Posted on Authorea 8 Mar 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161516405.50876931/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. iest ihnmn rusta a o vdn rmmr conserved more resulting from genus The evident the Lobata. not of the was among that analyses groups Phylogenetic many within species. diversity undescribed the many amplified including and primers correspond- new the designed and we sequences mitochondrial divergent few to (comb very due amplify Ctenophora study phylum to to inability the difficult However, ing been identifications. historically species has rapid jellies) and metabarcoding, genetics, ( 1 ulation subunit cytochrome-c-oxidase gene mitochondrial The Abstract [email protected] [email protected], [email protected], Correspondence: * US 95064, 2 1 Christianson mitochondrial M. new Lynne by revealed and Ctenophora libraries of reference worldwide diversity improving ctenophores Hidden by studies. of genetic DNA diversity population environmental the of analyze breadth illuminate to new to ability a researchers enable the and enable improve amplifications, to identifications, molecular tools The quick important via provide Lobata. herein the reported among primers particular genus in the sequences, of within rDNA groups structure cruentiventer 18S major community genus conserved all unexpected the more of diversity revealed high within members from also revealed from described evident sequences results fragment 200 not COI phylogenetic COI over was resulting COI the despite the that amplified ctenophores, of groups and analyses for many available Phylogenetic primers within sequences new species. COI designed undescribed few many we including very Here, standard ctenophores, are and phylum. degenerate there with the result, COI in a amplify difficult genetics, species to As inability been population corresponding historically primers. phylogenetics, the has ‘barcoding’ and for jellies) sequences COI (comb taxa mitochondrial Ctenophora divergent many phylum to in due the However, study useful to identifications. is species (COI) rapid 1 and subunit metabarcoding, cytochrome-c-oxidase gene mitochondrial The Abstract 2021 8, March 2 1 Christianson Lynne sequences mitochondrial and new primers by COI revealed Ctenophora of diversity Hidden eateto imlclrEgneigadBonomtc,Uiest fClfri,SnaCu,CA Cruz, Santa California, of University Bioinformatics, and Engineering US Biomolecular 95039, of CA Landing, Department Moss Institute, Research Aquarium Bay Monterey nvriyo aiona at Cruz Santa California, of University MBARI Bolinopsis, COI n iia oae ( lobates similar and eune vial o tnpoe,dsieoe 0 ecie pce ntepyu.Here, phylum. the in species described 200 over despite ctenophores, for available sequences Bathocyroe ugse e pce ihntegenus the within species new suggested 1 1* COI hno Johnson Shannon , n upre h clgcladmrhlgcldffrne fsm pce uhas such species some of differences morphological and ecological the supported and , COI hno .Johnson B. Shannon , ihdgnrt n standard and degenerate with Lampocteis hlgntcrslsas eelduepce omnt tutr ihnthe within structure community unexpected revealed also results phylogenetic p V taie ydph n A ieetae yclr.Tenwydescribed newly The color). by differentiated ‘A’ and depth, by stratified ‘V’ sp. COI 1 1* arnSchultz Darrin , rgetfo ebr falmjrgop fctenophores, of groups major all of members from fragment arnT Schultz T. Darrin , 1 COI Bathocyroe COI sueu nmn aafrpyoeeis pop- phylogenetics, for taxa many in useful is ) COI broig rmr.A eut hr are there result, a As primers. ‘barcoding’ 2 n tvnHaddock Steven and , 1,2 rmr n sequences and primers tvnHD Haddock H.D. Steven , n upre h clgcland ecological the supported and , 18S DAsqecs nparticular in sequences, rDNA COI Bolinopsis eune eeldhigh revealed sequences ugse e species new suggested , 1 1* Lampocteis Posted on Authorea 8 Mar 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161516405.50876931/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. nl o uretcnet hyaeas ryfralrerneo nml (Choy animals of range seem- large their a Despite for webs. prey food in also predators delicate are as are they they role Although content, critical ecology. nutrient a ocean play low in and ctenophores ingly carnivorous of role are the ctenophores of animals, understanding our markers. hampers population-genetic also and in tories and quick sequences phylogenetic robust of ctenophore of amplified lack few lack easily diversity, The a of revealing deficiency including: for a ramifications difficulties and important in databases, of results public number that identifications a molecular has easy the primers amplify barcoding to used suited commonly poorly often are primers (Folmer Many humans to bacteria 2019). from Goldstein taxa, of & swath (DeSalle broad a delimitation amplify ( and al. to available subunit-I identification et are cytochrome-c-oxidase sets species mitochondrial primer for PCR “barcoding” degenerate useful For The typically Lobata. prep). is in as fragment the of such al. utility groups the et of in (Haddock limitations particularly the (Simion showing genera sequences, diversity related rDNA representative as closely such some genera, and some of example, species studies many in-depth between more discriminate for allow the species However, of (Podar handful ctenophores a within relationships broad as such species ( some of differences morphological ihrtso iohnra vlto,aerc naeie()adtyie()rsde,adhv variable have (Arafat and genus residues, a (T) within thymine even and genome, (A) adenine mitochondrial extremely in the Pett have rich within species non-model are many for order since evolution, often gene Ctenophora, mitochondrial others, is many of example for such rates problematic One high is 2012). utility Waples its & (Vrijenhoek and/or organisms amplification taxa, many for amplified reference good and nuclear loci the polymorphic from although data goal. experts, Sequence the this taxonomic achieve reveal especially few to identifications, poor to have critical quick and that relatively are begun morphology, provide libraries ctenophores cryptic only can like specimens, identifications have taxa damaged Molecular we for by fixatives. that ctenophores, stymied all on work are suggest in who preservation often experts sea taxonomic identifications and few deep morphological are observe there the and However, to (Haddock remotely phylum. from research ability this of of within collected our diversity years use remarkable 30 The expanded specimens last have the of 2004). during equipment (Haddock investigations deep-sea sampling collection the in during specialized ctenophores damaged collect and often specimens (ROVs) because and and vehicles undescribed common access, remain operated are to ctenophores deep-living difficult species most Many delicate, However, (Harbison are world. 2007). deep-sea the Miyake the around & habitats to like (Lindsay whichto species surface depth with 2017). coastal the meters Cnidarians particularly (Mills 7,000 from well-studied, from over species and and at equator named observed plankton the ctenophore 200 gelatinous to (Dunn nearly other poles associated with from both them sometimes zooplankton separates are marine plan they gelatinous body of unique phylum Their a is Ctenophora Introduction | 1 oxidase cytochrome-c biodiversity, studies. barcoding, genetic reference population improving of by breadth DNA new KEYWORDS environmental a via enable analyze worldwide ctenophores and to of amplifications, ability diversity and the the libraries illuminate improve to identifications, researchers molecular enable quick to tools important provide herein Lampocteis tal. et 94 Geller 1994; 01 Schultz 2011; p V taie ydph n A ieetae yclr.Tenwydsge rmr reported primers designed newly The color). by differentiated ‘A’ and depth, by stratified ‘V’ sp. 18S tal. et COI DAgn rgeti ihycnevd n h hlgne fe onteffectively not do often phylogenies the and conserved, highly is fragment gene rDNA rmr n h eutn act fceohr eune vial npbi reposi- public in available sequences ctenophore of paucity resulting the and primers 03 Leray 2013; tal. et ahcre Eurhamphaea Bathocyroe, 18S 00.Acneuneo ihmtcodilvraiiyi htcommon that is variability mitochondrial high of consequence A 2020). tal. et iooa eepoieamlclrpyoeei rmwr o the for framework phylogenetic molecular a provide gene ribosomal tal. et 03 Siddall 2013; nmossleidyi Mnemiopsis , COI tnpoa DA eaacdn,primers metabarcoding, eDNA, Ctenophora, 05.Te r on hogottewrdoen from ocean, world the throughout found are They 2015). tal. et apcescruentiventer Lampocteis rget nucsflapicto fceohrsby ctenophores of amplification Unsuccessful fragment. 