emerged and, in some instances, main roots of different plants converged, complicating the visual assignment of the luciferase phenotype to specific plantlets. Consequently, day 7 was chosen for the initial phenotypic scoring.

RESULTS AND DISCUSSION

Figure 3-2 Expression of the luciferase reporter is visible since the onset of seed germination and in the developing root. Seeds were placed on ½ MS solid medium supplemented with 100 µM luciferin and stratified for two days at 4 °C in the dark. Seedlings were grown vertically in 12-h photoperiod and luciferase activity was detected every day between day 2 and day 10 post- germination (dpg) with an EMCCD camera.

RESULTS AND DISCUSSION

Selection of EMS-mutagenized M2 lines based on the luminescence phenotype

To obtain a mutagenized population of the reporter line pBUP2:Luc #12-3, ⁓10,000 homozygous seeds of the T3 generation were treated with 0.25 % [v/v] EMS (Ethyl methanesulfonate) for 12 h. With the goal of harvesting the progeny of individual M1 (the first generation after the mutagenesis) plants, the mutagenized seeds were suspended in 0.1 % [w/v] agar and distributed to 2,880 single pots (5x5-cm), where they were grown till maturity. The efficacy of EMS mutagenesis was inferred by the appearance of plants with albino sectors, however the number of M1 plants showing this phenotype was not quantified.

The assessment of the luciferase signal was performed using M2 seeds, collected from single plants. This allows the detection of recessive mutations that would not be identified if the selection were performed in the M1 generation. However, since the progeny of single plants were harvested it is possible to deduce immediately whether the mutation causing the phenotype has a recessive or dominant character.

About 90 seeds of each M2 population were germinated and grown for one week in a 12-h photoperiod on vertical ½ MS solid agar plates supplemented with 100 µM luciferin. Each plate also contained seeds of the non-mutagenized parental line as a baseline reference for the luciferase signal, and Col-0 seeds as negative controls. As chlorophyll fluorescence emission wavelength falls in the spectrum of detection of bioluminescence, the latter was used to ensure that the observed light signal derived from luciferase and not from natural fluorescence. To this end, plates were incubated in darkness for two minutes prior to luciferase detection, a time sufficient for the chlorophyll fluorescence complete decay. The reporter enzyme activity of single M2 lines was assessed by imaging photon release for 1 minute by means of EMCCD camera mounted in a dark cabinet, using the most sensitive camera settings.

As expected for mutagenized lines, the degree of luciferase activity varied greatly among the M2 populations, ranging from signals lower than the non-mutagenized parental (difficult to evaluate) to much higher ones. In some cases, the stunted or slow growth of the seedlings necessitated a second assessment of the bioluminescent phenotype, typically performed 5 to 7 days after the first.

During the course of my work, the phenotype of 275 M2 lines was scored. Of these, only the lines with increased luciferase activity compared to the parental were further evaluated. The gain in luminescence needed to be clearly visible for assessment of the segregation ratio both within the M2 population and, later, after the backcross with the parental line, so as to be able to select individuals for the generation of a bulk DNA sample for whole genome resequencing. Of the 275 M2 lines, 22 were selected for their enhanced luciferase activity. The high frequency of families with an increased luciferase

RESULTS AND DISCUSSION signal suggested the isolation of mutants not involved in the BZR1-BAMs pathway and led to establish an additional method of selection to be performed in series (described in section 3.1.4).

The phenotype of the selected M2 lines was confirmed with at least two rounds of growth and the same seedlings were used to count the segregation of the luminescence phenotype. I aimed to find lines where the phenotype was caused by a single recessive mutation. In Arabidopsis, recessive mutations are expected to segregate in a ratio of 1:7 (0.125) in a M2 family, assuming a Mendelian transmission of the recessive allele. This derives from the assumption that, at the time of mutagenesis, from all embryonic cells subjected to the EMS treatment, only two (the functional germline, referred to as genetically effective cell number) will give rise to the shoot apical meristem. Because different genetic changes have been induced in individual cells, the developing M1 plant will be chimeric and its seeds will be genetically different depending on the branch of the plant they derive from (Page and Grossniklaus, 2002). The main problems encountered when analysing the M2 generation were i) defects in the seedlings development, ii) non-homogeneous luciferase signal along the root and iii) marginal or variable increases in luciferase signal, with plants intermediates between the parental line and the most luminescent, all of which complicated the scoring. The χ 2 test was used to ensure that the calculated segregation ratios were in accordance with either 1:7, for a recessive mutation, or 3:5, as expected for dominant ones. Among the lines with increased luminescence, 14 matched the first kind of segregation, while 5 were more similar to the second. In addition, 3 did not comply with neither: in line #269 two genetic loci may contribute to the phenotype, while more complex genetic interaction phenomena or incorrect scoring may explain the segregation observed for lines #101 and #114.

RESULTS AND DISCUSSION

Table 3-1 Segregation of the luciferase signal was calculated in selected M2 populations that showed increased luminescence compared to the parental line. Recessive mutants are expected to be one in eight (0.125), while dominant ones should represent 3/8 (0.375) of the population. χ2< 0.05 indicates that the observed distribution might differ from the expected one. Grey background denotes the lines whose segregation might be for a recessive or dominant trait, respectively.

Line Segregation χ2 recessive χ 2 dominant ratio M2 101 0.244 8.32E-04 1.22E-02 103 0.091 2.80E-01 7.53E-10 105 0.08 2.17E-01 1.39E-08 106 0.183 9.19E-02 1.29E-04 107 0.298 3.39E-04 2.75E-01 114 0.218 1.31E-02 4.17E-03 126 0.107 4.84E-01 7.43E-13 131 0.125 1.00E+00 5.76E-10 133 0.153 2.91E-01 8.97E-09 136 0.324 2.26E-13 2.03E-01 144 0.090 1.77E-01 3.59E-14 160 0.096 2.76E-01 6.29E-13 165 0.099 3.40E-01 2.62E-12 173 0.354 3.03E-15 6.18E-01 176 0.095 3.72E-01 1.68E-08 185 0.123 9.53E-01 3.76E-11 188 0.295 5.72E-06 1.44E-01 207 0.365 8.32E-09 8.71E-01 223 0.150 3.44E-01 9.45E-09 261 0.160 4.54E-01 1.69E-03 262 0.048 1.29E-01 1.17E-05 269 0.020 1.09E-04 3.64E-19

A second layer of selection of M2 lines through expression analyses of selected marker genes EMS mutagenesis introduces transitions from C to G or from G to A that can occur anywhere in the genome. The altered loci may include the transgene bearing the promoter-reporter fusion. They may also include genes solely implicated in the negative regulation of the BR pathway that do not directly impact upon BZR1-BAMs, but nonetheless alter expression from the BUP2 promoter. To narrow down the number of M2 lines and seeking to exclude mutants in loci not relevant for this study, quantitative RT-PCR

RESULTS AND DISCUSSION of a number of BZR1-BAMs marker genes was used as a second layer of selection. To identify genes suitable for this, lists of BR- (Sun et al., 2010) and BZR1-BAMs-regulated genes (Reinhold et al., 2011) were compared with the goal to identify genes under the control of one but not the other pathway, and vice versa. From this in silico analysis, the following genes were chosen: AT2G47560 and AT1G09500, up- regulated only by BZR1-BAMs; AT1G56150 repressed by BR but not regulated by the BZR1-BAMs; and BUP1 and BUP2 that, despite being regulated by both BZR1-BAMs and by BR, are considered well established markers of BZR1-BAMs activity (Soyk et al., 2014). To confirm the regulation of the aforementioned genes, their expression levels were assessed in lines deregulated in the BR or BZR1-BAM responses and in the presence of BRZ, and compared to the wild type (Figure 3-2). In a BAM8 overexpressing line, all genes were up-regulated except AT1G56150. The expression of this gene also did not change compared to the wild type in the hypermorphic bzr1-D mutant, where it was expected to be down- regulated. Despite being a BZR1 direct target, this gene is likely to be controlled by other transcriptional regulators of the BR pathway, causing the observed expression levels. The presence of BRZ did not affect the expression of AT2G47560 and AT1G09500 in the reporter line and in the wild type, and AT1G56150 was only slightly up-regulated in the both genotypes in this condition. On the other hand, suppression of the BR pathway, either by chemical treatment or genetically (in the BR biosynthesis mutant det2-1), led

Figure 3-3 BZR1-BAMs marker genes used for the second layer of selection of M2 lines. A set of genes known to be regulated by BZR1-BAMs and/or by BR was selected based on their expression in genotypes deregulated in the response to these two pathways and in the reporter line with the aim to use their expression signature for a second step of selection of the M2 lines. Transcript levels of BUP1, BUP2, AT2G47560, AT1G09500 and AT1G56150 were measured by qPCR relative to YLS8 in one-week old seedlings grown as for the luciferase phenotype detection. Error bars represent SD of three technical replicates.

RESULTS AND DISCUSSION

to the up-regulation of BUP1 and BUP2. These genes were also down-regulated in bzr1-D. All the tested genes, except AT1G56150, behaved essentially as expected and were subsequently used as markers to

test the M2 lines. Despite not showing repression in the bzr1-D background, AT1G56150 was not up-

regulated in BAM8-OX, thus its expression was also tested in the M2 lines to serve as a negative control.

Transcript abundance of the aforementioned genes was detected in one-week old M2 seedlings selected for their luciferase activity within the respective populations and compared to that of the non- mutagenized parental line grown in the same plate (Figure 3-4). The expression level of the marker genes varied among the different lines, with BUP1 being the gene with the most frequent positive response (Figure 3-4) and AT1G09500 most frequently down-regulated as opposed to its behaviour in BAM8-OX.

Figure 3-4 The Luciferase phenotype and the expression level of a set of marker genes were used to select M2 lines suitable for the subsequent steps of the screen. A. Seedlings growth and luciferase signal as detected by the EMCCD camera. B. Transcript levels of BUP1, BUP2, AT2G47560, AT1G09500 and AT1G56150 measured by qPCR relative to YLS8. Error bars represent SD of three technical replicates. 54

RESULTS AND DISCUSSION

Unexpectedly, the expression of BUP2 did not always match the luciferase phenotype. For example, line #185 showed the strongest luminescence but most of the marker genes were slightly down-regulated compared to the parental line. Using the combination of marker gene expression levels, detection of luciferase (Figure 3-4) and segregation ratio (Table 3-1), I chose lines for the generation of mapping populations with the aim of identifying the mutation causing the phenotype by whole genome resequencing. Despite the incongruence between luciferase phenotype and gene expression, line #185 was retained for its strong luminescence. Similarly, the transcripts profile of line #173 led to its selection in spite of the segregation ratio suggesting the presence of a dominant mutation.

A single backcrossing scheme for the generation of mapping populations Technical advancements in DNA sequencing platforms and the consequent reduction of costs enable the use of whole genome resequencing to map and identify the mutation underling a phenotype of interest generated by random mutagenesis (Schneeberger, 2014). Despite traditionally requiring the generation of a mapping population generated from the cross between the mutant and a genetically divergent line, nowadays it is common practice to use the parental non-mutagenized line for crossing and the EMS- induced changes as genetic markers for linkage analyses. In this context, it was shown that multiple rounds of backcrossing do not greatly impact the mapping resolution while the size of the segregating population and the depth of sequencing do (James et al., 2013).

Individual M2 seedlings showing enhanced luminescence were transferred to soil and grown in 16 hours light until flowering. Crosses were made with the parental reporter line (backcrosses, BC), seeds collected and allowed to self for one generation (BC1F1). The progeny (BC1F2) were assessed for the segregating luciferase phenotype on plates, as described previously. This allowed the segregation of seedlings with enhanced or background levels of luminescence to be quantified. Given the previous step of selection for recessive mutations, the expected proportion of positive plants was one in four, following a classical Mendelian scheme, while for the progeny of line #173 that seemed to carry a dominant mutation three out of four plants were anticipated to show the high luminescence phenotype. In three lines (#133-1-1, #144-1-1 and #173-2-1) the luminescence phenotype appeared less often than expect, probably due to incorrect scoring or alternatively due to complex genetic phenomena.

RESULTS AND DISCUSSION

Table 3-2 Segregation of the luciferase signal was calculated in selected BC1F2 populations. Recessive mutations are expected to show the phenotype one in four plants (0.25), while dominant ones should represent 3/4 (0.75) of the population. χ2< 0.05 indicates that the observed distribution might differ from the expected one.

2 BC1F2 line Segregation ratio Χ n. plants/ recessive DNA sample #BC105-1-1 0.233 4.93E-01 112 #BC131-1-1 0.254 8.51E-01 243 #BC133-1-1 0.127 8.70E-12 130 #BC144-1-1 0.137 2.45E-15 113 #BC173-2-1 0.126 2.54E-11 118 #BC185-3-1 0.229 7.53E-02 155

Identification of the cause of the enhanced luminescence phenotype by whole genome resequencing

At least 100 BC1F2 seedlings with an enhanced luciferase signal were pooled for the preparation of DNA samples (Table 3-2). Similar amounts (in weight) of plant material were harvested from each individual contributing to the pool. This had the goal to create balanced DNA samples where the chance of sequencing individual alleles at a given locus would be equal for all the members of the pool. The non- mutagenized reporter line was also sequenced along with BC1F2 populations for reference. The Illumina platform was used for sequencing, achieving a genome coverage between 166x and 545x (Table 3-3).

Table 3-3 Yield, in number of reads, of genome resequencing for each of the mapping segregating populations.

Line Total reads Mapped reads

Parental 215,535,700 209,682,801 #BC105-1-1 246,647,640 241,453,319 #BC131-1-1 216,550,946 209,033,775 #BC133-1-1 193,420,216 187,814,410 #BC144-1-1 191,508,836 186,570,497 #BC173-2-1 122,812,586 119,934,896 #BC185-3-1 251,536,098 245,480,796

The generated reads were mapped to the Arabidopsis genome (TAIR 10) and used for the detection of genetic variants that could putatively cause the observed phenotype. The variants specific to the

RESULTS AND DISCUSSION

Arabidopsis strain used in this study, and not present in the publicly available genome sequence, were filtered away by comparing each sample with the parental, non-mutagenized line. Subsequently, only transitions presumably introduced by the EMS treatment (C to T and G to A, also referred to as Single

Nucleotide Variants, SNVs) were considered. Those detected at high frequency in the BC1F2 population (ideally represented by 100 % of the reads at a given locus) and falling in coding sequences, or in introns so as to cause incorrect splicing, are the most likely to explain the enhanced luminescence for which the seedlings were selected. The frequency threshold chosen to discriminate phenotype-causing variants and randomly occurring ones was 80 % among all reads covering a given nucleotide, however the stringency of this selection was relaxed when no candidates could be identified otherwise, as discussed later. For line BC105-1-1: seven variants with a frequency above 80 % were identified (data not shown). These were distributed to all 5 chromosomes and only one affected a protein coding gene (AT2G47650, UDP-XYLOSE SYNTHASE 4, frequency 80.6 %) introducing a change in the 5’ untranslated region. The absence of linked changes on chromosome 2 and the concomitant identification at similar frequencies of a few variants on all other chromosomes made impossible the attribution of the observed phenotype to changes within a specific genomic interval. For line BC131-1-1: it was necessary to lower the frequency threshold to 70 % to identify variants in protein coding genes. This resulted in the detection of a number of changes located mostly on chromosome 3, while two were on chromosome 5 (Table 3-4). On chromosome 3, variants occurring at lower frequency are approximately centred around the most represented one. This sequence variant was represented only by 78.4 % of the reads, not by 100 % as would be expected for changes that give rise to the scored phenotype. Incorrect selection of individuals from the BC1F2 segregating population could result in a low proportion of reads supporting the SNV, as assessment of the phenotype was complicated by the impaired root development of some of the seedlings. The variant introduces an amino acid exchange, from glycine to glutamate, and affects a gene encoding the chloroplastic amino acid kinase DPT1, involved in plastid pyrimidine metabolism and in the control of psaA/B transcript accumulation. For lines BC133-1-1 and BC144-1-1: both of these lines showed several EMS-induced SNVs on chromosome 1 and 2, with those on chromosome 1 never represented by 100 % of the reads. Interestingly, two of the genes affected in BC133-1-1 also carry SNVs in BC144-1-1. The first gene (HOMEODOMAIN GLABROUS 2, AT1G05230) is located on chromosome 1. In BC133-1-1, the change represents 92.04 % of the reads, while in BC144-1-1 it has a frequency of 97.27 %. The change introduced in line 133-1-1 mutates a splice site, whereas in BC144-1-1 a proline is substituted by a serine. The variants in the second gene (POLY(ADP-RIBOSE) GLYCOHYDROLASE 1, AT2G31870) have a frequency of 100 % in

RESULTS AND DISCUSSION both populations and the changes are of different nature: a splice variant in the first line and a tryptophan to stop codon exchange in the second. The sequencing also revealed that two and one loci in BC133-1-1 and in BC144-1-1, respectively, that were also changed with a frequency of 100 %. These variants are adjacent (i.e. genetically linked) to the aforementioned ones. In BC133-1-1 the first affects the coding sequence of a TF (HDG3) member of the homeobox-leucine zipper family of proteins that is involved in cotyledon development, while the second impacts a ERD1/XPR1/SYG1 protein of unknown function. In line BC144-1-1, the second variant that appears at a frequency of 100 % falls in the gene coding for a member of the galactosyltransferase proteins, where it introduces a phenylalanine instead of a leucine. For line BC173-2-1: all variants affecting protein-coding regions were located on chromosome 4, however none of them was detected at a frequency of 100 %. The variant represented by most reads introduces an amino acid exchange (glycine to aspartate) in AT4G30100 (encoding a P-loop containing nucleoside triphosphate hydrolases protein). This mutation is surrounded by other SNVs, but their frequency did not in all cases decrease proportionally to the distance from that in AT4G30100, hampering the attribution of the observed phenotype to the change in that gene. For line BC185-2-1: SNVs affecting protein-coding genes were found only on chromosome 4. Of these, only one is represented by the totality of the reads, and the distribution of less frequent ones is centred around its position, as expected for changes linked to the variant that causes the phenotype target of the plant selection. The nucleotide change leads to the replacement of a glycine with an arginine of the transcriptional repressor CPL1 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 1).

RESULTS AND DISCUSSION

Table 3-4 EMS-induced SNVs affecting protein-coding sequences in the six selected populations. SNVs supported by at least 80% of the reads (frequency) were arbitrarily considered as possible causes of the observed phenotype, unless otherwise specified (see text). For line 133-1-1, 144-1-1 and 185-2-1 the table displays only loci with a variant coverage above 90 %. Chrom.: chromosome; A.a. change: Amino acid change; Frequency: proportion of reads supporting the sequence variant among all reads covering the given locus.

Line Chrom. Frequency A. a. Change Exon ATG Gene name Protein function (%)

3 78.40 Gly67Glu 1/7 AT3G18680 Member of the family of the amino acid kinases 3 76.06 Arg550Lys 10/13 AT3G15990 SULFATE TRANSPORTER 3;4 (SULTR3;4) Sulfate transporter Sultr3;4.

