USOO7662561 B2

(12) United States Patent (10) Patent No.: US 7,662,561 B2 Godfrey et al. (45) Date of Patent: Feb. 16, 2010

(54) IDENTIFICATION OF MARKERS IN 6,440,725 B1 8/2002 Pourahmadi et al. ESOPHAGEAL CANCER, COLON CANCER, 7,101,663 B2 9/2006 Godfrey et al. HEAD AND NECK CANCER, AND 2001/005.1344 A1* 12/2001 Shalon et al...... 435/6 MELANOMA 2006/0068418 A1* 3/2006 Godfrey et al...... 435/6 (75) Inventors: Tony E. Godfrey, Bronxville, NY (US); FOREIGN PATENT DOCUMENTS Liqiang Xi, Plainsboro, NJ (US); Siva EP 105O587 11, 2000 Raja, Jamaica Plain, MA (US); Steven WO WO95/11687 5, 1995 J. Hughes, Blawnox, PA (US); William WO WO98,0897O 3, 1998 E. Gooding, Pittsburgh, PA (US) WO WO99, 13104 3, 1999 WO WOOOf 44774 8, 2000 (73) Assignee: University of Pittsburgh-Of the WO WOOOf 72970 12/2000 commonwealth System of Higher WO WOOOf73412 12/2000 WO WOOOf73413 12/2000 Education, Pittsburgh, PA (US) WO WOO1/O1129 1, 2001 WO WOO1? 45845 6, 2001 (*) Notice: Subject to any disclaimer, the term of this WO WO O1, 57253 8, 2001 patent is extended or adjusted under 35 WO WOO1 (84.463 11, 2001 U.S.C. 154(b) by 159 days. WO WO O2, 18902 3, 2002 WO WO O2/O52030 T 2002 (21) Appl. No.: 11/178,134 WO WO O2/O70751 9, 2002 WO WOO3/O55973 T 2003 (22) Filed: Jul. 8, 2005 WO WOO3,O72253 9, 2003 WO WOO3,O77O55 9, 2003 (65) Prior Publication Data WO WO 2004/048931 6, 2004 US 2006/OO1929.0 A1 Jan. 26, 2006 OTHER PUBLICATIONS Related U.S. Application Data Enard W et al. Intra- and interspecific variation in primate gene (60) Provisional applicationNo. 60/587,019, filed on Jul.9, expression patterns. Science. Apr. 12, 2002:296(5566):340-3.* 2004, provisional application No. 60/586,599, filed on Thisted RA (1998) What is a P-value?” available online at www.stat. Jul. 9, 2004. uchicago.edu/~thisted, pp. 1-6. Juppner H "Functional properties of the PTH/PTHrP receptor. Bone. (51) Int. C. Aug. 1995; 17(2 Suppl):39S-42S.* CI2O I/68 (2006.01) Cheung VG et al Natural variation in human gene expression CI2P 19/34 (2006.01) assessed in lymphoblastoid cells. Nat Genet. Mar. 2003:33(3):422 CO7H21/04 (2006.01) 5 : HuGeneFL Array from www.affymetrix.com, p. 1.* (52) U.S. Cl...... 435/6; 435/91.2:536/24.33 Details for HUGENEFL:M93036 AT, from www.affymetrix.com, (58) Field of Classification Search ...... None pp. 1-5.* See application file for complete search history. Details for HUGENEFL:M76482 AT, from www.affymetrix.com, pp. 1-3.* (56) References Cited de Vos S et al Gene expression profile of serial samples of trans U.S. PATENT DOCUMENTS formed B-cell lymphomas. Lab Invest. Feb. 2003:83(2):271-85.* ABI Prism 7700 Sequence Detection System User Bulletin #5, “Mul 5,314,809 A 5, 1994 Erlich et al. tiplex PCR with TaqMan VIC Probes.” Applied Biosystems (1998/ 5,814,491 A 9/1998 Vijg et al. 2001). 5,837.442 A 1 1/1998 Tsang Baner, Johan et al. “Signal amplification of padlock probes by rolling 5,843,761 A 12/1998 Barnett et al. circle replication.” Nucleic Acids Research (1998), vol. 26, No. 22. 5,854,033. A 12/1998 Lizardi pp. 5073-5078. 5,882,856 A 3, 1999 Shuber 5,958,349 A 9, 1999 Petersen et al. (Continued) 6,040,138 A 3, 2000 Lockhart et al. 6,057,105 A 5, 2000 Hoon et al. Primary Examiner Stephen Kapushoc 6,183,960 B1 2/2001 Lizardi (74) Attorney, Agent, or Firm Hirshman Law, LLC; Jesse A. 6,210,884 B1 4/2001 Lizardi Hirshman 6,245,517 B1 6, 2001 Chen et al. 6,251,601 B1 6, 2001 Bao et al. (57) ABSTRACT 6,261,776 B1 7/2001 Pirrung et al. 6,306,643 B1 10/2001 Gentalen et al. Methods for identifying expression of markers indicative of 6,309,823 B1 10/2001 Cronin et al. the presence of esophageal, a squamous cell cancer, a squa 6,344,329 B1 2/2002 Lizardi 6,346,413 B1 2/2002 Fodor et al. mous cell cancer of the head and neck, colon cancer and 6,374,684 B1 4/2002 Dority et al. melanoma are provided. Also provided are articles of manu 6,403,037 B1 6/2002 Chang et al. facture useful in Such methods and compositions containing 6,406,844 B1 6/2002 Pirrung et al. primers and probes useful in Such methods. 6,416,952 B1 7/2002 Pirrung et al. 6,431,476 B1 8/2002 Taylor et al. 15 Claims, 32 Drawing Sheets US 7,662,561 B2 Page 2