2 01 Simion 2001; tal. et , Deiopea 18S 09.Wietebroelcsi successfully is locus barcode the While 2009). hc sntdfrhvn enintroduced been having for noted is which , rgetwt epc oseisdelineation species to respect with fragment and tal. et Kiyohimea 05,adtasrpoe from transcriptomes and 2015), n iia necie lobates undescribed similar and tal. et tal. et tal. et aenal identical nearly have , 08 Kohn 2018; 98,wt h deepest the with 1978), tal. et 07.Morphological 2017). 07 heo & Thiebot 2017; COI tal. et tal. et sequence ) 2017). 2012; 18S Posted on Authorea 8 Mar 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161516405.50876931/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. ffradadrvrepieswre et rmrpstoswr ubrdrltv otestsa they 18S as sites of the Fragments to Sequencing relative and numbered Amplification were combinations | positions and 2.3 variants Primer which best. suggesting worked assays in primers PCR occur reverse multiplexed and with forward process, Primer of alignments. iterative nucleotide an on based was eye by design or (www.idtdna.com), PrimerQuest using (Francis www.geneious.com), described previously mitochondrial as the conducted for were analyses (Folmer and primers’ sequencing, ‘Folmer with amplify successfully of sequences JF760210), mitochondrial published data, scriptome the ctenophore to Initial according design MA) and MD) Primer localities Germantown, Ipswich, | different (Qiagen, Biolabs, from 2.2 sequenced. kit species England and a -80 Tissue amplified (New within at separately and Kit individuals were stored multiple Blood depths Purification then possible, DNA DNA When nitrogen, DNeasy directions. Genomic liquid manufacturers’ the Monarch in using S1 frozen the (Table samples flash or globe frozen were the RNA from around or isolated collaborators and DNA from diving, genomic contributions SCUBA blue-water for with (ROVs), vehicles along operated trawls, remotely midwater by collected primarily were taxonomic Ctenophores for Collection resolution Sample species-level | 2.1 provided Methods and and library coast, Materials a | Pacific as sequences 2 eastern generated taxonomic the newly tested our along ctenophores. used and of study we phylum assignments study, eDNA the case across a an as primers for Finally, those groups. applied various We for assignments species. amplify undescribed to primers deep-living, multiple many designed we study, from this missing For often is 2015). Ctenophora (Pitz Knowlton of & addressed phylum (Leray entire not (Lacoursi`ere-Roussel the were eDNA, estimates results and diversity the metabarcoding so of assignments studies of taxonomic environmental proportion poor significant had (G¨unther a sequences framework, together metabarcoding lumped a yet are nophores, in phylum entire loci multiple the used of members all often L´opez-Escard´o ctenophores, of species of on fragment based mon- analyses ecosystem diversity, metabarcoding L´opez-Escard´o community zooplankton assess in to ctenophores tools of (Eble powerful function are and studies itoring, eDNA and Metabarcoding 2020). Yeh 2020; McInnes n nlzdo 50LGntcAaye Lf ehoois albd CA). protocol Carlsbad, Technologies, manufacturer’s (Life the Analyzer to Genetic according 3500xL kit a sequencing on v3.1 BigDyeTerminator analyzed the and and Annealing primers CA). Carlsbad, PCR 50 Technologies, with (Life at cycler successful thermal most PCR were Veriti a temperatures in MA) Ipswich, BioLabs, England and .leidyi M. COI luorci pileus Pleurobrachia 18S rget eeapie sn hso ihFdlt C atrMxwt Fbffr(New buffer HF with Mix Master PCR High-Fidelity Phusion using amplified were fragments COI 18S tal. et tal. et sotnue nmtbroigsuisbtlcsrslto odsrmnt ewe most between discriminate to resolution lacks but studies metabarcoding in used often is COI J701;Pett (JF760210; DAwr mlfiduigpiesMth n icB(Medlin MitchB and MitchA primers using amplified were rDNA fe aldt eetay(Djurhuus any detect to failed often tal. et 08 Preston 2018; 08 Preston 2018; COI rmr eedsge ae on based designed were primers eewt rmr (Untergasser Primer3 with gene tal. et Gnakacsin# F621,adteceohrswihw could we which ctenophores the and JF760211), #: accession (GenBank 00.Mn aucit aehglgtdtepeec n abundance and presence the highlighted have manuscripts Many 2020). tal. et tal. et tal. et º 01,a niae nFgr 1 Figure in indicated as 2011), o otseis eefamnswr eune bi-directionally sequenced were fragments Gene species. most for C tal. et 00 Schroeder 2020; 00 Schroeder 2020; 08 rte r updi n‘nsindtx’category taxa’ ‘unassigned an in lumped are they or 2018) tal. et 3 nmossleidyi Mnemiopsis COI COI tal. et 94 Fgr ) N xrcin,transcriptome extractions, RNA 1). (Figure 1994) tal. et tal. et eune rmorupbihdceohr tran- ctenophore unpublished our from sequences tal. et rmalmjrcae fceohrs including ctenophores, of clades major all from 08 G¨unther2018; 00 Yeh 2020; 18S 00 Yeh 2020; 02 ihnGniu rm v 2020.2.3, (v. Prime Geneious within 2012) DAfamns(G¨unther fragments rDNA . Gnakacsin# NC016117, #: accession (GenBank tal. et tal. et tal. et tal. et 18S 03.W eindprimers designed We 2013). 00.I aucit that manuscripts In 2020). 00;Hwvr ic the since However, 2020); eune eefo cte- from were sequences 08,o h ctenophore the or 2018), ° .GnmcDAwas DNA Genomic C. tal. et tal. et ). 00.Frother For 2020). isesamples Tissue 98.Both 1988). tal. et tal. et 2018; 2018; Posted on Authorea 8 Mar 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161516405.50876931/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. es oepiesdsge o n pce lowre o te lsl eae aa uha Bfor259F, as such taxa, related closely other for worked also However, species primers). one starred for 2, (Figure designed species, cydippids primers as many generate of Some for such to species well mers. used genera worked many alignments F259/1060R many for the as successful of such of was primers amplification ends R866 of combinations the sets primer Primer trimmed few reverse 2). we A Figure and so data. of 1), missing branches (Figure exclude and lengths to 1, fragment phylogenies Figure of S1, range (Table a taxon amplified by varied pairs primer Combinations Successful and Design Primer | genera 3.1 the within species undescribed between differences with genera and distinct of differences morphological of isolates multiple 1. of Figure Analysis in indicated of are analyses sequences primer previous Phylogenetic from optimized species. evident been distinct not 67 had 18S which of Lobata, within individuals especially 174 sequenced resulting and the in amplified reads of successfully were absence We sequences or ctenophore 2016). presence Results (Wickham no the ggplot2 where | on with stations 3 based 2015) for assignments (Team Data Rstudio species study. in plotted the sample We of each reported. authors not the used were as we recovered methods assignments, sequence same metabarcoding the affect with can library the reference for complete data species more eight a also of how We genomes illustrate 2018). To mitochondrial Xia published (v7, the DAMBE7. DAMBE7 from with software saturation ctenophores the for of loci with both mitochondrial MOTUs other for all five among Lobata tested distance the GTR within versus sites transversions composition parsimony-informative Rozas Base of (v6.12.01, DnaSP (MOTUs). number with the units calculated taxonomic We Kumar operational Prime. (v10.0.5, molecular MegaX with between for calculated and was ctenophores within sequenced support distance likelihood within (GTR) and cydippid diversity Bayesian the assess with both To rooted and were alignment, phylogenies full lobate the The phylogeny. for the bachei used on been reported had were values that both parameters for Convergence same species within- generations. the lobate illuminate 1000 To of tree.bio.ed.ac.uk/software/figtree/). alignments every diversity, (v1.4.4, printed order FigTree and with visualized sampled were were Phylogenies 5x10 (Rambaut that of v1.7 chains, TRACER runs six with multiple with determined included was burn-in, MrBayes 10% with We a estimated model. with phylogenies evolutionary Bayesian best 1974). the (Akaike select codons stop to no Geneious (Minh that within Ronquist (v3.2, and 1998) MrBayes with frame Crandall phylogenies reading & estimated (Posada correct jModelTest the used in We aligned were sequences the present. that were ensure to Prime. Geneious table within code 2004) (Edgar MUSCLE with aligned The and edited, assembled, were fragments Sequence Methods Statistical | 2.4 eunefamnswr eoie nGnakwt ceso ubr xxxx TbeS) Taxon- S1). (Table (xxx-xxx) numbers accession with GenBank in deposited were fragments sequence Eurhamphaea COI tal. et steoutgroup the as lgmn a rnltdwt