Variation of Complement Factor H and Mannan Binding Lectin in Human

Home , C4A, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5

Variation of Complement Factor H and Mannan Binding Lectin in

Human Systemic and Vascular Immune-Mediated Diseases

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Kathryn Jean Kitzmiller

Graduate Program in Integrated Biomedical Science Program

The Ohio State University

2009

Dissertation Committee:

Professor Carlos Alvarez

Professor Daniel Birmingham

Professor Heithem El-Hodiri

Professor Haikady Nagaraja

Professor C. Yung Yu, Advisor

Kathryn Jean Kitzmiller

2009

Abstract

Recognizing multiple pathogenic challenges, the vertebrate immune

system devises numerous layers of inherent and somatic changes. Heritable

inherent immune diversity among different individuals is characterized by gene

copy number variation (CNV) and polymorphisms of coding and non-coding DNA

sequences that collectively contribute to quantitative and qualitative diversities of immune proteins. We hypothesize that inherent genetic diversity of the immune system confers a spectrum of intrinsic strengths among individuals of a population to defend against infections, but inflicts different susceptibilities for immune-mediated diseases. As effectors of immune defense, the complement protein cascades engage in self and nonself differentiation and hemostasis.

Inherited or acquired complement deficiency predisposes an individual to recurrent infections and compromises immune tolerance leading to diseases such as Systemic Lupus Erythematosus (SLE), Antiphospholipid Syndrome

(APS), and Age-Related Macular Degeneration (AMD). Multiple organ involvement and autoantibody production are characteristics of SLE as well as antiphospholipid antibodies (aPL) and thrombosis which also occurs in APS.

Vascular and cellular abnormalities of AMD cause elderly vision loss. Factors affecting racial disparity and severity in SLE and AMD are not well understood at present.

Complement Factor H (CFH) regulates complement activation in plasma and on host cell surfaces to protect against complement-mediated damage.

Mannan Binding Lectin (MBL) deficiency associates with increased infection, thrombosis, and autoimmunity. To determine how complement variation contributes to intrinsic immune strength and diversity, we elucidated MBL and

CFH variants in healthy subjects of multiple races, and subjects with SLE, APS, and AMD.

PmeI Pulsed-Field Gel Electrophoresis and TaqI and PshAI-PvuII

Restriction Fragment Length Polymorphism-Southern blots revealed the complexity of the CFH gene region. We established a 76-kb CNV of CFHR3 and

CFHR1 (CFHR3-R1) present at 0, 1, or 2 copies, and varies among healthy subjects of different races (χ2=181, p=2.28x10-36). Increased CFHR3-R1 deficiency demonstrates a dosage effect for African American SLE risk such that

CFHR3-R1 heterozygous deficiency associates with an OR of 1.67 (95% C.I.

1.09-2.61, p=0.03) whereas CFHR3-R1 homozygous deficiency has an OR of

1.94 (95% C.I. 1.12-3.38, p=0.02). Higher copy numbers of CFHR3-R1, as determined by real-time PCR in European subjects, associates with neovascular

AMD (χ2=6.8; p=0.03). CFHR3-R1 has a dual role in racial disparity: high copy numbers in European American AMD risk and low copy numbers in African

American SLE risk.

Phenotypic variation of plasma proteins for CFH detected by radial immunodiffusion, and functional MBL detected by ELISA, enable the iii investigation of their role in SLE and APS. Subjects with aPL-associated SLE with thrombosis have reduced protein levels of CFH and MBL compared to aPL- only subjects (CFH: 48.9±9.7 vs 54.5±15.4 mg/dL, p=0.001; MBL: 0.114 ± 0.128 vs 0.173 ± 0.192 mg/dL, p=0.0041). Multiple promoter polymorphisms and exon1 variants in MBL correlate with quantitative variations of functional MBL levels among SLE cases.

In conclusion, quantitative and qualitative variation of CFH and MBL contribute to immune-mediated, human systemic and vascular diseases. Low

CFHR3-R1 copy number is a significant risk factor for African American SLE.

Identification of subjects at risk or with severe disease manifestations can lead to more accurate diagnoses and reduced disease severity through precautionary intervention.

This document is dedicated to my family. Your continuous support and encouragement have enabled me to achieve this and many other successes. Thank you especially for amusing me with your ever-changing interpretations of my dissertation topic and for constantly asking if I have “cured lupus” yet.

Acknowledgments

I am most grateful for the continuous support and mentorship from my advisor, Dr. C. Yung Yu. Through his actions and constant encouragement he has taught me patience, tolerance, and inspiration. He has always humored my optimism and thinking outside the box. I would like to thank him sincerely for the opportunity to train in his laboratory, and prepare me for all my future endeavors.

He has been an inspirational advisor and leader who has enduring encouragement and support.

The magnitude of this work would not be possible without contributions by past and present colleagues, especially Dr. Erwin Chung, Dr. Yan Yang, Dr.

Stephanie Savelli, and Dr. Kapil Saxena for their assistance and fundamental work. I extend a special token of gratitude to Dr. Yee Ling Wu and Ms. Bi Zhou for their technical expertise and guidance in the laboratory, as well as Ms.

Nazreen Esack for assistance and friendships. I wish all of you many successes.

I am grateful for all the volunteers and donors that made this body of work possible. I would like to thank all the SLE patients and their families for participating in research studies. This work was generously sponsored from funding agencies including National Institute of Allergy and Infectious Diseases,

National Institute of Arthritis and Musculoskeletal and Skin Disease, National vi

Institute of Diabetes and Digestive Kidney Diseases, and the Lupus Foundation of America. I thank all the colleagues in the Ohio SLE study group, especially Dr.

Lee Hebert, Dr. Brad Rovin, Dr. Dan Birmingham, and Dr. Haikady Nagaraja for

their efforts in establishing and maintaining such a valuable resource. I thank Dr.

Gloria Higgins, Dr. Robert Rennenbohn, and Ms. Karla Jones at Nationwide

Children’s Hospital for assisting with the recruitment of pediatric SLE patients

and healthy controls.

I would like to thank all our collaborators who have provided us the

priceless gift of samples including Dr. Joann Moulds at Drexel University,

Philadelphia, Pennsylvania, Dr Mark Pepys at University College London,

London, Britain, Dr. Rando Allikmets at Columbia University, New York, New

York, Dr. Joe Ahearn at University of Pittsburgh, Pittsburgh, Pennsylvania, Dr.

Robert A.S. Roubey at the University of North Carolina at Chapel Hill, Chapel

Hill, North Carolina, and Dr. Betty Tsao at University of California, Los Angeles,

Los Angeles, California.

I would like to acknowledge the support of The Research Institute at

Nationwide Children’s Hospital and the Ohio State University Integrated

Biomedical Science Graduate Program. Thank you to my graduate dissertation

committee members Dr. Carlos Alvarez, Dr. Dan Birmingham, Dr. Heithem El-

Hodiri, Dr. Haikady Nagaraja for your assistance, attendance at meetings, and

support. Thank you Dr. Jaclyn McAlees and Dr. Joseph Carl and all my

classmates and friends in the IBGP program I have made along the way. Thank vii you to Mrs. Lisa Huber, Dr. David Cunningham, Dr. Holly Moose, Dr. Reyna

Martinez-Deluna, Mr. Sadeq Kharzai, Mr. Girish Rajgolikar for listening and sharing wisdom throughout this process.

Last, but not least I would like to thank my family for their support and encouragement. Thanks and love to Aunt Joan Mickunas for giving of yourself countless times. Finally, thanks to my mom and dad - I could not have asked for anything more.

viii

Vita

1998…………………………………………………………..Akron North High School

2001…………………………………..B.S. Chemistry, Youngstown State University

2004…………………………………..M.S. Chemistry, Youngstown State University

2004 to present ...... …………..Graduate Research Associate Integrated Biomedical Sciences The Ohio State University

Publications

Kitzmiller, K.J, Yang, Y., Wu, Y.L., Zhou, B., Chung, E., Yu, C.Y. (2009). Determining the copy number variation (CNV) of human Complement Factor H Related Genes: from Southern blots to real-time PCRs. J Immunol, 182, 136.30, Abstract.

Saxena, K., Kitzmiller, K.J., Wu, Y.L., Zhou, B., Esack, N., Hiremath, L., Chung, E., Yang, Y., Yu, C.Y. (2009) Great genotypic and phenotypic diversities associated with copy-number variations of complement C4 and RP-C4-CYP21- TNX (RCCX) modules: A comparison of Asian-Indian and European American populations. Mol Immunol, 49, 1289-1303.

Wu, Y.L., Yang, Y., Chung, E., Zhou, B., Kitzmiller, K.J., Savelli, S., Nagaraja, H., Birmingham, D., Tsao, B., Rovin, B., Hebert, L., and Yu, C.Y. (2008) Phenotypes, genotypes and disease susceptibility associated with gene copy number variations: complement C4 CNVs in European American healthy subjects and those with systemic lupus erythematosus. Cytogenet Genome Res, 123, 131-141.*Featured on cover

Yang, Y., Chung, E., Wu, Y.L., Savelli, S., Nagaraja, H., Zhou, B., Hebert, M., Jones, K., Shu, Y., Kitzmiller, K.J., Blanchong, C., McBride, K., Higgins, G., Rennebohm, R., Rice, R., Hackshaw, K., Roubey, R., Grossman, J., Tsao, B., Birmingham, D., Rovin, B., Hebert, L., Yu, C.Y. (2007). Gene copy-number variation and associated polymorphisms of complement component C4 in human Systemic Lupus Erythematosus (SLE): low copy number is a risk factor for and high copy number is a protective factor against SLE susceptibility in European Americans. Am J Hum Genet, 80, 1037-1054.

Field of Study

Major Field: Integrated Biomedical Science Program

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments ...... vi Vita ...... ix List of Tables ...... xv List of Figures ...... xvii Abbreviations and symbols ...... xviix Chapter 1 Introduction ...... 1 1.1 Complement introduction ...... 1 1.2 Complement in autoimmune and organ specific disease ...... 15 Specific Aims ...... 28 Chapter 2 Methods to detect and determine the variability of the Complement Factor H related genes CFHR3 and CFHR1 copy number variation among multiple races ...... 38 2.1 Introduction ...... 40 2.2 Material and methods ...... 43 2.2.1 Study populations ...... 43 2.2.2 Genomic DNA samples ...... 44 2.2.3 Hybridization of Southern blot membranes to detect CFHR3-R1 CNV ..... 44 2.2.4 Determination of CFHR3-R1 copy number and genotype by Southern blot analysis ...... 46 2.2.5 Bioinformatics, statistical analyses, and software applications ...... 46 2.3 Results...... 49

2.3.1 CNV of CFHR3-R1 detected by Southern blot analysis ...... 49 2.3.2 CFHR3-R1 CNV among healthy control groups ...... 52 2.3.3 CFHR3-R1 genotypes in healthy subjects among multiple races ...... 54 2.4 Discussion ...... 56 Chapter 3 Development of a Realtime PCR assay to determine the role of copy number variation of CFHR3-R1 and Complement C4 in Age-Related Macular Degeneration ...... 70 3.1 Introduction ...... 72 3.2 Material and methods ...... 77 3.2.1 Study populations ...... 77 3.2.2 Genomic DNA samples ...... 77 3.2.3 Genotyping of CFHR3-R1 ...... 78 3.2.4 Real-time PCR (RT-PCR) amplicon and experimental design ...... 78 3.2.5 RT-PCR using TaqMan® dye chemistry ...... 80 3.2.6 Double relative standard curve method of RT-PCR ...... 80 3.2.7 Genotyping of total C4 gene copy numbers ...... 81 3.2.8 Statistical analyses ...... 82 3.3 Results...... 83 3.3.1 Real-time PCR assay validation ...... 83 3.3.2 CFHR3-R1 CNV in AMD and healthy subjects of European descent ...... 86 3.3.3 CNV of total C4 genes in AMD and healthy subjects of European descent ...... 87 3.4 Discussion ...... 90 Chapter 4: The role of low Complement Factor H Related Genes 3 and 1 (CFHR3-R1) copy number in European And African American Systemic Lupus Erythematosus (SLE) ...... 119 4.1 Introduction ...... 121 4.2 Material and methods ...... 125 4.2.1 Study populations ...... 125 4.2.2 Sample DNA ...... 125

xii

4.2.3 Determination of CFHR3-R1 copy number ...... 126 4.2.4 Statistical analyses ...... 128 4.3 Results...... 130 4.3.1 Analysis of CFHR3-R1 copy numbers in European and African American SLE populations ...... 130 4.3.2 Distribution of CFHR3-R1 copy numbers in African American SLE ...... 130 4.3.3 Distribution of CFHR3-R1 copy numbers in European American SLE ... 132 4.3.4 CFHR3-R1 genotype in European American and African American SLE133 4.4 Discussion ...... 135 Chapter 5: A role for reduced complmeent Factor H (CFH) protein lvels in Systemic Lupus Erythematosus (SLE) and Antiphospholipid Syndrome (APS) 152 5.1 Introduction ...... 154 5.2 Material and methods ...... 160 5.2.1 Sample populations ...... 160 5.2.2 Determination of CFH plasma protein levels by radial immunodiffusion . 161 5.2.3 Statistical analyses ...... 161 5.3 Results...... 163 5.3.1 CFH plasma protein levels in an aPL cohort from APSCORE ...... 163 5.3.2 Mean CFH plasma protein levels in OSS cases ...... 165 5.3.3 The role of aPL in SLE ...... 166 5.3.4 CFH and C3 plasma protein levels in longitudinal OSS cases ...... 167 5.4 Discussion ...... 169 Chapter 6 The role of low mannan binding lectin in thrombosis and SLE ...... 186 6.1 Introduction ...... 188 6.2 Material and methods ...... 193 6.2.1 Study populations ...... 193 6.2.2 MBL2 genotyping ...... 194 6.2.3 Measurement of functional MBL protein levels ...... 195 6.2.4 Statistical analyses ...... 196 6.3 Results...... 198 xiii

6.3.1 Functional MBL protein levels in an aPL cohort from APSCORE ...... 198 6.3.2 Functional MBL plasma protein levels in OSS cases ...... 200 6.3.3 MBL2 promoter and exon 1 variant allele frequency in African and European American OSS cases ...... 201 6.3.4 Functional MBL plasma protein levels in longitudinal OSS cases ...... 204 6.4 Discussion ...... 207 Chapter 7 Discussion ...... 227 7.1 Complement in AMD ...... 228 7.2 Complement in autoimmunity ...... 231 7.2.1 Complement genetic variation and disease risk ...... 231 7.2.2 Complement and disease ...... 235 7.3 Complement proteins and the coagulation pathway ...... 238 7.4 Future work ...... 241 References ...... 246

xiv

List of Tables

Table 1.1 Genetic and environmental risk factors in SLE, APS, and AMD ...... 36

Table 2.1 Abbreviations used for healthy control group population studies ...... 66

Table 2.2 Copy number of CFHR3-R1 among populations of multiple races ... 67

Table 2.3 CFHR3-R1 copy number among healthy subjects of multiple races .. 68

Table 2.4 CFHR3-R1 genotypes among healthy subjects of multiple races ...... 69

Table 3.1 CFHR3-R1 RT-PCR amplicon design characeteristics ...... 106

Table 3.2 CFHR3-R1 copy number RT-PCR validation results ...... 107

Table 3.3 Determination of CFHR3-R1 in AMD samples ...... 109

Table 3.4 Distribution, GCI, allelic and carrier frequency of CFHR3-R1 in European American AMD ...... 116

Table 3.5 Distribution and GCI of total C4 in European American AMD ...... 117

Table 3.6 OR associated with total C4 gene copy number in European American AMD ...... 118

Table 4.1 Properties associate with CFH and CFH related proteins ...... 145

Table 4.2 Summary table of populations and abbreviations for SLE cohorts .. 146

Table 4.3 CFHR3-R1 copy numbers in Euroepan and African American SLE 147

Table 4.4 Distribution of CFHR3-R1 CNV among African American SLE patients and healthy unrelated controls...... 148

Table 4.5 Distribution of CFHR3-R1 CNV in European American SLE patients and healthy unrelated controls...... 149

Table 4.6 Distribution of CFHR3-R1 genotypes in European and African American SLE ...... 150

Table 4.7 Distribution of rs1061170 (Y402H) aby CFHR3-R1 copy numbers .. 151

Table 5.1 Sample populations, processing applications and groups ...... 179

Table 5.2 Mean plasma CFH levels in female aPL-positive subjects segregated by thrombosis status, SLE status, and pregnancy loss ...... 180

Table 5.3 Mean CFH protein levels in aPL subjects of Northern European ancestry segregate by thrombosis and SLE status ...... 181

Table 5.4 CFH protein levels in African and European American OSS cases and first-degree relatives ...... 182

Table 5.5 Genetic effect of rs1961170 on CFH protein levels in OSS cases ... 183

Table 5.6 Mean plasma CFH protein levels in OSS cases with aPL ...... 184

Table 5.7 CFH protein levels by CFHR3-R1 copy numbers in OSS cases ..... 185

Table 6.1 Mean functional MBL plasma protien leves in aPL subjects ...... 217

Table 6.2 Mean functional MBL plasma protien leves in APSCORE subjects with aPL categorized by SLE and thrombosis ...... 218

Table 6.3 MBL2 genotypes and functional MBL protein levels in OSS cases . 219

Table 6.4 MBL2 polymorphisms among European American OSS cases ...... 223

Table 6.5 MBL2 polymorphisms among African American OSS cases ...... 224

Table 6.6 Novel MBL2 polymorphisms among OSS cases ...... 225

Table 6.7 Mean functional MBL plasma protein levels among OSS cases by MBL2 genotype ...... 226

Table 7.1 Relationship between MBL, CFH and CFHR3-R1 in AMD, SLE, and APS ...... 245

xvi

List of Figures

Figure 1.1 Cartoon of complement activation and regulation ...... 32

Figure 1.2 The genetics of MBL2 ...... 34

Figure 1.3 The CFH gene region and proteins ...... 35

Figure 2.1 A dottup plot demonstrating sequence identity throughout the CFH gene region...... 60

Figure 2.2 A PmeI PFGE-Southern blot with CFHR1 cDNA label to resolve the CFHR3-R1 CNV ...... 62

Figure 2.3 A TaqI RFLP-Southern blot with a CFHR2 cDNA label refining the CFHR3-R1 CNV ...... 63

Figure 2.4 A PvuII-PshAI RFLP-Southern blot using a CFH cDNA probe corresponding to exons 21-22 to confirm the CFHR3-R1 CNV ...... 64

Figure 2.5 The frequency of CFHR3-R1 copy number in healthy subjects of multiple races ...... 65

Figure 3.1 A cartoon depicting RT-PCR assays and location to detect the copy number of CFHR3-R1 ...... 96

Figure 3.2 Double standard curves for each CFHR3-R1 RT-PCR assay and endogenous control ...... 98

Figure 3.3 RT-PCR cluster plots of CFHR3-R1 assays ...... 100

Figure 3.4 Distribution of CFHR3-R1 copy numbers in AMD by phenotype .... 102

xvii

Figure 3.5 The distribution of CFHR3-R1copy number in European American AMD ...... 103

Figure 3.6 Distribution of total C4 gene copy numbers in AMD ...... 104

Figure 3.7 Distribution of total C4 gene copy numbers in AMD by phenotype . 105

Figure 4.1 Distribution of CFHR3-R1 CNV in African American SLE cases and race-matched healthy controls ...... 141

Figure 4.2 The OR in African American SLE ...... 142

Figure 4.3 Distribution of CFHR3-R1 CNV in European American SLE cases and race-matched healthy controls ...... 143

Figure 4.4 The OR in European American SLE ...... 144

Figure 5.1 Mean CFH plasma protien levels in APSCORE subjects with SLE and thrombosis ...... 173

Figure 5.2 CFH correlates with C3 in European American and African American OSS cases...... 174

Figure 5.3 CFH correlates with C4 in European American and African American OSS cases...... 175

Figure 5.4 CFH and C3 protien levels in OSS patients studied longitudinally . 176

Figure 5.5 Western blot analysis ofplasma from healthy subjects with 2 copies of CFHR3-R1 ...... 178

Figure 6.1 Mean functional MBL plasma protien levels in APSCORE subjects with SLE and thrombosis ...... 213

Figure 6.2 Schematic depiction of MBL2 genotyping by PCR amplification followed by sequencing ...... 214

Figure 6.3 Effects of -550, -221, +4, and variant alleles on mean functional MBL plasma protien levels in OSS cases ...... 216 xviii

Abbreviations and symbols

5' = 5 prime aCGH = array comparative genomic hybridization aCL = anticardiolipin antibody aPL = antiphospholipid antibody aHUS = atypical hemolytic uremic syndrome

α = alpha

AMD = age-related macular degeneration

ANOVA = analysis of variance

AP50 = alternative pathway hemolytic activity

β2-GPI = beta-2 glycoprotein I

BAC = bacterial artificial chromosome

C-terminal= carboxyl terminus cDNA = copy deoxyribonucleic acid

CFH = complement factor H

CFHR = complement factor H related

CH50 = classical pathway hemolytic activity

χ = chi

xix

C.I. = confidence interval

CNV = copy number variation

CT = threshold cycle

CV = coefficient of variation

DDD = dense deposit disease

° C= degree in Celsius

DF = degrees of freedom

DNA = deoxyribonucleic acid

EBV = Epstein-Barr virus

EDTA = ethylenediaminetetraacetic acid

ELISA = enzyme linked Immunosorbent assay

GCI = gene copy index

HIV = human immunodeficiency virus

HLA = human leukocyte antigen

IDT = integrated DNA technologies

Ig = immunoglobulin kb = kilobase kDa = kilodalton

LAC = lupus anticoagulant

M = molar

MAC = membrane attack complex

MAPH-PRT = multiplex amplifiable probe hybridization and paralog ratio test

MASP = mannan binding lectin associate serine protease

MBL = mannan binding lectin

mg = milligram

MHC = major histocompatibility complex

min = minute

mL = milliliter

MLPA = multiplex ligation dependent probe amplification

MPGN = membranoproliferative glomerulonephritis mRNA = messenger ribonucleic acid mV = millivolt

N = sample size

N-terminal = amino terminus

NAOH = sodium hydroxide

NCBI = National Center for Biotechnology Information ng = nanogram nm = nanometer

OR = odds ratio

PCR = polymerase chain reaction

% = per cent

PFGE = pulsed-field gel electrophoresis

xxi pg = picogram

PNPP = p-nitrophenyl nitrate

RA = rheumatoid arthritis

RCA = regulators of complement activation

RCCX = RP, C4, CYP21, and TNX

RFLP = restriction fragment length polymorphism

RPE = retinal pigmented epithelium

RT = real-time

S. cerevisiae = Saccharomyces cerevisiae

SCR = short consensus repeat

SD = standard deviation sec = second

SLE = Systemic Lupus Erythematosus

SNP = single nucleotide polymorphism

TM = trademark

µg = microgram

UV = ultraviolet

xxii

CHAPTER 1

INTRODUCTION

1.1 Complement

Definition and function of complement

Complement consists of more than 30 soluble and membrane-bound plasma proteins and is considered part of humoral immunity due to an ascribed ability to “complement” the role of antibody (Bordet and Gengou 1901; Lachmann

2006). Complement functions in innate immunity to protect the host from infection, serves at the interface of innate and adaptive immunity and assists in waste disposal (Walport 2001). Complement also participates and interacts with the coagulation pathway (Markiewski et al. 2007). Constituents of complement include initiators, convertases, and regulators. Figure 1.1 demonstrates the three activating pathways and the terminal pathway of complement that concludes with the formation of the membrane attack complex. The most abundant complement protein, C3, is intrinsic to all pathways (Walport 2001). Complement is first activated by a triggering event such as the presence of apoptotic material or pathogen. Sequential binding and proteolytic cleavage of downstream

1 components by serine proteases results in a cascade of activation proceeding to form the Membrane Attack Complex (MAC). All downstream components after initial binding and proteolytic cleavage are identical between the lectin and classical complement pathways.

The alternative pathway has a different series of initiating events and is thought to be constitutively active through the spontaneous hydrolysis of C3 to

C3(H2O). In the presence of pathogen, activated C3 known as C3b, covalently binds to the cellular surface. Bound C3b recruits Factor B, cleaving it to Bb and

Ba by Factor D. C3bBb forms the alternative pathway C3 convertase, which serves to amplify additional C3. C3bBbC3b forms the C5 convertase initiating the terminal pathway.

Complement constitutes a part of the innate immune system recognizing self from non-self. C3b and C4b form covalent bonds indiscriminately with hydroxyl or amino groups (C4A) on cellular surfaces. Surface and membrane- bound regulators ensure complement activation does not damage host cells.

Regulators of complement activation include Complement Factor H (CFH),

Factor I (CFI), C4b Binding Protein (C4BP), Decay Accelerating Factor (DAF),

Membrane Cofactor Protein (MCP), Homologous Restriction Factor (HRF),

CD59, Protein S (Vitronectin), Complement Receptor 1 (CR1) and Complement

Receptor of the Ig Superfamily (CRIg). Regulators and their point of regulation are indicated in Figure 1.1. This figure illustrates components specific to the lectin and classical pathway (C4BP), the alternative pathway (CFH), and those

2 common to all pathways (CFI). Convertase activity is regulated by binding convertase components, inactivating convertase components, or decaying convertases (Turnberg and Botto 2003; Wiesmann et al. 2006). Binding of activated complement fragments to cellular receptors (CR1, CR2, CR3, CR4,

C3aR, C4aR, C5aR, and C1qR) facilitates the function of complement. Some factors stabilize convertases and enhance complement activation such as

Properdin and the antibody to the C3 convertase, C3-Nephritic Factor (West and

McAdams 1999).

Complement genetics and deficiency

Complement deficiency has been associated with increased infection, autoimmunity, and hematological disorders. Deficiency of early classical complement components results in autoimmune disorders such as Systemic

Lupus Erythematosus (Manderson et al. 2004). Among subjects with C1q deficiency, 93% develop Systemic Lupus Erythematosus (SLE), while a C1r or

C1s deficiency associates with 57% chance of SLE, and C4 deficiency has a

75% association with SLE (Pickering et al. 2000). Deficiency of C3 results in increased pyogenic and neisserial infections, rash, and Membranoproliferative

Glomerulonephritis (Alper et al. 1972; Pussell et al. 1980). Loss of properdin or late complement proteins results in infection (Lachmann et al. 1978; Schlesinger et al. 1990). Deficiency of complement regulators leads to an accelerated rate of complement depletion and hematological and organ specific disease (Walport

2001). Examples of hematologic manifestations include angioedema from C1 inhibitor deficiency and hemolysis and thrombosis from CD59 deficiency.

Diseases featuring organ specific manifestations include Age-Related

Macular Degeneration (AMD), Hemolytic Uremic Syndrome (HUS or aHUS), and

Membranoproliferative Glomerulonephritis Type II (MPGN II). Loss of a regulator

(CFH, CFI, DAF, and MCP) leads to hypocomplementemia (Edwards et al. 2005;

Esparza-Gordillo et al. 2005; Gold et al. 2006; Hageman et al. 2005; Hageman et al. 2006; Haines et al. 2005; Hughes et al. 2006; Kavanagh et al. 2008; Klein et al. 2005; Li et al. 2006; Maller et al. 2006; Noris et al. 2003; Vyse et al. 1996;

Walport 2001).

MBL

Mannose Binding Lectin or MBL is synthesized predominantly by hepatocytes from the MBL2 gene on chromosome 10q11.2-q21(Hansen and

Holmskov 1998; Sastry et al. 1989). MBL is an acute phase protein activating complement by binding to N-acetylglucosamine, mannosamine, glucose, fucose, and mannose on bacterial, viral, fungal cell walls (Anders et al. 1994; Fischer et al. 1994; Larkin et al. 1989; Reading et al. 1995; Taylor and Summerfield 1987;

Thiel et al. 1992). MBL facilitates opsonization and phagocytosis (Kuhlman et al.

1989; Ogden et al. 2001) and influences the release of inflammatory cytokines such as IL-6, IL-1B, and TNFα (Jack et al. 2001; Santos et al. 2001).

The MBL2 gene has four coding exons, though a 5th exon termed exon 0,

is present in 10-15% of transcription. Exon 1 and 2 encode the collagen domain,

exon 3 codes for the neck domain and exon 4 codes for the carbohydrate

recognition domain (Taylor et al. 1989). Figure 1.2 depicts the genetic structure

of MBL2, highlighting the position of exons, functional domains, promoter polymorphisms and exon 1 variants. Functional MBL protein includes highly oligomerized MBL polypeptide chains (Lipscombe et al. 1995; Lu et al. 1990;

Taylor and Summerfield 1987; Teillet et al. 2005). Small oligomers contain mutant MBL polypeptide chains in which the helical structure is distorted (Sumiya et al. 1991). Variants in exon 1 contribute to the formation of small MBL oligomers unable to activate complement efficiently. The three major variant alleles known as B at +230 (G54D; rs1800450), C at +239 (G57E; rs1800451) and D at +223 (R52C; rs5030737) are present at different frequencies in individuals of all populations investigated (Lipscombe et al. 1992; Madsen et al.

1994; Sacco et al. 1998; Sumiya et al. 1991). For instance, the C allele is commonly found among subjects of African ancestry, whereas the B allele is more commonly associated with Asian and European subjects. The 230-B and

239-C variants fail to oligomerize effectively and have reduced protein levels in the serum leading to defects in complement activation (Kurata et al. 1993;

Petersen et al. 2001; Super et al. 1989). The 223-D variant forms an adventitious disulphide bond which reduces the ability of MBL to form higher order oligomers

(Wallis and Cheng 1999). Heterozygosity for a single variant allele reduces

functional MBL protein levels dramatically, whereas subjects with 2 variant alleles

have nearly absent levels of MBL resulting in a functional deficit of complement

activation (Minchinton et al. 2002). Subjects lacking these variant alleles (termed

allele A at 223,230, or 239) have considerable fluctuation in MBL protein levels

(Garred et al. 2003).

Promoter polymorphisms at -550 and -221 affect MBL expressional levels

and can lead to a functional deficiency (Madsen et al. 1995; Steffensen et al.

2000). Additional variation at +4 (T-C) present in the 5’ UTR (Madsen et al. 1994) was found to be in 100% concordance with a promoter polymorphism at -70

(Steffensen et al. 2000). MBL genotypes and haplotypes are present at variable frequencies among multiple races (Crosdale et al. 2000; Garred et al. 1999; Lau et al. 2006; Lau et al. 1996; Lee et al. 2005a; Lee et al. 2005b; Madsen et al.

1998; Minchinton et al. 2002; Piao et al. 2007; Steffensen et al. 2000; Sullivan et al. 1996; Takahashi et al. 2005).

Several studies have reported associations between MBL deficiency and variant alleles and SLE with inconsistent results (Davies et al. 1995; Lau et al.

1996; Piao et al. 2007; Sullivan et al. 1996; Takahashi et al. 2005). The results reflect differences in populations, alleles genotyped, methods of analysis, and undersized populations. These studies failed to assess the entire MBL2 haplotype and thus provide incomplete reports of MBL deficiency. The study by

Piao et al. thoroughly examined MBL variant alleles and other SLE characteristics such as antibody production (Piao et al. 2007). Only Davies et al.

addressed the weak association between MBL deficiency and SLE (Davies et al.

1995). They found that the HLA was a stronger SLE risk than MBL, but when

combined was increased suggesting a role for additional genes contributing to immune complex clearance.

A meta-analysis resolved the role of MBL variants in SLE suggesting they are a minor risk, especially the -230-B variant, and this risk holds among multiple races. No effect was demonstrated for subjects heterozygous for variant alleles

(Lee et al. 2005b). Owing to the vast number of studies that only investigated allele 230-B, these results may reflect that bias. It is interesting that this risk

factor was present among multiple races investigated and requires more in-depth

investigation. In SLE, a promoter polymorphism at -221 associates with an earlier

age of disease onset, cutaneous manifestations, and pleuritis/pericarditis (Jakab

et al. 2007; Mullighan et al. 2000). The ability to establish these associations also

relies on the availability of such data. An MBL genotype associated with high

expression of protein was found to be decreased in SLE (Sullivan et al. 1996;

Villarreal et al. 2001). This then indicates there is decreased MBL protein levels

in SLE, which was not quantitatively demonstrated. One study linked MBL variant

alleles with reduced MBL complex and pathway activity demonstrating a

phenotypic consequence of low MBL protein levels (Seelen et al. 2005).

Comprising the recognition domain of the C3 convertase (C4bC2a), complement component C4 plays a crucial role in both the classical and lectin pathways of complement activation. In addition to copy number variation, C4 has two isotypes, C4A and C4B, each with multiple allotypes (Blanchong et al. 2001;

Mauff et al. 1990; Yu et al. 2003). C4A has a longer half-life (~10s) and forms amide bonds, whereas the half-life of C4B is quite short (<1s) and preferentially binds to hydroxyl groups forming an ester linkage (Dodds et al. 1996; Isenman and Young 1984; Law et al. 1984). Because of these properties, C4A more likely participates in immunoclearance while C4B may be more important in microbial defense.

The C4 gene is located in the RCCX (RP, C4, CYP21, and TNX). There is both phenotypic and genotypic diversity of C4 generated through copy number variation of RCCX modules and C4 gene size dichotomy. Differences in frequency and distribution of C4, C4A, and C4B gene copy numbers exist between healthy subjects of multiple races (Blanchong et al. 2000; Chung et al.

2002a; Saxena et al. 2009; Yang et al. 2007). The variability of C4 as an immune effector gene (it leads to the activation of C3 and participates in the initial steps of complement activation) differentially affects the strength of the immune system.

Low copy number of C4 and C4A genes increases the risk of SLE and demonstrates linkage with MHC class II (Yang et al. 2007). The role of C4 in SLE demonstrates two important features: 1) the role of variability within a single gene

8 being both protective and a risk within disease and 2) importance of a balanced complement system to maintain immunity and health.

Complement Factor H (CFH)

Complement Factor H (CFH) was first identified as a contaminant in a preparation of C5 by Nilsson and Müller-Eberhard in 1965 (Nilsson and Muller-

Eberhard 1965). The role of CFH in regulating C3 was determined twelve years later and shortly thereafter hypocomplementemia and Hemolytic Uremic

Syndrome (HUS) were ascribed to the genetic deficiency of CFH (Thompson and

Winterborn 1981; Whaley and Ruddy 1976). CFH deficiency associates with low hemolytic complement activity, low C3 protein levels in the absence of C3 nephritic factor (a C3 convertase stabilizer). The CFH gene region is located in the RCA or regulators of complement activation on chromosome 1q32

(Rodríguez de Córdoba et al. 2004; Rodríguez de Córdoba 2008). For the most part, each of the 23 exons of CFH codes for a 60 amino acid long short consensus repeat or SCR (Male et al. 2000). CFH is 155-kDa protein with an elongated chain of 20 SCRs with 4 invariable cysteines in each motif (Ripoche et al. 1988). Figure 1.3 illustrates the CFH gene region at the genomic and proteomic levels. Alternative splicing of exon 10 results in the production of a

CFH-Like (CFHL) protein containing the first seven SCRs of CFH plus four additional amino acids. CFH and CFHL function have been described in detail.

CFH potently regulates C3b by 1) dissociating the C3 convertase, 2) interacting 9 with Factor I (Whaley and Thompson 1978) to degrade C3b to its inactivated form, iC3b, C3dg (Alsenz et al. 1985; Pangburn et al. 1977; Weiler et al. 1976),

3) protecting host cells from complement mediated tissue injury (Brooimans et al.

1990). CFH tightly regulates activated C3 to prevent complement depletion and protect complement deposition on host cells. CFHL shares decay acceleration and cofactor activity with CFH, but lacks the ability to regulate C3 on cellular surfaces (Misasi et al. 1989; Rodríguez de Córdoba 2008; Schwaeble et al.

1987).

Within the CFH gene region are five related genes: CFHR3, CFHR1,

CFHR2, CFHR4, and CFHR5, likely arising through exon duplication events

(Rodríguez de Córdoba 2008; Zipfel et al. 1999; Zipfel et al. 2002). CFHR3 and

CFHR1 share structural similarity with CFH and proposed mechanisms of similar function are being elucidated (Hellwage et al. 1999; Hellwage et al. 1997; Murphy et al. 2002; Ren et al. 2002; Zipfel et al. 1999; Zipfel et al. 2002). No study has quantitatively demonstrated the effect of the CFHR3-R1 deficiency. The role of

the related proteins remains poorly defined, though overlapping complement

function is suggested (Murphy et al. 2002; Ren et al. 2002; Zipfel et al. 1999).

Regions corresponding to CFH host protection (SCR19-20) are present in all

related proteins, while no related protein contains regulatory regions (Zipfel et al.

2002). The related proteins associate with apolipoprotein particles (McRae et al.

2005; Skerka et al. 1997), which facilitate adhesive responses of neutrophils and

suggest a role in lipid transport or transport to cellular compartments (Park and

Wright 1996). CFHR3, CFHR4, and CFHR5 convincingly bind the C3d region of

C3b, but only CFHR3 and CFHR5 bind heparin (Hellwage et al. 1999; Hellwage

et al. 1997; McRae et al. 2001). Both CFHR3 and CFHR4 can bind to the acute inflammatory protein, CRP (Jozsi et al. 2005; Mihlan et al. 2009). Both CFHR3

and CFHR4, and to a lesser extent, CFHR5, enhance cofactor activity of CFH

(Hellwage et al. 1999; McRae et al. 2005). CFHR5 inhibits C3 convertase activity

(McRae et al. 2005) and recently, CFHR1 has been shown to inhibit C5

convertase activity, preventing terminal complement activation (Heinen et al.

2009). The differentiation between the C3 and C5 convertases is not well

understood at this time.

CFH deficiency associates with Membranoproliferative Glomerulonephritis

type II (MPGN II), in which the glomerular basement membrane is more

susceptible to complement activation (Ault et al. 1997; Dragon-Durey et al. 2004;

Pickering et al. 2002; Vogt et al. 1995). Reduced CFH protein levels or

dysfunctional CFH protein has been associated with atypical HUS or aHUS

(Caprioli et al. 2001; Pickering et al. 2007; Saunders et al. 2007; Saunders et al.

2006; Thompson and Winterborn 1981; Venables et al. 2006; Warwicker et al.

1998; Zipfel et al. 2007). Deficiency of CFHR3-R1 in the presence of antibodies

against CFH protein has been described in aHUS as well (Dragon-Durey et al.

2005; Zipfel et al. 2007). Polymorphisms in CFH and increased CFHR3-R1 copy

numbers have been reported in Age-Related Macular Degeneration (Edwards et

al. 2005; Gold et al. 2006; Hageman et al. 2005; Hageman et al. 2006; Haines et

11 al. 2005; Hughes et al. 2006; Klein et al. 2005; Li et al. 2006; Maller et al. 2006).

Each of these diseases is mediated by complement tissue injury of specific cell surfaces as demonstrated by deposits of activated fragments (Edwards et al.

2005; Gold et al. 2006; Hageman et al. 2005; Haines et al. 2005; Klein et al.

2005; Maller et al. 2006).

Copy number variation and disease

The copy number variation (CNV) of CFHR3-R1 genes within the CFH

gene region demonstrates significant frequency differences among several races

(Hageman et al. 2006) and the implications for this variability is not yet

understood. Copy number of C4 genes including both isotypes, C4A and C4B, vary among different ancestral groups (Jakobsson et al. 2008; Saxena et al.

2009) and represent a common structural variation among healthy individuals

(Lafrate et al. 2004; Sebat et al. 2004; Tuzun et al. 2005). Along the same line of variance, MBL can form higher order oligomers of varying sizes and structure, related to promoter and variant polymorphisms but is not a CNV by definition.

Copy number variants refer to segmental variations of genomic DNA greater than 1 kb in size that are either inherited or de novo. CNVs can result from nonallelic homologous recombination between regions of segmental duplication leading to either deletion or duplication of this interval (Lupski 1998;

Stankiewicz et al. 2003) or from gene conversion events (Nei et al. 2000; Nei and

Rooney 2005). Because of their size, CNVs account for more nucleotide variation

12 than SNPs and may involve multiple genes or segments of DNA significantly contributing to phenotype diversity (McCarroll et al. 2006; Perry et al. 2008)

(Tuzun et al. 2005). These structural variants may influence transcription or translation of overlapping or nearby genes directly or by disrupting necessary transcriptional elements (Aldred et al. 2005; Stranger et al. 2007). CNVs have a demonstrated role as a causal variant in disease susceptibility and severity

(Beckmann et al. 2007).

Multiple reports have linked copy number variation of several genes to complex, multifactorial and autoimmune diseases. High copy numbers of complement component C4 are protective against SLE, while low copy numbers are a risk (Yang et al. 2007). This is an example of a gene with dual roles in SLE.

There is also the unique phenomenon in genetics and genomics where a single copy number variant can be a risk for one disease but protective against another.

Defensin beta 4 (DEFB4) varies from 2-7 copies in a diploid genome. Low copy number of DEFB4 was reported by Fellermann to lead to development of Crohns disease (Fellermann et al. 2006). Thereafter, another mucosal based disease, psoriasis, was linked to increased copy numbers (Hollox et al. 2008). The chemokine, CC motif ligand-3-like-1 or CCL3L1 also has dual roles in

Rheumatoid arthritis (RA) and HIV infection susceptibility (Gonzalez et al. 2005;

McKinney et al. 2008). Greater than two gains is a risk for developing autoimmune RA, whereas deletion of the gene is a susceptibility risk factor for

HIV infection. The gene number gain and loss effects in DEFB4 and CCL3L1

13 show opposite effects in different diseases, emphasizing how immune diversity inflicts different susceptibilities to disease.

CNV association studies, like SNP association studies can be subject to population bias owing to stratification. In this case, a spurious genetic association

can be observed between a marker and a trait simply due to differing ancestral

composition or basic differences in genotype frequency distribution between cases and controls (Conrad and Hurles 2007; Redon et al. 2006), and indeed,

CNVs have been reported to vary among different ancestral groups (Jakobsson

et al. 2008).

Methods of detecting CNVs vary greatly and have size limitations. Large

chromosomal rearrangements are detected by karyotyping or comparative

genomic hybridization (CGH). Several established platforms of array CGH or

aCGH (Shinawi and Cheung 2008) using either BACs or oligonucleotides detect

CNVs from 50 kb down to 200 bp, respectively (Urban et al. 2006). Also relying

on a reference sample, multiplex amplifiable probe hybridization and paralog

ratio test (MAPH-PRT) has been reported (Armour et al. 2007). Using specifically

designed primers and probes, MAPH-PRT is an accurate high-through-put

method of CNV detection. Multiplex ligation dependent probe amplification or

MLPA (Schouten et al. 2002), where ligation only occurs in a perfectly matched

sequence, can also be applied. Often a SNP or a series of SNPs “tag” the CNV.

SNPs correlate strongly with CNVs (82%) but have limited genomic coverage. As

of 2008, current platforms could only capture 50% of all SNPs (Cooper et al.

2008). The need for a more comprehensive and definitive method for determining

and validating CNVs directly is warranted.

1.2 Complement in autoimmune and organ specific disease

The following section reports several diseases in which complement is

implicated. Each section begins with a description of the disease followed by

manifestations and underlying. Table 1.1 compares and contrasts SLE, APS,

and AMD.

Systemic Lupus Erythematosus

Autoimmune SLE results from a loss of self-tolerance affecting multiple

tissues and organs. Characteristics of SLE include chronic inflammation and the presence of autoantibodies against nuclear, cytoplasmic and membranous components of the cell. Patients with SLE manifest immune complex mediated tissue injury and low levels of complement components (Cochrane and Koffler

1973; Koffler et al. 1971). No single gene causes SLE, rather there is a complex genetic inheritance not yet completely understood (Sestak et al. 2007).

Classification of SLE requires meeting at least 4 of the 11 American College of

Rheumatology (ACR) Criteria developed in 1982 (Tan et al. 1982). The 11 criteria are sensitive and specific for SLE, though additional symptoms may also be present. These include skin manifestations such as malar rash, discoid rash, photosensitivity, oral ulcers; organ and joint involvement such as serositis, renal

15 disorders, neurological disorders, and arthritis; and immune or hematological abnormalities. It appears that ethnic and geographical variation impacts disease manifestations by influencing autoantibody profile, lupus nephritis, hemolytic anemia, thrombotic complications, cutaneous lupus, and prognosis (Lau et al.

2006).

The worldly incidence of SLE ranges from one to 10 per 100,000 person- years with a prevalence of roughly 20-70 per 100,000. Among all SLE subjects,

90% are women of childbearing age (Pons-Estel et al. 2009; Rahman and

Isenberg 2008). SLE is more prevalent among Asians and subjects African ancestry than in European populations (Johnson et al. 1995; Pons-Estel et al.

2009). Both Hispanic and African Americans have greater morbidity and a younger age of onset than European populations (Daniel et al. 1995; Fernandez et al. 2007). Several reports from multiple centers indicate increased risks and severity of SLE in women of African American, Hispanic American, and Asian ethnicities (Fernandez et al. 2007; Hochberg 1997; Moser et al. 1998; Petri

2005). Genetic component of SLE is suggested from familial aggregation and higher disease recurrences in siblings (relative risk of siblings, λs = 20-40) with a

monozygotic twin concordance rate of 26-69% (Harley et al. 1998; Walport

2001). Though SLE has a genetic basis (Arnett 1997), genetic susceptibilities,

like disease severity and incidence, vary among ethnicities (Mori et al. 2005;

Stefansson et al. 2005).

Despite numerous efforts unveiling the genetic component(s) of such a heterogenic disease such as SLE, ethnic disparity cannot be accounted for by differences in allele frequencies at any of the loci where associations with SLE have been found including HLA-DR, HLA-B, C4A, TNFα, MBL, FCGR2A,

FCGR3A, PDCD1 (Molokhia and McKeigue 2006). Among all populations, one of

the strongest genetic risk factors for SLE is complement deficiency in one of the

early components such as the C1q, C1r, C1s, C4, or C2 (Navratil et al. 1999;

Pickering et al. 2000). Among Caucasian SLE, multiple studies demonstrate

supporting evidence for several immune functioning genes such as the MHC,

CR3/ITGAM, IRF5, BLK, and STAT4 (Harley et al. 2008; Hom et al. 2008;

Karassa et al. 2004; Rhodes and Vyse 2008). There is a strong body of evidence

for PTPN22 and FCGR2A (Harley et al. 2008; Karassa et al. 2004; Lee et al.

2007; Rhodes and Vyse 2008). Many other genes (including MBL) associate with

SLE, but were either weak or required additional supporting data or validation. An

association between copy number variations and SLE susceptibility has been

demonstrated previously (Aitman et al. 2006; Fanciulli et al. 2007; Kelley et al.

2007; Pisitkun et al. 2006; Yamashina et al. 1990; Yang et al. 2007). Within

complement, homozygous and heterozygous C4A deficiency occurs in 30-40% of

SLE patients and associates with lupus susceptibility (Yang et al. 2004).

Additionally, low copy number of total C4 is a risk factor for SLE and high copy number of total C4 is protective against SLE (Yang et al. 2007).

Two major areas of SLE research are lacking. The first is the failure of genetic studies addressing racial disparity. The majority of SLE investigations focus predominantly on Caucasian populations, identifying genes with strong linkage and increased risk of SLE. The same risk factors in Caucasian SLE are either weak or might not be relevant among African American SLE suggesting inherent genetic composition differences. At the very least, they cannot provide an explanation why there is increased prevalence of disease and more severe manifestations. The second area is identifying biomarkers or risk factors for major causes of morbidity and mortality in SLE such as renal disease and thrombosis. It remains critical to identify subgroups of patients at greater risk of more severe disease in terms of treatment and prognosis.

Antiphospholipid Syndrome (APS)

A major hematological cause of morbidity and mortality in SLE is thrombosis, occurring at a greater frequency among younger age-groups than in the general population (Trager and Ward 2001). In a study of 1,930 SLE patients, thrombotic risk factors included antiphospholipid antibody (aPL) positivity, history of smoking, immune-modulating medication use, longer disease duration and older age at SLE onset. Protective effects for thrombosis included the use of hydroxychloroquine, and possibly Asian American and African American female ethnicity for certain thrombotic sub-types (Kaiser et al. 2009). Nearly half of SLE cases with Lupus Anticoagulant (LAC) or cardiolipin antibodies (aCL) had a

18 history of thrombosis (Love and Santoro 1990). Presence of aPL is thought to be a risk for SLE with thrombosis (Toloza et al. 2004), increasing the risk by up to 3 times (Kaiser et al. 2009). Persistent aPL with or without LAC can lead to

development of APS, a disease characterized by thrombosis and recurrent

pregnancy loss (Giles and Rahman 2009).

Antiphospholipid syndrome was first described by Hughes in 1983 based

on reports and observations on a subset of SLE patients with multiple

spontaneous abortions, multiple thromboses, and neurological abnormalities

(cerebral thrombosis/myelitis) in the presence of aPL (Hughes 1983).

Characteristics and minimal diagnostic criteria for APS include clinical criteria

(thrombosis or recurrent pregnancy loss); and one laboratory criteria such as

LAC, IgG/IgM aCL, or IgG/IgM beta-2 glycoprotein-I antibodies (Lockshin et al.