OTHER PUBLICATIONS Nallur, Girish et al. “Signal amplification by rolling circle amplifi cation on DNA microarrays.” Nucleic Acids Research, (2001) vol. Bercovich, Dani et al. "Quantitative Ratio of Primer Pairs and 29, No. 23 el 18. Annealing Temperature Affecting PCR Products in Duplex Amplifi Nilsson, M. et al. “Making Ends Meet in Genetic Analysis. Using cation.” BioTechniques (Oct. 1999), vol. 27, pp. 762-770. Padlock Probes.” Human Mutation (2002) 19:410-415. Braun, D. et al. “Exponential DNA Repliction by Laminar Convec Oehlenschlager, Frank et al."Detection of HIV-1 RNA by nucleic tion.” Physical Review Letters, 91: 158103. acid sequence-based amplification combined with fluorescence cor Brink. A. A.T. P. etal. "Nucleic Acid Sequence-Based Amplification, relation...” PNAS (1996) Biochemistry vol. 93, pp. 12811-12816. a New Method for Analysis of Spliced and Unspliced EBV . . .” Oshima, Akihiro et al. “Cloning, sequencing, and expression of Journal of Clinical Microbiology (Nov. 1998), pp. 3164-3169. cDNA for human B-glucuronidase.” Proc. Natl. Acad. Sci. USA. Canter, David et al., "On-Chip Amplification of Genomic DNA with (Feb. 1987), vol. 84, pp. 685-689. Short Tandem Repeat and Single Nucleotide Polymorphism Analy Raja, S., et al. “Increased Sensitivity of One-Tube, Quantitative RT sis.” Nangoen, Inc., San Diego, CA. PCR.” BioTechniques, (Oct. 2000) vol. 29, pp. 702-706. Christian, Allen T. et al. “Detection of DNA point mutations and Roberts CA, Beitsch PD, Litz CE, Hilton DS. Ewing GE, Clifford E mRNA expression levels by rolling circle amplification in individual et al. “Interpretive disparity among pathologists in breast sentinel cells.” PNAS (Dec. 2001), vol. 98, No. 25, pp. 14238-14243. lymph node evaluation.” Am J Surg 2003; 186(4):324-329. DeBaar, Michel Petal. “Single Rapid Real-Time Monitored Isother Schweitzer, Barry et al. “Immunoassays with rolling circle DNA mal RNA Amplification Assay for Quantification of HIV amplification: A versatile platform for ultrasensitive antigen detec Type 1 . . .” Journal of Clinical Microbiology (Apr. 2001), pp. tion.” PNAS (Aug. 2000), vol.97, No. 18, pp. 10113-101 19. 1378-1384. Schweitzer, B. et al. “Combining Nucleic Acid Amplification and DeBarr, M.P. et al. “One-Tube Real-Time Isothermal Amplification Detection.” Current Opinion in Biotechnology (2002) 12:21-27. Assay To Identify and Distinguish HIV Type 1 Subtypes ... 'Jour "TaqMan One-Step RT-PCR Master Mix Reagents Kit,” Biosystems nal of Clinical Microbiology (May 2001), pp. 1895-1902. (1999). Demidov, Vadim V. "Rolling-circle ampliction in DNA diagnostics: Thomas, David C. et al. "Amplification of Padlock Probes for DNA the power of simplicity.” Future Drugs Ltd., Expert Rev. Mol. Diagn. Diagnostics by Cascade Rolling Circle Amplification or Polymerase (Nov. 2002)2(6):542-548. Chain Reaction.” Arch Pathol Lab Med (Dec. 1999), vol. 123. Dessau, R. B. et al. “Coronaviruses in spinal fluid of patients with Troutt, Anthony B. et al. “Ligation-anchored PCR: A simple ampli acute monosymptomatic optic neuritis.” Acta Neurol Scand (1999), fication technique with single-sided specifity.” Proc. Natl. Acad. Sci. vol. 100, pp. 88-91. USA (Oct. 1992) vol. 89, pp.9823-9825. Efron, B. and Tibshirani, R.J. An Introduction to the Bootstrap. Boca Viehmann, S. et al. “Multiplex PCR-a rapid screening method for Raton: Chapman and Hall, 1993: 247-252. detection of gene rearrangements in childhood acute lymphoblastic Godfrey, T.E. et al. “Prognostic Value of Quantitative Reverse Tran leukemia.” Annals of Hematol (1999) vol. 78, pp. 157-162. scription-Polymerase Chain Reaction...” Clinical Cancer Research Wu, Dan Y. et al. “The Effect of Temperature and Oligonucleotide (Dec. 2001), vol. 7, pp. 4041-4048. Primer Length on the Specifity and Efficiency of Amplification by Greijer, Astrid E. etal. “Multiplex real-time NASBA for monitoring PCR).” DNA and Cell Biology (1991) vol. 10, No. 3, 233-238. expression dynamics of human cytomegalovirus encoded IE1 and Ylitalo, Nathalie et al. “Detection of Genital Human Papillomavirus pp67 RNA.” Journal of Clinical Virology (2002) vol. 24, pp. 57-66. by Single-Tube Nested PCR and Type-Specific Oligonucleotide Harris, Eva et al. “Typing of Dengue Viruses in Clinical Specimens Hybridization.” Journal of Clinical Microbiology (Jul 1995), pp. and Mosquitoes by Single-Tube Multiplex Reverse Transcriptase 1822-1828. PCR.” Journal of Clinical Microbiology (Sep.1998), pp. 2634-2639. Matsuda, Jun-ichi, et al. “Significance of Metastasis Detected by Hoshikawa, Yasushi, et al. “Hypoxia induces different genes in the Molecular Techniques in Sentinel Nodes of Patients with lungs of rates compared with mice.” Phyisical Genomics (Dec. 3, Gastrointestinal Cancer.” Annals of Surgical Oncology, (2004) vol. 2002). vol. 10, p. 1152. 11, No. 3, p. 250S-254S. Krishnan, Madhavi, et al. "PCR in Rayleigh-Benard Convection Raja, Siva, et al., “Rapid, quantitative reverse transcriptase Cell.” Science (Oct. 2002), vol. 298, p. 793. polymerase chain reaction: Application to intraoperative molecular detection of occult metastases in esophageal cancer. The Journal of Leone, G. et al. “Molecular beacon probes combined with amplifi Thoracic and Cardiovascular Surgery, (2002), vol. 123, No. 3, pp. cation by NASBA enable homogeneous, real-time detection . . .” 475-483. Nucleic Acids Research (1998), vol. 26, No. 9, pp. 2150-2155. Bage, NCBI Accession NM 001187, The NCBI handbook Little, Michael C. etal. “Molecular Diagnostics and Genetics.” Clini Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The cal Chemistry (1999) vol. 45, No. 6, pp. 777-784. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. Lockley, Andrew K. et al. “Colormetric detection of immobilized fcgi?db=Books. PCR products generated on a solid support.” Nucleic Acids Research, BHCG, NCBI Accession NM 000737, The NCBI handbook (1997), vol. 25, No. 6, pp. 1313-1314. Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Luketich, James D., et al. "Detection of Micrometastases in Histo RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. logically Negative Lymph Nodes in Esophageal Cancer.” Ann Thorac fcgi?db=Books. Surg (1998); vol. 66, pp. 1715-1718. BRDT, NCBI Accession NM 001726, The NCBI handbook Mitas Met al. "Quantitative real-time RT-PCR detection of breast Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The cancer micrometastasis using a multigene marker panel.” IntJCancer RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. 2001; 93(2):162-171. fcgi?db=Books. Miyake, Y. et al. "Quantification of Micrometastases in Lymph CEA, NCBI Accession NM 004363, The NCBI handbook Nodes of Colorectal Cancer Using Real-Time Fluorescence Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Polymerase Chain Reaction.” Int. J. Oncol (Feb. 2000), vol. 16, No. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. 2, pp. 289-293. fcgi?db=Books. Mondesire, Roy R. et al. “Solid-phase nucleic acid extraction, ampli CK7, NCBI Accession NM 005556, The NCBI handbook fication, and detection.” IVD Technology Magazine (May 2000). Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Morrison TB et al. "Quantification of low-copy transcripts by con RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. tinuous SYBR Green I monitoring during amplification.” fcgi?db=Books. Biotechniques, (Jun. 1998); vol. 24. No. 6, pp. 954-962. CK14, NCBI Accession NM 000526, The NCBI handbook Nagaraju, J. et al. "FISSR-PCR: a simple and sensitive assay for Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The highthroughput genotyping and genetic mapping. Molecular and RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. Cellular Proves (2002) vol. 16, pp. 67-72. fcgi?db=Books. US 7,662,561 B2 Page 3

CK18 NCBI Accession NM 000224. The NCBI handbook MGB1, NCBI Accession NM 002411, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. CK19, NCBI Accession NM 002276, The NCBI handbook MGB2, NCBI Accession NM 002407, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. CK20, NCBI Accession NM 019010, The NCBI handbook MMP7, NCBI Accession NM 002423. The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. CTAG1, NCBI Accession NM 001327. The NCBI handbook NIS, NCBI AccessionNM 000453, The NCBI handbookInternet. Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18. The RefSeq, RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. Project. http://www.ncbi.nlm.nih.gov/entrez?cuery.fcgi?db=Books. fcgi?db=Books. GAGE1, NCBI Accession NM 001468, The NCBI handbook NTS, NCBI Accession NM 006 183, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. HTERT, NCBI Accession NM 003219, The NCBI handbook PIP, NCBI Accession NM 002652, The NCBI handbook Internet. Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18. The RefSeq, RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. Project. http://www.ncbi.nlm.nih.gov/entrez?cuery.fcgi?db=Books. fcgi?db=Books. PTHrP, NCBI Accession NM 002820, The NCBI handbook ITGB4, NCBI Acce ssion NM 000213, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. PVA, NCBI Accession NM 00 1944. The NCBI handbook KRTHB1, NCBI Accession NM 002281, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. SCCA1, NCBI Accession NM 006919, The NCBI handbook LDHC, NCBI Accession NM 130852. The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entrez/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. SCCA2, NCBI Accession NM 002974, The NCBI handbook LUNX, NCBI Accession NM 017448, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. SFTPB, NCBI Accession NM 000542, The NCBI handbook MAGE A1, NCBI Accession NM 004988, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. SGY-1, NCBI Accession NM 014419, The NCBI handbook MAGE A2, NCBI Accession NM 005361, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. SSX2, NCBI Accession NM 006011, The NCBI handbook MAGEA3, NCBI Accession NM 005362, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. MAGEA4, NCBI Accession NM 002362, The NCBI handbook SSXu, NCBI Accession NM 001169, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. MAGE A8, NCBI, Ac cession NM 005364, The NCBI, handbook STX, NCBI Accession NM 019010, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. MAGE A10, NCBI Accession NM 021048, The NCBI handbook Survivin, NCBI Accession NM 001168, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The RefSeq, Project. http://www.ncbi.nlm RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. MAGE A12, NCBI Accession NM 005367, The NCBI handbook TACSTD1, NCBI Accession NM 002354, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The RefSeq, Project. http://www.ncbi.nlm RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. c-MET, NCBI Accession NM 000245, T he NCBI handbook TM4SF3, NCBI Accession NM 004616, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Internet. Bethesda (MD): Natl Lib Med (U S), 2002, Ch. 18. The RefSeq, Project. http://www.ncbi.nlm RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. fcgi?db=Books. fcgi?db=Books. US 7,662,561 B2 Page 4