h od rtza,adCeetrt rnlto mitochondrial translation Coelenterate and Protozoan, Mold, the with translated was alignment COI 00 o l tnpoe vial ae ntems prpit oesslce yteAIC the by selected models appropriate most the on based available ctenophores all for 2020) COI rgetfrceohrsfo Pitz from ctenophores for fragment htwr neovdwt the with unresolved were that , eune eeldhg iest n ubro rpi pce ihnalgop,but groups, all within species cryptic of number a and diversity high revealed sequences . tal. et Bolinopsis 07.W etdfrstrto fosre rprin ftastosand transitions of proportions observed of saturation for tested We 2017). ulkms crpi,Beroe, Ocyropsis, Euplokamis, ugse httegnsi oyhltc nadto,w confirmed we addition, In polyphyletic. is genus the that suggested tal. et tal. et 18S COI 08 n ariedsacswr acltdi Geneious in calculated were distances pairwise and 2018) tal. et tal. et COI 4 08 n ycmaigtplge fmlil runs. multiple of topologies comparing by and 2018) rget n on upr o utemorphological subtle for support found and fragment, COI eunefamns uhas such fragments, sequence 02 n QTe ih10 otta replicates bootstrap 1000 with 2 IQ-Tree and 2012) Lampocteis 22)adqeidorceohr-pcfi library ctenophore-specific our queried and (2020) and ecluae ecn eea iereversible time general percent calculated we 18S rget eeaaye eaaeywith separately analyzed were fragments 18S and and DAsqec analyses. sequence rDNA Bathocyroe Lampea eurdcsoie pri- customized required Deiopea . , COI Pleurobrachia 6 Kiyohimea generations COI and and 18S , Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. irr n sindterfamnsmr rcsl otndffrn pce ahrta he aiis Here, families. 6). three sequence (Figure than ctenophore matrix rather assembled presence/absence species newly a different our ten to used to We reduced precisely were com). identifications more pers. fragments species (Pitz, their level assigned family and the library to only assigned were n21 natastfo otryBy A S otemuho h ufo aiona XPitz MX California, of Gulf the for sequenced of they mouth which tows the net to vertical USA meter-depth 100 CA, with Bay, COI stations Monterey offshore from 15 sampled transit (2020) a on 2012 In pce eervae ob rl ompltnwt olwd ra es ca-ai iedistributions wide ocean-basin least 3a), other at (Figure Conversely, or evident worldwide MOTUs. was 3.3 with new saturation cosmopolitan and some truly complexes and be species 4b). supported to cryptic (Figure well several revealed amongst were relationships for not level support species still deeper high were Although than revealed taxa variable 4b). analyses more related (Figure is MOTUs distantly marker 27 the more the between using since taxa sites successful Distinguishing informative more due parsimony 4a). and was taxa (Figure Lobata among Lobata genera relationships the Posterior the and most to species for 4a). for unresolved among (Fig and data resolution genera poor low many sequence relatively to between were all even values and within bootstrap and within sites probabilities differentiation parsimony-informative little showed 47 analyses only phylogenetic included and conserved among TrN+i+ distance a GTR had 30% our and of green) majority 3b). or The the blue, (Figure repre- by pink, ctenophores was represented group; of distance, were (within (gray) GTR few ˜17% peaks orders 10% had at largest different at we two occurred centered although and The peak efforts GTR, complexes. small showed sequencing 0-4% species second and comparison around The closely-related 0–43%, In variability, by from estimate. within-species sented 3b). between this represented plot- ranging for (Figure peak also samples large, sequenced first we relatively within-species individuals phylum, The were all the MOTUs peaks. within for between diversity four distances distances of GTR phyla, levels other pairwise illustrate to to between reso- trees. order and phylogeny poor In within likelihood the 2). maximum ted in (Figure and reflected values Bayesian were support the 3a) without in (Figure taxa for amongst species relationships other relationships related Phylogenetic level the distantly deeper between for of saturation pattern lution of same levels high the including; The saw codons saturation. We of stop levels of high presence distinct. were the ˜30% there without than transversions align and more could distinct ND4 ˜25% we were than that more that general were loci the and that species mitochondrial to species for transitions contrast for transitions saturated in than saturated of were common is Transitions were more found which proportion two-fold 1996). transversions, we often the al. of are sequenced, transversions et that plotted ctenophores where (Xia than DNA), For we mitochondrial greater position. mammal 3a). was taxa, (for codon transitions (Figure rule third within of sequences the proportion at all and were the among changes between that of distance bases saturation majority GTR vast the versus examine the in transversions and to G, rich 13% order generally and C, are In 16% ctenophores T, 21% in A, (Pett loci GTR+i+ 50% (T) ˜ a Mitochondrial were thymine used we and 2). and (A) (Figure fragment adenine results (bp) jModelTest base-pair on 765 a based to trimmed was It The the amplified successfully pairs primer of to specific was which . hlgntc n pce Delimitation Species and Phylogenetics | 3.2 | COI 18S eaacdn rget.Teatosfud9105 found authors The fragments. metabarcoding and eaacdn ctenophores Metabarcoding lgmn fteLbt nldd8 eune o 9MTs hswstimdt 70b and bp 1780 to trimmed was This MOTUs. 29 for sequences 82 included Lobata the of alignment lgmn nldd14sqecsrpeetn 7MTs(oeua prtoa aooi units). taxonomic operational (molecular MOTUs 67 representing sequences 174 included alignment ND5 Γ Fgr 1.I hs ee swl,tasesoswr oecmo hntastosand transitions than common more were transversions well, as genes these In S1). (Figure oe eemndwt Mdletfrpyoeei nlss The analyses. phylogenetic for jModelTest with determined model .forskalii B. COI u loapie otBris o eea pce,mlil combinations multiple species, several For Beroids. most amplified also but mn l h tnpoe eeteeoeprrydi nuroe tree unrooted an in portrayed therefore were ctenophores the all among tal. et COI 01.Aeaebs opsto o l tnpoe sequenced ctenophores all for composition base Average 2011). rget(iue1 2). 1, (Figure fragment 5 COI eune rmtite ftesain that stations the of thirteen from sequences Γ 18S. oe o hlgntcanalyses phylogenetic for model The 18S COI COI OI OI,CytB, COIII, COII, rgetwsvery was fragment rgethd199 had fragment rgetlimited fragment 18S tal. et and Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. aionams lsl ace h ecito of resembled description California from the 5f) matched closely most California a ,5–) hr r he ecie pce ihntegnsincluding genus the the by within returned species was longigula Mexico, described that of B. three MOTU Gulf are single the There the from 1978) to distinct 5d–f). contrast a b, in for 4a, Mexico, support California, strong of gave Gulf which distance, GTR ˜17% The However, by MOTUs trait. two misleading other a species. often the is from color differed although A,’ color, red brilliant was a genus one the within returned species 4). that suspected (Figure species ecologically undescribed or several Lampocteis morphologically of differed designation but the MOTU, reinforced sequencing Mitochondrial n ora(iue4) lal,mr aafo oelclte,aogwt rncitmsadgenomes, and transcriptomes 4.3 with the along but localities, ctenophores, more among of from relationships point. individuals data understanding more in few Clearly, critical a are 4a). of (Figure exception Moorea the and with undifferentiated, were of genus species Johnson tropical and 4b; example; new One a and 4b). with (Figure clade supported polyphyletic were genera mikado many that revealed Thalassocalyce the When trbtbet OU,adpoe sflfrseisdelimitation. species for 4.2 within the useful resolution, on proved especially phylogenetic based and supported, poor conclusions MOTUs, in well strong to resulted make were taxa attributable S1). to groups divergent difficult (Figure satu- among and was transversions saturation transitions it species of Although and where related proportions 4b). pattern, higher closely (Figure were same Lobata saturation, there the the of and revealed levels distance, also high GTR loci Despite ˜20% (purines=pyrimidines) mitochondrial at transversions overly of often other were enriched quickly, incidence of data greater are rated of our Plots a ctenophores within to bases of contribute transitions transitions. genomes of could of than mitochondrial also exchange proportion which The the the residues, that obscured. A/T involve plausible were with is and the