2000; Miyakis et al. 2006; Weber et al. 2001; Wilson et al. 1999). APS is a form of autoimmune thrombophilia, related to increased morbidity and mortality. APS can be the primary disease, secondary to SLE, or present in other autoimmune diseases (McNeil et al. 1991). APS is considered a rare disease, present in less than 0.06% of Americans. Antiphospholipid antibodies are more common and are present in 1-10% of healthy subjects (George and Erkan 2009; Petri 2000; Shi et al. 1990), and 17-86% of SLE patients (Jones et al. 1991; Petri 2000; Picillo et al.

1992). Secondary APS manifests in 30-40% of SLE patients (Cervera et al. 2002;

George and Erkan 2009; Kaiser et al. 2009; Lockshin 2006; Petri 1997; Petri

2000).

Antiphospholipid antibodies increase with age, especially among the

elderly with concomitant chronic diseases (Petri 2000; Schved et al. 1994). APS predominantly affects young females, but has been reported among males and the elderly (Bertolaccini et al. 2005). The role of race in APS is unclear and the high incidence among Caucasians may reflect ascertainment bias (Cervera et al.

2002). However, multiple studies have linked increased incidence of stroke and thrombosis among non-Caucasian groups suggesting a possible increased prevalence of APS among African Americans, Afro-Caribbeans, and Latin

Americans (Ayala et al. 2001; Camargo et al. 2005; Chong and Sacco 2005;

Jacobs et al. 2002; Kittner et al. 1993; Molina et al. 1997; Sacco et al. 1998).

A proposed mechanism leading to APS involved molecular mimicry resulting from incidental exposure to environmental agents with β2GPI-like

peptides in susceptible individuals (Shoenfeld 2003). Mouse models demonstrate that immunization with aPL induces fetal loss and serologic and hematologic

manifestations of APS (Girardi et al. 2003). It is proposed that thrombosis results

from the binding of aPL to endothelial cells. This induces a procoagulant state,

initiates coagulation and thrombin formation, and mediates platelet and

endothelial cell activation involving adhesion molecules, tissue factor expression,

and complement activation (Erkan and Lockshin 2009; Ma et al. 2000; Pierangeli

et al. 2007; Simantov et al. 1995).

Like SLE, there is compelling evidence for a role of complement in aPL-

associated thrombosis and pregnancy loss. Complement is naturally activated 20 during pregnancy, as evidenced by increased levels of correlating C3a, C4a, and

C5a (Richani et al. 2005). Blocking C5a, the C5a receptor, (Giannakopoulos et al. 2007; Girardi et al. 2003) or C5 cleavage (Wang et al. 1995) effectively prevented fetal loss and growth restriction, a finding similar to APS-mice deficient in C4. Inhibition of complement activation or C3 deficiency protected mice against fetal loss when using Crry (rodent analogue for membrane complement regulators MCP-1 and DAF) on self-membranes (Holers et al. 2002; Kim et al.

1995). Based on these findings, complement is activated through either the classical or the lectin pathway. Decreased MBL protein levels associated with increased frequency of and number of previous miscarriages (Christiansen et al.

1999; Kilpatrick et al. 1995; Kruse et al. 2002). Decreased MBL protein levels do not arise from the pregnancy itself, nor from complement activation (Kilpatrick

2000). Low MBL protein levels are clinically significant in identifying couples with miscarriage (Kilpatrick et al. 1999). The role of alternative pathway in amplifying complement activation in APS cannot be ruled out (Schwaeble and Reid 1999;

Wirthmueller et al. 1997) since CFB deficient mice were also protected against pregnancy loss (Girardi et al. 2003).

Mouse models of thrombosis also indicate that complement must be present for thrombosis to occur (Fleming et al. 2004; Girardi et al. 2004;

Pierangeli et al. 2005). Evidence supporting a role for lectin pathway involvement is the finding of MBL variant alleles among SLE cases with arterial thrombosis

(Ohlenschlaeger et al. 2004). It was later proposed that MBL deficiency

21 associated with thrombosis due to coexisting APS (Font et al. 2007). Supporting

the role of MBL in APS or aPL-associated thrombosis is the presence of aCL

[and anti-C1q] more frequently encountered in patients with MBL variant alleles

decreased MBL concentration and function (Seelen et al. 2005). Despite this

body of evidence from human studies and animal models, arterial and venous

thromboses cannot be explained solely by the clinical criteria of APS (Mok et al.

2005). This suggests there may be yet unknown factors that can identify possible

subsets of aPL in SLE at risk for APS or primary APS subjects at risk for a

thrombotic event.

Membranoproliferative glomerulonephritis (MPGN II)

Membranoproliferative glomerulonephritis (MPGN II) manifests with

proteinuria, hematuria, and acute nephritic syndrome with complement

deposition in the glomerular basement membrane (GBM) and mesangial cells

(Appel et al. 2005; Skerka et al. 2009). This rare renal disorder accounts for 4-

7% of all primary renal causes of nephritic syndrome among children and adults

(Chadban and Atkins 2005; Orth and Ritz 1998), and affects both males and

females between the ages of 5-30 years. MPGN II includes the formation of

complement deposits within the capillaries of the kidneys leading to impaired

function or end-stage renal disease in about half of the patients (Orth and Ritz

1998). Deposits found in the GBM are positive on C3 staining, and often contain

22 components from the alternative pathway and terminal complement complex

(Sethi et al. 2009).

The GBM lacks membrane bound complement regulators and therefore relies extensively on circulating CFH to protect against complement-mediated damage (Pavenstadt et al. 2003). C3 nephritic factor (antibody that stabilizes the

C3 convertase) or an inherited or acquired deficiency of CFH leads to excessive

C3 activation (Berger and Daha 2007) characterized by hypocomplementemia of

Factor B, C3d, and low CH50 and AP50 (Dragon-Durey et al. 2004; Zipfel et al.

2006). Because of the severe CFH deficiency and secondary depletion of C3, subjects with MPGN II have an increased incidence of bacterial infection

(Pickering and Cook 2008).

A porcine model of CFH deficiency leading to piglet death revealed an

MPGN II-type of disease with excessive complement activation (Hegasy et al.

2002; Hogasen et al. 1995). Similarly, mice lacking CFH have a similar phenotype (Pickering et al. 2002), which mimic the observations in humans (Lau et al. 2008; Nielsen et al. 1989).

In addition to low CFH protein levels from deficiency, an acquired functional deficiency of CFH caused by polymorphisms or mutations contributes to MPGN II phenotype (Kavanagh et al. 2007; Licht et al. 2006). Many patients with MPGN II carry at least one copy of the risk allele coding for a histidine at position 402 reducing CFH binding to heparin and CRP (Laine et al. 2007;

Rodríguez de Córdoba 2008; Sjoberg et al. 2007a; Skerka et al. 2007). In the

23 absence of adequate CFH, or combined with presence of other triggers or

genetic factors, the Y402H variant alters the specificity of CFH protein binding

and damage to the glomerular basement membrane occurs (Barlow et al. 2008).

Many patients with MPGN II develop yellow-white deposits in the eye

known as drusen (Hageman et al. 2001), the characteristic feature of AMD

(deJong 2006). Drusen deposits contain many proteins, lipids, and lipoproteins

including C5, and C5b-9 complexes (Mullins et al. 2000). In the context of

MPGN, the drusen deposits appear in the first decades of life, but vision remains

stable for a prolonged time (Boon et al. 2009; Leys et al. 1991). Approximately

25% of MPGN cases demonstrate severe vision loss characterized by macular

and peripheral chorioretinal atrophy and/or subretinal neovascular membranes in

the macula (Colville et al. 2003; Leys et al. 1990; Leys et al. 1996).

Age-Related Macular Degeneration

Age-Related Macular Degeneration (AMD) affects approximately 50

million individuals worldwide and is the leading cause of irreversible blindness in

the elderly. Age, ethnicity, smoking, hypertension, obesity, diet and genetics are

all effectors of the complex disease. AMD first presents with blurry vision,

followed by the presence of drusen and changes in the photoreceptor and outer

retinal layers leading to geographic atrophy (GA), in which there is loss of the

retinal-pigmented epithelium (RPE) in the absence of exudates. There are two

forms of late stage AMD, geographical atrophy and choroid neovascularization.

GA accounts for ~85% of AMD. Choroid neovascularization (Neo) consists of degeneration in the choriocapillaris, Bruch’s membrane, pigment epithelium, and

retina caused by the presence of blood in the extracellular space between the

neural retina and the RPE, or between the RPE and Bruch’s membrane. Most

clinical features begin appearing after the age of 55 (Klein et al. 2004), and the

initiation and progression is not yet understood.

In a large multi-ethnic study of atherosclerosis, the prevalence of AMD

was determined in four racial/ethnic groups (Klein et al. 2006). This study found

wide variation in prevalence of overall AMD, and late AMD among black,

Hispanic, Chinese, and Caucasian. The prevalence of AMD has been reported in

other studies investigating Asians (Miyazaki et al. 2005; Wong et al. 2006), and

Asian Indians (Gupta et al. 2007; Krishnaiah et al. 2005). Ethnic differences in

AMD is demonstrated by a prevalence of 4.6-28% among Asians, 5.4% among

Caucasians, 4.2% among Hispanics, 2.4% among Blacks, and 1.4-2.6% among

Asian Indians (AREDS 2000; AREDS 2005; Klein et al. 2006; Okamoto et al.

2006). Differences in racial variability of AMD prevalence are not explained by

recognized risk factors such as age, gender, pupil size, body mass index,

smoking history, alcohol drinking history, diabetes, and hypertension status. It is

likely that genetic composition may play a role in AMD racial variability.

Early genetic studies investigated ABCA, APOE, and FIBL3 and related

genes as well as susceptibility loci at 1q, 9q, 10q, and 22q (Abecasis et al. 2004;

Iyengar et al. 2004; Klein et al. 1998; Majewski et al. 2003; Schmidt et al. 2002;

Seddon et al. 2003; Weeks et al. 2001; Weeks et al. 2004; Zareparsi et al. 2004).

These studies have narrowed the field of genetic contribution to AMD such that

OMIN entry #603075 for ARMD1 lists 11 susceptibility loci (ARMD1-11), multiple

polymorphic risk variants, and haplotypes for reduced risk of AMD. In one study,

C3 F allele was associated with a 2.6 increased odds for AMD (Yates et al.

2007), and activated complement products of FB and C3 are elevated in AMD

(Machalinska et al. 2009; Scholl et al. 2008). Lack of regulation in addition to

elevated plasma levels of complement can lead to systemic inflammation.

Genetic factors contributing to AMD include HLA class I and II (Goverdhan et al. 2005), and MHC Class III polymorphisms in both C2 and CFB (Gold et al.

2006). This region demonstrates high degrees of linkage disequilibrium and study designs have not yet investigated the region proximal to C2, the RCCX.

Genome wide association studies (GWAS) identified both risk and protective haplotypes within the CFH gene region (Edwards et al. 2005; Hageman et al.

2005; Haines et al. 2005; Klein et al. 2005; Li et al. 2006; Maller et al. 2006;

Thakkinstian et al. 2006; Thompson et al. 2007). The major risk haplotype

contained a nonsynonymous SNP resulting in a tyrosine to histidine amino acid

substitution (Y402H) which may reduce the interaction between the retinal

pigmented epithelium (RPE) and CFH (Clark et al. 2006; Prosser et al. 2007;

Sjoberg et al. 2007b; Skerka et al. 2007), though this was not the strongest risk allele in a Korean population (Kim et al. 2008). The Y402H substitution accounts for up to 50% of all AMD due to its effect on CFH binding to the RPE (Clark et al.

2006; Prosser et al. 2007; Sjoberg et al. 2007b; Skerka et al. 2007). The main

protective haplotype contained a CFHR3-R1 deficiency and was less frequent in

neovascularized AMD patients than in controls (Hughes et al. 2006). Additional

studies confirmed the protective effect of the common CNV including CFHR3-R1,

and reported its variation among ethnic groups (Feifel et al. 1992; Hageman et al.

2006; Martínez-Barricarte et al. 2007). To date, there is a conflict as to which

SNPs best tag the CFHR3-R1 CNV and whether the CNV itself is causative or within a causative haplotype in AMD susceptibility.

Specific Aims

Genetic influences on phenotype and disease susceptibility can be small or large in magnitude, involving a single nucleotide or entire chromosomes.

Structural variants involving segments of DNA greater than 1kb in size include copy number variants (CNVs), low-copy repeats, inversions, and translocations.

CNVs can be complex, involve multiple genes or genomic regions, and influence transcription or translation of overlapping or nearby genes.

Multiple reports have linked CNV of several genes to diseases, especially those of a complex or autoimmune nature. Rare de novo CNVs have been

reported in complex disorders with variable phenotypic manifestations such as

schizophrenia or autism spectrum disorder. Several common, ancestral CNVs

associate with systemic autoimmunity, Systemic Lupus Erythematosus (SLE),

Crohns disease, psoriasis, rheumatoid arthritis, and HIV susceptibility. Some

CNVs demonstrate copy number gain and loss effects reflecting the delicate

balance of immunity to maintain a diverse profile to fight off pathogens and

protect against autoimmunity.

Variation in the human genome exists both within and among populations.

Genetic and structural variants in immune genes provide a means of

diversification, but also contribute to differences in disease susceptibility. Within

innate immunity, pattern recognition molecules or proteins such as complement,

arose through exon/domain duplication events early in evolution. To date,

28 complement is known to consist of three initiating pathways and one terminal

pathway designed as a first-line of defense to protect the host against foreign pathogen. The initial components of the pathway also prevent the development of autoimmunity, given that deficiency of C1, C2, or C4 are among the greatest

genetic risk factors for development of autoimmune disease SLE.

SLE is a chronic inflammatory disease resulting from a loss of self-

tolerance affecting multiple tissues and organs. Subjects with SLE generate

autoantibodies against nuclear, cytoplasmic and membranous components of the

cell, and manifest immune complex mediated tissue injury and low plasma levels

of complement components, especially C4 and C3. Associations between the

lectin pathway initiator, Mannan Binding Lectin (MBL), and SLE have been varied

and only weakly associated. The role of MBL in SLE with thrombosis has been

suggested and requires further investigation.

The central component to all three activation pathways is C3, directly

downstream of C4. Activated C3 is regulated by Complement Factor H (CFH), by

limiting convertase activity within the alternative pathway and preventing

unwanted complement activation. Deficiency of CFH whether inherited, acquired,

or functional loss, results in organ specific disease involving the kidneys,

vasculature, and eyes. Within the CFH gene region, copy number variation of

CFHR3 and CFHR1 has been reported at zero, one, or two copies. Functional

implications of the CFHR3-R1 copy number variant have not yet been

29 determined, nor has the role of CFHR3-R1 copy number variation and disease susceptibility.

This work tests the hypothesis that complement variation contributes to intrinsic immune strength diversity influencing racial disparity in systemic and vascular immune-mediated disease. To achieve this goal, three specific aims are proposed.

Aim 1. Establish the methodology to resolve and confirm the variability of the

CFH gene region among multiple races.

Aim 2. Develop a robust and reliable method of detecting the CFHR3-R1 CNV to

confirm the protective effect of decreased CFHR3-R1 copy numbers in Age-

Related Macular Degeneration.

Aim 3. Investigate the role of the CFH gene family and MBL2 genes in Systemic

Lupus Erythematosus and Antiphospholipid Syndrome.

These aims will demonstrate the role of SNPs and structural variants on

the susceptibility to immune mediated diseases. The first aim addresses the

need for definitive measurement of the CFHR3-R1 copy number variation to

assess its frequency among multiple races. The second aim is achieved through

the development of a real-time PCR assay using nanogram quantities of DNA.

This method is then applied to a cohort of AMD cases to confirm the protective effect of CFHR3-R1 deficiency and extends further by also investigating the role

of complement C4 copy number variation. The last aim focuses on demonstrating

the role of CFHR3-R1 copy numbers in SLE and the role of CFH protein levels in hematological and renal manifestations of SLE. The second part of Aim 3 will

determine the role of MBL in thrombosis and SLE with thrombosis at both the

genetic and phenotypic levels.

These specific aims will enable the elucidation of race-specific disease

susceptibility risk factors involving SNPs and structural variants on phenotype

and risk of disease. Determining a risk factor that also varies among races may

begin to elucidate the root underlying common disease susceptibility. To date, no

genetic risk factor has been able to address differences in disease susceptibility

among multiple races. These aims focus not only on racial variability and

disease, but also on the effects of genetic variation in systemic and vascular

immune-mediated diseases such as AMD, SLE, and APS. The role of

complement in autoimmune, renal, hematological, and ocular disease is

implicated, but warrants further investigation. Identification of specific disease

manifestations would lead to better disease prognosis through more immediate

treatment.

Figure 1.1 Cartoon of complement activation and regulation. This figure demonstrates the 3 activation pathways: classical, lectin, and alternative; and the terminal pathway resulting in formation of the membrane-attack complex (MAC).

Membrane bound and circulating regulators are in red with arrows pointed toward targets. Image modified from Walport, NEJM 344; 1058-1066: 2001. Copyright

Abbreviations: MBL-Mannan binding lectin; MASP-MBL associated serine protease; C4BP-C4b binding protein; CFI-Complement Factor I; CFH-

Complement Factor H; DAF-Decay accelerating factor; MCP-Membrane cofactor protein.

C1-INH C4BP CFI

CFI CFH

DAF MCP

Vitronectin CD59

C9 C9 C9 C9

Figure 1.1

Chromosome 10q21-22 A/D A/B A/C A/B A/D +223 +230 G57E G54D +239R53C +4 P/Q G or A -70 G or A A or G Exon 0 0 Exon 2 1 Exon Exon 4 3 Exon Exon DomainRegion: Collagen Collagen Neck Carbohydrate Binding Theof genetics MBL2 H/L Y/X H/L -550 -221 -550 C C G or or G Allele Allele Change Position Figure 1.2 Figure MBL is MBL encoded by 4 exons with exon 0 incorporation in of Position, amino 10-15% transcripts. acid or base change,and resulting allele polymorphisms of multiple and promoter exonalleles variant 1 indicated. The are domains are of above MBL listed the corresponding exon(s).

C4BPB CRBPA 42 32 49 74 57 47 70 66 43 SRP72 CFHR5 1 2 3 4 5 6 7 8 9 C4BPAL1 C4BPAL2 70 64 64 64 37 DAF CFHR4B 1 2 3 4 5 CR2 CR1 MCPL1 71 62 68 64 CR1L1 CFHR4A 1 2 3 4 MCP

73 64 64 64 37 1q32

5 6 7 8 9 CFHR5 CFHR4A/B CFHR1 CFHR2 CFHR3 CFH ÅÅÅ Å ÅÅ

41 34 89 61 CFHR2 1 2 3 4

42 34 100 100 97 1 2 3 4 5 CFHR1

91 85 62 64 37% identity CFHR3 1 2 3 4 5 1p

CFHL 1 2 3 4 5 6 7

CFH 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 RCA

Figure 1.3 The CFH gene region and proteins. Located on chromosome 1q32 near the Regulators of Complement Activation (RCA), this region consists of the genes for CFH, CFHR3, CFHR1, CFHR2, CFHR4, and CFHR5 in tandem. Each exon of CFH approximately encodes for a short-consensus repeat domain (SCR) represented by globular structures in the figure. The amino terminal of CFH regulates C3 convertase activity, while the carboxyl terminal is involved in host cell recognition. The related proteins arose through exon duplication events and sequence identity to CFH is listed above the corresponding SCR. Image based on Jozsi Trends Immunol 29; 380-387: 2008 and Rodríguez de Córdoba Clin Exp Med 151; 1-13: 2008. 35

Table 1.1 Genetic and environmental risk factors in SLE, APS, and AMD

Genetic Risks SLE APS AMD

Common HLA HLA HLA

C4 C4

MBL MBL

CFB CFB

C3 C3

C2 C2

Specific C1q, C1r, C1s C5 CFH, CFHR3-R1

BLK, FCGR2A, IRF5, ABCA, APOE, FIBL3 ITGAM, PTPN22, STAT4

Environmental Risks

Common Gender Gender Gender

Age Age Age

Racea Raceb

UV exposure UV exposure

Dietc Diet/Obesity

Smokingc Smoking

EBV Infection Infection

Prescription Prescription

Specific Chemical exposure Immobilityc

Surgeryc

Oral Contraceptivesc

Continued

Table 1.1 continued

aIncreased risk in African Americans and Asians compared to European

Americans

bIncreased risk among Asians and European Americans compared to African

Americans

cRisk factors for developing APS when aPL are present

Abbreviations: SLE-Systemic Lupus Erythematosus; APS-Antiphospholipid

syndrome; AMD-Age related macular degeneration; EBV-Epstein Barr Virus;

aPL-antiphospholipid antibodies.

CHAPTER 2

METHODS TO DETECT AND DETERMINE THE VARIABILITY OF THE

COMPLEMENT FACTOR H RELATED GENES CFHR3 AND CFHR1 COPY

NUMBER VARIAITON AMONG MULTIPLE RACES

Abstract

Multiple variations of Complement Factor H (CFH) affect its ability to regulate C3b leading to deregulated complement activation and host-cell damage. Recently, a copy number variant (CNV) in the CFH gene region

resulting in loss of both CFHR3 and CFHR1 has been implicated in Age-Related

Macular Degeneration. Methods of detecting the CFHR3-R1 CNV vary and provide discrepant results. This chapter aims to detect and determine the

CFHR3-R1 CNV among multiple races by establishing definitive and robust methodologies. To this extent CFHR3-R1 copy numbers were measured in over

1600 samples representing subjects of European, African, Asian, and Asian

Indian ancestries by Southern blot. The 76-kb CNV was resolved by PmeI PFGE-

Southern blot and is present at 0, 1, or 2 copies in diploid individuals.

Confirmation and refinement by TaqI RFLP-Southern blot and PshAI-PvuII

RFLP-Southern blot, revealed common polymorphisms in the 5’ region of the

CFHR1 gene. CFHR3-R1 copy numbers varied significantly between subjects of multiple races (χ2=181, p=2.28x10-36). Only 1 out of 215 subjects of Asian

ancestry had a homozygous deficiency of CFHR3-R1. This contrasts with the

African cohort with nearly 20% of subjects having a homozygous deficiency.

CFHR3-R1 carriers were highest among subjects of Asian ancestry (0.995),

followed by European ancestry (0.951), then Asian Indian ancestry (0.896) and

lowest among African ancestries (0.823). CFHR3-R1 copy numbers vary widely

among multiple races and could affect the functional regulation of C3, the target

of CFH. These great race differences suggest that differences in CFHR3-R1

copy numbers may contribute to the variability, susceptibility, and severity in

complement-mediated disease.

2.1. Introduction

Segmental variation of genomic DNA of 1 kb or larger is a copy number variant or CNV which is either inherited or de novo. Nonallelic homologous recombination or gene conversion likely give rise to CNVs and can span several genes allowing both size and polymorphic variability (Nei et al. 2000; Nei and

Rooney 2005; Perry et al. 2008).

CNV detection methods vary reflecting both the technological advances and the size variability of CNVs. Karyotyping or comparative genomic hybridization (CGH) detects large chromosomal rearrangements. CGH examines the ratio of intensity between a reference (or pooled reference group) and another sample that are differently labeled to determine regions of chromosomal deletion and duplication. Array CGH (aCGH) can detect regions of 50 kb down to

200 bp by changing the platform from BACs to long oligonucleotides (Shinawi and Cheung 2008; Urban et al. 2006). Other comparative methods such as multiplex amplifiable probe hybridization and paralog ratio test (MAPH-PRT) use sequence specifical primers and probes to accurately detect CNVs in a high through-put manner (Armour et al. 2007). Multiplex ligation dependent probe amplification (MLPA) depends on perfectly matched sequence for ligation to commence and is another example with high throughput possibilities (Schouten et al. 2002). A single SNP or a series of SNPs in linkage with the CNV can “tag” the region. Tagging can be a reliable method of CNV detection but only 50% of

40 known SNPs are captured by current platforms (Cooper et al. 2008). Despite the

ability to multiplex and tag a region of interest, there remains a need for more

definitive, rapid, and robust methods of detecting CNVs.

Copy number variants are similar to SNPs in that they can associate with

disease and vary among populations. There can be false associations between

SNPs or CNVs with a genetic trait because of differences in ancestral

composition (Conrad and Hurles 2007; Jakobsson et al. 2008; Redon et al.

2006). CNVs represent a widespread common structural variation among

otherwise healthy individuals (Lafrate et al. 2004; Sebat et al. 2004; Tuzun et al.

2005) and account for more nucleotide variation than SNPs owing to the size

alone (Tuzun et al. 2005). CNVs are overrepresented in environmental and immune sensory genes (Cooper et al. 2007; Nguyen et al. 2006). Affecting transcription or translation of overlapping or nearby genes (Aldred et al. 2005;

Stranger et al. 2007), acting on gene(s) directly, or disrupting transcriptional

elements, CNVs influence phenotype diversity (McCarroll et al. 2006). The

implication of a genetic structural element to alter phenotype leads to the belief that CNVs may be strong causal variants in disease susceptibility and severity

(Beckmann et al. 2007).

The following describes the development of definitive methods for detecting CFHR3-R1 copy numbers among healthy subjects of multiple races using Southern blot. The 76-kb biallelic CNV in the CFH gene region

encompassing CFHR3 and CFHR1 was resolved by PmeI PFGE, then confirmed

41 and refined by TaqI and PshAI-PvuII RFLP-Southern blot. The CFHR3-R1 CNV

varied among multiple races, and was detected at high frequencies among Asian

American populations, followed by subjects of European ancestry, and Asian

Indian Americans. There were decreased copy numbers in subjects of African

origins. These results suggest that the variable frequency of the CFHR3-R1 CNV

among multiple populations may contribute to different disease susceptibility.

2.2 Materials and Methods

2.2.1 Study populations

Copy number of CFHR3-R1 was determined by Southern blot analysis in over 2000 samples of multiple ethnicities, in the absence and presence of

disease to establish definitive methods of CNV detection. Abbreviations and

sample sizes of unrelated healthy subject cohorts are listed in Table 2.1. There

are 689 subjects of European ancestry, 378 subjects of African ancestry, 163

subjects with Asian Indian ancestry, and 215 subjects with East/Southeast Asian

ancestry. Healthy subjects were recruited from The Ohio State University,

Nationwide Children’s Hospital, Church fairs and ethnic festivals in Columbus,

Ohio, and collaborators from Pennsylvania, Britain, and Africa.

Subjects of European ancestry (EUA-LB) consist of 541 European

Americans (EUA) and 148 subjects from London, Britain (LB). The European

American cohort divides into 442 subjects from Ohio (including 50 medical

students at The Ohio State University), and 99 subjects from Pennsylvania.

Among those with African ancestry (AFA-AFR), 250 are from Ohio (EUA-OH),

and 103 were provided from JM at Drexel in Pennsylvania (EUA-PA). African

(AFR) samples were collected from Mali, Africa and provided through JM (n=25).

Asian Indian American (AIA) samples consisted of individuals from India,

Pakistan, Bangladesh, and Sri Lanka now living in the US. Subjects with Eastern

and Southeast Asian (EAA) origins were comprised of 176 individuals from

China, Korea, Japan (EAA-EA) and 39 subjects from regions of Cambodia,

Philippines, Vietnam, Laos, Malaysia, and Thailand (EAA-SE). All healthy subjects had an absence of autoimmunity extending through their primary relatives, and self-reported ancestral information. Height, weight, and age were collected when available.

2.2.2 Genomic DNA samples

Genomic DNA was derived from cultured cells from blood collected in

EDTA-tubes using Puregene DNA isolation kit (Gentra Systems), or provided through collaborative efforts. Genomic DNA was obtained from consenting healthy subjects and processed in the Yu Lab by E. Chung, K. Saxena, Y. Shu,

Y. Wu, B. Zhou, and Y. Yang. Digestion of genomic DNA for analysis by TaqI

RFLP-Southern blot, PshAI-PvuII RFLP-Southern blot, and by long-range mapping PFGE using PmeI was performed previously by C. Blanchong, E.

Chung, K. Saxena, Y. Shu, Y. Wu, and Y. Yang as described (Blanchong et al.

2001; Chung et al. 2005; Chung et al. 2002b).

2.2.3 Hybridization of Southern blot membranes to detect CFHR3-R1 copy number variation

Labeling reactions were performed according to previously described methods using [α-32P]dCTP (PerkinElmer) with assistance from B. Zhou and Y.

Yang (Chung et al. 2002b).

TaqI RFLP: A cDNA clone for CFHR2 (GenBank I.D.: BC022283, ATCC

6672582) was amplified by PCR at 94°C for 2 min, followed by 35 cycles of 94°C

for 45 sec, 60°C for 45 sec, and 72°C for 2 min. An additional elongation step for

5 min at 72°C followed. PCR amplified a 817 bp region using the Fail-safe™ PCR

system (Epicentre) with primers corresponding to the N and C termini of CFHR2

(Forward: 5’-CCTCCACCTATTGACAATGG-3’, Reverse: 5’-

CTTCACAACTGGGATATACCAG-3’; Invitrogen). Eight 25 µL reactions were

pooled, purified, and concentrated by ethanol precipitation overnight and excised

following standard protocol (Qiagen #28104) from an 0.8% low-melting point

agarose gel (Invitrogen) following electrophoresis at 4°C, 80 mV.

PshAI-PvuII RFLP: A cDNA clone for CFH (GenBank I.D.: BC142699,

Open Biosystems Clone ID: 40148771) was amplified using Fail-safe™ PCR

system (Epicentre) at 94°C for 2 min, followed by 35 cycles of 94°C for 45 sec,

60°C for 45 sec, and 72°C for 2 min, an additional elongation step for 5 min at

72°C followed. Primers amplified a 125-kb region of CFH corresponding to exons

21 and 22 (Forward: 5’-CCTCCACCTATTGACAATGG-3’, Reverse: 5’-

CTATCTTTTTGCACAAGTTGGATACTC-3’, IDT). Eight 25 µL reactions were

pooled, purified, and concentrated by ethanol precipitation overnight and excised

following standard protocol (Qiagen #28104) from an 0.8% low-melting point

agarose gel (Invitrogen) following electrophoresis at 4°C, 80 mV.

PmeI PFGE: CFHR1cDNA clone (GenBank I.D.: BC016755, ATCC MGC-

13525) digested with SfiI restriction enzyme of 1312-kb in length was excised from an 0.8% low-melting point agarose gel (Invitrogen) following electrophoresis at 4°C, 80 mV. This hybridized to the membrane alone or jointly with CFHR2 cDNA label prepared as described previously.

2.2.4 Determination of CFHR3-R1 copy number and genotype by Southern blot analysis

The CFHR3-R1 copy number variant was resolved by PmeI-PFGE labeled with a CFHR1 or CFHR2 cDNA probe. PmeI restriction mapping and DNA fragmentation patterns were used to reveal the nature and size of the CNV.

Refinement and confirmation by TaqI RFLP-Southern blot or PshAI-PvuII RFLP-

Southern blot used probes labeled with either full-length CFHR2 cDNA or CFH cDNA for exons 21 and 22.

2.2.5 Bioinformatics, statistical analyses and software applications

Dottup plot of sequence identity in the CFH gene region was generated using EMBOSS: The Applications (http://mobyle.pasteur.fr/cgi- bin/portal.py?form=dottup). Sequence corresponding to CFH through CFHR5

was plotted against itself at a word size or exact match size of 30. Individual

genes and restriction sites were mapped based on NCBI Build 37.1. The UCSC

Genome Browser GRCh37 Assembly (hg19) was used to demonstrate repeating

46 elements using Repeat Masker corresponding to the CFH gene region at http://genome.ucsc.edu/. Statistical analyses were performed using JMP v 8.0

(SAS). Copy numbers of CFHR3-R1 were compared by Chi-Squared analysis

(Likelihood ratio reported) or Fisher’s exact test if applicable. In the case of EAA comparison between EA and SA groups, Chi-Squared analysis would be inappropriate and instead the average number of genes were compared using

Student’s t-test instead. Gene copy index (GCI) refers to the average number of copies of CFHR3-R1. Multiple group comparisons were done in an One-way-

Analysis of Variance (ANOVA) framework, and individual groups were compared by Student’s t-test. Carrier refers to subjects with the presence of CFHR3-R1 with no reference to quantity. Carrier frequency of CFHR3-R1 is the count of subjects with one or two copies of CFHR3-R1 divided by the total number of subjects in the group of interest. Allelic frequency of CFHR3-R1 considers the entire CFHR3-R1 region as a biallelic entity, and is computed as the number of chromosomes containing CFHR3-R1 divided by the total number of chromosomes in the group of interest.

Additional Declarations: The extensive cohorts obtained to investigate the copy number of CFHR3-R1 were made possible through collaborative efforts by past and present colleagues in the Yu laboratory and Nationwide Children’s Hospital who assisted in the recruitment of healthy subjects. Additional contributions of healthy subject cohorts were generously provided from Dr. Mark Pepys at

University College London, London, Britain, and Dr. Joann Moulds at Drexel

University. I am indebted to Yu lab members Dr. Kapil Saxena, Ms. Bi Zhou, Dr.

Yee Ling Wu, Ms. Yaoling Shu, Dr. Yan Yang, and Dr. Erwin Chung for DNA

preparation, DNA digestion, and Southern blot performance . I would also like to acknowledge assistance from Ms. Bi Zhou and Dr. Yan Yang in establishing and performing the hybridization experiments.

2.3 Results

2.3.1 Copy number variation of CFHR3-R1 detected by Southern blot

analysis

Dottup plot of identical regions spanning CFH through CFHR5.

To ascertain the extent of sequence identity within the CFH gene region, a

dottup plot of the region containing CFH, CFHR3, CFHR1, CFHR4, CFHR2, and

CFHR5 in tandem was performed. Each of the genes is denoted by black boxes

as positioned according to NCBI Build 37.1 (Figure 2.1). Large regions of

sequence identity appear as solid black diagonal lines. The length of these lines

correlates to the length of sequence identity. The corresponding genomic

positions is determined by tracing the lines to either the left or bottom portion of

the plot. The central diagonal line represents the perfect alignment of the CFH

gene region to itself. All other regions appear as mirror images from this line.

There is a large region of segmental duplication extending from the 3’ region of

CFH through to the 3’ region of CFHR3 and again from the 3’ region of CFHR3

through to the mid-region of CFHR2 separated by navy vertical lines. Extensive

segments of sequence identity were found to occur within CFH and CFHR4. One

particular region of CFHR4 is present 3 times throughout the region. Based on

RepeatMasker, this segment is not a repetitive element. Additionally, there is

sequence identity between CFHR5 and downstream sequence of both CFHR1

and CFHR2. This extensive sequence identity in the CFH gene region enables

cross-hybridization between differently labeled probes. Breakpoints of the

CFHR3-R1 CNV are indicated in red and occur 6400 bases after CFH and after

CFHR1 (Hughes et al. 2006).

PmeI PFGE-Southern blot resolves CFHR3-R1 CNV

Long-range mapping of PmeI-digested genomic DNA by PFGE hybridized

to CFHR1 cDNA labeled probe reveals three distinct patterns of genomic

fragments (Figure 2.2). The first pattern consists of 2 DNA fragments of 171 and

120-kb. Based on restriction mapping within the CFH gene region, the 171-kb

fragment contains the genomic sequence of CFH, CFHR3, and CFHR1. The

120-kb region corresponds to CFHR4, CFHR2, and CFHR5 (Figure 2.1). In all

samples analyzed the 120-kb DNA fragment was present and not subject to copy

number variation. The second pattern represents a shift of the 171-kb fragment

to ~95-kb. This corresponds to a homozygous deficiency of CFHR3-R1. the third

pattern consists of DNA fragments at 171, 120, and 95-kb. This represents

subjects with one copy of CFHR3-R1 indicating its absence from one

chromosome. Based on these definitive PFGE results, the copy number variant

is 76-kb and biallelic. Subjects can have zero, one, or two copies of the genomic

region spanning CFHR3-R1.

TaqI and PshAI-PvuII RFLP-Southern blot analysis confirms CFHR3-R1

CNV

To confirm absence of DNA fragments containing CFHR3-R1 from the

germline, genomic DNA was subjected to TaqI-RFLP-Southern blot (Figure 2.3)

and PshAI-PvuII RFLP-Southern blot (data not shown). A CFHR2 cDNA label hybridized to full-length CFHR2 as well as to regions in CFHR1 and CFHR5 resulted in a complex fragmentation pattern representing 6 genotypes. BLASTn of CFHR2 cDNA sequence to the CFH gene region and TaqI-restriction mapping identified 8 regions of 94-100% sequence identity at 9.9, 5.3, 4.3, 4.1, 3.5, 3.2,

2.4, 2.2-kb. DNA fragments subject to copy number variation correspond to

CFHR1 fragments at 9.9, 4.3, 3.2, and 2.4-kb.

Lane 3 represents a subject with zero copies of CFHR3-R1. The allele is termed C and the genotype is CC. Lanes 2, 4, and 5 are subjects with two copies of CFHR3-R1 and a common polymorphism. Based on restriction mapping, and refined cDNA labels, the SNP occurs within the 5’ region of CFHR1 resulting in either a 9.9-kb fragment (allele A) or a 4.3-kb fragment (allele B). Lane 2 contains the homozygous AA genotype and lane 5 the homozygous BB genotype. Lane 4 represents a subjects with an A allele and a B allele for the heterozygous AB

genotype. One copy of either allele A or allele B can be found with allele C giving

genotypes of AC (lane 1) and BC (lane 6). Allele A and allele B are present only

in the presence of DNA fragments at 3.2 and 2.4-kb. Each of these regions maps

to an exon in CFHR1 confirming the absence of the gene from germline DNA.

CFHR3-R1 copy number of one is determined based on apparent differences in intensity of DNA fragments corresponding to allele C with those fragments corresponding to CFHR2. The TaqI RFLP represents a complex picture of the

CFH gene region in which 6 genotypes are present: AA, AB, BB, AC, BC, and

CC. Subjects with AA, AB, or BB carry two copies of CFHR3-R1 and those with

either AC or BC carry one copy of CFHR3-R1. Homozygous deficiency of

CFHR3-R1 is denoted as the CC genotype.

PshAI-PvuII RFLP-Southern blot labeled with CFH cDNA probe

corresponding to exons 21 and 22 confirms the findings of PmeI PFGE and TaqI

RFLP (Figure 2.4). Cross hybridization of this region results in 6 DNA fragments

(1.2, 2.8, 3.8, 4.9, 7.2, to 8.5-kb) and map to exonic regions in CFH, CFHR1, and

CFHR2. The absence of gene fragments at 7.2, 3.8, and 1.2-kb, all mapping to

exonic regions of CFHR1, confirm the absence of the CFHR3-R1 region.

Collectively, PFGE, and both RFLPs cross-confirm each other and provide

definitive evidence for a 76-kb copy number variant in CFHR3-R1.

2.3.2 CFHR3-R1 copy number variation among healthy control groups

CFHR3-R1 copy numbers were determined in four different race groups

defined by ancestral origins consisting of European, African, Asian, and Asian

Indian. Subjects of European, African, and Asian ancestries were subdivided

geographically and results are presented in Table 2.2. The copy number of

CFHR3-R1 was determined in the 689 European (EUA-LB) subjects. No

52 significant differences were detected among subjects of European ancestry, justifying inclusion as one large group (χ2=5.6, p=0.5). A significant difference was detected among those with African ancestry (χ2=13.4, p=0.0098). AFA-OH

had 10% lower frequencies of CFHR3-R1 homozygous deficiency than either

AFR or AFA-PA (AFA-OH: 0.14, AFR and AFA-PA: 0.24). Further differences are

present at both 1 and 2 copies of CFHR3-R1. Subjects of Asian ancestry were

geographically divided into Southern Asian and East Asian with no detected

differences (χ2=0.63, p=0.7).

The copy number of CFHR3-R1 in healthy subjects among multiple races

significantly different (χ2= 181, p=2.28x10-36, Figure 2.5; Table 2.3). Of the 215

EAA subjects, CFHR3-R1 homozygous deficiency was present in one individual.

Greater than 75% of the EAA cohort carried two copies of CFHR3-R1, and only

15.3% had one copy of CFHR3-R1. In the European cohort (EUA-LB), 34 (4.9%)

of subjects lacked CFHR3-R1 completely. There were 31.0% carrier frequency of

one copy and 64.1% carried two copies of CFHR3-R1.There were twice as many

homozygous deficiencies detected in the AIA cohort (10.4%) than EUA.

Additionally, one copy of CFHR3-R1 was present in 40.5% of individuals and half

(49.1%) maintained two copies of CFHR3-R1. The cohort with the most

homozygous deficiencies is AFA-AFR, present in 17.7% of subjects. Nearly half

of the AFA-AFR cohort carries one copy of CFHR3-R1 (46.0%). The remaining

36.2% have two copies. CFHR3-R1 copy number frequency varied significantly

between all races. The greatest difference occurring between the two extremes

53 in AFA-AFR and EAA (χ2=150, p=2.81x10-33). The smallest difference was

between AIA and AFA-AFR (χ2=9.5, 0.0086).

The Gene Copy Index (GCI) or the average copy number of CFHR3-R1,

was also significantly different (F ratio=63, p=1.70x10-38). The GCI for AFA-AFR

is 1.18 ± 0.71 and for EAS is 1.84 ± 0.38 (p=1.41x10-34). AFA was also

significantly increased over AIA (1.39 ± 0.67, p=4.06x10-4) and EUA-LB (1.59 ±

0.58, p=7.33-25). There were also significant differences detected between the

EUA-LB and AIA (p=1.02x10-4), and EUA-LB and EAA (p=3.60x10-7). The

CFHR3-R1 carrier frequency was 82.3% in AFA, 99.5% in EAA, 95.1 in EUA-LB and 89.6% in AIA. These differences were significant (χ2=76.3, p=1.92x10-16) and demonstrate a trend toward higher CFHR3-R1 copy numbers. AFA-AFR also had the lowest CFHR3-R1 allelic frequency (0.593). This is a 32.6% reduction compared to EAA (0.919). EUA and AIA demonstrate a 10% difference in allelic frequencies (0.796, 0.693, respectively). These results translate into greater deficiency among AFA than AIA, with less CFHR3-R1 deficiencies in EUA-LB and EAA.

2.3.3 CFHR3-R1 genotypes in healthy subjects among multiple races

Examination of CFHR3-R1 by TaqI RFLP-Southern blot analysis revealed the presence of 6 genotypes that account for a polymorphism in the 5’ region of

CFHR1 and the CFHR3-R1 copy number variation. The frequency the CFHR3-

R1 genotypes was significantly different among the multiple races examined

(χ2=182, p=8.6x10-31; Table 2.4). Each allele, A, B, C, was present among each race, but the AA genotype was not detected among the 108 Asian Indian

Americans. This is an interesting observation since over half the AIA population are carriers of the A allele (0.537). The reason for the absence of the A allele in

AIA is unknown. The AC genotype was most common in both AIA and AFA

(0.343 and 0.312, respectively. EAA and EUA had highest frequencies of the AB genotype (0.401 and 0.296, respectively) followed by the BB genotype which was present in EAA at 22.8% and in EUA at 25.7%.

EAA and AIA were highly divergent (χ2=117, p=1.2x10-23) though all races

were significantly different from each other. The A allele is the major allele in

African and Asian subjects (0.641 and 0.709, respectively). The majority of EUA

were B allele carriers (0.749) and AIA demonstrated a trend toward increased C

allele carriers (0.704). The least carried allele was B in AFA (0.313), C in EAA

and EUA (0.143 and 0.346), and allele A in AIA (0.537).

2.4. Discussion

This chapter establishes definitive methodology for determining and characterizing the copy number variation in the CFH gene region. The CFHR3-

R1 CNV has been reported in the literature previously and is described as an

84.7-kb deletion (Hughes et al. 2006) based on sequencing alignments of

suggested breakpoints. Southern blot analysis suggests the region varies by

approximately 76-kb. There are multiple possibilities in which either size is

correct. The Southern blot analysis by PFGE resolves large fragments of DNA

and the precision is limited to around 5-kb. This would give a range from 71 to

81-kb. The 76-kb size was determined based on the properties of the gel (larger

sizes migrate closer together while smaller sized fragments are further apart) and

placement of markers. Additional support derives from the position of the PmeI-

restriction sites located outside the breakpoints of the CNV. The breakpoints are

not well defined, owing to the high amount of sequence identity, needs to be

resolved further.

A common polymorphism from a TaqI RFLP occurred in the CFHR3-R1

region and mapped to the 5’ region of CFHR1. This leads to a possibility of six

genotypes for the CFHR3-R1 region alone. The functional consequences of this polymorphism are unknown but indicate the complexity of the CFH gene region

and its full description as being triallelic.

CFHR3-R1 copy numbers vary widely among healthy subjects of multiple

races. These samples were collected from multiple locations, grouped according

56 to reported ancestry into European, African, Asian, and Asian Indian. The extent of ancestry each subject reported was not experimentally verified and segregated based on self-reported information. Reasons for differences among groups of common geographic origins such as African ancestries can be attributed to migration influxes into regions where similar individuals perpetuate a community together reminiscent of their homeland. Diversity may exist within Africa itself, as geographic barriers or settlement differences contribute to genetic diversity. This variability can also stem from the ancient origins of the CFHR3-R1 CNV.

Inclusion of all African populations in a single group (AFA-AFR) is justified as differences alter the effect size of the results but not the trend.

Comparing healthy subjects of multiple races demonstrated remarkable

differences in CFHR3-R1 copy numbers, which agree with those previously reported by Hageman (Hageman et al. 2006). The CFHR3-R1 deficiency was present at 16% in African Americans, 4.7% in Europeans, 2% in Chinese, 17% in

HGDP-Africans and North Africans, and 15% in Middle Eastern subjects. The first report in an European cohort found 4.4% of subjects with the CFHR3-R1 homozygous deficiency (Feifel et al. 1992). This demonstrates a CNV with great racial variability and possible impacts on health and disease. The need to have duplications of the CFH family of genes implies an immunological need for diversity. Immune diversity can lead to an efficient immune system to battle an array of host-pathogens while protecting against autoimmunity. Other possibilities for these differences can be evolutionary changes, geographic barriers, and

57 effects from migration and trading patterns. Owing to the great architectural complexity, the presence of multiple regions of duplication of CNVs in general

(Perry et al. 2008), and ethnic variation (Jakobsson et al. 2008), copy number

variants may contribute to differential intrinsic strength of the immune system,

impacting health and disease.

In addition to the CFHR3-R1 copy number variation, a TaqI RFLP was

detected and mapped to a location 5’ of CFHR1. Data was not available for all

samples because of limited quantities of DNA or poor quality DNA. The major

allele varied by race and the RFLP may associate with CFHR3-R1 copy

numbers. The RFLP alleles likely represent a SNP generating a different DNA

fragmentation pattern based on restriction mapping of this region. This is the first

known account of this high frequency SNP in the 5’ region of CFHR1 and is not

present in dbSNP, nor reported in any papers. The influence the allele may have

on CFHR1 protein levels or differential disease states is currently unknown and

will be the subject of future studies. The CFHR3-R1 CNV and the polymorphic

alleles form a complex interrelationship because in essence homozygous

deficiency of CFHR3-R1 implies a lack of either A or B alleles, whilst both allele A

and allele B can be found in heterozygous individuals.

This study demonstrates great racial differences in CFHR3-R1 copy

numbers and within the CFHR1 RFLP. Asian populations have the highest

frequency of CFHR3-R1 and individuals of African ancestry have the lowest.

There is unexplained variation in which Africans have increased frequencies of

58 the AA genotype compared to other races, in which allele B appears to be the major allele. Future studies will provide more in-depth knowledge of the CFH gene region to determine the breakpoints and additional variability of the CNV.

The role of CFHR3-R1 copy numbers in racial disparity needs investigated.

Altering the number of genes within the CFH gene region provides an additional

level of genetic variation which can fine tune the immune response. Future efforts

would establish the impact of CFHR3-R1 functional levels of protein or gene

transcription and translation.

Figure 2.1 A dottup plot and RepeatMasker demonstrating sequence identity

throughout the CFH gene region. Solid black lines represent regions of sequence

identity of exact match at a word-size of 30. Black bars and labels indicate the

location of CFH, CFHR3, CFHR1, CFHR2, CFHR4 and CFHR5. The size of the

PmeI digestion fragments (red arrows) varies with CFHR3-R1 copy number and

is indicated.

CFH CFHR3 CFHR1 CFHR4A CFHR4B CFHR2 CHFR5 CFHR2 CFHR4B CFHR4A CFHR1 CFHR3 CFH

196621008 196680641 196740273 196799906 196859539 196919172 196978804

CFH CFHR3 CFHR1 CFHR4A CFHR4B CFHR2 CHFR5 PmeI

CFH CFHR4A CFHR4B CFHR2 CHFR5 PmeI

Figure 2.1

1 2 3 M

171 ―

― 146

120 ―

― 97

95 ―

2 0 1 Copies of CFHR3-R1

Figure 2.2 A PmeI PFGE-Southern blot with CFHR1 cDNA label to resolve the

CFHR3-R1 CNV. PmeI PFGE-Southern blot reveals a 76-kb biallelic copy number variant. A marker (M) lane is indicated on the left with DNA fragments of

146- and 97-kb. The figure demonstrates the DNA fragments generated from subjects with 0, 1, or 2 copies of CFHR3-R1 are 171- and 120-kb for 2 copies;

120- and 95-kb for 0 copies; and 171-, 120-, and 95-kb for 1 copy.