TITF1, NCBI Accession NM 003317. The NCBI handbook Godfrey, Tony E., et al. “Prognostic Value of Quantitative Reverse Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Transcription-Polymerase Chain Reaction in Lymph Node-Negative RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. Esophageal Cancer Patients1” Clinical Cancer Research, Dec. 2001, fcgi?db=Books. vol. 7, pp. 4041-4048. TYR, NCBI Accession NM 000372, The NCBI handbook Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The Jiao, Xiaolong, MD “Clinical Significance of Micrometastasis in RefSeq, Project, http://www.ncbi.nlm.nih.gov/entreZ/query. Lung and Esophageal Cancer: A New Paradigm in Thoracic Oncol fcgi?db=Books. ogy.” Elsevier Science Inc., The Society of Thoracic Surgeons, Villin 1, NCBI Accession NM 007127. The NCBI handbook (2002), Vo. 74, pp. 278-284. Internet. Bethesda (MD): Natl Lib Med (US), 2002, Ch. 18 The RefSeq, Project. http://www.ncbi.nlm.nih.gov/entreZ/query. Nakanishi, Hayao, et al. “Rapid Quantitative Detection of fcgi?db=Books. Carcinoembryonic Antigen-Expressing Free Tumor cells in the Bostick, Peter J., et al. “Limitations of Specific Reverse Peritoneal Cavity of Gastric-Cancer Patients with Real-Time RT Transcriptase Polymerase Chain Reaction Markers in the Detection PCR on the Lightcycler”, Int. J. Cancer (Pred. Oncol.) 2000, vol. 89, of Metastses in the Lymph NOdes and Blood of Breast Cancer pp. 411-417. Patients.” Journal of Clinical Oncology, Aug. 1998, vol. 16, No. 8, pp. Silva, J. M. et al. “Detection of epithelial tumour RNA in the plasma 2632-2640. of colon cancer patients is associated with advanced stages and Cheung, Vivian G., et al. “Natural Variation in human gene expres circulating tumour cells.” Gut 2002; vol. 50, pp. 530-534. sion assessed in lymphoblastoid cells.” Nature Genetics, Mar. 2003, vol. 33, pp. 422-425. * cited by examiner

U.S. Patent Feb. 16, 2010 Sheet 2 of 32 US 7,662,561 B2

CEA cDNA Sequence (SEQ ID NO: 2)

Ctcaggg cag agg gaggaag gacag Cagac Calgacagt ca. Cagcagcctt gacaaaacgt 6. toctggaact caagct citt c tcCacagagg agg acagag C aga cagoaga gaCCatggag 121 totc.cct cqg CCCCtcCcca Cagatggtgc at CCCCtggC agaggct cot gcticacagoc 181 tcact tctaa cCttctggala ccc.gc.ccacc act gccalag C tcactattga atcCacgc.cg 241 ttcaatgtc.g Cagaggggala ggaggtgctt ctacttgtc.c a caatctgcc ccagdatctt 30 tttggctaca gctgg tacaa aggtgaaaga gtggatggca accgtcaaat tataggatat 361 gtaataggaa Ctcaacaagc taccc.caggg cCogcataca gtgg to gaga gataatata C 42 cc caatgcat ccctgctgat cCagaacatc atccagaatg acacaggatt CtaCaCCCta 48 Cacgt. Catala agt cag atct tgttgaatgaa galagcaactg gccagttcc.g gg tata CCC g 541 gagctgcc.ca agcc ct coat citc.ca.gcaac aaCtcCalala C CCG tiggagga caaggatgct 601 gtggcct tca cctgtgaacC tgagacticag gacgcaacct acct tdgtg gg taaacaat 66 Cagag cct co cgg toag to c Caggctgcag ctgtccaatg gCaa CaggaC cct Cact cital 721 ttcaatgtca caagaaatga Cacagoaa.gc tacaaatgtg aalacc Cagaa cc cagtgagt 781 gccagg.cgca gtgatt cagt catcctgaat gtcct citatg gcc.cggatgc Ccccaccatt 84.1 to CCCtctala aCaCat Ctta Cag at Caggg gaaaatctga acct CtcCtg cCacgcagcC 901 totalacccac Ctgcacagta cticttggittt gt caatggga Cttt coagca at CCaCC Caa 961. gagct ctitta to cccalacat cactgtgaat aatagtggat cctatacgtg ccaagcc cat 102 aact Cagaca ctggCCtcaa tagg accaca gtcacgacga. t cacagt cta tgcagag cca. 1081 Cccaaaccct tcatcaccag CalacaactCC aa.ccc.cgtgg aggatgagga tgctgtag cc ll 41. ttaacctgtg alacct gagat tcagalacaca acctacctgt ggtggg taala taat CagagC l2O. Ctc.ccggit ca. gt CCCaggct gCagctgtc.c aatgacaa.ca gg accCtcac tctacticagt 26l gt cacaagga atgatgtagg accCtatgag tgttggaat CC agalacga att aagttgttgac 1321 cacagogacc cagt catcct gaatgtc.ctic tatggcc.ca.g acg accc.cac catttcCCCC 138 toata Cacct attaccgt.cc agggg togaac cticagoctot cctgccatgc agcctictaac 1441 ccacctgcac agtatt Cttg gctgattgat gggalacat CC agcaa.cacac acalaga.gctic l5O1 tittat citcca acat cactga galagalacag C ggactictata cctgccaggc Caataactica 561 gccag tag cc acag Caggac tacagt caag acaat Cacag totctg.cgga gctg.cccaag 1621 cc citcCatct ccagcaacaa Ctccaaaccc gtggagga.ca aggatgctgt ggcct tcacc 1681 tgtgaacctg aggct Cagaa Calcalacct a C Ctgtgg toggg taalatgg toa gag cc tocca 1741 gtCag tocca ggctgcagot gtcCaatggc aacaggaccC tCact C tatt caatgtcaca 1801 agaaatgacg Calaga.gc.cta tg tatgtgga atccagaact cagtgagtgC aaac Cocagt 1861 gacccagtica CCC toggatgt cctictatggg ccgga cacCC ccat cattt C cc.ccc.ca.gac Fig. 211 U.S. Patent Feb. 16, 2010 Sheet 3 of 32 US 7,662,561 B2

1921 tcgtcttacc ttt C9ggagc gaacct caac citct cotgcc acticggcctic talacc catcC 1981 cc.gcagtatt cittgg.cgitat caatgggata cc.gcagcaac acacacaagt tctCttitatic 2O4. gccaaaatca cgc.calaataa taacggg acc tatgcCtgtt ttgtctictaa CttggCtact 2O ggcc.gcaata attic catagt calaga.gcatc acag totctg catctggaac ttcticctdgt 216 citctoagctg gggccactgt cgg catcatg attggagtgc tggttggggit tgctctgata 222 tag cagcc ct ggtgtag titt Ctt Cattitca ggalagactga cagttgttitt gcttct tcct 2281 taalag cattt gcaa.ca.gcta cag totaaaa ttgcttctitt accalaggata tttacagaaa 2341 agacitctgac cagagat.cga. gacCatCcta gccaa.catcg tgaaaccc.ca tCtctactala 24 O1 aalata Calaaa. atgag Ctggg CttggtggCg CgCaCCtgta gtCCCagtta Ct C999 aggC 246 tgagg Cagg a gaatcgcttg alaccc.gggag gtggagattg cagtgagcCC agat.cgcacc 252 actgcacticc agtctggcaa. Caga.gcaaga CtC Catct Ca aaaagaaaag. aaaagaagac 258 totgacctgt acticttgaat acaagtt tot gataccactg Cactgtctga gaattitccala 264 aactittaatg aactalactga cagctt Catg aaactgtc.ca ccaagat caa gcagagaaaa. 27 O1 taattaattit catgggacta aatgaactaa tgaggattgc tgattctitta aatgtc.ttgt 276 ttcc.cagatt tCaggaaact ttt ttt Cttt talag Citat CC act Ctta Cag Caatttgata 282 aalata tact t ttgttgaacaa aaattgagac atttacattt tctoccitatg tgg togctcc 288 agaCttggga alactatt Cat gaatatttat attg tatggit aatatagitta ttgcacaagt

2941 tCalataaaaa. totgctictitt gtatala Caga alaala Fig. 212

U.S. Patent Feb. 16, 2010 Sheet 6 of 32 US 7,662,561 B2

CK20 cDNA Sequence (SEQ ID NO: 5)