mutations than It additional mutations common for 1996). and more synonymous transversions saturated al. often in than et are in (Xia result transitions transitions shapes resulted usually of loci, similar and protein-coding they proportion For relationships because higher higher-level 3a). within transversions a many (Figure Saturation found mitochon- ctenophores obscured of we among 3b). positions, levels fragment Curiously, (Figure high codon 4% Despite third polytomies. exceeded 2016). at basal Pett rarely especially & ctenophores (Lavrov among phylum, of genes Metazoa the diversity mitochondrial the for in within-species saturation highest variation, and the drial divergence of base of some levels ˜700-1000 are the amplify However, ctenophores to groups. between us and enabled within pairs primer mitochondrial existing COI the few of a with pairs combined primers Newly-designed 4.1 4 | Discussion | | | COI hlgn luiae ra elo pce-ee iest htwsnteietfrthe for evident not was that diversity species-level of deal great a illuminated phylogeny opooia n oeua concordance molecular and Morphological h Lobata The hlgntcanalyses Phylogenetic (Japan), rgetrvae he distinct three revealed fragment COI Bolinopsis s.V Fgr b,dffrdb 1%GRdsac n eesgeae ydph third A depth. by segregated were and distance GTR ˜10% by differed 5b), (Figure V’ ‘sp. Hrt ta.21)fo hlo aesi Japan. in waters shallow from 2011) al. et (Horita hlgn a iie otelbt tnpoe,wihfr oohltccae(including clade monophyletic a form which ctenophores, lobate the to limited was phylogeny n etd;Pdr 01,pyoeei eouinwsipoe,adthe and improved, was resolution phylogenetic 2001), Podar, Cestids; and .vitrea B. tal. et nmossleidyi. Mnemiopsis OUfo h atr aicwr nadsic n elspotdcae(Figure clade well-supported and distinct a in were Pacific eastern the from MOTU npe) hswsi otatt the to contrast in was This prep). in (Bahamas), COI .longigula B. .paragaster B. rgetfr6 OU rmalgop fceohrs(iue2.The 2). (Figure ctenophores of groups all from MOTUs 66 for fragment B. Lampocteis h eprt species temperate The aff. somewhat Bathocyroe Rlh&Kbry15)fo h ot etr aic and Pacific, Western South the from 1950) Kaberry & (Ralph vitrea s.A’(iue5)wihaetpclyabrrte than rather amber typically are which 5c) (Figure A,’ ‘sp. .fosteri B. , 6 Hwi)and (Hawaii) nhvn neogtdsooau,bti akdany lacked it but stomodaeum, elongated an having in OU olce rmClfri,adoefo the from one and California, from collected MOTUs COI 18S Fgr 5d) (Figure rgetalone, fragment oiossinfundibulum Bolinopsis apcescruentiventer Lampocteis Bathocyroe rgetweeseiswithin species where fragment .ashleyi B. COI B. COI Bathocyroe . aff. .fosteri B. eepoie sflstarting useful a provides gene Asrla l omdawell- a formed all (Australia) aff. eune for sequences vitrea COI fosteri olce erHawaii near collected eune eeeasily were sequences aff. Mdn&Harbison & (Madin 18S A olce from collected ‘A’ longigula Alni Ocean) (Atlantic Fgr a and 5a) (Figure rget(Figs. fragment Lampocteis COI 18S Bolinopsis Bolinopsis fragment, fragment (Figure COI 18S ‘sp. Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ooe pt ln h eiinlcnl n h u perdwdrta htof that than wider appeared gut the and canals the meridional the along spots colored e o aawr ure gis eune eeae ytenwceohr rmr,w eeal to able were we primers, over changed ctenophore diversity how new illuminating the ctenophores, of by species generated stations distinct ten at sequences to tows against sequences net of queried thousands vertical were assign depth to data 100-meter primers tow Pitz took ‘barcoding’ Mexico, net used California, that of commonly for study was Gulf ctenophores of a paucity the some there failure to The In the manuscript CA Bay, databases. of phylum. this Monterey result BOLD divergent from of a and highly writing mostly GenBank the the is on amplify data ctenophores of sequencing of As with mitochondrial species marker of ˜eight high-resolution critical. for a is genetics, genomes) library population mitochondrial and reference function, good ecosystem biodiversity, a explore to order In of specimens contrast, In MOTU. are but maculata Europe), maculata (near Ocean guttata Atlantic crystallina the O. from worldwide described distributed be both to including were thought and coloration, distributions sympatric on have based These subspecies two with distributions sympatric both genus with The those for 4b). revealed (Figure were bet- isolation complexes were many allopatric species relationships revealed phylogenetic and cryptic sequencing Lobata, many Mitochondrial Within and genetics. supported species. ter population distinct for genetically the marker but make cryptic good Ctenophores morphologically a of general, diversity in sequencing within-species drial of of levels species high both The or one whether unclear is it Spec- so the distribution. sequencing, of oceanic for one broad unavailable as a were MOTU and Japan same capabilities from the dispersal was high also has of Islands species imens Hawaiian this showing the California, of from offshore collected specimen single COI to new or tinctions, described already those and of match species amplify sequenced collected for now we The unavailable only can MOTUs identifications. was world-wide were species the researchers and localities confirm primers of rare, type to new any relatively help from our was if with specimens MOTUs, divergent unclear However, Unfortunately, other most is science. the the 5e). it all were (Figure so California, from and depth sequencing color from the f) meters and MOTU to 5d, 3000 third shape upwelled (Figure below gut The occasionally shape distinct GTR). be gut a (15% in to had molecularly distinctions known another small are one California, had from species In but deep distributions, (although waters.). ranges, surface those the in at surface collected was Japan erywrdiedsrbto Jhsne l,i prep). in 4.5 al., not et were (Johnson distribution regions yet worldwide subspecies, other nearly named from many to specimens lead Unfortunately, as the such subspecies Regardless, lineages. one distinct sequencing. for three available represented Hawaii, and 4.4 undescribed. are Bay Monterey B. ioie usagi Kiyohimea | | COI rgetw on w itntlnae of lineages distinct two found we fragment DAadmetabarcoding and eDNA of subdivision Population aff. .kaloktenota, D. Deiopea Ocyropsis rgetsqecsas eovdterltosisbetween relationships the resolved also sequences fragment longigula ih eajvnl omof form juvenile a be might eune rmFoia utai,adTht eecoeyrltdadalrpeetdone represented all and related closely were Tahiti and Australia, Florida, from sequenced rmClfri a anyfudfo 20–00mtr et and depth meters ˜2000–3000 from found mainly was California from a odeape Currently, example. good a was Mtuoo&Rbsn1992) Robison & (Matsumoto COI hc esqecdoeseie omFoia The Florida. form specimen one sequenced we which .cytliacrystallina crystallina O. hc eedsrbdfo h .Alni,and Atlantic, N. the from described were which and 18S, .cytliacrystallina crystallina O. . u a nyal oasg aooymsl otefml ee.When level. family the to mostly taxonomy assign to able only was but Ocyropsis .mclt maculata, maculata O. w te useiswr ecie rmteGl fMxc,including Mexico, of Gulf the from described were subspecies other Two Ocyropsis B. aff. Kiyohimea Deiopea a aemn eei n opooia itntosthat distinctions morphological and genetic many have may longigula . eu ersnsjs n neetn ihtm where dichotomy interesting one just represents genus Ocyropsis .cytliacrystallina crystallina O. 7 twsfis upce htdsiemrhlgcldis- morphological despite that suspected first was It rmClfri nadto ota of that to addition in California from Mtuoo&Rbsn19) ysqecn the sequencing By 1992). Robison & (Matsumoto lsl eae pce ihntegnshsa has genus the within species related closely a eune rmFoia h ufo California, of Gulf the Florida, from sequenced and tal. et otistorbsl ecie pce,each species, described robustly two contains B. COI aff. 22)scesul eune tleast at sequenced successfully (2020) , otr ‘ fosteri .aurita K. eoe kaloktenota Deiopea rget n osbymitochon- possibly and fragment, COI rgetfrseiesof specimens for fragment and Bathocyroe ’hdoelpigdepth overlapping had A’ .longigula B. Kmi&Tkoa1940) Tokioka & (Komai .mclt maculata. maculata O. COI Bathocyroe aa(including data aff. .longigula B. Deiopea naddition, In . Cu 1880) (Chun .usagi. K. fosteri Deiopea from and ‘B’, O. in A Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. nemn,Lizg -1 eal ,GlsenP(09 eiwaditrrtto fted nDNA in trends metabarcoding. ctenophores. of and DNA interpretation sponges environmental and through Methods structure Review Oceanography: community and (2019) zooplankton P marine of Goldstein uation R, DeSalle 1-311 