1 2 3 4 5 6 kb Gene/Exon % identity ― 9.9 R1e1-5’

― 5.3 R2e1 100 ― 4.3 R1e1 100 ― 4.1 R2e3,e4 100 ― 3.5 R5e2,e3 94 ― 3.2 R1e5 95

― 2.4 R1e2 96 ― 2.2 R2e4,e5 100

1 2 0 2 2 1 Copy number of CFHR3-R1 AC AA CC AB BB BC CFHR3-R1 genotype

Figure 2.3 A TaqI RFLP-Southern blot with a CFHR2 cDNA label refining the

CFHR3-R1 CNV. TaqI RFLP-Southern blot reveals a complex pattern of DNA fragments refining the CNV of CFHR3-R1. To the right of the figure is the corresponding size of DNA fragments, with the gene/exon region indicated with

% sequence identity. Red color represents regions subject to copy number variation. Number of copies of CFHR3-R1 and genotypes generated from the complex banding pattern are listed below the figure.

1 2 3 4 5 kb Gene/Exon % identity ― 8.5 CFHe21,22 100 ― 7.2 R1e5 100

― 4.9 CFHe21 100

― 3.8 R1e6 99

― 4.1 R2e4 95

― 1.2 R1e5,e6 99 2 0 2 2 1 Copy number of CFHR3-R1 XX CC XX XX CX CFHR3-R1 genotype

Figure 2.4 A PvuII-PshAI-Southern blot using a CFH cDNA probe corresponding to exons 21-22 to confirm the CFHR3-R1 CNV. PvuII-PshAI RFLP-Southern blot reveals a simple pattern of DNA fragments confirming the CNV of CFHR3-R1. To the right of the figure is the corresponding size of DNA fragments, with the gene/exon region indicated with % sequence identity. Red color represents regions subject to copy number variation. Number of copies of CFHR3-R1 and genotypes generated from the complex banding pattern are listed below the figure.

1.0 χ2=181 P=2.28x10-36 0.84 0.8 EAA, N-215 EUA-LB, N=689 0.64 AIA, N=163 0.6 AFA-AFR, N=378 0.49 0.46 0.40 0.4 0.36 Frequency 0.31

0.18 0.2 0.15 0.10 0.05 0.01 0.0 01 2 Copies of CFHR3-R1

Figure 2.5 The frequency of CFHR3-R1 copy number in healthy subjects of multiple races. EAA (blue) East/Southeast Asian American; EUA-LB (red)

European American and London, Britain Europeans; AIA (green) Asian Indian

American; MB (purple) African Americans from Ohio.

Table 2.1 Abbreviations used for healthy control group population studies

Abbreviation Population N

EUA-LB All subjects of European ancestry 689

LB Europeans from London, Britain 148

EUA European Americans (EUA-OH, OSU, EUA-PA) 541

EUA-OH European Americans from Ohio 392

EUA-OSU European American students at the Ohio State University 50

EUA-PA European Americans from Pennsylvania 99

AFA-AFR All subjects of African ancestry 378

AFR Africans from Mali, Africa 25

AFA African Americans 353

AFA-OH African Americans from Ohio 250

AFA-PA African Americans from Pennsylvania 103

AIA Asian Indian Americans 163

EAA East and Southeast Asian Americans 215

EAA-EA East Asian Americans 176

EAA-SE Southeast Asian Americans 39

0.7376 0.7376 p-value p-value 2 χ t-test multiple races multiple races y N Frequency Total N N Total N Frequency y among populations of among populations CFHR3-R1

3 0.056 0.630 31 0.315 16 50 9 0.091 0.646 64 0.263 26 99 6 0.040 0.628 93 0.331 49 148 5.6 0.5 0.0098 8 0.360 0.440 6 0.240 11 16.7 25 1 0.006 26 0.847 149 0.148 0 176 0 7 0.820 32 0.180 39 16 16 0.041 0.648 254 0.311 122 392 36 0.145 0.415 105 0.440 109 250 0.238 25 0.248 24 0.514 54 103 0 Copies 1 Copy 2 Copies Copy number of of number Copy

N Frequency N Frequenc N Table 2.2 Frequency N EUA-OH EUA-OSU EUA-PA LB AFA-OH AFA-PA AFR EA SA

N Frequency N Frequency copy number among healthy subjects of multiple races. races. multiple of subjects healthy among number copy 0.919 0.796 0.693 0.593 0.693 0.796 0.919 0.995 0.951 0.896 0.823 0.896 0.951 0.995 ± 0.38* 1.84 ± 0.58 1.59 0.67 ± 1.39 ± 0.71 1.18

1 0.005 0.104 17 0.049 34 67 0.177 33 33 0.405 66 0.310 174 213 0.460 0.153 181 0.842 442 0.641 80 0.491 0.491 80 0.641 137 181 442 0.362 0.842 215 215 163 689 378 EAA EUA+LB AIA AFA+AFR AIA EUA+LB EAA N Frequency N Frequency Frequency N Frequency N CFHR3-R1

Total N Total N

0 1 2 GCI GCI Allelic Allelic Carrier Carrier Copies CFHR3-R1

Table 2.3 SD ± *Mean

12 9 - 31 12 14 12 23 ------

p-value

χ EUA v AIA 61.1 7.12x10 61.1 AIA v EUA 0.343 AFA v AIA AIA 72.3 3.5x10 v 0.343 AFA 0.194 AFA v EAA 62.2 4.3x10 v 0.194 AFA 0.102 EUA v AFA 46.9 6.0x10 ican; EUA-European EUA-European ican;

0.102 0 0.102 0 All 182 8.6x10 bjects of multiple races races bjects of multiple N Freq Groups

A- East Asian Amer Asian East A- 15 42 189 541 108 genotypes among healthy su healthy among genotypes 0.641 0.709 0.499 0.537 0.537 0.499 0.709 0.641 0.313 0.693 0.749 0.556 0.556 0.749 0.693 0.313 0.594 0.143 0.346 0.704 0.704 0.346 0.143 0.594 8 0.125 77 0.296 160 0.401 5 0.078 43 21 0.257 139 0.228 11 7 0.109 11 0.196 106 0.058 EUA 64 v 28 0.259 1.8x10 EAA 20 0.312 20 37 0.102 55 0.079 11 0.172 1 0.005 26 0.048 11 0.102 EAA v AIA AIA 1.2x10 117.2 v 0.172 11 1 0.102 11 0.048 26 0.005 EAA 64 13 0.203 13 55 0.222 CFHR3-R1

EAA AFA EUA AIA Total N AC AB BB BC CC AA A Carrier A B Carrier B Carrier C Carrier C Carrier Genotype N Freq N Freq N Freq N Genotype American; AIA-Asian Indian American; Freq-Frequency American; Indian AIA-Asian American; Table 2.4 AFA-African American; EA Abbreviations:

CHAPTER 3

DEVELOPMENT OF A REAL-TIME PCR ASSAY TO DETERMINE THE ROLE

OF COPY NUMBER VARIATION OF CFHR3-R1 AND COMPLEMENT C4 IN

AGE-RELATED MACULAR DEGENERATION (AMD)

Abstract

Age Related Macular Degeneration (AMD) affects approximately 50 million individuals worldwide and is the leading cause of blindness. Both environmental and genetic factors contribute to disease susceptibility. This chapter develops a quantitative real-time PCR (RT-PCR) assay to detect the copy number variation of CFHR3-R1 using minimal quantities of DNA. The RT-

PCR method was then applied to investigate the role of CFHR3-R1 and

Complement Component C4 in 182 AMD patients with geographic atrophy (GA,

N=91) and choroid neovascularization (Neo, N=90). Copy numbers of CFHR3-R1 and total C4 genes were determined in 457 European American healthy controls by PmeI PFGE, TaqI RFLP, and PvuII-PshAI RFLP- Southern blot analysis.

CFHR1-R3 copy numbers were significantly increased in Neo AMD cases compared to controls (χ2=6.8, p=0.03). All Neo AMD cases investigated carried 70 one or two copies of CFHR3-R1 which was reflected in the carrier frequency of

Neo-AMD and controls (1.000 vs 0.957; p=0.05). A difference in total C4 copy numbers was detected among AMD cases with GA and controls (χ2=16.6; p=0.023). GA AMD cases have significant increases in C4 gene copies (GCI:

4.15 ± 0.72 vs 3.85 ± 0.70, p=0.0002). These results demonstrate a role for increased copy numbers of CFHR3-R1 and C4 with AMD risk. The association of

CFHR3-R1 with choroid neovascularization and C4 with geographic atrophy suggests different mechanisms of disease progression. This is the first report using definitive methods of detection for determination of the CFHR3-R1 CNV in

AMD.

3.1 Introduction

Age-Related Macular Degeneration (AMD) is a complex disease causing irreversible blindness with both genetic and environmental components such as age, ethnicity, smoking, hypertension, obesity, and diet (Jager et al. 2008).

Central vision loss begins with changes in the photoreceptor and outer retinal layers due to drusen. Vision loss worsens as geographic atrophy (GA) accelerates. GA describes loss of the retinal pigmented epithelium (RPE) in the absence of exudates and accounts for 85% of late stage AMD. Choroid neovascularization (Neo) is present in the remaining 15% of late state AMD. Neo describes the process of degeneration in the choriocapillaris, Bruch’s membrane, pigment epithelium, and retina when blood becomes present between the neural retina and the RPE, or between the RPE and Bruch’s membrane (Penfold et al.

2001). AMD begins developing in the fifth decade of life with the presence of drusen (Klein et al. 2004). The pathological changes initiating and progressing to late stage AMD remain understudied.

Wide variation in AMD prevalence was detected in a large multi-ethnic study among black, Hispanic, Chinese, and Caucasian groups (Klein et al. 2006).

Additional studies investigating other races include more comprehensive Asian and Asian Indian cohorts (Gupta et al. 2007; Krishnaiah et al. 2005; Miyazaki et al. 2005; Wong et al. 2006). AMD is most prevalent among Asians (4.6-28%) and may positively correlate with altitudes. Caucasians also demonstrate a high frequency of AMD (5.4%) followed by Hispanics (4.2%). Subjects of African

72 ancestry and Indian ancestries are less affected by AMD (2.4%, 1.4-2.6%, respectively), (AREDS 2000; AREDS 2005; Klein et al. 2006; Okamoto et al.

2006). After accounting for differences such as age, gender, pupil size, body

mass index, smoking history, alcohol consumption history, diabetes and

hypertension, differences in the racial variability affecting AMD prevalence could

not be accounted for entirely. It is likely that genetic composition may play a role

in AMD racial variability.

AMD is a complex disease with multiple susceptibility loci demonstrated

by the OMIN entry #603075 for ARMD1 listing 11 loci (ARMD1-11), multiple

polymorphic risk variants, and haplotypes for risk of AMD. Earlier studies

indicated a role for ABCA, APOE, and FIBL3, and loci at 1q, 9q, 10q, and 22q as

susceptibility markers (Abecasis et al. 2004; Iyengar et al. 2004; Klein et al.

1998; Majewski et al. 2003; Schmidt et al. 2002; Seddon et al. 2003; Weeks et al.

2001; Weeks et al. 2004; Zareparsi et al. 2004). Other genetic contributing

factors include variations in HLA class I and II, C2, and CFB. Among the genetic

components, CFH has been at the pinnacle of multiple studies with an estimated

contribution of up to 50% of the total genetic risk in AMD.

CFH regulates the alternative pathway of complement activation by tightly

monitoring C3 activation preventing complement depletion and protecting host

cells from unwarranted attack. In 2005 4 labs performed Genome Wide

Association Studies (GWAS) and independently associated CFH risk and protective haplotypes with AMD (Edwards et al. 2005; Hageman et al. 2005;

Haines et al. 2005; Klein et al. 2005). Confirmation of the studies extended the

risk loci through the entire CFH gene region (Hughes et al. 2006; Li et al. 2006;

Maller et al. 2006; Thakkinstian et al. 2006; Thompson et al. 2007). A SNP in

exon 9 of CFH resulted in the substitution of a tyrosine residue for histidine

(Y402H) leading to differential CFH-RPE binding (Clark et al. 2006; Prosser et al.

2007; Sjoberg et al. 2007b; Skerka et al. 2007). However, a single SNP could not

account for the risk among a Korean population (Kim et al. 2008). These

associations also fail to capture the racial variability seen in AMD, suggesting

other genetic factors were present.

One of the protective haplotypes was found to include a complete

genomic loss of both CFHR3 and CFHR1. This deficiency is a copy number

variation occurring less frequently among AMD cases than in age-matched

controls (Hughes et al. 2006). The original sample cohort consisted of all

neovascular AMD cases and was confirmed in another neovascular AMD cohort

a year later (Hughes et al. 2007). Additional studies confirmed the protective

effect of the common CFHR3-R1 deficiency, and demonstrated ethnic and racial

variation (Feifel et al. 1992; Hageman et al. 2006; Martínez-Barricarte et al.

2007). There were some inconsistencies represented among the studies in the

different types of methodologies used. SNP tagging, MLPA, and SS-PCR with

sequencing of the protective haplotype containing CFHR3-R1 deficiency were

inconsistent, lacked definition, and often based on single SNPs (Feifel et al.

1992; Hageman et al. 2006; Hughes et al. 2006; Hughes et al. 2007; Martínez-

Barricarte et al. 2007; Montes et al. 2008; Spencer et al. 2008; Zipfel et al. 2007).

HLA class I and II polymorphisms were reported to associate with AMD

(Goverdhan et al. 2005). Within the closely related MHC Class III, C2 and CFB have been reported to be associated with AMD risk and protective haplotypes

(Gold et al. 2006). This region demonstrates high degrees of linkage disequilibrium and study designs have not included the region proximal to C2, the

RCCX. The RCCX contains the genes for RP, C4, CYP21, and TNX. C4 genes are subject to copy number variation in which low C4 copy numbers increase the risk of Systemic Lupus Erythematosus (SLE) and are in linkage with MHC class II

(Yang et al. 2007).

In addition to copy number variation, C4 has two isotypes encoded by different genes, C4A and C4B, each with multiple allotypes (Blanchong et al.

2001; Mauff et al. 1990; Yu et al. 2003) demonstrating intricate complexity. C4A has a longer half-life (~10s) and forms amide bonds, whereas the half-life of C4B is quite short (<1s) and preferentially binds to hydroxyl groups forming an ester linkage (Dodds et al. 1996; Isenman and Young 1984; Law et al. 1984). Because of these properties, C4A more likely participates in immunoclearance, and C4B may be more important in microbial defense. Additionally, null C4A and C4B alleles and low copy numbers have been associated with increased risk of chronic and inflammatory diseases such as SLE (Yang et al. 2007). C4 is activated upstream of C3 within the classical pathway of complement activation

75 which could feasibly feed additional C3 for the amplification of the alternative

pathway. Activated complement products of FB and C3 are elevated in AMD

(Machalinska et al. 2009; Scholl et al. 2008). Lack of regulation in addition to

elevated plasma levels of complement can lead to systemic inflammation, such

as that seen in AMD.

This chapter develops the role of increased copy numbers of CFHR3-R1

and C4 total genes in AMD. RT-PCR detects increased copy numbers of

CFHR3-R1 in neovascular AMD. Further increased total C4 copy number was a

risk for geographic atrophy. These results suggest a role for the alternative and

classical pathways of complement activation contributing to different disease

pathologies. This work is the first study using RT-PCR to measure CFHR3-R1

copy numbers and to demonstrate a role for increased C4 in AMD.

3.2 Materials and methods

3.2.1 Study populations

Healthy unrelated subjects comprised the control group consisting of 457

European Americans from Ohio (including 50 medical students at The Ohio State

University). All healthy subjects had an absence of autoimmunity extending

through their primary relatives, and self-reported ancestral information. The

CFHR3-R1 real-time (RT) PCR validation cohort consisted of 72 samples of

multiple races, either healthy or with Systemic Lupus Erythematosus (SLE). DNA

from 182 samples was provided by Dr. Rando Allikmets (Columbia University,

New York ) and were collected from 182 AMD cases with either geographic

atrophy (GA, N=91) or choroid neovascularization (Neo, N=90).

3.2.2 Isolation of genomic DNA

European American genomic DNA samples were derived from cultured

cells collected in EDTA-tubes using Puregene DNA isolation kit (Gentra

Systems), or provided through collaborative efforts. Genomic DNA was obtained

from consenting healthy subjects, subjects with SLE and relatives of subjects

with SLE. DNA was isolated from peripheral blood and collected in 10 mL EDTA

(purple-top) tubes using standard methods. The mean age (± SD) of the control

group was 40.8 ± 10 years and had not undergone ophthalmological

examination. Blood samples processed in the Yu Lab were performed by the

following individuals: E. Chung, Y. Wu, Y. Yang, and B. Zhou. Digestion of 77 genomic DNA for analysis by TaqI RFLP-Southern blot, PshAI-PvuII RFLP-

Southern blot, and by long-range mapping PFGE using PmeI was performed

previously by C. Blanchong, E. Chung, Y. Wu, Y. Yang, and B. Zhou as

described (Blanchong et al. 2001; Chung et al. 2005; Chung et al. 2002b).

3.2.3 Genotyping of CFHR3-R1

CFHR3-R1 copy numbers in healthy European American controls were

determined by Southern blot analyses. Long range physical mapping of the 76-kb

biallelic CFHR3-R1 copy number was resolved by PFGE using PmeI digested

genomic DNA and a CFHR1 and/or CFHR2 cDNA label. Southern blot analysis

of RFLP using TaqI and PshAI/PvuII digested DNA with CFHR2 cDNA and CFH exons 21-22 cDNA labeled probes, respectively, further refined the region and confirmed the presence of a CFHR3-R1 CNV.

Quantitative RT-PCR determined the CFHR3-R1 CNV in AMD cases.

Three cross-confirming RT-PCR assays using Taqman® chemistry were developed and experimentally verified against Southern blot analysis in 72 samples. Specific details regarding the assay design and validation are described in the following passages.

3.2.4 Real-time PCR (RT-PCR) amplicon and experimental design

Figure 3.1A demonstrates the overall RT-PCR assay design within the

CFH gene region. Three assays were designed and are marked in green

(CFHR3-R1 intergenic), blue (CFHR1-CFHR2 common), or red (CFHR3-CFHR4 common) dots above their location on chromosome 1q32. The CFHR3-R1 intergenic region amplicon measures the copy number variant directly, resulting in copy numbers of 0, 1, or 2 (Figure 3.1B). The CFHR1-CFHR2 common amplicon (Figure 3.1C) measures the first exon in both CFHR1 and CFHR2, which displays a high level of sequence identity. This results in copy numbers of

2, 3, and 4, thus accounting for 2 [fixed] copies of CFHR2 exon 1 plus either 0, 1, or 2 copies of CFHR1 exon1. The same concept was behind the design of the

CFHR3 and CFHR4 common amplicon (Figure 3.1D) which also amplifies an exonic region of sequence identity between these two genes. The endogenous control is another example of a common amplicon that measures the copy number of HspA1A and HspA1B simultaneously at a fixed copy number of

accounting for 2 genes per chromosome in a diploid genome (Figure 3.1E), which was designed by Dr. Yee-Ling Wu.

The three CFHR3-R1 assays provide cross-confirming results. The common assays utilize the sequence similarity between CFHR1 and CFHR2 as well as between CFHR3 and CFHR4. The specific design details for each assay ensure all measurements are within reported CFHR3-R1 breakpoints. SNPs in probes and 3’ primer sequence were deliberately avoided. Regions of sequence identity were determined using BLASTn of the human genome and the corresponding CFH gene region for NCBI build 36.3. Table 3.1 lists nucleotide sequence for the primers and probes of each amplicon and its position in the

CFH gene region. The position of nucleotide sequence for the RT-PCR amplicons on chromosome 1 are as follows: CFHR1: 195055484-67942; CFHR2-

195179557-94979; CFHR3-195010553-29496; CFHR4-195123835-54386; and

on chromosome 6: HspA1A-31891316-3698; HspA1B-31903503-6010.

3.2.5 RT-PCR using TaqMan® dye chemistry

Quantitative analysis of genomic DNA using RT-PCR assays utilized

TaqMan® minor groove binder (MGB) probes in which targets were VIC® dye-

labeled and endogenous controls were FAM™ dye-labeled (Applied Biosystems).

Each reaction contained forward and reverse primers (0.5-1µM; Invitrogen) for

both the target and endogenous control, 100 nM of both target and endogenous

control probes, 15 ng of genomic DNA (~5ng/µl), and 2x TaqMan universal PCR

master mix (P/N 4324018; Applied Biosystems). Final volume was adjusted to 10

µl with molecular grade water. Each sample was analyzed in duplicate and

reactions were conducted in a MicroAmp fast 96-well optical reaction plate (P/N

4306737; Applied Biosystems) and sealed with PCR sealing film (B1212-RT1;

Denville Scientific). All real-time assays were performed on the ABI 7500 fast

real-time PCR system using PCR cycles of 95°C for 15s and 60°C for 1 min.

3.2.6 Double relative standard curve method of RT-PCR

The absolute quantification (standard curve) assay option in SDS software

(Applied Biosystems) was selected to calculate the target copy number using the

80 relative standard curve method as described (Wu et al. 2007) with the following

specifications. As a standard control, a genomic DNA sample with CFHR3-R1 on

both chromosomes was serially diluted 1:3 to cover a CT range in the target and

endogenous assays of about ~22-32, allowing for interassay variability. The

quantity was arbitrarily set to reflect the molar ratio of each assay. After

amplification is complete, the machine automatically sets the fluorescence

threshold of both the target and control amplicons to calculate the CT for each

test sample. To account for the lack of amplification of the CFHR3-R1 intergenic

amplicon in subjects with homozygous deficiencies the cycle threshold was set

manually to contain the linear range of the endogenous control. A standard curve

is generated using log “absolute” copy number of DNA for the ENDO and target

genes plotted against the CT at each dilution point (Figure 3.2). The molar ratio

between target and ENDO in test samples is based on their CT , and the

concentration is generated from the standard curve. The HspAB endogenous

control is present at 4 copies in a diploid genome. Multiplying the molar ratio of

target to control by the number of endogenous genes provides the copy number

of CFHR3-R1. To correct apparent intrinsic underestimation, a calibration curve

using 6 samples with known copy numbers and an inverse prediction equation is

applied.

3.2.7 Genotyping of total C4 gene copy numbers

For unrelated healthy subjects, gene copy number variations of total C4 were determined by genomic Southern blot analyses of TaqI and PshAI-PvuII digested genomic DNA by members of the Yu lab as previously described

(Chung et al. 2005; Chung et al. 2002b). Total C4 gene copy number was determined by Yee Ling Wu using quantitative RT-PCR by the relative standard curve method to measure the breakpoint region of RP-C4-CYP21-TNX (RCCX) as described (Wu et al. 2007).

3.2.8 Statistical analyses

Statistical analyses were computed in JMP v 8.0 (SAS) comparing copy numbers by Chi-Squared reporting the Likelihood Ratio. The Odds Ratio (OR) was calculated by Fisher’s exact test. Continuous variables were analyzed in an

One-way-Analysis of Variance (ANOVA) framework, and individual groups were compared by Student’s t-test. Software applications include Excel,

PrimerExpress version 3.0, and SDS version 1.3.1.

Additional Declarations: DNA samples from subjects with AMD were generously provided by Dr. Rando Allikments at Columbia University, New York,

New York. Dr. Yee Ling Wu performed the C4 genotyping results for analysis, designed the HspA1A, HspA1B endogenous controls amplicon and assisted with technical aspects of designing and implementing the CFHR3-R1 RT-PCR assay.

3.3 Results

3.3.1 Real-time PCR assay validation

To enable the analysis of nanogram quantities of DNA, a real-time (RT)

PCR-based method for determining the copy number of CFHR3-R1 was validated in 72 samples with known copy numbers of CFHR3-R1 as determined

by multiple Southern blots. Samples were examined by all three real-time

amplicons and consisted of European, Asian Indian, and African American

subjects with 0, 1 or 2 copies of CFHR3-R1. There were 19 (26.4%) homozygous

deficiencies (copy number=0), 26 (36.1%) samples with 1 copy of CFHR3-R1,

and 27 (37.5%) samples with 2 copies of CFHR3-R1. Two assays were designed

to measure an exon of common sequence in CFHR1 and CFHR2 (CFHR1-R2

common amplicon), and CFHR3 and CFHR4 (CFHR3-R4 common amplicon).

The third assay measured the intergenic region between CFHR3 and CFHR1

(CFHR3-R1 intergenic amplicon).

The three assays provide cross-confirming results and were validated by

Southern blot based methods. A standard curve was generated from a serially diluted DNA sample with two copies of CFHR3-R1. Pairs of subjects with 0, 1, or

2 copies of CFHR3-R1 served as internal controls for generation of a correction calibration curve. All samples were run in duplicate.

For each assay the mean and standard deviation (SD) at each copy number was calculated, giving an observed value (Table 3.2). The ratio of the

actual/observed copy number should approach the value of 1.0. To correct for an

83 intrinsic underestimation, application of a second calibration curve provides a

better approximation of the mean and the actual/observed copy number ratio.

Figure 3.3 A shows the cluster plot of the CFHR3-R1 intergenic region

amplicon displaying the actual copy number versus the predicted copy number. A

copy number of 0, indicating the complete absence of CFHR3-R1, clusters

tightly, as most DNA samples either fail to amplify or demonstrate very late non-

specific amplification (mean copy number= 0.14). After adjustment the assay

correctly called 18/19 subjects with 0 copies of CFHR3-R1. Repeated measurement of the incorrectly called sample gave similar results and cannot be explained presently. One and two copies of CFHR3-R1 were consistently called correctly making the intrinsic assay 99% accurate.

The common assay for CFHR1-R2 detects the presence of 2 copies of

CFHR2 and 0 or 1 copy of CFHR1 giving total assay copy numbers of 2, 3, or 4.

Figure 3.3 B shows tight clustering of subjects with a homozygous deficiency of

CFHR1. Samples demonstrate overlap between 0, 1, or 2 copies of CFHR3-R1 with a wide distribution among those with 4 copies of CFHR1-CFHR2.

The CFHR3-R4 common amplicon detects 2 copies of CFHR4 and 0, 1, or

2 copies of CFHR3 giving the assay total copy numbers of 2, 3, or 4. At higher copy numbers of 4 in the CFHR3- R4 common assay, there was a wide distribution (Figure 3.3 C). Lower copy numbers such as 2 cluster tightly whereas there is greater spread among those with 3 or 4 copies of CFHR3-R1.

All 19 subjects with a homozygous CFHR3 deficiency were accurately detected,

84 but only 92% of subjects with 3 or 4 copies were correctly predicted from the

assay. This results in an overall assay accuracy of 94.4%.

To overcome the overlap in higher copy numbers and the infidelity of the

CFHR3-R1 intergenic assay, the results of the three assays are combined and a

consensus call is reached. Samples with intermediate values are listed as such

in the database. Based on the call of the other 2 assays, the value can then be

deduced. Most often all assays agree and give copy numbers of 0 or 2; 1or 3; or

2 or 4 for intergenic and common assays, respectively. Though these results

show 100% accuracy of the CFHR1-R2 common assay, because of possibly yet undetermined rare duplication, deletion, or mutation, the 3 validated assays

cross-confirm each other and mimic the findings of the more definitive but

laborious Southern blot analysis. These assays were able to provide 100%

accurate calls in all 72 samples.

The RT-PCR assay for detecting CFHR3-R1 was applied to 182 cases of

AMD. Table 3.3 demonstrates the results of each assay in all 172 cases. In

some cases, the copy number fell between two whole integers (0 or 1 and 1 or 2)

and is listed as such. Runs consisting of failed assays or copy numbers greater

than 2 standard deviations from the mean of all copy numbers are purposely left

blank and the resulting 2 assays are then considered.

3.3.2 CFHR3-R1 CNV in AMD and healthy subjects of European descent

AMD cases were subdivided according to the presence of either geographic atrophy (GA, N=86) or choroid neovascularization (Neo, N=85).

There was a significant difference in CFHR3-R1 copy numbers between AMD cases with choroid neovascularization and controls (χ2=6.8; p=0.03; Table 3.4).

There were 67.0% of Neo-AMD cases with 2 copies of CFHR3-R1and 33.0% with 1 copy of CFHR3-R1. Among healthy controls of European ancestry 64.6% had 2 copies of CFHR3-R1 and 31.2% had 1 copy. Most striking was the presence of CFHR3-R1 among all cases of Neo-AMD indicating an absence of homozygous deficiencies, which are present among 4.3% of controls. This leads to a trend toward increased CFHR3-R1 carrier frequency in Neo-AMD compared to controls (1.00 vs 0.957; p=0.05).

Because all AMD cases with choroid neovascularization are CFHR3-R1

carriers, CFHR3-R1 homozygous deficiencies are only present among cases

with geographic atrophy. Copy numbers of CFHR3-R1 were marginally

significant between the two phenotypes of AMD: GA and Neo-AMD (χ2=5.62,

p=0.06; Figure 3.5). There was a non-significant observation of increased

CFHR3-R1 copies among Neo-AMD compared to GA-AMD cases (1.67± 0.47 vs

1.58 ± 0.59). Among cases of GA-AMD, there were 4.7% homozygous

deficiency, 32.6% with one copy of CFHR3-R1, and 62.8% of subjects with 2

copies of CFHR3-R1. AMD cases with geographic atrophy demonstrated a

86 similar distribution of CFHR3-R1 copy numbers as controls (χ2=0.1, p=0.95) with

nearly identical carrier frequencies (0.954 vs 0.957).

Despite evidence suggesting a role for increased CFHR3-R1 copy numbers in Neo-AMD and not in GA-AMD, all AMD cases were pooled to determine the overall effect. No differences were detected between AMD cases and controls (χ2=1.5, p=0.47; Figure 3.5). There was a minor increase in

CFHR3-R1 carrier frequency among all AMD cases compared to controls (0.977

vs 0.957), which as explained earlier represents the difference in CFHR3-R1

copy numbers in GA and Neo-AMD. AMD cases had increased frequencies of

subjects with one copy of CFHR3-R1 (0.331 vs 0.312) and decreased

frequencies of homozygous deficiency of CFHR3-R1 (0.023 vs 0.043). However,

none of these differences were significant but demonstrated a similar trend to

results which were previously published (Hageman et al. 2006; Hughes et al.

2006; Hughes et al. 2007; Spencer et al. 2008). The data suggests there may be

a protective effect of the CFHR3-R1 homozygous deficiency against the

development of choroid neovascularization AMD.

3.3.3 CNV of total C4 genes in AMD and healthy subjects of European

descent

Copy numbers of total C4 genes in a diploid genome ranged from 2 to 8

among AMD cases (N=182), and from 2 to 6 total genes in healthy controls

(N=457; Table 3.5). Significant differences in total C4 copy number distribution

87 were detected between AMD cases and controls (χ2 = 18.4, p=0.0025; Figure

3.6). AMD cases and controls both had median C4 copy numbers of 4 genes

present at frequencies of 0.59 and 0.61, respectively. AMD cases had increased

average copy numbers of total C4 (4.04 ± 0.72) compared to controls (3.85 ±

0.70, p=0.0027) reflecting the 8 control subjects with 2 C4 genes, whereas AMD

cases had at least 3 genes.

Differences in total C4 copy number distribution between the two phenotypic groups of AMD cases (GA, N=91 and Neo, N=90) did not reach significance (χ2=4.1, p=0.25; Figure 3.7), but there was a marginal increase in average number of C4 total genes among GA-AMD than Neo-AMD cases

(4.15±0.77 vs 3.93 ± 0.65, p=0.047). Only GA-AMD cases are significantly different compared to controls (χ2=16.6, p=0.0023; GCI, p=0.0002). The greatest

single difference in C4 copy numbers in GA-AMD is an 14.1% increase in

subjects with 5 copies compared to controls (0.242 vs 0.101).

The effects of increased total C4 copy numbers were investigated further

using the gene copy number of C4 as a continuous variable to construct odds

ratios (Table 3.6). AMD subjects with 3 or fewer C4 genes had an OR of 0.66

(95% C.I. 0.43-1.00, p=0.05). This was even more apparent among GA-AMD

which had an associated OR of 0.48 (95% C.I. 0.26-0.89, p=0.02). The median

copy number of 4 total C4 genes was neutral in all AMD and GA-AMD. There

was an increased associated risk of AMD among subjects with 5 copies of C4.

Among AMD, there is a 2.16 times greater risk (95% C.I. 1.34-3.50, p=0.0022).

The risk increased to 2.90 times (95% C.I. 1.64-5.13, p<0.0001) in GA-AMD.

There was no effect in subjects with greater than 5 copies of C4 , possibly

reflecting small sample size. Increased copy numbers of C4 genes are a risk

factor for AMD, specifically for geographic atrophy.

3.4 Discussion

The effects of increased copy numbers of CFHR3-R1 and C4 in European

American AMD was elucidated. Use of a newly characterized RT-PCR assay

enabled the detection of nanogram quantities of DNA. Southern blot methods are

superior in that they provide definitive descriptions of the entire CFH gene region

but this is at the cost of high quantities of high quality DNA, time, and labor. The

RT-PCR based method provides a rapid, robust, and accurate method for

detecting CFHR3-R1 copy numbers when DNA quantities are limiting.

The accuracy of each individual RT-PCR assay varied, creating a

requirement to perform at least two separate RT-PCR assays in duplicate to

confirm the number of CFHR3-R1 genes. Despite careful planning and design in

avoiding CNV breakpoints and highly polymorphic regions, unknown rare

mutations could possibly affect the overall assay performance. The design of the

CFHR3-R1 intergenic assay relies on the ability of the reverse primer to anneal

specifically to this region and not anneal to a region sharing high sequence

identity found between CFHR4-CFHR2 shown in Figure 3.1. Such high

sequence identity could explain some of the artificially high overlap between copy

numbers. Additionally, two mismatches in the endogenous control sequence

could affect the efficiency of the assays. However, these mismatches are invariant sequence differences between the two HspA1 genes and would be present among all samples tested. Unknown variability in the endogenous control could also lead to false results.

This is the first AMD study to use a definitive method of detecting the

CFHR3-R1 CNV and confirms previous findings of decreased CFHR3-R1 homozygous deficiencies in AMD (Hageman et al. 2006; Hughes et al. 2006).

The contribution of CFHR3-R1 in AMD is statistically small and limited by the frequency of the CFHR3-R1 in healthy controls. The maximum difference in

CFHR3-R1 homozygous deficiencies this study can achieve is capped at 4.3%.

Altering the sample size would provide better statistical values but not elevate the small difference. A multi-cohort study of 583 subjects by Hageman demonstrates this effect (Hageman et al. 2006). European controls had a homozygous deficiency ranging from 2.5–6.7% while AMD cases varied from 0 -1.2%, respectively. The maximum difference for the two cohorts is 2.5% and 5.5%, similar to the results presented here. Another group (Spencer et al. 2008) found

2.2% of homozygous deficiencies in controls and 0.8% in cases, which equates to a maximum difference of 1.4%.

These studies all demonstrated small differences between cases and controls, and may have a slightly lower CFHR3-R1 allelic frequency among their controls than those presented here. The difference is that their use of large sample sizes enabled their results to reach significance. Because the age of the control group used in this study is younger than the age of the AMD case group, effects of the CFHR3-R1 copy number may not be apparent. Use of an age- matched healthy control cohort with the absence of ophthalmological disease

91 would be more appropriate and reach a true difference in copy numbers of

CFHR3-R1.

To overcome the age difference between cases and controls, AMD

subjects with choroid neovascularization were compared to those with

geographic atrophy and showed a trend toward increased copy numbers among

Neo-AMD was still present. Other studies support the role of CFHR3-R1

deficiency in neovascular AMD through direct and indirect evidence. Indirect

support stems from studies investigating cases with geographic atrophy that fail

to maintain haplotype associations (Gold et al. 2006; Hageman et al. 2005). This

can contribute to a lack of effect of CFHR3-R1 in geographic atrophy as these

studies did not investigate choroid neovascularization. The initial CFHR3-R1

study and follow-up report relied on Neo-AMD cohorts, and thus were able to

associate CFHR3-R1 deficiency with AMD (Hughes et al. 2006; Hughes et al.

2007). A concurrent study by another AMD group of investigators, failed to detect

any differences associated with AMD phenotypes. In this instance, the CFHR3-

R1 deficiency was not tested and the group accessed significance at 5 common

risk alleles in CFH, LOC387715, and C2-FB (Maller et al. 2006).

Finally, this study does not investigate additional risk factors acting in

concert or independently of the CFHR3-R1 copy number variant. Previous

studies have investigated the Fast C3 allele (Yates et al. 2007) and constructed

models including genetic, environmental, and/or medical risk factors (Hughes et

al. 2007; Spencer et al. 2008). These models suggest there may be additional 92 effects contributing to the presence of CFHR3-R1 and AMD supporting the role

of multi-loci in AMD disease susceptibility (Hageman et al. 2006; Spencer et al.

2008). Future studies in larger cohorts of well-characterized AMD cases with age-matched controls are needed to demonstrate the effect of CFHR3-R1 and

other known AMD risk factors leading to choroid neovascularization.

The association between increased copy numbers of total C4 in AMD and in geography atrophy has not previously been reported. Past studies investigating the MHC in AMD found associations between HLA class I and II,

C2, and CFB polymorphisms (Gold et al. 2006; Goverdhan et al. 2005). The findings of increased C4 copy number needs verified in a larger sample size. A likely role for increased C4 copy numbers in AMD pathology would be an increased presence of C4 protein enabling further deposition and complement activation in times of inflammation. This study does not measure protein levels of any component, but has previously demonstrated a positive association between increasing copy numbers of C4 genes and increased protein levels (Saxena et al.

2009; Yang et al. 2003). Higher copy numbers of C4 genes may then be upstream of additional C3 activation resulting in accumulation of complement activation fragments.

One study investigating the plasma concentration of C4 found no difference between AMD cases and controls (Scholl et al. 2008). This study did not quantify activated products of C4, despite reporting elevated plasma levels of

C3a and C3d but not C3. A possible explanation for this finding is the small

93 sample size of their control group (N=67). The copy number of C4 varies widely,

and a limited number of subjects may not capture the diversity providing only a

limited range of C4 protein levels. Even among the 182 AMD samples measured

in this study, the range and frequencies of total C4 genes is limited.

To date, this is the first association of a genetic contribution of significant

magnitude among AMD cases with geographic atrophy. The implications are far-

leading considering that AMD first manifests with the appearance of general geographic atrophy and develops into late-stage GA or Neo (in the case of vessel formation). Increased copy numbers of C4 likely contribute to early initiating events in the pathogenesis and early intervention may help prevent progression to late-stage AMD.

These findings support a model of complement activation and disregulation in both the classical and alternative pathways. Specifically, it appears that increased copy numbers of either complement C4 or CFHR3-R1 associates with an increased risk of AMD. The pathogenesis of CFHR3 and

CFHR1 is unknown in AMD but theories suggest they may bind similar to CFH, but are unable to regulate surface activation effectively. The role of C4 specifically in geographic atrophy requires further investigation, but may demonstrate ‘leaky’ complement activation at low levels leading to a more pro- inflammatory state, contributing to progressive drusen accumulation and loss of specialized vascular sites. These results suggest different mechanisms may be involved leading to either the geographic or neovascular form of AMD.

Future investigations of CFHR3-R1 and C4 would be done in a larger

AMD cohort with an age, ethnic, region matched unrelated control group without clinical evidence of AMD. All published studies except where noted, examined cohorts of European ancestry, which is a high risk ethnic group for AMD and in groups with lower copy number of CFHR3-R1 such as African and Asian Indian, there may be greater differences, though the prevalence of AMD in these groups is quite low compared to Europeans. No full model of AMD with previously demonstrated risk variables was constructed (due to lack of personal and clinical data) to segregate the effects of CFHR3-R1 and C4 in AMD and in the progression of geographic atrophy or neovascularization.

In summary, these results demonstrate increased risk associated with high copy numbers of complement C4, specifically C4B, and CFHR3-R1 in AMD.

Further, there was evidence supporting separate complement pathways may contribute to the different phenotypes of AMD, implicating the classical pathway in the pathogenesis of geographic atrophy and the alternative pathway in the pathogenesis of neovascularization, though contributions from overall complement activation cannot be excluded from AMD in general. This study provided novel results and is the first to use definitive methods for determining

CFHR3-R1 copy numbers directly, and reporting an association between increased complement C4 as a risk for AMD.

Figure 3.1 A Cartoon depicting real time PCR assays and location to detect the copy number of CFHR3-R1. This cartoon indicates the location of the amplicons within the CFH gene region represented by dots in panel A. Primers and probes corresponding to each amplicon are represented by directional arrows and barbells, respectively. B. Intergenic region between CFHR3-R1, yielding 0, 1, or

2 copies. C. A common region in both CFHR1 and CFHR2, yielding 2, 3,or 4 copies. D. A common region in both CFHR3 and CFHR4 yielding 2, 3,or 4 copies. E. A common region in both HspA1A and HspA1B to serve as an endogenous control of 4 copies.

Figure 3.1

A. Spatial arrangement of RT-PCR assay locations within the CFH gene region

Chromosome 1q32

centromeric telomeric

CFH CFHR3 CFHR1 CFHR4 CFHR2 CFHR5

B. CFHR3-CFHR1 intergenic amplicon, copy number = 0, 1, or 2

F primer ______Probe 5’- CCCTGTGAATTTTGGACTTGCTTATACTCACAAATCAAGTAAACCAATTGCATAAAACAAATCTCTATCTCATCTATCTATACACACC -3’ 3’- GGGACACTTAAAACCTGAACGAATATGAGTGTTTAGTTCATTTGGTTAACGTATTTTGTTTAGAGATAGAGTAGATAGATATGTGTGG -5’

R primer

C. CFHR1-CFHR2 common amplicon, copy number = 2, 3, or 4

F primer ______Probe CFHR1 5’- ATGAAAGCAGATTCAAAGCAACACCACCACCACTGAAGTATTTTTAGTTATATAAGATTGGAACTACCAAGCATGTGGC -3’ ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CFHR2 5’- ATGAAAGCAGATTCAAAGCAACACCACCACCACTGAAGTATTTTTAGTTATATAAGATTGGAACTACCAAGCATGTGGC -3’ 3’- TACTTTCGTCTAAGTTTCGTTGTGGTGGTGGTGACTTCATAAAAATTCATATATTCTAACCTTGATGGTTCGTACACCG -5’

R primer

D. CFHR3-CFHR4 common amplicon, copy number = 2, 3, or 4

F primer ______Probe CFHR3 5’- AGAGTCGAGTACCAATGCCAGCCCTACTATGAACTTCAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGGTCGG -3’ ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CFHR4 5’- AGAGTCGAGTACCAATGCCAGTCCTACTATGAACTTCAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGGTCGG -3’ 3’- TCTCAGCTCATGGTTACGGTCAGGATGATACTTGAAGTCCCAAGATTAATACATTGTACATCATTACCTCTCACCAGCC -5’

R primer

E. HspA1A-A1B common endogenous amplicon, copy number = 4

F primer ______Probe HspA1B 5’- GGCGAAACCCCTGGAATATTCCCGACCTGGCAGCCTCATCGAGCTTGGTGATTGGCTCAGAAGGGGAAA -3’ ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| HspA1A 5’- GGCGAAAACCCTGGAATATTCCCGACCTGGCAGCCTCATCGAGCTCGGTGATTGGCTCAGAAGGGAAAA -3’ 3’- CCGCTTTTGGGACCTTATAAGGGCTGGACCGTCGGAGTAGCTCGAGCCACTAACCGAGTCTTCCCTTTT -5’

R primer 97

Figure 3.2 Double standard curves for each CFHR3-R1 RT-PCR assay and

endogenous control. Each CFHR3-R1 amplicon is represented in the figures.

The slope, intercept, and fit of the line are labeled for each detector. A standard

DNA sample with 2 copies of CFHR3-R1 is serially diluted 1:3. The molar ratio is

arbitrarily set to express differences in gene numbers by assay. A. CFHR1-

CFHR2 common assay with copy numbers of 2, 3, or 4. B. CFHR3-CFHR1

intergenic assay with copy numbers of 0, 1, or 2. C. CFHR3-CFHR4 common

assay with copy numbers of 2, 3, and 4.

Figure 3.2

A. CFHR1-CFHR2 Common Standard Curve

B. CFHR3-CFHR1 Intergenic Standard Curve

C. CFHR3-CHFR4 Common Standard Curve

Figure 3.3 RT-PCR cluster plots of CFHR3-R1 assays. For each amplicon the actual copy number was plotted against the predicted copy number as seen for each assay. Each dot represents an individual sample run in each assay.

Therefore the same sample is represented twice for each assay. A. CFHR3-R1 intergenic assay, B. CFHR1-R2 common assay, and C. CFHR3-R4 common assay.

Abbreviations: Log CO-Log concentration; CT- cycle threshold

100

Figure 3.3

A. CFHR3-R1 Intergenic Region Assay

0 Predicted copy number copy Predicted 0 1 2 Actual copy number

B. CFHR1 and CFHR2 Common Assay

0 Predicted copy number copy Predicted 2 3 4 Actual copy number C. CFHR3 and CFHR4 Common Assay

0 Predicted copy number copy Predicted 2 3 4

Actual copy number

101

of Figure 3.4Distribution (aqua). atrophy (lime)andneovascularization CFHR3-R1 Frequency 0.20 0.40 0.60 0 copy numberswerecompared χ P=0.06 0.05 2 =5.62 0 0 2 1 CFHR3-R1 0.00 CFHR3-R1 0.32 Copy Number 0.33 copynumbersinAMDbyphenotype. 102 among AMDcaseswithgeographic 0.63 0.67 Neo, N=85 GA, N=86

AMD. Copynumberof healthy controls(blue)ofEuropeandescent. Figure 3.5Thedistributionof Frequency 0.20 0.40 0.60 0 P=0.25 χ 0.04 2 CFHR3-R1 =2.8 0 0 2 1 0.02 CFHR3-R1 0.31 CFHR3-R1 Copy Number wascomparedbetweenAMDcases(red)and 0.33 103 copynumberinEuropeanAmerican .50.64 0.65 AMD, N=172 Control, N=446

2 χ =14.6 0.61 0.59 0.60 p=0.006 Control, N=454 AMD, N=182

0.40

0.26

Frequency 0.20 0.19 0.20 0.10

0.01 0.02 0.02 0.00 0 2 3 4 5 6,8

C4 Total Gene Copy Number

Figure 3.6 Distribution of total C4 gene copy numbers in AMD. Gene copy numbers were compared between AMD cases (red) and healthy controls (blue).

104

χ2=4.12 p=0.25 0.61 0.60 0.58 GA, N=91 Neo, N=90

0.40

0.23 0.24

Frequency 0.20 0.15 0.14

0.02 0.01 0 3 4 5 6,8

C4 Total Gene Copy Number

Figure 3.7 Distribution of C4 total genes in AMD by phenotype. Copy numbers were compared between AMD cases with geographic atrophy (lime) and neovascularization (aqua).