CalaccatcCt gaa.gctacag gtgctcc citc ctggaatcto caatggattt cagtcgcaga 61 agct tccaca gaa.gc.ctsgag cticcitcc ttg cagg.cccctg tag toagtac agtgggCatg 2 cag C9 cct C9 ggacgacacc cagcgttitat gggggtgctd gaggcc.gggg catcc.gcatc 181 tcCaact coal gacacacggit galactatoggg agcgatctoa Cagg C9g C9g ggacctgttt 24l gttgg caatg agaaaatggC Catgcagaac Ctalaatgacc gt Citagcgag ctacctagaa 301 aaggtgcgga CCCtggagca gtcCaactico alala Cttgaag tgcaa at Caa gcagtgg tac 361 gaaac Caacg. CCCC9 aggg C tgg togC gaC tacagtgcat attacagaca aattgaagag 421. Ctg.cgalagt C agattalagga tgctcaactg caaaatgctic gg togtgtc.ct gcaaattgat 48 aatgctaaac tggctgctga ggactitcaga ctgaagtatg agactgagag aggaatacgt 54 ctaa.ca.gtgg aagctgat ct cCaaggcctg aataaggtot ttgatgacct alaccCtacat 60 aaaacagatt tggagattica aattgaagaa ctgaataaag acctagotct CCtcaaaaag 661 gag catcagg aggaagttcga tggcctacac aag Catctgg gcaa.cactgt Caatgtggag 721 gttgatgctg citccaggcct galaccttggc gtCatcatga atgaaatgag gcagaagitat 781 gaagt catgg CCCagalagaa CCttcaa.gag gCCaaagaac agtttgagag acagactgca 841 gttctgcagc ala Caggit CaC agtgaatact gaagaattaa. aaggaact ga. ggttcaacta 901 acggagctga gacgcacct c ccagagc Ctt gagatagaac to cag tocca tCtcagoatg 96. aaagag tott tggagcacac totagaggag accaaggccc gtta Cagcag Ccagttagcc 1021 aacct coagt cgctgttgag ctictotggag gCC Calactga tgcagatt.cg gagtaacatg 108.1 gaacgc.ca.ga acaacgaata cCatat cott Cttga catala agact cqact tgaacaggaa 1141 attgctactt accgc.cgcct tCtggalagga galaga C9 tala aaact acaga atatoagitta 12 Ol a gCaccCtgg alagaga.gaga. tataaagaala accagga aga ttaag acagt Cgtgcaagaa 126 gtag toggatg gCalaggtogt gtCatctgaa gtcaaagagg tggaagaaaa tat ctaalata l321 gctaccagaa ggagatgctg Ctgaggittitt gaaagaaatt tggctataat Cttatctttg 1381 citccctgcaa. gaaat cago C atalagaaag.c act attalata Ctctgcagtg attaga aggg 1441 gtgggg togg C gggaatccta tittatcagac tctgtaattg aatatalaatg ttt tacticag 50 aggag Ctgca aattgcctgc aaaaatgaaa. tcCagtgagc actagalatat ttaaaa.catc 1561 at tact.gc.ca tct titat cat galag cacatc aattacaagc tgtag accac Ctaat at Cala 1621 tttgtagg tal atgttcctga aaattgcaat acatttcaat tata Ctaalac Ct cacaaagt 58. agagga at CC atgtaaattg Calaataala CC actitt Ctaat ttitt toctgt ttctgaaaaa. 74 aaaaaaaaaa. aaaaaaaaaa. aaaaaaaaaa. aaaaaaaaaa. aaaaaaaaaa. alaaaaaaaaa.

1801 aaaaaaaaaa aaaaaala Fig. 5 U.S. Patent Feb. 16, 2010 Sheet 7 of 32 US 7,662,561 B2

MAGEA1 cDNA Sequence (SEQID NO: 6)

l C9tagagttc. g.gc.cgaagga acct gaccca ggCtctgtga ggagg Calagg ttitt Cagggg 61 a CaggcCaac CCagaggaca ggatt.ccctg gaggccacag aggag cacca aggagaagat 121 Ctgcc togtgg gtott cattg cc cagotcct goccacactic Ctgcctgctg CCCtgacgag 181 agt catcatg totcttgagc agaggagtCt gCactgcaa.g CCtgaggalag CCCttgaggC 241. Ccaacaagag gCCCtgg gCC tggtgttgttgt gcaggctgcc gcct cotcct cct citcCtct 3 OL ggtoctogggc accotggagg aggtgcc.cac tgctggg tda acagatcctic CccagagtCC 361 tCagg gag CC to cqcctitt c CCaCtaCCat Caact tcact C9a Calga99C aaccCagtga 421. gggttc.ca.gc agc.cgtgaag aggagggg.cc aag cacct ct tgitat cotgg agticcittgtt 48 cc.gagcagta at Cactalaga aggtggctga tttggttggit tttctgcticc tcaaatat cq 54 agCCa999ag cCagt calcala aggCagaaat gCtggagagt gtcatcaaaa attacalagca 60 citgtttitcct gagat ctitcg gcaaag.cctic tgagt cottg cagotgg tot ttggcattga 66 Cgtgaaggaa gCagaccc.ca ccggccactic ctatgtcc tt gt cacct gCC taggtotCtc 72 Ctatgatgg C Ct9Ct999 tg ataat Cagat catgcc.caag acaggct tcc tgataattgt 78 cctggtoatg attgcaatgg aggg.cggCCa tgctcct gag gaggaaatct gggaggagct 84 gag totgatg gaggt9tatg atgg gaggga gCacagtgCC tatggggagc ccaggaagct 90 gct cacccala gatttggtgc aggaaaagta cc toggagtac cggCagg togC cggacagtga 961 toccgcacgc tatgagttcc tgttgggg to C aagggCCCtt gCtgaalacca gctatgtgaa 1021 agt CCttgag tatgttgat Ca aggt cagtgc aagagttc.gc tttittct tcc. catccctg.cg 108 tgaag cagct ttgagagagg aggalagaggg agtctgagca tgagttgcag cCagg gCCag 1141 tgg gaggggg actgggc.ca.g tgcacCtt CC agg gcc.gc.gt C Cag Cag Ctt cc cctgcctic 12 Ol gtgttga catg aggcc cattc ttcactctga agaga.gcggit cagtgttcto agtag taggit 1261 ttctgttcta ttggg tact tggagattta totttgttct Cttittggaat tgttcaaatg 132 tt t t t t t t ta. agggatggtt gaatgaactt cag catccala gtttatgaat gacagoag to 138 acacagttct gtgtatatag tttalaggg ta. agagtc.ttgt gttt tattoa gattgggaala 1441 tCcatt citat tttgttgaatt gggataataa. Cag Cagtgga ataag tactt agaaatgtoga 150 aaaatgagca gtaaaataga tgagataaag aactaaagaa attalagagat agt caattct 156 tgctttatac cticag totat totgtaaaat ttittaaagat atatgcatac CtggattitcC 1621 ttggct tctt tgagaatgta agagalaatta aatctgaata aagaattctt cctgttaaaa

68 aaaaaaaaaa. aaaaaaaaaa. alaaaaaaaaa. aaaaaaaaaa ala Fig. 6

U.S. Patent Feb. 16, 2010 Sheet 9 of 32 US 7,662,561 B2

MAGEA6 cDNA Sequence (SEQ ID NO:8)