3 73.48 Ser335Leu 1/1 AT3G12970 Serine/arginine repetitive matrix-like protein 3 73.08 Leu813Phe 11/11 AT3G16290 EMBRYO DEFECTIVE 2083 (EMB2083) Member of the family of AAA-type ATPase proteins 3 73.05 Arg298Lys 8/16 AT3G13670 PHOTOREGULATORY PROTEIN KINASE 1 (PPK1) Member of the family of protein kinases

3 72.36 Glu310Lys 7/10 AT3G18350 Heat-inducible transcription repressor 3 72.31 Glu259Lys 1/1 AT3G21220 MAP KINASE KINASE 5 (MKK5) Involved in innate immunity. Activates MPK3/MPK6 and early-defense genes redundantly with MKK4. Mediates floral organ abscission 3 72.17 Ser105Phe 5/14 AT3G10700 GALACTURONIC ACID KINASE (GalAK) Involved in the synthesis of UDP-galacturonic acid

3 72.06 Ala432Val 6/9 AT3G19300 Member of the superfamily of protein kinases 131 3 72.04 Ala182Thr 2/2 AT3G22000 Putative cysteine-rich repeat secretory protein 3 72.00 Leu18Phe 1/2 AT3G18485 IAA-LEUCINE RESISTANT 2 (ILR2) Putative modulator of a metal transporter. Mutants are defective in lateral root formation and primary root elongation

3 71.30 Arg653Lys 5/15 AT3G19190 AUTOPHAGY 2 (ATG2)

3 70.94 Leu228Phe 2/9 AT3G25660 Member of the family of amidase proteins

3 70.39 Glu107Lys 4/10 AT3G22260 Member of the superfamily of cysteine proteinases 3 74.45 Splice site 10^11 AT3G18480 CCAAT-DISPLACEMENT PROTEIN ALTERNATIVELY Putative Golgi apparatus structural component /19 SPLICED PRODUCT (CASP) 5 70.69 Ala31Thr 1/1 AT5G57070 Member of the family of hydroxyproline-rich glycoproteins 5 72.03 Thr270Ile 10/19 AT5G58910 LACCASE 16 (LAC16) Putative laccase

1 97.69 Glu236Lys 1/4 AT1G02110 bZIP domain class transcription factor 133 1 95.33 Thr535Ile 15/22 AT1G03445 BRI1 SUPPRESSOR 1 (BSU1) Serine/Threonine protein phosphatase

RESULTS AND DISCUSSION

Line Chrom. Frequency A. a. Change Exon ATG Gene name Protein function (%)

1 92.78 Arg167Lys 2/8 AT1G05380 Acyl-CoA N-acyltransferase 1 92.78 Leu334Phe 3/17 AT1G08130 DNA LIGASE 1 (LIG1) Active in DNA replication and excision repair pathways. DNA demethylation machinery 1 92.31 Gly299Glu 1/1 AT1G06530 PEROXISOMAL AND MITOCHONDRIAL DIVISION Involved in mitochondrial morphogenesis FACTOR 2 (PMD2)

1 92.23 Arg27Lys 1/8 AT1G03370 C2 calcium/lipid-binding and GRAM domain containing protein

1 92.08 Val152Met 4/8 AT1G04430 Member of the superfamily of S-adenosyl-L-methionine-dependent methyltransferases 1 92.04 Splice site 10^11 AT1G05230 HOMEODOMAIN GLABROUS 2 (HDG2) Member of the IV family homeobox-leucine zipper, involved in trichome /11 development

1 91.74 Pro4Leu 1/13 AT1G03830 Member of family of the guanylate-binding proteins 1 91.59 Thr241Met 5/5 AT1G06350 DELTA 9 DESATURASE 4 (ADS4) Member of family of fatty acid desaturase proteins

2 100 Splice site 2^3/1 AT2G31870 POLY(ADP-RIBOSE) GLYCOHYDROLASE 1 (PARG1) Plays a role in abiotic stress responses and DNA repair 1

2 100 Ser192Phe 8/14 AT2G32295 Member of the family of EXS (ERD1/XPR1/SYG1) proteins 2 100 Thr202Met 6/12 AT2G32370 HOMEODOMAIN GLABROUS 3 (HDG3) Member of the IV family of homeobox-leucine zipper. Involved in cotyledon development. Up Curved leaves

2 99.07 Pro387Leu 11/12 AT2G31810 ACT domain-containing small subunit of acetolactate synthase protein; Chloroplastic protein involved in the biosynthesis of branched chain amino acids 2 98.33 Arg645Cys 17/42 AT2G33240 ATXID, MYOSIN XI D, XID Member of Myosin-like proteins

2 97.37 Ala288Thr 8/10 AT2G34190 Xanthine/uracil permease family protein 2 96.69 Val133Ile 3/8 AT2G35650 CELLULOSE SYNTHASE LIKE (CSLA07) Member of glycosyltransferase-family 2. Beta-mannan synthase

RESULTS AND DISCUSSION

Line Chrom. Frequency A. a. Change Exon ATG Gene name Protein function (%) 2 95.58 Pro486Ser 5/12 AT2G33540 C-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3) Negative regulation of abscisic acid-activated signalling pathway, response to salt stress 2 95.1 Ser97Phe 1/4 AT2G37550 ARF-GAP DOMAIN 7 (AGD7) Involved in vesicle-mediated transport

2 94.95 Arg100Stop 5/16 AT2G34750 RNA polymerase I specific transcription initiation factor RRN3 protein 2 94.2 Glu175Lys 4/6 AT2G33600 CCR(CINNAMOYL COA:NADP OXIDOREDUCTASE)-LIKE Involved in the synthesis and/or maintenance of vascular tissue 2 (CRL2)

2 94.06 Glu199Lys 1/1 AT2G36090 Member of the family of F-box proteins

2 93.16 Glu85Lys 1/4 AT2G33430 FGENESH2_KG.4__1346__AT2G33430.1.1 2 92.42 Met184Ile 1/1 AT2G39120 WHAT'S THIS FACTOR 9 (WTF9) Encodes a mitochondrial protein essential for the splicing of group II introns 1 97.27 Pro59Ser 4/14 AT1G05230 HOMEODOMAIN GLABROUS 2 (HDG2) Member of the IV family of homeobox-leucine zipper, involved in trichome development 1 95.88 Thr62Ile 2/3 AT1G08010 GATA TRANSCRIPTION FACTOR 11 (GATA11) Zinc finger transcription factors. 1 95.73 Glu260Lys 1/1 AT1G05800 DONGLE (DGL) Galactolipase. Involved in jasmonic acid biosynthesis. 1 95.45 Gly224Glu 2/4 AT1G04520 PLASMODESMATA-LOCATED PROTEIN 2 (PDLP2) Putatively involved in the intercellular movement of molecules through the plasmodesmata

1 94.05 Arg14Lys 1/1 AT1G05920 B3 domain protein (DUF313)

144 1 93.97 Cys251Tyr 5/50 AT1G02080 Transcription regulator 1 92.93 Leu727Phe 4/4 AT1G10920 LOCUS ORCHESTRATING VICTORIN EFFECTS 1 (LOV1) Disease susceptibility gene, member of the NBS-LRR resistance gene family

1 92.71 Glu339Lys 10/27 AT1G10490 GNAT acetyltransferase (DUF699) 1 92.59 Ser34Asn 1/1 AT1G10480 ZINC FINGER PROTEIN 5 (ZFP5) Involved in trichome development by integrating GA and cytokinin signaling

1 92.23 Gly70Ser 1/1 AT1G09900 Member of the superfamily of pentatricopeptide repeat (PPR-like) proteins

RESULTS AND DISCUSSION

Line Chrom. Frequency A. a. Change Exon ATG Gene name Protein function (%) 1 92.17 Gln257Stop 2/2 AT1G08700 PRESENILIN-1 (PS1) Up-regulated in response to potassium (K+) deprivation

1 91.46 Gly432Glu 18/18 AT1G08890 Member of the superfamily of major facilitator proteins

1 91.43 Gly82Ser 3/12 AT1G07470 Transcription factor IIA, alpha/beta subunit 1 91.23 Ala389Thr 10/12 AT1G10950 TRANSMEMBRANE NINE 1 (TMN1) Localized in the secretory pathway. Involved in cell adhesion and phagocytosis 1 90.65 Ser111Phe 2/2 AT1G10360 GLUTATHIONE S-TRANSFERASE TAU 18 (GSTU18) Glutathione transferase 1 90.48 Ala85Thr 2/2 AT1G05600 EMBRYO DEFECTIVE 3101 (EMB3101) Member of the superfamily of tetratricopeptide repeat (TPR)-like proteins 2 100 Trp226Stop 4/11 AT2G31870 POLY(ADP-RIBOSE) GLYCOHYDROLASE 1 (PARG1), Plays a role in abiotic stress responses and DNA repair

2 100 Leu219Phe 7/11 AT2G32430 Member of the galactosyltransferase proteins

2 98.35 Ala150Thr 4/4 AT2G34050 ATP synthase F1 complex assembly factor 2 95.28 Splice site 3^4/6 AT2G35890 CALCIUM-DEPENDENT PROTEIN KINASE 25 (CPK25) Member of the Calcium Dependent Protein Kinase

2 95.04 Arg272Lys 1/1 AT2G36730 Member of the superfamily of the pentatricopeptide repeat (PPR) proteins 4 90.79 4/7 AT4G30100 Member of the superfamily of P-loop containing nucleoside triphosphate Gly517Asp hydrolases proteins

4 88.06 Gly955Arg 25/32 AT4G24450 PHOSPHOGLUCAN, WATER DIKINASE (PWD) 4 88.00 Glu229Lys 3/3 AT4G26200 1-AMINO-CYCLOPROPANE-1-CARBOXYLATE SYNTHASE Involved in ethylene biosynthesis 7 (ACS7) 4 85.71 Trp176Stop 2/8 AT4G23800 3XHIGH MOBILITY GROUP-BOX2 (3xHMG-box2) Interacts with mitotic and meiotic chromosomes 173

4 85.26 Met369Ile 10/13 AT4G36490 SEC14-LIKE 12 (SFH12)

4 85.07 Glu353Lys 1/1 AT4G23530 ROH1, putative (DUF793)

4 84.71 Ala237Thr 8/10 AT4G25610 C2H2-like zinc finger protein

4 81.82 Glu77Lys 3/7 AT4G25600 Oxoglutarate/iron-dependent oxygenase

4 80.60 Thr144Ile 1/2 AT4G19925 Member of the family of Toll-Interleukin-Resistance (TIR) domain proteins

RESULTS AND DISCUSSION

Line Chrom. Frequency A. a. Change Exon ATG Gene name Protein function (%) 4 100 Gly768Arg 12/17 AT4G21670 C-TERMINAL DOMAIN PHOSPHATASE-LIKE 1 (CPL1) Transcriptional repressor. Phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold and NaCl 4 98.62 Thr641Ile 7/7 AT4G23200 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) Cysteine-rich receptor-like protein kinase. 12 (CRK12)

4 96.69 Gly121Ser 1/1 AT4G25390 Member of the superfamily of protein kinases 4 96.35 Ala231Val 2/2 AT4G19700 BOTRYTIS SUSCEPTIBLE 1 INTERACTOR (BOI) E3 ubiquitin ligase activity. Prevents caspase activation and attenuates cell death 4 96.3 Leu15Phe 1/5 AT4G27600 GENES NECESSARY FOR THE ACHIEVEMENT OF Member of the phosphofructokinase B-type carbohydrate kinase RUBISCO ACCUMULATION 5 (NARA5) proteins. Regulates photosynthetic gene expression 4 96.12 Thr503Ile 6/6 AT4G30360 CYCLIC NUCLEOTIDE-GATED CHANNEL 17 (CNGC17) Member of the family of cyclic nucleotide gated channels

4 94.57 Ala497Val 10/10 AT4G26760 MICROTUBULE-ASSOCIATED PROTEIN 65-2 (MAP65-2) 185 4 94.41 Arg109Stop 1/1 AT4G17490 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 6 Member of the family of ERF/AP2 transcription factors. Involved in the (ERF6) response to reactive oxygen species and light stress

4 93.75 Asp20Asn 3/12 AT4G27690 VACUOLAR PROTEIN SORTING 26B (VPS26B)

4 93.55 Splice site 6^7/1 AT4G28000 Member of the superfamily of P-loop containing nucleoside triphosphate 6 hydrolases 4 93.1 Glu114Lys 2/7 AT4G25630 FIBRILLARIN 2 (FIB2) Directs 2'-O-ribose methylation of the rRNA. Encodes a novel box C/D snoRNA, U60.2f

4 93.1 Ser340Asn 4/8 AT4G27870 Member of the family of vacuolar iron transporters (VIT) 4 92.79 Val1151Ile 19/23 AT4G19020 CHROMOMETHYLASE 2 (CMT2) DNA methyltransferase. Involved in heat tolerance

4 91.2 Ser317Leu 7/7 AT4G17860 Carboxyl-terminal proteinase-like protein

4 90.84 Ala335Thr 11/13 AT4G28706 Member of the pfkB-like carbohydrate kinases

RESULTS AND DISCUSSION

Table 3-5 Putative BZR1-BAMs interactors are encoded by genes affected by SNVs. Immunoprecipitation (IP) of BAM7 and BAM8 from plant extracts was coupled with mass spectrometry analyses and led to the identification of BZR1-BAMs putative interactors (Soyk, PhD thesis 2013). Grey cells: peptide found in the respective IP.

Line Frequ. ATG Gene name Protein function BAM7 BAM8 (%) 133 99.07 AT2G31810 ACT domain-containing small subunit of acetolactate synthase protein; Chloroplastic protein involved in the biosynthesis of branched chain amino acids

133 98.33 AT2G33240 ATXID, MYOSIN XI D, XID Member of Myosin-like proteins

133 92.78 AT1G05380 Acyl-CoA N-acyltransferase

133/ 92.04 AT1G05230 HOMEODOMAIN GLABROUS 2 Member of the IV family homeobox-leucine zipper, involved in trichome 144 (HDG2) development

173 85.07 AT4G23530 ROH1, putative (DUF793)

185 96.12 AT4G30360 CYCLIC NUCLEOTIDE-GATED CHANNEL 17 (CNGC17) Member of the family of cyclic nucleotide gated channels 185 92.79 AT4G19020 CHROMOMETHYLASE 2 (CMT2) DNA methyltransferase. Involved in heat tolerance

RESULTS AND DISCUSSION

Discussion BUP1 and BUP2 are well-established markers for the activity of the BZR1-BAMs as their deregulation was consistently identified in studies investigating the transcriptional responses to BZR1-BAMs constitutive overexpression or complete disruption (Reinhold et al., 2011; Soyk et al., 2014). More recently, ChIP-qPCR experiments revealed that BAM8 binds directly to the BBRE motifs in their promoters consistent with a direct regulatory mechanism (Dankwa-Egli, PhD thesis 2017). Due to this tight, demonstrated link between the BUP genes and BAM8, their promoter regions were chosen as the basis for the creation of the reporter line used in my forward genetic screen described here. In addition to containing three BBRE motifs, searching the Arabidopsis cis-regulatory element database (http://arabidopsis.med.ohio-state.edu/AtcisDB/) revealed that BUP2 promoter hosts several potential TF binding sites, among which the ABA response element-like (ABRE-like), the auxin response factors (ARF) element and regions recognized by bZIP, homeobox, GATA, basic helix-loop-helix, or WRKY TFs. The presence of these binding motifs has implications for the forward genetic screen. On one hand, it leaves room for the unwanted discovery of mutants impaired in pathways unrelated to BZR1-BAMs. On the other hand, it could provide insight into the action of BAM8 in the framework of its true genetic interactions with other TFs that collectively determine the responses to internal and environmental cues. Thanks to previous studies from our laboratory, we know that BZR1-BAM action is antagonistic to that of BRs, that they participate in responses to shade, and that the metabolic status of the plant, that dynamically modifies the level of the putative ligand, may impact on their function (Reinhold et al. 2011; Soyk 2013 and Dankwa-Egli 2017 PhD theses). This suggests that BZR1-BAMs are part of a larger network of proteins collectively determining plant development. It is easy to envision a wealth of factors potentially fine-tuning their activity as transcriptional regulators, from proteins of carbohydrate metabolism to post-translational modifications enzymes, which are likely mechanisms of regulation of these proteins given the seemingly constant levels their gene expression. Thus, it may be challenging in most cases to pinpoint the exact EMS-induced mutations causing enhanced luminescence phenotype through mechanisms involving the BZR1-BAMs. In the mutant lines I analysed, the number of detected SNVs was large and their distribution affected at high frequency more than a single genomic interval in most lines, and were within coding sequences, regulatory elements and intergenic regions. The apparent linkage between the phenotype and multiple genomic locations suggests genetic interactions occurring between the mutated loci that together contribute to the luciferase expression. The influence of different, secondary mutations on the observed phenotype could explain the gradation of luminescence observed in some populations which made scoring difficult and could explain why some of the segregation ratios

RESULTS AND DISCUSSION differ slightly from the expected values. Further rounds of backcrossing and segregation could help separate the SNVs and confirm whether their simultaneous presence is required for the enhanced luciferase expression. Similarly, allelism tests could help clarify the involvement of single genes in the observed phenotype. In two instances, lines BC133-1-1 and BC144-1-1, multiple SNVs had a frequency of 100 % in the populations, while a single SNV would be expected to be fixed in all individuals and the surrounding ones should occur at gradually decreasing frequencies as the distance from the fixed change increases. This observation introduces additional uncertainty in the attribution of the observed phenotype to mutation of a specific gene. However, it is remarkable that independently isolated lines carry different SNVs in the same two genes, hinting at their genuine contribution in regulating the expression of the BUP2 promoter reporter. Despite the fact that the SNV in AT1G05230 is not present in all plants of the two populations, the sequence variants in AT1G05230 and AT2G31870 may interact to give rise to the observed phenotype in those plants were they simultaneously occur. Indeed the BC1F2 segregation ratio for these two populations was lower than the expected for recessive mutations following a Mendelian distribution. However, the presence of additional sequence variants highly represented in the populations and affecting genes coding for transcription factors raises doubts about the true origin of the enhanced luminescence. Factors like HDG3, GATA11 (mutated in line BC144-1-1) and CLP3 (mutated in line BC133- 1-1) have the potential alone to determine the increased luciferase activity by regulating its transcription from the BUP2 promoter, synergistically or independently from the BZR1-BAMs. Interestingly, proteins encoded by a number of genes identified in this study were found to putatively interact with the BZR1- BAMs in a previous study (Soyk, PhD thesis 2013; Table 3-5), among these the TF HDG2. The same study identified other members of the HDG and GATA families (HDG6, GATA1 and GATA27) suggesting that TFs belonging to these lineages may work with the BZR1-BAMs to orchestrate gene expression, also from the BUP2 promoter that possesses binding sites for both kinds of TFs, as previously mentioned. Furthermore, the mutation in BSU, which dephosphorylates BES1 in the nucleus, thereby amplifying the BR responses (Mora-Garcia et al., 2004), might alone be responsible for the phenotype of line BC133-1-1, as BUP2 is negatively regulated by BRs and induced upon inhibition of this signalling pathway (Figure 3-1 B). To clarify whether the variants found in the mutagenized lines act via the BZR1-BAMs or affect general regulators of BUP2 expression, further work will be required. Crosses between bam8-1, bam7bam8 and positive M2 individuals have been generated, but to date, only the F1 generation was assessed for its luminescence phenotype (data not shown). The heterozygosity of this generation did not allow final conclusions because the luminescent signal was comparable to that of F1 individuals deriving

RESULTS AND DISCUSSION from a cross with the wild type used as control. The evaluation of the successive generations may allow one or the other possibility to be excluded. The change detected by the totality of the reads for line BC133-1-1 and BC144-1-1 falls in the coding sequence of Poly(ADP-ribose) glycohydrolase 1 (PARG1; AT2G31870). Poly(ADP-ribosyl)ation (PARylation) is a post translational modification that is added to aspartate (Asp), glutamate (Glu) and lysine (Lys) side chains by Poly(ADP-ribose) polymerases (PARPs), using NAD+ as a donor of ADP-ribose moieties, and removed by PARGs (Briggs and Bent, 2011; Heller et al., 1995). Despite being a well- established protein modification in animals, its role and targets in plants are just emerging. A recent study sought to broaden the number of known PARylated proteins in Arabidopsis by using a protein chip to detect the modification added in vitro by the most active PARP isoform, PARP2 (Feng et al., 2016). The experiment resulted in the identification of 54 PARylated proteins, 56 % of which localized to the nucleus, in agreement with the localization of PARP2 (Feng et al., 2015). Among the PARylated proteins, those involved in transcription, DNA/RNA metabolism, response to stresses, response to biotic/abiotic stimuli were enriched confirming the previous reported role of this PTM in gene transcriptional regulation, stress responses, DNA damage repair and chromatin modification (De Block, Verduyn, De Brouwer, & Cornelissen, 2005; Zhang et al., 2015). Neither BAM8 nor BAM7 were among the identified PARylated proteins, however, in the context of the present study, MS spectra of BAM8 were acquired in an attempt to characterize the protein phosphorylation (see section 3.2, below). The spectra were also analysed for the presence of peptides carrying PARylated residues, with a negative outcome. It is worth mentioning that the detection of PARylation is best achieved by use of a specific method involving NH2OH treatment of the protein sample. This generates hydroxamic acid derivatives of the modified Asp and Glu, later detect by a mass shift in MS spectra (Zhang, Wang, Ding, & Yu, 2013). Protein PARylation has been suggested to alter energy metabolism in plants, owing to its high NAD+ consumption (De Block et al., 2005). Presently, there is no evidence of the direct PARylation of BAM7 and BAM8. However, if further experiments substantiate the involvement of PARG1 in regulating the BUP2 promoter reporter, further investigation of this PTM would be warranted since it could still play a role in regulating BZR1-BAMs or other components in their signalling network, with impacts on the transcriptional output of their target genes. The luminescence phenotype of line BC185-2-1 was very clear and the chance of selecting false- positive individuals for the preparation of the bulk DNA sample was virtually zero. The ease of phenotype scoring probably explains the good fit of the segregation ratios in the M2 and BC1F2 populations with the expected models and contributed to the identification of a single SNV with a frequency of 100%, flanked

RESULTS AND DISCUSSION by less frequently occurring ones. This SNV introduces an amino acid exchange in the gene coding for the C-TERMINAL DOMAIN PHOSPHATASE-LIKE 1 (CPL1), an enzyme that removes phosphate groups from serines of RNA pol II heptapeptide repeats, thereby regulating transcription efficiency (Koiwa et al., 2004). In addition to being a general transcriptional regulator, CPL1 negatively controls responses to ABA, cold and high salinity (Koiwa et al., 2002) and interacts with TFs involved in response to drought (Bang et al., 2008). BUP2 promoter contains ABRE-like motifs, hence the strong activation of luciferase expression could be explained by the general effect on RNA pol II and/or by the specialized negative influence on ABA responses. This model might reconcile the observation that most marker genes tested by qPCR in the present study are not up- or down-regulated as expected in line #185, with the exception of BUP1. It is interesting to note that CLP3, a CPL1 homolog that is also a negative regulator of ABA responses, also harbours a SNV in its coding sequence in line BC133-1-1 at a frequency of 95.58%. Here I showed that mutagenesis of the reporter line leads to a broad range of luciferase phenotypes, some of which can be assess with ease, thereby enabling to pinpoint a single sequence variant as likely causative of the observed luciferase signal. I have assessed the phenotype only of a portion of the generated M2 lines, the remaining ones represent a valuable source of genetic material to be explored for the identification of novel factors of the BZR1-BAMs signalling pathway. This will help expand our understanding of this system in the context of plant development. However, it is essential to develop and employ independent validations methods, such as the use of crosses with BZR1-BAMs mutants and knockout lines of the candidate genes, in order to achieve the desired specificity towards the BZR1-BAMs pathway.