105

59 58 58 58

AT (°C) AT

CFHR1 CFHR3 CFHR3 12-91 Hsp A1A A1A Hsp Hsp A1B 42-121 15311-15410 15311-15410

CFHR2 CFHR1 67 bp of 5' 58 bp of 5' CFHR4 : 26959-27039 CFHR3 : Amplicon Position(s) Amplicon 9323-9410 3' of bp 16481-16568 5' of bp Sequence Sequence VIC-ACCACCACTGAAGTAT VIC-CTTAGGGTTCTAATTAT 6FAM-CAGCCTCATCGAGCT VIC-AAATCAAGTAAACCAATTGC 5'-GGCGAAACCCCTGGAATATT-3' 5'-TTTTCCCTTCTGAGCCAATCA-3' 5'-GCCACATGCTTGGTAGTTCCA-3' 5'-GCCACATGCTTGGTAGTTCCA-3' 5'-AGAGTCGAGTACCAATGCCAG-3' 5'-AGAGTCGAGTACCAATGCCAG-3' 5-CCCTGTGAATTTTGGACTTGCT-3' 5-CCCTGTGAATTTTGGACTTGCT-3' 5'-CCGACCACTCTCCATTACTACATG-3' 5'-ATGAAAGCAGATTCAAAGCAACAC-3' 5'-GGTGTGTATAGATAGATGAGATAGAGAT-3' 5'-GGTGTGTATAGATAGATGAGATAGAGAT-3' . y R1R2 HspAB RT-PCR amplicon design characteristics. characteristics. design RT-PCR amplicon R1R2e1 AltR3R4 AltR3R4 R1s.A.R R1s.A.R Hsp4.F1 Hsp4.F1 Hsp4.R1 Hsp4.R1 R1R2e1.F AltR3R4.F R1R2e1.R AltR3R4.R R1R2spec.F erature of the assa the of erature p tem CFHR3-R1 g Amplicon Primers/Probe Primers/Probe Amplicon R1 specific specific R1 R1R2 Common R3R4 Common Numbering is based on gene position in reference to chromosome 1 and chromosome 6, NCBI build 36. AT refers to the to the refers AT 36. build NCBI 6, chromosome and 1 to chromosome reference in position gene on based is Numbering HspAB Common

Table 3.1 1 annealin 106

% Correct Correct % b Ratio A/O a 100

1 26 0.94 0.10 0.94 1.17 1.17 1.17 100 1.17 1.06 100 0.94 2.12 0.83 0.10 0.19 1 26 0.94 2 27 1.66 2 19 1.47 0.16 0.74 2.00 1.00 1.00 100 2.00 0.74 0.99 100 2.98 0.16 1.02 100 0.72 4.06 2 19 1.47 1.02 100 0.73 0.25 2.04 0.85 0.40 3 26 92.3 2.17 1.01 3.03 0.15 4 27 92.6 2.91 1.21 0.78 4.84 2 19 1.69 0.87 0.27 1.94 3 26 2.34 4 27 3.47 0 19 0.14 0.15 NA 0.11 NA NA 94.7 0.11 NA 0.15 0 19 0.14 CN Samples (N) Mean SD Ratio A/O Mean A/O (N) Mean SD Ratio CN Samples copy number RT-PCR validation results results validation RT-PCR number copy 0, 2 0, 2 1, 3 19 2, 4 26 27 100 100 100

CFHR3-R1

Common Intergenic Assay Overall Overall All Assays Assays All R1-R2 R3-R4 Common Common R3-R4 R3-R1

Table 3.2

Continued 107

Table 3.2 continued

aMean after adjustment with internal control calibration curve bRatio of actual to observed copies of CFHR3-R1 after adjustment with internal control calibration curve

Abbreviations: CN- Copy number; SD-Standard deviation; A/O-Actual divided by observed copies of CFHR3-R1

108

Table 3.3 Determination of CFHR3-R1 in AMD samples

Sample R1 Specific R1R2 Common R3R4 Common Final 1 2 1 1 1 2 1 1 or 2 1 3 2 2 2 2 4 1 or 2 2 2 5 1 2 2 2 6 2 2 2 2 7 2 2 2 2 8 2 1 2 2 9 2 2 1 or 2 2 10 1 1 1 1 11 2 2 1 2 12 2 2 1 2 13 2 1 2 2 14 2 2 2 2 15 1 2 0 or 1 1 16 2 2 2 2 17 1 2 1 1 18 2 2 2 2 19 2 2 1 2 20 1 1 or 2 1 1 21 2 2 1 2 22 1 1 0 or 1 1 23 1 2 2 2 24 2 2 1 2 25 2 2 1 2 26 1 2 2 2

Continued

109

Table 3.3 continued

Sample R1 Specific R1R2 Common R3R4 Common Final 27 2 2 1 2 28 1 1 0 or 1 1 29 1 1 0 1 30 1 2 2 2 31 2 2 1 2 32 2 2 1 2 33 1 1 1 1 34 2 2 1 2 35 2 2 1 2 36 2 2 1 2 37 2 2 2 2 38 2 2 1 2 39 2 2 1 2 40 1 1 0 or 1 1 41 1 1 or 2 1 1 42 2 2 2 43 2 2 2 2 44 2 2 1 or 2 2 45 2 2 2 2 46 1 or 2 2 1 or 2 2 47 1 1 1 1 48 1 1 1 1 49 2 2 1 or 2 2 50 2 2 2 51 2 2 2 2 52 1 1 or 2 1 1

Continued 110

Table 3.3 continued

Sample R1 Specific R1R2 Common R3R4 Common Final 53 2 1 2 2 54 1 1 1 1 55 2 2 1 2 56 2 2 2 57 2 2 2 58 2 2 1 2 59 2 2 1 or 2 2 60 2 2 1 or 2 2 61 1 1 or 2 0 or 1 1 62 2 2 1 2 63 2 2 1 2 64 2 2 1 or 2 2 65 2 2 1 2 66 1 2 1 1 67 1 1 1 68 2 2 0 or 1 2 69 2 2 1 2 70 2 2 2 2 71 2 2 2 2 72 2 1 2 2 73 2 2 1 or 2 2 74 2 1 1 1 75 2 1 0 or 1 1 76 0 or 1 0 0 0 77 2 1 2 2 78 1 2 2 2

Continued 111

Table 3.3 continued

Sample R1 Specific R1R2 Common R3R4 Common Final 79 2 1 1 1 80 1 1 1 1 81 1 0 0 0 82 1 0 0 0 83 2 2 1 2 84 1 1 or 2 1 1 85 2 2 2 86 2 2 1 or 2 2 87 0 0 0 88 2 1 1 1 89 1 1 1 1 90 1 0 1 1 91 1 1 1 or 2 1 92 2 1 1 1 93 1 or 2 1 1 1 94 1 1 or 2 1 95 2 1 or 2 2 2 96 2 2 1 or 2 2 97 2 2 2 2 98 2 1 1 1 99 2 2 1 2 100 2 2 1 2 101 2 2 1 2 102 1 1 1 103 2 2 2 2 104 2 2 1 or 2 2

Continued 112

Table 3.3 continued

Sample R1 Specific R1R2 Common R3R4 Common Final 105 2 2 2 2 106 2 1 1 1 107 2 1 1 1 108 1 1 1 1 109 1 1 1 1 110 2 1 2 2 111 2 2 2 2 112 2 2 2 2 113 2 1 1 1 114 2 1 2 2 115 2 2 2 116 2 2 0 2 117 2 2 2 118 1 1 or 2 1 119 2 2 1 2 120 2 1 or 2 2 121 2 2 0 2 122 2 2 0 2 123 1 0 1 1 124 2 1 2 2 125 2 2 0 2 126 2 2 1 2 127 2 2 1 2 128 2 2 1 2 129 2 2 1 or 2 2 130 2 2 2 2

Continued 113

Table 3.3 continued

Sample R1 Specific R1R2 Common R3R4 Common Final 131 2 1 1 1 132 2 1 1 1 133 2 2 1 2 134 2 2 1 2 135 2 2 1 2 136 2 1 2 2 137 2 1 or 2 2 2 138 2 2 2 139 2 2 2 2 140 2 1 1 1 141 2 2 1 2 142 2 2 1 2 143 2 2 1 2 144 2 2 1 2 145 2 2 1 2 146 2 2 1 or 2 2 147 2 1 2 2 148 2 1 1 1 149 2 1 1 1 150 2 1 1 1 151 2 1 2 2 152 2 1 1 1 153 2 2 1 2 154 2 2 1 or 2 2 155 2 2 2 156 1 2 0 or 1 1

Continued 114

Table 3.3 continued

Sample R1 Specific R1R2 Common R3R4 Common Final 157 2 1 1 1 158 2 1 1 1 159 2 1 1 1 160 2 2 1 2 161 2 2 2 2 162 2 1 1 1 163 1 or 2 2 2 164 2 1 1 1 165 2 2 0 2 166 2 1 2 2 167 1 2 1 1 168 2 1 2 2 169 1 or 2 1 0 or 1 1 170 2 2 0 or 1 2 171 2 1 1 1 172 1 1 2 1

115

Table 3.4 Distribution, GCI, allelic and carrier frequency of CFHR3-R1 in European American AMD

1. Control 2. AMD 3. GA-AMD 4. Neo-AMD CFHR3-R1 N Frequency N Frequency N Frequency N Frequency Groups χ2 p-value 0 19 0.043 4 0.023 4 0.047 0 0.000 1 v 2 1.5 0.47 1 139 0.312 57 0.331 28 0.326 28 0.330 1 v 3 0.1 0.95 2 288 0.646 111 0.645 54 0.628 57 0.670 1 v 4 6.8 0.03 Total N 446 172 86 85 3 v 4 5.6 0.06 GCI 1.60 ± 0.57 1.62 ± 0.54 1.58 ± 0.59 1.67 ± 0.47 1 v 2 Carrier 0.34 Allelic 0.802 0.811 0.791 0.835 1 v 3 Carrier 0.78

116 Carrier 0.957 0.977 0.954 1.000 1 v 4 Carrier 0.05 3 v 4 Carrier 0.12 1 v 2 GCI 0.70 1 v 3 GCI 0.75 1 v 4 GCI 0.25 3 v 4 GCI 0.27

p-value

χ 1 v 2 1 v GCI 0.0027 4 3 v GCI 0.047

in EuropeanAmericanAMD

CFHR3-R1

3.85 ± 0.70 ± 3.85 0.70 ± 0.72 4.04 ± 0.77 4.15 ± 0.65 3.93 3 1 v GCI 0.0002

4 1 v GCI 0.30 1. Control 2. AMD 3. GA-AMD 4. Neo-AMD 9 0.020 9 0.020 3 0.016 2 0.022 1 0.011 T-test 8 0.018 0 0.000 0 0.000 0 0.000 2 1 v 18.4 0.0025 N Frequency N Frequency N Frequency N Frequency Groups 46 46 0.101 35 0.192 22 0.242 13 0.144 4 3 v 4.1 0.25 Distribution of and GCI 457 182 91 90 90 91 182 457

117 117 277 0.256 0.606 36 108 0.198 0.593 14 53 0.154 0.582 21 55 0.233 0.611 3 1 v 4 1 v 16.6 4.1 0.0023 0.40

CN 2 3 4 5 ≥ 6 GCI Total N C4 Table 3.5 3.5 Table 117

Table 3.6 OR associated with total C4 gene copy number in European American

AMD.

C4 Total OR 95% Confidence Interval p-value

All AMD ≤ 3 0.66 0.43-1.00 0.05 4 0.94 0.66-1.34 0.79 5 2.16 1.34-3.55 0.0022 ≥6 0.83 0.22-3.10 1.00 Geographic Atrophy ≤ 3 0.48 0.26-0.89 0.02 4 0.90 0.57-1.42 0.72 5 2.90 1.64-5.13 <0.0001 ≥6 1.11 0.24-5.24 1.00 Neovascularization ≤ 3 0.81 0.48-1.38 0.51 4 1.01 0.64-1.61 1.00 5 1.53 0.79-2.98 0.20 ≥6 0.56 0.07-4.44 1.00

118

CHAPTER 4

THE ROLE OF LOW COMPLEMENT FACTOR H RELATED GENES 3 AND 1

(CFHR3-R1) COPY NUMBER IN EUROPEAN AND AFRICAN AMERICAN

SYSTEMIC LUPUS ERYTHEMATOSUS (SLE)

Abstract

Variation within the CFH gene region on chromosome 1q32 demonstrates racial differences in terms of allelic frequency and disease association. A copy number variant within this region containing CFHR3 and CFHR1 has different frequency distribution among multiple races and associates with renal and ocular disease. The role of the CFHR3-R1 copy number in Systemic Lupus

Erythematosus was determined by Southern blot analysis in European American and African American SLE cases and race-matched unrelated healthy controls.

African American SLE cases (N=154) had significantly different copy numbers of

CFHR3-R1 than healthy controls (N=353; χ2=6.9; p=0.03). Both the

heterozygous deficiency and the homozygous deficiency are risk factors in

African American SLE. One copy of CFHR3-R1 associates with an OR of 1.67

(95% C.I. 1.09-2.61; p=0.03). The risk is increased among subjects with 119

homozygous deficiency to 1.94 (95% C.I. 1.12-3.38; p=0.02). Modest differences were detected between European American SLE cases (N=352) and healthy controls (N=689; χ2=6.7; p=0.03). One copy of CFHR3-R1 associated with a 1.43

increased risk of SLE (95% C.I. 1.09-1.88; p=0.01). These results suggest that

reduced copy numbers of CFHR3-R1 are a strong risk in African American SLE,

but less so in European American SLE. There was a dosage effect of CFHR3-R1

copy numbers among African American SLE cases, which was not present in

European American SLE. Among European American SLE cases, only the

heterozygous deficiency associated with increased risk of SLE. These results

may provide a partial explanation for the race disparity seen in SLE.

120

4.1 Introduction

The copy number variation (CNV) of CFHR3 and CFHR1 genes (CFHR3-

R1) within the CFH gene region displays significant frequency differences among

several races (Hageman et al. 2006) which are also demonstrated in chapter 2.

The implications for CFHR3-R1 copy number variability are not yet understood,

but may contribute to racial differences in disease susceptibility and severity.

In general, CNVs vary among different ancestral groups (Jakobsson et al.

2008; Saxena et al. 2009) Common ancestral CNVs have been implicated in

asthma, systemic autoimmunity, and SLE (Aitman et al. 2006; Brasch-Andersen

et al. 2004; Fanciulli et al. 2007; Ivaschenko et al. 2002; Palmer et al. 2006;

Pisitkun et al. 2006; Yang et al. 2007; Yang et al. 2004). Low copy numbers of

Defensin beta 4 (DEFB4) associate with Crohn’s disease (Fellermann et al.

2006), and high copy numbers associate with psoriasis (Hollox et al. 2008). The

chemokine CC motif ligand-3-like-1 (CCL3L1) has roles in both Rheumatoid

Arthritis and HIV susceptibility (Gonzalez et al. 2005; McKinney et al. 2008).

These gain and loss effects reflect the delicate balance of immunity to maintain a

diverse profile to ward off pathogen and protect against autoimmunity. The

CFHR3-R1 deficiency has also been shown to be protective against AMD, but a

risk for aHUS (Hageman et al. 2006; Hughes et al. 2006; Hughes et al. 2007;

Jozsi et al. 2008; Spencer et al. 2008; Zipfel et al. 2001).

No study has quantitatively demonstrated the effect of the CFHR3-R1

deficiency and the function of the related proteins is thought mimic that of CFH

121

(Hellwage et al. 1999; Hellwage et al. 1997; Murphy et al. 2002; Ren et al. 2002;

Zipfel et al. 1999; Zipfel et al. 2002). Table 4.1 lists the related proteins and

associated binding partners and function. Evidence supports the ability of

CFHR3, CFHR4, and CFHR5 to bind the C3d region of C3b (Hellwage et al.

1999; Hellwage et al. 1997; McRae et al. 2001), with limited enhancement of

cofactor activity (Hellwage et al. 1999; McRae et al. 2005). CFHR5 inhibits C3

convertase activity (McRae et al. 2005), while CFHR1 inhibits C5 convertase

activity, preventing terminal complement activation (Heinen et al. 2009).

Deficiency and mutations affecting the function of CFH or CFHR3-R1

have been linked to hypocomplementemia as well as diseases with ocular, renal,

and hematological manifestations (Ault et al. 1997; Caprioli et al. 2001; Dragon-

Durey et al. 2004; Edwards et al. 2005; Gold et al. 2006; Hageman et al. 2005;

Hageman et al. 2006; Haines et al. 2005; Hughes et al. 2006; Klein et al. 2005; Li

et al. 2006; Maller et al. 2006; Pickering et al. 2002; Pickering et al. 2007;

Saunders et al. 2007; Saunders et al. 2006; Thompson and Winterborn 1981;

Venables et al. 2006; Vogt et al. 1995; Warwicker et al. 1998; Zipfel et al. 2007).

Deficiency or dysfunction of CFH results in the presence of complement

mediated tissue injury of specific cell surfaces (Edwards et al. 2005; Gold et al.

2006; Hageman et al. 2005; Haines et al. 2005; Klein et al. 2005; Maller et al.

2006) .

Similarly, SLE is characterized by immune complex mediated tissue injury and low levels of complement components (Cochrane and Koffler 1973; Koffler et

122

al. 1971). The prototypic autoimmune disease SLE results from a loss of self-

tolerance and affects multiple tissues and organs. Characteristics of SLE include

immune complex mediated tissue injury, hematological and immunological

manifestations, and low levels of complement components such as C3 and C4

(Cochrane and Koffler 1973; Koffler et al. 1971). Patients with SLE have chronic inflammation and the presence of autoantibodies against nuclear, cytoplasmic and membranous components of the cell. Deficiency of early classical complement pathway components is one of the greatest genetic risk factors

(Navratil et al. 1999; Pickering et al. 2000). Deficiency of C3 associates more often with increased infections and membranous glomerulonephritis and can lead to the development of an SLE-like disease course (Alper et al. 1972; Nilsson et

al. 1992; Pussell et al. 1980).

Ethnic and geographical variation influence SLE disease manifestations

(Lau et al. 2006). SLE has a complex genetic inheritance and no single gene is

causative (Sestak et al. 2007). Evidence of a genetic component in SLE stems

from familial aggregation and higher disease recurrences in siblings (relative risk

of siblings, λs = 20-40) and a monozygotic twin concordance rate of 26-69%

(Harley et al. 1998; Walport 2001). The genetic basis in SLE (Arnett 1997) underlying disease severity and incidence may vary among ethnicities (Mori et al.

2005; Stefansson et al. 2005) and evade current detection methods. Several reports from multiple centers indicate increased risks and severity of SLE in

women of African American, Hispanic American, and Asian ethnicities

123

(Fernandez et al. 2007; Hochberg 1997; Moser et al. 1998; Petri 2005). Both

Hispanic and African Americans have greater morbidity and a younger age of

onset than European populations (Daniel et al. 1995; Fernandez et al. 2007).

SLE is rare in Africa but more common among persons of African and Asian

backgrounds than in European populations (Pons-Estel et al. 2009). Ethnic

disparity in SLE cannot be accounted for by differences in allele frequencies at

any of the loci where associations with SLE have been found, including those in

the HLA region (HLA-DR, HLA-B, C4A, TNF-alpha, MBL, FCGR2A, FCGR3A,

PDCD1 (Molokhia and McKeigue 2006).

Based on the disease manifestations resulting from loss of complement

regulation, copy number variation in CFHR3-R1 may influence SLE susceptibility

through direct interactions with C3. This chapter demonstrates reduced copy

numbers of CFHR3-R1 are a stronger risk factor in African American SLE than in

European American SLE. This suggests a possible role for the CFHR3-R1

deficiency contributing to the increased disease susceptibility and severity

associated with African American SLE.

124

4.2 Materials and Methods

4.2.1 Study Populations

This study consists of subjects recruited primarily in Ohio and is approved by institutional review boards of the Ohio State University, Nationwide Children’s

Hospital, and University of Pittsburgh. SLE patients are defined by meeting the

1982 American College of Rheumatology criteria for SLE (Tan et al. 1982).

Previous investigation of the CFHR3-R1 copy-number demonstrates great variability among multiple races. Therefore, the population study (provided in

Table 4.2) focuses on European and African American SLE cases (N=505) from

Ohio (N=337), Pennsylvania (142) and Louisiana (25) and race-matched unrelated healthy controls (N=1042) consisting of 689 subjects of European ancestry and 353 African Americans.

4.2.2 Sample DNA

Peripheral blood samples for SLE patients and first-degree relatives were collected at various Ohio locations or made available from collaborators (Dr.

Daniel Birmingham, Dr. Brad Rovin, and Dr. Lee Hebert at the Ohio State

University; Dr. Gloria Higgins and Dr. Robert Rennebohm at Nationwide

Children’s Hospital; Dr. Hermine Brunner at Cincinnati Children’s Hospital; Dr.

Joe Ahearn and Dr. Joann Moulds at the University of Pittsburgh). Isolation of genomic DNA was performed by Yu Lab members (Dr. Erwin Chung, Ms.

Yaoling Shu, Dr. Yee Ling Wu, Dr. Yan Yang, and Ms. Bi Zhou at The Research

125

Institute at Nationwide Children’s Hospital) using standard protocols from EDTA containing vials. Specifically, peripheral blood leukocytes were prepared via

Ficoll gradient centrifugation and prepared in low-melting temperature agarose for PFGE-Southern blot applications. Genomic DNA from whole blood prepared by standard protocols using Puregene kits (Gentra Systems) was used in RFLP-

Southern blot and quantitative real-time PCR analyses. Age, height, weight were collected at time of blood draw if available.

4.2.3 Determination of CFHR3-R1 copy-number

Southern blot analyses of PmeI PFGE, TaqI RFLP and PvuII-PshAI RFLP of genomic DNA was performed by Yu lab members Dr. Carol Blanchong, Dr.

Erwin Chung, Ms. Yaoling Shu, Dr. Yee Ling Wu, Dr. Yan Yang, and Ms. Bi

Zhou.

Pulsed-Field Gel Electrophoresis: PmeI PFGE-Southern blot membranes were hybridized with a CFHR1 or CFHR2 cDNA probe. Of the two or three DNA fragments detected, all samples contain a DNA fragment of 120-kb.

Based on restriction mapping, the 20-kb fragment represented CFHR4, CFHR2, and CFHR5. The 171-kb DNA fragment corresponded to CFH, CFHR3 and

CFHR1, whereas a 95-kb DNA fragment indicated the loss of CFHR3-R1. The copy number of CFHR3-R1 was then zero, one, or two.

TaqI RFLP-Southern blot: Hybridization of TaqI RFLP-Southern blots with CFHR2 cDNA yielded 9 DNA fragments: 9.9, 5.3, 4.3, 4.1, 3.5, 3.2, 2.4, 2.2,

126 and 1.4-kb. The absence of DNA fragments at 2.4, 3.2, 4.3, and 9.9-kb is the result of a CNV encoding CFHR3-R1 and is termed allele C, with the genotype

CC. An additional polymorphism occurs between the 9.9-kb fragment (allele A) and the 4.3-kb fragment (allele B) in CFHR3-R1. Thus accounting for the CNV and polymorphisms, there are six genotypes: AA, AB, BB, AC, BC, and CC.

Subjects with AA, AB, or BB carry two copies of CFHR3-R1 and those with either

AC or BC carry one copy of CFHR3-R1. Homozygous deficiency of CFHR3-R1 is denoted as the CC genotype.

PshAI-PvuII RFLP- Southern blot: Additionally, PshAI-PvuII RFLP-

Southern blots were hybridized with a probe corresponding to exons 21 and 22 of

CFH. This results in 6 fragments at 8.5, 7.2, 4.9, 3.8, 2.8, and 1.2-kb and represent DNA fragments of CFH, CFHR1, and CFHR2. The absence of DNA fragments at 7.2, 3.8, and 1.2-kb is the result of the CFHR3-R1 CNV, with both

CFHR1 exon 5 and exon 6 containing internal PshAI-PvuII restriction sites. This is the deficiency allele C, and the presence of CFHR3-R1 is then denoted a generic term X. Subjects are then determined to have 0 (CC), 1 (CX), or 2 (XX) copies of CFHR3-R1.

Results of these Southern blots are cross confirming. In cases of limited

DNA, quantitative real-time PCR was used. For this, TaqMan® (Applied

Biosystems) based dye chemistry was employed in three target amplicons, and one endogenous control amplicon. The three target amplicons measured the copy-number of a specific intergenic region between CFHR3 and CFHR1 or in

127

exons commonly found in CFHR1 and CFHR2 or CFHR3 and CFHR4. The double standard curve method of analysis was employed to measure the differences in molar ratio between target and endogenous amplicons. Each

sample was ran in duplicate and confirmed by call in at least two assays (as

detailed in Chapter 2).

4.2.4 Statistical analyses

Databases containing relevant genotypes of alleles A, B, C alleles, and

CFHR3-R1 copy-numbers were stored in Excel. Statistical analyses were

performed using JMP version 8.0 (SAS). Group comparisons were performed

using Chi-Squared analysis, based on likelihood ratio, or Fisher’s exact test

where applicable. The average copy number of genes or Gene copy index (GCI)

was analyzed in -. The term carrier refers to subjects with one or two copies of

CFHR3-R1 divided by the total number of subjects in the group of interest. Allelic

frequency is the number of chromosomes containing CFHR3-R1 divided by the

total number of chromosome in the group of interest. A p-value of less than 0.05 was considered significant.

Additional declarations: Thank you to Yu lab members including Dr. Erwin

Chung, Dr. Yan Yang, Ms. Bi Zhou, and Dr. Yee Ling Wu for isolating DNA and performing original Southern blots for the Ohio SLE Study patients and families.

Ms. Bi Zhou and Dr. Yan Yang assisted in probe design and hybridization for

128

Southern blot. Additional SLE samples were generously provided by Dr. Joe

Ahearn at University of Pittsburgh and Dr. Joann Moulds at Drexel University.

Genotyping of rs1061170 (Y402H) was performed by Dr. Betty Tsao at University of California, Los Angeles and subsequently provided through Dr. Dan

Birmingham.

129

4.3 Results

4.3.1 Analysis of CFHR3-R1 copy numbers in European and African

American SLE populations

Multiple African American and European American SLE populations were

examined for differences between race-matched groups prior to inclusion as a

single African or European American SLE cohort. Distribution of CFHR3-R1 copy

numbers are presented in Table 4.2. There were no differences among

European American (EUA) SLE populations (OSS, N=235; AJ, N=117; χ2 = 0.03, p=0.98). No significant differences were present among the African American

SLE populations (OSS: N=102; AJ: N=26; BS: N=25; (χ2=2.4, p=0.7;), though

minor allelic differences were present among the groups with zero, one, or two

copies of CFHR3-R1. Future comparisons include all African and European

populations as either the entire African American or European American SLE

cohort.

4.3.2 Distribution of CFHR3-R1 copy numbers in African American SLE

African American SLE cases and unrelated healthy controls

African American SLE cases have significantly different distribution

frequency of CFHR3-R1copy copy numbers compared to race-matched

unrelated healthy controls (χ2=6.9, p=0.03, Figure 4.1). African American SLE cases have a 5.6% increase in CFHR3-R1 homozygous deficiencies (0.229) compared to controls (0.173; Table 4.4). Subjects with one copy of CFHR3-R1

130

are also reduced among SLE cases (0.523) compared to controls (0.462). This

reflects an 11.7% decrease among SLE cases carrying two copies of CFHR3-R1

(0.248 vs 0.365). There are 11.7% more CFHR3-R1 deficiencies among AFA-

SLE cases than controls (0.634 vs 0.752, p=0.01). African American SLE cases have decreased copy numbers of CFHR3-R1 (GCI: 1.18 ± 0.71 vs 1.02 ± 0.69; p=0.013).

Odds ratio (OR) in African American SLE

To compare the effect of both homozygous and heterozygous CFHR3-R1 deficiency (copy numbers of zero and one, respectively) the OR was constructed using African American SLE cases with 2 copies of CFHR3-R1 as a reference

(Figure 4.2). African American SLE cases with a homozygous deficiency have an odds ratio of 1.94 (95% C.I. 1.12-3.38; p=0.022). The heterozygous state, one copy of CFHR3-R1, has an OR of 1.67 (95% C.I. 1.09-2.61; p=0.027). The

CFHR3-R1 copy number demonstrates a dosage effect in African American SLE.

Decreasing the copy number of CFHR3-R1 by one increased the odds of SLE

1.66 times. When both copies of CFHR3-R1 are absent and a homozygous deficiency is present, the odds of SLE increase 1.94 times.

131

4.3.3 Distribution of CFHR3-R1 copy numbers in European SLE

European American SLE cases and unrelated healthy controls

The frequency of CFHR3-R1 copy numbers was determined in 352

European American SLE cases and found to be significantly different among

European American healthy unrelated controls (χ2=6.7, p=0.03; Figure 4.3). Both

SLE cases and controls demonstrated similar frequencies of the CFHR3-R1

homozygous deficiency (SLE: 0.054; Control : 0.049; Table 4.5). There was an

8% increase in EUA SLE cases with one copy of CFHR3-R1 compared to

controls (0.309 vs 0.386, respectively). This increase parallels the 8% decrease

in SLE cases with two copies of CFHR3-R1 (0.642 vs 0.560). SLE cases had

significantly more overall CFHR3-R1 deficiencies than controls (0.44 vs 0.36;

p=0.01). CFHR3-R1 copy numbers are significantly reduced in European

American SLE (GCI: 1.50 ± 0.60 vs 1.59 ± 0.58; p=0.023).

Odds Ratio (OR) in European American SLE

The OR was determined differently among European American SLE cases

to account for similar frequencies of CFHR3-R1 homozygous deficiencies. Copy

numbers of CFHR3-R1 were treated as a continuous variable in which a single

group or single copy number level was compared to both remaining groupsThe

effect was neutral in subjects with CFHR3-R1 homozygous deficiency (OR: 0.93;

Figure 4.4). Subjects with 2 copies of CFHR3-R1 are afforded protection and the

risk of SLE is reduced 1.39 times (OR: 0.72, 95% C.I. 0.55-0.95; p=0.02). The

132

risk of SLE is increased by 1.44 times by among subjects with a homozygous

deficiency (95% C.I. 1.08-1.90; p=0.01). This data implies that two copies of

CFHR3-R1 are protective against SLE, and the heterozygous deficiency is a risk.

4.3.4. CFHR3-R1 genotype in European American and African American

SLE

Early investigations of the CFHR3-R1 by TaqI RFLP-Southern blot

detected a common allelic polymorphism within the CFHR3-R1 region, upstream of CFHR1. The allelic variation was investigated in African American and

European American SLE cases and race-matched healthy controls (Table 4.6).

For both groups the frequencies of each of the six genotypes (AA, AB, BB, AC,

BC, or CC) were determined along with the carrier frequency of each allele.

African American SLE cases and controls had significantly different

CFHR3-R1 genotype distributions (χ2=20.3, p=0.0011). It appears that the B

allele is less variable than either C or A as AFA cases and controls has similar

frequencies of the BB genotype (0.078) and different AB and BC. This could

reflect variability in either the C allele (which has been demonstrated earlier) or

the A allele. Previously variability in the C allele (CFHR3-R1 deficiency) was

demonstrated, and there is a marginally significant 16.1% reduction in A carrier

frequency between AFA cases and controls (0.480 vs 0.641; p=0.063). The most

frequent genotype among SLE cases is CC followed by AC, and BC. AFA

controls have a majority of AC, then AA, then CC.

133

Differences in CFHR3-R1 genotypes were significant between European

American SLE cases and controls (χ2=13.6, p=0.02). The greatest discrepancy occurs in the frequency of the AC genotype in which SLE cases have an 8% increase compared to controls (0.181 vs 0.102). In European American SLE, A carrier frequency was highly similar (0.483 vs 0.492) and no significant difference was detected among B allele carriers. Neither the A nor B allele exerted a major effect in European American SLE.

134

4.4. Discussion

The role of reduced CFHR3-R1 copy numbers was determined in

European and African American SLE. These results are significant in that they

find a genetic risk factor, which may explain the greater susceptibility and

severity of SLE seen in African Americans compared to European Americans.

African Americans have 2-3 times increased frequency of SLE compared to

European Americans (Fernandez et al. 2007; Hochberg 1997; Petri 2005) and greater morbidity and earlier onset than European populations (Daniel et al.

1995; Fernandez et al. 2007). One study did find significant contribution of the splice variant of the IRF5 gene among African Americans, but this was not as strong as the association first identified in European Americans (Kelly et al.

2008).

To confirm the findings of increased risk of SLE associated with decreased copy numbers of CFHR3-R1 these results need replicated in a larger cohort. The African American SLE cohort was small and included subjects from

Ohio and Pennsylvania to increase sample size. Addition or recruitment of

African American SLE cases and race-matched controls would lend support by strengthening the association. The role of CFHR3-R1 CNV in SLE susceptibility could be extended by the inclusion of an Asian SLE population and race- matched controls. A greater prevalence and severity of disease manifestations are also present among Asian populations compared to European Americans

(Fernandez et al. 2007; Hochberg 1997; Petri 2005).

135

Future efforts increasing sample size would enrich the current SLE

cohorts allowing stratification into more homogenous genetic groups. The genetic composition of European American SLE cases or controls may reflect a heterogenic background making differences not easily deciphered. The ancestral composition of the SLE cases and controls could be determined and resolve ambiguity associated with race determinations. However, no differences were detected between SLE cases from Ohio and SLE cases from Pennsylvania.

Excluding any other sources of heterogeneity and performing the study in a more homogenous sample would yield a clear assessment of the role of CFHR3-R1 in

SLE.

In African American SLE both the homozygous and heterozygous

deficiency are risk factors demonstrating a dosage effect in which the risk for

SLE increases from one to zero copies of CFHR3-R1, but only the heterozygous

deficiency is a risk in European American SLE. Despite a large European

American cohort of SLE cases and controls, the CFHR3-R1 was only marginally

associated with SLE. It is unclear why the heterozygous deficiency and not the

homozygous deficiency contributed to an increased risk of European American

SLE at this moment. Likewise only the heterozygous CFHR3-R1 deficiency may

be detectable. Because of the reduced frequency of the homozygous deficiency

in European Americans detecting such small differences would require unrealistic

sample sizes (Ioannidis et al. 2004). A larger sample size would enable the

detection of a greater number of homozygous CFHR3-R1 deficiencies.

136

These results support a hypothesis where high CFHR3-R1 copy number is

protective. Under this premise, loss of a single copy of CFHR3-R1 reduces the

threshold for disease. CFHR3-R1 is present among European Americans at high frequencies, narrowing the range of variability. Possibly, reduced CFHR3-R1 is

not a major player in European American SLE, or functions in tandem with other

genetic risk factors.

Also within the CFH gene region is a common polymorphism in exon 9 of

CFH (rs1061170) which alters CFH binding to CRP and heparin by substituting

histidine for tyrosine at position 402 (Y402H). This was investigated in a small

cohort consisting of 95 SLE cases of mixed race (Table 4.9). The A nucleotide codes for a tyrosine amino acid at position 402 whereas the risk G nucleotide codes for the histidine substitution. All cases of SLE with the homozygous risk

(HH) contain two copies of CFHR3-R1. If CFHR3-R1 is a risk for disease, then it

does not occur on the same haplotype as the 402H risk, though this observation

has been made previously (Hageman et al. 2006; Spencer et al. 2008).

In context, this generates additional variability and stringency within the

CFH gene region reflecting the intricacies in maintaining a regulatory balance in

the immune system. The small sample size of each of the groups may give a

spurious association and further genotyping in a larger cohort should proceed. It

is possible that the lack of association of the CFHR3-R1 homozygous deficiency

in European American SLE is partially attributed to this relationship. In this case,

the homozygous 402H may be increased in European American SLE. . It is

137 curious to note that the CFHR3-R1 homozygous deficiency and 402-HH are not commonly encountered in tandem in the population, despite both being common variants. A possible explanation for this finding is there may be a deleterious effect of having both risks, and one is genetically excluded from the other. This suggests there may be multiple loci contributing to disease.

Even within the CFHR3-R1 copy number variant there was a common

RFLP termed allele A or allele B. This common polymorphism has not been reported previously and its association with SLE is unclear and complex. This polymorphism within CFHR3-R1 can be thought of as tri-allelic owing to their intrinsic link because of proximity. Sorting out whether the absence of CFHR3-R1 is the risk or that the absence of CFHR3-R1 reduces the frequency of the true risk (allele A or B) requires additional investigations.

The functional consequence of CFHR3-R1 deficiency is unknown but has been associated with an increased risk for atypical Hemolytic Uremic Syndrome

(Dragon-Durey et al. 2009; Jozsi et al. 2008; Zipfel et al. 2007). In related studies, CFH deficiency was present in Dense Deposit Disease (DDD) or

Membranous proliferative glomerulonephritis type II (MPGN II) ultimately leading to a premature death in a porcine model and a similar MPGN II phenotype in mice due to excessive complement activation (Hegasy et al. 2002; Hogasen et al. 1995; Jansen et al. 1993; Pickering et al. 2002). No direct report indicates a role of the CFH gene region in SLE disease susceptibility or racial diversity, but it has been suggested to play a role in lupus nephritis (The 8th International

138

Congress on Lupus, Shanghai 2007 and Lupus Genetics Conference, OMRF

2008).

In the current study, nearly half of the European and African American

SLE cases with membranous glomerulonephritis had CFHR3-R1 deficiency and among them, 24% were homozygous. When segregating by race, there was a significant difference among African American SLE renal cases with membranous glomerulonephritis and controls (χ2=6.6, p=0.037). Half of the

African American SLE cases with membranous glomerulonephritis (World Health

Organization Class V) had CFHR3-R1 homozygous deficiencies. This data suggests the presence of a sub-group of membranous glomerulonephritis SLE patients in which CFHR3-R1 deficiency contributes significantly.

To conclude this section, there is a role for low copy numbers of CFHR3-

R1 as a risk factor for the development of SLE. The risk is more strongly associated with African American SLE than European American SLE. A common polymorphism in CFHR1 with variable frequency adds complexity to the CFH gene region and may independently contribute SLE. CFHR3-R1 copy numbers were decreased among African American SLE cases with membranous glomerulonephritis. Future efforts will attempt to determine the extent of the

CFHR3-R1 deficiency in European American SLE, and confirm whether the absence of CFHR3-R1 contributes to renal manifestations.

139

Notably omitted from the SLE study was family based investigation of the

CFHR3-R1 copy number variant and genotypes. No proper statistics were run to investigate if the deficiency or alleles are more frequently transmitted to the proband than expected. CFHR3-R1 copy number and genotypic data are available for first-degree relatives including parents and siblings. Formal statistical applications will be used in the future to determine the contribution of

CFHR3-R1 among families.

140

2 χ =6.9 0.52 Controls, N=353 P=0.03 0.46 SLE, N=153 0.4 0.36

0.25 0.23

0.2 0.17 Frequency

0 0 1 2

CFHR3-R1Copy Number

Figure 4.1 Distribution of CFHR3-R1 CNV in African American SLE cases and race-matched healthy controls. Healthy controls (blue) compared to SLE cases

(red) demonstrate significant differences in CFHR3-R1 copy numbers.

141

African American SLE

OR 1.94 1.67 1* 95% C.I. 1.12-3.38 1.09-2.61 * p-value 0.022 0.027 * Odds Ratio

CFHR3-R1Copy Number

Figure 4.2 The OR in African American SLE. The OR is calculated using two copies of CFHR3-R1 as the reference group noted by * (asterisk). In all graphs the upper and lower 95% limits are plotted as confidence interval (C.I.).

142

Controls, N=689 2 χ =6.7 0.64 0.6 P=0.03 0.56 SLE, N=352

0.4 0.39 0.31

0.2 Frequency

0.05 0.05 0 0 1 2

CFHR3-R1 Copy Number

Figure 4.3 Distribution of CFHR3-R1 CNV in European American SLE cases and race-matched healthy controls. Healthy controls (blue) compared to SLE cases (red) demonstrate significant differences in CFHR3-R1 copy numbers.

143

European American SLE

OR 0.93 1.44 0.72 95% C.I. 0.49-1.75 1.08-1.90 0.55-0.95 p-value 0.87 0.01 0.02

Figure 4.4 The OR in European American SLE. The OR is conducted using

CFHR3-R1 copy numbers as a continuous variable. In this manner, subjects with

2 copies are compared with those with 0 or 1. Subjects with 1 copy are compared to those with 0 or 2. In all graphs the upper and lower 95% limits are plotted as confidence interval (C.I.).

144

Table 4.1 Properties associated with CFH and CFH related proteins.

Binding Partners Activity

Protein C3b Heparin CRP Cofactor Decay acceleration CFH X X X X X CFHR1 X CFHR2 CFHR3 X X X X CFHR4 X X X CFHR5 X X X X

This table demonstrates the function of CFH and the related proteins. A property of that protein is marked as an ‘X’ and the absence is left blank. There is a lack of information regarding the function of CFHR2 in the literature and this is indicated by the absence of associated properties.

145

Table 4.2 Summary table of populations and abbreviations for SLE cohorts

European American African American

Group ID N N All SLE 352 153 Ohio SLE OSS 235 102 Pennsylvania SLE AJ 117 26 Louisiana SLE BS - 25

146

Table 4.3 CFHR3-R1 copy numbers in European and African American SLE

AFA-SLE OSS AJ BS χ2 p-value

CFHR3-R1 N Freq N Freq N Freq 0 25 0.245 5 0.192 5 0.200 2.4 0.7 1 51 0.500 13 0.500 16 0.640 2 26 0.255 8 0.308 4 0.160 102 26 25

EUA-SLE OSS AJ χ2 p-value

CFHR3-R1 N Freq N Freq 0 13 0.055 6 0.051 0.03 0.9844 1 91 0.387 45 0.385 2 131 0.557 66 0.564 235 117

Abbreviations: AFA-SLE-African American SLE, OSS-Ohio SLE; AJ-

Pennsylvania SLE; BS-Louisiana SLE; Freq-Frequency; EUA-SLE-European

American SLE

147

Table 4.4 Distribution of CFHR3-R1 CNV among African American SLE patients and healthy unrelated controls.

Controls SLE

CFHR3-R1 N Frequency N Frequency p-value

0 67 0.177 35 0.229 χ2=6.9 0.03

1 174 0.460 80 0.523 GCI 0.013

2 137 0.362 38 0.248

Total N 378 153

GCI 1.18 ± 0.71 1.02 ± 0.69

Allelic 0.593 0.510

Carrier 0.823 0.771

148

Table 4.5 Distribution of CFHR3-R1 CNV in European American SLE patients and healthy unrelated controls

Controls SLE

CFHR3-R1 N Frequency N Frequency p-value

0 34 0.049 19 0.054 χ2=6.7 0.03

1 213 0.309 136 0.386 GCI 0.023

2 442 0.642 197 0.560

Total N 689 352

GCI 1.59 ± 0.58 1.50 ± 0.60

Allelic 0.796 0.753

Carrier 0.951 0.946

149

p-value p-value

Group Carriers p-value p-value Carriers Group Group Group

0.483 0.483 0.698 0.430

0.492 0.492 0.738 0.346

0.480 0.480 0.442 0.662 genotypes in European Americanand African SLE

African American American African American European 0.312 0.312 0.594 0.641 0.641 8 0.125 12 0.156 160 0.296 62 0.234 EUA 13.6 13.6 0.02 160 0.296 0.156 12 62 0.234 8 0.125 EUA 139 5 0.078 0.257 6 0.078 71 0.268 7 0.109 16 0.208 106 106 0.196 0.208 16 52 0.196 7 0.109 AFA B 0.12 13 0.203 0.203 13 8 0.104 55 0.102 18 0.068 AFA 20.3 0.0011 20 0.313 0.313 20 17 0.221 55 B 0.102 0.13 48 0.181 AFA A A 0.172 11 18 0.234 26 0.048 0.063 0.71 14 0.053 541 77 64 265 EUA EUA Distribution of CFHR3-R1

Control SLE Control SLE AA AB BB AC BC CC Total N Total N B Carrier C Carrier A Carrier Carrier A Genotype N Frequency Frequency N Genotype N Frequency N Frequency N Frequency Table 4.6 4.6 Table 150

Table 4.7 Distribution of rs1061170 (Y402H) by CFHR3-R1 copy numbers.

Y402H Genotype

HH HY YY

CFHR3-R1 N Frequency N Frequency N Frequency

0 0 0 2 0.040 8 0.222

1 0 0 21 0.420 16 0.444

2 9 100 27 0.540 12 0.333

Total N 9 50 36

151

CHAPTER 5

A ROLE FOR REDUCED COMPLEMENT FACTOR H (CFH) PROTEIN

LEVELS IN SYSTEMIC LUPUS ERYTHEMATOSUS (SLE) AND

ANTIPHOSPHOLIPID SYNDROME (APS)

Abstract

Deficient or dysfunctional CFH protein fails to regulate C3b in the alternative pathway of complement activation leading to hematological and renal disorders. Systemic Lupus Erythematosus (SLE) is a prototypic autoimmune disease affecting multiple organs in which deficiency of early classical complement components are a risk. To determine the role of CFH in SLE and associated hematological manifestations CFH protein levels were measured in

Ohio SLE Study (OSS) cases and subjects positive for antiphospholipid antibodies (aPL). CFH protein levels were determined by radial immunodiffusion in 314 OSS cases, the 616 first-degree relatives of OSS cases, and 456 subjects with aPL. Mean CFH protein levels were significantly reduced among aPL-

152 positive subjects with SLE compared to aPL-subjects without SLE (49.9±13.1 vs

52.9±14.4; p=0.02). There was a trend for decreased CFH in aPL-associated thrombosis (49.9±12.1 vs 52.3±15.0; p=0.056). The combined aPL-associated

SLE with thrombosis group demonstrated significantly reduced CFH protein levels (48.9±9.7 vs 54.5±15.4 in non-thrombosis, non-SLE; p=0.001). Among

Ohio SLE cases, those with aPL had reduced CFH protein levels (aPL: 47.7±11 vs 57.0±15 mg/dL; p=0.022). This study demonstrates an association between low CFH plasma protein levels and a subgroup of SLE patients with aPL and aPL-thrombosis, identifying a subset of SLE cases with an increased risk of morbidity or mortality.

153 5.1 Introduction

Complement Factor H (CFH) regulates the alternative pathway of

complement activation at the point of C3b (Whaley and Ruddy 1976) and

deficiency is associates with excessive complement activation resulting in

hypocomplementemia, low complement hemolytic activity, and low C3 protein

levels (Hegasy et al. 2002; Hogasen et al. 1995; Pickering et al. 2002; Thompson

and Winterborn 1981). CFH is part of the CFH gene region at 1q32 (Rodríguez

de Córdoba et al. 2004; Rodríguez de Córdoba 2008) containing CFH and five related genes: CFHR3, CFHR1, CFHR2, CFHR4, and CFHR5 with 85% to 97% nucleotide identity (Rodríguez de Córdoba 2008; Zipfel et al. 1999; Zipfel et al.

2002). There is a copy number variation in CFHR3-R1 so that zero, one, or two copies of CFHR3 and CFHR1 are present in tandem in a diploid genome.

Approximately each exon of CFH codes for a 60 amino acid long short consensus repeat or SCR (Male et al. 2000), collectively forming functional domains. The CFH N-terminal region regulates C3 activation and serves as a cofactor for Factor I (Alsenz et al. 1985; Kuhn et al. 1995; Pangburn et al. 1977;

Weiler et al. 1976; Whaley and Thompson 1978). The C-terminal domain recognizes host glycoproteins to prevent activation of complement on these surfaces (Meri and Pangburn 1990; Oppermann et al. 2006). CFH has 3 binding sites for C3b (Jokiranta et al. 1996) and heparin (Blackmore et al. 1998;

Blackmore et al. 1996; Sahu and Pangburn 1993).

154 Multiple cases of CFH deficiency and dysfunction are reported in renal

and ocular disease such as Membranoproliferative Glomerulonephritis II, Age-

Related Macular Degeneration (AMD), and atypical Hemolytic Uremic Syndrome

(Edwards et al. 2005; Gold et al. 2006; Hageman et al. 2005; Hageman et al.

2006; Haines et al. 2005; Hughes et al. 2006; Klein et al. 2005; Li et al. 2006;

Maller et al. 2006; Nielsen et al. 1989). Deficiency of CFH associates with MPGN

II and is characterized by complement and immune deposits leading to impaired

renal function or end-stage renal disease (Orth and Ritz 1998). Glomerular

basement membrane deposits are positive for C3 (Sethi et al. 2009) as the GBM

lacks membrane bound complement regulators and therefore relies extensively

on circulating CFH to protect against complement-mediated damage (Pavenstadt

et al. 2003).

Dysfunctional CFH protein levels alters the specificity of CFH protein binding leading to host cell damage in the absence of adequate CFH, or

combined with presence of other triggers or genetic factors (Abrera-Abeleda et al. 2006; Barlow et al. 2008). This can lead to a disease characterized by dense deposits of complement activated fragments (Kavanagh et al. 2007; Licht et al.

2006). The characteristic feature of AMD, drusen, consists of complement deposits (deJong 2006; Hageman et al. 2001). Both risk and protective haplotypes within the CFH gene region have been associated with AMD

(Edwards et al. 2005; Hageman et al. 2005; Haines et al. 2005; Klein et al. 2005;

Li et al. 2006; Maller et al. 2006; Thakkinstian et al. 2006; Thompson et al. 2007).

The main protective haplotype revealed a copy number variation containing

155 genes encoding CFHR3 and CFHR1 (Hughes et al. 2006). The major AMD risk haplotype contains a nonsynonymous SNP in SCR 7 of CFH resulting in a tyrosine to histidine amino acid substitution (Y402H) leading to differential binding of CFH (Clark et al. 2006; Prosser et al. 2007; Sjoberg et al. 2007b;

Skerka et al. 2007). SCR 7 is capable of binding C-Reactive Protein or heparin

(Giannakis et al. 2003; Kaplan and Volanakis 1974; Mold et al. 1984).

The common outcome related to CFH disregulation, whether because of deficiency or dysfunction, was the presence of complement mediated tissue injury of specific cell surfaces. Low levels of complement components and immune complex mediated tissue injury are present in Systemic Lupus

Erythematosus or SLE (Cochrane and Koffler 1973; Koffler et al. 1971). Genetic deficiency of early classical complement components are among the strongest known genetic risk factors for SLE (Navratil et al. 1999; Pickering et al. 2000).

Low circulating protein levels of C3 and C4 in tandem have been investigated in a pediatric SLE cohort (Wu et al. 2006). Early onset of SLE was documented in a case report of complete Factor I deficiency with concurrent low CFH protein levels (Amadei et al. 2001). CFH may play a role in SLE by regulating the activation of C3, which can be a sensitive marker for hematological and renal manifestations seen in SLE (Ho et al. 2001; Tsokos 2004).