barcoding. Meeres-Abschnitte. angrenzenden der Leipzig. by Sciences und revealed Engelmann, Biological Neapel as von structure B: Golfes web Society des food Royal pelagic the Deep of (2017) Proceedings BH Playtctenida. Robison benthic SHD, from dock insights Ctenophora: identification. the model in statistical the at look 19 new A (1974) H the Akaike by funded and was SHDH) work to References (R01-GM087198). This 1542679 (NSF-DEB Health Foundation library. of Science Katie Institutes metabarcoding acknowledge National National graciously the her Sciences, the Foundation, also from Packard the We Lucile of sequences breadth. and Academy sampling ctenophore David our California collect provided by increase Aquarium), Kim, helped who donated to Stacy Bay 2, We Center were Pitz, Browne, (Monterey Legacy figure specimens William Patry sea. Genome for Lundsten, Numerous Wyatt Ocean at Lonny silhouettes and Madin, Clague, support manuscript. the Larry David for the Walz, of Bayha, Thun Kristine on some Keith Von Sherlock, comments created Susan Rob constructive who and Robison, his Winnikoff Bruce Schlining instrumental for Jacob were Kyra data Prickett and thank thank transcriptome Maile we specimens, to our and and like Woods of help, also April many would sequencing generating manuscript. for and the Francis on PCR Warren comments in thank helpful providing to for like and would We the of diving. pilots blue-water and and crew Carson Rachel the acknowledge gratefully We 1. Acknowledgements Figure in indicated are sequences Primer COI Accessibility statistical manuscript. the performed Data the data, H.D. draft of transcriptomic Steven to provided funding, Schultz helped most some manuscript. specimens, T. and the sequence provided sequenced study, Darrin analyses edited and the and manuscript. amplify and conceive sequences, the to helped mitochondrial drafted amplified Haddock helped data, and Johnson transcriptomic collected, analyses, B. specimens, statistical Shannon valuable primers, performed manuscript. ctenophores, study, the the of the draft se- helped designed to and continue ctenophores, Christianson we M. As Ctenophora. Lynne within ocean. relationships and of world identification understanding the Contributions species better with Author in a help provide small will researchers sequence also information and primers, sequence will and new new large and ctenophores, our descriptions, amplify processes of from diversity of to amplified broader a sequences understanding worldwide quence our our researchers of increase publication enable the can will With studies. herein metabarcoding designed sequences, mitochondrial the and primers ctenophores for primers of ctenophores the diversity new of of conclusion, spectrum addition full In the the include With to ocean. primers were world samples. common there the net-tow redesign assignments, in the to taxonomic primers able successful in Common now had species are we 6). researchers ten although (Figure and than ctenophores Eugenia more of Punta certainly groups and few a Conception amplify Point only barriers, biogeographic important two 1-2.Aaa ,AaauA is ,Hco 21)Etniemtcodilgn rearrangements gene mitochondrial Extensive (2018) D Huchon C, Gissi A, Alamaru H, Arafat 716-723. , and 18S rnir nEooyadEvolution and Ecology in Frontiers eunefamnswr eoie nGnakwt ceso ubr xxxx TbeS1). (Table (xxx-xxx) numbers accession with GenBank in deposited were fragments sequence ROV etn o hi epwt olcigteedlct pcmn n sitnewith assistance and specimens delicate these collecting with help their for Ventana rnsi clg n Evolution and Ecology in Trends 16 0-2.Dn W esS,HdokSD(05 h idnbooyof biology hidden The (2015) SHD Haddock SP, Leys CW, Dunn 209-221. , COI ou o uc dnicto,a ouaingntcmre,adfor and marker, genetic population a as identification, quick for locus 7 0.Duhu ,Pt ,Swy NA Sawaya K, Pitz A, Djurhuus 302. , 8 R/V M vltoayBiology Evolutionary BMC 284 30 0716 hnC(80 i Ctenophoren Die (1880) C Chun 20172116. , 8-9.El A ayEglT,DiBattista TS, Daly-Engel JA, Eble 282-291. , etr le and Flyer Western EETascin nAtmtcControl Automatic on Transactions IEEE lr n an e ofsvnNeapel, von Golfes des Fauna und Flora nsitu in ROV 18 1 hyC,Had- CA, Choy 11. , edn observations. feeding tal. et , o Ricketts, Doc 21)Eval- (2018) Limnology R/V 1 Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. n ffciesohsi loih o siaigmxmmlklho phylogenies. likelihood maximum nophore estimating for era. algorithm Evolution genomic stochastic the in effective inference regi- and phylogenetic for rRNA-coding methods Evolution efficient O 16S-like and and Chernomor models eukaryotic New H, amplified 2: Schmidt TREE enzymatically B, of Minh ps://faculty.washington.edu/cemills/Ctenolist.html characterization The ons. (1988) ML gin canyon. (1992) submarine BH terey Robison GI, Matsumoto cydippids. deep-sea submersible. 559-564. of a taxonomy from (1978) collected the GR and diversity. on metazoan Harbison molecular notes LP, new Madin with reveals samples Japan, coastal Trench, European Ryukyu on Researchanalysis the Benthos in and depth Plankton m reef coral 7,217 characterizing for from application diversity: metazoan contents. gut metabarcoding fish for region COI mitochondrial CP the diversity. Meyer JY, benthic Yang M, lineages. marine Leray nonbilaterian 2076-2081. of in patterns evolution reveal and samples organization mt-genome it: know Evolution not do we as Analysis Genetics Evolutionary biodiversity. Molecular E X: MEGA Normandeau (2018) K, K Tamura C, platforms. Knyaz computing M, across Li G, Stecher S, Kumar Citarella Japan AB, Zool. (1940) Kohn Annot. T Pacific. Tokioka eastern T, the Komai in ctenophore lobate bootstrap new ultrafast ctenophore, a the KM midwater; Improving Kocot the UFBoot2: MR, in (2018) L Speciation Vinh prep) B, (in Minh ctenophores. A, oceanic Haeseler von of approximation. O, distribution Chernomor and D, history ang natural the On technology. (1978) maritime nuclear and and molecular using mitochondrial on based WR Francis DNA cnidarians. and environmental ctenophores marine planktonic of Metabarcoding (2018) genes. PM Arbizu S, for surveys. cytochrome depth mitochondrial sequencing invertebrates. for optimal primers metazoan an suggests from animals assembly. I non-model tome subunit across oxidase comparison Biotechnology A C and (2013) cytochrome Biology throughput. mitochondrial high Marine of and Molecular accuracy amplification high for with primers alignment sequence Research multiple Acids MUSCLE: opportunities. (2004) and R applications, Edgar Approaches, DNA: Environmental Marine (2020) In: MR Gaither A, Koziol JD, dacsi aieBiology Marine in Advances Genetica cetfi Reports Scientific nmossleidyi Mnemiopsis oeua clg Resources Ecology Molecular 32 8 luorci bachei Pleurobrachia tal. et , 8621.LryM nwtnN(05 N acdn n eaacdn fstandardized of metabarcoding and barcoding DNA (2015) N Knowlton M, Leray 2896-2913. , 6-7.Pt ,Ra R agK Pang JR, Ryan W, Pett 268-274. , Evolution and Ecology 71 37 oeua ilg n Evolution and Biology Molecular tal. et , 32 M Genomics BMC 9-9.MlsC (2017) CE Mills 491-499. , rnir nZoology in Frontiers 5013.Nue ,ShitH o aslrA ihB(05 QTE:Afast A IQ-TREE: (2015) B Minh A, Haeseler von H, Schmidt L, Nguyen 1530-1534. , tal. et , 21)Isgt noteboiest,bhvo,adbouiecneo epsaorganisms deep-sea of bioluminescence and behavior, biodiversity, the into Insights (2017) 7219.Fle ,BakM,He R uzR,Viehe C(94 DNA (1994) RC Vrijenhoek RA, Lutz WR, Hoeh MB, Black O, Folmer 1792-1797. , 19 43-46. , 21)Rpdeouino h opc n nsa iohnra eoei the in genome mitochondrial unusual and compact the of evolution Rapid (2012) 8 42.HdokSD(04 odnaeo eaa atadftr eerhon research future and past gelata: of age golden A (2004) SHD Haddock 14822. , ultno aieScience Marine of Bulletin 21)eN eaacdn sanwsrelac prahfrcatlArctic coastal for approach surveillance new a as metabarcoding eDNA (2018) nihsfo tN n h ula genome. nuclear the and mtDNA from insights : oeua ilg n Evolution and Biology Molecular ioie aurita, Kiyohimea . 