RESULTS AND DISCUSSION

3.2 Study of the phosphorylation of BZR1-BAMs

Accurate and coordinated functioning of transcription factors is crucial to all aspects of plant life. To promptly fine-tune protein activity, post-translational modifications, rather than the slower gene expression control, are often utilized. To date, no evidence suggests transcriptional modulation of BZR1- BAMs. Rather it was hypothesized that their activity is modified by the availability of a sugar-derived ligand molecule that acts as a signal (Soyk et al. 2014; Dankwa-Egli, PhD thesis 2017). It is also reasonable to envision additional layers of regulation that would allow the BZR1-BAMs to integrate in the larger protein signalling networks. For instance the dynamic post-translational modification of the proteins could dictate protein-protein interactions or affect protein life span. Preliminary evidence for the phosphorylation of BZR1-BAMs was provided by previous studies conducted in our laboratory. I studied in more detail the phosphorylation of BAM8 and sought to understand how this PTM alters its activity and links its function to other signalling pathways that ultimately determine plant development. To this end, I used mass spectrometry to map BAM8 phosphorylated residues, performed in vitro and in vivo studies to address the involvement of CK2 in its modification and finally used whole transcriptome profiling of transgenic lines overexpressing BAM8 phosphorylation-impaired mutants to understand the crosstalk between BZR1-BAMs and other signalling pathways affecting plant growth.

BAM8 interacts with several kinases and is a phosphorylated protein Gene transcription requires the participation of a wealth of interacting proteins. To investigate the interactions required for BAM7 and BAM8 function, the proteins were previously isolated from Arabidopsis cell culture together with their respective partners using immunoprecipitation followed by mass spectrometry to investigate the sample composition (Soyk, PhD thesis 2013). Several protein kinases were found to interact with BAM8, suggesting that phosphorylation might modify this TF. Furthermore, a BAM8 phosphorylated peptide was also identified. Additional hints for the occurrence of PTMs on BAM8 came from the repeated observation of a protein doublet or smear on immunoblots performed with protein extracts from plants grown under different conditions, suggesting the coexistence of multiple proteoforms. To test whether phosphorylation was the PTM causing the smear, nuclei were isolated from 2 week-old wild-type seedlings, yielding a relatively high concentration of BAM8, and incubated with recombinant Lambda Protein Phosphatase (λPPase), with or without phosphatase inhibitors. When the

RESULTS AND DISCUSSION enzyme was allowed to act on its substrates, BAM8 proteoforms appeared to be reduced to a single protein species as indicated by the disappearance of the higher molecular weight band. Inhibition of the phosphatase activity resulted in a similar smear to that observed for the untreated sample (Figure 3-5), further suggesting that the phosphatase activity is responsible for removal of the protein modifications. Next, I mapped BAM8 phosphorylation sites using tandem MS analyses. A line over-expressing YFP-tagged BAM8 was grown for 4 weeks in 12 h photoperiod and rosettes harvested in the morning. BAM8 was immunoprecipitated using anti-GFP antibodies. The sample complexity was further reduced by separating the antibody-bound fraction on a polyacrylamide gel and excising the band enriched in BAM8, which was subsequently prepared for LC-MS analyses. Proteins were digested with trypsin, or with a combination of trypsin and chymotrypsin to obtain greater coverage of the protein sequence. Peptides were either directly analysed or an additional step was performed that made use of magnetic beads coated with titanium dioxide to enrich the sample in phosphorylated peptides. The software Mascot (http://www.matrixscience.com/) was used to match the identified peptides with the Arabidopsis proteome and to attribute phosphorylation probabilities to individual residues. The experiments revealed six phosphorylated peptides (Table 3-6), within which multiple residues carried phosphate groups. The close vicinity of serine and threonine residues within the detected peptides hampered the unambiguous location of the PTM to a single amino acid, however the highest and most recurrent position was considered the most probable in vivo (Table 3-6), although multiple residues could coexist or be alternatively phosphorylated. When matching position within the amino acid sequence and degree of conservation (as derived from the alignment of 27 BAM8 orthologues; Soyk et al. 2014) of the phosphorylated residues, it became apparent that all modified residues lie in the TF domain and that both highly conserved and more variable residues are affected (Figure 3-6).

Figure 3-5 BAM8 exists in different phosphorylation statuses. Nuclei extracted from 2 weeks-old wild type seedlings were treated with λPPase or λPPase in combination with phosphatase inhibitors. The presence of multiple BAM8 proteoforms was assessed using an anti-BAM8 antibody and inferred by the visualization of a protein doublet/smear.

RESULTS AND DISCUSSION

Table 3-6 Multiple BAM8 serine and threonine residues are phosphorylated in vivo. The first and last amino acid of each peptide are indicated following the numbering in the BAM8 protein sequence. Within the phosphorylated peptides, the underlined amino acids are alternatively or simultaneously phosphorylated as stated in the last column of the table. Experiments details: A – Whole trypsin digest; B – Phosphopeptide enriched-trypsin digest; C – Phosphopeptide enriched-trypsin digest; D – Phosphopeptide enriched-trypsin digest performed in solution; E – Whole trypsin and chymotrypsin digest.

Experiment Start – End Peptide sequence Residue in BAM8 amino acids ACDE 43 – 84 GFAAAAAAASIAPTENDVNNGNIAGIGGGEGSSGGGGGGGGK S74 or S75 AE 152 – 177 QSQQPNHVVQFPTRSIESPLSSSTLK T164 or S166 ABCDE 166 – 177 SIESPLSSSTLK S169 and S172 or S173 or S174 AC 166 – 181 SIESPLSSSTLKNCAK S169 and S172 ABCE 182 – 193 AAIESQQHSVLR S186 and S190 AC 198 – 218 LAPVSLDSIGIAESDHPGNGR S202, S205 and S211

CK2 interacts and phosphorylates BAM8 As anticipated above, several protein kinases were found among BAM8 interactors (Soyk, PhD thesis 2013). One of these was CK22 (AT3G50000), the catalytic subunit of Casein Kinase 2. BAM8 sequence analysis performed with the phosphorylation prediction tool NetPhos 3.1 (http://www.cbs.dtu.dk/services/NetPhos/; Blom et al., 1999) revealed that four sites are putative CK2 targets (Ser211 0.514; Thr367 0.547; Thr418 0.533; Ser483 0.512). Of these, only Ser211 was identified by the MS analyses. The others were located in the BAM domain, where no phosphorylated amino acid was found by the present work. Confocal microscopy was used to confirm BAM8 and CK22 subcellular co-localization. To this end, N. benthamiana leaves were infiltrated with suspensions of A. tumefaciens strains carrying BAM8-

Figure 3-6 Phosphorylation affects conserved and variable residues of BAM8. Conservation of the protein sequence of 27 BAM8 orthologues and location of the most probable phosphorylated residues (diamonds) as reported in Table 3-6. The TF and BAM domains are indicated by light grey bars. The dark grey bar within the TF domain, corresponding to the DNA-binding region, shows the portion of BAM8 most similar to the Arabidopsis BZR1 and BES1. Adapted from Soyk et al. 2014

RESULTS AND DISCUSSION

CFP or CK22-YFP expression vectors. As previously reported (Salinas et al., 2006), CK22-YFP accumulated in the nucleus, with a remarkable enrichment in the nucleolus and only a weak cytosolic signal. Similarly, BAM8-CFP localized to the nucleus, with only a small fraction present in the cytoplasm, but it remained excluded from the nucleolus (Figure 3-7 A). To substantiate the interaction between BAM8 and CK22 bimolecular fluorescent complementation (BiFC) was used. The proteins were fused to either halves of YFP and their interaction was inferred by the observation of YFP signal. Only when CK22 was attached to the N-terminal half of YFP was interaction with BAM8 observed, possibly due to an improper folding of the protein when tagged at the C-terminal. Previous studies implicated CK2 in the regulation of TFs involved in light responses, such as PIF1, HFR1 and HY5 (Bu et al., 2011; Park et al., 2008; Hardtke et al., 2000) and in the BR signalling pathway (Lin et al., 2015). This evidence coupled with the observations made within the present study suggested CK2 as a possible BAM8 modifier and encouraged me to further investigate the phosphorylation of BAM8 by CK2.

RESULTS AND DISCUSSION

Multiple BAM8 residues are phosphorylated by CK2 To confirm that BAM8 is a true CK2 target, in vitro kinase assays were performed using recombinant proteins. Validation of serine (S) 211 as a real CK2 target site, as suggested by the in silico prediction, was performed by using site-directed mutagenesis to substitute this amino acid with an alanine (A), whose side chain cannot be phosphorylated. The resulting BAM8 mutant (BAM8S211A) as well as the wild-type protein were incubated with the mammalian CK2 holoenzyme in the presence of radioactively labelled ATP ([-32P] ATP). Autoradiography of proteins separated by gel-electrophoresis revealed that BAM8 incorporates radioactive phosphate upon kinase treatment and that, despite a 67 % reduction of the radioactive signal, BAM8S211A is still phosphorylated. This suggests that Ser211 is a CK2 target, although not the only one. To assess the specificity of the mammalian kinase towards its target, the related BAM1

Figure 3-7 CK22 and BAM8 localize to the cell nucleus where they interact with each other. A. CK22 and BAM8 were transiently expressed as fusion proteins to YFP and CFP, respectively, in N. benthamiana leaves by infiltration with A. tumefaciens. The YFP and CFP channels are shown independently and merged with the bright field (BF). B. BiFC was used to assess CK22 interaction with BAM8. The first protein was fused to the N-terminal half of YFP (NYFP), while the second to the C-terminal (CYFP) and transiently co-expressed in N. benthamiana leaves by A. tumefaciens infiltration. The YFP channel is shown alone and merged BF.

RESULTS AND DISCUSSION protein, also known to be a phospho-protein in vivo (De La Fuente Van Bentem et al., 2008), was included in the assay as a control. It was not phosphorylated. To identify which of the serine and threonine residues of BAM8 react with an ATP-derived phosphate group in the presence of CK2, a pilot MS experiment (a single sample) of in vitro phosphorylated BAM8 was performed. MS analysis found six phosphorylated sites (Thr56, Ser172, Ser186, Ser205, Ser211, Ser483), among these, four (Ser172, Ser186, Ser205, Ser211) were also phosphorylated in vivo. To resolve ambiguities connected to the presence of more than one possible phosphorylation site on the same peptide, mutant versions of BAM8 were created in which different combinations of the latter subset of amino acids were substituted with alanine (Figure 3-8 B). A fifth residue (Thr164), which was phosphorylated in plant samples and predicted to be a CK2 target by a second in silico tool (KinasePhos 2.0, http://kinasephos2.mbc.nctu.edu.tw/predict.php; Wong et al. 2007) was also mutated. These phospho-mutant versions of BAM8 were expressed in and purified from E. coli and phosphorylated in vitro as described before. The experiment revealed that Ser211 is the major phosphorylation site, while the other residues contribute only to a lower extent to the total radioactive signal, with none of them being of major importance after Ser211 (Figure 3-8).

A B

Figure 3-8 CK2 phosphorylates multiple BAM8 residues. A. In vitro kinase assay was performed with recombinant HIS-tagged BAM8 proteins (legend: top right) and the mammalian CK2 holoenzyme. The reaction mix contained radioactive ATP as substrate for the phosphorylation reaction. Proteins were separated by gel electrophoresis, gel stained with CBB prior to be dried and coupled to an autoradiography film for radioactivity detection. A representative example is shown. B. Quantification of phosphorylation was achieved by measuring band densities of autoradiographs and stained gels with Fiji software and expressing their ratio relative to the wild-type BAM8 protein.

RESULTS AND DISCUSSION

I questioned whether lack of the major target site in BAM8S211A would cause phosphorylation at naturally non-target residues. MS analyses were used to address this: wild-type BAM8, BAM8S211A and BAM85A (designated B7 in Figure 3-8) were phosphorylated in vitro as described before and their phosphopeptides identified by MS. Residues that were modified in at least two out of three analysed biological replicates were considered real phosphorylation sites. Of the five mutations introduced in the BAM8 sequence, two (Ser164, Ser172) were not found in this experiment while Ser186 was only identified in one replicate of BAM8S211A. In the wild-type protein Ser52, Thr56, Ser74, Ser75, Ser205 and Ser211 were phosphorylated. Lack of Ser211 in BAM8S211A led to the additional phosphorylation of Ser483, which was found also in wild-type BAM8 in the previous experiment. Mutation of five residues in BAM85A did not cause phosphorylation of additional sites. These experiments led me to conclude that Ser211 is the major CK2 target and that the other phospho-residues found in vivo may be modified at lower efficiency. It cannot be excluded that the phosphorylated residues found in vitro but not in planta would be modified in conditions different from those tested within this study.

In protoplasts CK2 seems not to modulate BAM8 TF activity Phosphorylation affects TFs in many ways. To assess whether modification of Ser211 has an impact on BAM8 TF activity, transactivation assays (TAAs) were performed. BAM8 wild-type and two Ser211 mutant versions were overexpressed in Arabidopsis mesophyll protoplasts (Yoo et al., 2007). The mutations exchanged Ser211 either with an alanine, as introduced above, or with a glutamic acid (E), whose side chain carries a negative charge expected to resemble that of a phosphate group. Together with the effectors, a reporter construct and a transfection control were introduced in bam7bam8 mutant protoplasts. Measurements of the enzymatic activity of the reporter and transfection control showed no significant differences between the mutated TFs and the wild-type isoform (Figure 3-9 A). To assess whether the transcriptional output correlated with the TFs expression levels, the protein abundance was assessed by immunoblotting of protoplasts extracts (Figure 3-9 B). The wild-type protein and BAM8S211E were expressed to the same level, while BAM8S211A was slightly more abundant, but this was not reflected in the TF activity. To complement this experiment, the transcriptional activity of BAM8 wild-type protein was tested in the presence of CK22. This time TAAs were performed co-transfecting protoplasts with the TF and kinase expression vectors (Figure 3-9 C). The results indicated a slight decrease in the transcription of the reporter gene when BAM8 and CK2 were simultaneously transfected as compared to samples where BAM8 was expressed alone. However, immunoblotting of the effectors revealed reduced BAM8

RESULTS AND DISCUSSION levels in the co-transfected samples, while CK22 was not detectable (Figure 3-9 D). The catalytic subunit CK22 might not be sufficiently stable in the absence of other subunits assembled in the holoenzyme, thereby failing to contribute to the outcome of the assay. These observations suggest that the transcriptional output is likely to be caused by differences in effector expression rather than by the impact of the kinase on the function of BAM8.

Figure 3-9 Transactivation assays were performed in Arabidopsis protoplasts (bam7bam8 background) to assess the impact of phosphorylation by CK2 on BAM8 transcriptional activity. A. The effectors BAM8 wild-type (WT) and the mutant versions BAM8S211A (S211A) and BAM8S211E (S211E) were expressed with an N-terminal HA tag under the control of the CaMV35S promoter. Empty vector DNA was used as negative control (CTRL). The luciferase (LUC) reporter gene was driven by a minimal CaMV35S promoter fused to twelve repetitions of the BBRE motif, while the transfection control β-glucuronidase (GUS) was expressed by the constitutive UBI10 promoter. The experiment was repeated three times with comparable results. Each included three technical replicates of which the average ± SD is shown. Equal amounts of protoplast extract were pooled from the three technical replicates. Expression of the effectors was assessed by immunoblotting performed with an anti-HA antibody (BAM8 ~78kDa). B. TAA as described in A with the following differences: the amount of DNA transfected for the effectors was increased from 10 to 15 ng and equally divided between the two. For BAM8 and CK2 transfections equal amount of empty and effector vector were used. Expression of the luciferase reporter gene was driven by a minimal CaMV35S promoter fused to three repetitions of the BBRE motif (Reinhold et al., 2011). CK22 ~48kDa.

RESULTS AND DISCUSSION

Overexpression of phospho-impaired BAM8 mutants strongly affects plant development Although the protoplast system has proven useful and versatile to study a wealth of cellular process and responses (Yoo et al., 2007), it possesses some intrinsic limitations related to the artificial modification of the cellular environment, wherein only a small number of factors involved in a signal transduction pathway is overexpressed, thereby creating an imbalanced circuitry. Furthermore, this system is well suitable to test the response of TFs to their known DNA element, but it would miss alterations in the TF DNA-binding preference in case of mutations or supplied stimuli that change this property of the protein. For these reasons, the mutated versions of BAM8 tested in the TAAs were constitutively overexpressed the Arabidopsis bam8-1 mutant background to study their effects in planta (Figure 3-10). Several

Figure 3-10 Overexpression of BAM8S211 mutants causes impaired development of the plant rosette. A. Transgenic lines overexpressing (pCaMV35S) BAM8-YFP wild-type or mutated versions were grown on soil in 12 h photoperiod for 24 (top) and 32 (bottom) days. B. The level of expression of the BAM8-YFP was assessed by immunoblot of protein extracts of seedlings grown on synthetic medium for 8 days in 12 h photoperiod. For BAM8 detection an anti-GFP antibody was used. To control for protein loading an anti-actin (ACT) antibody was utilized. Genotypes as in A.

RESULTS AND DISCUSSION independent lines were generated for both variants and in Figure 3-10 A two are shown for BAM8S211E (#20-7 and #21-1) and one for BAM8S211A (#5-2). Surprisingly, the transgenic plants all developed similar phenotypes exhibiting small, compact rosettes with rounded and dark green leaves whose petioles were extremely short compared both to the wild-type accession Col-0 and to a line overexpressing the wild- type form of BAM8. The severity of the rosette phenotype correlated with BAM8 expression levels in both cases and was most pronounced in the early stages of growth. The plants remained dwarf throughout the life cycle, flowered late (Figure 3-10, Figure 3-11) and developed an extremely branched stem (bushy, Figure 3-12). Flowers were small and pollen production was scarce. The earlier flowers developed siliques in which a large proportion of seeds was aborted and only a small number of seeds was generated at the end of the flowering phase. At the first transgenic generation (T1) only two plants (out of 19 tested) expressing BAM8S211A to levels comparable to that of BAM8 wild-type, in the respective overexpressing

S211A line, could be isolated and one did not reach maturity. At the third generation (T3) of BAM8 #5-2 no descendent line was found to be homozygous for the transgene, however the seedling phenotype allowed

Figure 3-11 Overexpression of BAM8S211 mutants leads to an extended vegetative phase. Plants were grown in soil in 12 h photoperiod for 49 days. BAM8S211E#20-7 shows a milder phenotype comparable to the wild-type BAM8 overexpressor. However, elongation of one of the inflorescence stems (close up) is impaired as in the other two phospho-impaired lines.

RESULTS AND DISCUSSION to distinguish the individuals that did not carry any copy of it from the homozygous and hemizygous ones, and to a lesser extent, the latter two from each other. Only at the T4 generation, one plant was found to be homozygous for the transgene (BAM8S211A#5-2-8). Several of the traits observed for these lines are common to mutants impaired in BR biosynthesis, perception and responses, such as det2. This mutant is impaired in BR biosynthesis as DET2 expresses a steroid 5 α-reductases (Li et al., 1996). When grown in darkness det2-1 exhibits a de-etiolated phenotype, with a short, thickened hypocotyl, an open apical hook and expanded cotyledons. Later the plants are dwarfed, have an extended juvenile phase and show reduced male fertility (Chory et al., 1991). To assess whether the BAM8 phospho-impaired over-expressors development was also impaired during skotomorphogenesis, seeds were germinated and grown for 7 days in the dark (Figure 3-13 A). Wild-type

Figure 3-12 Bushy architecture of flowering plants overexpressing BAM8S211 mutants. Plants were grown in soil in 12 h photoperiod for 68 days. The wild type and BAM8 overexpressing plants have reached complete maturity at this stage.

RESULTS AND DISCUSSION plantlets showed the expected etiolated phenotype, characterized by elongated hypocotyls, close apical hook and pale cotyledons. Seedlings overexpressing the wild-type form of BAM8 did not significantly differ from wild-type ones, while those overexpressing BAM8 mutant versions had significantly shorter hypocotyls (Figure 3-13 B). To assess specific differences in growth at the root level and exclude a general elongation defect, the hypocotyl to root length ratio was calculated. This index was smaller for seedling expressing the mutated versions of BAM8 than for the wild type and BAM8 overexpressor, indicative of a greater root growth the in those genotypes. All other features did not change.

B C Col-0 Col-0 BAM8 BAM8 S211A S211A BAM8 #5-2-8 BAM8 #5-2 S211E S211E BAM8S211E#20-7 BAM8S211E#20-7 BAM8 #21-1 BAM8 #21-1

Figure 3-13. Overexpression of BAM8S211 mutants impairs hypocotyl and root elongation during skotomorphogenesis. A. Seeds were exposed to light for 4 h to synchronize germination and subsequently grown for 7 days in darkness on synthetic medium. B. Hypocotyl length of seedlings grown as in A. n≥25. Hinges of the boxplots show 25th and 75th percentile, whiskers indicate the maximum and minimum values, respectively. The median is reported within the box. a and b represent significant differences identified with Tukey-Kramer’s test with p<0.001; difference between c and d p<0.01. C. The ratio between the hypocotyl and the root length of single seedlings (n≥28) was calculated. Statistical differences were calculated and are shown as described in B. Difference between a and all other indices p<0.0001. Difference between b and d p<0.001; difference between c and d p<0.01. The experiment was repeated three times, similar results were obtained in all experiments, a representative example is shown.