Contributing factors to the morbidity and mortality associated with SLE is hematological manifestations such as thrombosis, which occurs at a greater frequency among younger age-groups than in the general population and is a

156 significant determinant in SLE (Trager and Ward 2001). A large thrombosis and

SLE study of nearly 2,000 SLE cases found an increased risk associated with antiphospholipid antibody (aPL) positivity, history of smoking, immune modulating medication use, longer disease duration and older age at SLE onset

(Kaiser et al. 2009). Nearly half of SLE cases with aPL such as Lupus

Anticoagulant (LAC) or cardiolipin antibodies (aCL) had a history of thrombosis

(Love and Santoro 1990). Presence of aPL alone increases the risk of thrombosis in SLE by 3 times (Kaiser et al. 2009; Toloza et al. 2004). A major risk associated with persistent aPL is the development of Antiphospholipid

Syndrome (APS), characterized by thrombosis and recurrent pregnancy loss

(Giles and Rahman 2009).

Antiphospholipid syndrome is a form of autoimmune thrombophilia, related to increased morbidity and mortality. APS describes a subset of SLE cases meeting diagnostic criteria including multiple spontaneous abortions, multiple thromboses, and neurological abnormalities (cerebral thrombosis/myelitis) in the presence of antiphospholipid antibodies (Hughes 1983; Lockshin et al. 2000;

Miyakis et al. 2006; Weber et al. 2001; Wilson et al. 1999). Antiphospholipid antibodies are present in 1-10% of healthy subjects (George and Erkan 2009;

Petri 2000; Shi et al. 1990), and 17-86% of SLE patients (Jones et al. 1991; Petri

2000; Picillo et al. 1992). APS can be the primary disease, secondary to SLE, or present in other autoimmune diseases (McNeil et al. 1991). Secondary APS is present in 20-40% of SLE cases (Cervera et al. 2002; George and Erkan 2009;

Kaiser et al. 2009; Lockshin 2006; Petri 1997; Petri 2000). 157 Complement and coagulation pathways feature overlapping similarities and functional roles (Markiewski et al. 2007) such that both cascades consist of circulating protein proteases that initiate sequences of pathway activity (Krem and Di Cera 2002). Within the coagulation cascade, thrombin can activate complement C5 in the absence of C3 (Huber-Lang et al. 2006). The role of complement in APS is seen in both thrombosis and pregnancy loss. Complement is naturally activated during pregnancy in which C3a, C4a, and C5a protein levels are increased (Richani et al. 2005). Blocking or knocking out C5a or the C5a receptor inhibited fetal injury in aPL-injected mice (Giannakopoulos et al. 2007;

Girardi et al. 2003). Inhibiting complement activation, deficiency of C3, or deficiency of Crry in murine models of APS protected against fetal loss (Holers et al. 2002; Kim et al. 1995).

This chapter aims to determine the role of CFH protein levels in SLE and

APS by investigating an SLE cohort and a cohort of aPL positive subjects to isolate aPL-associated SLE, thrombosis, and SLE with thrombosis. This work addresses the cause of decreased C3 protein levels seen in SLE, which could be due to consumption or disregulation of complement. CFH regulates C3 activation and may contribute to the reduced protein levels of C3 in SLE. Despite evidence linking complement and coagulation and complement with APS, clinical factors still do not explain thrombosis in patients with SLE (Mok et al. 2005) and there may be yet unknown factors which can identify possible subsets of aPL in SLE at risk for APS. CFH protein levels were reduced in aPL-positive subjects with pregnancy loss, SLE, and marginally, thrombosis. There were significant 158 reductions in CFH protein levels among a subset of patients with aPL and SLE with thrombosis. CFH protein levels were measured in OSS cases with and without aPL. No differences in CFH protein levels were detected between OSS cases and their first-degree relatives. However, CFH protein levels were significantly reduced among OSS cases with aPL compared to those without aPL. These results suggest a role for CFH and aPL contributing to SLE with thrombosis such that reduced CFH protein levels can lead to or are a consequence of a loss of host-cell protection with complement mediated damage.

159 5.2 Materials and Methods

5.2.1 Study Populations

This study was approved by the Institutional Review Board of Nationwide

(Columbus) Children’s Hospital. Two major sample populations were used for

these studies: a cohort positive for antiphospholipid antibodies (aPL) and an Ohio

SLE Study cohort (OSS). Citrate-plasma and matched genomic DNA from 456

subjects with aPL and clinical status were provide by the APSCORE (Roubey et

al. 2004). The OSS cohort contained 314 SLE cases meeting American College

of Rheumatology criteria (Tan et al. 1982) and 616 of their first-degree relatives

recruited in central Ohio. Of these subjects, 93 were followed longitudinally and

have a more detailed clinical status. Genomic DNA and EDTA-plasma from the

OSS cohort were prepared by previous Yu Lab members (Dr. Erwin Chung, Ms.

Dr. Stephanie Savelli, Dr. Yee Ling Wu, Dr. Yan Yang, and Ms. Bi Zhou at The

Research Institute at Nationwide Children’s Hospital). There were 236 European

American SLE cases and 78 African American SLE cases. First-degree relatives

were mostly European Americans (N=515).

Blood Processing

APSCPRE citrate-platelet poor plasma (PPP) samples were processed

with a consistent protocol. Briefly, blood samples in citrate tubes were

centrifuged at 1500g for 10 min, 4-8°C. Plasma samples were transferred to microcentrifuge tubes and spun again at 2000g for 5 min. Aliquots were kept

160 frozen at -80°C. OSS and the Yu lab collected blood in EDTA-tubes, following standard laboratory protocols with slight variation (Chung et al. 2005).

5.2.2 Determination of CFH plasma protein levels by radial immunodiffusion

Plasma protein levels were determined by single radial immunodiffusion

(RID) assays using homemade RID plates standardized to those commercially available from The Binding Site (Birmingham, United Kingdom) according to a standard protocol (Giclas 2003). Goat anti-human complement factor H antibody

(Calbiochem) was diluted (1:20 of 42.0 mg/mL) in a 2% SeaKem LG (Lonza) agarose gel in Modified Mancini Buffer. Known standard plasma calibrators were diluted 1:4 in 7% BSA. The diameter of the precipitant ring was measured with a jeweler’s eyepiece. The square of the diameter is plotted against the known concentration, from which a linear equation is generated. CFH plasma protein levels were determined in unknown samples diluted 1:8 in 7% BSA using the linear equation. Batches of 10-15 homemade plates were tested for interassay and intraassay reliability. Any sample reading with a diameter outside the standard curve was diluted appropriately and retested.

5.2.3 Statistical analyses

Descriptive statistics, including means, standard deviations (SD), and 95% confidence intervals (95% C.I.) were computed for numeric data. Frequency distributions were determined for categorical variables. The mean of CFH protein

161 concentrations among T0, TS, S0 and NTS groups were compared using One

Way Analysis of Variance (ANOVA) techniques. Specifically, Tukey HSD test

with an alpha set at 0.05 was applied, and was followed by pairwise Student’s t-

tests that yielded the p-valuesTwo group comparisons were based on individual

Student’s t-tests accounting for unequal variances when appropriate. Mean CFH

protein levels are reported as CFH ± SD in mg/dL, and logCFH was used for

analysis under parametric conditions when appropriate. Mean CFH protein

concentrations were compared using One Way Analysis of Variance (ANOVA)

among multiple groups followed by pairwise Student’s t-tests that yielded the p-

values. All statistics were performed using JMP v8.0 (SAS).

Additional declarations: Plasma from aPL-positive subjects were provided

through the APSCORE from Dr. Robert A.S. Roubey. Plasma from OSS samples

were processed by Yu lab members and at the Ohio State University.

Longitudinal OSS samples and related data information including aPL and LAC

status were maintained in an Excel database by OSS coordinators and collaborators.

162 5.3 Results

5.3.1 CFH plasma protein levels in an aPL cohort from APSCORE

Distinctions between clinical manifestations associated with APS allowed

the aPL-subjects to be categorized by the presence of thrombosis, SLE,

pregnancy loss and various combinations or exclusions of such (Table 5.1).

There was a trend toward reduced mean CFH protein levels in subjects with

thrombosis (49.9±12 mg/dL) compared to those without thrombosis (52.3±15 mg/dL; p=0.056; Table 5.2). Significant differences in decreased mean CFH protein levels were detected among subjects with SLE compared to those without

SLE (49.9±13 vs 52.9±14 mg/dL, p=0.020). Pregnancy loss also associated with a significant decrease in mean CFH protein levels (48.8±10 vs 52.1±14 mg/dL; p=0.019).

A considerable proportion (i.e., 21.0%) of aPL-positive subjects diagnosed with SLE also experienced thromboses. To distinguish the role of CFH in thromboses and SLE, subjects with aPL were segregated according to their thrombosis and SLE status, i.e., T0, TS, S0 and NTS (Figure 5.1). Two sets of binary comparisons yielded complementary information on the patterns of CFH and aPL in thrombosis. The first is a comparison between two groups of non-SLE subjects, T0 and NTS; the second is a comparison between two groups of SLE

subjects, S0 and TS. The T0/NTS comparison revealed decreased CFH protein

levels in aPL subjects without SLE but with thrombosis compared to subjects with

neither thrombosis nor SLE (T0: 51.5±14; NTS: 54.5±15 mg/dL; p=0.121). The

TS/S0 comparison revealed lower CFH protein levels in aPL subjects with both

163 thrombosis and SLE than subjects with SLE only (TS: 47.9±10; S0: 51.1±15

mg/dL; p=0.079).

To determine significant parameters for SLE, two separate sets of binary

comparisons yielded complementary information. The first is a comparison

between two non-thrombotic groups S0 and NTS; the second is a comparison

between two thrombotic groups TS and T0. The S0/NTS comparison

demonstrates reduced CFH protein levels in subjects with SLE than those with

neither SLE nor thrombosis (S0: 51.1±15; NTS: 54.5±15 mg/dL; p=0.053).

Interestingly, the CFH protein levels for either SLE only or thrombosis only are

quite similar (p=0.78). The TS/T0 comparison identified a further decrease in CFH

protein levels among aPL subjects with both thrombosis and SLE than with

thrombosis alone (TS: 47.9±10; T0: 51.5±14 mg/dL; p=0.059). The difference

between aPL subjects with both thrombosis and SLE versus those without either

SLE or thrombosis was highly significant (p=0.001).

Table 5.3 represents aPL subjects of Northern European ancestry.

Subjects with either SLE or thrombosis had significantly reduced levels of CFH protein than aPL subjects without SLE without thrombosis (NTS: 56.3±16; S0:

49.0±13 mg/dL, p=0.0026; T0: 50.6±10 mg/dL, p=0.021). Subjects with both

thrombosis and SLE also had significantly reduced CFH protein levels than aPL

subjects without SLE without thrombosis (TS: 49.4±10 mg/dL; p=0.0075).

164 5.3.2 Mean CFH plasma protein levels in OSS cases

The role of CFH in SLE was investigated further by comparing CFH

protein levels between cases and first-degree relatives. Because samples were

processed differently OSS cases cannot be directly compared to healthy

unrelated controls, as this could create a false difference in protein levels.

Comparing OSS cases to first-degree relatives overcomes this obstacle and

controls any genetic effects on CFH expression owing to the shared genetic

composition amongst family members. Mean CFH plasma protein levels were

similar between African and European American OSS cases and their race-

matched first-degree relatives (Table 5.4). There was an observed marginal

increase in African American parents’ CFH protein levels compared to AFA

siblings (67.0±18 vs 59.8±18 mg/dL; p=0.055). This could be an artifact of the small sample size or of greater differences in age.

CFH associates with C3 and C4

Because CFH regulates activated C3, the associations between these proteins (as well as C4 and CFH) were investigated among OSS cases (Figure

5.2). CFH and C3 protein levels demonstrates a significant association inboth

African and European American SLE (R=0.285, p=0.013; EUA: R=0.44, p=

8.02x10-12). The significance of the association likely reflects the sample size.

EUA-SLE cases also demonstrate a significant correlation between CFH and C4

(R=0.25, p=6.04x10-5; Figure 5.3 A). As mentioned previously, the significance of the correlations among AFA OSS cases reflects a smaller sample size, but

165 does not necessarily bear on the strength of the association. This is the case for the association between CFH and C4, which is stronger in AFA-SLE than in

EUA-SLE (R=0.23, p=0.042; Figure 5.3 B).

CFH protein levels are not affected by rs1061170

Genotypes at rs1061170 antisense A/G alleles were determined in 68

OSS cases to compare mean plasma protein levels of CFH between the different genotypes (Table 5.5). The sample size of African American OSS cases is smaller and may be subject to ascertainment bias. AFA SLE cases with one risk allele (AG) demonstrated the highest protein levels of CFH with both the GG and

AA genotypes having equivalent protein levels (62.7 ±16, 53.6 ±15, 54.8 ± 6 mg/dL, respectively; p=0.53). A dosage effect was present in European American cases. The majority of cases were heterozygous AG with mean protein levels of

54.6±13 mg/dL. Homozygous AA cases had higher CFH levels (56.9±16 mg/dL) while homozygotes for the risk genotype (GG) had the lowest values of CFH

(50.6±6 mg/dL). No significant difference was detected (p=0.58) despite that carrying 2 risk alleles is found in cases with lower CFH protein levels.

5.3.3 The role of aPL in SLE (study in OSS samples)

OSS cases studied longitudinally were evaluated for the presence of IgG and IgM anticardiolipin antibodies or Lupus Anticoagulant (LAC). Of the 93 longitudinally investigated SLE patients meeting ACR criteria, 58 had anticardiolipin antibodies to IgG, IgM, or LAC. Of these, laboratory criteria for

166 APS (Bertolaccini et al. 2005) was met in 20.4% of the OSS cases. CFH protein levels were determined among 84 cases. There was a significant reduction in

CFH protein levels in subjects with aPL (aPL: 47.7 mg/dL; Non-aPL: 57.0 mg/dL; p=0.0215; Table 5.6). A similar trend was detected when segregating by race, which reached significance in EUA-SLE (p-0.02).

5.3.4 CFH and C3 plasma protein levels in longitudinal OSS cases

CFH and C3 protein levels were measured in two OSS cases with renal flares of disease activity studied longitudinally over periods of 45 or 28 months

(Patient 402 and 464, respectively; Figure 5.4). Mean CFH protein levels were higher in patient 402 (53.2±12, 49.3±5 mg/dL, respectively), whereas mean C3 protein levels were higher in patient 464 (87.4±16.2, 80.9±9.8 mg/dL, respectively). Both patients demonstrate a similar range of protein values fluctuating from 45.3 to 60.3 mg/dL (464) and from 48.3 to 65.6 mg/dL (402) for

CFH and 63 to 100 mg/dL (402) and from 72.2 to 101.8 mg/dL (464). There was tight association between CFH and C3 in patient 402, which was not as tight in patient 464. At times of renal flare, there appears to be lower C3 and CFH protein levels than the previous date for 80% of flares, though no clear trend is present when examining these points compared to average protein levels overall.

Interestingly, at the last renal flare event in both subjects, C3 and CFH are divergent. Decreases in either CFH or C3 do not always lead to a flare and represent the normal fluctuation over SLE disease course. Additional studies could elucidate if other factors were present that would affect the tight

167 association between CFH and C3, modify complement consumption, or interfere with complement regulation.

168 5.4 Discussion

This chapter investigated CFH protein levels among patients with SLE,

relatives of patients with SLE, and patients with antiphospholipid antibodies (aPL)

to determine the role of CFH. Mean CFH protein levels were reduced among

subjects with aPL associated SLE and aPL-associated thrombosis, which was

highly significant among subjects with aPL-associated SLE with thrombosis. SLE

cases with aPL had lower CFH protein levels than non-aPL SLE cases, but there

was no difference in CFH protein levels between SLE cases and first-degree

relatives. These results suggest a role for reduced CFH protein levels associated

with aPL-SLE and aPL-associated SLE with thrombosis.

This study demonstrated a role of reduced CFH protein levels but was

unable to demonstrate significant contributors to CFH protein expression. When

investigating if the CFHR3-R1 copy number variant contributed to CFH protein

levels, no difference was detected between subjects with zero, one, or two

copies of CFHR3-R1 (Table 5.7). Detection of CFH by RID utilized a polyclonal

antibody against CFH, allowing for cross-hybridization to related proteins and

could possible detect a difference in total CFH protein levels. To test the ability of

the polyclonal antibody to recognize related proteins, plasma from subjects with 2

copies of CFHR3-R1 were subjected to Western blot analysis (Figure 5.6).

Fragments were detected of approximately 150, 120, 100, 42, and 39 kDa, which based on results of others and reported size of CFH and related proteins, corresponds to CFH, CFHR5, CFH-Like, and CFHR1 (Fontaine et al. 1989;

Timmann et al. 1991). The intensity of the fragment corresponding to CFHR1 is

169 about 1000-fold less. This could explain why no effect was observed for CFHR3-

R1 copy numbers. This reduction could explain why no difference in CFH protein levels was observed.

The association between CFH and aPL-associated SLE or thrombosis is novel. These results accumulatively support a role for decreased CFH protein levels in aPL-associated SLE and aPL-associated SLE with thrombosis. The role of reduced CFH protein levels in thrombosis or SLE with thrombosis has not been reported. Animal models of thrombosis and fetal loss implicate complement

(Fleming et al. 2004; Giannakopoulos et al. 2007; Girardi et al. 2003; Girardi et al. 2004; Holers et al. 2002; Kim et al. 1995; Pierangeli et al. 2005). The majority of studies focus on classical pathway components: C3, C4 and C5. Complement

Factor H regulates C3, which is downstream of C4, and could directly influence activation of C5. Decreased levels of C3 and C4 have been reported in association with hematological disorders of SLE (Ho et al. 2001). Specifically, low

C3 was present at times of low platelets, low hematacrit, and white blood cells.

Thrombosis stems from increased clotting, which is the opposite of these findings. Decreased CFH protein levels could then lead to an increase of C3. In a model of aPL-thrombosis, both C3 and C4 were significantly increased.

How CFH is participating in blood homeostasis remains unknown. Early studies of CFH noted two forms named either H1 or H2 or φ1 and φ2 (Ohtsuka et

al. 1993; Ripoche et al. 1984). Ohtsuka demonstrated that the second form of

CFH was only present in serum and not found in plasma. This was the direct

result of proteolytic cleavage of CFH by thrombin. Thrombin directly participates 170 in blood homeostasis, converting fibrinogen to fibrin, limits coagulation by

activating protein C, and increases platelet activation. Thrombin is also able to

activate complement directly by cleaving C5 (Huber-Lang et al. 2006). CFH

contains binding sites for heparin. At times of complement activation, CFH can

limit the amount of activated C3 and bind to endothelial cell heparin sulfate.

Reduced CFH can lead to additional C3 activation resulting in a procoagulant

state. Lack of CFH protection of cellular surfaces such as the endothelium could

result in complement mediated damage furthering triggering activation of procoagulant factors. The exposed phospholipid layer could be recognized by aPL, thus contributing to thrombosis. The role of CFH in platelet activation and

thrombosis appears to be quite complex, and requires further investigation.

This study brought to light a major limitation of studying the CFH protein

family- how to measure the related proteins. Without prior immunoprecipitation to

enhance for the CFH family of proteins, the low concentrations of the related

proteins are not adequately detected by Western blot and ELISA (results not

shown). One way to overcome this limitation is to measure the expression of

CFH at the mRNA level using sensitive quantitative methods. An earlier chapter

described several real-time PCR assays that measured the copy number of

CFHR3-R1 at various locations. Two amplicons are contained within the coding

region of the CFHR1 and CFHR3 genes enabling the detection of differences in

expression. This is feasible if are expressed similarly as CFH, which can be

synthesized extrahepatically and expressed in monocytes, endothelial cells,

171 fibroblasts, and myoblasts (Guc et al. 1993; Lappin et al. 1992; Legoedec et al.

1995).

This chapter determined the role of reduced CFH protein levels in aPL- associated SLE and aPL-associated SLE with thrombosis. These results identify a subset of SLE patients at greater risk of increased disease or more severe disease manifestation. Early intervention and identification of these individuals may enable better treatment and prognosis for disease. Future work would focus toward establishing a direct relationship between complement and coagulation to elucidate the influence of CFH protein levels in maintaining homeostasis.

172 p=0.053 p=0.001

p=0.079

p=0.121

p=0.775

p=0.059

100

50 CFH mg/dL

0 T TS S NTS 0 0 .

CFH 51.5±13.6 48.9±9.7 51.1±14.6 54.5±15.4

N 111 96 157 92

Figure 5.1 Mean CFH plasma protein levels in APSCORE subjects with SLE and thrombosis. Mean CFH protein levels were determined by Radial

Immunodiffusion in aPL positive subjects with thrombosis only (T0), SLE only

(S0), thrombosis and SLE (TS), and neither thrombosis nor SLE (NTS).

173 A. Correlation of CFH protein levels with C3 in European American OSS cases

200 R=0.44 p=8.02x10-12 N=225 150

100 CFH mg/dL

0 0 100 200 300

C3 mg/dL

B. Correlation of CFH protein levels with C3 in African American OSS cases

150 R=0.285 p=0.013 N=75 100

CFH mg/dL 50

0 0 100 200 300

C3 mg/dL

Figure 5.2 CFH correlates with C3 in European and African American OSS cases. A. CFH protein levels (mg/dL) correlated with C3 protein levels (mg/dL) in

European American SLE. B. CFH protein levels (mg/dL) correlated with C3 protein levels (mg/dL) in African American SLE cases.

174 A. Correlation of CFH protein levels with C4 in European American OSS cases

200 R=0.25 p=6.04x10-5 N=233 150

100 CFH mg/dL

0 0 50 100 150

C4 mg/dL

B. Correlation of CFH protein levels with C4 in African American OSS cases

150 R=0.23 p=0.042 N=77

100

CFH mg/dL 50

0 0 25 50 75 100

C4 mg/dL

Figure 5.3 CFH correlates with C4 in European and African American OSS cases. All protein levels were determined by RID. A. CFH protein levels (mg/dL) correlated with C4 protein levels (mg/dL) in European American SLE cases. B.

CFH protein levels (mg/dL) correlated with C4 protein levels (mg/dL) in African

American SLE cases. 175

Figure 5.4 CFH and C3 protein levels in OSS patients studied longitudinally.

Patients were studied longitudinally and variation of CFH and C3 proteins were plotted against the date the patient was seen by the attending physician. CFH protein levels are in blue, C3 protein levels are indicated in red. Mean protein levels are represented by a gray line. Renal flares are indicated by red stars. The highest and lowest protein levels are indicated by blue or red arrows, respectively. All protein levels are in mg/dL and determined by radial immunodiffusion. A. CFH and C3 protein levels in SLE patient 402. B. CFH and

C3 protein levels in SLE patient 464.

176 Figure 5.4

A. CFH protein variation in OSS patient 402

100 * C3 mg/dL

100

80 73 *81 80.9±9.8 63 * mg/dL 48.3 60 65.6* 59.6±5.6 60.0 * 58.0 CFH mg/dL * 40

10/01 01/02 04/02 07/02 10/02 01/03 04/03 07/03 10/03 01/04 04/04 07/04 10/04 01/05 04/05 07/05

Date of Visit

B. CFH protein variation in OSS patient 464

101.8 100 C3 mg/dL

72.2 * 87.7±16.2 80 *

mg/dL CFH mg/dL 60 49.2 41.5 49.3±4.9 60.3 *

40 * 04/02 06/02 08/02 10/02 12/02 02/03 04/03 06/03 08/03 10/03 12/03 02/04 04/04 06/04 08/04

Date of Visit

177 Lane : 1 2 kDa

150

120

100

Figure 5.5 Western blot analysis of plasma from healthy subjects with 2 copies of CFHR3-R1. Fragments were detected at 150, 120, 100, 42 and 39 kDa corresponding to the reported size of CFH, CFHR5, CFHL and CFHR1. Blue arrows indicate fragments corresponding to CFH and CFHR5. Red arrows indicate fragments corresponding to CFHR1 and CFH-L. CFH and antigenically related proteins were detected by using a polyclonal antibody against CFH using chemiluminescence under UV radiation. Abbreviations: M-Protein molecular weight marker; kDa-KiloDaltons

178 Table 5.1 Sample populations, processing applications and groups.

Group Abbreviation N

Thrombosis T 249

Non-thrombosis Non-T 207

SLE S 253

Non-SLE Non-S 203

Recurrent spontaneous abortion RSA 87

Non-recurrent spontaneous abortion Non-RSA 296

Thrombosis only T0 111

SLE only S0 157

SLE with thrombosis TS 96

aPL only NTS 92

179 Table 5.2 Mean plasma CFH levels in female aPL-positive subjects segregated by thrombosis status, SLE status and pregnancy loss.

Group CFH ± SD N p-value

Non-T 52.3 ± 15.0 249 0.056

T 49.9 ± 12.1 207

Non-S 52.9 ± 14.4 203 0.020

S 49.9 ± 13.1 253

Non-RSA 52.1 ± 14.2 296 0.019

RSA 48.8 ± 10.4 87

Abbreviations: Non-T, Non-thrombosis; T, Thrombosis; Non-S, Non-SLE; S, SLE;

Non-RSA, Non-recurrent spontaneous abortion; RSA, Recurrent spontaneous abortion.

180 Table 5.3 Mean CFH protein levels in aPL subjects of Northern European ancestry segregated by thrombosis and SLE status.

Group CFH mg/dL N Compare p-value

T0 50.6±10 55 T0/TS 0.63

TS 49.4±10 46 T0/S0 0.50

S0 49.0±13 59 T0/NTS 0.021

NTS 56.3±16 57 TS/S0 0.88

TS/NTS 0.0075

S0/NTS 0.0026

181

Table 5.4 Mean CFH protein levels in SLE cases and race-matched first-degree relatives

EUA-SLE AFA-SLE Statistics CFH mg/dL N CFH mg/dL N Race Group p-value 1. SLE 63.6 ± 19 236 64.9 ± 21 78 EUA 1 vs 2 0.40 2. Primary 64.5 ± 17 511 64.1 ± 18 105 EUA a vs b 0.30 a. Parents 63.9 ± 18 307 67.0 ± 18 63 AFA 1 vs 2 0.96 b. Siblings 65.4 ± 17 204 59.8 ± 18 42 AFA a vs b 0.06

182 Abbreviations: EUA-European American; AFA-African American

Table 5.5 Genetic effect of rs1061170 on CFH protein levels in OSS cases

African American European American

rs1061170 CFH ± SD N CFH ± SD N

AA 53.6 ±14.8 10 56.9 ±16.1 16

AG 62.7 ±16.1 8 54.6 ±13.0 26

GG 54.8 ±6.3 2 50.6 ± 6.0 6

p-value NS NS

Abbreviations: NS-not significant; SD-standard deviation

183 Table 5.6 Mean plasma CFH protein levels in OSS cases with aPL and thrombosis

Group CFH mg/dL N p-value

All SLE Non-aPL 57.0 ± 14.6 60 0.0215

aPL 47.7 ± 11.4 14

EUA Non-aPL 56.8 ± 14.3 42 0.0199

aPL 46.5 ± 11.3 11

Abbreviations: aPL-antiphospholipid antibodies; EUA-European American

184 Table 5.7 CFH protein levels by CFHR3-R1 copy numbers in OSS cases

AFA EUA

CFHR3-R1 CFH mg/dL N CFH mg/dL N

2 61.3 ± 23 76 60.3 ± 16 188

1 62.8 ± 16 84 62.0 ± 16 91

0 60.2 ± 13 26 61.2 ± 14 13

p-value NS NS

Abbreviations: NS-not significant

185 CHAPTER 6

THE ROLE OF LOW MANNAN BINDING LECTIN IN THROMBOSIS AND SLE

Abstract

Mannan Binding Lectin (MBL) initiates the lectin pathway of complement

activation and functions as an opson to enhance phagocytosis. Promoter polymorphisms and variant alleles in exon 1 affect the level of functional MBL protein in the plasma. Low expression MBL genotypes weakly associate with

Systemic Lupus Erythematosus (SLE), and has been implicated in thrombosis,

and aPL-associated thrombosis. This study investigates the role of MBL in the

context of antiphospholipid antibodies (aPL), SLE, and thrombosis by measuring

functional MBL protein levels in a cohort of aPL positive subjects and SLE cases

and SLE first-degree relatives. Functional MBL plasma protein levels are

significantly reduced among subjects with aPL-associated thrombosis (T0: 0.118

± 0.140 mg/dL) compared to aPL-associated SLE only (S0: 0.173 ± 0.192 mg/dL;

p=0.0046). Subjects with aPL-associated thrombosis and SLE (TS: 0.114 ±

0.128 mg/dL) have significantly less functional MBL protein levels than aPL-

positive subjects with SLE alone (p=0.0041). SLE did not significantly associate

186

with reduced functional MBL protein levels unless in association with thrombosis and aPL. In conclusion, functional MBL protein deficiency is a risk for aPL- associated thrombosis alone or in combination with SLE. The majority of associations between reduced functional MBL protein levels and SLE in past studies likely capture the frequent presence of secondary APS. Low functional

MBL protein levels may be caused by exon 1 allele variants and promoter polymorphisms but the presence of autoantibodies or other mutations cannot be excluded and warrants further investigation.

187

6.1 Introduction

Mannose Binding Lectin (MBL) is a versatile complement protein activator that was originally described for its contribution in defective opsonophagocytosis

(Miller et al. 1968). The opsonic defect was present in 5-8% of healthy populations and resulted from low serum MBL protein levels due to mutant MBL

(Soothill and Harvey 1976; Sumiya et al. 1991; Super et al. 1989). Promoter polymorphisms at -550 and -221 dramatically reduce the expression of MBL protein levels, while variants in the coding sequence of exon 1 generate mutant

MBL that does not form the higher ordered structures necessary to function MBL

(Madsen et al. 1995; Petersen et al. 2001; Super et al. 1989).

MBL initiates the lectin complement pathway by binding MASP-1 and

MASP-2, thereby activating C2 and C4 (Super et al. 1989). MBL recognizes mannan, N-acetylglucosamine, mannosamine, glucose, and fucose (Taylor and

Summerfield 1987) on cell surfaces, facilitating opsonization and phagocytosis

(Kuhlman et al. 1989; Ogden et al. 2001). MBL enhances the phagocytic function of Fc receptors on monocytes and macrophages through C1q receptor binding

(Tenner et al. 1995).

MBL is synthesized predominantly by hepatocytes and monocytes from the MBL2 gene on chromosome 10q11.2-q21 (Sastry et al. 1989). A single MBL polypeptide consists of a cysteine-rich domain, a collagen-like domain, a neck region, and a carbohydrate-binding domain, encoded by separate exons (Taylor et al. 1989). Individual polypeptide MBL subunits form dimeric, trimeric, and

188 tetrameric units (Teillet et al. 2005) that, upon oligomerization, form higher ordered functional protein structures such as the common hexamer of trimers, consisting of 18 polypeptide MBL subunits (Lipscombe et al. 1995; Taylor and

Summerfield 1987). Lower order oligomers have been reported but are unable to activate complement (Lu et al. 1990).

Variant MBL alleles in exon 1 lead to reduced levels of functional protein and mainly consist of 3 SNPs at nucleotide positions 223, 230, and 239. Mutant

MBL containing allele 230-B (G54A; rs1800450) and 239-C (G57E; rs1800541) are reduced in the serum and their failure to oligomerize leads to defective complement activation (Kurata et al. 1993; Lipscombe et al. 1995). Allele 223-D

(R52C; rs5030737) produces an adventitious disulphide bond, reducing the ability of MBL to form higher order oligomers (Wallis and Cheng 1999). Subjects who are heterozygous for a single variant allele have reduced functional MBL protein levels, whereas all homozygous variant and compound heterozygous variant carriers have nearly absent levels of MBL.

Deficiency of MBL influences the immune response increasing susceptibility to infection and autoimmunity such that defective clearance of apoptotic cells results in a pro-inflammatory environment (Fraser et al. 2006;

Kilpatrick 2002; Neth et al. 2001; Peterslund et al. 2001; Roos et al. 2004).

Several studies report associations between MBL deficiency and SLE using variant alleles or low expression MBL genotypes. Initial investigations demonstrate a minor risk of SLE with the presence of variant allele 230-B among

189

Caucasians from Northwest England, Hong Kong Chinese, Japanese and African

Americans (Davies et al. 1995; Lau et al. 1996; Sullivan et al. 1996; Takahashi et

al. 2005) though allele 239-C was stronger in African Americans. Not all studies were able to support a role of variant alleles with an increased risk of SLE (Piao et al. 2007). Whether MBL variants associate with specific manifestations of SLE such as lupus nephritis, dsDNA, or other autoantibodies will require further

investigation (Garred et al. 1999; Piao et al. 2007; Villarreal et al. 2001).

Deficient MBL protein levels have been investigated in hematological

manifestations such as atherosclerosis, chronic heart disease, cardiovascular

disease, chronic renal failure, antiphospholipid syndrome (APS), and vasculitis

(Best et al. 2004; Font et al. 2007; Madsen et al. 1994; Rugonfalvi-Kiss et al.

2002). In 2004, an association between homozygous MBL variants and arterial thrombosis was documented (Ohlenschlaeger et al. 2004), but has not been replicated in subsequent studies. In a multivariate analysis, only APS independently associated with cardiovascular events, whereas SLE did not. This suggests that the higher frequency of thrombotic events in SLE cases with MBL deficient genotypes might be related to coexisting APS (Font et al. 2007).

SLE and APS are inter-related diseases such that one of the criteria for

SLE is the presence of antiphospholipid antibodies (aPL). All APS subjects are

positive for aPL such as lupus anticoagulant (LAC) and anticardiolipin

(aCL)(Lockshin 2006; Lockshin et al. 2000; Weber et al. 2001; Wilson et al.

1999). Subjects with APS also experience thromboses and recurrent

190 spontaneous abortion (RSA) or pregnancy loss. If MBL protein deficiency associates with aPL-thrombosis, then MBL deficiency may also contribute to other characteristics of APS such as RSA. Several studies have found decreased

MBL protein levels in women with RSA, and a negative correlation between functional MBL protein levels and the number of previous miscarriages

(Christiansen et al. 1999; Kilpatrick et al. 1995; Kruse et al. 2002). The decreased MBL protein levels were not due to the pregnancy itself nor from complement activation (Kilpatrick 2000).

Thrombosis is a major contributor to increased morbidity and mortality in

SLE. This occurs at a greater frequency among younger subjects than in the general population (Trager and Ward 2001). Nearly half of SLE cases with LAC or aCL had a history of thrombosis (Love and Santoro 1990). In general, the presence of aPL is thought to increase the risk for SLE with thrombosis by up to

3 times (Kaiser et al. 2009; Toloza et al. 2004). Defining the role of MBL in SLE and thrombosis may identify individuals who are at highest risk of more severe disease manifestations.

Here, the hypothesis that the association between MBL variants and deficiency in SLE are due to coexisting APS in SLE was explored by measuring functional MBL protein levels in subjects with SLE or APS. Reduced MBL protein levels were present in aPL-associated thrombosis and aPL-thrombosis with SLE, but not in SLE or aPL-associated SLE. Phenotypic variation in functional MBL protein levels is likely due to promoter polymorphisms and variant alleles, though

191 the presence of autoantibodies needs to be explored. These results suggest that the association between MBL variant alleles and thrombosis seen in SLE can be attributed to the presence of aPL.

192

6.2 Materials and methods

6.2.1 Study populations aPL positive subjects from APSCORE

Citrate-plasma from 522 subjects with antiphospholipid antibodies (aPL) and clinical status were provided by the APSCORE (Roubey et al. 2004). Platelet poor plasma (PPP) samples were processed with a consistent protocol. Briefly, blood samples in citrate tubes were centrifuged at 1500g for 10 min, 4-8ºC.

Plasma samples were transferred to microcentrifuge tubes and spun again at

2000g for 5 min. Aliquots were kept frozen at -80ºC. There were 237 with a history of thrombosis (T) and 238 subjects did not have thrombosis (Non-T). A total of 293 subjects were diagnosed with SLE (S) and 232 subjects did not have

SLE (Non-S) at the time of recruitment. Additionally, there were 90 subjects with recurrent spontaneous abortion (RSA) and 292 without RSA. Of these, 218 were of Northern European ancestry and analyzed individually. Otherwise no racial segregations were made.

Ohio SLE Study (OSS) cohort

Genomic DNA and EDTA-plasma were prepared by Yu Lab members

(Ms. Bi Zhou, Dr. Erwin Chung, Dr. Yan Yang, Dr. Stephanie Savelli, Dr. Yee

Ling Wu) including 137 subjects that met American College of Rheumatology

(ACR) criteria (Tan et al. 1982) and 231 of their first-degree relatives. These subjects were selected based on the order of collection and enrollment in either

193

a longitudinal SLE study or cross-sectional study. Among the SLE cases, 98

were European American and 39 were African American. First-degree relatives

were mostly European American (N=176). EDTA-plasma was processed at OSU

by spinning for 5 min at 5000 rpm. For genotype-phenotype analysis, subjects

with Lupus-like disease, not yet meeting the ACR criteria, were included. There

were 39 OSS patients were selected based on functional MBL protein levels in

the cross-sectional study and followed longitudinally. Clinical parameters were

provided from patient files.

6.2.2 MBL2 genotyping

The promoter region through exon 1 of MBL2 was genotyped by

sequencing a 1.1-kb segment of genomic DNA following amplification by PCR

(Figure 6.3). The sequence positions of identified SNPs are presented above

corresponding sequence trace illustrating major and minor alleles in homozygous

and heterozygous states when available. The sequence positions reported here

reflect accepted literature nomenclature and consider the first base of exon 1 as

nucleotide position 1. Translation of exon 1 begins at position 70.

Each PCR reaction contained 100 ng of genomic DNA, 40 pg of both a

forward (5’- GCAAGTTTTCTAATTGCCAGTGG-3’) and reverse primer (5’-

GCTGTGTGGAATTCTGAGATGC-3’),appropriate volumes of FailSafe™ PCR

Enzyme Mix and 2x Premix H (EPICENTRE Biotechnologies, Madison, WI,

USA). An initial denaturation step for 2 min at 94°C is followed by 35 cycles of 194 denaturation at 94°C, annealing at 58°C and elongation at 72°C. A final elongation step at 72°C for five min completes the reaction.

The PCR products were sequenced directly using the same primers as in

PCR amplification. In a 10 μL reaction mix, 1 μL of initial PCR product was combined with either the reverse or forward primer utilizing Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and denatured for 3 min at 96°C followed by 25 cycles of 96°C for 15 sec, 50 °C for 10 sec, and 60 °C for 4 min.

The sequencing reactions were purified (Edge Biosystems for single samples, or

Multiscreen HV plate from Millipore with Sephadex ® G-50 superfine, Sigma), analyzed using AB 3130x Genetic Analyzer (Applied Biosystems). The two sequencing reactions provide sense and anti-sense sequence of exon 1 and the promoter region. Sequence traces were imported to DNASTAR Lasergene 7

Seqman application for alignment and SNP discovery. In all cases, the antisense sequence is presented.

6.2.3 Measurement of functional MBL protein levels

Oligomerized MBL was detected from plasma by ELISA using MBL

Mannan-Binding ELISA kit (KIT 030, Antibody Shop) for APSCORE samples and a homemade-modified ELISA for OSS samples. Both assays are considered functional and recognize higher-order oligomerized MBL capable of activating complement through mannan binding. The homemade ELISA uses Wash

195

Solution and Sample Diluent from the MBL kit. Briefly, mannan from S. Cervisiae

(400 ng/well, Sigma) coats 96-well Nunc plate (Denmark) overnight at room temperature. Each subsequent incubation step was carried out at room temperature with shaking followed by washing. Plasma samples were diluted

1:100 in Sample diluent (Antibody Shop) and tested in duplicate against a standard curve, positive, and negative controls. Bound MBL is detected using

100 ug/well of monoclonal anti-mouse MBL antibody (Antibody Shop) and 750 pg of rabbit anti-mouse IgG alkaline phosphatase (Pierce) conjugate. The substrate

PNPP (Pierce) was added and incubated for 45 min at room temperature with shaking. Reactions were stopped by adding NaOH to 0.5M. Spectrophotometric measurements of the optical density were read at 405 nm. Sample concentrations were calculated using the equation derived from the standard curve. Outliers were repeated using appropriate dilutions and any duplicate measures that deviate greater than 10% CV are repeated. This assay allows

MBL concentrations to be meausred over a range of 5.1-5,000 ng/mL.

Concentrations less than 500 ng/mL were deemed MBL deficient.

6.2.4 Statistical analyses

Statistical analyses were performed using JMP v 8.0 (SAS). Protein levels of MBL were analyzed using non-parametric methods as the data could not be transformed so that normal distribution based models could be fit. The functional mean of MBL protein concentrations among T0, TS, S0 and NTS groups were

196

compared using One Way Analysis of Variance (ANOVA) techniques.

Specifically, Tukey HSD test with an alpha set at 0.05 was applied, and was

followed by pairwise Student’s t-tests that yielded the p-values. Regression

analysis was used to determine the effect of multiple variants on nominal clinical

parameters. Only variables with p<0.05 were considered for the final model.

When C3 and C4 were significant, the model with the stronger variable was

used. MBL2 genotypes were in Hardy-Weinberg equilibrium, unless otherwise noted.

Additional declarations: Plasma from aPL-positive subjects were provided

through the APSCORE from Dr. Robert A.S. Roubey. Plasma from OSS samples

were processed by Yu lab members and at the Ohio State University.

Longitudinal OSS samples and related data information including aPL and LAC

status were maintained in an Excel database by OSS coordinators and collaborators. Sequencing was performed by Ms. Huachun Zhong of the

Sequencing Core at The Research Institute at Nationwide Children’s Hospital.

197

6.3 Results

6.3.1 Functional MBL protein levels in an aPL cohort from APSCORE

MBL protein levels were determined in 456 aPL-positive subjects (86.8%) using a functional MBL ELISA kit (described in Methods). For subjects with undetectable functional MBL protein levels, the measurements were repeated to confirm a deficiency. Any sample falling outside the upper limit of detection or not within 10% CV between duplicates was repeated. Due to quality of plasma and avoidance of repeated freeze-thaw cycles, MBL protein levels were not determined in all samples. There were 214 subjects with a history of thrombosis

(T) and 242 subject without thrombosis (Non-T). A total of 252 subjects were diagnosed with SLE (S) and 204 subjects did not have SLE (Non-SLE) at the time of recruitment. Additionally there were 90 subjects with pregnancy loss or recurrent spontaneous abortion (RSA) and 292 without RSA.

MBL protein levels were significantly reduced in aPL- associated thrombosis (0.117 ± 0.129 mg/dL) compared to those without thrombosis (0.167

± 0.173 mg/dL, p=0.0007; Table 6.1). There was a trend for marginally reduced functional MBL protein levels in aPL-associated pregnancy loss (RSA: 0.118 ±

0.133; Non-RSA: 0.150 ± 0.163, p=0.064). No significant differences were detected between aPL-associated SLE and those without SLE. (S: 0.151 ±

0.168; Non-SLE: 0.135 ± 0.140; p=0.285.)

A considerable proportion (i.e., 21.0%) of aPL-positive subjects with SLE also experienced thromboses. To distinguish the role of MBL protein levels in

198

thromboses and SLE, aPL-positive subjects were segregated according to their

clinical presentations: T0, thrombosis only (N=114); TS, thrombosis and SLE

(N=100); S0, SLE only; and NTS, without thrombosis and without SLE (N=90;

Figure 6.1, Table 6.2). Two sets of binary comparisons yielded complementary

information on the patterns of complement and aPL in thrombosis. The first is a

comparison between two groups of non-SLE subjects, T0 and NTS; the second is

a comparison between two groups of SLE subjects, S0 and TS. Subjects with

thrombosis only had marginally reduced MBL protein levels than NTS (0.118 ±

0.140 vs 0.157 ± 0.137 mg/dL; p=0.078). The TS/S0 comparison revealed lower

MBL protein levels in TS than in S0 (0.117 ± 0.115 vs 0.173 ± 0.192 mg/dL;

p=0.0046).

To determine significant parameters for SLE, two separate sets of binary

comparisons yielded complementary information. The first is a comparison

between two non-thrombotic groups S0 and NTS; the second is a comparison

between two thrombotic groups TS and T0. Increased levels of MBL in subjects

with SLE only compared to NTS were not significant (0.173 ± 0.192 vs 0.157 ±

0.137 mg/dL; p=0.416). There was also no difference in MBL protein levels

between TS and T0 (0.117 ± 0.115 vs 0.118 ± 0.140; p=0.945).

Reduced levels of MBL were present in aPL-associated thrombosis only

(T0) and thrombosis and SLE (TS) compared to SLE only (S0; T0/S0: 0.111 ±

0.128 vs 0.182 ± 0.185 mg/dL; p=0.012; TS/S0: 0.114 ± 0.128 vs 0.182 ± 0.185 mg/dL; p=0.023). Differences in MBL protein levels between NTS/T0 and

199

NTS/TS did not reach significance, but were reduced in both cases (NTS/T0:

0.153 ± 0.148 vs .111 ± 0.128 mg/dL; p=0.137; TS/NTS: 0.114 ± 0.128 vs 0.153

± 0.148; p=0.193).

A nominal logistic regression model was employed to determine the

contributions of lower MBL protein levels in the presence of thrombosis and

thrombosis with SLE. In a model of venous thrombosis, significant contributors to

thrombosis status were MBL, gender, C4 and LAC. The odds ratio for MBL was

0.9973. The OR of the range over MBL (0.0593) indicates that the odds of thrombosis increase 16.9 times over the range of MBL protein values (highest to lowest). MBL protein levels were not a significant contributor in models of arterial

thrombosis, SLE, and pregnancy loss (data not shown).

6.3.2 Functional MBL plasma protein levels in the OSS cases

To confirm the role of MBL in SLE or in aPL with SLE, protein levels were

determined in 137 OSS cases and compared to their first-degree relatives. First-

degree relatives share genetic risk components but do not have any history of

autoimmune disease. SLE cases were non-significantly increased compared to

primary relatives (0.100±0.102 vs 0.089±0.098 mg/dL, p=0.182). There were no

differences when segregating the OSS cases and first-degree relatives by race. It

appears that functional MBL protein levels are lower in African American OSS

cases (0.096±0.112 mg/dL) compared to European OSS cases (0.102±0.098).

200

6.3.3 MBL2 promoter and exon 1 variant allele frequency in African and

European American OSS cases

SNP detection

Sequencing based detection of major promoter polymorphisms (-550, -

221, +4) and exon 1 variant alleles (223, 230, 239) enabled the detection of additional novel (+71, +366) and some previously reported SNPs (-427, -245) according to dbSNP (http://www.ncbi.nlm.nih.gov/SNP; Figure 6.2). Results of sequence determination at -550, -221, 223, 230, and 239 for 83 OSS cases are listed in Table 6.3 with functional plasma MBL protein concentrations available for 62 cases. Frequency of alleles at -550, -221, 223, 230, and 239 are presented in Table 6.4 and 6.5 corresponding to European and African American OSS cases.

The major -550 allele C was more frequent in AFA-OSS (0.786) than in

EUA-OSS (0.651). No African American OSS cases had homozygous -550 GG genotypes, whereas 17.0% of European American OSS cases did. There was a reverse trend for -221 such that African American OSS cases had lower frequencies of the major allele than European OSS cases (0.262 vs 0.321). In both races, few cases were homozygous for the minor allele (1 vs 4, respectively).

SNPs at -427 (T to G) and -245 (C to T) have been previously reported as rs11003124 and rs35236971, respectively (Table 6.6). The major allele at -427 is present in 83.6% of subjects examined, of which 79.7% are homozygous.

201

Interestingly, there were more subjects homozygous for the minor allele than heterozygotes (0.125 vs 0.078) and allele frequencies were not in Hardy-Winberg equilibrium (χ2=9.09, p=0.01). The major allele frequency at -245 was 0.953, with a heterozygous frequency of 0.047. No subjects were homozygous for the minor allele. OSS patient 416 was heterozygous for a nonsynonymous A to G nucleotide transition at +71 resulting in a Met to Thr substitution at the start codon of exon 1. Functional MBL protein levels were in the normal range for this patient. Since MBL is secreted, protein levels may not be adversely affected or transcription initiates from the alternative exon 0.

Variant alleles at 223, 230, and 239 are referred to as allele D, B, and C, respectively, and collectively are considered allele O. The major allele is referred to as allele A in all cases. Mutations in D, B, and C results in deficient MBL protein levels, and subjects can be homozygous for a single allele, or compound heterozygous for two variant alleles. Both African American and European

American OSS cases have similar frequencies of variant alleles (0.143 and

0.123, respectively). No D alleles were detected among AFA-OSS whereas it was the most frequent variant allele in EUA-OSS (0.075). Allele C was most frequent among AFA-OSS (0.095). All compound heterozygous cases for variant alleles were European American, though AFA-OSS had more cases with heterozygous variant alleles.