2 e.Sepr ) p 4-6.Esve t. odn ntdKingdom. United London, Ltd., Elsevier 141-169. pp. C), Sheppard (ed. oeua hlgntc n Evolution and Phylogenetics Molecular 14 ahcrefosteri Bathocyroe ora fteMrn ilgclAscaino h ntdKingdom United the of Association Biological Marine the of Journal 812 ´pzEcr´ ,Pp ,C dV C. J, L´opez-Escard´o Paps 98-102. D, , 6.Gle ,MyrC akrM akH(03 eeino PCR of Redesign (2013) H Hawk M, Parker C, Meyer J, Geller 167. , 8 ioie usagi, Kiyohimea 10 7377.Lvo V etW(06 nmlmtcodilDNA mitochondrial Animal (2016) W Pett DV, Lavrov 7763-7777. , c 13 Hydrobiologica tal. et , 4 ida J iaeH(07 oe etoeai ctenophore benthopelagic novel A (2007) H Miyake DJ, Lindsay 34. , uui o aieivrertsadapiaini l-aabiotic all-taxa in application and invertebrates marine for I subunit 5-6.G 851-861. , Oceanography 21)Anwvraiepie e agtn hr rgetof fragment short a targeting set primer versatile new A (2013) 3 hlmceohr:ls falvldseisnames. species valid all of list ctenophora: Phylum .gn,n p,tp fanwfml flbt Ctenophora. lobate of family new a of type sp., n. gen., n. 9-9.FacsW,Crsino C ioR Kiko LC, Christianson WR, Francis 294-299. , 35 tal. et , 1-2.JhsnS,Wnio R cut DT Schultz JR, Winnikoff SB, Johnson 518-522. , rceig fteNtoa cdm fSciences of Academy National the of Proceedings 9 e.o. pnv:amsplgcceohr observed ctenophore mesopelagic a sp.nov.: gen.nov., nhrB nblbre ,NuanH Laakmann H, Neumann T, Knebelsberger B, unther 530/531 ¨ 51 e pce flbt tnpoefo h Mon- the from ctenophore lobate of species new a 30 21)Eteemtcodileouini h cte- the in evolution mitochondrial Extreme (2011) 92.Mdi K lodH,SiklS So- S, Stickel HJ, Elwood LK, Medlin 19-29. , 94.Hrio R ai P wnegNR Swanberg LP, Madin GR, Harbison 39-47. , 35 5714.Lacoursi`ere-Roussel Howland 1547-1549. A, , 4-5.HdokSD hitasnLM, Christianson SHD, Haddock 549-556. , epSaResearch Deep-Sea 63 iohnra DNA Mitochondrial 203-207. , tal. et , cetfi Reports Scientific oeua ilg and Biology Molecular 21)Metabarcoding (2018) eoeBooyand Biology Genome tal. et , enovo de oeua Biology Molecular 25 3-5.Ho- 233-256. , 22 22)IQ- (2020) transcrip- 130-142. , 8 Nucleic tal. et , 9106. , tal. et , 112 58 htt- , , Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. IUE3a rniin n rnvrin essGRsqec iegnead()Piws percent Pairwise the (b) for and sequenced species divergence ctenophore sequence all amongst GTR and versus within transversions (GTR) distance and by sequence colored Transitions (green). indicate Branches Platyctenes 3(a) open pairs. and FIGURE and primer (blue), forward successful Beroids indicate multiple (pink), Lobates triangles indicate including; Closed triangles group triangles. Multiple primers. colored by direction reverse indicated pairs primer successful IUE2Bysa notdpyoeyfr75bp 765 for phylogeny universal. more unrooted are Bayesian * with 2 marked FIGURE Primers base. to according colored and oiinue oapiyadsqec l ruso tnpoe nldn C19/C29 (Folmer LCO1490/HCO2198 including set ctenophores primer of each groups for all conditions sequence and reaction al. amplify PCR to and used amplified, position gut taxa published in position, to variation binding relative regional Primer 1(a) of FIGURE analysis Metabarcoding (2020) Legends A Figure Bucklin KR, copepod Maas the gophers. of JM, pocket contents of Questel genes HD, mitochondrial in Yeh bias transition On Evolution (1996) Molecular PD Sudman of MS, evolution. Hafner and X, Xia biology molecular in analysis data 1550-1552. analysis for data tools tool for improved phylogenetic graphics misconceptions. online Elegant Popular fast (2012) ggplot2: a RS Waples W-IQ-TREE: RC, (2016) hoek B Minh McInnes T analyses. A, J-B, Koressaar prey? likelihood Haeseler Thiebot gelatinous maximum von MA. eat Boston, L, for endotherms Inc, Nguyen marine RStudio J, R. do Trifinopoulos for Why Development (2020) Integrated JC RStudio: Straight. (2015) Cook Team from R Ctenophores College Coelenterates. RNA University Zealand Victoria small New from (1950) of cations C potential Kaberry the PM, Ctenophora. Ralph Exploring phylum (2015) within relationships M phylogenetic Manuel resolving Qu´einnec E, for 102-114. sequences M, ITS Jager and microbes. subunit N, marine by Bekkouche targets P, primer Simion mitochondrial metazoan to convergence transi- in 8 biodiversity zooplankton al. of Assessment et - analysis waters. morphological tional and metabarcoding DNA (2020) space. JC model datasets. S´anchez large D, a A, across Ferrer-Mata choice J, model 1.7. and Tracer inference using phylogenetics phylogenetic Bayesian in summarisation depths Posterior abyssal Biology (2018) to MA flux Suchard matter ocean. G, Pacific particulate Baele East to 18S contributing North using organisms the Ctenophora reveals in metabarcoding phylum substitution. DNA the (2020) DNA for KM of framework model phylogenetic the molecular Testing A (2001) genes. GR rRNA Harbison ML, metabarcoding. gin from determined SB as Johnson System J, Guo K, Pitz idl E otnlaF,Wto C vs ,EsesC(09 acdn aboldb bacteria: by bamboozled Barcoding (2009) Ers´eus C S, Kvist SC, Watson FM, Fontanella ME, Siddall . 94 n eaCIF/eaCIR (Pett meta-COI-F2/meta-COI-R2 and 1994) 22)CnevdnvlOF ntemtcodilgnm ftectenophore the of genome mitochondrial the in ORFs novel Conserved (2020) syy032 oeua ilg n Evolution and Biology Molecular tal. et , oeua hlgntc n Evolution and Phylogenetics Molecular aieEvrnetlResearch Environmental Marine oqitF elnoM a e akP Mark der van M, Teslenko F, Ronquist . 21)Pie3nwcpblte n interfaces. and capabilities Primer3—new (2012) nmossleidyi Mnemiopsis 43 aau finmarchicus Calanus 32-40. , tal. et , epSaRsac atII Part Research Deep-Sea tal. et , uli cd Research Acids Nucleic 22)Zolntnboegahcbudre nteClfri Current California the in boundaries biogeographic Zooplankton (2020) eune nldn h Fle’rgo b rmrsqecsand sequences primer (b) region ‘Folmer’ the including sequence, 3 Bioinformatics 21)DaP6 N euneplmrhs nlsso large of analysis polymorphism sequence DNA 6: DnaSP (2017) pigrVra,NwYr.XaX(08 AB7 e and New DAMBE7: (2018) X Xia York. New Springer-Verlag, 1-11. , 34 lsOne Plos 2930.ShodrA tnoicD alvcn A Pallavicini Stankovi´c D, A, Schroeder 3299-3302. , nteNrhAlni Ocean. Atlantic North the in 160 tal. et 096 cut T ieg M obt-ei RB Corbett-Detig JM, Eizenga DT, Schultz 104946. , 21 10 oeua Ecology Molecular 01.Dffrne from Differences 2011). 15 1-3.Psd ,Cadl A(98 Modeltest: (1998) KA Crandall D, Posada 218-230. , COI 14 03590350 oa ,HdokSD So- SHD, Haddock M, Podar e0231519-0231520. , 44 173 1-1.PetnC,Dri A Yamahara CA, Durkin CM, Preston 817-818. , tal. et , rgetfralceohrssqecdwith sequenced ctenophores all for fragment 22W3.UtrasrA uctceI, Cutcutache A, Untergasser W232-W235. , CSJunlo aieScience Marine of Journal ICES 078 abu ,Dumn ,XeD, Xie A, Drummond A, Rambaut 104708. , uli cd Research Acids Nucleic 21)MBys32 ffiin Bayesian Efficient 3.2: MrBayes (2012) ytmtcBiology Systematic oeua ilg n Evolution and Biology Molecular 21 1545.WchmH(2016) H Wickham 4155-4156. , ytmtcBiology Systematic epSaRsac atII Part Research Deep-Sea .leidyi M. eo forskalii Beroe r niae nbold in indicated are COI 61 40 3-4.Rozas 539-542. , fragment. olg Publi- Zoology 15 Vrijen- e115. , Zoology 4 Systematic 77 445-451. , 58-71. , Journal . tal. et , PeerJ 118 . 35 et , , , Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. IUE4Bysa n aiu ieiodetmtdpyoeisfrfamnso (a) of fragments for phylogenies estimated likelihood maximum and TrN+i+ Bayesian 4 FIGURE r dnia with identical are with distribution scattered the showing COII for divergence sequence (LN898115), to GTR USA, versus California, transversions Central cucumis and from Transitions of spanned S1 fragment that FIGURE bp SUPPLEMENTARY transect Pitz 311 a from a along Mexico for 2012 California, species in Baja ctenophore collected Southern assigned tows of net matrix meter-depth absence 100 and Presence 6 FIGURE (e) gut), red longigula small (a) m, of specimens (560–3572 of ‘A’ meters in depths known Florida, (b) S1) and (FL) (WH) (Table Washington, Images California, (WA) Locations 5 Tahiti, (CA) (TA) FIGURE Norway, Bahamas, support. (NO) (BA) Japan, low (JP) Australia, having US, (AU) Hole Hawaii, nodes Woods (HI) including: unlabeled California, labels of with blue Gulf nodes, (GC) the the in on indicated triangles are by indicated are Lampocteis 56bp) (536 Γ (MK361035), n (b) and ) 10–88m i gut) big m, (1900–2858 ompoacalifornensis Hormiphora COIII , p V ˜5030 ) (c) m), (˜1500–3000 ‘V’ sp. 18S COI eo forskalii Beroe (601) u omdsic ldswith clades distinct form but 75b,GTR+i+ bp, (765 CytB , 50bp) (570 Bathocyroe (MG655623), M540) and (MN544300), 18S Γ Lampocteis ooe akrud niaeteseisof species the indicate backgrounds Colored . iie oLbt ctenophores. Lobate to limited ) tal. et ND4 , aff. (2020). 49bp) (429 11 olpaaloyai Coeloplana fosteri COI p A,(5020 ) (d) m), (˜500–2800 ‘A’, sp. nmossleidyi Mnemiopsis ohlklho n aeinspotvalues support Bayesian and likelihood Both . , B ( ‘B’ and > ND5 apcescruentiventer Lampocteis 00m ec u) (f) gut), peach m, 3000 (LN898113), 56bp) (506 J701)for (JF760210) Bolinopsis . olpaayulianicorum Coeloplana Bathocyroe pce r bolded, are species Lampocteis COI Bathocyroe ˜5–50m) (˜250–1500 18S aff. 11 bp) (1311 COI 18 bp, (1780 fosteri which Beroe from aff. , Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. LCO1490 LCO1490 A B *meta-COI-F2 F259MBBoli Aula119F *F259Mod5 1 F259CydB *LCO1490 Aula1 F259Bfor LSC204F F259Ocy