RESULTS AND DISCUSSION

Overexpression of BAM8 phospho-impaired variants causes large transcriptional changes To gain more insight into the origin of the phenotypes observed for the lines overexpressing the BAM8 phospho-impaired mutants, their transcriptional profiles were studied by RNA sequencing (RNAseq). Previous transcriptional analyses investigating responses to BAM8 over-expression, or to the absence of both BZR1-BAMs, suggested a greater impact of BZR1-BAMs in young seedlings than in older rosettes: the number of genes deregulated and the magnitude of the changes were larger (Reinhold et al., 2011; Soyk et al., 2014). Furthermore, physiological experiments and analyses of the changes in gene expression suggested the involvement of BZR1-BAMs in responses to plant shading (Dankwa-Egli, PhD thesis 2017). For the RNAseq analyses conducted here, seedlings were grown in 12-h photoperiod on soil for 2 weeks. The plants were well-spaced so as to avoid shading. The aerial parts were harvested approximately 4 h into the light. To acquire robust data, two lines overexpressing BAM8S211E were analysed. However, for BAM8S211A, only a single viable line expressing this version of BAM8 at high levels was isolated, as mentioned above. Because the BAM8 phospho-impaired overexpressing lines resembled plants lacking a functional BR signalling pathway, the mutant det2-1 (Chory et al., 1991), was included in the analysis for comparison. Furthermore, a line overexpressing BAM8 TF domain but lacking its BAM domain (BAM8-N-OX, generated by Dr. Sebastian Soyk and described in Soyk et al. 2014) was also analysed. This line was previously shown to have a reduced rosette size, which was attributable to the enhanced, but less specific TF activity that affected a larger number of non-BBRE-genes compared to the wild-type BAM8 protein (Soyk et al., 2014). Analysis of BAM8-N-OX transcriptional profile led to understand the regulatory role of the BAM domain over the TF activity of BAM8. The BZR1-BAMs double mutant bam7bam8 and a line overexpressing wild- type BAM8 (BAM8) were also included in the transcriptional profiling experiment. It is worth mentioning that line BAM8S211A#5-2, used for the RNAseq experiment, was heterozygous for the transgene, thus seedlings used for the preparation of RNA samples were pre-selected based on their robust phenotype. The transcript levels of BAM8 in the transgenic lines differed only slightly and known BZR1-BAMs marker genes (see paragraph 3.1.4) responded in the expected direction (Figure 3-14 A). However, in the phospho-impaired mutants, BUP1 was expressed at slightly lower levels than BUP2, inverting their ratio compared to BAM8 overexpressor (Figure 3-14 A). Among all tested genotypes, the transcriptomes of the BAM8 phospho-impaired mutants showed the largest number of genes deregulated by at least 2-fold compared to the wild type (Figure 3-14 B). Changes occurred in both directions, but differences existed between the BAM8 mutant lines: in BAM8S211A#5-2 more genes were up than down-regulated, as in the

RESULTS AND DISCUSSION wild-type BAM8 overexpressor, whereas in both BAM8S211E-expressing lines, almost an equal proportion of genes changed in either directions, more similar to what observed for BAM8-N-OX (Figure 3-14 B). However, in contrast to BAM8-N-OX, which targeted genes independently of the BBRE motif (CACGTGTG), this 8-nucleotide element was highly enriched in the promoters of genes up-regulated by the BAM8 phospho-impaired mutants, as it was for those up-regulated by BAM8 (Table 3-7). This shows that the phospho-impaired mutant forms of BAM8 have retained their specificity, unlike BAM8-N-OX. The two shorter motifs embedded in the BBRE, the BRRE1 (CGTGTG) and the G-box (CACGTG), were more enriched in the promoters of genes up-regulated by the phospho-impaired mutants than in those up-regulated by wild-type BAM8. The G-box was also enriched in the promoters of genes down-regulated by the mutant BAM8 versions (Table 3-7).

A B

Figure 3-14 Over-expressors of BAM8 phospho-impaired variants show enhanced responses compared to the wild-type BAM8 over-expressor. A. Transcript levels of BAM8 and of the marker genes BUP1, BUP2, AT2G47560, AT1G09500, AT1G56150 expressed as log2 fold-change (FC) compared to the wild type (Col-0). B. Proportion of genes deregulated by more than 2-fold in the tested lines compared to the wild type. The actual number of genes is indicated within the columns.

RESULTS AND DISCUSSION

Table 3-7 BAM8 phospho-impaired mutants retain specificity towards the BBRE motif. The 50 most represented 6- and 8- nucleotide motifs within 1,500 bp promoter regions of genes either up or down-regulated (FC>2) in the tested genotypes were identified with RSAT oligo analysis tool (http://floresta.eead.csic.es/rsat; van Helden et al., 1998). Here the binomial probability of the occurrence, the e-value and the ranking of the BBRE, BRRE1 and G-box elements are displayed.

Up-regulated Down-regulated

Motif Genotype Occ. Prob. Occ. E-value Rank Occ. Prob. Occ. E-value Rank BAM8 4.4E-12 1.40E-07 2 BAM8S211E#20-7 2.5E-23 8.3E-19 1 BAM8S211E#21-1 6.6E-22 2.2E-17 2 BBRE BAM8S211A#5-2 2.6E-17 8.7E-13 6 BAM8-N-OX 1.60E-05 5.30E-01 46 bam7bam8 5.00E-08 1.70E-03 1 det2-1 BAM8 4.60E-14 9.60E-11 8 BAM8S211E#20-7 4.70E-22 9.70E-19 4 BAM8S211E#21-1 7.50E-23 1.60E-19 5 BRRE1 BAM8S211A#5-2 3.30E-26 6.80E-23 5 BAM8-N-OX 5.60E-06 1.20E-02 39 bam7bam8 4.00E-06 8.30E-03 12 det2-1 7.30E-06 1.50E-02 42 BAM8 1.40E-07 3.00E-04 19 3.90E-04 8.20E-01 30 BAM8S211E#20-7 2.80E-16 5.90E-13 8 3.00E-14 6.30E-11 3 BAM8S211E#21-1 5.30E-13 1.10E-09 14 2.10E-14 4.40E-11 3 G-box BAM8S211A#5-2 4.50E-17 9.30E-14 15 5.40E-08 1.10E-04 7 BAM8-N-OX 3.50E-06 7.20E-03 37 8.00E-07 1.70E-03 7 bam7bam8 9.20E-05 1.90E-01 49 1.10E-06 2.20E-03 10 det2-1 2.40E-12 4.90E-09 9 1.10E-04 2.40E-01 29

RESULTS AND DISCUSSION

Hierarchical clustering of genes deregulated by more than 4-fold in at least one of the tested genotypes showed that the transcriptional profiles of BAM8S211E#20-7 and in BAM8S211E#21-1 were the most similar to each other and also closer to BAM8S211A#5-2 than to any of the other genotypes (Figure 3-15 A). The greater number of genes deregulated in BAM8-N-OX and the larger magnitude of the changes rendered it closer to the BAM8 phospho-impaired mutants than were BAM8 and the double mutant. Despite a number of genes changed in the same direction in det2-1 and in the BAM8 transgenic lines (33 %), the BR mutant showed a distinct transcriptome and formed an own branch (Figure 3-15 A). The majority of the genes deregulated in the phospho-impaired mutants showed milder responses in BAM8, often below the threshold of 2-fold, however, when altered, their change was in the same direction (Figure 3-15 E-G).

RESULTS AND DISCUSSION

A B C

E F

G H

Figure 3-15 BAM8 phospho-impaired mutants are highly active transcription factors with similar transcriptional profiles. A. Hierarchical clustering of genes (n=1,303) deregulated by more than 4-fold in at least one of the genotypes (FDR<0.05). B. Scatter S211A plot of log2 fold-change values of genes deregulated by more than 2-fold compared to the wild type in BAM8 #5-2 or BAM8S211E#20-7 (n=2,452). R2 value of the linear correlation is indicated. C-G. Scatter plots of the comparison between the indicated genotypes as in B. Number of genes in the comparisons (n) are respectively: C. n=2,588; D. n=2,610; E. n=1,287; F. n=1,324; G. n=1,252.

RESULTS AND DISCUSSION

Despite the fact that the amino acid substitutions introduced in the BAM8 protein sequences were designed to mimic opposing phosphorylation statuses, the phenotype of plants overexpressing these BAM8 variants was very similar, as were the responses at transcriptional level, since most genes deregulated in all three lines and changed in the same direction (Figure 3-15 B-D). However, it should be noted that the total number of genes changed in BAM8S211A#5-2 was smaller than in BAM8S211E#20-7 and BAM8S211E#21-1 (Figure 3-14 B), probably owing to its lower expression level (Figure 3-14 A). In order to identify most relevant patterns that distinguish the tested lines, fold-changes larger than four were considered hereafter, unless otherwise specified. A number of genes (52) was deregulated only in BAM8S211A#5-2 and not in the other two lines. On the contrary, 16 genes simultaneously changed in BAM8S211E#20-7 and BAM8S211E#21-1 but not in BAM8S211A#5-2. To gain more insight into the effect of overexpressing the phospho-impaired versions of BAM8 and to study the differences that may exist between the two forms, gene ontology (GO) terms enriched among up- (Figure 3-16 A) or down-regulated genes (Figure 3-16 B) were identified for each line using the Panther classification system (http://go.pantherdb.org/; Thomas et al., 2003). Several terms related to light and hormonal responses were found (Figure 3-16). Surprisingly, among the genes up-regulated in all three genotypes, “response to absence of light” was overrepresented (Figure 3-16 A). On the other hand, the two lines overexpressing BAM8S211E seemed to respond to red and far red light by down-regulating genes involved in the respective response mechanisms (Figure 3-16 B). In addition, responses to UV-B

A B

Figure 3-16 Genes up- or down-regulated in the BAM8 phospho-impaired mutants are involved in responses to light and hormones. A. Fold enrichment of selected GO terms related to light and hormonal responses that were overrepresented among genes up-regulated by more than 4-fold in individual genotypes. p-value of the overrepresentation is indicated. B. As in A for down-regulated genes.

RESULTS AND DISCUSSION were also overrepresented among genes down-regulated in both lines, whereas “cellular response to blue light” and “negative regulation of photomorphogenesis” were enriched only in BAM8S211E#21-1. To corroborate these findings, public expression-profiling data, available through Genevestigator (https://genevestigator.com/gv/doc/intro_plant.jsp), were compared to the dataset generated within the present study. To this end, the 400 most deregulated genes (200 up-regulated and 200 down-regulated) in each genotype were used to create a sample signature that was then compared to the public data. Interestingly, for both BAM8S211E lines the most similar profile (of wild-type plants) derived from a study analysing responses of mature plants (35 days-old) to the exposure to extended darkness (72 h; Manhattan relative similarity for line #20-7: 1.48; line #21-1: 1.47) (Peng et al., 2015). Similarly, the closest profile to BAM8S211A#5-2 belonged to seedlings harvested 2 h into the dark period (Manhattan relative similarity: 1.60) (Rugnone et al., 2013). In contrast, the most different profile compared to all three genotypes derived from seedlings grown for 4 days in the dark and subsequently exposed to the light for 4 h (Manhattan relative similarity for line #20-7: 0.785; line #21-1: 0.783; line #5-2: 0.652) (Liu et al., 2013). Taken together, the GO term enrichment and the transcriptional signature analyses suggest the impairment of light signal perception in lines overexpressing BAM8 phospho-impaired versions, probably through changes in the metabolic status perceived via the BZR1-BAMs.

The transcriptional profiles of the BAM8 phospho-impaired lines resemble that of dark-grown plants The similarity found with Genevestigator between the transcriptional signature of the BAM8 phospho- impaired mutants and plants exposed to a prolonged period of darkness was based only on the most responsive genes (400 most deregulated genes). To investigate whether the identified trend extends to the larger transcriptional profile, the whole dataset derived from the same study (Peng et al., 2015) was retrieved and compared to the dataset generated by the present study. The comparison focused on the transcriptional profile of wild-type (Col-0) mature plants kept for three days in the dark against plants kept in regular short day conditions (8 h light, 16 h dark) for the same time. Growth in darkness elicited transcriptional changes greater than 4-fold of 2,087 genes, while only 994 showed the same magnitude of change in at least one of the BAM8 mutants. Of these, 186 genes were simultaneously deregulated in both datasets, corresponding to 18.71 % of the genes deregulated by BAM8 mutants, while only 6.26 %

RESULTS AND DISCUSSION would be expected by chance. Hierarchical clustering of the 186 shared genes was used to assess the directionality of the observed changes. The vast majority of the genes was regulated in the same direction (176 genes, 146 up-regulated, 30 down-regulated) whereas only 10 changed in opposite directions. Thus, extending the analysis to the whole transcripts profile confirmed the results previously obtained with Genevestigator and with the GO terms enrichment analysis, which found an overrepresentation of genes related to the absence of light among those up-regulated in the BAM8 phospho-impaired lines. These findings raise questions regarding the mechanisms that determine the observed transcriptional profile and the links to the pnlants phenotype.

A B

Figure 3-17 The high transcriptional activity of the BAM8 phospho- impaired mutants highlights the involvement of BAM8 in the regulation of genes that respond to an extended period of darkness. A. RNAseq analyses of 35 days-old wild-type plants kept for 3 days in darkness show transcriptional reprogramming (p<0.05, FC≥4) of 2,087 genes compared to plants grown in short day conditions. 18.71 % of the BAM8 phospho-impaired mutants- deregulated genes (FDR<0.05; FC>4, 186 genes) are among them. B. Hierarchical clustering of the 186 shared genes shows the parallel transcriptional response.

RESULTS AND DISCUSSION

Altered levels of trehalose 6-phosphate impose transcriptional changes that partly overlap with those of the BAM8 phospho- impaired lines Limitations in energy availability induce large alterations of the metabolic status of the cell due to the arrest of biosynthetic processes and the induction of photosynthesis and catabolic ones (Tomé et al., 2014). Within a few hours of the exhaustion of starch and the remobilization of sugars, plants that do not encounter favourable conditions begin to use alternative carbon sources, for instance by breaking down proteins and amino acids (Dietrich et al., 2011). The BZR1-BAMs, with their hypothesised sensor domain, may be involved in imposing a different growth program in such transitions, when sugars become limiting or are replenished. Despite the initial controversy about the role of trehalose 6-phosphate (Tre6P) in the cellular metabolism, it is now established that this disaccharide functions as a sugar signal to indicate the general carbon status (Lunn et al., 2014). It was shown that Tre6P levels correlate with those of sucrose and that in carbon-starved plants they are very low, while they promptly rise upon re-illumination at dawn (Lunn et al., 2006). I compared the transcriptional profiles of the BAM8 phospho-impaired mutants to that of a line possessing increased Tre6P concentrations. High Tre6P levels were obtained by overexpressing otsA, the E. coli trehalose 6-phosphate synthase, which converts UDP-glucose and glucose 6-phosphate in Tre6P (Zhang et al., 2009; Schluepmann et al., 2003). Overexpression of otsA causes transcriptional changes higher than 2-fold of 5,176 genes. While only 3,310 change to the same extent in at least one of the BAM8 phospho-impaired lines, 1,140 of these are shared. This represents 34.44 % of the deregulated genes in the latter lines, while 19.78 % would be expected by chance (Figure 3-18 A). Interestingly, the majority of the genes (727; cluster 1 and cluster 3; Figure 3-18 B) is regulated in opposite directions in the BAM8 phospho-impaired lines as compared with the otsA overexpression line. Recently, studies to identify the BZR1-BAMs ligand have been conducted in our laboratory. These experiments indicated that several phosphorylated sugars could bind to BZR1-BAMs, the most credible of which was Tre6P (Dankwa-Egli, PhD thesis 2017). In vitro experiments (surface plasmon resonance) showed that BAM8 affinity to the BBRE motif was reduced in the presence of Tre6P in a concentration- dependent manner, whereas in vivo (TAA experiments) and in silico (gene expression comparison of a core of BZR1-BAMs direct targets and the same otsA-OX and otsB-OX lines compared here) data was more suggestive of a positive correlation between Tre6P levels and BAM8 transcriptional activator function. This led to the proposal of a dynamic model whereby at high ligand concentrations, BAM8 frequently

RESULTS AND DISCUSSION associates and dissociates from the BBRE motif while activating gene transcription at high rate, probably through interaction with other as yet-unknown factors. On the contrary, when the ligand is scarce, BAM8 affinity for the DNA motif is increased, while its TF activity is reduced. The in vitro method used in the aforementioned study showed that BAM8 interacts more weakly with the BBRE motif as Tre6P is introduced in the system. In vivo, decreased rather than increased levels of Tre6P would be expected in plants after an extended period of darkness. Thus, it is possible to imagine that in plants with increased Tre6P levels, gene regulation would respond in a contrasting fashion to what seen for the BAM8 versions studied here. Despite the overlap between the genes deregulated in the BAM8 phospho-impaired lines and in otsA-OX is only partial, and despite the growth conditions of the plants differed substantially (otsA- OX seedlings were grown for one week in liquid culture in continuous light) it is interesting to note that the genes expressed in opposite directions are involved in biological processes induced upon energy stress to adjust growth to energy availability. Genes down-regulated in otsA-OX and up-regulated in the BAM8 phospho-impaired lines (Figure 3-18 B, cluster 1) seem to directly control responses to limited resources availability (“cellular responses to sucrose starvation” and “response to absence of light”), which results in the breakdown of carbon-rich molecules, such as proteins and carboxylic acids (“proteasomal protein catabolic process”, “protein ubiquitination” and “carboxylic acid catabolic process”) and general stress responses (“response to salicylic acid” and “response to oxidative stress”; Figure 3-18 C). Conversely, biological functions related to ribosomal biogenesis (“ribosomal large subunit biogenesis”, “ribosome assembly” and “rRNA processing”) and protein synthesis (“translation”) were enriched among genes up- regulated by Tre6P excess and down-regulated in the BAM8 phospho-impaired lines (cluster 3 Figure 3-18 B and Figure 3-18 D).

RESULTS AND DISCUSSION

A B

C D

RESULTS AND DISCUSSION

Figure 3-1819 Responses of the transcriptome of the BAM8 phospho-impaired lines mostly contrast those of plants possessing increased levels of trehalose 6-phosphate. A. Microarray analyses found 5,176 genes deregulated by more than 2-fold (p<0.05) in a line overexpressoverexpressinging the E. coli Tre6P synthase (CaMV35s:otsA) (Schluepmann et al., 2003; Zhang et al., 2009). Of the 3,310 genes deregulated by more than 2-fold in the BAM8 phospho-impaired lines, 34.44 % (1,140) are shared. B. Hierarchical clustering of the 1,140 shared targets results in 4 groups of genes. Cluster 1 (323) andand cluster 3 (404) are the largest and collect gengeneses regulated in opposite directions in the two experiments. Cluster 2: 219 genes; Cluster 4: 194. C-D. GO terms enrichment of genes in cluster 1 and cluster 3, respectively. p-value of the enrichment is indicated.indicated.

The same study (Zhang et al., 2009) analysed also the transcriptional profile of plants possessing reduced levels of Tre6P as a consequence of the overexpression of otsB (otsB-OX), the E. coli Tre6P phosphatase, which dephosphorylates Tre6P generating trehalose (Schluepmann et al., 2003; Zhang et al., 2009). As opposed to the large changes caused by the expression of otsA, in the transgenic otsB-OX line only 227 genes were deregulated by more than 2-fold. Of these, 70 were also deregulated to the same magnitude in at least one of the BAM8 phospho-impaired mutants, while only 22 would be expected by chance. Comparing the direction of the change by hierarchical clustering of the shared genes, revealed that also in this case the majority of the genes changes in opposite directions (49). This is a somewhat surprising observation. It might stem from the small number of genes globally deregulated in otsB-OX, and follows a similar trend to what observed when comparing the two transgenic lines with altered Tre6P levels with each other. GO term enrichment analysis was performed with genes belonging to the contrasting or converging groups, but no biological process was found to be overrepresented, again probably due to the limited number of genes considered.

RESULTS AND DISCUSSION

The fact that the mostly contrasting transcriptional profiles are those of the BAM8 phospho- impaired lines and the otsA overexpressor support my previous findings, deriving from the analysis of GO terms enriched among the genes deregulated in the transgenic lines, which suggested that BAM8 phospho-impaired lines’ severe phenotype is a consequence of an altered perception of energy availability, similar to what is experienced by plants suffering starvation and opposite to plants with an abundance of resources. Unexpectedly, also the overlap between the transcriptomes of otsB-OX and those of the BAM8 phospho-impaired lines tends to be in opposite directions, however, the restricted number of deregulated genes suggests caution in the interpretation of these results. A B

Figure 3-20 Reduced levels of Tre6P cause limited changes in the transcriptome of Arabidopsis seedlings, some overlap with those of the BAM8 phospho-impaired lines. A. Microarray analyses found 227 genes deregulated by more than 2-fold (p<0.05) in a line overexpressing the E. coli Tre6P phosphatase (CaMV35s:otsB) grown for 7 days in liquid medium (Schluepmann et al., 2003; Zhang et al., 2009). Of the 3,310 genes deregulated by more than 2-fold in the BAM8 phospho-impaired lines 70 are shared. B. Hierarchical clustering of the 70 shared genes.