202

MBL genotype and phenotype in OSS

Polymorphic variants in the MBL2 gene promoter region (-550, -221, +4)

and exon 1 variants (223-D, 230-B, and 239-C) were determined in 59 SLE

cases to investigate the role of genetic variants on MBL protein levels (Figure

6.3, Table 6.7). Patient 461 was removed from the data set following analysis

and has a complete MBL deficiency and homozygous -221 GG genotype. There

were significant differences in MBL plasma protein levels among SLE cases with

CC, CG, and GG genotypes at -221 (χ2=6.74, p=0.034; Figure 6.3 A). Highest

MBL protein levels were measured among those with CC genotypes (0.139 ±

0.116 mg/dL). The presence of a single C allele reduced MBL protein levels by

nearly 20% (CG 0.113 ± 0.106 mg/dL). Subjects with homozygous GG alleles had large reductions in MBL plasma protein levels and would be considered functionally deficient (0.024 ± 0.172 mg/dL).

For promoter SNP -550, no significant differences were detected among the different genotypes (χ2=3.69, p=0.158; Figure 6.3 A). There was a trend

such that subjects with CC genotypes had higher functional MBL protein levels than CG and GG genotypes (0.183 ± 0.143, 0.136 ± 0.104, 0.104 ± 0.105 mg/dL,

respectively). The allele at position +4 is part of the mRNA transcript and in

linkage with -338, -335, -327, and -70 SNPs in all subjects examined. No

differences in protein levels were detected among +4 genotypes (GG: 1.115 ±

1.166; GA: 1.168 ± 1.056; AA: 1.760 ± 0.941 mg/dL; χ2=3.27, p=0.195; Figure

6.3 B).

203

To demonstrate the effect of variant alleles in exon 1 on the functional levels of MBL plasma protein, subjects with A/A, A/O, and O/O genotypes were compared and were significantly different (χ2=12.85, p=0.0016; Figure 6.3 B). In the absence of variant alleles, subjects have high levels of MBL protein (1.403 ±

1.145 mg/dL). The addition of a single variant allele reduces the level of functional MBL by 60% (0.560 ± 0.495 mg/dL). No functional MBL protein was detected among individuals with compound heterozygous variant allele genotypes. Of those with single variant alleles, subjects with variant allele D at

223 had higher MBL protein levels (0.632 ± 0.499 mg/dL) than those with either the 239-C allele (0.460 ± 0.665 mg/dL) or the 230-B allele (0.429 mg/dL).

6.3.4 Functional MBL plasma protein levels among longitudinally OSS cases

Functional MBL plasma protein levels were measured longitudinally in 39

OSS cases consisting of 577 patient-visits. Genotype information was available for 37 subjects. Each subject had between 4 and 25 visit numbers. Patient #467 was a compound homozygote for variant alleles B and D and lacked functional

MBL protein on all 10 visits. Among the two OSS cases with unknown MBL genotypes (Patients 407 and 419), mean protein levels of functional MBL were

0.937 ± 0.269 mg/dL (range: 0.437-1.411 mg/dL over 8 visits), and 0.457 ± 0.127 mg/dL (range: 0.240-0.573 mg/dL over 5 visits), respectively. The combined effect of exon 1 variant alleles and low promoter haplotypes at -550 and -221

204

(CG) was present in patient 401, who had concurrent lupus nephritis. Mean functional MBL levels were 0.306 ± 0.054 mg/dL and demonstrated a limited range of protein fluctuation (0.175-0.410) over 25 visits. Three SLE cases

(Patients 441, 409, and 420) were heterozygous for variant alleles (A/D, A/D, and

A/C), with -550, -221 promoter haplotypes of GC/ GC, GC /CC, and GC / CC, and 17, 8, and 23 visits, respectively. Mean MBL protein levels were quite similar

(1.200 ± 0.156, 1.337 ± 0.431, and 1.225 ± 0.208 mg/dL, respectively) and varied by no more than 3-fold between minimum and maximum values over the range.

Patient 408 had homozygous low promoter haplotype and low average MBL protein levels (0.288 ± 0.054 mg/dL), which remained below 0.500 mg/dL at all of the 24 visits.

Two OSS cases demonstrated functional MBL deficiency on every visit, in the absence of exon 1 variants and low expression promoter polymorphisms

(Patients 422 and 445). Both cases share the CG/CC haplotype as deduced from the presence of alleles and linkage. This haplotype was also present in another patient, 417, who demonstrated complete absence of functional MBL on more than one of his/her 24 total visits, despite normal average functional MBL protein levels (0.652 ± 0.322 mg/dL).

The highest mean MBL protein levels were present in patient 435 (CC/

CC) at 4.208 ± 1.501 mg/dL. However, the highest single value for MBL protein levels occurred in patient 473 (6.175 mg/dL). High MBL producers make functional protein levels greater than 3.0 mg/dL or are among the top 20% of

205 maximum average MBL protein levels. Patients 414, 435, 463, 484 were high

MBL producers with 2 to 3-fold fluctuations in MBL protein levels. Other high

MBL producers (patients 404, 421, 457, and 473) had MBL protein level fluctuations ranging from 4 to 25-fold. MBL haplotypes varied among the high

MBL producers and contained both low and high expression promoter alleles. It is noteworthy that the high MBL producers with limited protein fluctuations were homozygous for different haplotypes.

206

6.4 Discussion

Focusing on the role of MBL genetics and protein levels in human subjects with SLE, antiphospholipid antibodies (aPL), and thrombosis the role of reduced

MBL in SLE was found to be limited to a subset of cases with aPL-associated thrombosis. Functional MBL plasma protein levels were determined cross- sectionally in APSCORE and OSS samples, and longitudinally in 39 OSS cases.

Genotyping was performed on OSS cases to correlate genetic and phenotypic variation. Reduced functional MBL protein levels in aPL-positive subjects with thrombosis, irrespective of SLE status, support previous findings that weak MBL associations in SLE are due to coexisting APS (Font et al. 2007).

The results presented here confirm previous speculation in the field regarding MBL variant alleles and arterial thrombosis (Ohlenschlaeger et al.

2004). Subsequent studies failed to replicate the results and noted the elevated frequency of thrombosis among the Danish SLE cases (Bessant et al. 2004;

Calvo-Alen et al. 2006; Font et al. 2007). Additionally, Ohlenschlaeger et al. failed to address the presence or coexistence of aPL in SLE and thrombosis.

Evidence supporting the role of MBL deficiency and venous thrombosis include increased occlusions in venous bypass grafts initiated by thrombosis in subjects with MBL deficiency and IgG-aCL (Limnell et al. 2002). Additionally, MBL gene polymorphisms or MBL-deficient genotypes in SLE cases are found in subjects with other thrombotic risk factors such as LAC and/or IgG-aCL (Font et al. 2007;

Ohlenschlaeger et al. 2004; Seelen et al. 2005).

207

The mechanism whereby MBL deficiency in the presence of aPL contributes to thrombosis is not known. MBL can bind phosphatidylserine, phosphatidylinositol, and phosphatidylcholine in a concentration dependent fashion by way of its carbohydrate recognition domain (Kilpatrick 1998; Yildirim et al. 2001). In the absence of MBL, phospholipids would be exposed and susceptible to aPL binding. This could lead to clinical manifestations of thrombosis and pregnancy loss thrombocytopenia, and fetal loss (Shapiro 1996).

Reduced functional MBL protein levels associate with RSA or recurrent spontaneous abortion (Christiansen et al. 1999; Kilpatrick et al. 1995; Kilpatrick et al. 1999; Kruse et al. 2002). This study was unable to segregate subjects with

RSA by coexisting SLE or thrombosis, due to the small number of subjects with

RSA.. Future efforts would then expand aPL-associated RSA (with/without coexisting SLE and thrombosis) to determine the role of reduced functional MBL protein levels.

Previously, a role for reduced functional MBL protein levels in aPL- associated thrombosis and pregnancy loss has been demonstrated, thus reaffirming and extending the link between complement and coagulation

(Markiewski et al. 2007). However, the role of MBL in coagulation is less resolved. Coagulation requires calcium and phospholipids for the conversions of

Factor X to Xa and prothrombin to thrombin (Hougie et al. 1967; Jackson and

Nemerson 1980; Macfarlane et al. 1964). MBL is also calcium dependent and

208 binds phospholipids (Turner 1996), suggesting the involvement of similar factors in both complement and coagulation.

Because MBL protein levels tightly correlate with exon 1 variant alleles and promoter polymorphisms (Garred et al. 1999; Lipscombe et al. 1995;

Madsen et al. 1995), the genetic risk of these variants is implied based on findings of decreased MBL protein levels. Therefore, this study also demonstrates the relationship between MBL genetic and phenotypic variation.

Three OSS subjects with consistent or intermittent functional MBL deficiency lacked low MBL expression genotypes (compound heterozygotes for either exon

1 variant alleles or compound -221 allele C and a variant allele). Factors other than the standard MBL expression genotypes represented by -550 and -221 promoter polymorphisms and exon 1 variant alleles must also contribute to functional MBL protein levels. Possible explanations for deficient levels of functional MBL are i) consumption due to complement activation, ii) presence of autoantibodies or, iii) undetected MBL2 mutations or polymorphisms.

Persistently low functional MBL protein levels are not likely due to consumption or activation of complement in OSS patient 422 or 445. If MBL were consumed, functional protein levels would return to normal after the triggering event is resolved. There was no evidence of MBL protein levels increasing which would be the case if infection were present as MBL is an acute inflammatory protein (Thiel et al. 1992). However, neither subject displayed variable MBL protein levels as measured by a functional ELISA. Consumption, in response to

209

pathogenic activation of complement may explain the infrequent functional MBL

protein deficiency seen in patient 417.

Several studies have noted difficulties in predicting MBL protein levels

using known MBL expression genotypes (Biezeveld et al. 2003; Eisen and

Minchinton 2003; Kilpatrick 2002). At least 15% of predictive genotypes do not correspond to reported MBL protein levels (Chanock and Taylor 2002; Garred et al. 2003; Madsen et al. 1995; Madsen et al. 1998; Minchinton et al. 2002).

Additional promoter polymorphisms and coding variants may contribute to altered

MBL protein expression (Lee et al. 2005a). The database for SNPs reports 3 additional exon 1 nonsynonymous SNPs (L12V, L12R, C25S); and 3 (V151G,

N176S, N214Y) nonsynonymous SNPs in exon 4 (www.ncbi.nlm.nih.gov/SNP/).

A coding change in the carbohydrate recognition domain of exon 4 could adversely affect the functional MBL ELISA used for detection.

Detection of decreased levels of functional MBL protein in the absence of low expression genotypes could be due to the presence of autoantibodies against MBL. When only functional MBL protein levels are measured, it is possible that the presence of autoantibody would inhibit MBL binding to substrate resulting in low MBL protein levels. Antibodies against MBL have been reported previously (Gupta et al. 2006; Seelen et al. 2003; Seelen et al. 2005). The presence of anti-MBL autoantibodies is unknown in SLE, about 60% in rheumatoid arthritis and less than 2% among healthy controls lacking inflammatory autoimmune disease (Gupta et al. 2006). Anti-MBL autoantibodies

210

are commonly found in subjects lacking variant alleles and adversely affect

complement activation (Seelen et al. 2003; Seelen et al. 2005). This suggests

that despite normal expression genotypes, MBL function can be impaired or regulated adversely. It is unclear whether antibodies against MBL are present persistently or intermittently. In the case of functionally low MBL protein levels, it will be important to determine whether autoantibodies directed against MBL interfere with the ELISA, thereby causing the observed functional deficiency.

In summary, these results demonstrate an association between reduced

MBL protein levels and thrombosis in aPL subjects, irrespective of SLE status.

This study is the first to investigate and report functional MBL protein levels in a

cohort of aPL subjects to resolve the role of MBL in SLE and thrombosis by

avoiding ambiguity with genotype classification. It is likely that low functional MBL

protein levels are caused by exon 1 allele variants and promoter polymorphisms

but the presence of autoantibodies or other mutations cannot be excluded and

should be resolved by further genotyping. Expanding the aPL cohort with

recurrent spontaneous abortion would allow further segregation to account for

the role of thrombosis and SLE. Additionally, future efforts would involve

genotyping more SLE cases and expanding the region to include all coding

sequence of MBL2. In addition to measuring function MBL protein levels, patients

with low expression should be examined for the presence of variant alleles,

polymorphisms, and anti-MBL autoantibodies. In conclusion, functional MBL

protein deficiency is a risk for aPL-associated thrombosis and the majority of

211 associations with SLE in past studies likely represent SLE cases with coexisting

APS.

212

P=0.42 P=0.076 P=0.0046

P=0.078 P=0.0041 P=0.94

0.11 MBL mg/dL 0.011

0.0011

TS T0 S0 NTS

[MBL] 0.12±0.14 0.12±0.12 0.17±0.19 0.16±0.14

N 100 114 152 90

Figure 6.1 Mean functional MBL plasma protein levels in APSCORE subjects with SLE and thrombosis. Mean CFH protein levels were determined by Radial

Immunodiffusion in aPL positive subjects with thrombosis only (T0), SLE only

(S0), thrombosis and SLE (TS), and neither thrombosis nor SLE (NTS).

213

Figure 6.2 Schematic depiction of MBL2 genotyping by PCR amplification followed by sequencing. Forward and reverse directional primers for both PCR and sequencing are indicated in red and amplify/sequence a 1.1-kb of genomic

DNA encompassing the promoter regions through intron 1. Novel and previously reported SNPs are listed by published nucleotide positions with corresponding sequence trace(s) for the antisense strand of DNA. The consensus sequence is based on genotyping results of all OSS cases. Promoter polymorphisms and exon 1 variant alleles associated with functional MBL protein levels are indicated in bold; all other SNPs are indicated in gray. Sequence is based on antisense strand of DNA.

Abbreviations: K, G or T (keto); R, A or G (purine); S, C or G (strong); Y, C or T

(pyrimidine).

214

Figure 6.2

Consensus A G A A T TTT C A T G G T C C C G C C G

A G A A T TC C G C C G

A S A A K T T Y C A Y G G Y C C Y G C S G

A C A A G T C G G -550 -427 -338 -335 -327 -245 -221

Exon 1

-70 4 71 223 230 239 366

Consensus G G GC G A C A T C G C A C T A C C G T C C T T C C C T A C A

G GGAGGC A C T C C A C T A C C G T C C T T C CCC T A A

G RRRRG C A C T G C A C T A C Y G T C Y T T C CCY T A A

G A G C A AC G C A C T A C Y G T C C T T C CYT T A A

215

A. χ2 = 3.3 χ2 = 6.7 P = NS P = 0.034

[MBL] 0.18±0.14 0.14±0.12 0.09±0.09 0.14±0.12 0.11±0.10 0.02±0.02 N 7 21 34 30 27 5 1

0.1

0.01 GG GC CC GG GC CC

-221 -550

B. χ2 = 3.3 χ2 = 12.8 P = NS P = 0.0016

[MBL] 0.11±0.12 0.12±0.11 0.18±0.19 0.14±0.11 0.06±0.05 0.0 N 33 24 5 49 10 3

0.1

0.01

0.001 MBL mg/dL

0.0001

CC CT TT A/A A/O O/O

+4Exon1

Figure 6.3 Effects of -550, -221, +4, and variant alleles on mean functional MBL plasma protein levels in OSS cases. Patient 461 has been removed from panel A and has -550 CC, -221 GG genotype and MBL deficiency.

216

Table 6.1 Mean functional MBL plasma protein levels in APSCORE subjects with aPL.

Group MBL (mg/dL) N p-value

Non-T 0.167 ± 0.173 242 0.0007

T 0.117 ± 0.129 214

Non-S 0.135 ± 0.140 204 0.285

S 0.151 ± 0.168 252

Non-RSA 0.150 ± 0.163 292 0.064

RSA 0.118 ± 0.133 90

Abbreviations: Non-T: Non-thrombosis; T: Thrombosis; Non-S: Non-SLE; S: SLE;

Non-RSA: Non-recurrent spontaneous abortion; RSA: Recurrent spontaneous abortion

217

Table 6.2 Mean functional MBL plasma protein levels in APSCORE subjects with aPL categorized by SLE and thrombosis.

Group MBL (mg/dL) N Groups p

T0 0.118 ± 0.140 114 T0 vs TS 0.945

TS 0.117 ± 0.115 100 T0 vs S0 0.0041

S0 0.173 ± 0.192 152 T0 vs NTS 0.078

NTS 0.157 ± 0.137 90 TS vs S0 0.0046

TS vs NTS 0.076

S0 vs NTS 0.416

Abbreviations: T0: Thrombosis only; TS: Thrombosis and SLE; S0: SLE only;

NTS: Non-thrombosis and non-SLE

218

Table 6.3 MBL2 genotypes and functional MBL protein levels in OSS cases

ID Genotype (Diploid) MBL -550 -221 +4 223 230 239 Variant mg/dL G to C G to C C to T C to T G to A G to A A to O 401 GC CG CC CT GG GG AO 306 402 GC CC CT CC GG GG AA 1508 403 GC CG CC CC GG GG AA 1057 404 GC CG CC CC GG GG AA 2284 405 CC CG CT CC GG GG AA 1000 406 GC CC CT CC GG GA AO 408 CC GG CC CC GG GG AA 301 409 GC CC CC CT GG GG AO 1337 410 CC CG CT CC GG GG AA 859 412 GC CC CC CT AG GG OO 0 414 GG CC CC CC GG GG AA 3908 415 GC CG CC CC GG GG AA 1002 416 CC CG CT CC GG GG AA 1344 417 CC CG CT CC GG GG AA 652 420 GC CC CT CC GG GA AO 1225 421 GC CG CT CC GG GG AA 3625 422 CC CG CT CC GG GG AA 112 423 CC CC CT CC GG GG AA 698 425 GC CC CT CC GG GG AA 427 CC CC CT CC GG GG AA 117 428 GG CC CC CT GG GG AO 314 429 GC CC CT CC GG GG AA 315 430 GC CG CC CC GG GG AA 215 431 CC CG CC CC GG GG AA 949 432 CC CC CC CC GG GG AA 1386

Continued 219

Table 6.3 continued

ID Genotype (Diploid) MBL -550 -221 +4 223 230 239 Variant mg/dL G to C G to C C to T C to T G to A G to A A to O 433 CC CC CT CC GG GA AO 1415 435 CC CC CC CC GG GG AA 4208 437 GC CC CT CC GG GA AO 439 GC CG CC CT GG GG AO 441 GG CC CC CT GG GG AO 1200 442 CC CC TT CC GG GA AO 444 CC CG CT CC GG GG AA 445 CC CG CT CC GG GA AO 15 446 GC CG CC CC GG GG AA 260 447 GG CC CC CT GG GG AO 449 CC CG CC CC GG GG AA 450 CC CG CC CC GG GG AA 451 GC CC CT CC GG GG AA 452 GC CG CC CC GG GG AA 453 CC CG CT CC GG GG AA 391 454 CC CG CC CT GG GG AO 216 456 CC GG CC CC GG GG AA 150 457 CC CG CT CC GG GG AA 3180 458 CC CC CC CC AA GG OO 461 CC GG CC CC GG GG AA 0 463 GG CC CC CC GG GG AA 3331 464 CC CC TT CC GG GG AA 913 465 CC CG CC CC GG GG AA 123 467 GC CC CC CT AG GG OO 0

Continued 220

Table 6.3 continued

ID Genotype (Diploid) MBL -550 -221 +4 223 230 239 Variant mg/dL G to C G to C C to T C to T G to A G to A A to O 468 CC CC CT CC AG GA OO 0 469 CC CG CT CC GG GG AA 957 470 CC CC CC CC GA GG AO 429 471 CC CG CC CC GG GG AA 3234 472 CC CC TT CC GG GG AA 1514 473 GC CG CT CC GG GG AA 3337 474 GC CC CT CC GG GG AA 2701 475 GG CC CC CC GG GG AA 375 476 GC CC CC CC GG GG AA 1637 477 CC GG CC CC GG GG AA 436 478 GC CC TT CC GG GG AA 1729 480 CC CG CT CC GG GG AA 1062 482 CC CG CT CC GG GG AA 1088 483 GC CG CC CT GG GG AO 417 484 CC CC TT CC GG GG AA 3354 485 CC GG CC CC GG GG AA 342 486 GG CC CC CC GG GG AA 1214 491 GC CG CC CC GG GG AA 707 494 GC CC CC CC GG GG AA 1575 496 GG CC CC CC GG GG AA 2502 497 CC CC CT CC GG GG AA 498 CC CG CT CC GG GG AA 1438 499 GC CC CC CC GG GG AA 1384 500 CC CC CT CC GG GG AA 1540

Continued 221

Table 6.3 continued

ID Genotype (Diploid) MBL -550 -221 +4 223 230 239 Variant mg/dL G to C G to C C to T C to T G to A G to A A to O 902 CC CC TT CC GG GG AA 1288 904 GC CG CC CC GG GG AA 905 GC CC CC CT GG GG AO 906 GC CC CC CC GA GG AO 907 GC CC CT CC GG GG AA 908 GG CC CC TT GG GG OO 909 CC CG CT CC GG GG AA 738 910 GC CC CT CC GG GG AA 911 CC CG CT CC GG GG AA 916 CC CG CT CC GG GG AA

Nucleotide positions correspond to those previously published. Variant allele O represents minor alleles at 223, 230, or 239, whereas allele A represents the major allele.

222

Table 6.4 MBL2 polymorphisms among European American OSS cases

MBL2 position -550 -221 Exon 1 Exon 1 Nucleotide change G to C G to C 52, 54, 57 52, 54, 57 N Freq N Freq N Freq N Freq Major Homozygous 9 0.170 23 0.434 42 0.792 Allele D 8 0.075 Heterozygous 19 0.358 26 0.491 9 0.170 Allele B 1 0.009 Minor Homozygous 25 0.472 4 0.075 2 0.038 Allele C 2 0.019 Total N 53 53 53

223 Major Allelic 0.651 0.321 0.877 Minor Allelic 0.349 0.679 0.123

Nucleotides are indicated in italics. Exon 1 variant alleles collectively referred to as O correspond to 52-D, 54-B, and 57-C. Abbreviations: Freq-frequency

2 0.019 2 0.019 8 0.075 8 0.075 1 0.009 52, 54, 57 52, 54, 57 Allele C C Allele Allele D D Allele B Allele Exon 1 52, 54, 57 52, 54, 57 Exon 1

C alleles collectively referred to as O correspond to to to as O correspond referred collectively alleles G to -221 C -550 -550 G to 0.651 0.321 0.877 0.651 0.877 0.321 0.349 0.123 0.679 9 0.170 23 0.434 42 0.792 0.792 42 0.434 23 9 0.170 53 53 53 25 0.472 4 0.075 2 0.038 25 0.472 0.038 2 4 0.075 19 0.358 26 0.491 9 0.170 0.170 9 0.491 26 0.358 19 polymorphisms among American European cases OSS Total N N Freq N Freq N Freq N Freq N Freq N Freq N Freq N MBL2 position BL2 Major Allelic Allelic Major Minor Allelic Allelic Minor Heterozygous Heterozygous M Nucleotide change change Nucleotide Major Homozygous Major Minor Homozygous

Table 6.5 6.5 Table Nucleotides indicated are in Exon italics. 1 variant 54-B, 52-D, and 57-C. Abbreviations: Freq-frequency

224

Table 6.6 MBL2 polymorphisms among African American OSS cases

MBL2 position -550 -221 Exon 1 Exon 1 Nucleotide change G to C G to C 52, 54, 57 52, 54, 57 N Freq N Freq N Freq N Freq Major Homozygous 0 0.000 11 0.524 15 0.714 Allele D 0 0.000 Heterozygous 9 0.429 9 0.429 6 0.286 Allele B 1 0.024 Minor Homozygous 12 0.571 1 0.048 0 0.000 Allele C 4 0.095 Total N 21 21 21

225 Major Allelic 0.786 0.262 0.857 Minor Allelic 0.214 0.738 0.143

Nucleotides are indicated in italics. Exon 1 variant alleles collectively referred to as O correspond to 52-D, 54-B, and 57-C. Abbreviations: Freq-frequency

Table 6.7 Mean functional MBL plasma protein levels among OSS cases by

MBL2 genotype.

MBL (mg/dL) SD N χ2 p-value -550 CC 0.183 0.143 7 3.31 0.1910 CG 0.127 0.104 21 GG 0.100 0.105 34 -221 GG 0.139 0.116 30 6.735 0.0345 GC 0.113 0.106 27 CC 0.024 0.172 5 +4 CC 1.115 1.166 33 3.27 0.1952 CT 1.168 1.056 24 TT 1.760 0.941 5 Variant A/A 1.403 1.145 49 12.85 0.0016 A/O 0.560 0.495 10 O/O 0.000 0.000 3 A/A 0.139 0.114 49 13.07 0.0227 A/B 0.429 1 A/C 0.46 0.665 3 A/D 0.632 0.499 6 B/C 0.000 1 B/D 0.000 0.000 2

Allele O collectively refers to minor alleles at 223 (D), 230 (B), or 239 (C).

Abbreviations: NS, Not significant

226

CHAPTER 7

DISCUSSION

This work addresses the quantitative and qualitative variation of

Complement Factor H and Mannan Binding Lectin in disease susceptibility, disease severity, and racial disparity in Age Related Macular Degeneration,

Systemic Lupus Erythematosus, and Antiphospholipid Syndrome. Table 7.1 summarizes the results which support a role for complement variants in systemic and vascular immune-mediated diseases.

Genetic structural variation of CFHR3 and CFHR1 is referred to as a copy number variant, and describes deletion of CFHR3-R1 (Hughes et al. 2006).

Subsequent reports then include terms such as large, common deletion

(Hageman et al. 2006), chromosomal deletion (Zipfel et al. 2007), or ‘deletion’

(Dahl et al. 2001; Dragon-Durey et al. 2009; Spencer et al. 2008). The presence of CFHR3-R1 varies among all populations, and the deficiency frequency exceeds 1% in all populations examined, making this region a structural polymorphism more appropriately termed a copy number polymorphism or CNP

(Feuk et al. 2006). Specifically, CFHR3-R1 belongs to the subset of CNPs called copy number variants (CNVs) because of its association with disease and commonality among healthy subjects.

227

7.1 Complement in AMD

AMD is described as having a complement mediated pathology due to the presence of complement activation fragments in drusen (Hageman et al. 1999;

Johnson et al. 2000). Genetic studies have demonstrated associations between the classical/lectin and alternative pathways of complement activation (Edwards et al. 2005; Gold et al. 2006; Haines et al. 2005; Klein et al. 2005). A murine model of laser induced choroid neovascularization demonstrated no role for either the lectin or classical pathway concluding that choroid neovascularization is mediated through alternative pathway activity (Bora et al. 2006). To date there are no clear mediators initiating the development of geographic atrophy versus neovascular AMD. The natural progression of AMD from early to late stages begins with the presence of drusen associating with development of geographic atrophy (Jager et al. 2008; Sarks 1976).

A small subset of AMD patients develops new vessels or hemorrhages termed choroid neovascularization. The mechanism for this distinction is unknown but suggests different etiologies leading to diverse outcomes in AMD.

Deficiency of CFHR3-R1 likely results in the default AMD phenotype of geographic atrophy, whereas increased copy numbers specify, in part, neovascular-AMD. Along this line of reasoning then increased C4 copy numbers contributed to an overall increased risk of AMD but not specifically neovascularization. This is supported by evidence of increased C4 copy numbers

228 in late stage geographic atrophy and neovascularized AMD, with significant enhancement of the geographic AMD form.

The results presented support an association between increased copy numbers of C4 and CFHR3-R1 in geographic atrophy and neovascularized AMD, but do not explain their role in AMD development and progression. A working hypothesis is that when complement is normally activated at times of ocular defense additional C4 could result in excessive fragment deposition mediating complement damage to bystander cells, thus initiating AMD. Accumulation of complement products and excessive activation would accumulate and manifest as drusen leading to geographic atrophy at later stages of life. Increased CFHR3-

R1 may antagonize normal CFH function, act synergistically with CFH, or perform independently of CFH (Jozsi and Zipfel 2008). The mechanism by which this occurs is unknown. Little has been reported regarding the function of CFHR1 except that it likely perturbs C5 binding and convertase formation (Heinen et al.

2009). CFHR3 binds C3b and C3d but has limited decay acceleration and can only function as a cofactor for CFI in the presence of CFH (Hellwage et al. 1999).

Increased copy numbers of CFHR3-R1 in combination with other CFH mutations and polymorphisms affecting the functional activity of CFH could lead to additional complement activation and more severe AMD.

One final discussion point on the role of increased complement CFHR3-

R1 and C4 in AMD is the disease does not manifest until much later in life. The role of increased CFHR3-R1 and C4 copy numbers in AMD may be inflated until

229 other genetic and environmental factors are considered in this study. Decreased complement may place individuals at a stronger disposition for diseases associated with greater mortality and earlier onset (Blasko et al. 2008) by increasing their susceptibility to infectious agents. This would preclude them from late-stage AMD.

230

7.2 Complement in autoimmunity

7.2.1 Complement genetic variation and disease risk

The next section pertaining to chapters 4-6 develops the role of genetic risk factors and protein markers in autoimmunity, focusing on the role of the CFH gene region and MBL2 in Systemic Lupus Erythematosus and Antiphospholipid syndrome (APS). The relationship between SLE, thrombosis, and aPL is investigated at the genotypic and phenotypic levels, though not always associating the two. These chapters cover major concerns in SLE leading to greater severity of disease affecting morbidity and mortality.

The greater associated prevalence and disease severity in African

American SLE compared to European American SLE suggests differences in genetics may influence disease susceptibility and manifestations (Lau et al.

2006; Mori et al. 2005; Stefansson et al. 2005). The Major Histocompatibility

Complex (MHC) was recently found as the greatest risk for SLE in a meta- analysis of linkage screenings (Forabosco et al. 2006). However, its contribution to the total genetic risk for SLE is unknown. Based on multiple studies and the heterogenic phenotype of disease manifestations, the genetic risk for SLE is complex and the result of multiple genes or gene regions (Arnett 1997; Sestak et al. 2007). Risk haplotypes of the HLA with DR3 and DR2 are prominent among

SLE cases of European ancestries, but inconsistent in other races (Azizah et al.

2001; Logar et al. 2002; Miyagawa et al. 1998; Weyand et al. 1995). Loci

231 associated with SLE are well described among populations of European ancestry but fail to explain or [at times] contribute to African American SLE (Molokhia and

McKeigue 2006; Pons-Estel et al. 2009).

The role of CFHR3 and CFHR1 in complement regulation is largely unknown. It has been hypothesized that related proteins could antagonize CFH function, synergize with CFH function, or perform independent functions CFH. All related proteins lack regulatory domains and have limited binding sites compared to full-length CFH. Protein expression studies suggest they are present at very small concentrations and are found in association with triglyceride-rich lipoproteins (Jozsi et al. 2005; McRae et al. 2005; Skerka et al. 1997). The effects of the related proteins on systemic and local CFH expression is also unknown and needs addressed in future studies.

Variability of CFHR3-R1 copy numbers among healthy subjects of African,

European, Asian, and Asian Indian ancestries hinted at a possible role in SLE.

There were significantly different copy numbers of CFHR3-R1 in African

American and European American SLE cases compared to race-matched controls. This novel finding demonstrated a stronger increased associated risk of decreased copy numbers of CFHR3-R1 among African American SLE than in

European American SLE. This represents one of the first genetic risk factors for

SLE with a greater association and role in African Americans. An alternative splice variant in IRF5 associating with SLE was originally describe in a European population, but was later found to associate with increased risk of SLE in African 232

Americans (Graham et al. 2006; Kelly et al. 2008) but does not explain the increased disease susceptibility and severity.

The significance of this finding among a small sample size of African

American SLE cases eclipses that found among European American SLE cases, which only had a marginal association with SLE. Reduced copies of CHFR3-R1 demonstrated a greater effect size in African American SLE than European

American SLE. There was also an increasing risk dosage effect in African

American SLE, which was not present among European American SLE. Instead, reduction of CFHR3-R1 by one copy in European Americans associated with increased risk of SLE, whereas a complete deficiency of CFHR3-R1 had a neutral effect on disease. It is puzzling that the homozygous deficiency did not contribute to a greater risk in European American SLE. More homozygous deficiencies among SLE cases and controls would be detected by increasing the sample size, at the cost of unrealistic sample numbers. In this case, homogenizing the European American SLE cohort may be beneficial but would also be limited by sample sizes.

The data supports a protective effect against SLE for European American subjects with 2 copies of CFHR3-R1, but this was not significant in African

Americans. The significant reduction of CFHR3-R1 copy numbers in African

American SLE and increasing dosage effect of the gene copy number needs replicated in additional populations. The sample size and heterogeneity of the

African American SLE cohort may limit the results of CFHR3-R1 copy numbers. 233

In larger sample sizes, more homogenous cohorts could be investigated to determine the overall effect of variation in the CFH gene region.

The differences in associated risk of decreased CFHR3-R1 demonstrates the variable risk attributed to a common genetic variant among multiple races

(Fernando et al. 2008). The dosage effect of increased risk of heterozygous to homozygous CFHR3-R1 deficiency in African American SLE would demonstrate the difference between limited functional capacities (one copy) versus no function. However, there is a dominant effect of CFHR3-R1 in European

American SLE. The lack of a dose dependent risk increase in European

Americans suggests that the presence of a single copy of CFHR3-R1 alone is sufficient to increase the susceptibility. This is also demonstrated in the association between DRB1 **0301 and SLE among Caucasian populations

(Fernando et al. 2007). The risk for SLE did not increase with an increased presence of the risk haplotype. In this case, the authors describe the presence of one copy as being sufficient for the presentation of autoantigen to stimulate the immune response, whereas in its absence this would not be possible.

One possible role for CFHR3 and CFHR1 deficiency contributing to SLE is if they function in concert with CFH. Both CFHR3 and CFHR1 can bind C3b and

C5b, respectively and in concert with CFH prevent complement activation on cellular surfaces (Hellwage et al. 2002; Hellwage et al. 1999; Jokiranta et al.

2000; McRae et al. 2005). Their presence then could limit the amount local complement activation such that CFH and other surface regulators may not be 234 able to compensate for this loss of function. The effect is exaggerated greatly in

African American SLE.

A likely explanation is the absence or presence of other genetic risk factors occurring on a wider risk haplotype for SLE. In the case of DRB1 *0301, there is an increased risk for subjects who are compound heterozygous for DRB1

*0301 and *1501 in SLE (Graham et al. 2002; McHugh et al. 2006). It is possible that other genetic factors act in concert with CFHR3-R1 in European American

SLE, which is not necessarily present or contributing to African American SLE.

One mechanism by which this could occur is the occlusion of the 402H homozygous risk in subjects with a deficiency of CFHR3-R1. Although, the

European American sample size is relatively large, there may not be enough power to detect minor differences in frequency of the CFHR3-R1 among

European American SLE populations. The frequency of CFHR3-R1 homozygous deficiency in African Americans with SLE is 4 times that seen in European

American SLE, which may reflect upon the ability to detect a difference.

7.2.2 Complement and disease

Genetic influences on functional MBL protein levels such as variant alleles and promoter polymorphisms associate weakly and with variability in SLE among multiple races. The persistence of associating MBL variants with SLE or manifestations of SLE could be due to a confounding effect. It was suggested 235

that coexisting or secondary APS by be involved. The role of the CFH gene

region in SLE had not been investigated previously, despite its regulatory role on

C3 activation. Reduced CFH protein levels and genetic polymorphisms contribute

to hematologic and renal-based diseased diseases such as atypical Hemolytic

Uremic Syndrome (aHUS), Membranoproliferative Glomerulonephritis (MPGN II),

and to a lesser degree Idiopathic Thrombocytopenia Purpura (ITP) syndrome

(Ault et al. 1997; Caprioli et al. 2001; Dragon-Durey et al. 2004; Ohali et al. 2005;

Pickering et al. 2002; Pickering et al. 2007; Saunders et al. 2007; Saunders et al.

2006; Thompson and Winterborn 1981; Venables et al. 2006; Vogt et al. 1995;

Warwicker et al. 1998; Zipfel et al. 2007). Manifestations of these diseases overlap with major clinical criteria of both SLE and APS.

Neither CFH nor MBL protein levels were significantly reduced in SLE cases compared to their first-degree relatives. In fact, even among SLE cases with aPL there were no differences in MBL protein levels. However, MBL was reduced in aPL-associated thrombosis and aPL-associated SLE with thrombosis.

CFH on the other hand appears to be reduced in the presence of aPL-associated

SLE and marginally in aPL-associated thrombosis. When examined among SLE cases, thrombosis and largely, aPL-thrombosis associated with decreased CFH protein levels. In both SLE and SLE with coexisting APS, the effect of aPL- associated SLE with thrombosis resulted in a greater reduction of CFH protein levels. Decreased CFH and MBL were present in aPL-associated pregnancy loss. Reduced levels of MBL and CFH may be a relevant diagnostic marker for

236 thrombosis among the subset of SLE cases with aPL and among SLE cases with coexisting APS.

237

7.3 Complement proteins and the coagulation pathways

Results presented here demonstrate the association between complement and coagulation which have overlapping similarities and functional roles

(Markiewski et al. 2007). Both the coagulation and complement cascades consist of circulating protein proteases that initiate sequences of pathway activity (Krem and Di Cera 2002). Complement and coagulation play essential roles during times of inflammation to maintain and stabilize the injury or insult (Esmon 2003;

Nathan 2002). Complement activation induces a procoagulant state through platelet activation, phospholipid modification, and increasing Tissue Factor (TF) exposure and expression (Esmon 2003; Markiewski et al. 2007; Wojta et al.

2003; Wojta et al. 2002).

Complement components with direct roles include: C3a in activating platelets and promoting aggregation (Polley and Nachman 1983); the Membrane

Attack Complex (MAC, C5b-C9) to expose phospholipids such as

Phosphatidylserine (Sims et al. 1988; Zwaal et al. 1989); C5a and C5b to activate endothelial cells inducing adhesion molecule and TF expression (Ikeda et al. 1997; Muhlfelder et al. 1979; Tedesco et al. 1997); C5a in conjunction with anti-endothelial cell antibody to induce heparin sulfate shedding from endothelial cells (Platt et al. 1991). Under normal conditions, heparin sulfate maintains an anticoagulant environment by localizing anti-thrombin III that inhibits the generation of thrombin (Marcum et al. 1986). A shared factor to both coagulation and complement is Protein S. When bound to C4b Binding Protein (C4BP) the 238

amount of free Protein S able to serve as a cofactor for degrading Va and VIIIa

through Protein C cofactor activity decreases (Rezende et al. 2004). Within the

coagulation cascade, thrombin can activate complement C5 in the absence of C3

(Huber-Lang et al. 2006). The question remains where MBL and CFH fit into this

process.

CFH contains a binding site for heparin in SCR 7. At times of complement

activation, CFH can limit the amount of activated C3 and bind to endothelial cell

heparin sulfate. Reduced CFH can lead to additional C3 activation resulting in a

procoagulant factors. Lack of CFH protection of cellular surfaces such as the endothelium could result in complement mediated damage furthering triggering activation of procoagulant states. The exposed phospholipid layer could be recognized by aPL contributing to thrombosis. MBL has the ability to bind to

phospholipids, specifically phosphatidylserine which is an important key

component of coagulation (Kilpatrick 1998; Zwaal et al. 1989). MBL binding to

phospholipids likely promotes an anticoagulant state such that aPL competition

for phospholipid binding results in complement-mediated damage to the

endothelium and a procoagulant state.

In explaining the role of reduced MBL and CFH in aPL-associated thrombosis and aPL-associated SLE with thrombosis, an important role of the cellular surface was exhibited. The endothelium promotes hemostasis and can serve as the activating surface for either coagulation or complement. The kidney is a vascular organ with specialized membranes and structures. Reduced protein 239 levels of both CFH and MBL were present in at least one class of lupus nephritis.

There was a trend toward reduced MBL protein levels in mesangial lupus nephritis, whereas reduced CFH protein levels were significant in focal proliferative glomerulonephritis. Reduced MBL likely contributes to complement dysfunction. Loss of CFH would leave the glomerular membrane exposed for complement mediated damage as demonstrated in both aHUS and MPGN II

(Nielsen et al. 1989; Pickering and Cook 2008; Pickering et al. 2002; Pickering et al. 2007; Thompson and Winterborn 1981).

240

7.4 Future Work

This work investigated the role of complement genetic and phenotypic

variants in ocular, hematological, and renal manifestations of disease. Future

work would first address the major limitations of this study, namely, sample size,

DNA quantity and quality, and sample characterization. Though the SLE study

was able to demonstrate a significant dose-dependent effect of CFHR3-R1 in

African Americans, this was not the case in European American SLE. Whether

the sample size was too small or if race classifications were too broad is

unknown. These could lead to spurious associations or failure to detect a

difference when one is present. Future studies would extend both the European

American and African American SLE cohorts, confirm the results in an

independent cohort, and acquire Asian SLE cases and controls. This would elucidate the role of low copy numbers of CFHR3-R1attributing to SLE disease

susceptibility and prevalence.

To date, no phenotypic difference in total CFH protein levels has been

appreciably determined for CFHR3-R1 deficiency. Using antibodies against the

proteins, Western blot demonstrates the absence of CFHR3 or CFHR1, but fails

to quantify the difference between one and two copies of the genes. Several

major limitations hinder the process of detecting CFHR3 and CFHR1. First, no

antibody is specific for a single related protein that does not also recognize full

length CFH. The low levels of circulating CFH related proteins (CFHRs) require

immunoprecipitation prior to detect on Western blots. Determining a method to 241

quantify the difference of these proteins is challenging. It is not currently known

whether any or all of the CFHRs fluctuate in response to different stimuli or if

protein levels are relatively static. The total contribution of all CFHRs on total

CFH concentration and function has not been demonstrated. Some authors

suggest that because the related proteins lack regulatory domains, they function

in a limited capacity either obstructing CFH regulation of complement or promoting cofactor activity (Jozsi and Zipfel 2008).

Therefore, future efforts investigating the interaction between CFH and

CFHRs would be useful in explaining the risk associated with increased copy numbers in AMD and decreased copy numbers in SLE and aHUS (Dragon-Durey et al. 2009; Hageman et al. 2006; Hughes et al. 2006; Hughes et al. 2007;

Spencer et al. 2008; Zipfel et al. 2007). It is then proposed that relative expression of the related proteins can be quantified using real-time PCR at the mRNA level. The common amplicons designed to detect CFHR1 and CFHR2 or

CFHR3 and CFHR4 can be used as designed (or improved to exclude CFHR2 and CFHR4) changing the template from genomic DNA to mRNA. This would allow direct detection of the related proteins and the difference in expression of one or two copies of CFHR3-R1 can finally be resolved.

Extended sample sizes and better classification of disease manifestations would improve the study of CFH and MBL in aPL-associated disease states and lupus nephritis. When investigating individual manifestations such as thrombosis, SLE, pregnancy loss, and SLE with thrombosis in the aPL cohort, 242 sample sizes were reduced making clear trends more difficult to assess. Missing information among the SLE cohort prevented thorough investigation of aPL status, thrombosis, and lupus nephritis categorization. There were a large number of European American samples where lupus nephritis was indicated and no further classification was described. This makes it extremely difficult to determine the role of CFH and MBL in specific types of renal disease. This could identify subjects at a greater risk of severe complications and dictate an improved treatment option. Some data was only present in the longitudinally examined SLE cases such as aPL status and thrombosis. It would be relevant to determine the change in CFH or MBL protein levels before, during, and after times of thrombosis. This would enable the determination of whether reduced protein levels contribute to an overall risk or are a precipitating event. If reduced

MBL or CFH are present consistently in subjects with aPL-associated thrombosis, then infusion of these protein(s) may afford additional protection.

The AMD cohort needs expanded in future studies and compared to a correctly age-matched control group to determine the effect of the alternative and classical pathways of complement activation. Investigating the role of CFHR3-R1 and C4 in additional race groups at greater risk of AMD or reduced risk of AMD may provide additional insight into the disease etiology and pathology. Genetic studies would benefit from the inclusion of other known variables in AMD susceptibility to generate a model for overall total effects. Expansion of the

243 geographic atrophy and neovascular AMD subjects would be able to separate the signals leading to different ends in AMD.

In summary this work demonstrates a role for complement genetic and phenotypic variation resulting in greater susceptibility to autoimmune and organ specific disease among multiple populations. The major findings of this work is the generation of definitive, robust, and accurate method to detect the copy number variation of CFHR3-R1 among multiple populations at either the microgram or nanogram level of DNA. Increased copy numbers of CFHR3-

R1and C4 associated with Age-Related Macular Degeneration, particularly choroid neovascular and geographic atrophy, respectively. Reduced copy numbers of CFHR3-R1 were more strongly associated with African American

SLE than with European American SLE. Reduced protein levels of MBL and

CFH contributed to aPL-associated disease manifestations such as SLE, thrombosis, and SLE with thrombosis. This work supports a model of site-specific complement function and cooperation to protect host cells, eliminate pathogen, and promote basic homeostasis.

244

Table 7.1 Relationship between MBL, CFH, and CFHR3-R1 in AMD, SLE, and aPL.

[MBL] [CFH] CFHR3-R1 CNV

AMD - - ↑ risk Neo

SLE ND ND ↓ risk, greater in AFA

aPL ↓ T-VT, ↓ TS ↓ RSA, ↓ SLE, ↓↓ TS

Abbreviations: AMD- Age-Related Macular Degeneration; SLE-Systemic Lupus

Erythematosus, aPL-antiphospholipid antibodies; MBL-Mannan binding lectin;

CFH-complement factor H; Neo- choroid neovascularization; AFA-African

American; T-VT-Venous Thrombosis; TS-SLE with thrombosis; RSA-Recurrent

Spontaneous Abortion; ND-Not Determined.

245

REFERENCES

Abecasis G. R., Yashar B. M., Zhao Y., Ghiasvand N. M., Zareparsi S., Branham K. E. H., Reddick A. C., Trager E. H., Yoshida S., Bahling J., Filippova E., Elner S., Johnson M. W., Vine A. K., Sieving P. A., Jacobson S. G., Richards J. E. and Swaroop A. (2004) Age-Related Macular Degeneration: A High-Resolution Genome Scan for Susceptibility Loci in a Population Enriched for Late-Stage Disease. Am J Hum Genet 74, 482-494.

Abrera-Abeleda M. A., Nishimura C., Smith J. L., Sethi S., McRae J. L., Murphy B. F., Silvestri G., Skerka C., Jozsi M., Zipfel P. F., Hageman G. S. and Smith R. J. (2006) Variations in the complement regulatory genes factor H (CFH) and factor H related 5 (CFHR5) are associated with membranoproliferative glomerulonephritis type II (dense deposit disease). J Med Genet 43, 582-9.

Aitman T. J., Dong R., Vyse T. J., Norsworthy P. J., Johnson M. D., Smith J., Mangion J., Roberton-Lowe C., Marshall A. J., Petretto E., Hodges M. D., Bhangal G., Patel S. G., Sheehan-Rooney K., Duda M., Cook P. R., Evans D. J., Domin J., Flint J., Boyle J. J., Pusey C. D. and Cook H. T. (2006) Copy number polymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature 439, 851-5.

Aldred P. M., Hollox E. J. and Armour J. A. (2005) Copy number polymorphism and expression level variation of the human alpha-defensin genes DEFA1 and DEFA3. Hum Mol Genet 14, 2045-52.

Alper C. A., Colten H. R., Rosen F. S., Rabson A. R., Macnab G. M. and Gear J. S. (1972) Homozygous deficiency of C3 in a patient with repeated infections. Lancet 2, 1179-81.

Alsenz J., Schulz T. F., Lambris J. D., Sim R. B. and Dierich M. P. (1985) Structural and functional analysis of the complement component factor H with the use of different enzymes and monoclonal antibodies to factor H. Biochem J 232, 841- 50.

Amadei N., Baracho G. V., Nudelman V., Bastos W., Florido M. P. and Isaac L. (2001) Inherited complete factor I deficiency associated with systemic lupus erythematosus, higher susceptibility to infection and low levels of factor H. Scand J Immunol 53, 615-21.

Anders E. M., Hartley C. A., Reading P. C. and Ezekowitz R. A. (1994) Complement- dependent neutralization of influenza virus by a serum mannose-binding lectin. J Gen Virol 75 ( Pt 3), 615-22.

Appel G. B., Cook H. T., Hageman G., Jennette J. C., Kashgarian M., Kirschfink M., Lambris J. D., Lanning L., Lutz H. U., Meri S., Rose N. R., Salant D. J., Sethi S.,

251

Smith R. J., Smoyer W., Tully H. F., Tully S. P., Walker P., Welsh M., Wurzner R. and Zipfel P. F. (2005) Membranoproliferative glomerulonephritis type II (dense deposit disease): an update. J Am Soc Nephrol 16, 1392-403.

AREDS. (2000) Risk factors associated with age-related macular degeneration. Ophthalmology 107, 2224-2234.

AREDS. (2005) Risk Factors for the Incidence of Advanced Age-Related Macular Degeneration in the Age-Related Eye Disease Study (AREDS). Ophthalmology 112, 533-539.