l agcaa.cgagic gacgg cct ga. cgt.cgg.cgga gggaag.ccgg cccaggctog gtgaggaggc 61 aaggttctga gggga caggc tgacct ggag gaccagaggc CccCggagga gCact galagg 121 agaag atctg ccagtggg to to cattgccc agctcctgcc cacacticcc.g cctgttgcc.c l8l tgaccagagt catcatgcct Cttgag caga ggagt cag Ca Ctgcaa.gc.ct galaga aggCC 24l ttgagg.ccc.g aggagaggcc CtgggCCtgg tgggtgcgca ggct cotgct act gaggagc 301 aggaggct gC Ctcc torctict totactic tag ttgaagttcac CCtgggggag gtgcCtgctg 361 cc.gag toacc agat.cct coc cagagt cotc agg gag CCtc cagcct cocc actaccatga 421 actaCCCt. Ct. Ctggagccala to Ctatgagg actCcagcaa. C Caagala gag 9ag999CCala 48 gcacct tccc tgaCCtggag totgagttcc alag Cag cact Cagtaggaag gtggcCaagt 54 tggttcattt tctgcticcitc alagtalt c.gag CCa999 agCC ggtCacalaag gCagaalatgc 60 tg999 agtgt Cgtcggaaat tgg Cag tact tottt cotgt gatct tcago aaagct tcc.g 661 attcCttgca gctgg tottt gg Catcgagc tgatggaagt ggacco catc ggccacgtgt 721 a catctttgc Cacct gcct g ggcct citcct acqatggcct gctggg toga C aat cagat.ca 781 tgcc.ca agaC aggct tcc ty attaatcatCc tggccataat cgcaaaagag ggCgaCt9tg 841 cc cct gagga gaaaatctgg gaggagctga gtgtgttaga ggtgtttgag gggagggala 9 901 acagtatctt cggggat CCC aagaagctgc tCaCCCalata titt.cgtgcag gaaaactacC 961 tggag taccg gcagg toccc ggcagtgat C ctgcatgcta tgagttcCtg tggggit CCala O21 ggg.ccct cat tgaalaccagc tatgtgaaag tCctgcacca tatgg taalag at Cagtggag 108 gacct.cgcat tCct accCa CtCCtgcatg agtgggct tt ga9a 9ag999 galaga.gtgag 14 tctgag cacg agttgcagcC agggc.ca.gtg 99 a 99999 tt tgggc.ca.gtg cacct tccgg 120 gg CCC cat CC Cttagtttco actgcct cot gtgacgtgag gcc cattctt cactictttga 26 ag.cgag Cagt cagcatt Ctt agtag taggit ttctgttctg ttggatgact ttgagattat 1321 totttgttt C Ctgttggagt tgttcaaatg ttCCttittaa. cggatggttg aatgagcgtC 38 agcatcCagg tttatgaatg acagtag toa caca tag togc tgtttatata gtt taggagt 144l aagag tot tog tttitt tatt c agattgggaa atcCatt CCa ttttgttgaat tgtgacatala 150 taatagoagt gg taaaagta tttgct taala attgtgag cq aattagcaat ala Catacatg 56 agataactica agaaatcaaa agatagttga ttcttgcctt gtacct caat Ct attctgta 1621 alaattalaa.ca aatatgcaaa ccaggattitc Cttgacttct ttgagaatgc aag.cgaalatt 1681 aaatctgaat aalata attala aaaaaaaaala aaaaaaaaaa. aac Fig. 8 U.S. Patent Feb. 16, 2010 Sheet 10 of 32 US 7,662,561 B2

MART1 cDNA Sequence (SEQ ID NO:9)

l agcagacaga ggactictoat taaggaaggt gtcctgttgcc CtgaccCtaC aagatgccala 61 gagaagatgc toactitcatc tatggittacC CCaagaa999 gcacggcCaC t ct tacacca 21 cggctgaaga ggcc.gct999 atcggcatcc tgacagtgat cctgggag to t tactgctica 181 tcggctgttg g tattgtaga agacqalaatg gata Cag agc Cttgatggat aaaagticttic 241 atgttgg cac tCaatgttgCC ttaacaagaa gatgcc.caca agaagggittt gatcatcggg 30 acagcaaagt gtc.t.cttcaa gagaaaaact gtgaacctdt ggttcc.caat gC tccacctg 361 ct tatgagaa actic totgca galacagt cac CaCCaCCtta tt Caccittaa. gag coag.cga. 421 gacacct gag a catgctgaa attattt citc tcacact titt gcttgaattit aatacagaca 48 totaatgttc tcc tittggaa tgg togtagga aaaatgcaag CCatct Ctala taataagttca 54. gtgttaaaat tt tag taggit CCgctagoag tactaat Cat gtgaggaaat gatgagaaat 601 attaaattgg gaaaactcca tcaataaatg ttgcaatgca tgatactato tgttgc.ca.gag 66 gtaatgttag taaatcCatg gtgttattitt Ctgagaga Ca gaattcaagt ggg tatt Ctg 72 gggCCatcCa attt ct ctitt act tdaaatt tggctaataa caaactag to agg tttitcga. 78. accttgaccg acatgaactg tacacagaat tgttccagta Ctatggagtg Ct cacaaagg 841 altactitt tac aggttalaga C alaagggttga. Ctggcc tatt tatctgatca agaacatgtc. 901 agcaatgtct ctttgtgctic taalaatticta ttatact aca atalatatatt gtaalagat CC 961 tatagotctt tttt tttgag atggagtttic gcttttgttg ccCaggctgg agtgcaatgg 1021 cgc.gat Cttg gct Caccata acct cogcct cc caggttca agcaattcto citgccttagc 108 citcctgagta gctgggatta cagg.cgtgcg ccactatgcc tgactalatitt tg tagttitta l141 gtagaga C99 ggtttct coa tgttggtcag gctgg to tca aactCctgac ct caggtgat l2Ol ctg.ccc.gc.ct cagcc tocca aagtgctgga attacagg.cg tgagccacca Cg CCtggctg 1261. gatcctatat Cttagg talag a Catatalacg cagtictaatt a cattt cact tcaaggctca 1321 atgctatt ct aactaatgac aag tatttitc tactaaacca gaaattgg ta galaggattta 1381 aataagtaaa agctactato tact.gc.ctta gtgct gatgc Ctgttg tactg cct taaatgt 144 l acctatggca atttagctct Cttgggttcc caaatcc ct c toacaagaat gtgcagaaga 15 Ol aat catalaag gatcagagat totg Fig. 9 U.S. Patent Feb. 16, 2010 Sheet 11 Of 32 US 7,662,561 B2

PTHrP cDNA Sequence (SEQID NO: 10)

cctgcatctt tittggalagga ttct tettitat aaatcagalaa gtgttcgagg ttcaaaggitt 61 tgcct cq gag cgtgttgaa.ca ttccticcgct cggttttcaa citc.gc.ctcca acctg.cgc.cg l2l cc.cggc.ca.gc atgtctoccc gcc.cgtgaag cggggctgcc gcct coctogc cgctc.cggct 181 gccactalacg acccgc.cc to gcc.gccacct gg.ccct cotg atcgacgaca Cacgca Cttg 24l aaacttgttc tcagggtgtg tggaatcaac titt Coggalag calaccagocc aCCagaggag 301 gtCCC9 ag.cg cgagcggaga. cgatgcagcg gag actggitt Cag Cagtgga gCdtcgcggit 361 gttcCtgctg agctacgcgg tgcc.ctcctg Cgg gCdCtcg gtggagggit C tcagoCgcc.g 421 CCtcaaaaga gctgttgtctg ala catcagct cct coatgac alaggggaagt cCatcCalaga 481 tttacggcga cgattct tcc tt Caccatct gatcgcagaa atcca Cacag Ctgaaatcag 541 agctacctic g gaggtgtcCC Cta acticcala gcc ct ct coc alacacaaaga accaccc.cgt 601 ccgatttggg totgatgatg aggg Cagata Ccta acticag gala actaa.ca aggtegagac 66 gta Caaagag Cagcc.gctica aga cacctgg gaagaaaaag alaaggcaa.gc cc.gggaaacg. 721 Calaggag Cag gaaaagaaaa aacggCdaac tcgctctgcc tgg ttagact ctggag togac 781 tgg gag toggg Ctagalagggg accacctgtc tgacaccitco acaacg togc tggagctcga 84 tt Cacgg tala caggcttctic tgg CCC9 tag Cct cagoggg gtgctic toag Ctgggttttg 90 gag cct coct totgccttgg Cttgg acaaa cctagaattit tct.ccc titta tgitatctota 961 tcgattgttgt agcaattgac agagaataac tdagaatatt gtctgcctta aag cag tacC 102l CCCC taccac acaca CCCCt gtoctocago accatagaga ggcgctagag cc catt cotc 108 tittcticcacc gtcaccoaac atcaatcCtt taccacticta cCaaataatt tcat attcaa ll 4 gct tcagaag Ctagtgacca tct t cataat ttgctggaga agtgttgttt C titcCCCttac 12 Ol tct caca Cct gggcaaactt tott cagtgt ttitt catttic ttacgttctt toacttcaag 126 ggagalatata galagcatttg at attat Cta caaacactgc agaa.ca.gcat catgtcataa 1321 acgattctga gccattcaca Ctttittattt aattaaatgt atttaattaa. at Ctcaaatt 1381 tattt taatg taaagaactt aaattatgtt ttaalacacat gcct taaatt tgtttaatta 1441 aatttalactic tggitt totac cagotcatac aaaataaatg gtttctgaaa atgtttaagt 150 attaact taC aaggata tag gtttittctica tgitaticttitt tgttcattgg Caagatgaaa 156 taattitt tot aggg taatgc cg taggaaaa. altaaaactitc acatttatgt ggCttgttta 1621 toctitagctic acagattgag gtaataatga cacticcitaga citttgg gatc aaataa Ctta 168 gggC CaagtC ttggg totga att tatttala gttcacala CC tagg gcaagt tactctgcct 741 ttctaag act cact tacatc ttctgttgaala tataattgta cCalacct Cat a gag tittggt 1801 gtcaactaaa. tgagattata tgtggactala ata totgtca tatag taaac act Caataaa. 186 ttgcaa.cata ttaaaaaaaa 3. Fig. 10 U.S. Patent Feb. 16, 2010 Sheet 12 of 32 US 7,662,561 B2