RESULTS AND DISCUSSION

Shading causes transcriptional changes resembling those imposed by overexpression of the BAM8 phospho-impaired mutants Restriction in energy availability might be encountered by plants also when growing under the shade of competing vegetation (O’Hara et al., 2013). Under this situation, sugars levels decrease and with them also those of Tre6P, which was shown to have an impact on the responses to shading carried out through the TF PIF4 (Paul et al., 2010). Reduction in the ratio of red (R) to far red (FR) light, as well as reduction in the intensity of blue light elicits in plants the so-called shade avoidance syndrome (SAS) (Franklin, 2008; Pedmale et al., 2016). In nature, as a result of the light absorption or transmission by the overgrowing vegetation, plants under a closed canopy or in close proximity to neighbours experience a decrease in the red and blue wavelengths and an enrichment in far red light, in addition to a drop in photosynthetically active radiation (PAR). Perception of these changes in light quality and quantity activates a series of adaptive developmental responses to circumvent energy deprivation that include the upward reorientation of leaves and the elongation of organs such as the seedling hypocotyl, and, in mature plants, the leaf petiole and the stem internodes (Franklin, 2008). GO terms overrepresentation analysis revealed an enrichment of genes involved in responses to red and far red light among those down-regulated in both BAM8S211E lines and responses to blue light were part of the BAM8S211E#21-1 down-regulated profile. To investigate to what extent the transcriptional changes imposed by the overexpression of BAM8 phospho-impaired mutants resemble those triggered by shade, the transcripts profiles of the transgenic lines were compared to those of plants exposed to shade. Data generated by Nozue and colleagues, who studied the early responses to shade in leaves and shoot apexes of wild-type plants was used (Nozue et al., 2015). In that study, plants were grown for 17 days and exposed to simulated shade (neighbouring detection) for 1 or 4 h (white light supplemented with far-red light: R/FR of 0.5 and 80–100 μE PAR) and compared to plants kept in white light (R/FR = 1.9 and 80–100 μE PAR). The authors found 164 and 97 genes differentially expressed (FDR<0.001) compared to the control condition at the two time points, respectively, however they did not set a cut-off based on fold-change, probably owing to the small number of genes, thus also the following comparisons with the BAM8 mutants lines was performed irrespective of fold-change, but limited by significance.

RESULTS AND DISCUSSION

A B

C D

Figure 3-21 Overexpression of BAM8 phospho-impaired mutants deregulates a common set of genes that are involved in responses to shade. A. 6,336 genes changed significantly (FDR<0.05) compared to the wild type in at least one of the BAM8 phospho-impaired overexpressing lines. Of these, 452 were simultaneously deregulated by more than 4-fold in all three lines. B. GO terms enriched among the 452 genes commonly deregulated by the BAM8 phospho-impaired overexpressing lines. The four underlined terms were among the six also found for genes deregulated by 4 h shade treatment (Nozue et al., 2015). p-value of the enrichment is indicated. C. Hierarchical clustering of 95 of the 164 genes significantly changed by 1 h shade treatment that are also significantly deregulated (FDR<0.05) in at least one of the BAM8 phospho-impaired lines or BAM8. D. Hierarchical clustering of 63 of the 97 genes significantly changed by 4 h shade treatment that are also significantly deregulated (FDR<0.05) in at least one of the BAM8 phospho-impaired lines or BAM8.

Interestingly, in the aforementioned study, a GO terms enrichment analysis was performed and 95

RESULTS AND DISCUSSION the combination of terms identified for the 4 h time point closely resembled that found for genes simultaneously deregulated by more than 4-fold in all three BAM8 phospho-impaired lines (4 out of 6 terms; 452 genes; Figure 3-21 A and B). A fifth term, related to responses to auxin was found only among genes deregulated in the two BAM8S211E lines (198 genes; Figure 3-21 B), while responses to jasmonic acid were overrepresented among the genes down-regulated in both BAM8S211E lines (Figure 3-16 B). Indeed, when looking at genes differentially expressed after 4 h shading and in white light, 65 % of them (63 out of 97) were also significantly changed in at least one of the BAM8 phospho-impaired lines (10 genes would be expected by chance), while 54.3 % (89 out of 164; 16 genes expected by chance) overlapped with the 1 h treatment. Among the 97 genes differentially expressed upon 4 h shade treatment, the majority were induced (FC>2, 85 genes) rather than repressed (FC<-2, 12 genes) and the same trend was true upon 1 h shading (29 down- and 131 up-regulated). Hierarchical clustering of the 63 shared genes revealed that 34 and 7 genes were up and down-regulated in all conditions, respectively. However, 17 genes were regulated in opposite directions by shade and overexpression of the BAM8 phospho-impaired mutants and 5 had heterogeneous responses in the transgenic lines. Despite the smaller general overlap with the 1 h shade treatment (54.3 % of the genes), the direction of the deregulation supported more clearly the general trend depicted by the GO term enrichment analysis. This analysis took into account all down-regulated genes in the BAM8 mutants and found an over-representation of genes related to red and far red light responses. The genes shared with 1 h shading are mostly down-regulated in my transgenic lines (54 out of 89) and the majority of them was induced by the light treatment (42 genes). This suggests that the signalling cascade operated by the BAM8 mutants differs from the initial responses triggered early by shade, while later effects, that are more representative of the plants downstream adaptive response, tend to be more similar. To shed additional light on the crosstalk between the BZR1-BAMs and shade signalling pathways, the BAM8 phospho-impaired mutants were exposed to conditions mimicking shade from neighbouring plants (high PAR, low R/FR) for 3 days after growth in white light for 5 days. As expected, wild-type (Col- 0) seedlings showed an elongated hypocotyl and cotyledons were oriented upwards compared to seedlings continuously grown in white light (Figure 3-22). Compared to the wild type, BAM8 showed a milder hypocotyl response to shading, however the cotyledon movement seemed similar or even more pronounced. Strikingly, the BAM8 phospho-impaired lines did not show any hypocotyl elongation compared to non-shaded seedlings, and, even though differences were not statistically significant, the hypocotyl of seedlings grown for three days in shade tended to be slightly shorter. This experiment indicates that BAM8 phospho-impaired lines are unresponsive to shading, at least at an early stage of

RESULTS AND DISCUSSION growth, and paired with the transcriptional profile of these mutants suggests a role for the BZR1-BAMs in attenuating the growth responses to this light condition.

Col-0 BAM8 S211A BAM8 #5-2-8 S211E BAM8 #20-7 S211E BAM8 #21-1

Figure 3-22 BAM8 phospho-impaired mutants are affected in the hypocotyl response to shade. A. Seedlings were grown on synthetic medium for 5 days in white light (WL; 150 μmol photons/m2/s, R/FR: 1.01) in 12 h photoperiod and subsequently exposed for 3 days to a neighboring detection treatment (150 μmol photons/m2/s R/FR: 0.20). B. Hypocotyl length of seedlings grown as in A. n≥27. Hinges of the boxplots show 25th and 75th percentile, whiskers indicate the maximum and minimum values, respectively. The median is reported within the box. a-d represent significant differences identified with Tukey-Kramer’s test with p<0.0001. The experiment was repeated twice with similar results.

RESULTS AND DISCUSSION

Discussion 3.2.10.1 BAM8 is a multi-phosphorylated protein BZR1-BAMs are TFs whose hypothesized role is to directly link information regarding the availability of carbon resources, in the form of soluble sugars, to the developmental program of the plant, in which cues dictated by hormonal signals play a fundamental role. This task would be carried out by the BZR1-BAMs through their remarkable protein structure: on the one hand, the TF domain, by virtue of its similarity to the brassinosteroids TFs BZR1 and BES1, leads to the antagonistic regulation of genes controlled also by this hormone; on the other hand, the BAM domain is proposed to act as a sugar sensor, binding a sugar ligand - possibly Tre6P (Dankwa-Egli, PhD thesis 2017). However, it is very likely that the BZR1-BAMs require interacting proteins to perform their role. Such factors may be other transcriptional regulators or proteins that could modulate their function through post-translational modifications and/or by fine- tuning their stability, thereby determining precisely the context of their action. Amongst the multitude of proteins that were found to putatively interact with the BZR1-BAMs were several kinases (Soyk, PhD thesis 2013). Given the additional evidence for two or more BAM8 proteoforms on immunoblots, I tested and confirmed the idea that the BZR1-BAMs are phosphorylated proteins. The use λ protein phosphatase supported the idea that BAM8 is modified by phosphorylation, which was unequivocally demonstrated by tandem mass spectrometry. This showed that BAM8 was phosphorylated at multiple locations: six phosphorylated peptides were identified which included at least nine phosphorylated serine and threonine residues. Remarkably, all of them lay in the TF domain, but not in the most conserved part of it that is responsible for DNA-binding. It is this conserved part which has homology to the transcription factors BZR1 and BES1. Interestingly, a similar situation has been reported for these two proteins: the DNA-binding domain of both is not phosphorylated, although the adjacent C- terminal regions, which are not homologous to BZR1-BAMs, are phosphorylated (Kim and Wang 2010; http://phosphat.uni-hohenheim.de/; Heazlewood et al. 2008). Furthermore, the phosphorylation of BZR1 and BES1 was found to affect protein-protein interactions, cellular localization, protein stability, and affinity to DNA. It was shown that upon phosphorylation, interaction with DNA becomes weaker, and that the TFs are targeted for proteasomal degradation. Furthermore, through interaction with 14-3-3 proteins they are retained in the cytosol rather than being nuclear (He et al., 2002; Vert and Chory, 2006; Gampala et al., 2007). Here, I present evidence that suggests that through the action of the kinase CK2 BAM8 becomes phosphorylated with proposed impacts on the protein activity that will be discussed later. Previous studies hypothesized an interaction between BAM8 and members of the 14-3-3 proteins, with effects on its subcellular localization and TF activity (Soyk, PhD thesis 2013). A putative 14-3-3

RESULTS AND DISCUSSION recognition site containing Ser434 was identified. However phosphorylation of this amino acid, which is typically required for the interaction between 14-3-3 proteins and their client proteins, was not detected in the present study nor it was found in public databases. My attempts to substantiate the interaction between BAM8 and the 14-3-3 proteins through biochemical approaches were confounded by technical issues (data not shown). I was unsuccessful in obtaining native BAM8 proteins from plant extracts, preventing me from performing the experiments. Thus, this interaction remains as an intriguing hypothesis. The Arabidopsis phosphorylation site public database PhosPhAt was interrogated to assess whether other studies had identified similar or additional phosphorylated residues. Five studies reported phosphorylation of BAM8. Only one study investigating a transgenic line harbouring an inducible MAP kinase (Hoehenwarter et al., 2013), found a phosphorylated peptide that was not identified here. This peptide spanned amino acids Asp565-Lys582 within the BAM domain and included four phosphorylated residues (Tyr567, Ser568,Thr573, Tyr577). It is possible that the inducible line used in that study leads to the presence of a kinase activity to which BAM8 is not normally exposed. Alternatively, the different experimental conditions applied there may have trigged phosphorylation events that did not occur in our hands. It should also be noted that the detection of phosphorylated peptides with the MS methods used here requires large quantities of relatively pure protein samples. Therefore, the plant extracts used for the phosphoproteomics experiment were obtained from a BAM8 overexpressing line (pCaMV35S:BAM8- YFP), rather than the wild type. Thus, I cannot exclude that some of the phosphorylation sites reported here occur as the result of the ectopic overexpression of BAM8. The more sensitive and quantitative methods available today, such as label-free quantification coupled with more efficient phosphopeptide enrichment techniques, may help resolve the spatial and temporal appearance of differently phosphorylated BAM8 proteoforms.

3.2.10.2 Hypothesized effects of BAM8 phosphorylation by CK2 The study of the phosphorylation sites of BAM8 was coupled with investigations regarding the kinases potentially targeting it. From the list of putative BAM8 interacting proteins, the most intriguing was CK2α2. This is one of the four catalytic subunits of Casein Kinase 2 that was already reported to be involved in the regulation of numerous transcription factors (Meggio and Pinna, 2003), including well known players of light signalling cascades (Bu et al., 2011; Hardtke et al., 2000; Park et al., 2008). Here, the interaction between BAM8 and CK2α2 was confirmed using BiFC. Which also allowed me to visualize the prevalent nuclear localization of the complex.

RESULTS AND DISCUSSION

In vitro phosphorylation assays confirmed that BAM8 can be phosphorylated by CK2 and it showed that the major target residue is Ser211, as substitution of this amino acid led to a reduction close to 70 % in radioactive phosphate incorporation used as the readout of the experiment. Nevertheless, this assay showed that multiple BAM8 residues can be modified by CK2, even after four additional amino acids, previously shown to be phosphorylated in plants samples, were substituted to prevent phosphorylation. My data suggests that when the recombinant protein is phosphorylated in vitro, the kinase targeted novel residues in addition to those found in the protein extracted from plants. These novel phosphorylation sites could be artefacts arising from the conditions of the assay and may not be modified in planta. That said, the preferred motif (S/T-X-X-D/E) of CK2 is highly similar across species (Meggio and Pinna, 2003), so the human enzyme used for the in vitro experiment may be expected to behave similarly to the Arabidopsis one. Indeed, a previous work examining CK2 phosphorylation of the Arabidopsis TF p23 came to similar conclusions both using the human and the maize enzymes (Tosoni et al., 2011). Nevertheless, to overcome this uncertainty, the recombinant Arabidopsis kinase could be used in future in vitro experiment. I attempted to purify this protein from transgenic E. coli strains, both using in-house generated expression vectors and clones obtained from an external laboratory (Dennis and Browning, 2009), but was unsuccessful. This is probably due to instability of the single subunits that may require the formation of a protein complex to be stable and functional. Conclusive statements regarding the in vivo phosphorylation of BAM8 by CK2 could be achieved using a combination of genetic and biochemical approaches: native BAM8 protein could be purified from CK2 mutants and directly analysed by MS. Several limitations would need to be overcome to enable this experiment. First, the quadruple knockout mutant of the CK2 catalytic subunits is inviable. As an alternative, a dominant-negative inducible line could be used (Moreno-Romero et al., 2008), or the triple knockout mutant, which still retains 70 % of the kinase activity, could be treated with the specific CK2 inhibitors 5,6-dichloro- 1-β -D-ribofuranosyl-benzimidazole (DRB) or heparin (Park et al., 2008). Second, it would be necessary to analyse the limited amounts of BAM8 protein obtained in this background with highly sensitive MS methods to allow sufficient coverage of phosphorylated peptides that, as mentioned previously, are difficult to detect. Transactivation assays in Arabidopsis protoplasts using BAM8 mutated at the major phosphorylation site (Ser211 to either alanine, which cannot be phosphorylated, or to glutamic acid, which is negatively charged like a phosphate group) or where BAM8 was co-expressed together with CK2α2 both yielded results that were indistinguishable from the control samples. While this could be interpreted to mean that phosphorylation at Ser211 is inconsequential for the plant, this seems unlikely considering the

100

RESULTS AND DISCUSSION impact these proteoforms have when stably expressed in plants (see below). There could be several reasons for the lack of response in the protoplast system. Recent spatio-temporal expression profiling experiments revealed that BAM8 transcript is more abundant in young leaves than in mature ones (Dankwa-Egli, PhD thesis 2017). The protoplasts used for the transactivation assays derive from expanded leaves, and it is possible that these cells lack some of the protein factors required for the modulation of BAM8 activity or that their abundance is insufficient to cope with abnormally high levels of BAM8, when expression is driven by the CaMV35S promoter. Such factors may include interacting proteins that respond to BAM8 phosphorylation (e.g. other transcriptional regulators) or additional BAM8 modifiers, such as other kinases, which may create the necessary environment for the CK2-mediated phosphorylation to exert its function. Indeed, it was shown that CK2 can phosphorylate its substrates either independently of pre-existing phosphorylated sites or after prior modification by other kinases that create the appropriate sequence determinants for its activity (St-Denis et al., 2015). It is plausible that this mode of action applies to BAM8, as numerous phosphorylation sites occur in close proximity within the TF domain (Table 3-6 and Figure 3-6), and that only the phosphorylation of all sites has a detectable effect. To test this hypothesis, different combinations of multiple residues could be mutated at the same time and the resulting proteins tested for their extent of residual phosphorylation by CK2, in addition to their activity, stability and other features commonly affected by phosphorylation. Regarding the co-expression setup used in the transactivation assays, it must be mentioned that although there are reports of the independent functioning of the CK2 subunits, two catalytic and two regulatory subunits typically assemble in a holoenzyme (Salinas et al., 2006). Expression of the single α2 subunit in protoplasts might not confer the required stability to the enzyme, which would also explain the inability to detect the kinase by immunoblotting (Figure 3-9 D). My attempt to circumvent limitations of the protoplast system and assess in vivo the impact of the CK2-mediated phosphorylation of BAM8 by measuring transcripts of BAM8 marker genes in the triple knockout mutant ck2α1α2α3 revealed no significant differences compared to the wild type (data not shown). However, as mentioned previously, this mutant still possesses substantial enzymatic activity, thus no conclusions could be drawn from this experiment.

3.2.10.3 Alterations of Ser211 create a constitutively dephosphorylates TF and give rise to similar plant phenotypes It is established that BZR1-BAMs play a role in determining plant development with consequences on the architecture of both shoots and roots (Reinhold et al., 2011; Soyk et al., 2014). Although the expression

101

RESULTS AND DISCUSSION of the BAM8 phospho-impaired mutants in protoplasts did not offer insight into the effect of BAM8 phosphorylation, their expression at the organismal level did. Both BAM8S211A and BAM8S211E when overexpressed in the bam8-1 background, gave surprising effects. Plants accumulating these protein variants at high levels showed severely compromised development throughout the life cycle. Size and colouring of the rosette, stature and architecture of the inflorescence stem, flowering time and seed set were affected. Unexpectedly, overexpression of both versions of BAM8 led to similar phenotypes, although the amino acid substitutions generated were meant to resemble opposing phosphorylation statuses. It is a common approach to introduce glutamic acid in place of serine or threonine to study the effect of their phosphorylation, as the negative charge of the acidic amino acid can reproduce the biochemical properties of a phosphate group (Dissmeyer and Schnittger, 2011). However, there is no guarantee that this protein sequence alteration will effectively mimic the phosphorylated proteoform; the strategy is unpredictable and needs to be assessed for each mutated protein. As an alternative to glutamic acid, the second negatively charged amino acid aspartate could be utilized. However, it is not infrequent that phosphorylation disruption and attempts to mimic its presence result in similar protein behaviours (Kanamaru et al. 1999; Aronsson et al. 2006), as seen here. It is probable that the carboxyl group of glutamic acid fails to reproduce the steric and chemical properties of a phosphate group, resulting instead in another constitutively dephosphorylated variant. The phenotype of the BAM8 phospho-impaired mutants, particularly the rosette morphology, appears to be a more extreme version of what observed in lines overexpressing the wild-type BAM8 gene. Substitution of Ser211 may result in increased transcription factor activity, although it is also possible that it increases protein stability: although BAM8 transcript levels in the overexpressing lines seemed lower than in the wild-type overexpressor (Figure 3-14 A), the protein abundance (Figure 3-10 B) was slightly higher. In vitro degradation assays utilizing plant extracts were performed to try and assess whether the mutated versions of BAM8 had altered stability. However, these experiments did not produce consistent results due to the natural tendency of the recombinant BAM8 protein to precipitate under a range of experimental conditions tested, making thus impossible to attribute a decrease of protein over time to proteasomal degradation (data not shown). However, in other cases it was shown that CK2 influences either positively (HFR1, HY5) or negatively (PIF1) (Park et al., 2008; Hardtke et al., 2000; Bu et al., 2011) the stability of transcription factors acting in light signalling pathways. Hence, this could still be the mechanism through which the kinase exerts its control on BAM8.

102

RESULTS AND DISCUSSION

3.2.10.4 The phenotype of BAM8 phospho-impaired lines suggests a role of BAM8 in signalling conditions of low resources availability The phenotype of plants overexpressing the BAM8 phospho-impaired versions resembles that of mutants impaired in the BR pathway, as the latter are dwarfed, with curled leaves, have reduced apical dominance and compromised male fertility (Clouse, 2011). However, some of these features are also characteristic of plants with altered energy sensing ability. The tps1 (Tre6P SYNTHASE 1) mutant has an embryo-lethal phenotype, but dexamethasone-induced transient expression of TPS1 enables the growth arrest to be overcome and seedlings can be established. However, these plants remain smaller throughout their life cycle; their flowers develop later than in the wild type from more highly-branched inflorescence stems and produce small siliques and aerial rosettes (van Dijken et al., 2004). Analogous observations were made also for weak TPS1 alleles that were not embryo-lethal, but affected vegetative growth and transition to the reproductive phase (Gómez et al., 2010). Similarly, lines overexpressing KIN10 (Baena-González et al., 2007), one of the two SnRK1 kinase subunits involved in controlling responses to energy deprivation, develop small shoots and roots; later during development they show retarded flowering and senescence as opposed to wild-type plants. It is interesting to note that transgenic plants overexpressing the E. coli Tre6P synthase otsA, simulating conditions of resources abundance (Zhang et al., 2009), develop smaller, dark green leaves compared to wild type. Adult plants are bushy and early flowers produce a scarce number of seeds, except under continuous light (Schluepmann et al., 2003). The phenotype of these plants challenges the understanding of the physiological mechanisms underlying plant development; resource limitation would be expected to restrict growth, while their abundance is believed to enhance it. The observation that opposite extremes in Tre6P levels inhibit plant growth was reconciled in a model that takes into account an inhibitory effect of Tre6P on SnRK1 (Schluepmann et al., 2012). This model proposes that in heterotrophic tissues, increasing Tre6P levels derived from sucrose inhibits SnRK1, thereby enhancing anabolic metabolism and growth. As sucrose levels decrease, also those of Tre6P drop. At this point, SnRK1 activates responses to low resources availability that in turn trigger remobilization of carbon. As sucrose is made available again, SnRK1 will be inhibited and growth will proceed. In mutants with altered levels of Tre6P, the correspondence with carbon availability is lost, thereby uncoupling the resources response from growth. Taken together, the phenotype of the BAM8 phospho-impaired overexpressing lines suggests that the mutated forms of BAM8 impose transcriptional changes that make these plants behave similarly to energy-deprived ones. The activation of this developmental program might be the result of the regulation

103

RESULTS AND DISCUSSION of a set of genes that, in situations of high resources availability, are activated through the BR transcription factors BZR1 and BES1, while in times of resource limitation are the targets of BAM8. Of the 186 genes commonly deregulated by starvation and by the BAM8 phospho-impaired mutants (see section 3.2.7), 65 are high-confidence BZR1 direct targets (Sun et al., 2010). Indeed, it was proposed that an intact BR signalling pathway is required to achieve the positive effect of sugars on plant growth (Gupta et al., 2015a; Zhang et al., 2015b; Zhang and He, 2015; Zhang et al., 2016). Conversely, the BZR1-BAMs may be the effectors at the end of the “low energy signalling pathway”, while displaced from DNA at times of high ligand (i.e. Tre6P) concentrations, as suggested by in vitro protein-sugar-DNA interaction studies (Dankwa- Egli, PhD thesis 2017). In my transgenic lines, the high activity and/or abundance of the BAM8 proteins might create a dominant effect, overriding the regulation of the proteins normally achieved via the presence/absence of the putative ligand. This would confer the BAM8 phospho-impaired lines a phenotype similar to that of plants facing resource restrictions even under standard growth conditions. Such a model might explain features such as the drastic reduction in hypocotyl elongation of seedlings grown in darkness compared to wild type (Figure 3-13). Hypocotyl elongation in the absence of light is a well-known adaptive response of seedlings striving to reach the light before exhausting their stored resources. It was shown that the exogenous supplementation of resources in the form of low concentrations of sugars enhances hypocotyl elongation in the dark (Liu et al., 2011; Zhang et al., 2015; Zhang et al., 2016). It remains to be tested whether growth in sugar-containing medium in the dark induces hypocotyl elongation in my transgenic lines; no stimulation might be expected if the plants continue to perceived (wrongly) energy restrictions and therefore limit growth. Interestingly, a similar experiment (growth on a medium supplemented with glucose or sucrose) in conditions mimicking shade did not revert the reduced hypocotyl elongation of the BAM8 over-expressor that was observed when grown on sugar-free medium (Dankwa-Egli, PhD thesis 2017).