Armour J. A., Palla R., Zeeuwen P. L., den Heijer M., Schalkwijk J. and Hollox E. J. (2007) Accurate, high-throughput typing of copy number variation using paralogue ratios from dispersed repeats. Nucleic Acids Res 35, e19.

Arnett F. C. (1997) The Genetics of Human Lupus. Williams and Wilkins, Baltimore.

Ault B. H., Schmidt B. Z., Fowler N. L., Kashtan C. E., Ahmed A. E., Vogt B. A. and Colten H. R. (1997) Human factor H deficiency. Mutations in framework cysteine residues and block in H protein secretion and intracellular catabolism. J Biol Chem 272, 25168-75.

Ayala C., Greenlund K. J., Croft J. B., Keenan N. L., Donehoo R. S., Giles W. H., Kittner S. J. and Marks J. S. (2001) Racial/ethnic disparities in mortality by stroke subtype in the United States, 1995-1998. Am J Epidemiol 154, 1057-63.

Azizah M. R., Ainoi S. S., Kuak S. H., Kong N. C., Normaznah Y. and Rahim M. N. (2001) The association of the HLA class II antigens with clinical and autoantibody expression in Malaysian Chinese patients with systemic lupus erythematosus. Asian Pac J Allergy Immunol 19, 93-100.

Barlow P. N., Hageman G. S. and Lea S. M. (2008) Complement factor H: using atomic resolution structure to illuminate disease mechanisms. Adv Exp Med Biol 632, 117-42.

Beckmann J. S., Estivill X. and Antonarakis S. E. (2007) Copy number variants and genetic traits: closer to the resolution of phenotypic to genotypic variability. Nat Rev Genet 8, 639-46.

Berger S. P. and Daha M. R. (2007) Complement in glomerular injury. Semin Immunopathol 29, 375-84.

Bertolaccini M. L., Khamashta M. A. and Hughes G. R. (2005) Diagnosis of antiphospholipid syndrome. Nat Clin Pract Rheumatol 1, 40-6.

Bessant R., Hingorani A., Patel L., MacGregor A., Isenberg D. A. and Rahman A. (2004) Risk of coronary heart disease and stroke in a large British cohort of patients with systemic lupus erythematosus. Rheumatology 43, 924-9.

252

Best L. G., Davidson M., North K. E., MacCluer J. W., Zhang Y., Lee E. T., Howard B. V., DeCroo S. and Ferrell R. E. (2004) Prospective analysis of mannose-binding lectin genotypes and coronary artery disease in American Indians: the Strong Heart Study. Circulation 109, 471-5.

Biezeveld M. H., Kuipers I. M., Geissler J., Lam J., Ottenkamp J. J., Hack C. E. and Kuijpers T. W. (2003) Association of mannose-binding lectin genotype with cardiovascular abnormalities in Kawasaki disease. Lancet 361, 1268-70.

Blackmore T. K., Hellwage J., Sadlon T. A., Higgs N., Zipfel P. F., Ward H. M. and Gordon D. L. (1998) Identification of the second heparin-binding domain in human complement factor H. J Immunol 160, 3342-8.

Blackmore T. K., Sadlon T. A., Ward H. M., Lublin D. M. and Gordon D. L. (1996) Identification of a heparin binding domain in the seventh short consensus repeat of complement factor H. J Immunol 157, 5422-7.

Blanchong C. A., Chung E. K., Rupert K. L., Yang Y., Yang Z., Zhou B., Moulds J. M. and Yu C. Y. (2001) Genetic, structural and functional diversities of human complement components C4A and C4B and their mouse homologues, Slp and C4. Int Immunopharmacol 1, 365-92.

Blanchong C. A., Zhou B., Rupert K. L., Chung E. K., Jones K. N., Sotos J. F., Zipf W. B., Rennebohm R. M. and Yung Yu C. (2000) Deficiencies of human complement component C4A and C4B and heterozygosity in length variants of RP-C4- CYP21-TNX (RCCX) modules in caucasians. The load of RCCX genetic diversity on major histocompatibility complex-associated disease. J Exp Med 191, 2183- 96.

Blasko B., Kolka R., Thorbjornsdottir P., Sigurdarson S. T., Sigurdsson G., Ronai Z., Sasvari-Szekely M., Bodvarsson S., Thorgeirsson G., Prohaszka Z., Kovacs M., Fust G. and Arason G. J. (2008) Low complement C4B gene copy number predicts short-term mortality after acute myocardial infarction. Int Immunol 20, 31-7.

Boon C. J., van de Kar N. C., Klevering B. J., Keunen J. E., Cremers F. P., Klaver C. C., Hoyng C. B., Daha M. R. and den Hollander A. I. (2009) The spectrum of phenotypes caused by variants in the CFH gene. Mol Immunol 46, 1573-94.

Bora N. S., Kaliappan S., Jha P., Xu Q., Sohn J. H., Dhaulakhandi D. B., Kaplan H. J. and Bora P. S. (2006) Complement activation via alternative pathway is critical in the development of laser-induced choroidal neovascularization: role of factor B and factor H. J Immunol 177, 1872-8.

Brasch-Andersen C., Christiansen L., Tan Q., Haagerup A., Vestbo J. and Kruse T. A. (2004) Possible gene dosage effect of glutathione-S-transferases on atopic asthma: using real-time PCR for quantification of GSTM1 and GSTT1 gene copy numbers. Hum Mutat 24, 208-14.

253

Brooimans R. A., van der Ark A. A., Buurman W. A., van Es L. A. and Daha M. R. (1990) Differential regulation of complement factor H and C3 production in human umbilical vein endothelial cells by IFN-gamma and IL-1. J Immunol 144, 3835-40.

Calvo-Alen J., Alarcon G. S., Tew M. B., Tan F. K., McGwin G., Jr., Fessler B. J., Vila L. M. and Reveille J. D. (2006) Systemic lupus erythematosus in a multiethnic US cohort: XXXIV. Deficient mannose-binding lectin exon 1 polymorphisms are associated with cerebrovascular but not with other arterial thrombotic events. Arthritis Rheum 54, 1940-5.

Camargo E. C., Massaro A. R., Bacheschi L. A., D'Amico E. A., Villaca P. R., Bassitt R. P., Gualandro S. F., Bendit I. and Scaff M. (2005) Ethnic differences in cerebral venous thrombosis. Cerebrovasc Dis 19, 147-51.

Caprioli J., Bettinaglio P., Zipfel P. F., Amadei B., Daina E., Gamba S., Skerka C., Marziliano N., Remuzzi G. and Noris M. (2001) The molecular basis of familial hemolytic uremic syndrome: mutation analysis of factor H gene reveals a hot spot in short consensus repeat 20. J Am Soc Nephrol 12, 297-307.

Cervera R., Piette J. C., Font J., Khamashta M. A., Shoenfeld Y., Camps M. T., Jacobsen S., Lakos G., Tincani A., Kontopoulou-Griva I., Galeazzi M., Meroni P. L., Derksen R. H., de Groot P. G., Gromnica-Ihle E., Baleva M., Mosca M., Bombardieri S., Houssiau F., Gris J. C., Quere I., Hachulla E., Vasconcelos C., Roch B., Fernandez-Nebro A., Boffa M. C., Hughes G. R. and Ingelmo M. (2002) Antiphospholipid syndrome: clinical and immunologic manifestations and patterns of disease expression in a cohort of 1,000 patients. Arthritis Rheum 46, 1019-27.

Chadban S. J. and Atkins R. C. (2005) Glomerulonephritis. Lancet 365, 1797-806.

Chanock S. and Taylor J. G. t. (2002) Using genetic variation to study immunomodulation. Curr Opin Pharmacol 2, 463-9.

Chong J. Y. and Sacco R. L. (2005) Epidemiology of stroke in young adults: race/ethnic differences. J Thromb Thrombolysis 20, 77-83.

Christiansen O. B., Kilpatrick D. C., Souter V., Varming K., Thiel S. and Jensenius J. C. (1999) Mannan-binding lectin deficiency is associated with unexplained recurrent miscarriage. Scand J Immunol 49, 193-6.

Chung E. K., Wu Y. L., Yang Y., Zhou B. and Yu C. Y. (2005) Human complement components C4A and C4B genetic diversitities: complex genotypes and phenotypes. John Wiley & Sons, Edison, NJ.

Chung E. K., Yang Y., Rennebohm R. M., Lokki M. L., Higgins G. C., Jones K. N., Zhou B., Blanchong C. A. and Yu C. Y. (2002a) Genetic sophistication of human complement components C4A and C4B and RP-C4-CYP21-TNX (RCCX) modules in the major histocompatibility complex. Am J Hum Genet 71, 823-37.

254

Chung E. K., Yang Y., Rupert K. L., Jones K. N., Rennebohm R. M., Blanchong C. A. and Yu C. Y. (2002b) Determining the one, two, three, or four long and short loci of human complement C4 in a major histocompatibility complex haplotype encoding C4A or C4B proteins. Am J Hum Genet 71, 810-22.

Clark S. J., Higman V. A., Mulloy B., Perkins S. J., Lea S. M., Sim R. B. and Day A. J. (2006) His-384 allotypic variant of factor H associated with age-related macular degeneration has different heparin binding properties from the non-disease- associated form. J Biol Chem 281, 24713-20.

Cochrane C. G. and Koffler D. (1973) Immune complex disease in experimental animals and man. Adv Immunol 16, 185-264.

Colville D., Guymer R., Sinclair R. A. and Savige J. (2003) Visual impairment caused by retinal abnormalities in mesangiocapillary (membranoproliferative) glomerulonephritis type II ("dense deposit disease"). Am J Kidney Dis 42, E2-5.

Conrad D. F. and Hurles M. E. (2007) The population genetics of structural variation. Nat Genet 39, S30-6.

Cooper G. M., Nickerson D. A. and Eichler E. E. (2007) Mutational and selective effects on copy-number variants in the human genome. Nat Genet 39, S22-9.

Cooper G. M., Zerr T., Kidd J. M., Eichler E. E. and Nickerson D. A. (2008) Systematic assessment of copy number variant detection via genome-wide SNP genotyping. Nat Genet 40, 1199-203.

Crosdale D. J., Ollier W. E., Thomson W., Dyer P. A., Jensenious J., Johnson R. W. and Poulton K. V. (2000) Mannose binding lectin (MBL) genotype distributions with relation to serum levels in UK Caucasoids. Eur J Immunogenet 27, 111-7.

Dahl M. R., Thiel S., Matsushita M., Fujita T., Willis A. C., Christensen T., Vorup-Jensen T. and Jensenius J. C. (2001) MASP-3 and its association with distinct complexes of the mannan-binding lectin complement activation pathway. Immunity 15, 127-35.

Daniel J. M., Susan M., Thomas A. M. J. R., Rosalind R.-G., Ronald E. L. and Kwoh C. K. (1995) Incidence of systemic lupus erythematosus race and gender differences. Arthritis Rheum 38, 1260-1270.

Davies E. J., Snowden N., Hillarby M. C., Carthy D., Grennan D. M., Thomson W. and Ollier W. E. (1995) Mannose-binding protein gene polymorphism in systemic lupus erythematosus. Arthritis Rheum 38, 110-4.

deJong P. T. V. M. (2006) Age-Related Macular Degeneration. N Eng J Med 355, 1474- 1485.

255

Dodds A. W., Ren X. D., Willis A. C. and Law S. K. (1996) The reaction mechanism of the internal thioester in the human complement component C4. Nature 379, 177- 9.

Dragon-Durey M. A., Blanc C., Marliot F., Loirat C., Blouin J., Sautes-Fridman C., Fridman W. H. and Fremeaux-Bacchi V. (2009) The high frequency of complement factor H related CFHR1 gene deletion is restricted to specific subgroups of patients with atypical haemolytic uraemic syndrome. J Med Genet 46, 447-50.

Dragon-Durey M. A., Fremeaux-Bacchi V., Loirat C., Blouin J., Niaudet P., Deschenes G., Coppo P., Herman Fridman W. and Weiss L. (2004) Heterozygous and homozygous factor h deficiencies associated with hemolytic uremic syndrome or membranoproliferative glomerulonephritis: report and genetic analysis of 16 cases. J Am Soc Nephrol 15, 787-95.

Dragon-Durey M. A., Loirat C., Cloarec S., Macher M. A., Blouin J., Nivet H., Weiss L., Fridman W. H. and Fremeaux-Bacchi V. (2005) Anti-Factor H autoantibodies associated with atypical hemolytic uremic syndrome. J Am Soc Nephrol 16, 555- 63.

Edwards A. O., Ritter R., 3rd, Abel K. J., Manning A., Panhuysen C. and Farrer L. A. (2005) Complement factor H polymorphism and age-related macular degeneration. Science 308, 421-4.

Eisen D. P. and Minchinton R. M. (2003) Impact of mannose-binding lectin on susceptibility to infectious diseases. Clin Infect Dis 37, 1496-505.

Erkan D. and Lockshin M. D. (2009) New approaches for managing antiphospholipid syndrome. Nat Clin Pract Rheumatol 5, 160-70.

Esmon C. T. (2003) Coagulation and inflammation. J Endotoxin Res 9, 192-8.

Esparza-Gordillo J., Goicoechea de Jorge E., Buil A., Carreras Berges L., Lopez- Trascasa M., Sanchez-Corral P. and Rodriguez de Cordoba S. (2005) Predisposition to atypical hemolytic uremic syndrome involves the concurrence of different susceptibility alleles in the regulators of complement activation gene cluster in 1q32. Hum Mol Genet 14, 703-12.

Fanciulli M., Norsworthy P. J., Petretto E., Dong R., Harper L., Kamesh L., Heward J. M., Gough S. C., de Smith A., Blakemore A. I., Froguel P., Owen C. J., Pearce S. H., Teixeira L., Guillevin L., Graham D. S., Pusey C. D., Cook H. T., Vyse T. J. and Aitman T. J. (2007) FCGR3B copy number variation is associated with susceptibility to systemic, but not organ-specific, autoimmunity. Nat Genet 39, 721-3.

Feifel E., Prodinger W. M., Molgg M., Schwaeble W., Schonitzer D., Koistinen V., Misasi R. and Dierich M. P. (1992) Polymorphism and deficiency of human factor H- related proteins p39 and p37. Immunogenetics 36, 104-9. 256

Fellermann K., Stange D. E., Schaeffeler E., Schmalzl H., Wehkamp J., Bevins C. L., Reinisch W., Teml A., Schwab M., Lichter P., Radlwimmer B. and Stange E. F. (2006) A chromosome 8 gene-cluster polymorphism with low human beta- defensin 2 gene copy number predisposes to Crohn disease of the colon. Am J Hum Genet 79, 439-48.

Fernandez M., Alarcon G. S., Calvo-Alen J., Andrade R., McGwin G., Jr., Vila L. M. and Reveille J. D. (2007) A multiethnic, multicenter cohort of patients with systemic lupus erythematosus (SLE) as a model for the study of ethnic disparities in SLE. Arthritis Rheum 57, 576-84.

Fernando M. M., Stevens C. R., Sabeti P. C., Walsh E. C., McWhinnie A. J., Shah A., Green T., Rioux J. D. and Vyse T. J. (2007) Identification of two independent risk factors for lupus within the MHC in United Kingdom families. PLoS Genet 3, e192.

Fernando M. M., Stevens C. R., Walsh E. C., De Jager P. L., Goyette P., Plenge R. M., Vyse T. J. and Rioux J. D. (2008) Defining the role of the MHC in autoimmunity: a review and pooled analysis. PLoS Genet 4, e1000024.

Feuk L., Carson A. R. and Scherer S. W. (2006) Structural variation in the human genome. Nat Rev Genet 7, 85-97.

Fischer P. B., Ellermann-Eriksen S., Thiel S., Jensenius J. C. and Mogensen S. C. (1994) Mannan-binding protein and bovine conglutinin mediate enhancement of herpes simplex virus type 2 infection in mice. Scand J Immunol 39, 439-45.

Fleming S. D., Egan R. P., Chai C., Girardi G., Holers V. M., Salmon J., Monestier M. and Tsokos G. C. (2004) Anti-phospholipid antibodies restore mesenteric ischemia/reperfusion-induced injury in complement receptor 2/complement receptor 1-deficient mice. J Immunol 173, 7055-61.

Font J., Ramos-Casals M., Brito-Zeron P., Nardi N., Ibanez A., Suarez B., Jimenez S., Tassies D., Garcia-Criado A., Ros E., Sentis J., Reverter J. C. and Lozano F. (2007) Association of mannose-binding lectin gene polymorphisms with antiphospholipid syndrome, cardiovascular disease and chronic damage in patients with systemic lupus erythematosus. Rheumatology 46, 76-80.

Fontaine M., Demares M. J., Koistinen V., Day A. J., Davrinche C., Sim R. B. and Ripoche J. (1989) Truncated forms of human complement factor H. Biochem J 258, 927-30.

Forabosco P., Gorman J. D., Cleveland C., Kelly J. A., Fisher S. A., Ortmann W. A., Johansson C., Johanneson B., Moser K. L., Gaffney P. M., Tsao B. P., Cantor R. M., Alarcon-Riquelme M. E., Behrens T. W., Harley J. B., Lewis C. M. and Criswell L. A. (2006) Meta-analysis of genome-wide linkage studies of systemic lupus erythematosus. Genes Immun 7, 609-14.

257

Fraser D. A., Bohlson S. S., Jasinskiene N., Rawal N., Palmarini G., Ruiz S., Rochford R. and Tenner A. J. (2006) C1q and MBL, components of the innate immune system, influence monocyte cytokine expression. J Leukoc Biol 80, 107-16.

Garred P., Larsen F., Madsen H. O. and Koch C. (2003) Mannose-binding lectin deficiency--revisited. Mol Immunol 40, 73-84.

Garred P., Madsen H. O., Halberg P., Petersen J., Kronborg G., Svejgaard A., Andersen V. and Jacobsen S. (1999) Mannose-binding lectin polymorphisms and susceptibility to infection in systemic lupus erythematosus. Arthritis Rheum 42, 2145-52.

George D. and Erkan D. (2009) Antiphospholipid syndrome. Prog Cardiovasc Dis 52, 115-25.

Giannakis E., Jokiranta T. S., Male D. A., Ranganathan S., Ormsby R. J., Fischetti V. A., Mold C. and Gordon D. L. (2003) A common site within factor H SCR 7 responsible for binding heparin, C-reactive protein and streptococcal M protein. Eur J Immunol 33, 962-9.

Giannakopoulos B., Passam F., Rahgozar S. and Krilis S. A. (2007) Current concepts on the pathogenesis of the antiphospholipid syndrome. Blood 109, 422-430.

Giclas P. D. (2003) Measurent of Complement Component Levels by Radial Immunodiffusion (RID). Current Protocols In Immunology 13, 1.9-1.26.

Giles I. and Rahman A. (2009) How to manage patients with systemic lupus erythematosus who are also antiphospholipid antibody positive. Best Pract Res Clin Rheumatol 23, 525-37.

Girardi G., Berman J., Redecha P., Spruce L., Thurman J. M., Kraus D., Hollmann T. J., Casali P., Caroll M. C., Wetsel R. A., Lambris J. D., Holers V. M. and Salmon J. E. (2003) Complement C5a receptors and neutrophils mediate fetal injury in the antiphospholipid syndrome. J Clin Invest 112, 1644-54.

Girardi G., Redecha P. and Salmon J. E. (2004) Heparin prevents antiphospholipid antibody-induced fetal loss by inhibiting complement activation. Nat Med 10, 1222-6.

Gold B., Merriam J. E., Zernant J., Hancox L. S., Taiber A. J., Gehrs K., Cramer K., Neel J., Bergeron J., Barile G. R., Smith R. T., Hageman G. S., Dean M. and Allikmets R. (2006) Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nat Genet 38, 458-62.

Gonzalez E., Kulkarni H., Bolivar H., Mangano A., Sanchez R., Catano G., Nibbs R. J., Freedman B. I., Quinones M. P., Bamshad M. J., Murthy K. K., Rovin B. H., Bradley W., Clark R. A., Anderson S. A., O'Connell R J., Agan B. K., Ahuja S. S., Bologna R., Sen L., Dolan M. J. and Ahuja S. K. (2005) The influence of CCL3L1

258

gene-containing segmental duplications on HIV-1/AIDS susceptibility. Science 307, 1434-40.

Goverdhan S. V., Howell M. W., Mullins R. F., Osmond C., Hodgkins P. R., Self J., Avery K. and Lotery A. J. (2005) Association of HLA class I and class II polymorphisms with age-related macular degeneration. Invest Ophthalmol Vis Sci 46, 1726-34.

Graham R. R., Kozyrev S. V., Baechler E. C., Reddy M. V., Plenge R. M., Bauer J. W., Ortmann W. A., Koeuth T., Gonzalez Escribano M. F., Pons-Estel B., Petri M., Daly M., Gregersen P. K., Martin J., Altshuler D., Behrens T. W. and Alarcon- Riquelme M. E. (2006) A common haplotype of interferon regulatory factor 5 (IRF5) regulates splicing and expression and is associated with increased risk of systemic lupus erythematosus. Nat Genet 38, 550-5.

Graham R. R., Ortmann W. A., Langefeld C. D., Jawaheer D., Selby S. A., Rodine P. R., Baechler E. C., Rohlf K. E., Shark K. B., Espe K. J., Green L. E., Nair R. P., Stuart P. E., Elder J. T., King R. A., Moser K. L., Gaffney P. M., Bugawan T. L., Erlich H. A., Rich S. S., Gregersen P. K. and Behrens T. W. (2002) Visualizing human leukocyte antigen class II risk haplotypes in human systemic lupus erythematosus. Am J Hum Genet 71, 543-53.

Guc D., Gulati P., Lemercier C., Lappin D., Birnie G. D. and Whaley K. (1993) Expression of the components and regulatory proteins of the alternative complement pathway and the membrane attack complex in normal and diseased synovium. Rheumatol Int 13, 139-46.

Gupta B., Raghav S. K., Agrawal C., Chaturvedi V. P., Das R. H. and Das H. R. (2006) Anti-MBL autoantibodies in patients with rheumatoid arthritis: prevalence and clinical significance. J Autoimmun 27, 125-133.

Gupta S. K., Murthy G. V. S., Morrison N., Price G. M., Dherani M., John N., Fletcher A. E. and Chakravarthy U. (2007) Prevalence of Early and Late Age-Related Macular Degeneration in a Rural Population in Northern India: The INDEYE Feasibility Study. Invest Ophthalmol Vis Sci 48, 1007-1011.

Hageman G. S., Anderson D. H., Johnson L. V., Hancox L. S., Taiber A. J., Hardisty L. I., Hageman J. L., Stockman H. A., Borchardt J. D., Gehrs K. M., Smith R. J., Silvestri G., Russell S. R., Klaver C. C., Barbazetto I., Chang S., Yannuzzi L. A., Barile G. R., Merriam J. C., Smith R. T., Olsh A. K., Bergeron J., Zernant J., Merriam J. E., Gold B., Dean M. and Allikmets R. (2005) A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci U S A 102, 7227-32.

Hageman G. S., Hancox L. S., Taiber A. J., Gehrs K. M., Anderson D. H., Johnson L. V., Radeke M. J., Kavanagh D., Richards A., Atkinson J., Meri S., Bergeron J., Zernant J., Merriam J., Gold B., Allikmets R. and Dean M. (2006) Extended haplotypes in the complement factor H (CFH) and CFH-related (CFHR) family of genes protect against age-related macular degeneration: characterization, ethnic distribution and evolutionary implications. Ann Med 38, 592-604. 259

Hageman G. S., Luthert P. J., Victor Chong N. H., Johnson L. V., Anderson D. H. and Mullins R. F. (2001) An integrated hypothesis that considers drusen as biomarkers of immune-mediated processes at the RPE-Bruch's membrane interface in aging and age-related macular degeneration. Prog Retin Eye Res 20, 705-32.

Hageman G. S., Mullins R. F., Russell S. R., Johnson L. V. and Anderson D. H. (1999) Vitronectin is a constituent of ocular drusen and the vitronectin gene is expressed in human retinal pigmented epithelial cells. Faseb J 13, 477-84.

Haines J. L., Hauser M. A., Schmidt S., Scott W. K., Olson L. M., Gallins P., Spencer K. L., Kwan S. Y., Noureddine M., Gilbert J. R., Schnetz-Boutaud N., Agarwal A., Postel E. A. and Pericak-Vance M. A. (2005) Complement factor H variant increases the risk of age-related macular degeneration. Science 308, 419-21.

Hansen S. and Holmskov U. (1998) Structural aspects of collectins and receptors for collectins. Immunobiology 199, 165-89.

Harley J. B., Alarcon-Riquelme M. E., Criswell L. A., Jacob C. O., Kimberly R. P., Moser K. L., Tsao B. P., Vyse T. J., Langefeld C. D., Nath S. K., Guthridge J. M., Cobb B. L., Mirel D. B., Marion M. C., Williams A. H., Divers J., Wang W., Frank S. G., Namjou B., Gabriel S. B., Lee A. T., Gregersen P. K., Behrens T. W., Taylor K. E., Fernando M., Zidovetzki R., Gaffney P. M., Edberg J. C., Rioux J. D., Ojwang J. O., James J. A., Merrill J. T., Gilkeson G. S., Seldin M. F., Yin H., Baechler E. C., Li Q. Z., Wakeland E. K., Bruner G. R., Kaufman K. M. and Kelly J. A. (2008) Genome-wide association scan in women with systemic lupus erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and other loci. Nat Genet 40, 204-10.

Harley J. B., Moser K. L., Gaffney P. M. and Behrens T. W. (1998) The genetics of human systemic lupus erythematosus. Curr Opin Immunol 10, 690-6.

Hegasy G. A., Manuelian T., Hogasen K., Jansen J. H. and Zipfel P. F. (2002) The molecular basis for hereditary porcine membranoproliferative glomerulonephritis type II: point mutations in the factor H coding sequence block protein secretion. Am J Pathol 161, 2027-34.

Heinen S., Hartmann A., Lauer N., Wiehl U., Dahse H. M., Schirmer S., Gropp K., Enghardt T., Wallich R., Halbich S., Mihlan M., Schlotzer-Schrehardt U., Zipfel P. F. and Skerka C. (2009) Factor H related protein 1 (CFHR-1) inhibits complement C5 convertase activity and terminal complex formation. Blood.

Hellwage J., Jokiranta T. S., Friese M. A., Wolk T. U., Kampen E., Zipfel P. F. and Meri S. (2002) Complement C3b/C3d and cell surface polyanions are recognized by overlapping binding sites on the most carboxyl-terminal domain of complement factor H. J Immunol 169, 6935-44.

Hellwage J., Jokiranta T. S., Koistinen V., Vaarala O., Meri S. and Zipfel P. F. (1999) Functional properties of complement factor H-related proteins FHR-3 and FHR-4: 260

binding to the C3d region of C3b and differential regulation by heparin. FEBS Lett 462, 345-52.

Hellwage J., Skerka C. and Zipfel P. F. (1997) Biochemical and functional characterization of the factor-H-related protein 4 (FHR-4). Immunopharmacology 38, 149-57.

Ho A., Barr S. G., Magder L. S. and Petri M. (2001) A decrease in complement is associated with increased renal and hematologic activity in patients with systemic lupus erythematosus. Arthritis Rheum 44, 2350-7.

Hochberg M. C. (1997) The Epidemiology of Systemic Lupus Erythematosus. In Dubois' Lupus Erythematosus (Edited by Wallace D. J. and Hahn B. H.), p. 49-65. Williams and Wilkins, Baltimore.

Hogasen K., Jansen J. H., Mollnes T. E., Hovdenes J. and Harboe M. (1995) Hereditary porcine membranoproliferative glomerulonephritis type II is caused by factor H deficiency. J Clin Invest 95, 1054-61.

Holers V. M., Girardi G., Mo L., Guthridge J. M., Molina H., Pierangeli S. S., Espinola R., Xiaowei L. E., Mao D., Vialpando C. G. and Salmon J. E. (2002) Complement C3 activation is required for antiphospholipid antibody-induced fetal loss. J Exp Med 195, 211-20.

Hollox E. J., Huffmeier U., Zeeuwen P. L., Palla R., Lascorz J., Rodijk-Olthuis D., van de Kerkhof P. C., Traupe H., de Jongh G., den Heijer M., Reis A., Armour J. A. and Schalkwijk J. (2008) Psoriasis is associated with increased beta-defensin genomic copy number. Nat Genet 40, 23-5.

Hom G., Graham R. R., Modrek B., Taylor K. E., Ortmann W., Garnier S., Lee A. T., Chung S. A., Ferreira R. C., Pant P. V., Ballinger D. G., Kosoy R., Demirci F. Y., Kamboh M. I., Kao A. H., Tian C., Gunnarsson I., Bengtsson A. A., Rantapaa- Dahlqvist S., Petri M., Manzi S., Seldin M. F., Ronnblom L., Syvanen A. C., Criswell L. A., Gregersen P. K. and Behrens T. W. (2008) Association of systemic lupus erythematosus with C8orf13-BLK and ITGAM-ITGAX. N Engl J Med 358, 900-9.

Hougie C., Denson K. W. and Biggs R. (1967) A study of the reaction product of factor 8 and factor IX by gel filtration. Thromb Diath Haemorrh 18, 211-22.

Huber-Lang M., Sarma J. V., Zetoune F. S., Rittirsch D., Neff T. A., McGuire S. R., Lambris J. D., Warner R. L., Flierl M. A., Hoesel L. M., Gebhard F., Younger J. G., Drouin S. M., Wetsel R. A. and Ward P. A. (2006) Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 12, 682-7.

Hughes A. E., Orr N., Esfandiary H., Diaz-Torres M., Goodship T. and Chakravarthy U. (2006) A common CFH haplotype, with deletion of CFHR1 and CFHR3, is associated with lower risk of age-related macular degeneration. Nat Genet 38, 1173-7. 261

Hughes A. E., Orr N., Patterson C., Esfandiary H., Hogg R., McConnell V., Silvestri G. and Chakravarthy U. (2007) Neovascular age-related macular degeneration risk based on CFH, LOC387715/HTRA1, and smoking. PLoS Med 4, e355.

Hughes G. R. (1983) Thrombosis, abortion, cerebral disease, and the lupus anticoagulant. Br Med J (Clin Res Ed) 287, 1088-9.

Ikeda K., Nagasawa K., Horiuchi T., Tsuru T., Nishizaka H. and Niho Y. (1997) C5a induces tissue factor activity on endothelial cells. Thromb Haemost 77, 394-8.

Ioannidis J. P., Ntzani E. E. and Trikalinos T. A. (2004) 'Racial' differences in genetic effects for complex diseases. Nat Genet 36, 1312-8.

Isenman D. E. and Young J. R. (1984) The molecular basis for the difference in immune hemolysis activity of the Chido and Rodgers isotypes of human complement component C4. J Immunol 132, 3019-27.

Ivaschenko T. E., Sideleva O. G. and Baranov V. S. (2002) Glutathione- S-transferase micro and theta gene polymorphisms as new risk factors of atopic bronchial asthma. J Mol Med 80, 39-43.

Iyengar S. K., Song D., Klein B. E. K., Klein R., Schick J. H., Humphrey J., Millard C., Liptak R., Russo K., Jun G., Lee K. E., Fijal B. and Elston R. C. (2004) Dissection of Genomewide-Scan Data in Extended Families Reveals a Major Locus and Oligogenic Susceptibility for Age-Related Macular Degeneration. Am J Hum Genet 74, 20-39.

Jack D. L., Read R. C., Tenner A. J., Frosch M., Turner M. W. and Klein N. J. (2001) Mannose-binding lectin regulates the inflammatory response of human professional phagocytes to Neisseria meningitidis serogroup B. J Infect Dis 184, 1152-62.

Jackson C. M. and Nemerson Y. (1980) Blood coagulation. Annu Rev Biochem 49, 765- 811.

Jacobs B. S., Boden-Albala B., Lin I. F. and Sacco R. L. (2002) Stroke in the young in the northern Manhattan stroke study. Stroke 33, 2789-93.

Jager R. D., Mieler W. F. and Miller J. W. (2008) Age-related macular degeneration. N Engl J Med 358, 2606-17.

Jakab L., Laki J., Sallai K., Temesszentandrasi G., Pozsonyi T., Kalabay L., Varga L., Gombos T., Blasko B., Biro A., Madsen H. O., Radics J., Gergely P., Fust G., Czirjak L., Garred P. and Fekete B. (2007) Association between early onset and organ manifestations of systemic lupus erythematosus (SLE) and a down- regulating promoter polymorphism in the MBL2 gene. Clin Immunol 125, 230-6.

Jakobsson M., Scholz S. W., Scheet P., Gibbs J. R., VanLiere J. M., Fung H. C., Szpiech Z. A., Degnan J. H., Wang K., Guerreiro R., Bras J. M., Schymick J. C., 262

Hernandez D. G., Traynor B. J., Simon-Sanchez J., Matarin M., Britton A., van de Leemput J., Rafferty I., Bucan M., Cann H. M., Hardy J. A., Rosenberg N. A. and Singleton A. B. (2008) Genotype, haplotype and copy-number variation in worldwide human populations. Nature 451, 998-1003.

Jansen J. H., Hogasen K. and Mollnes T. E. (1993) Extensive complement activation in hereditary porcine membranoproliferative glomerulonephritis type II (porcine dense deposit disease). Am J Pathol 143, 1356-65.

Johnson A. E., Gordon C., Palmer R. G. and Bacon P. A. (1995) The prevalence and incidence of systemic lupus erythematosus in Birmingham, England. Relationship to ethnicity and country of birth. Arthritis Rheum 38, 551-8.

Johnson L. V., Ozaki S., Staples M. K., Erickson P. A. and Anderson D. H. (2000) A potential role for immune complex pathogenesis in drusen formation. Exp Eye Res 70, 441-9.

Jokiranta T. S., Hellwage J., Koistinen V., Zipfel P. F. and Meri S. (2000) Each of the three binding sites on complement factor H interacts with a distinct site on C3b. J Biol Chem 275, 27657-62.

Jokiranta T. S., Zipfel P. F., Hakulinen J., Kuhn S., Pangburn M. K., Tamerius J. D. and Meri S. (1996) Analysis of the recognition mechanism of the alternative pathway of complement by monoclonal anti-factor H antibodies: evidence for multiple interactions between H and surface bound C3b. FEBS Lett 393, 297-302.

Jones H. W., Ireland R., Senaldi G., Wang F., Khamashta M., Bellingham A. J., Veerapan K., Hughes G. R. and Vergani D. (1991) Anticardiolipin antibodies in patients from Malaysia with systemic lupus erythematosus. Ann Rheum Dis 50, 173-5.

Jozsi M., Licht C., Strobel S., Zipfel S. L., Richter H., Heinen S., Zipfel P. F. and Skerka C. (2008) Factor H autoantibodies in atypical hemolytic uremic syndrome correlate with CFHR1/CFHR3 deficiency. Blood 111, 1512-4.

Jozsi M., Richter H., Loschmann I., Skerka C., Buck F., Beisiegel U., Erdei A. and Zipfel P. F. (2005) FHR-4A: a new factor H-related protein is encoded by the human FHR-4 gene. Eur J Hum Genet 13, 321-9.

Jozsi M. and Zipfel P. F. (2008) Factor H family proteins and human diseases. Trends Immunol 29, 380-7.

Kaiser R., Cleveland C. M. and Criswell L. A. (2009) Risk and protective factors for thrombosis in systemic lupus erythematosus: results from a large, multi-ethnic cohort. Ann Rheum Dis 68, 238-241.

Kaplan M. H. and Volanakis J. E. (1974) Interaction of C-reactive protein complexes with the complement system. I. Consumption of human complement associated with

263

the reaction of C-reactive protein with pneumococcal C-polysaccharide and with the choline phosphatides, lecithin and sphingomyelin. J Immunol 112, 2135-47.

Karassa F. B., Trikalinos T. A. and Ioannidis J. P. (2004) The role of FcgammaRIIA and IIIA polymorphisms in autoimmune diseases. Biomed Pharmacother 58, 286-91.

Kavanagh D., Richards A., Fremeaux-Bacchi V., Noris M., Goodship T., Remuzzi G. and Atkinson J. P. (2007) Screening for complement system abnormalities in patients with atypical hemolytic uremic syndrome. Clin J Am Soc Nephrol 2, 591-6.

Kavanagh D., Richards A., Noris M., Hauhart R., Liszewski M. K., Karpman D., Goodship J. A., Fremeaux-Bacchi V., Remuzzi G., Goodship T. H. and Atkinson J. P. (2008) Characterization of mutations in complement factor I (CFI) associated with hemolytic uremic syndrome. Mol Immunol 45, 95-105.

Kelley J., Johnson M. R., Alarcon G. S., Kimberly R. P. and Edberg J. C. (2007) Variation in the relative copy number of the TLR7 gene in patients with systemic lupus erythematosus and healthy control subjects. Arthritis Rheum 56, 3375-8.

Kelly J. A., Kelley J. M., Kaufman K. M., Kilpatrick J., Bruner G. R., Merrill J. T., James J. A., Frank S. G., Reams E., Brown E. E., Gibson A. W., Marion M. C., Langefeld C. D., Li Q. Z., Karp D. R., Wakeland E. K., Petri M., Ramsey-Goldman R., Reveille J. D., Vila L. M., Alarcon G. S., Kimberly R. P., Harley J. B. and Edberg J. C. (2008) Interferon regulatory factor-5 is genetically associated with systemic lupus erythematosus in African Americans. Genes Immun 9, 187-194.

Kilpatrick D. C. (1998) Phospholipid-binding activity of human mannan-binding lectin. Immunol Lett 61, 191-5.

Kilpatrick D. C. (2000) Mannan-binding lectin concentration during normal human pregnancy. Hum Reprod 15, 941-3.

Kilpatrick D. C. (2002) Mannan-binding lectin: clinical significance and applications. Biochim Biophys Acta 1572, 401-13.

Kilpatrick D. C., Bevan B. H. and Liston W. A. (1995) Association between mannan binding protein deficiency and recurrent miscarriage. Hum Reprod 10, 2501-5.

Kilpatrick D. C., Starrs L., Moore S., Souter V. and Liston W. A. (1999) Mannan binding lectin concentration and risk of miscarriage. Hum Reprod 14, 2379-80.

Kim N. R., Kang J. H., Kwon O. W., Lee S. J., Oh J. H. and Chin H. S. (2008) Association between Complement Factor H Gene Polymorphisms and Neovascular Age-Related Macular Degeneration in Koreans. Invest Ophthalmol Vis Sci 49, 2071-2076.

Kim Y. U., Kinoshita T., Molina H., Hourcade D., Seya T., Wagner L. M. and Holers V. M. (1995) Mouse complement regulatory protein Crry/p65 uses the specific

264

mechanisms of both human decay-accelerating factor and membrane cofactor protein. J Exp Med 181, 151-9.

Kittner S. J., McCarter R. J., Sherwin R. W., Sloan M. A., Stern B. J., Johnson C. J., Buchholz D., Seipp M. J. and Price T. R. (1993) Black-white differences in stroke risk among young adults. Stroke 24, I13-5; discussion I20-1.

Klein M. L., Schultz D. W., Edwards A., Matise T. C., Rust K., Berselli C. B., Trzupek K., Weleber R. G., Ott J., Wirtz M. K. and Acott T. S. (1998) Age-related Macular Degeneration: Clinical Features in a Large Family and Linkage to Chromosome 1q. Arch Ophthalmol 116, 1082-1088.

Klein R., Klein B. E., Knudtson M. D., Wong T. Y., Cotch M. F., Liu K., Burke G., Saad M. F. and Jacobs D. R., Jr. (2006) Prevalence of age-related macular degeneration in 4 racial/ethnic groups in the multi-ethnic study of atherosclerosis. Ophthalmology 113, 373-80.

Klein R., Peto T., Bird A. and Vannewkirk M. R. (2004) The epidemiology of age-related macular degeneration. Am J Ophthalmol 137, 486-95.

Klein R. J., Zeiss C., Chew E. Y., Tsai J. Y., Sackler R. S., Haynes C., Henning A. K., SanGiovanni J. P., Mane S. M., Mayne S. T., Bracken M. B., Ferris F. L., Ott J., Barnstable C. and Hoh J. (2005) Complement factor H polymorphism in age- related macular degeneration. Science 308, 385-9.

Koffler D., Agnello V., Thoburn R. and Kunkel H. G. (1971) Systemic lupus erythematosus: prototype of immune complex nephritis in man. J Exp Med 134, 169s-179s.

Krem M. M. and Di Cera E. (2002) Evolution of enzyme cascades from embryonic development to blood coagulation. Trends Biochem Sci 27, 67-74.

Krishnaiah S., Das T., Nirmalan P. K., Nutheti R., Shamanna B. R., Rao G. N. and Thomas R. (2005) Risk factors for age-related macular degeneration: findings from the Andhra Pradesh eye disease study in South India. Invest Ophthalmol Vis Sci 46, 4442-9.

Kruse C., Rosgaard A., Steffensen R., Varming K., Jensenius J. C. and Christiansen O. B. (2002) Low serum level of mannan-binding lectin is a determinant for pregnancy outcome in women with recurrent spontaneous abortion. Am J Obstet Gynecol 187, 1313-20.

Kuhlman M., Joiner K. and Ezekowitz R. A. (1989) The human mannose-binding protein functions as an opsonin. J Exp Med 169, 1733-45.

Kuhn S., Skerka C. and Zipfel P. F. (1995) Mapping of the complement regulatory domains in the human factor H-like protein 1 and in factor H1. J Immunol 155, 5663-70.

265

Kurata H., Cheng H. M., Kozutsumi Y., Yokota Y. and Kawasaki T. (1993) Role of the collagen-like domain of the human serum mannan-binding protein in the activation of complement and the secretion of this lectin. Biochem Biophys Res Commun 191, 1204-10.

Lachmann P. J., Hobart M. J. and Woo P. (1978) Combined genetic deficiency of C6 and C7 in man. Clin Exp Immunol 33, 193-203.

Lafrate A. J., Feuk L., Rivera M. N., Listewnik M. L., Donahoe P. K., Qi Y., Scherer S. W. and Lee C. (2004) Detection of large-scale variation in the human genome. Nat Genet 36, 949-51.

Laine M., Jarva H., Seitsonen S., Haapasalo K., Lehtinen M. J., Lindeman N., Anderson D. H., Johnson P. T., Jarvela I., Jokiranta T. S., Hageman G. S., Immonen I. and Meri S. (2007) Y402H polymorphism of complement factor H affects binding affinity to C-reactive protein. J Immunol 178, 3831-6.

Lappin D. F., Guc D., Hill A., McShane T. and Whaley K. (1992) Effect of interferon- gamma on complement gene expression in different cell types. Biochem J 281 ( Pt 2), 437-42.

Larkin M., Childs R. A., Matthews T. J., Thiel S., Mizuochi T., Lawson A. M., Savill J. S., Haslett C., Diaz R. and Feizi T. (1989) Oligosaccharide-mediated interactions of the envelope glycoprotein gp120 of HIV-1 that are independent of CD4 recognition. AIDS 3, 793-8.

Lau C. S., Yin G. and Mok M. Y. (2006) Ethnic and geographical differences in systemic lupus erythematosus: an overview. Lupus 15, 715-9.

Lau K. K., Smith R. J., Kolbeck P. C. and Butani L. (2008) Dense deposit disease and the factor H H402 allele. Clin Exp Nephrol 12, 228-32.

Lau Y. L., Lau C. S., Chan S. Y., Karlberg J. and Turner M. W. (1996) Mannose-binding protein in Chinese patients with systemic lupus erythematosus. Arthritis Rheum 39, 706-8.

Law S. K., Dodds A. W. and Porter R. R. (1984) A comparison of the properties of two classes, C4A and C4B, of the human complement component C4. Embo J 3, 1819-23.

Lee S. G., Yum J. S., Moon H. M., Kim H. J., Yang Y. J., Kim H. L., Yoon Y., Lee S. and Song K. (2005a) Analysis of mannose-binding lectin 2 (MBL2) genotype and the serum protein levels in the Korean population. Mol Immunol 42, 969-77.

Lee Y. H., Rho Y. H., Choi S. J., Ji J. D., Song G. G., Nath S. K. and Harley J. B. (2007) The PTPN22 C1858T functional polymorphism and autoimmune diseases--a meta-analysis. Rheumatology 46, 49-56.

266

Lee Y. H., Witte T., Momot T., Schmidt R. E., Kaufman K. M., Harley J. B. and Sestak A. L. (2005b) The mannose-binding lectin gene polymorphisms and systemic lupus erythematosus: two case-control studies and a meta-analysis. Arthritis Rheum 52, 3966-74.

Legoedec J., Gasque P., Jeanne J. F. and Fontaine M. (1995) Expression of the complement alternative pathway by human myoblasts in vitro: biosynthesis of C3, factor B, factor H and factor I. Eur J Immunol 25, 3460-6.

Leys A., Michielsen B., Leys M., Vanrenterghem Y., Missotten L. and Van Damme B. (1990) Subretinal neovascular membranes associated with chronic membranoproliferative glomerulonephritis type II. Graefes Arch Clin Exp Ophthalmol 228, 499-504.

Leys A., Van Damme B. and Verberckmoes R. (1996) Ocular complications of type 2 membranoproliferative glomerulonephritis. Nephrol Dial Transplant 11, 211-4.

Leys A., Vanrenterghem Y., Van Damme B., Snyers B., Pirson Y. and Leys M. (1991) Sequential observation of fundus changes in patients with long standing membranoproliferative glomerulonephritis type II (MPGN type II). Eur J Ophthalmol 1, 17-22.

Li M., Atmaca-Sonmez P., Othman M., Branham K. E., Khanna R., Wade M. S., Li Y., Liang L., Zareparsi S., Swaroop A. and Abecasis G. R. (2006) CFH haplotypes without the Y402H coding variant show strong association with susceptibility to age-related macular degeneration. Nat Genet 38, 1049-54.

Licht C., Heinen S., Jozsi M., Loschmann I., Saunders R. E., Perkins S. J., Waldherr R., Skerka C., Kirschfink M., Hoppe B. and Zipfel P. F. (2006) Deletion of Lys224 in regulatory domain 4 of Factor H reveals a novel pathomechanism for dense deposit disease (MPGN II). Kidney Int 70, 42-50.

Limnell V., Aittoniemi J., Vaarala O., Lehtimaki T., Laine S., Virtanen V., Palosuo T. and Miettinen A. (2002) Association of mannan-binding lectin deficiency with venous bypass graft occlusions in patients with coronary heart disease. Cardiology 98, 123-6.

Lipscombe R. J., Sumiya M., Hill A. V., Lau Y. L., Levinsky R. J., Summerfield J. A. and Turner M. W. (1992) High frequencies in African and non-African populations of independent mutations in the mannose binding protein gene. Hum Mol Genet 1, 709-15.

Lipscombe R. J., Sumiya M., Summerfield J. A. and Turner M. W. (1995) Distinct physicochemical characteristics of human mannose binding protein expressed by individuals of differing genotype. Immunology 85, 660-7.

Lockshin M. D. (2006) Update on antiphospholipid syndrome. Bull NYU Hosp Jt Dis 64, 57-9.

267

Lockshin M. D., Sammaritano L. R. and Schwartzman S. (2000) Validation of the Sapporo criteria for antiphospholipid syndrome. Arthritis Rheum 43, 440-3.

Logar D., Vidan-Jeras B., Dolzan V., Bozic B. and Kveder T. (2002) The contribution of HLA-DQB1 coding and QBP promoter alleles to anti-Ro alone autoantibody response in systemic lupus erythematosus. Rheumatology (Oxford) 41, 305-11.

Love P. E. and Santoro S. A. (1990) Antiphospholipid antibodies: anticardiolipin and the lupus anticoagulant in systemic lupus erythematosus (SLE) and in non-SLE disorders. Prevalence and clinical significance. Ann Intern Med 112, 682-98.

Lu J. H., Thiel S., Wiedemann H., Timpl R. and Reid K. B. (1990) Binding of the pentamer/hexamer forms of mannan-binding protein to zymosan activates the proenzyme C1r2C1s2 complex, of the classical pathway of complement, without involvement of C1q. J Immunol 144, 2287-94.

Lupski J. R. (1998) Genomic disorders: structural features of the genome can lead to DNA rearrangements and human disease traits. Trends Genet 14, 417-22.

Ma K., Simantov R., Zhang J. C., Silverstein R., Hajjar K. A. and McCrae K. R. (2000) High affinity binding of beta 2-glycoprotein I to human endothelial cells is mediated by annexin II. J Biol Chem 275, 15541-8.

Macfarlane R. G., Biggs R., Ash B. J. and Denson K. W. (1964) The Interaction of Factors 8 and 9. Br J Haematol 10, 530-41.

Machalinska A., Dziedziejko V., Mozolewska-Piotrowska K., Karczewicz D., Wiszniewska B. and Machalinski B. (2009) Elevated Plasma Levels of C3a Complement Compound in the Exudative Form of Age-Related Macular Degeneration. Ophthalmic Res 42, 54-59.