PVA cDNA Sequence (SEQ ID NO: 11)

ttittcttaga cattaactgc agacggctgg Caggatagaa gCag.cggctic acttgg actt 61 titt caccagg galaat Cagag acaatgatgg ggctct tccc cagaactaca gggg Ctctgg 12l ccatcttcgt. ggtgg toata ttggttcatg gaga attgcg aatagagact alaaggtoaat 181 atgatgalaga agagatgact atgcaacaag ctaaaagaag gcaaaaacgt. gaatggg toga 241 aatttgccala accotgcaga 9aaggagalag ata actcaaa. aagaaa.ccca attgcCaaga 3 Ol ttact tcaga ttaccaag.ca accoagaaaa to acctaccg aatctic tigga gtgggaatcg 36 at Cagcc.gcC ttittggaat C tttgttgttg acaaaalacac tggaga tatt aacatalacag 421 ctatagtcga cc.gggaggaa act.ccaagct toctgat cac atgtcgggct CtaaatgccC 481. aaggactaga tgtagagaaa ccacttatac taacgg ttaa aattittggat attaatgata 541 atcct CCagt attitt cacala Calaattitt Ca tgggtgaaat tgaagaaaat agtgcct cala 60 acticactgg t gatgatacta aatgcca Cag atgcagatgal aCCalala CCaC ttgaatticta 661 aaattgcc tt caaaattgtc totcaggaac Cagcagg cac accoatgttc Ctcc talagca 721 gaalacactgg ggalagt cogt actittgacca attotcttga cc.gaga.gcaa gctagoagct 78. atcgtctgg t tgtgagtggt gCaga Caaag atggagalagg act at Caact caatgtgaat 841 gtaatattaa. agtgaaagat gtcaacgata act tcc.calat gtttagagac tcticagtatt 9 O. cagcacgitat tgaagaaaat attittaagtt ctgaattact toga t t t cala gtaacagatt 961 tggatgaaga gtacacagat aattggcttg cagtatattt Ctttacctict gggaatgaag 1021 gaaattggitt tgaaatacala actgatccta galactaatga aggCatCctg aaagtggtga 108 aggct Ctaga ttatgaacaa Cta Caaag.cg tgaaact tag tattgctgtc aaaaacaaag 1141 ctgaattit.ca ccaat cagtt atct citcgat accgagttca gt caa.ccc.ca gtcacaattic 12 Ol agg taataala tg talagagaa ggaattgcat to cqtcc tigc tt CCaag aca tt tactgtgc 26 aaaaaggCat alagtagcaaa. alaattggtgg attatat cct gggaa catat caa.gc.catcg 321 atgaggacac taacaaagct gCCt Caalatg tcaaatatgt catggg acgt. aacgatgg to 381 gatacctaat gattgatt.ca aaaactgctg aalatcaaatt tgtcaaaaat atgaaccgag l44 l attctactitt catagittaac aaaacaatca cagotgaggit totggccata gatgaataca 150 cggg taaaac ttctacagg C acgg tatatg ttagagtacc cgatttcaat gacaattgtc 1551 caa.ca.gctgt. cct cqaaaaa gatgcagttt gCagttctt C acct tcc.gtg gttgtctcc.g 162 ctagalacact gaataataga tacactggcc Cctata catt tgcactuggala gatcaacctg 1681 taaagttgcc tg.ccg tatgg agtat calcala ccct caatgc tacct cqgcc citcct cagag 1741 ccCaggaa.ca gatacct cot ggagtatacc acatct cocct gg tact taca gacagt caga 180 acaatcggtg tgagatgcCa cgcagcttga cactggaagt Ctgtcagtgt gacaa.caggg 1861 gCatctgttgg aact tcttac CCaCCaCata gCCCtgggaC Cagg tatggc aggcc.gcact Fig.1111 U.S. Patent Feb. 16, 2010 Sheet 13 of 32 US 7,662,561 B2

1921 Cagg gaggct ggggcCtgCC gccatcggcc tgctgct cot tggtCt CCtg Ctgctgctgt 198 tggccCC cct tctgctgttg acctgttgact gtgggg.ca99 ttctactggg ggagtgaCag 204 gtggttittat cc cagttcct gatggcticag aaggaacaat tCatcagtgg ggaattgaag 21 Ol gag.cccatcC tgaaga Caag gaaatcacala a tatttgttgt gcct cotgta acagccaatg 21 61 gag.ccgattt catggaaagt totgaagttt gtacaaataC g tatgccaga ggCacagogg 2221 tggaagg cac tt Caggaatg gaaatgacca Ctaagcttgg agcagcCact gaatctggag 2281 gtgctgcagg Ctttgcaa.ca ggga Cagtgt Caggag CtgC tt Caggatt C ggag cagc.ca 2341 Ctggagttgg catctgttcc tcagggcagt ctggalaccat gagaacaagg cattccactg 24 O gaggaaccala taaggactac gctgatgggg cgataag Cat gaattittctg gactCctact 24 61 tttctoagaa agcatttgCC tgtgcggagg alaga.cgatgg C Caggalagca aatgactgct 2521 tgttgat Cta tgataatgaa gg.cgcagatg ccactggttc tcctgtgggc tcc.gtggg tt 258 gttgcagttt tattgctgat gacctggatg acagcttctt ggact Cactt ggaccCalaat 2641 ttaaaaaact tgcagagata agcCttggtg ttgatggtga aggcaaagaa gttcagocac 27 O1 cctictaaaga cagoggittat gggattgaat Cctgtggc.ca toccatagaa gtc.ca.gcaga 276 Caggatttgt talagtgc.ca.g actttgtcag galagt Caagg agct tctgct ttgtc.cgc.ct 2821 CtgggtCtgt cCagc.ca.gct gttt coat co ctgaccotct gcagoatggit aactatttag 2.881 taacggaga C ttact cqgct totggttccc tcgtgcaacc ttcCactgca ggCtttgat C 2941 cactt. Ct. CaC acaaaatgttg a tag tacag aaagggtgat Ctgtcc catt tCcagtgttc 3 OO1 Ctggcaa.cct agctggcc.ca acgcagotiac gaggg toaca tactatgctic tgtacagagg 306 atccttgctic cc.gtctaata tgaccagaat gagctggaat accacactga cCaaatctgg 312 at CtttggaC taaagtatt C aaaa tag cat agcaaag Ctic actg. tattgg gctaataatt 38 tgg cact tat tagct tctict cataaactga tcacgattat aaattaaatg tttgg gttca 3241 tacccCaaaa gCalatatgtt gtcacticcita att Ct Caagt actatt Caaa. ttgtag taala 33 O1 tct taaagtt titt CaaaaCC Ctaaaat Cat attcgc Fig. 1 1/2 U.S. Patent Feb. 16, 2010 Sheet 14 of 32 US 7,662,561 B2

SCCA1 cDNA Sequence (SEQ ID NO: 12)