3.2.10.5 Transcriptional profile of BAM8 phospho-impaired lines corroborates the hypothesized role of BZR1-BAMs as effectors of the low-resources signalling pathway The transcriptome of the BAM8 phospho-impaired overexpressing lines confirmed the hypothesized nature of the plants phenotype at least at three levels. First, in the BAM8 phospho-impaired lines, a larger number of genes was deregulated compared to the wild-type BAM8 over-expressor, thereby showing that the introduced mutation led to enhanced transcriptional activity or stability of the proteins. Second, the transcriptional profile of the BAM8S211A line was similar to those of the two BAM8S211E lines tested,

104

RESULTS AND DISCUSSION consistent with phenotypic similarity of the respective plants. The mutated versions of the transcription factor retained a preference for the same DNA motif recognized by the wild-type form of BAM8 (BBRE). However, unlike the BAM8 and BAM8S211A lines, where the number of up-regulated genes was larger than those down-regulated, in the two BAM8S211E over-expressors, approximately the same proportion of genes changed in either directions. This difference could be attributed to the overall greater deregulation detected in the latter plants, which might have resulted in more secondary transcriptional effects. This is quite different from the behaviour of the line overexpressing the N-terminal portion of BAM8 that deregulates a larger number of genes compared to wild-type BAM8 irrespective of the presence of the BBRE in their promoters (Figure 3-14; Table 3-7; Soyk et al. 2014). Third, similar gene ontology terms were overrepresented among genes either up- or down-regulated in the BAM8 phospho-impaired lines. Firstly, were “responses to absence of light” and secondly were “responses to altered light conditions” (red, far red and blue light), all terms related to shading (Franklin, 2008; Pedmale et al., 2016). Obviously, the light conditions highlighted, when prolonged, will bring about low energy stress responses that lead to the phenotypes previously discussed and observed in my transgenic lines (Baena-González and Sheen, 2008). The high transcriptional output of the BAM8 phospho-impaired versions implies a role for the BZR1-BAMs in the regulation of genes responding to stress-inducing light conditions (i.e. darkness, shade). The recent study in which BZR1-BAMs activity was proposed to be modulated through interaction with Tre6P (Dankwa-Egli, PhD thesis 2017) also suggested that the BZR1-BAMs do not participate in the earliest responses to shade, but rather function later to limit growth in these light conditions. After the first elongation response, if growth is not down-regulated, it would probably lead to excess energy consumption with detrimental effects. Function of the BZR1-BAMs in a second layer of responses to shade is in agreement with the slightly higher similarity between the transcriptional profiles of the BAM8 phospho-impaired lines and that of plants exposed to shade for four hours rather than for one (Figure 3-21). The longer shading would affect the metabolic status of a wild-type plant to a larger extent, thereby reducing the levels of the putative ligand and in turn having a greater impact on the BZR1-BAMs activity. A role for the BZR1-BAMs in limiting growth also in shade conditions is suggested by the reduced hypocotyl length of seedlings grown in low R/FR light (neighbour detection; Figure 3-22).

3.2.10.6 Cross-talk between the BZR1-BAMs and known energy-sensing signalling pathways Comparison of the transcripts profiles of BAM8 phospho-impaired over-expressors to those obtained by studies investigating responses to altered resources availability (Tre6P levels) or changing light conditions

105

RESULTS AND DISCUSSION can help understand the cross-talk between the BZR1-BAMs signalling pathway and others pathways linking the use of resources and plant development. This strategy proved useful to shed light on the roles of factors that are now considered as central regulators of energy utilization (e.g. KIN10, Tre6P, TOR; Baena-González et al. 2007; Zhang et al. 2009; Tomé et al. 2014). My comparative transcriptome analyses showed that among the BZR1-BAMs targets is a set of genes similarly regulated during starvation (growth in darkness for three days; Figure 3-17), while an inverse correlation exists for genes deregulated by increased concentrations of Tre6P (Figure 3-18). A comparison between the profiles of the BAM8 phospho-impaired lines and plants with low Tre6P concentrations gave only a small overlap, this was probably due to the limited number of genes deregulated in the latter line (Figure 3-20). Transactivation assays performed to try and study the in vivo effect of Tre6P on BAM8 led to the hypothesis that it positively influences the BAM8’s TF activity. However, this was inconsistent with the in vitro analyses showing enhanced dissociation from DNA upon Tre6P administration (Dankwa-Egli, PhD thesis 2017), confusing the interpretation of the mode of action of Tre6P on the BZR1-BAMs. The correlation between the gene expression profiles of the BAM8 phospho-impaired lines studied here and plants altered in the perception of energy availability, together with the phenotypical observations, argue for a role of the BZR1-BAMs in the signalling cascade that leads to adaptation to low resources availability. The link connecting these pathways would be the proposed ligand Tre6P, whose levels correlate positively with photosynthetic capacity and decrease at the end of the night, becoming soon depleted in extended darkness (Lunn et al., 2006). Tre6P would negatively regulate DNA binding of the BZR1-BAMs, thereby diminishing their transcription factor activity. Interestingly, it was shown that Tre6P inhibits SnRK1 in vitro and that in vivo an intermediate factor is required to exert the same effect (Zhang et al., 2009). More recently, it was hypothesized that the two effectors function through independent but converging pathways (Lunn et al., 2014). However, it was seen that the gene expression profile of a transgenic line expressing otsA and possessing elevated Tre6P levels, correlated negatively with the genes deregulation imposed by KIN10, a catalytic subunit of SnRK1, substantiating the antagonism (Zhang et al., 2009). Similarly, the transcriptional targets of TOR, the kinase that controls resources allocation when they are abundant, are regulated in a largely opposing direction by SnRK1 (Tomé et al., 2014; Zhang et al., 2013a).

106

CONCLUSIONS

4 CONCLUSIONS

The hypothesis that BZR1-BAMs play a role in the perception of the metabolic status of the cell, binding a sugar signal and acting as a TF to regulate gene expression and activate adaptive strategies is broadly consistent with the findings of my research. My results broaden our knowledge of the signalling pathway culminating in the BZR1-BAMs and expand our understanding of their function in the context of plant growth. Even if many questions remain unanswered, the context of BZR1-BAM function becomes clearer. Furthermore, my forward-genetic screen, despite having analysed only a handful of mutants, has already led to identification of putative factors that might influence the BZR1-BAMs and their transcriptional output. Inevitably, classical genetic approaches with mutagens like EMS introduce a large number of single nucleotide variants (SNVs) into the genome, and it has not yet been possible to define unequivocally those that are implicated in modulating expression via the BZR1-BAMs. Genetic complementation and the isolation of additional mutant alleles in the best candidate genes will be required. Nevertheless, in three of the mutagenized populations interesting loci were found that are worthy of further investigations. Remarkably, in two of the mutagenized populations different mutant alleles were found to simultaneously affect a pair of genes (AT1G05230 and AT2G31870). Odds of this happening by chance seem rather small, hinting at a genuine function of one or both of the two genes within the BZR1-BAMs signalling pathway. Additional evidence reinforces this idea; for example, the transcription factor HDG2 (HOMEODOMAIN GLABROUS 2, encoded by AT1G05230), together with another member of the same TFs family, was found in a previous study to putatively interact with BAM8 in vivo (Soyk, PhD thesis 2013). Thus, TFs of this class may function together with the BZR1-BAMs. The protein encoded by the other gene, is PARG1 (POLY(ADP- RIBOSE) GLYCOHYDROLASE 1, AT2G31870), an enzyme involved in the dynamic PARylation (poly(ADP- ribosyl)ation) of proteins. This PTM was reported to control several classes of nuclear proteins and is activated by abiotic stresses, such as drought, high light and heat (De Block et al., 2005). PARylation is

+ mediated by poly(ADP-ribose) polymerases (PARPs), using NAD as the donor of ADP-ribose moieties (Heller et al., 1995). It is tempting to speculate that PARylation might directly modify the BZR1-BAMs, thereby enhancing their activity upon stress. Malfunctioning (or complete lack) of PARG1, that removes ADP-ribose polymers from target proteins, caused by the EMS-induced mutation, would be responsible for the increased reporter expression observed in the mutagenized populations. It is possible that the two aforementioned loci need to both be mutated to observe a substantial effect on BAM8 TF activity. It is imaginable, albeit highly speculative, that PARylation modifies the

107

CONCLUSIONS interaction between BAM8 and HDG2, and mutation in the second factor further enhances the positive effect on transcription. However, it is currently not possible to assert what kind of influence the detected SNVs would have on the respective protein functions. Genetic analyses of knockout lines of both genes, and their combination with genotypes altered in BZR1-BAM may help clarify the putative interplay. In a third mutagenized line, a mutation was identified in the gene encoding C-TERMINAL DOMAIN PHOSPHATASE-LIKE 1 (CPL1). The fact that CPL1 is known regulator of RNA pol II (Koiwa et al., 2004) discourages further investigations, as it suggests BZR1-BAMs-independent regulation of transcription. However, since CPL1 was also reported to negatively control ABA responses and interact with TFs in the drought-induced signalling cascade (Koiwa et al., 2002), further analysis may be worthwhile. A link between sugars and ABA has long been established: on the one hand, glucose has a positive effect on ABA synthesis and sensitivity (Arenas-Huertero et al., 2000; Cheng et al., 2002), while on the other hand, increased Tre6P levels confer glucose and ABA insensitivity (Avonce et al., 2004). It might be that there is a convergent effect of CPL1 and Tre6P signalling in regulating responses to ABA and/or sugars through the BZR1-BAMs. Further potential links connect BZR1-BAMs and ABA signalling; the BAM7 promoter contains an ABRE-like element, and preliminary evidence suggests the bam7 mutants have a reduced sensitivity to drought (Simkova and Zeeman, unpublished observations) - the opposite to the phenotypes of ABA deficient and insensitive mutants (Koornneef et al., 1982, 1984). Again, at present it is unclear whether the amino acid substitution in CPL1 has a positive or negative effect, so the mechanism underlying the activation of the reporter gene needs further assessment. Crosses between the bam7bam8 knockout mutant and the mutagenized line could be analysed to see if the expression of the reporter gene is BZR1- BAMs-dependent. If so, the link between CPL1 and the BZR1-BAMs should be investigated in more details. Further mining of the mutagenized population I generated is also a way to confirm or refute the candidate proteins identified thus far, since it should contain additional alleles with the same phenotype, as well as being a potential source for the discovery of novel factors implicated in the BZR1-BAMs signalling pathway. In theory, it should also contain mutants affecting some of the other proteins that were identified in independent approaches, particularly those controlling BAM8 phosphorylation, which appears to be an important mechanism controlling its function. The biochemical approaches (tandem MS, in vitro phosphorylation assays) I applied in this study revealed that BAM8 is a phosphoprotein and propose the kinase CK2 as one of the enzymes responsible for the protein modification. While I summarised some of the difficulties in creating CK2 null mutants, the range of mutations caused by classical genetics could still provide independent evidence to corroborate my hypothesis.

108

CONCLUSIONS

The in planta stable overexpression of mutated versions of BAM8, where the major CK2 phosphorylation site (Ser211) cannot be modified strongly supports the idea that BAM8 is negatively regulated through phosphorylation (Figure 4-1). The mutant is either more stable or has enhanced TF activity. The strong impact of the overexpression of the phospho-mutant forms was demonstrated both by the growth phenotype and the transcriptome analyses. The suggested role for BZR1-BAMs is in activating a transcriptional responses in conditions of energy scarcity to limit growth and resources utilization. I propose that putative ligand, Tre6P, whose levels decrease when resources are limited (Lunn et al. 2006), negatively controls BAM8. This might work by lowering BAM8 affinity to DNA, as was shown recently in vitro (Dankwa-Egli, PhD thesis 2017), thereby down-regulating its target genes. When Tre6P levels are low, BAM8 would associate more stably with DNA and activate the expression of BBRE genes. This hypothesis is summarized in Figure 4-1. To validate the hypothesis that both phosphorylation and Tre6P have a negative effect on BAM8 it could be tested whether elevated Tre6P levels alleviate the developmental and transcriptional phenotype of the BAM8 over-expressors (using both the wild-type and phospho-impaired versions). This could be achieved generating crosses between the transgenic lines described here and otsA (E.coli Tre6P synthase) expressing plants. Alternatively, the transactivation ability of BAM8 could be tested in otsA derived protoplasts, to ensure the endogenous alteration of Tre6P levels and overcome possible misinterpretation of the results owing to differential transfection efficiencies and/or levels of expression from different constructs in protoplasts. It seems that post-translational modifications play an important role in the regulation the BZR1- BAMs, and it is realistic to imagine that other kinases target the BZR1-BAMs, as not all phosphorylation sites found in vivo were also identified in in vitro CK2-phosphorylated samples. Mining the results of large- scale studies investigating the targets of specific classes of kinases and phosphatases may give some clues. At the same time, further use of classical approaches such as in-gel kinase assays coupled with protein identification by mass spectrometry may offer new answers. Existing data from protein interaction studies may also serve to expand our knowledge of the protein network that functions with BAM7 and BAM8. Presently, dedicated databases report little information, but targeted data generation (e.g. from plants grown in prolonged darkness, fed by exogenous sugars, and/or from mutant genetic backgrounds including those used or described herein), may be the trigger for a deeper understanding of BZR1-BAM function. A question regarding the differential phosphorylation of BAM7 and BAM8 remains unanswered. My work, together with other work on ligand binding has focused on BAM8, since it has measurable TF

109

CONCLUSIONS activity. Yet BAM7 is also implicate in transcriptional regulation, and the fact that its activity has not been directly detected could potentially be due to the fact that it too is regulated by phosphorylation or other PTMs. Currently little is known about a possible link existing between brassinosteroids and Tre6P, however a synergistic effect of glucose and BR on the growth of seedling in the dark was shown (Gupta et al, 2015a; Zhang et al. 2015; Zhang et al. 2016). It was also shown that exogenous glucose leads to enhanced Tre6P levels (Yadav et al., 2014), hence it is possible to imagine that BR exerts its growth- promoting role partly by binding to a set of genes that, in the dark and at low sugar levels, are oppositely regulated by BZR1-BAMs. When sugars are supplemented, thereby increasing the concentration of Tre6P, BZR1-BAMs would lose affinity for the BBRE motif, enabling the BR TFs to bind instead to the BRRE motif and repress those genes. This model would reinforce the idea of a cross-talk between BZR1-BAMs and BR occurring by competition for the DNA element that was previously proposed (Soyk, PhD thesis 2013) and links it with the phenotypes observed when exogenous sugars are supplied. It would be interesting to repeat such growth experiments in the absence of BZR1-BAMs. The emerging link between BRZ1-BAMs and Tre6P is clearly very exciting and, if substantiated, would represent an important step forward in the sugar signalling field. However, it is important to point out that signalling through BZR1-BAMs certainly cannot account for all of the phenotypes attributed to changes in Tre6P levels. Thus, it seems certain that other mechanisms for Tre6P perception exist, for instance to respond positively to its increasing levels rather than negatively, as proposed here for the BZR1-BAMs. Additional hints for the likely existence of Tre6P sensors besides BZR1-BAMs derive from phylogenetic analyses that date the appearance of genes encoding trehalose metabolism enzymes before the divergence of Chlorophyta and Streptophyta (Lunn, 2007), while a single ancestral BZR1-BAM seems to have first emerged in low land plants and then diversified into two distinct isoforms in angiosperms where they are widespread (Thalmann et al., unpublished). It is interesting to note that in green algae and in some species of low land plants trehalose was found to accumulate at high levels and function to protect cellular membranes and proteins during desiccation and osmotic stress (Bremauntz et al., 2011). Conversely, higher plants possess only very low concentrations (in the µM range) of Tre and Tre6P, with rare exceptions represented by few resurrection plants (Lunn, 2007). In higher plants Tre and Tre6P were detected only recently, after the annotation of the Arabidopsis genome revealed the existence of multiple Tre6P synthases, Tre6P phosphatases and a single trehalase genes and suggested that this disaccharide is part of plant metabolism, yet with a signalling role. It is tempting to speculate that the appearance of an

110

CONCLUSIONS ancestral BZR1-BAM in low land plants allowed a finer sensing of resources availability and consequently enabled a tighter regulation of development in those species where Tre6P acquired a more prominent signalling role. The divergence of the ancestral BZR1-BAM into two distinct clades (BAM7 and BAM8) in angiosperms and the preservation of two isoforms in most species might have played a role in the success of these plants, probably contributing to the regulation of growth during energetically expensive transition phases, such as flowering, where also Tre6P is implicated. It would be interesting to study the role of the BZR1-BAM transcription factor activity in those angiosperm species that possess only a single isoform (BAM7 or BAM8) or two copies of either one or the other (Soyk et al., 2014) and relate it to the Arabidopsis proteins, where BAM7 and BAM8 seem to have acquired different roles. This kind of comparative studies may shed additional light on the role of the BZR1-BAMs in the orchestration of plant growth and metabolism and may help clarify the function of BAM7 that still remains an elusive protein in Arabidopsis.

111

CONCLUSIONS

A B

NR CK2 ?

BAM8

BBRE

BBRE BAM7

BAM7 ?

P26S

C D

CK2 NR ?

BAM8 BAM8

BZR1/2 BZR1/2 BBRE BBRE ? BAM7 BAM7 P26S

E ?

PARG1 PARPs

HDG2 CPL1

Figure 4-1 Proposed mode of action of the BZR1-BAMs-mediated gene expression. A. Under conditions of low resources availability, as in darkness, the putative BZR1-BAMs ligand, Tre6P, is present only at very low levels. If the BZR1-BAMs are not phosphorylated, they can tightly bind the BBRE motif in the promoter of target genes and induce their expression. B. Phosphorylation of BAM8 (BAM8pS211), and possibly BAM7, by CK2 has a negative effect on their transcriptional activity, probably by modifying their stability, through the action of the proteasome 26S (P26S) or by mediating interaction with negative regulators (NR). C. When resources are abundant, the levels of Tre6P increase causing dissociation of the BZR1-BAMs from DNA, thereby reducing the expression of their target genes. The BBRE motif is then free to be bound by the BR TFs BZR1 and BES1 (BZR2) with a repressive effect. D. Phosphorylation of Ser211, added by CK2, may reinforce the inhibitory effect of high ligand concentrations and lead to complete repression of BZR1-BAMs target genes. Purple Diamond: Phosphorylation. E. Factors putatively involved in regulating the transcriptional output of the BZR1-BAMs.