Madsen H. O., Garred P., Kurtzhals J. A., Lamm L. U., Ryder L. P., Thiel S. and Svejgaard A. (1994) A new frequent allele is the missing link in the structural polymorphism of the human mannan-binding protein. Immunogenetics 40, 37-44.

Madsen H. O., Garred P., Thiel S., Kurtzhals J. A., Lamm L. U., Ryder L. P. and Svejgaard A. (1995) Interplay between promoter and structural gene variants control basal serum level of mannan-binding protein. J Immunol 155, 3013-20.

Madsen H. O., Satz M. L., Hogh B., Svejgaard A. and Garred P. (1998) Different molecular events result in low protein levels of mannan-binding lectin in populations from southeast Africa and South America. J Immunol 161, 3169-75.

Majewski J., Schultz D. W., Weleber R. G., Schain M. B., Edwards A. O., Matise T. C., Acott T. S., Ott J. and Klein M. L. (2003) Age-related macular degeneration--a genome scan in extended families. Am J Hum Genet 73, 540-50.

268

Male D. A., Ormsby R. J., Ranganathan S., Giannakis E. and Gordon D. L. (2000) Complement factor H: sequence analysis of 221 kb of human genomic DNA containing the entire fH, fHR-1 and fHR-3 genes. Mol Immunol 37, 41-52.

Maller J., George S., Purcell S., Fagerness J., Altshuler D., Daly M. J. and Seddon J. M. (2006) Common variation in three genes, including a noncoding variant in CFH, strongly influences risk of age-related macular degeneration. Nat Genet 38, 1055-9.

Manderson A. P., Botto M. and Walport M. J. (2004) The role of complement in the development of systemic lupus erythematosus. Annu Rev Immunol 22, 431-56.

Marcum J. A., Atha D. H., Fritze L. M., Nawroth P., Stern D. and Rosenberg R. D. (1986) Cloned bovine aortic endothelial cells synthesize anticoagulantly active heparan sulfate proteoglycan. J Biol Chem 261, 7507-17.

Markiewski M. M., Nilsson B., Ekdahl K. N., Mollnes T. E. and Lambris J. D. (2007) Complement and coagulation: strangers or partners in crime? Trends Immunol 28, 184-92.

Martínez-Barricarte R., de Jorge E. G., Recalde S., Pinto S., Sánchez-Corral P., Lopez- Trascasa M., Garcia-Layana A. and de Cordoba S. R. (2007) Complement factor H haplotypes and copy number variations of the factor H-related genes in renal and ocular disorders. Mol Immunol 44, 3919-3920.

Mauff G., Brenden M., Braun-Stilwell M., Doxiadis G., Giles C. M., Hauptmann G., Rittner C., Schneider P. M., Stradmann-Bellinghausen B. and Uring-Lambert B. (1990) C4 reference typing report. Complement Inflamm 7, 193-212.

McCarroll S. A., Hadnott T. N., Perry G. H., Sabeti P. C., Zody M. C., Barrett J. C., Dallaire S., Gabriel S. B., Lee C., Daly M. J. and Altshuler D. M. (2006) Common deletion polymorphisms in the human genome. Nat Genet 38, 86-92.

McHugh N. J., Owen P., Cox B., Dunphy J. and Welsh K. (2006) MHC class II, tumour necrosis factor alpha, and lymphotoxin alpha gene haplotype associations with serological subsets of systemic lupus erythematosus. Ann Rheum Dis 65, 488- 94.

McKinney C., Merriman M. E., Chapman P. T., Gow P. J., Harrison A. A., Highton J., Jones P. B., McLean L., O'Donnell J. L., Pokorny V., Spellerberg M., Stamp L. K., Willis J., Steer S. and Merriman T. R. (2008) Evidence for an influence of chemokine ligand 3-like 1 (CCL3L1) gene copy number on susceptibility to rheumatoid arthritis. Ann Rheum Dis 67, 409-13.

McNeil H. P., Chesterman C. N. and Krilis S. A. (1991) Immunology and clinical importance of antiphospholipid antibodies. Adv Immunol 49, 193-280.

269

McRae J. L., Cowan P. J., Power D. A., Mitchelhill K. I., Kemp B. E., Morgan B. P. and Murphy B. F. (2001) Human factor H-related protein 5 (FHR-5). A new complement-associated protein. J Biol Chem 276, 6747-54.

McRae J. L., Duthy T. G., Griggs K. M., Ormsby R. J., Cowan P. J., Cromer B. A., McKinstry W. J., Parker M. W., Murphy B. F. and Gordon D. L. (2005) Human factor H-related protein 5 has cofactor activity, inhibits C3 convertase activity, binds heparin and C-reactive protein, and associates with lipoprotein. J Immunol 174, 6250-6.

Meri S. and Pangburn M. K. (1990) Discrimination between activators and nonactivators of the alternative pathway of complement: regulation via a sialic acid/polyanion binding site on factor H. Proc Natl Acad Sci U S A 87, 3982-6.

Mihlan M., Hebecker M., Dahse H. M., Halbich S., Huber-Lang M., Dahse R., Zipfel P. F. and Jozsi M. (2009) Human complement factor H-related protein 4 binds and recruits native pentameric C-reactive protein to necrotic cells. Mol Immunol 46, 335-44.

Miller M. E., Seals J., Kaye R. and Levitsky L. C. (1968) A familial plasma-associated defect of phagocytosis. Lancet 2, 60-63.

Minchinton R. M., Dean M. M., Clark T. R., Heatley S. and Mullighan C. G. (2002) Analysis of the relationship between mannose-binding lectin (MBL) genotype, MBL levels and function in an Australian blood donor population. Scand J Immunol 56, 630-41.

Misasi R., Huemer H. P., Schwaeble W., Solder E., Larcher C. and Dierich M. P. (1989) Human complement factor H: an additional gene product of 43 kDa isolated from human plasma shows cofactor activity for the cleavage of the third component of complement. Eur J Immunol 19, 1765-8.

Miyagawa S., Shinohara K., Nakajima M., Kidoguchi K., Fujita T., Fukumoto T., Yoshioka A., Dohi K. and Shirai T. (1998) Polymorphisms of HLA class II genes and autoimmune responses to Ro/SS-A-La/SS-B among Japanese subjects. Arthritis Rheum 41, 927-34.

Miyakis S., Lockshin M. D., Atsumi T., Branch D. W., Brey R. L., Cervera R., Derksen R. H., PG D. E. G., Koike T., Meroni P. L., Reber G., Shoenfeld Y., Tincani A., Vlachoyiannopoulos P. G. and Krilis S. A. (2006) International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost 4, 295-306.

Miyazaki M., Kiyohara Y., Yoshida A., Iida M., Nose Y. and Ishibashi T. (2005) The 5- year incidence and risk factors for age-related maculopathy in a general Japanese population: the Hisayama study. Invest Ophthalmol Vis Sci 46, 1907- 10.

270

Mok C. C., Tang S. S., To C. H. and Petri M. (2005) Incidence and risk factors of thromboembolism in systemic lupus erythematosus: a comparison of three ethnic groups. Arthritis Rheum 52, 2774-82.

Mold C., Kingzette M. and Gewurz H. (1984) C-reactive protein inhibits pneumococcal activation of the alternative pathway by increasing the interaction between factor H and C3b. J Immunol 133, 882-5.

Molina J. F., Molina J., Garcia C., Gharavi A. E., Wilson W. A. and Espinoza L. R. (1997) Ethnic differences in the clinical expression of systemic lupus erythematosus: a comparative study between African-Americans and Latin Americans. Lupus 6, 63-7.

Molokhia M. and McKeigue P. (2006) Systemic lupus erythematosus: genes versus environment in high risk populations. Lupus 15, 827-32.

Montes T., Goicoechea de Jorge E., Ramos R., Gomà M., Pujol O., Sánchez-Corral P. and Rodríguez de Córdoba S. (2008) Genetic deficiency of complement factor H in a patient with age-related macular degeneration and membranoproliferative glomerulonephritis. Mol Immunol 45, 2897-2904.

Mori M., Yamada R., Kobayashi K., Kawaida R. and Yamamoto K. (2005) Ethnic differences in allele frequency of autoimmune-disease-associated SNPs. J Hum Genet 50, 264-6.

Moser K. L., Neas B. R., Salmon J. E., Yu H., Gray-McGuire C., Asundi N., Bruner G. R., Fox J., Kelly J., Henshall S., Bacino D., Dietz M., Hogue R., Koelsch G., Nightingale L., Shaver T., Abdou N. I., Albert D. A., Carson C., Petri M., Treadwell E. L., James J. A. and Harley J. B. (1998) Genome scan of human systemic lupus erythematosus: evidence for linkage on chromosome 1q in African-American pedigrees. Proc Natl Acad Sci U S A 95, 14869-74.

Muhlfelder T. W., Niemetz J., Kreutzer D., Beebe D., Ward P. A. and Rosenfeld S. I. (1979) C5 chemotactic fragment induces leukocyte production of tissue factor activity: a link between complement and coagulation. J Clin Invest 63, 147-50.

Mullighan C. G., Marshall S. E. and Welsh K. I. (2000) Mannose binding lectin polymorphisms are associated with early age of disease onset and autoimmunity in common variable immunodeficiency. Scand J Immunol 51, 111-22.

Mullins R. F., Russell S. R., Anderson D. H. and Hageman G. S. (2000) Drusen associated with aging and age-related macular degeneration contain proteins common to extracellular deposits associated with atherosclerosis, elastosis, amyloidosis, and dense deposit disease. FASEB J 14, 835-46.

Murphy B., Georgiou T., Machet D., Hill P. and McRae J. (2002) Factor H-related protein-5: a novel component of human glomerular immune deposits. Am J Kidney Dis 39, 24-7.

271

Nathan C. (2002) Points of control in inflammation. Nature 420, 846-52.

Navratil J. S., Korb L. C. and Ahearn J. M. (1999) Systemic lupus erythematosus and complement deficiency: clues to a novel role for the classical complement pathway in the maintenance of immune tolerance. Immunopharmacology 42, 47- 52.

Nei M., Rogozin I. B. and Piontkivska H. (2000) Purifying selection and birth-and-death evolution in the ubiquitin gene family. Proc Natl Acad Sci U S A 97, 10866-71.

Nei M. and Rooney A. P. (2005) Concerted and birth-and-death evolution of multigene families. Annu Rev Genet 39, 121-52.

Neth O., Hann I., Turner M. W. and Klein N. J. (2001) Deficiency of mannose-binding lectin and burden of infection in children with malignancy: a prospective study. Lancet 358, 614-8.

Nguyen D. Q., Webber C. and Ponting C. P. (2006) Bias of selection on human copy- number variants. PLoS Genet 2, e20.

Nielsen H. E., Christensen K. C., Koch C., Thomsen B. S., Heegaard N. H. and Tranum- Jensen J. (1989) Hereditary, complete deficiency of complement factor H associated with recurrent meningococcal disease. Scand J Immunol 30, 711-8.

Nilsson U. R. and Muller-Eberhard H. J. (1965) Isolation of Beta-1F-Globulin from Human Serum and its Characterization as the Fifth Component of Complement J Exp Med 122, 277-298.

Nilsson U. R., Nilsson B., Storm K. E., Sjolin-Forsberg G. and Hallgren R. (1992) Hereditary dysfunction of the third component of complement associated with a systemic lupus erythematosus-like syndrome and meningococcal meningitis. Arthritis Rheum 35, 580-6.

Noris M., Brioschi S., Caprioli J., Todeschini M., Bresin E., Porrati F., Gamba S. and Remuzzi G. (2003) Familial haemolytic uraemic syndrome and an MCP mutation. Lancet 362, 1542-7.

Ogden C. A., deCathelineau A., Hoffmann P. R., Bratton D., Ghebrehiwet B., Fadok V. A. and Henson P. M. (2001) C1q and mannose binding lectin engagement of cell surface calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J Exp Med 194, 781-95.

Ohali M., Maizlish Y., Abramov H., Schlesinger M., Bransky D. and Lugassy G. (2005) Complement profile in childhood immune thrombocytopenic purpura: a prospective pilot study. Ann Hematol 84, 812-5.

Ohlenschlaeger T., Garred P., Madsen H. O. and Jacobsen S. (2004) Mannose-binding lectin variant alleles and the risk of arterial thrombosis in systemic lupus erythematosus. N Engl J Med 351, 260-7. 272

Ohtsuka H., Imamura T., Matsushita M., Tanase S., Okada H., Ogawa M. and Kambara T. (1993) Thrombin generates monocyte chemotactic activity from complement factor H. Immunology 80, 140-5.

Okamoto H., Umeda S., Obazawa M., Minami M., Noda T., Mizota A., Honda M., Tanaka M., Koyama R., Takagi I., Sakamoto Y., Saito Y., Miyake Y. and Iwata T. (2006) Complement factor H polymorphisms in Japanese population with age- related macular degeneration. Mol Vis 12, 156-8.

Oppermann M., Manuelian T., Jozsi M., Brandt E., Jokiranta T. S., Heinen S., Meri S., Skerka C., Gotze O. and Zipfel P. F. (2006) The C-terminus of complement regulator Factor H mediates target recognition: evidence for a compact conformation of the native protein. Clin Exp Immunol 144, 342-52.

Orth S. R. and Ritz E. (1998) The nephrotic syndrome. N Engl J Med 338, 1202-11.

Palmer C. N., Doney A. S., Lee S. P., Murrie I., Ismail T., Macgregor D. F. and Mukhopadhyay S. (2006) Glutathione S-transferase M1 and P1 genotype, passive smoking, and peak expiratory flow in asthma. Pediatrics 118, 710-6.

Pangburn M. K., Schreiber R. D. and Muller-Eberhard H. J. (1977) Human complement C3b inactivator: isolation, characterization, and demonstration of an absolute requirement for the serum protein beta1H for cleavage of C3b and C4b in solution. J Exp Med 146, 257-70.

Park C. T. and Wright S. D. (1996) Plasma lipopolysaccharide-binding protein is found associated with a particle containing apolipoprotein A-I, phospholipid, and factor H-related proteins. J Biol Chem 271, 18054-60.

Pavenstadt H., Kriz W. and Kretzler M. (2003) Cell biology of the glomerular podocyte. Physiol Rev 83, 253-307.

Penfold P. L., Madigan M. C., Gillies M. C. and Provis J. M. (2001) Immunological and aetiological aspects of macular degeneration. Prog Retin Eye Res 20, 385-414.

Perry G. H., Ben-Dor A., Tsalenko A., Sampas N., Rodriguez-Revenga L., Tran C. W., Scheffer A., Steinfeld I., Tsang P., Yamada N. A., Park H. S., Kim J. I., Seo J. S., Yakhini Z., Laderman S., Bruhn L. and Lee C. (2008) The fine-scale and complex architecture of human copy-number variation. Am J Hum Genet 82, 685-95.

Petersen S. V., Thiel S. and Jensenius J. C. (2001) The mannan-binding lectin pathway of complement activation: biology and disease association. Mol Immunol 38, 133- 49.

Peterslund N. A., Koch C., Jensenius J. C. and Thiel S. (2001) Association between deficiency of mannose-binding lectin and severe infections after chemotherapy. Lancet 358, 637-8.

273

Petri M. (1997) Clinical and management aspects of the antiphospholipid syndrome. In Dubois' Lupus Erythematosus (Edited by Wallace D. J. and Hahn B. H.), p. 57. Williams & Wilkins, Baltimore.

Petri M. (2000) Epidemiology of the antiphospholipid antibody syndrome. J Autoimmun 15, 145-51.

Petri M. (2005) Lupus in baltimore: evidence-based 'clinical pearls' from the Hopkins Lupus Cohort. Lupus 14, 970-973.

Piao W., Liu C.-C., Kao A. H., Manzi S., Vogt M. T., Ruffing M. J. and Ahearn J. M. (2007) Mannose-Binding Lectin is a Disease-Modifying Factor in North AMerican Patients with Systemic Lupus Erythematosus. J Rheum 34, 1506-1513.

Picillo U., Migliaresi S., Marcialis M. R., Longobardo A., La Palombara F. and Tirri G. (1992) Longitudinal survey of anticardiolipin antibodies in systemic lupus erythematosus. Relationships with clinical manifestations and disease activity in an Italian series. Scand J Rheumatol 21, 271-6.

Pickering M. C., Botto M., Taylor P. R., Lachmann P. J. and Walport M. J. (2000) Systemic lupus erythematosus, complement deficiency, and apoptosis. Adv Immunol 76, 227-324.

Pickering M. C. and Cook H. T. (2008) Translational mini-review series on complement factor H: renal diseases associated with complement factor H: novel insights from humans and animals. Clin Exp Immunol 151, 210-30.

Pickering M. C., Cook H. T., Warren J., Bygrave A. E., Moss J., Walport M. J. and Botto M. (2002) Uncontrolled C3 activation causes membranoproliferative glomerulonephritis in mice deficient in complement factor H. Nat Genet 31, 424- 8.

Pickering M. C., de Jorge E. G., Martinez-Barricarte R., Recalde S., Garcia-Layana A., Rose K. L., Moss J., Walport M. J., Cook H. T., de Cordoba S. R. and Botto M. (2007) Spontaneous hemolytic uremic syndrome triggered by complement factor H lacking surface recognition domains. J Exp Med 204, 1249-56.

Pierangeli S. S., Girardi G., Vega-Ostertag M., Liu X., Espinola R. G. and Salmon J. (2005) Requirement of activation of complement C3 and C5 for antiphospholipid antibody-mediated thrombophilia. Arthritis Rheum 52, 2120-4.

Pierangeli S. S., Vega-Ostertag M. E. and Gonzalez E. B. (2007) New targeted therapies for treatment of thrombosis in antiphospholipid syndrome. Expert Rev Mol Med 9, 1-15.

Pisitkun P., Deane J. A., Difilippantonio M. J., Tarasenko T., Satterthwaite A. B. and Bolland S. (2006) Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science 312, 1669-72.

274

Platt J. L., Dalmasso A. P., Lindman B. J., Ihrcke N. S. and Bach F. H. (1991) The role of C5a and antibody in the release of heparan sulfate from endothelial cells. Eur J Immunol 21, 2887-90.

Polley M. J. and Nachman R. L. (1983) Human platelet activation by C3a and C3a des- arg. J Exp Med 158, 603-15.

Pons-Estel G. J., Alarcon G. S., Scofield L., Reinlib L. and Cooper G. S. (2009) Understanding the Epidemiology and Progression of Systemic Lupus Erythematosus. Semin Arthritis Rheum.

Prosser B. E., Johnson S., Roversi P., Herbert A. P., Blaum B. S., Tyrrell J., Jowitt T. A., Clark S. J., Tarelli E., Uhrin D., Barlow P. N., Sim R. B., Day A. J. and Lea S. M. (2007) Structural basis for complement factor H linked age-related macular degeneration. J Exp Med 204, 2277-2283.

Pussell B. A., Bourke E., Nayef M., Morris S. and Peters D. K. (1980) Complement deficiency and nephritis. A report of a family. Lancet 1, 675-7.

Rahman A. and Isenberg D. A. (2008) Systemic lupus erythematosus. N Engl J Med 358, 929-39.

Reading P. C., Hartley C. A., Ezekowitz R. A. and Anders E. M. (1995) A serum mannose-binding lectin mediates complement-dependent lysis of influenza virus- infected cells. Biochem Biophys Res Commun 217, 1128-36.

Redon R., Ishikawa S., Fitch K. R., Feuk L., Perry G. H., Andrews T. D., Fiegler H., Shapero M. H., Carson A. R., Chen W., Cho E. K., Dallaire S., Freeman J. L., Gonzalez J. R., Gratacos M., Huang J., Kalaitzopoulos D., Komura D., MacDonald J. R., Marshall C. R., Mei R., Montgomery L., Nishimura K., Okamura K., Shen F., Somerville M. J., Tchinda J., Valsesia A., Woodwark C., Yang F., Zhang J., Zerjal T., Zhang J., Armengol L., Conrad D. F., Estivill X., Tyler-Smith C., Carter N. P., Aburatani H., Lee C., Jones K. W., Scherer S. W. and Hurles M. E. (2006) Global variation in copy number in the human genome. Nature 444, 444-54.

Ren G., Doshi M., Hack B. K., Alexander J. J. and Quigg R. J. (2002) Isolation and characterization of a novel rat factor H-related protein that is up-regulated in glomeruli under complement attack. J Biol Chem 277, 48351-8.

Rezende S. M., Simmonds R. E. and Lane D. A. (2004) Coagulation, inflammation, and apoptosis: different roles for protein S and the protein S-C4b binding protein complex. Blood 103, 1192-201.

Rhodes B. and Vyse T. J. (2008) The genetics of SLE: an update in the light of genomewide association studies. Rheumatology 47, 1603-11.

Richani K., Soto E., Romero R., Espinoza J., Chaiworapongsa T., Nien J. K., Edwin S., Kim Y. M., Hong J. S. and Mazor M. (2005) Normal pregnancy is characterized 275

by systemic activation of the complement system. J Matern Fetal Neonatal Med 17, 239-45.

Ripoche J., Al Salihi A., Rousseaux J. and Fontaine M. (1984) Isolation of two molecular populations of human complement factor H by hydrophobic affinity chromatography. Biochem J 221, 89-96.

Ripoche J., Day A. J., Harris T. J. and Sim R. B. (1988) The complete amino acid sequence of human complement factor H. Biochem J 249, 593-602.

Rodríguez de Córdoba S., Esparza-Gordillo J., Goicoechea de Jorge E., Lopez- Trascasa M. and Sánchez-Corral P. (2004) The human complement factor H: functional roles, genetic variations and disease associations. Mol Immunol 41, 355-367.

Rodríguez de Córdoba S. a. G. d. J., E. . (2008) Translational Mini-Review Series on Complement Factor H: Genetics and disease associations of human complement factor H. Clin Exp Immunol 151, 1-13.

Roos A., Garred P., Wildenberg M. E., Lynch N. J., Munoz J. R., Zuiverloon T. C., Bouwman L. H., Schlagwein N., Fallaux van den Houten F. C., Faber-Krol M. C., Madsen H. O., Schwaeble W. J., Matsushita M., Fujita T. and Daha M. R. (2004) Antibody-mediated activation of the classical pathway of complement may compensate for mannose-binding lectin deficiency. Eur J Immunol 34, 2589-98.

Roubey R. A., Buxton S. G. and investigators. A. (2004) The Antiphospholipid Sundrome Collaborative Registry (APSCORE): Report on the first 546 subjects. S640.

Rugonfalvi-Kiss S., Endresz V., Madsen H. O., Burian K., Duba J., Prohaszka Z., Karadi I., Romics L., Gonczol E., Fust G. and Garred P. (2002) Association of Chlamydia pneumoniae with coronary artery disease and its progression is dependent on the modifying effect of mannose-binding lectin. Circulation 106, 1071-6.

Sacco R. L., Boden-Albala B., Gan R., Chen X., Kargman D. E., Shea S., Paik M. C. and Hauser W. A. (1998) Stroke incidence among white, black, and Hispanic residents of an urban community: the Northern Manhattan Stroke Study. Am J Epidemiol 147, 259-68.

Sahu A. and Pangburn M. K. (1993) Identification of multiple sites of interaction between heparin and the complement system. Mol Immunol 30, 679-84.

Santos I. K., Costa C. H., Krieger H., Feitosa M. F., Zurakowski D., Fardin B., Gomes R. B., Weiner D. L., Harn D. A., Ezekowitz R. A. and Epstein J. E. (2001) Mannan- binding lectin enhances susceptibility to visceral leishmaniasis. Infect Immun 69, 5212-5.

Sarks S. H. (1976) Ageing and degeneration in the macular region: a clinico-pathological study. Br J Ophthalmol 60, 324-41. 276

Sastry K., Herman G. A., Day L., Deignan E., Bruns G., Morton C. C. and Ezekowitz R. A. (1989) The human mannose-binding protein gene. Exon structure reveals its evolutionary relationship to a human pulmonary surfactant gene and localization to chromosome 10. J Exp Med 170, 1175-89.

Saunders R. E., Abarrategui-Garrido C., Fremeaux-Bacchi V., Goicoechea de Jorge E., Goodship T. H., Lopez Trascasa M., Noris M., Ponce Castro I. M., Remuzzi G., Rodriguez de Cordoba S., Sanchez-Corral P., Skerka C., Zipfel P. F. and Perkins S. J. (2007) The interactive Factor H-atypical hemolytic uremic syndrome mutation database and website: update and integration of membrane cofactor protein and Factor I mutations with structural models. Hum Mutat 28, 222-34.

Saunders R. E., Goodship T. H., Zipfel P. F. and Perkins S. J. (2006) An interactive web database of factor H-associated hemolytic uremic syndrome mutations: insights into the structural consequences of disease-associated mutations. Hum Mutat 27, 21-30.

Saxena K., Kitzmiller K. J., Wu Y. L., Zhou B., Esack N., Hiremath L., Chung E. K., Yang Y. and Yu C. Y. (2009) Great genotypic and phenotypic diversities associated with copy-number variations of complement C4 and RP-C4-CYP21-TNX (RCCX) modules: a comparison of Asian-Indian and European American populations. Mol Immunol 46, 1289-303.

Schlesinger M., Nave Z., Levy Y., Slater P. E. and Fishelson Z. (1990) Prevalence of hereditary properdin, C7 and C8 deficiencies in patients with meningococcal infections. Clin Exp Immunol 81, 423-7.

Schmidt S., Klaver C., Saunders A., Postel E., De La Paz M., Agarwal A., Small K., Udar N., Ong J., Chalukya M., Nesburn A., Kenney C., Domurath R., Hogan M., Mah T., Conley Y., Ferrell R., Weeks D., de Jong P. T., van Duijn C., Haines J., Pericak-Vance M. and Gorin M. (2002) A pooled case-control study of the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet 23, 209-23.

Scholl H. P., Charbel Issa P., Walier M., Janzer S., Pollok-Kopp B., Borncke F., Fritsche L. G., Chong N. V., Fimmers R., Wienker T., Holz F. G., Weber B. H. and Oppermann M. (2008) Systemic complement activation in age-related macular degeneration. PLoS One 3, e2593.

Schouten J. P., McElgunn C. J., Waaijer R., Zwijnenburg D., Diepvens F. and Pals G. (2002) Relative quantification of 40 nucleic acid sequences by multiplex ligation- dependent probe amplification. Nucleic Acids Res 30, e57.

Schved J. F., Dupuy-Fons C., Biron C., Quere I. and Janbon C. (1994) A prospective epidemiological study on the occurrence of antiphospholipid antibody: the Montpellier Antiphospholipid (MAP) Study. Haemostasis 24, 175-82.

277

Schwaeble W., Zwirner J., Schulz T. F., Linke R. P., Dierich M. P. and Weiss E. H. (1987) Human complement factor H: expression of an additional truncated gene product of 43 kDa in human liver. Eur J Immunol 17, 1485-9.

Schwaeble W. J. and Reid K. B. (1999) Does properdin crosslink the cellular and the humoral immune response? Immunol Today 20, 17-21.

Sebat J., Lakshmi B., Troge J., Alexander J., Young J., Lundin P., Maner S., Massa H., Walker M., Chi M., Navin N., Lucito R., Healy J., Hicks J., Ye K., Reiner A., Gilliam T. C., Trask B., Patterson N., Zetterberg A. and Wigler M. (2004) Large- scale copy number polymorphism in the human genome. Science 305, 525-8.

Seddon J. M., Santangelo S. L., Book K., Chong S. and Cote J. (2003) A genomewide scan for age-related macular degeneration provides evidence for linkage to several chromosomal regions. Am J Hum Genet 73, 780-90.

Seelen M. A., Trouw L. A., van der Hoorn J. W., Fallaux-van den Houten F. C., Huizinga T. W., Daha M. R. and Roos A. (2003) Autoantibodies against mannose-binding lectin in systemic lupus erythematosus. Clin Exp Immunol 134, 335-43.

Seelen M. A., van der Bijl E. A., Trouw L. A., Zuiverloon T. C., Munoz J. R., Fallaux-van den Houten F. C., Schlagwein N., Daha M. R., Huizinga T. W. and Roos A. (2005) A role for mannose-binding lectin dysfunction in generation of autoantibodies in systemic lupus erythematosus. Rheumatology 44, 111-9.

Sestak A. L., Nath S. K., Sawalha A. H. and Harley J. B. (2007) Current status of lupus genetics. Arthritis Res Ther 9, 210.

Sethi S., Gamez J. D., Vrana J. A., Theis J. D., Bergen H. R., 3rd, Zipfel P. F., Dogan A. and Smith R. J. (2009) Glomeruli of Dense Deposit Disease contain components of the alternative and terminal complement pathway. Kidney Int 75, 952-60.

Shapiro S. S. (1996) The lupus anticoagulant/antiphospholipid syndrome. Annu Rev Med 47, 533-53.

Shi W., Krilis S. A., Chong B. H., Gordon S. and Chesterman C. N. (1990) Prevalence of lupus anticoagulant and anticardiolipin antibodies in a healthy population. Aust N Z J Med 20, 231-6.

Shinawi M. and Cheung S. W. (2008) The array CGH and its clinical applications. Drug Discov Today 13, 760-770.

Shoenfeld Y. (2003) Etiology and pathogenetic mechanisms of the anti-phospholipid syndrome unraveled. Trends Immunol 24, 2-4.

Simantov R., LaSala J. M., Lo S. K., Gharavi A. E., Sammaritano L. R., Salmon J. E. and Silverstein R. L. (1995) Activation of cultured vascular endothelial cells by antiphospholipid antibodies. J Clin Invest 96, 2211-9.

278

Sims P. J., Faioni E. M., Wiedmer T. and Shattil S. J. (1988) Complement proteins C5b- 9 cause release of membrane vesicles from the platelet surface that are enriched in the membrane receptor for coagulation factor Va and express prothrombinase activity. J Biol Chem 263, 18205-12.

Sjoberg A. P., Trouw L. A., Clark S. J., Sjolander J., Heinegard D., Sim R. B., Day A. J. and Blom A. M. (2007a) The factor H variant associated with age-related macular degeneration (His-384) and the non-disease-associated form bind differentially to C-reactive protein, fibromodulin, DNA, and necrotic cells. J Biol Chem 282, 10894-900.

Sjoberg A. P., Trouw L. A., Clark S. J., Sjolander J., Heinegard D., Sim R. B., Day A. J. and Blom A. M. (2007b) The factor H variant associated with age-related macular degeneration (His-384) and the non-disease-associated form bind differentially to C-reactive protein, fibromodulin, DNA, and necrotic cells. J Biol Chem 282, 10894-900.

Skerka C., Hellwage J., Weber W., Tilkorn A., Buck F., Marti T., Kampen E., Beisiegel U. and Zipfel P. F. (1997) The human factor H-related protein 4 (FHR-4). A novel short consensus repeat-containing protein is associated with human triglyceride- rich lipoproteins. J Biol Chem 272, 5627-34.

Skerka C., Lauer N., Weinberger A. A., Keilhauer C. N., Suhnel J., Smith R., Schlotzer- Schrehardt U., Fritsche L., Heinen S., Hartmann A., Weber B. H. and Zipfel P. F. (2007) Defective complement control of factor H (Y402H) and FHL-1 in age- related macular degeneration. Mol Immunol 44, 3398-406.

Skerka C., Licht C., Mengel M., Uzonyi B., Strobel S., Zipfel P. F. and Józsi M. (2009) Autoimmune forms of thrombotic micorangiopathy and membranoproliferative glomerulonephritis: Indications for a disease spectrum and common pathogenic principles. Mol Immunol 46, 2801-2807.

Soothill J. F. and Harvey B. A. (1976) Defective opsonization. A common immunity deficiency. Arch Dis Child 51, 91-9.

Spencer K. L., Hauser M. A., Olson L. M., Schmidt S., Scott W. K., Gallins P., Agarwal A., Postel E. A., Pericak-Vance M. A. and Haines J. L. (2008) Deletion of CFHR3 and CFHR1 genes in age-related macular degeneration. Hum Mol Genet 17, 971-7.

Stankiewicz P., Shaw C. J., Dapper J. D., Wakui K., Shaffer L. G., Withers M., Elizondo L., Park S. S. and Lupski J. R. (2003) Genome architecture catalyzes nonrecurrent chromosomal rearrangements. Am J Hum Genet 72, 1101-16.

Stefansson H., Helgason A., Thorleifsson G., Steinthorsdottir V., Masson G., Barnard J., Baker A., Jonasdottir A., Ingason A., Gudnadottir V. G., Desnica N., Hicks A., Gylfason A., Gudbjartsson D. F., Jonsdottir G. M., Sainz J., Agnarsson K., Birgisdottir B., Ghosh S., Olafsdottir A., Cazier J. B., Kristjansson K., Frigge M.

279

L., Thorgeirsson T. E., Gulcher J. R., Kong A. and Stefansson K. (2005) A common inversion under selection in Europeans. Nat Genet 37, 129-37.

Steffensen R., Thiel S., Varming K., Jersild C. and Jensenius J. C. (2000) Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J Immunol Methods 241, 33-42.

Stranger B. E., Forrest M. S., Dunning M., Ingle C. E., Beazley C., Thorne N., Redon R., Bird C. P., de Grassi A., Lee C., Tyler-Smith C., Carter N., Scherer S. W., Tavare S., Deloukas P., Hurles M. E. and Dermitzakis E. T. (2007) Relative impact of nucleotide and copy number variation on gene expression phenotypes. Science 315, 848-53.

Sullivan K. E., Wooten C., Goldman D. and Petri M. (1996) Mannose-binding protein genetic polymorphisms in black patients with systemic lupus erythematosus. Arthritis Rheum 39, 2046-51.

Sumiya M., Super M., Tabona P., Levinsky R. J., Arai T., Turner M. W. and Summerfield J. A. (1991) Molecular basis of opsonic defect in immunodeficient children. Lancet 337, 1569-70.

Super M., Thiel S., Lu J., Levinsky R. J. and Turner M. W. (1989) Association of low levels of mannan-binding protein with a common defect of opsonisation. Lancet 2, 1236-9.

Takahashi R., Tsutsumi A., Ohtani K., Muraki Y., Goto D., Matsumoto I., Wakamiya N. and Sumida T. (2005) Association of mannose binding lectin (MBL) gene polymorphism and serum MBL concentration with characteristics and progression of systemic lupus erythematosus. Ann Rheum Dis 64, 311-4.

Tan E. M., Cohen A. S., Fries J. F., Masi A. T., McShane D. J., Rothfield N. F., Schaller J. G., Talal N. and Winchester R. J. (1982) The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25, 1271-7.

Taylor M. E., Brickell P. M., Craig R. K. and Summerfield J. A. (1989) Structure and evolutionary origin of the gene encoding a human serum mannose-binding protein. Biochem J 262, 763-71.

Taylor M. E. and Summerfield J. A. (1987) Carbohydrate-binding proteins of human serum: isolation of two mannose/fucose-specific lectins. Biochim Biophys Acta 915, 60-7.

Tedesco F., Pausa M., Nardon E., Introna M., Mantovani A. and Dobrina A. (1997) The cytolytically inactive terminal complement complex activates endothelial cells to express adhesion molecules and tissue factor procoagulant activity. J Exp Med 185, 1619-27.

280

Teillet F., Dublet B., Andrieu J. P., Gaboriaud C., Arlaud G. J. and Thielens N. M. (2005) The two major oligomeric forms of human mannan-binding lectin: chemical characterization, carbohydrate-binding properties, and interaction with MBL- associated serine proteases. J Immunol 174, 2870-7.

Tenner A. J., Robinson S. L. and Ezekowitz R. A. (1995) Mannose binding protein (MBP) enhances mononuclear phagocyte function via a receptor that contains the 126,000 M(r) component of the C1q receptor. Immunity 3, 485-93.

Thakkinstian A., Han P., McEvoy M., Smith W., Hoh J., Magnusson K., Zhang K. and Attia J. (2006) Systematic review and meta-analysis of the association between complement factor H Y402H polymorphisms and age-related macular degeneration. Hum Mol Genet 15, 2784-90.

Thiel S., Holmskov U., Hviid L., Laursen S. B. and Jensenius J. C. (1992) The concentration of the C-type lectin, mannan-binding protein, in human plasma increases during an acute phase response. Clin Exp Immunol 90, 31-5.

Thompson C. L., Klein B. E. K., Klein R., Xu Z., Capriotti J., Joshi T., Leontiev D., Lee K. E., Elston R. C. and Iyengar S. K. (2007) Complement factor H and hemicentin-1 in age-related macular degeneration and renal phenotypes. Hum Mol Genet 16, 2135-2148.

Thompson R. A. and Winterborn M. H. (1981) Hypocomplementaemia due to a genetic deficiency of beta 1H globulin. Clin Exp Immunol 46, 110-9.

Timmann C., Leippe M. and Horstmann R. D. (1991) Two major serum components antigenically related to complement factor H are different glycosylation forms of a single protein with no factor H-like complement regulatory functions. J Immunol 146, 1265-70.

Toloza S. M., Uribe A. G., McGwin G., Jr., Alarcon G. S., Fessler B. J., Bastian H. M., Vila L. M., Wu R., Shoenfeld Y., Roseman J. M. and Reveille J. D. (2004) Systemic lupus erythematosus in a multiethnic US cohort (LUMINA). XXIII. Baseline predictors of vascular events. Arthritis Rheum 50, 3947-57.

Trager J. and Ward M. M. (2001) Mortality and causes of death in systemic lupus erythematosus. Curr Opin Rheumatol 13, 345-51.

Tsokos G. C. (2004) Exploring complement activation to develop biomarkers for systemic lupus erythematosus. Arthritis Rheum 50, 3404-7.

Turner M. W. (1996) Mannose-binding lectin: the pluripotent molecule of the innate immune system. Immunol Today 17, 532-40.

Tuzun E., Sharp A. J., Bailey J. A., Kaul R., Morrison V. A., Pertz L. M., Haugen E., Hayden H., Albertson D., Pinkel D., Olson M. V. and Eichler E. E. (2005) Fine- scale structural variation of the human genome. Nat Genet 37, 727-32.

281

Urban A. E., Korbel J. O., Selzer R., Richmond T., Hacker A., Popescu G. V., Cubells J. F., Green R., Emanuel B. S., Gerstein M. B., Weissman S. M. and Snyder M. (2006) High-resolution mapping of DNA copy alterations in human chromosome 22 using high-density tiling oligonucleotide arrays. Proc Natl Acad Sci U S A 103, 4534-4539.

Venables J. P., Strain L., Routledge D., Bourn D., Powell H. M., Warwicker P., Diaz- Torres M. L., Sampson A., Mead P., Webb M., Pirson Y., Jackson M. S., Hughes A., Wood K. M., Goodship J. A. and Goodship T. H. (2006) Atypical haemolytic uraemic syndrome associated with a hybrid complement gene. PLoS Med 3, e431.

Villarreal J., Crosdale D., Ollier W., Hajeer A., Thomson W., Ordi J., Balada E., Villardell M., Teh L. S. and Poulton K. (2001) Mannose binding lectin and FcgammaRIIa (CD32) polymorphism in Spanish systemic lupus erythematosus patients. Rheumatology 40, 1009-12.

Vogt B. A., Wyatt R. J., Burke B. A., Simonton S. C. and Kashtan C. E. (1995) Inherited factor H deficiency and collagen type III glomerulopathy. Pediatr Nephrol 9, 11-5.

Vyse T. J., Morley B. J., Bartok I., Theodoridis E. L., Davies K. A., Webster A. D. and Walport M. J. (1996) The molecular basis of hereditary complement factor I deficiency. J Clin Investig 97, 925-933.

Wallis R. and Cheng J. Y. (1999) Molecular defects in variant forms of mannose-binding protein associated with immunodeficiency. J Immunol 163, 4953-9.

Walport M. J. (2001) Complement- First of Two Parts. N Eng J Med 344, 1058-1066.

Wang Y., Rollins S. A., Madri J. A. and Matis L. A. (1995) Anti-C5 monoclonal antibody therapy prevents collagen-induced arthritis and ameliorates established disease. Proc Natl Acad Sci U S A 92, 8955-9.

Warwicker P., Goodship T. H., Donne R. L., Pirson Y., Nicholls A., Ward R. M., Turnpenny P. and Goodship J. A. (1998) Genetic studies into inherited and sporadic hemolytic uremic syndrome. Kidney Int 53, 836-44.

Weber M., Hayem G. and Meyer O. (2001) The Sapporo criteria for antiphospholipid syndrome: comment on the article by Lockshin et al. Arthritis Rheum 44, 1965-6.

Weeks D. E., Conley Y. P., Tsai H.-j., Mah T. S., Rosenfeld P. J., Paul T. O., Eller A. W., Morse L. S., Dailey J. P., Ferrell R. E. and Gorin M. B. (2001) Age-related maculopathy: an expanded genome-wide scan with evidence of susceptibility loci within the 1q31 and 17q25 regions. Am J Ophthalmol 132, 682-692.

Weeks D. E., Conley Y. P., Tsai H.-J., Mah T. S., Schmidt S., Postel E. A., Agarwal A., Haines J. L., Pericak-Vance M. A., Rosenfeld P. J., Paul T. O., Eller A. W., Morse L. S., Dailey J. P., Ferrell R. E. and Gorin M. B. (2004) Age-Related

282

Maculopathy: A Genomewide Scan with Continued Evidence of Susceptibility Loci within the 1q31, 10q26, and 17q25 Regions. Am J Hum Genet 75, 174-189.

Weiler J. M., Daha M. R., Austen K. F. and Fearon D. T. (1976) Control of the amplification convertase of complement by the plasma protein beta1H. Proc Natl Acad Sci U S A 73, 3268-72.

West C. D. and McAdams A. J. (1999) The alternative pathway C3 convertase and glomerular deposits. Pediatr Nephrol 13, 448-53.

Weyand C. M., McCarthy T. G. and Goronzy J. J. (1995) Correlation between disease phenotype and genetic heterogeneity in rheumatoid arthritis. J Clin Invest 95, 2120-6.

Whaley K. and Ruddy S. (1976) Modulation of C3b hemolytic activity by a plasma protein distinct from C3b inactivator. Science 193, 1011-3.

Whaley K. and Thompson R. A. (1978) Requirements for Beta1H globulin and C3b inactivator in the control of the alternative complement pathway in human serum Immunology 35, 1045-1049.

Wilson W. A., Gharavi A. E., Koike T., Lockshin M. D., Branch D. W., Piette J. C., Brey R., Derksen R., Harris E. N., Hughes G. R., Triplett D. A. and Khamashta M. A. (1999) International consensus statement on preliminary classification criteria for definite antiphospholipid syndrome: report of an international workshop. Arthritis Rheum 42, 1309-11.

Wirthmueller U., Dewald B., Thelen M., Schafer M. K., Stover C., Whaley K., North J., Eggleton P., Reid K. B. and Schwaeble W. J. (1997) Properdin, a positive regulator of complement activation, is released from secondary granules of stimulated peripheral blood neutrophils. J Immunol 158, 4444-51.

Wojta J., Huber K. and Valent P. (2003) New aspects in thrombotic research: complement induced switch in mast cells from a profibrinolytic to a prothrombotic phenotype. Pathophysiol Haemost Thromb 33, 438-41.

Wojta J., Kaun C., Zorn G., Ghannadan M., Hauswirth A. W., Sperr W. R., Fritsch G., Printz D., Binder B. R., Schatzl G., Zwirner J., Maurer G., Huber K. and Valent P. (2002) C5a stimulates production of plasminogen activator inhibitor-1 in human mast cells and basophils. Blood 100, 517-23.

Wong T. Y., Loon S. C. and Saw S. M. (2006) The epidemiology of age related eye diseases in Asia. Br J Ophthalmol 90, 506-11.

Wu Y. L., Higgins G. C., Rennebohm R. M., Chung E. K., Yang Y., Zhou B., Nagaraja H. N., Birmingham D. J., Rovin B. H., Hebert L. A. and Yu C. Y. (2006) Three distinct profiles of serum complement C4 proteins in pediatric systemic lupus erythematosus (SLE) patients: tight associations of complement C4 and C3 protein levels in SLE but not in healthy subjects. Adv Exp Med Biol 586, 227-47. 283

Wu Y. L., Savelli S. L., Yang Y., Zhou B., Rovin B. H., Birmingham D. J., Nagaraja H. N., Hebert L. A. and Yu C. Y. (2007) Sensitive and specific real-time polymerase chain reaction assays to accurately determine copy number variations (CNVs) of human complement C4A, C4B, C4-long, C4-short, and RCCX modules: elucidation of C4 CNVs in 50 consanguineous subjects with defined HLA genotypes. J Immunol 179, 3012-25.

Yamashina M., Ueda E., Kinoshita T., Takami T., Ojima A., Ono H., Tanaka H., Kondo N., Orii T., Okada N. and et al. (1990) Inherited complete deficiency of 20- kilodalton homologous restriction factor (CD59) as a cause of paroxysmal nocturnal hemoglobinuria. N Engl J Med 323, 1184-9.

Yang Y., Chung E. K., Wu Y. L., Savelli S. L., Nagaraja H. N., Zhou B., Hebert M., Jones K. N., Shu Y., Kitzmiller K., Blanchong C. A., McBride K. L., Higgins G. C., Rennebohm R. M., Rice R. R., Hackshaw K. V., Roubey R. A., Grossman J. M., Tsao B. P., Birmingham D. J., Rovin B. H., Hebert L. A. and Yu C. Y. (2007) Gene copy-number variation and associated polymorphisms of complement component C4 in human systemic lupus erythematosus (SLE): low copy number is a risk factor for and high copy number is a protective factor against SLE susceptibility in European Americans. Am J Hum Genet 80, 1037-54.

Yang Y., Chung E. K., Zhou B., Blanchong C. A., Yu C. Y., Fust G., Kovacs M., Vatay A., Szalai C., Karadi I. and Varga L. (2003) Diversity in Intrinsic Strengths of the Human Complement System: Serum C4 Protein Concentrations Correlate with C4 Gene Size and Polygenic Variations, Hemolytic Activities, and Body Mass Index. J Immunol 171, 2734-2745.

Yang Y., Chung E. K., Zhou B., Lhotta K., Hebert L. A., Birmingham D. J., Rovin B. H. and Yu C. Y. (2004) The intricate role of complement component C4 in human systemic lupus erythematosus. Curr Dir Autoimmun 7, 98-132.

Yates J. R. W., Sepp T., Matharu B. K., Khan J. C., Thurlby D. A., Shahid H., Clayton D. G., Hayward C., Morgan J., Wright A. F., Armbrecht A. M., Dhillon B., Deary I. J., Redmond E., Bird A. C., Moore A. T. and the Genetic Factors in A. M. D. S. G. (2007) Complement C3 Variant and the Risk of Age-Related Macular Degeneration. N Eng J Med, NEJMoa072618.

Yildirim H., Weintraub A. and Widmalm G. (2001) Structural studies of the O- polysaccharide from the Escherichia coli O77 lipopolysaccharide. Carbohydr Res 333, 179-83.

Yu C. Y., Chung E. K., Yang Y., Blanchong C. A., Jacobsen N., Saxena K., Yang Z., Miller W., Varga L. and Fust G. (2003) Dancing with complement C4 and the RP- C4-CYP21-TNX (RCCX) modules of the major histocompatibility complex. Prog Nucleic Acid Res Mol Biol 75, 217-92.

Zareparsi S., Reddick A. C., Branham K. E., Moore K. B., Jessup L., Thoms S., Smith- Wheelock M., Yashar B. M. and Swaroop A. (2004) Association of apolipoprotein

284

E alleles with susceptibility to age-related macular degeneration in a large cohort from a single center. Invest Ophthalmol Vis Sci 45, 1306-10.

Zipfel P. F., Edey M., Heinen S., Jozsi M., Richter H., Misselwitz J., Hoppe B., Routledge D., Strain L., Hughes A. E., Goodship J. A., Licht C., Goodship T. H. and Skerka C. (2007) Deletion of complement factor H-related genes CFHR1 and CFHR3 is associated with atypical hemolytic uremic syndrome. PLoS Genet 3, e41.

Zipfel P. F., Heinen S., Jozsi M. and Skerka C. (2006) Complement and diseases: defective alternative pathway control results in kidney and eye diseases. Mol Immunol 43, 97-106.

Zipfel P. F., Jokiranta T. S., Hellwage J., Koistinen V. and Meri S. (1999) The factor H protein family. Immunopharmacology 42, 53-60.

Zipfel P. F., Skerka C., Caprioli J., Manuelian T., Neumann H. H., Noris M. and Remuzzi G. (2001) Complement factor H and hemolytic uremic syndrome. Int Immunopharmacol 1, 461-8.

Zipfel P. F., Skerka C., Hellwage J., Jokiranta S. T., Meri S., Brade V., Kraiczy P., Noris M. and Remuzzi G. (2002) Factor H family proteins: on complement, microbes and human diseases. Biochem Soc Trans 30, 971-8.

Zwaal R. F., Bevers E. M., Comfurius P., Rosing J., Tilly R. H. and Verhallen P. F. (1989) Loss of membrane phospholipid asymmetry during activation of blood platelets and sickled red cells; mechanisms and physiological significance. Mol Cell Biochem 91, 23-31.

285