citctotgcc.c acctctgctt cct Ctaggaa Cacaggagtt C Cagat Calca tcgagttcac 61 Catgaattica ct cagtgaag CCala CalcCaa gttcatgttc gacctgttcc aacagttcag l21 aaaat Caaaa. gagaacaa.ca tct tctatt c cccitat cagc at cacat cag Cattagggat 81 ggtocticitta ggagccaaag acaa.cactg.c acaacagatt aagaaggttc tt cactittga 24l tCaagt caca gagaacacca Caggaaaag.c tgcaa.catat catgttgata gg toaggaaa. 3 Ol tgttcatcac cagtt toaaa agct tctgac tgaattcaac aaatccactg atgcatatga 361 gctgaagatc gCoaacaagc tottcggaga aaaaacg tat citattetttac aggaatattt 421. agatgcCatC aagaaattitt accagaC cag tgttggaat ct gttgattittg caaatgct CC 48 agaagaaagt cgaaagaaga ttaactCctg ggtggaaagt caaacgaatg aaaaaattaa. 541 aalacCtaatt cctgaagg tal at attgg cag caataccaca ttggttcttg tgaacgcaat 601 Ctattt Calala ggg Cagtggg agaagaaatt taataaagaa gatact aaag aggaaaaatt 66 ttggccaaac aagaatacat acaagtic cat acagatgatg aggcaataca Catct titt Ca 72 ttittgcct.cg Ctggaggatg tacaggccala ggtoctggaa attaccataca alaggcaaaga 781 tctaag catg attgtgttgc tgcCaaatga aatcgatggit Ct CCalgaag C ttgaa.gagaa 841 acticactgct gagaaattga tggaatggac aagtttgcag aatatgaga.g agaca C9tgt 9 Ol cgatttacac ttacct c.ggt tcaaagtgga aga gag Citat gacct calagg acacgttgag 961 aacCatggga atggtggata tottcaatgg ggatgcagac Ctcticaggca tgaCCgg gag 1021 cc.gcgg totc gtgctatotg gag to Ctaca caaggcc titt gtggaggitta Cagaggaggg 108 agCagaagct gCagctg.cca cc.gctg. tagt aggatt C9ga tCat Caccta Cttcaactaa 14 tgaag agttc cattgtaatc accct t t cct att Ctt Cata aggcaaaata agaCCaa Cag 201 catcct Cttic tatgg cagat totCat CCCC gtagatgcaa. ttagtctgtc acticcatttg 261 gaalaatgttc a CCtg Cagat gttctgg tala actgattgct ggcaacaa.ca gattct cittg 1321 gctica tattt Cttitt ctitt C tdatcttgat gatgatcgtc atcatcaaga atttaatgat 38 taalaa tag Ca tgcct ttctic tottt ct citt aataag.ccca catataaatg tact t t t tect 441 tcCagaaaaa ttcticcittga goaaaaatgt C Caaaataag atgaat cact taataccgta 15O1 tcttctaaat ttgaaatata attctgtttg tgacctgttt taaatgalacc aaaCCaaat C 1561 atact t t titc tttgaattta gcaacct aga alacaca Catt tctttgaatt taggtgatac 621. CtalaatcCtt cittatgtttc taaattttgt gattictataa ala Cacat Cat Caataaaata 68 gtgacataaa at Ca Fig. 12 U.S. Patent Feb. 16, 2010 Sheet 15 of 32 US 7,662,561 B2

SCCA2 cDNA Sequence (SEQID NO: 13)

gg gagacaca cacagcctict ctg.cccacct ctgct tcctic taggaacaca ggagttcCag 6. at cacatcga gttcaccatg aatt Cact Ca gtgaa.gc.cala Caccaagttc atgttcgatc 121 tgttcCaiaca gttcagaaaa toaaaag aga acaa.cat Ctt Ctatt CCCCt at Cagcatca 81 Cat Cag Catt agggatgg to citct taggag ccaaaga caa cactgcacaa Calaat tag Ca 241 aggttctt Ca Ctttgat Cala gtcacagaga. acaccacaga aaaagctgca acatat catg 3 O1 ttgataggit C aggaalatgtt catcaccagt ttcaaaagct totgactgaa tt Cala Calaat 361 ccactgatgc atatgag Ctg alagat C9 C Ca acaagct citt cggagaaaag acgitat caat 421. ttttacagga at atttagat gc.cat Calaga aattitta CCa gaccag togtg gaatctactg 481 attittgcaaa tgctCcagaa gaaagttcaa. agalagattala Ct CCtggg to gaaagttcaaa. 541 Cgaatgaaaa aattaaaaac ctattitcctg atggg act at tgg Calatgat acgacactgg 6O1 ttcttgttgaa cgcaatctat ttcaaagggc agtgggagaa taalatt taala aaagaaaa.ca 66. Ctaaagagga aaaattittgg Ccaaacaaga alta Catacala at Ct9tacag atgatgagg C 72 aalta Calatt C Ctttaattitt gccttgctgg aggatgtaca ggcCalagg to CtggalaataC 78. Catacaaagg caaagatcta agcatgattg tgctgctgcC aaatgaaatc gatgg totgC 841 agaagcttga agagaaactC actgctgaga aattgatgga atggaCaagt ttgCalgaata 901 tgaga.gagac atgtgtcg at ttacact tac citcggttcaa aatgga agag agctatgacc 961 toaaggacac gttgaga acc atgggaatgg tgaatat citt Caatggggat gcagacct ct 102 Cagg catgac ctggagccac ggtotcticag tatictaaagt cctacacaag gCCtttgttgg 108 aggt Cactga ggagggagtg gaagctgcag ctgccaccgc tgtag tagta gtcga attat 141 Catct CCtt C alactaatgaa gagttctgtt gtaatcacco ttitcc tattic tt catalaggc 2O1 aaaataagac caa.ca.gcatc citct tctatg gcagattcto atc.cccatag atgcaattag 1261 tCtgtcactic catttagaala atgttcacct agaggtgttc tgg taalactg attgctggca 1321 a Caacagatt CtCttggct C a tattt Cttt tct at Ct cat Cttgatgatg atagt catca 1381 tCaaga attt aatgattaaa a tag Cat gCC titt ct ct citt tCtcttaata agcccacata 1441 taaatgtact titt CCtt coca gaaaaattt C CCttgaggaa aaatgtcCala gatalagatga 15O1 at Catttaat accgtgtctt Ctaaatttga alatatalattC tgtttctgac ctgttittaaa 15 61 tgaaccaaac Calaat CataC titt Ctctt Ca aatttagcaa. Cctagaaa.ca Cacattt Ctt 1621 tgaatttagg tgatacctaa atcCtt Ctta tgtttctaala ttttgttgatt Ctataaaa.ca 1681 CatCatcaat aaaataatga Ctaaaaaaaa. aaaaaaaaala aadalalaaaa. laaaaaaaala

74 aaaaaaaaala ala CCCaaaaa. aaaaaaaaaa. aaaaaaaaaa. aa. Fig. 13

U.S. Patent Feb. 16, 2010 Sheet 17 of 32 US 7,662,561 B2

TYR cDNA Sequence (SEQ ID NO: 15)

tattgagttc ttcaaacatt gtagcc tictt tatgg totct galgaaataac tacct taalac 61 cCatalat Ctt taataCtt CC taalactitt Ct taataa.gaga. agctictatto Ctgacactac 121 ctotcatttg caaggtoaaa tdatcattag ttttgtag to tatta actgg gtttgct tag 181 gtCagg catt attattact a acct tattgt taatatt cita accataagaa ttaalactatt 24 aatggtgaat agagtttitt c act ttaaCat agg CCtat CC Cactggtggg atacgagcca 301 att C9 aaaga aaagt cagtic atgtgcttitt Cagaggatga aagct talaga taaagaCtaa 361 aagttgtttga tgctggaggit gggagtggta ttatataggit cticago Caag acatgtgata 42 at cactg tag tag tagctgg aaag agaaat ctgtgacticc aattagocag titcCtgcaga 48 cCttgttgagg acta gagga a gaatgctCct ggctgttittg tactgcctgc tgtggagttt 54 ccagacctico gctggccatt tocctagagc ctgtgtctoc tctaagaacc tgatggagaa 601 ggaatgctgt ccaccgtgga gCgggga cag gagt ccCtgt ggccagottt Caggcagagg 661 ttcctgtcag alatat cott c tgtccaatgc acCacttggg cct caattitc CCtt Cacagg 721 ggtggatgac Cgggagt C9t ggCCttCcgt Cttittataat aggacctgcc agtgctctgg 781 caact tcatg ggattcaact gtggaaactg Caagtttggc ttittggggac caaactgcac 841 agagaga.cga. citcttgg toga gaagaaacat ct tcgatttg agtgCCC cag aga agga Cala 90 atttitttgcc tacct Cact t tag Caaag.ca taccatcago toagactato tdatc.cccat. 961 agggaccitat ggccalaatga aaaatggat C aacaccCatg tttalacga.ca tcaat attta 1021 tgacct ctitt gtctggatgC attattatgt gt caatggat gcactgcttg ggggatctga 1081 aatctggaga gacattgatt ttgcc catga agcaccagct tttctgcctt gg catagact 14 Cttcttgttg Cggtgggaac aagaaatcca gaagctgaca ggagatgaaa actt Cactat 120 to catattgg gactggCggg atgcagaaala gtgttga catt tgcacagatg agtacatggg 1261 aggtoag cac cc cacaaatc ctaact tact cagcc.ca.gca totatt ctitct cct Cttggca l321 gattgttctgt agcc.gattgg aggagtacala cagocatcag tott tatgca atggalacgc.c 1381 cgaggg acct ttacggCgta at CCtggaala c catgacaaa tcCagaacco caaggctocc 441 ctott cagot gatgtagaat tttgcctgag tttgacccala tatgaatctg gttcCatgga 1501 talaagctg.cc aattt cagct ttagaaatac actggaagga tttgctag to Cact tactgg 1561 gatag coggat. gcct citcaaa gcagcatgca Caatgccttg ca Catctata tgaatggaac 1621 aatgtcc.ca.g gta Cagg gat Ctgccaacga toctatic tetc Cttct tcacc atgcatttgt 1681 tgacag tatt tittgag Cagt ggct CC9aag gCaccgt.cct Cttcaagaag tittatcCaga 1741 agcCaatgca cc cattggac ataa.ccggga atcc tacatg gttcCttitta taCCaCtgta 1801 Cagaaatggit gatttct tta titt catccala agatctgggC tatgactata gctatotaca 1861 agattcagac ccagactictt ttcaagacta Cattalagt cc tatttggaac aag.cgagt cq Fig. 1511 U.S. Patent Feb. 16, 2010 Sheet 18 of 32 US 7,662,561 B2