112

REFERENCES

Ahn, C.S., Han, J.-A., Lee, H.-S., Lee, S., and Pai, H.-S. (2011). The PP2A regulatory subunit Tap46, a component of the TOR signaling pathway, modulates growth and metabolism in plants. Plant Cell 23: 185–209. Arenas-Huertero, F., Arroyo, A., Zhou, L., Sheen, J., and León, P. (2000). Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev. 14: 2085–9096. Aronsson, H., Combe, J., Patel, R., and Jarvis, P. (2006). In vivo assessment of the significance of phosphorylation of the Arabidopsis chloroplast protein import receptor, atToc33. FEBS Lett. 580: 649–655. Avonce, N., Leyman, B., Mascorro-Gallardo, J.O., Van Dijck, P., Thevelein, J.M., and Itu (2004). The Arabidopsis Trehalose-6-P Synthase AtTPS1 gene is a regulator of glucose, abscisic acid and stress signaling. Plant Physiol. 136: 3649–3659. Baena-González, E., Rolland, F., Thevelein, J.M., and Sheen, J. (2007). A central integrator of transcription networks in plant stress and energy signalling. Nature 448: 938–42. Baena-González, E. and Sheen, J. (2008). Convergent energy and stress signaling. Trends Plant Sci. 13: 474–482. Bai, M.-Y., Shang, J.-X., Oh, E., Fan, M., Bai, Y., Zentella, R., Sun, T.-P., and Wang, Z.-Y. (2012). Brassinosteroid, gibberellin and phytochrome impinge on a common transcription module in Arabidopsis. Nat. Cell Biol. 14: 810–7. Bang, W.Y., Kim, S.W., Jeong, I.S., Koiwa, H., and Bahk, J.D. (2008). The C-terminal region (640-967) of Arabidopsis CPL1 interacts with the abiotic stress- and ABA-responsive transcription factors. Biochem. Biophys. Res. Commun. 372: 907–912. Belkhadir, Y. and Jaillais, Y. (2015). The molecular circuitry of brassinosteroid signaling. New Phytol. 206: 522–540. Benayoun, B.A. and Veitia, R.A. (2009). A post-translational modification code for transcription factors: Sorting through a sea of signals. Trends Cell Biol. 19: 189–197. Bernardo-García, S., de Lucas, M., Martínez, C., Espinosa-Ruiz, A., Davière, J.M., and Prat, S. (2014). BR- dependent phosphorylation modulates PIF4 transcriptional activity and shapes diurnal hypocotyl growth. Genes Dev. 28: 1681–1694. De Block, M., Verduyn, C., De Brouwer, D., and Cornelissen, M. (2005). Poly(ADP-ribose) polymerase in plants affects energy homeotasis, cell death and stress tolerance. Plant J. 41: 95–106. Blom, N., Gammeltoft, S., and Brunak, S. (1999). Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 294: 1351–62. Bolger, A.M., Lohse, M., and Usadel, B. (2014). Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120. Bouquin, T., Meier, C., Foster, R., Nielsen, M.E., and Mundy, J. (2001). Control of specific gene expression by gibberellin and brassinosteroid. 127: 450–458. Bremauntz, M. del P., Torres-Bustillos, L.G., Cañizares-Villanueva, R.-O., Duran-Paramo, E., and Fernández-Linares, L. (2011). Trehalose and sucrose osmolytes accumulated by algae as potential raw material for bioethanol. Nat. Resour. 2: 173–179. Briggs, A.G. and Bent, A.F. (2011). Poly(ADP-ribosyl)ation in plants. Trends Plant Sci. 16: 372–380. Bu, Q., Zhu, L., Dennis, M.D., Yu, L., Lu, S.X., Person, M.D., Tobin, E.M., Browning, K.S., and Huq, E. (2011). Phosphorylation by CK2 enhances the rapid light-induced degradation of Phytochrome Interacting Factor 1 in Arabidopsis. J. Biol. Chem. 286: 12066–12074.

113

Caño-Delgado, A., Yin, Y., Yu, C., Vafeados, D., Mora-García, S., Cheng, J.-C., Nam, K.H., Li, J., and Chory, J. (2004). BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis. Development 131: 5341–5351. Chaiwanon, J., Wang, W., Zhu, J.-Y., Oh, E., and Wang, Z.-Y. (2016). Information integration and communication in plant growth regulation. Cell 164: 1257–1268. Chattopadhyay, S., Ang, L.H., Puente, P., Deng, X.W., and Wei, N. (1998). Arabidopsis bZIP protein HY5 directly interacts with light-responsive promoters in mediating light control of gene expression. Plant Cell 10: 673–683. Cheng, W.-H., Endo, A., and Zhou, L. (2002). A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signalling and abscisic acid biosynthesis and functions. Plant Cell 14: 2723–2743. Cheng, Y., Zhu, W., Chen, Y., Ito, S., Asami, T., and Wang, X. (2014). Brassinosteroids control root epidermal cell fate via direct regulation of a MYB-bHLH-WD40 complex by GSK3-like kinases. Elife 2014: 1–17. Cho, H. et al. (2014). A secreted peptide acts on BIN2-mediated phosphorylation of ARFs to potentiate auxin response during lateral root development. Nat. Cell Biol. 16: 66–76. Cho, Y.-H., Yoo, S.-D., and Sheen, J. (2006). Regulatory functions of nuclear Hexokinase1 complex in glucose signaling. Cell 127: 579–589. Chory, J., Nagpal, P., and Peto, C. (1991). Phenotypic and genetic analysis of det2, a new mutant that affects light-regulated seedling development in Arabidopsis. Plant Cell 3: 445–459. Clouse, S.D. (2011). Brassinosteroids. Arab. book, Am. Soc. Plant Biol. 9: e0151. Clouse, S.D., Langford, M., and Mcmorris, T.C. (1996). A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development. Plant Physiol 11: 671–678. Cohen, P. (2000). The regulation of protein function by multisite phosphorylation - a 25 year update. Trends Biochem. Sci. 25: 596–601. Dennis, M.D. and Browning, K.S. (2009). Differential phosphorylation of plant translation initiation factors by Arabidopsis thaliana CK2 holoenzymes. J. Biol. Chem. 284: 20602–14. Deribe, Y.L., Pawson, T., and Dikic, I. (2010). Post-translational modifications in signal integration. Nat. Struct. Mol. Biol. 17: 666–672. Dietrich, K., Weltmeier, F., Ehlert, A., Weiste, C., Stahl, M., Harter, K., and Dröge-Laser, W. (2011). Heterodimers of the Arabidopsis transcription factors bZIP1 and bZIP53 reprogram amino acid metabolism during low energy stress. Plant Cell 23: 381–395. van Dijken, A.J.H., Schluepmann, H., and Smeekens, S.C.M. (2004). Arabidopsis trehalose-6-phosphate synthase 1 is essential for normal vegetative growth and transition to flowering. Plant Physiol. 135: 969–977. Dissmeyer, N. and Schnittger, A. (2011). Use of phospho-site substitutions to analyze the biological relevance of phosphorylation events in regulatory networks. In Plant Kinases: Methods and Protocols, N. Dissmeyer and A. Schnittger, eds (Humana Press: Totowa, NJ), pp. 93–138. Dobrenel, T., Marchive, C., Azzopardi, M., Clément, G., Moreau, M., Sormani, R., Robaglia, C., and Meyer, C. (2013). Sugar metabolism and the plant target of rapamycin kinase: a sweet operaTOR? Front. Plant Sci. 4. Domagalska, M.A., Schomburg, F.M., Amasino, R.M., Vierstra, R.D., Nagy, F., and Davis, S.J. (2007). Attenuation of brassinosteroid signaling enhances FLC expression and delays flowering. Development 134: 2841–2850. Duan, K., Li, L., Hu, P., Xu, S.P., Xu, Z.H., and Xue, H.W. (2006). A brassinolide-suppressed rice MADS-box transcription factor, OsMDP1, has a negative regulatory role in BR signaling. Plant J. 47: 519–531. Earley, K.W., Haag, J.R., Pontes, O., Opper, K., Juehne, T., Song, K., and Pikaard, C.S. (2006). Gateway- compatible vectors for plant functional genomics and proteomics. Plant J. 45: 616–629. Engelsen, S.B., Madsen, A.O., Blennow, A., Motawia, M.S., Moller, B.L., and Larsen, S. (2003). The

114

phosphorylation site in double helical amylopectin as investigated by a combined approach using chemical synthesis, crystallography and molecular modeling. FEBS Lett. 541: 137–144. Feng, B., Liu, C., de Oliveira, M.V. V, Intorne, A.C., Li, B., Babilonia, K., de Souza Filho, G.A., Shan, L., and He, P. (2015). Protein poly(ADP-ribosyl)ation regulates Arabidopsis immune gene expression and defense responses. PLoS Genet. 11: e1004936. Feng, B., Ma, S., Chen, S., Zhu, N., Zhang, S., Yu, B., Yu, Y., Le, B., Chen, X., Dinesh-Kumar, S.P., Shan, L., and He, P. (2016). PARylation of the forkhead-associated domain protein DAWDLE regulates plant immunity. EMBO Rep.: e201642486. Finkelstein, R.R. and Gibson, S.I. (2002). ABA and sugar interactions regulating development: Cross-talk or voices in a crowd? Curr. Opin. Plant Biol. 5: 26–32. Franklin, K.A. (2008). Shade avoidance. New Phytol. 179: 930–944. Fridman, Y. and Savaldi-Goldstein, S. (2013). Brassinosteroids in growth control: How, when and where. Plant Sci. 209: 24–31. Fulton, D.C. et al. (2008). Beta-AMYLASE4, a noncatalytic protein required for starch breakdown, acts upstream of three active beta-amylases in Arabidopsis chloroplasts. Plant Cell 20: 1040–1058. Gampala, S.S. et al. (2007). An essential role for 14-3-3 proteins in brassinosteroid signal transduction in Arabidopsis. Dev. Cell 13: 177–189. Geigenberger, P. (2011). Regulation of Starch Biosynthesis in Response to a Fluctuating Environment. Plant Physiol. 155: 1566–1577. Goda, H., Shimada, Y., Asami, T., Fujioka, S., and Yoshida, S. (2002). Microarray analysis of brassinosteroid-regulated genes in Arabidopsis. Plant Physiol. 130: 1319–1334. Gómez, L.D., Baud, S., Gilday, A., Li, Y., and Graham, I.A. (2006). Delayed embryo development in the ARABIDOPSIS TREHALOSE-6-PHOSPHATE SYNTHASE 1 mutant is associated with altered cell wall structure, decreased cell division and starch accumulation. Plant J. 46: 69–84. Gómez, L.D., Gilday, A., Feil, R., Lunn, J.E., and Graham, I.A. (2010). AtTPS1-mediated trehalose 6- phosphate synthesis is essential for embryogenic and vegetative growth and responsiveness to ABA in germinating seeds and stomatal guard cells. Plant J. 64: 1–13. González-García, M.-P., Vilarrasa-Blasi, J., Zhiponova, M., Divol, F., Mora-García, S., Russinova, E., and Caño-Delgado, A.I. (2011). Brassinosteroids control meristem size by promoting cell cycle progression in Arabidopsis roots. Development 138: 849–859. Grigston, J.C., Osuna, D., Scheible, W.R., Liu, C., Stitt, M., and Jones, A.M. (2008). D-Glucose sensing by a plasma membrane regulator of G signaling protein, AtRGS1. FEBS Lett. 582: 3577–3584. Gudesblat, G.E., Schneider-Pizoń, J., Betti, C., Mayerhofer, J., Vanhoutte, I., van Dongen, W., Boeren, S., Zhiponova, M., de Vries, S., Jonak, C., and Russinova, E. (2012). SPEECHLESS integrates brassinosteroid and stomata signalling pathways. Nat. Cell Biol. 14: 548–554. Gupta, A., Singh, M., and Laxmi, A. (2015a). Interaction between glucose and brassinosteroid during regulation of lateral root development in Arabidopsis thaliana. Plant Physiol. 168: 307–320. Gupta, A., Singh, M., and Laxmi, A. (2015b). Multiple interactions between glucose and brassinosteroid signal transduction pathways in Arabidopsis are uncovered by whole-genome transcriptional profiling. Plant Physiol. 168: 1091–1105. Hacham, Y., Holland, N., Butterfield, C., Ubeda-Tomas, S., Bennett, M.J., Chory, J., and Savaldi- Goldstein, S. (2011). Brassinosteroid perception in the epidermis controls root meristem size. Development 138: 839–848. Hanson, J. and Smeekens, S. (2009). Sugar perception and signaling - an update. Curr. Opin. Plant Biol. 12: 562–567. Hardtke, C.S., Gohda, K., Osterlund, M.T., Oyama, T., Okada, K., and Deng, X.W. (2000). HY5 stability and activity in Arabidopsis is regulated by phosphorylation in its COP1 binding domain. EMBO J. 19: 4997–5006.

115

He, J.-X., Gendron, J.M., Sun, Y., Gampala, S.S.L., Gendron, N., Sun, C.Q., and Wang, Z.-Y. (2005). BZR1 is a transcriptional repressor with dual roles in brassinosteroid homeostasis and growth responses. Science (80-. ). 307: 1634–1638. He, J.-X., Gendron, J.M., Yang, Y., Li, J., and Wang, Z.-Y. (2002). The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 99: 10185–10190. Heazlewood, J.I., Durek, P., Hummel, J., Selbig, J., Weckwerth, W., Walther, D., and Schulze, W.X. (2008). PhosPhAt : A database of phosphorylation sites in Arabidopsis thaliana and a plant-specific phosphorylation site predictor. Nucleic Acids Res. 36: 1015–1021. van Helden, J., André, B., and Collado-Vides, J. (1998). Extracting regulatory sites from the upstream region of yeast genes by computational analysis of oligonucleotide frequencies. J. Mol. Biol. 281: 827–842. Heller, B., Wang, Z.-Q., Wagner, Erwin, Radons, Juergen, Buerkle, A., Fehsel, K., Burkart, V., and Kolb, H. (1995). Inactivation of the poly (ADP-ribose) polymerase gene affects oxygen radical and nitric oxide toxicity in islet cells. J. Biol. Chem. 270: 11176–11180. Hoehenwarter, W., Thomas, M., Nukarinen, E., Egelhofer, V., Röhrig, H., Weckwerth, W., Conrath, U., and Beckers, G.J.M. (2013). Identification of novel in vivo MAP kinase substrates in Arabidopsis thaliana through use of tandem metal oxide affinity chromatography. Mol. Cell. Proteomics 12: 369– 380. Holmberg, C.I., Tran, S.E.F., Eriksson, J.E., and Sistonen, L. (2002). Multisite phosphorylation provides sophisticated regulation of transcription factors. Trends Biochem. Sci. 27: 619–627. Horacio, P. and Martinez-Noel, G. (2013). Sucrose signaling in plants: A world yet to be explored. Plant Signal. Behav. 8: e23316. Horrer, D., Flütsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., Leonhardt, N., Lawson, T., and Santelia, D. (2016). Blue light induces a distinct starch degradation pathway in guard cells for stomatal opening. Curr. Biol. 26: 362–370. Van Houtte, H., Vandesteene, L., Lopez-Galvis, L., Lemmens, L., Kissel, E., Carpentier, S., Feil, R., Avonce, N., Beeckman, T., Lunn, J.E., and Van Dijck, P. (2013). Overexpression of the trehalase gene AtTRE1 leads to increased drought stress tolerance in Arabidopsis and is involved in abscisic acid-induced stomatal closure. Plant Physiol 161: 1158–1171. Huang, J., Taylor, J.P., Chen, J.-G., Uhrig, J.F., Schnell, D.J., Nakagawa, T., Korth, K.L., and Jones, A.M. (2006). The plastid protein THYLAKOID FORMATION1 and the plasma membrane G-protein GPA1 interact in a novel sugar-signaling mechanism in Arabidopsis. Plant Cell 18: 1226–1238. Huber, S.C. (2007). Exploring the role of protein phosphorylation in plants: from signalling to metabolism. Biochem. Soc. Trans. 35: 28–32. Hunter, T. (2007). The age of crosstalk: Phosphorylation, ubiquitination, and beyond. Mol. Cell 28: 730– 738. James, G., Patel, V., Nordström, K.J., Klasen, J.R., Salomé, P.A., Weigel, D., and Schneeberger, K. (2013). User guide for mapping-by-sequencing in Arabidopsis. Genome Biol. 14: R61. Kanamaru, K., Wang, R., Su, W., and Crawford, N.M. (1999). Ser-534 in the hinge 1 region of Arabidopsis nitrate reductase is conditionally required for binding of 14-3-3 proteins and in vitro inhibition. J. Biol. Chem. 274: 4160–4165. Karimi, M., Inzé, D., and Depicker, A. (2002). GATEWAYTM vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7: 193–195. Khan, M., Rozhon, W., Bigeard, J., Pflieger, D., Husar, S., Pitzschke, A., Teige, M., Jonak, C., Hirt, H., and Poppenberger, B. (2013). Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana. J. Biol. Chem. 288: 7519–7527.

116

Khan, M., Rozhon, W., Unterholzner, S.J., Chen, T., Eremina, M., Wurzinger, B., Bachmair, A., Teige, M., Sieberer, T., Isono, E., and Poppenberger, B. (2014). Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signalling. Nat. Commun. 5: 4687–4696. Kim, T.-W., Guan, S., Sun, Y., Deng, Z., Tang, W., Shang, J.-X., Sun, Y., Burlingame, A.L., and Wang, Z.-Y. (2009). Brassinosteroid signal transduction from cell-surface receptor kinases to nuclear transcription factors. Nat. Cell Biol. 11: 1254–60. Kim, T.-W., Hwang, J.-Y., Kim, Y.-S., Joo, S.-H., Chang, S.C., Lee, J.S., Takatsuto, S., and Kim, S.-K. (2005). Arabidopsis CYP85A2, a Cytochrome P450, mediates the Baeyer-Villiger oxidation of castasterone to brassinolide in brassinosteroid biosynthesis. Plant Cell 17: 2397–2412. Kim, T.-W., Michniewicz, M., Bergmann, D.C., and Wang, Z.-Y. (2012). Brassinosteroid regulates stomatal development by GSK3-mediated inhibition of a MAPK pathway. Nature 482: 419–422. Kim, T.-W. and Wang, Z.-Y. (2010). Brassinosteroid signal transduction from receptor kinases to transcription factors. Annu. Rev. Plant Biol. 61: 681–704. Koetting, O., Pusch, K., Tiessen, A., Geigenberger, P., Steup, M., and Ritte, G. (2004). Identification of a Novel Enzyme Required for Starch Metabolism in Arabidopsis Leaves . The Phosphoglucan, water dikinase. Plant Physiol. 137: 242–252. Koiwa, H. et al. (2002). C-terminal domain phosphatase-like family members (AtCPLs) differentially regulate Arabidopsis thaliana abiotic stress signaling, growth, and development. Proc. Natl. Acad. Sci. U. S. A. 99: 10893–10898. Koiwa, H., Hausmann, S., Bang, W.Y., Ueda, A., Kondo, N., Hiraguri, A., Fukuhara, T., Bahk, J.D., Yun, D.- J., Bressan, R.A., Hasegawa, P.M., and Shuman, S. (2004). Arabidopsis C-terminal domain phosphatase-like 1 and 2 are essential Ser-5-specific C-terminal domain phosphatases. Proc. Natl. Acad. Sci. U. S. A. 101: 14539–14544. Koornneef, M., Jorna, M.L., Brinkhorst-van der Swan, D.L.C., and Karssen, C.M. (1982). The isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in non-germinating gibberellin sensitive lines of Arabidopsis thaliana (L.) heynh. Theor. Appl. Genet. 61: 385–393. Koornneef, M., Reuling, G., and Karssen, C.M. (1984). The isolation and characterization of abscisic acid- insensitive mutants of Arabidopsis thaliana. Physiol. Plant. 61: 377–383. Kötting, O., Kossmann, J., Zeeman, S.C., and Lloyd, J.R. (2010). Regulation of starch metabolism: the age of enlightenment? Curr. Opin. Plant Biol. 13: 321–329. Kötting, O., Santelia, D., Edner, C., Eicke, S., Marthaler, T., Gentry, M.S., Comparot-Moss, S., Chen, J., Smith, A.M., Steup, M., Ritte, G., and Zeeman, S.C. (2009). STARCH-EXCESS4 is a laforin-like phosphoglucan phosphatase required for starch degradation in Arabidopsis thaliana. Plant Cell 21: 334–346. De La Fuente Van Bentem, S. et al. (2008). Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. J. Proteome Res. 7: 2458–2470. Laby, R.J., Kim, D., and Gibson, S.I. (2001). The ram1 mutant of Arabidopsis exhibits severely decreased beta-amylase activity. Plant Physiol. 127: 1798–807. Laby, R.J., Kincaid, M.S., Kim, D., and Gibson, S.I. (2000). The Arabidopsis sugar-insensitive mutants sis4 and sis5 are defective in abscisic acid synthesis and response. Plant J. 23: 587–596. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S. (2009). 2C- Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10: R25. Laxmi, A., Paul, L.K., Peters, J.L., and Khurana, J.P. (2004). Arabidopsis constitutive photomorphogenic mutant, bls1, displays altered brassinosteroid response and sugar sensitivity. Plant Mol. Biol. 56: 185–201. Lee, S., Choi, S.C., and An, G. (2008). Rice SVP-group MADS-box proteins, OsMADS22 and OsMADS55, are negative regulators of brassinosteroid responses. Plant J. 54: 93–105.