Cyd202F 14 SC253F SC259F Aulacoctena, F259Ne SC204F F256Ct M. leidyi M. leidyi M. leidyi M. leidyi *F259 M. leidyi 100 19F CYD202F LSC204F SC204F

119 F259MBBoli F259CydB F259Bfor Ocy259F F259Ne F256Ct 694 TTKYTGRGGNCACC TTATTTTGATTTTTTGGCCATCC 253 202 GCGTCTTTATTAGTTGACCTT GCGTTTAGCTTTAGTTTGACCTTTTGC 102 TTTCTACTAATCACAAAGATATAGC 14 5′ Bathyctena, GGTCAACAATCATAAAGATATG 200 CATTTGGCTGATATGTGTTTACCTCGTAT GGTTGTCGAATGCC ATGCCTTTTWSHWTWGGNTT ATGCCTTTTAGTATAGGTGGTTTATC 204 210 GCCWTTTTCTATGGNTTR GCCTTTTTCTATGGTGGTTTAGG

GCTAGATATGTTTACCT 213 Primer binding position relative toMnemiopsisleidyiCOI Primer bindingpositionrelative Undescribed sp.BRD,RG SC253F, 259F 253 Lampea, Vallicula,Undescribedsp.C.,platyctene 256 GCTGACATGGTCCACG GTTGATATGTGTTTCCTC CCTGATATGTTTGCCTA ATTGATATGTGTTTACCTCG GCCGATATGTGTTGCCACG GCTGATATGTGYCTCCTAG GCNGATATGTGYYTCCNMG GCWGATATGTGTTTACCYMG 259 300 Beroe FORWARD Aulacoctena abyssicola, 400 Ocyropsis Undescribed Beroe spp. Bolinopsis aff.infundibulum Euplokamis, Lyrocteis, Undescribed Charistephane, Undescribed 500 spp. 716 . sp. ATC Undescribed Undescribed 38 meta-COI-F2 227 K 119 3’ sp. 600 sp. 281 Coeloplana N C 12 sp. sp. 700 M 694 B SC870R *meta-COI-R2 HCO2198