117

León, P. and Sheen, J. (2003). Sugar and hormone connections. Trends Plant Sci. 8: 110–116. Li, J., Li, Y., Chen, S., and An, L. (2010). Involvement of brassinosteroid signals in the floral-induction network of Arabidopsis. J. Exp. Bot. 61: 4221–4230. Li, J., Nagpal, P., Vitart, V., McMorris, T.C., and Chory, J. (1996). A Role for brassinosteroids in light- dependent development of Arabidopsis. Science (80-. ). 272: 398–401. Li, J., Nam, K.H., Vafeados, D., and Chory, J. (2001). BIN2, a new brassinosteroid-insensitive locus in Arabidopsis. Plant Physiol. 127: 14–22. Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An endogenous carbon-sensing pathway triggers increased auxin flux and hypocotyl elongation. Plant Physiol. 160: 2261–2270. Lin, L.-L., Hsu, C.-L., Hu, C.-W., Ko, S.-Y., Hsieh, H.-L., Huang, H.-C., and Juan, H.-F. (2015). Integrating phosphoproteomics and bioinformatics to study brassinosteroid-regulated phosphorylation dynamics in Arabidopsis. BMC Genomics 16: 533–549. Liu, M.-J., Wu, S.-H.S.-H., Wu, J.-F., Lin, W.-D., Wu, Y.-C., Tsai, T.-Y., Tsai, H.-L., and Wu, S.-H.S.-H. (2013). Translational landscape of photomorphogenic Arabidopsis. Plant Cell 25: 3699–3710. Liu, Z., Zhang, Y., Liu, R., Hao, H., Wang, Z., and Bi, Y. (2011). Phytochrome interacting factors (PIFs) are essential regulators for sucrose-induced hypocotyl elongation in Arabidopsis. J. Plant Physiol. 168: 1771–1779. Lunn, J.E. (2007). Gene families and evolution of trehalose metabolism in plants. Funct. Plant Biol. 34: 550–563. Lunn, J.E., Delorge, I., Figueroa, C.M., Van Dijck, P., and Stitt, M. (2014). Trehalose metabolism in plants. Plant J. 79: 544–567. Lunn, J.E., Feil, R., Hendriks, J.H.M., Gibon, Y., Morcuende, R., Osuna, D., Scheible, W.-R., Carillo, P., Hajirezaei, M.-R., and Stitt, M. (2006). Sugar-induced increases in trehalose 6-phosphate are correlated with redox activation of ADPglucose pyrophosphorylase and higher rates of starch synthesis in Arabidopsis thaliana. Biochem. J. 397: 139–148. Luo, X.-M. et al. (2010). Integration of light- and brassinosteroid-signaling pathways by a GATA transcription factor in Arabidopsis. Dev. Cell 19: 872–883. Marquès-Bueno, M.M., Moreno-Romero, J., Abas, L., De Michele, R., and Martínez, M.C. (2011). A dominant negative mutant of protein kinase CK2 exhibits altered auxin responses in Arabidopsis. Plant J. 67: 169–180. Martínez-García, J.F., Galstyan, A., Salla-Martret, M., Cifuentes-Esquivel, N., Gallemí, M., and Bou- Torrent, J. (2010). Regulatory components of shade avoidance syndrome. Adv. Bot. Res. 53: 65–116. Meggio, F. and Pinna, L.A. (2003). One-thousand-and-one substrates of protein kinase CK2? FASEB J. 17: 349–368. Mishra, B.S., Singh, M., Aggrawal, P., and Laxmi, A. (2009). Glucose and auxin signaling interaction in controlling Arabidopsis thaliana seedlings root growth and development. PLoS One 4: e4502. Moore, B., Zhou, L., Rolland, F., Hall, Q., Cheng, W.-H., Liu, Y.-X., Hwang, I., Jones, T., and Sheen, J. (2003). Role of the Arabidopsis glucose sensor HXK1 in nutrient, light and hormonal signaling. Science (80-. ). 300: 332–336. Mora-Garcia, S., Vert, G., Yin, Y.H., Cano-Delgado, A., Cheong, H., and Chory, J. (2004). Nuclear protein phosphatases with Kelch-repeat domains modulate the response to brassinosteroids in Arabidopsis. Genes Dev. 18: 448–460. Moreno-Romero, J., Espunya, M.C., Platara, M., Ariño, J., and Martínez, M.C. (2008). A role for protein kinase CK2 in plant development: evidence obtained using a dominant-negative mutant. Plant J. 55: 118–130. Moreno, F., Ahuatzi, D., Riera, A., Palomino, C.A., and Herrero, P. (2005). Glucose sensing through the Hxk2-dependent signalling pathway. Biochem. Soc. Trans. 33: 265–268. Morillon, R., Catterou, M., Sangwan, R.S., Sangwan, B.S., and Lassalles, J.P. (2001). Brassinolide may

118

control aquaporin activities in Arabidopsis thaliana. Planta 212: 199–204. Mulekar, J.J. and Huq, E. (2014). Expanding roles of protein kinase CK2 in regulating plant growth and development. J. Exp. Bot. 65: 2883–2893. Nakashima, K., Fujita, Y., Kanamori, N., Katagiri, T., Umezawa, T., Kidokoro, S., Maruyama, K., Yoshida, T., Ishiyama, K., Kobayashi, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2009). Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. Plant Cell Physiol. 50: 1345–1363. Ni, W., Xu, S.-L., Chalkley, R.J., Pham, T.N.D., Guan, S., Maltby, D.A., Burlingame, A.L., Wang, Z.-Y., and Quail, P.H. (2013). Multisite light-induced phosphorylation of the transcription factor PIF3 is necessary for both its rapid degradation and concomitant negative feedback modulation of photoreceptor phyB levels in Arabidopsis. Plant Cell 25: 2679–2698. Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R., Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade avoidance components and pathways in adult plants revealed by phenotypic profiling. PLOS Genet. 11: e1004953. O’Hara, L.E., Paul, M.J., and Wingler, A. (2013). How do sugars regulate plant growth and development? new insight into the role of trehalose-6-phosphate. Mol. Plant 6: 261–274. Oh, E., Zhu, J.Y., Bai, M.Y., Arenhart, R.A., Sun, Y., and Wang, Z.Y. (2014). Cell elongation is regulated through a central circuit of interacting transcription factors in the Arabidopsis hypocotyl. Elife 3: e03031. Page, D.R. and Grossniklaus, U. (2002). The art and design of genetic screens: Arabidopsis thaliana. Nat. Rev. Genet. 3: 124–136. Park, H.-J., Ding, L., Dai, M., Lin, R., and Wang, H. (2008). Multisite phosphorylation of Arabidopsis HFR1 by casein kinase II and a plausible role in regulating its degradation rate. J. Biol. Chem. 283: 23264– 23273. Paul, M.J., Jhurreea, D., Zhang, Y., Primavesi, L.F., Delatte, T., Schluepmann, H., and Wingler, A. (2010). Upregulation of biosynthetic processes associated with growth by trehalose 6-phosphate. Plant Sgnaling Behav. 5: 386–392. Paul, M.J., Primavesi, L.F., Jhurreea, D. and, and Zhang, Y. (2008). Trehalose metabolism and signaling. Annu. Rev. Plant Biol. 59: 417–441. Pedmale, U. V., Huang, S.S.C., Zander, M., Cole, B.J., Hetzel, J., Ljung, K., Reis, P.A.B., Sridevi, P., Nito, K., Nery, J.R., Ecker, J.R., and Chory, J. (2016). Cryptochromes interact directly with PIFs to control plant growth in limiting blue light. Cell 164: 233–245. Peng, C., Uygun, S., Shiu, S.-H., and Last, R.L. (2015). The impact of the branched-chain ketoacid dehydrogenase complex on amino acid homeostasis in Arabidopsis. Plant Physiol. 169: 1807–1820. Reinhold, H., Soyk, S., Simková, K., Hostettler, C., Marafino, J., Mainiero, S., Vaughan, C.K., Monroe, J.D., and Zeeman, S.C. (2011). β-amylase-like proteins function as transcription factors in Arabidopsis, controlling shoot growth and development. Plant Cell 23: 1391–1403. Ritte, G., Lloyd, J.R., Eckermann, N., Rottmann, A., Kossmann, J., and Steup, M. (2002). The starch- related R1 protein is an alpha-glucan, water dikinase. Proc. Natl. Acad. Sci. U. S. A. 99: 7166–7171. Rolland, F., Baena-Gonzalez, E., and Sheen, J. (2006). Sugar sensing and signaling in plants: conserved and novel mechanisms. Annu. Rev. Plant Biol. 57: 675–709. Rook, F., Corke, F., Card, R., Munz, G., Smith, C., and Bevan, M.W. (2001). Impaired sucrose-induction mutants reveal the modulation of sugar-induced starch biosynthetic gene expression by abscisic acid signalling. Plant J. 26: 421–433. Rook, F., Hadingham, S.A., Li, Y., and Bevan, M.W. (2006). Sugar and ABA response pathways and the control of gene expression. Plant, Cell Environ. 29: 426–434. Rugnone, M.L., Faigón Soverna, A., Sanchez, S.E., Schlaen, R.G., Hernando, C.E., Seymour, D.K., Mancini,

119

E., Chernomoretz, A., Weigel, D., Más, P., and Yanovsky, M.J. (2013). LNK genes integrate light and clock signaling networks at the core of the Arabidopsis oscillator. Proc. Natl. Acad. Sci. U. S. A. 110: 12120–5. Sairanen, I., Novak, O., Pencik, A., Ikeda, Y., Jones, B., Sandberg, G., and Ljung, K. (2012). Soluble carbohydrates regulate auxin biosynthesis via PIF proteins in Arabidopsis. Plant Cell 24: 4907–4916. Salinas, P., Fuentes, D., Vidal, E., Jordana, X., Echeverria, M., and Holuigue, L. (2006). An extensive survey of CK2 alpha and beta subunits in Arabidopsis: Multiple isoforms exhibit differential subcellular localization. Plant Cell Physiol. 47: 1295–1308. Santelia, D., Kotting, O., Seung, D., Schubert, M., Thalmann, M., Bischof, S., Meekins, D. a., Lutz, A., Patron, N., Gentry, M.S., Allain, F.H.-T., and Zeeman, S.C. (2011). The phosphoglucan phosphatase like Sex Four2 dephosphorylates starch at the C3-position in Arabidopsis. Plant Cell 23: 4096–4111. Schluepmann, H., Berke, L., and Sanchez-Perez, G.F. (2012). Metabolism control over growth: A case for trehalose-6-phosphate in plants. J. Exp. Bot. 63: 3379–3390. Schluepmann, H., Pellny, T., van Dijken, A., Smeekens, S., and Paul, M. (2003). Trehalose 6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 100: 6849–6854. Schneeberger, K. (2014). Using next-generation sequencing to isolate mutant genes from forward genetic screens. Nat. Rev. Genet. 15: 662–676. Schuetze, K., Harter, K., and Chaban, C. (2009). Bimolecular fluorescence complementation (BiFC) to study protein-protein interactions in living plant cells. Plant Signal Transduct. 479: 61–77. Sheikh, A.H., Eschen-Lippold, L., Pecher, P., Hoehenwarter, W., Sinha, A.K., Scheel, D., and Lee, J. (2016). Regulation of WRKY46 transcription factor function by Mitogen-Activated Protein Kinases in Arabidopsis thaliana. Front. Plant Sci. 7. Smeekens, S., Ma, J., Hanson, J., and Rolland, F. (2010). Sugar signals and molecular networks controlling plant growth. Curr. Opin. Plant Biol. 13: 274–279. Smykowski, A., Fischer, S., and Zentgraf, U. (2015). Phosphorylation affects DNA-binding of the senescence-regulating bZIP transcription factor GBF1. Plants 4: 691–709. Soyk, S., Simková, K., Zürcher, E., Luginbühl, L., Brand, L.H., Vaughan, C.K., Wanke, D., and Zeeman, S.C. (2014). The enzyme-like domain of Arabidopsis nuclear β-amylases is critical for DNA sequence recognition and transcriptional activation. Plant Cell 26: 1746–1763. St-Denis, N., Gabriel, M., Turowec, J.P., Gloor, G.B., Li, S.S.C., Gingras, A.C., and Litchfield, D.W. (2015). Systematic investigation of hierarchical phosphorylation by protein kinase CK2. J. Proteomics 118: 49–62. Steber, C.M. and McCourt, P. (2001). A role for brassinosteroids in germination in Arabidopsis. Plant Physiol. 125: 763–769. Stitt, M. and Zeeman, S.C. (2012). Starch turnover: Pathways, regulation and role in growth. Curr. Opin. Plant Biol. 15: 282–292. Streb, S. and Zeeman, S.C. (2012). Starch metabolism in Arabidopsis. Arab. book, Am. Soc. Plant Biol. 9: e0160. Su, W., Huber, S.C., and Crawford, N.M. (1996). Identification in vitro of a post-translational regulatory site in the hinge 1 region of Arabidopsis nitrate reductase. Plant Cell 8: 519–527. Sun, Y. et al. (2010). Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis. Dev. Cell 19: 765–777. Szekeres, M., Németh, K., Koncz-Kálmán, Z., Mathur, J., Kauschmann, A., Altmann, T., Rédei, G.P., Nagy, F., Schell, J., and Koncz, C. (1996). Brassinosteroids rescue the deficiency of CYP90, a cytochrome P450, controlling cell elongation and de-etiolation in Arabidopsis. Cell 85: 171–182. Thomas, P.D., Campbell, M.J., Kejariwal, A., Mi, H., and Karlak, B. (2003). PANTHER: A library of protein families and subfamilies indexed by function. Genome Res. 13: 2129–2141.

120

Tomé, F., Naegele, T., Adamo, M., Garg, A., Marco-llorca, C., Nukarinen, E., Pedrotti, L., Peviani, A., Simeunovic, A., Tatkiewicz, A., Tomar, M., and Gamm, M. (2014). The low energy signaling network. Front. Plant Sci. 5. Tosoni, K., Costa, A., Sarno, S., D’Alessandro, S., Sparla, F., Pinna, L.A., Zottini, M., and Ruzzene, M. (2011). The p23 co-chaperone protein is a novel substrate of CK2 in Arabidopsis. Mol. Cell. Biochem. 356: 245–254. Valerio, C., Costa, A., Marri, L., Issakidis-Bourguet, E., Pupillo, P., Trost, P., and Sparla, F. (2011). Thioredoxin-regulated β-amylase (BAM1) triggers diurnal starch degradation in guard cells, and in mesophyll cells under osmotic stress. J. Exp. Bot. 62: 545–555. Vandesteene, L., Lopez-Galvis, L., Vanneste, K., Feil, R., Maere, S., Lammens, W., Rolland, F., Lunn, J.E., Avonce, N., Beeckman, T., and Van Dijck, P. (2012). Expansive evolution of the TREHALOSE-6- PHOSPHATE PHOSPHATASE gene family in Arabidopsis. Plant Physiol. 160: 884–896. Vert, G. and Chory, J. (2006). Downstream nuclear events in brassinosteroid signalling. Nature 441: 96– 100. Vert, G., Walcher, C.L., Chory, J., and Nemhauser, J.L. (2008). Integration of auxin and brassinosteroid pathways by Auxin Response Factor 2. Proc. Natl. Acad. Sci. U. S. A. 105: 9829–9834. Wahl, V., Ponnu, J., Schlereth, A., Arrivault, S., Langenecker, T., Franke, A., Feil, R., Lunn, J.E., Stitt, M., and Schmid, M. (2013). Regulation of flowering by trehalose-6-phosphate signaling in Arabidopsis tumefa. Science (80-. ). 339: 704–707. Wang, D., Harper, J.F., and Gribskov, M. (2003). Systematic trans-genomic comparison of protein kinases between Arabidopsis and Saccharomyces cerevisiae. Plant Physiol. 132: 2152–2165. Wang, X., Bian, Y., Cheng, K., Gu, L.F., Ye, M., Zou, H., Sun, S.S.M., and He, J.X. (2013a). A large-scale protein phosphorylation analysis reveals novel phosphorylation motifs and phosphoregulatory networks in Arabidopsis. J. Proteomics 78: 486–498. Wang, Y. et al. (2013b). The inhibitory effect of ABA on floral transition is mediated by ABI5 in Arabidopsis. J. Exp. Bot. 64: 675–684. Wang, Z.-Y., Bai, M.-Y., Oh, E., and Zhu, J.-Y. (2012). Brassinosteroid signaling network and regulation of photomorphogenesis. Annu. Rev. Genet. 46: 701–724. Wang, Z.-Y., Nakano, T., Gendron, J., He, J., Chen, M., Vafeados, D., Yang, Y., Fujioka, S., Yoshida, S., Asami, T., and Chory, J. (2002). Nuclear-localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis. Dev Cell 2: 505–513. Wiese, A., Elzinga, N., Wobbes, B., and Smeekens, S. (2005). Sucrose-induced translational repression of plant bZIP-type transcription factors. Biochem. Soc. Trans. 33: 272–275. Wobus, U. and Weber, H. (1999). Sugars as signal molecules in plant seed development. Biol. Chem. 380: 937–944. Wong, Y.H., Lee, T.Y., Liang, H.K., Huang, C.M., Wang, T.Y., Yang, Y.H., Chu, C.H., Huang, H. Da, Ko, M.T., and Hwang, J.K. (2007). KinasePhos 2.0: A web server for identifying protein kinase-specific phosphorylation sites based on sequences and coupling patterns. Nucleic Acids Res. 35: 588–594. Xiong, Y., McCormack, M., Li, L., Hall, Q., Xiang, C., and Sheen, J. (2013). Glucose-TOR signalling reprograms the transcriptome and activates meristems. Nature 496: 181–186. Xiong, Y. and Sheen, J. (2015). Novel links in the plant TOR kinase signaling network. Curr. Opin. Plant Biol. 28: 83–91. Yadav, U.P., Ivakov, A., Feil, R., Duan, G.Y., Walther, D., Giavalisco, P., Piques, M., Carillo, P., Hubberten, H.M., Stitt, M., and Lunn, J.E. (2014). The sucrose-trehalose 6-phosphate (Tre6P) nexus: Specificity and mechanisms of sucrose signalling by Tre6P. J. Exp. Bot. 65: 1051–1068. Ye, H., Li, L., Guo, H., and Yin, Y. (2012). MYBL2 is a substrate of GSK3-like kinase BIN2 and acts as a corepressor of BES1 in brassinosteroid signaling pathway in Arabidopsis. Proc. Natl. Acad. Sci. 109: 20142–20147.

121

Ye, Q., Zhu, W., Li, L., Zhang, S., Yin, Y., Ma, H., and Wang, X. (2010). Brassinosteroids control male fertility by regulating the expression of key genes involved in Arabidopsis anther and pollen development. Proc. Natl. Acad. Sci. U. S. A. 107: 6100–6105. Yin, Y., Vafeados, D., Tao, Y., Yoshida, S., Asami, T., and Chory, J. (2005). A new class of transcription factors mediates brassinosteroid-regulated gene expression in Arabidopsis. Cell 120: 249–259. Yoo, S.-D., Cho, Y.-H., and Sheen, J. (2007). Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2: 1565–1572. Yu, F., Wu, Y., and Xie, Q. (2015). Precise protein post-translational modifications modulate ABI5 activity. Trends Plant Sci. 20: 569–575. Yu, X., Li, L., Li, L., Guo, M., Chory, J., and Yin, Y. (2008). Modulation of brassinosteroid-regulated gene expression by Jumonji domain-containing proteins ELF6 and REF6 in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 105: 7618–7623. Yu, X., Li, L., Zola, J., Aluru, M., Ye, H., Foudree, A., Guo, H., Anderson, S., Aluru, S., Liu, P., Rodermel, S., and Yin, Y. (2011). A brassinosteroid transcriptional network revealed by genome-wide identification of BESI target genes in Arabidopsis thaliana. Plant J. 65: 634–646. Zeeman, S.C., Kossmann, J., and Smith, A.M. (2010). Starch: Its metabolism, evolution, and biotechnological modification in plants. Annu Rev Plant Biol 61: 209–234. Zhang, D., Ye, H., Guo, H., Johnson, A., Zhang, M., Lin, H., and Yin, Y. (2014). Transcription factor HAT1 is phosphorylated by BIN2 kinase and mediates brassinosteroid repressed gene expression in Arabidopsis. Plant J. 77: 59–70. Zhang, H., Gu, Z., Wu, Q., Yang, L., Liu, C., Ma, H., Xia, Y., and Ge, X. (2015a). Arabidopsis PARG1 is the key factor promoting cell survival among the enzymes regulating post-translational poly(ADP- ribosyl)ation. Sci. Rep. 5: 1–13. Zhang, Y. and He, J. (2015). Sugar-induced plant growth is dependent on brassinosteroids. Plant Signal. Behav. 10: e1082700. Zhang, Y., Liu, Z., Wang, J., Chen, Y., Bi, Y., and He, J. (2015b). Brassinosteroid is required for sugar promotion of hypocotyl elongation in Arabidopsis in darkness. Planta 242: 881–893. Zhang, Y., Persson, S., and Giavalisco, P. (2013a). Differential regulation of carbon partitioning by the central growth regulator Target of Rapamycin (TOR). Mol. Plant 6: 1731–1733. Zhang, Y., Primavesi, L.F., Jhurreea, D., Aandralojc, P.J., Mitchell, R.A.C., Powers, S.J., Schluepmann, H., Delatte, T., Wingler, A., and Paul, M.J. (2009). Inhibition of SNF1-related protein kinase1 activity and regulation of metabolic pathways by trehalose-6-phosphate. Plant Physiol. 149: 1860–1871. Zhang, Y., Wang, J., Ding, M., and Yu, Y. (2013b). Site-specific characterization of the Asp- and Glu-ADP- ribosylated proteome. Nat. Methods 10: 981–984. Zhang, Z., Zhu, J.Y., Roh, J., Marchive, C., Kim, S.K., Meyer, C., Sun, Y., Wang, W., and Wang, Z.Y. (2016). TOR signaling promotes accumulation of BZR1 to balance growth with carbon availability in Arabidopsis. Curr. Biol. 26: 1854–1860. Zhou, X. et al. (2015). SOS2-LIKE PROTEIN KINASE5, an SNF1-RELATED PROTEIN KINASE3-Type protein kinase, is important for abscisic acid responses in Arabidopsis through phosphorylation of ABSCISIC ACID-INSENSITIVE5. Plant Physiol. 168: 659–676. Zhu, J.-Y., Sae-Seaw, J., and Wang, Z.-Y. (2013). Brassinosteroid signalling. Development 140: 1615–1620.

122