SC942R 725 M. leidyi *R866 *HCO2198 *R1060Mod4 M. leidyi 800 M. leidyi Ct1060R M. leidyi *R1060 Aula1307R Tj M. leidyi CATRTGNGCYCAACA CATATGATGGGCTCAAACTAAACAACCT 870 M. leidyi GGTAGGAACTGCAATTAAGTAGC AGTAGGAATAGCTATGATTAAGGTAGC 942 866 R866 R866 R866 R866 900 SC870R TAAACTTCTGGATGGCCAAAAAATCA TAAACTTCAGGGTGCCAAAAAATCA 5’ 725 870 Mertensia GATGAGCTCAAACTACAACCT GAKAAACGTAGTGRNGC GATAAAACGTAATGAAAATGAGC 1139 1060 TWCCAGAYRRCCAAAGT TACCGGATAGACCTCCAAATGT ACCRGAYAGCCCCAAA ACCAGTTACCCAATGT

942 SC870R, SC942R 1000 1307 CGAGGTAAACCTCATAAAC CGGGGTAAACCTCATAAAC REVERSE (bp) R1060 1059 R1060 R1060Mod4 Ct1060R

1100 1060

1139 meta-COI-R2 1200 1289 AGT 1117 1039 Aula1307R 843 913 700 1300 3’

1307 Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary.

Lobates

E

u

r

h

a

m

p h

Boli B a

B. aff o e

M C

l a E

i n e

n

n

a o s v V

e B o

t

p f

e

p e u m f

. B. vitrea

vitrea

s

x l

s m

i m v a

l

s i il

i e o m

s

i i v

a p x

k g

e

a e

l

f il

s a e n

f L

i s n

i d e

i s r

g h e

n p a D

o u

r

f e l a

l e c

u e

e i

s

r r

i

n o y o

a

B i a

d t

d p

i

h

l

.

l

i y e e

b e

i a

i n a

L l

u u

k

a f

c u pul l m

m n u a l

p d m o

o i k

t

b r

c e

a

D

teis u n

o

lu e

i t

o

m a usagi Kiyohimea

c p

r e

u O

a a Lampocteis sp

T e c

h y

n r a o

la ti p

s v s

s i

e s o

c n m

a t a

ly e c

c r u

e sp. V l

a

i t

Lampocteis n a c

o m

n a

s c

ta u l

n a

s t

sp. A a

D guttata crystallina O. ryo crystallina crystallina O. do P ra leur sp obra chia

bac

hei

O.

Hor aff mip crystallina hora califor nensis

Pleu 13 robra chia pileus

Bathocyroe aff fosteri GoC

Horm iphora sp Undescribed sp. N sp. Undescribed B. aff fosteri sp A

5

U

n

d

e B. aff fosteri

s 0 c

r

i b

e sp

d B .

s p . 0

W B. aff longigula

U B

n er

d oe

e

s ov

c a

r B ta i

b .

E

e fo

d

U r

s

s u k

p

n a .

d l

i

2 p i e

r

sc l

U o

C n i

b

d k B h

e

e

. d

a

a

s g

r

s

c r

i a

p. M p. m s

r

i c

t

b ili e

B

A

e s i p

d .

s

h

a

u

s

a d

Un f

p f

n s

l

. c a

e

K p u

c f c

e

u . u

s

g o m L c

i B

e

a c b ri i

s n B

m a

t

s e b

e e

p r d y

U e o

n s

s a e s

ndescribed sp. C sp. ndescribed C

a B

p i

U s c s

.

L a . o Call p

p

n s

R c l

y l a . B. d

G p l u

r i C

e c

o a

.

U H a u

s H

c n a i

U a ff m

c

V a

B n

t i lli .

e n n

r r e a i

a d a s

i a a r

i

b

d i c b

C

s r u l

t e n y

l B e a k e

h

s b i

o s s

s i c e d

s

A

y a p r r s

p

e c s l

c a

u a

c t i i

u

s p c

l a

. r Forward h

r Beroids

l o

t

p ol

c la i

a s

i e U

b y

b p b U 3

. p a

n c

n e e e m l

B

n

a J

a t Aula119F LCO1490 meta_COI_F2 o F259Ne d d 2 e F259Ocy F259Bfor F259MBBoli F259Mod5 F259 SC204/253/259F F259CydB

CYD202F d

LSC204F e a

d

n

u

c h

p

n e c

p

a e

l s l

PRIMER PAIRS t a

t a s e h

e

l s

i p n a

g c r

f u

n c i

o . chu

t o r

n a U y

r i

r B

n b

c i i

m

n

b

a o

t G e

e d n

i c e

c d s

n i

e

u d t

e e

m s s

n

s Platyctenes

c p

T

i

a p.

n r . j

i

a

v b B

t G

a e R a

r d

D n

s a

p t a

.

Reverse

l

e X

n

s

i

Aula1307R R1060Mod4 R1059 Spatchy942R SC865R R859 HCO2198 s meta_COI_R2

Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. a) Transitions and Transversions 0.0 0.1 0.2 0.3 0.0 GTR distance 0.2 0.4 0.6 Transitions Transversions 14 b) 100 150 50 0 0.0 0.1 GTR Distance 0.2 0.3 0.4 Group Between Group Platyctenes Lobates Beroids Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. Pleur A. obrachia bachei 0.007 SUPPORT PP BS 0.85-0.94 ≥0.95 75-89% ≥90% HI TA HI TA HI SB MB MB TA GC HI BA HI GC HI NO WH MB Bolinopsis af MB WH TA TA FL GC FL HI GC MB Bolinopsis af C. veneris FL Leucothea pulcra HI FL Bolinopsis af Bolinopsis af Kiyohimea aurita Eurhamphaea vexilligera Kiyohimea usagi Cestum veneris SB MB GC Lampocteis sp.A Lampocteis cruentiventer Lampocteis sp.V Deiopea kaloktenota Ocyr Bolinopsis infundibulum Bathocyr O. crystallina GC Mnemiopsis leidyi V Bathyctena chuni O. crystallinaguttata O. crystallina elamen parallelum BA Thalassocalyce inconstans opsis maculata Undescribed sp.4MP MB GC oe af f. infundibulum B. af B. af B. af Bathocyr f. vitrea f. vitrea f. vitrea f. fosteriA f. fosteriA f. fosteriC f. fosteriB oe af f. fosteri Bolinopsis af Lampocteis sp.A Bolinopsis mikado Eurhamphaea vexilligera f. vitrea Ocyr 15 Bathocyr B. Bolinopsis af Mnemiopsis leidyi B. vitr opsis maculata HI B. af Deiopea kaloktenota V MB Bolinopsis infundibulum elamen parallelum D. aff.kaloktenota Cestum veneris oe af ea BA f. fosteriA B. af Leucothea pulchra JP BA f. fosteri E. vexilligera Thalassocalyce inconstans B. af f. fosteriC f. infundibulum HI GC O. aff.crystallina FL GC f. fosteriB B. ashleyi TA CA,W Kiyohimea usagi O. crystallinaguttata GC MB FL SB AU GC O. crystallina TA TA A GC MB SB MB BA MB MB HI Lampocteis sp.V Lampocteis cruentiventer HI MB AU HI CA MB WH GC GC MB FL SB MB FL MB Pleur obrachia bachei MB 0.07 Posted on Authorea 8 Mar 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161516405.50876931/v1 — This a preprint and has not been peer reviewed. Data may be preliminary.

South South North P. Eugenia P. Conception P. Conception

V elamen par

Thalassocalyce alellum

Beroe

gr inconstans Beroe acilis

cucumis Cestum v 16

Ocr ener y opsis is

Haeck maculata

elia r Undescr ubr a Pleurobribed sp

T Char achia bachei istephane

fugiens