1921 gatctgg toa tggct cottg ggg C9g Coat gg tagggg CC gtcct cactg cc.ctgctggc 98. aggg Cttgttg agcttgctgt gtcgtcacala gagaaag.ca.g Ctt CCtgaag aaaag CagCC 2041 acticct catg galgaaagagg attacCacag Cttgtaticag agc catttat aaaaggCtta 2101 gg Caatagag tagg gccaaa aag cctgacC tCact CtaaC tcaaagtaat gtcCaggitt C 216l ccagagaata totgctggta tttittctgta aagaccattt gcaaaattgt aaCCtaataC 222l aaagtgtag C Cttct tccala cticagg taga acacacctgt Ctttgtc.ttg Ctgttitt cac 228. tdag coctitt tala Cattitt c CCCtaag.ccc atatgtctaa ggaaaggatg ctatttggta 2341 atgaggaact gttatttgta tgttgaattaa agtgct citta titt t Fig. 15/2

U.S. Patent Feb. 16, 2010 Sheet 20 of 32 US 7,662,561 B2

1861 gaaaacctgg t cat Caccc.c ccggctic titt gag tett CCa a Caag actgg gcgct tcctg

1921 gccacagaga tocctgacitt caatcaggat gacttggaag aggatgatgt gttcc tacta 1981 gatgtctggg accaggtott cittctggatt gggaalacatg C Calacgagga ggagalagaag 2041 gcc.gcagcaa cCactgcaca ggaatacctic aaga CC catc CCa9C999C9 tgaCCCt9ag 2101 a CCCC catca ttgttgg togala gCaggga cac gag.ccc.ccca cct tca cagg Ctggttcctg 216 gCttgggat.c CCttcaagtg gag taa Cacc aaatcc tatg agga CCtgaa ggcggagt ct 2221 ggCaaCCtta gggaCtggag ccagat Cact gCtgagg to a caagcc.ccala agtggacgtg 2281 ttcaatgcta a Cag Calacct cagttctggg Cctctg.ccca tct tcc.ccct gdagcagota 234l gtgaacaagc Ctgtagagga gct CCCC gag ggtgtggaCC CCagcaggaa ggaggaaCaC 24 O1 Ctgtc.cattg aagattt cac tcaggcc titt gggatgactic cagotgcc.tt citctgctctg 246 Cct C9 atgga agcaacaaaa Cct Caagaala gaaaaagga C tattittgaga agagtagctg 2521 tgg ttgtaaa gCagtaccCt accctgattg taggg to tca ttitt ct cacc gatat tagt c 258 Ctal CaCCaat tgaagttgaaa. ttittgcagat gtgcc tatga gCacaaactt Ctgtggcaaa 2641 tgccagttitt gtttaataat gtacctatt C Ctt cagaaag atgata CCCC aaaaaaaaaa.

27 Ol ala Fig. 16/2 U.S. Patent Feb. 16, 2010 Sheet 21 of 32 US 7,662,561 B2

: : Ž 4. H 2, f

3A3 uossadx. U.S. Patent Feb. 16, 2010 Sheet 22 of 32 US 7,662,561 B2

U.S. Patent Feb. 16, 2010 Sheet 23 of 32 US 7,662,561 B2

pSOe) 6O U.S. Patent Feb. 16, 2010 Sheet 24 of 32 US 7,662,561 B2

N

C N. CO yoo CD cp

op

C- 7- 9- 8- O- Øl LuIIIA fo

cN

O

CNN s V o so CD

c op

O C- 7- 9- 8 Lpisoel 6ol lipsoe 6o

cN

Cd CD CNN CO d v g w S2 9 cp L

OO

O G- O Oayo 6o U.S. Patent Feb. 16, 2010 Sheet 25 of 32 US 7,662,561 B2

w

cN - OO O V cy s 9 3 L cp op

Z- 7- 9- 9- Ol- ZL LuIIIA 6o

w

CN N1 OO O Vim g N is O 3 L p op

O a- 7- 9- 8 pisoe) fo

w

CN I O OO o v

cN O Yi o 9l cp op

O G- OL Ozyo fo U.S. Patent Feb. 16, 2010 Sheet 26 of 32 US 7,662,561 B2

c O OO g Vs rt st 3. 9 c

ed

C- ty- 9- g- O - al LuIIIA 6o

Z OO V 9

2- 7- 9- 9- O- 2 - LuIIIA fo

e OO vm 9 L

Lpsoe 6o U.S. Patent Feb. 16, 2010 Sheet 27 Of 32 US 7,662,561 B2

m Z. H 2. < re

N Z G < 8 2

Z.

sA. 2. H

Z. C Z V g A - A. H CD Ž S. AZ. H

Z. c Na Z. O A. s

5

eaat uoisseudx U.S. Patent Feb. 16, 2010 Sheet 28 of 32 US 7,662,561 B2

SOwl. U.S. Patent Feb. 16, 2010 Sheet 29 of 32 US 7,662,561 B2

i U.S. Patent Feb. 16, 2010 Sheet 30 of 32 US 7,662,561 B2

2

al

3

2.

5 s 2.

co (N - d ... c. co w up cip eme uossaudx. U.S. Patent Feb. 16, 2010 Sheet 31 of 32 US 7,662,561 B2

; 3. CN 9

C t GN CN O LL U.S. Patent Feb. 16, 2010 Sheet 32 of 32 US 7,662,561 B2

:

3

3 3 t

9A3 uoisseudx US 7,662,561 B2 1. 2 IDENTIFICATION OF MARKERS IN determining if an mRNA species specific to one or more of ESOPHAGEAL CANCER, COLON CANCER, CEA, CK19, PTHrP, PVA, TACSTD1 and SCCA1.2 HEAD AND NECK CANCER, AND (SCCA1+SCCA2) is overabundant in an RNA sample pre MELANOMA pared from the lymph node. The overabundance of the mRNA species is indicative of the presence of displaced cells of a CROSS REFERENCE TO RELATED squamous cell carcinoma of the head and neck in the lymph APPLICATIONS node. This application claims the benefit under 35 U.S.C. S 119 Instill another embodiment, the present invention relates to (e) to priority U.S. Provisional Patent Application Nos. 10 a method for identifying the expression or markers indicative 60/586,599 and 60/587,019, both filed on Jul. 9, 2004, each of of the presence of cells of a squamous cell carcinoma in a which is incorporated herein by reference in its entirety. lymph node of a patient. The method comprises determining if an mRNA species specific to PVA is overabundant in an BACKGROUND RNA sample prepared from the lymph node. The overabun 15 dance of the mRNA species is indicative of the presence of 1. Field of the Invention displaced cells of a squamous cell carcinoma in the lymph Provided are improved cancer diagnostic methods, along node. with compositions and apparatus useful in conducting those In yet another embodiment, the present invention relates to methods. a method for identifying the expression of markers indicative 2. Description of the Related Art of the presence of colon cancer cells in a lymph node of a Early detection of cancer typically leads to increased Sur patient. The method comprises determining if an mRNA spe vival rates. Metastatic lesions commonly are detected by cies specific to one or more of CDX1, TACSTD1 and VIL1 is histological techniques, including immunohistochemical overabundant in an RNA sample prepared from the lymph techniques. Metastasized cells typically infiltrate the lymph node. The overabundance of the mRNA species is indicative nodes, and, thus in most instances, certain sentinel lymph 25 of the presence of displaced colon cells in the lymph node. nodes, lymph nodes where metastasized cells typically first Instill another embodiment, the present invention relates to infiltrate, are recognized for each cancer type and are ana a method for identifying the expression of markers indicative lyzed for the presence of lesions, including micrometastases. of the presence of melanoma cells in a lymph node of a Trained histologists often can detect metastatic lesions visu patient. The method comprises determining if an mRNA spe ally after tissue from a sentinel lymph node is sectioned and 30 cies specific to one or more of MAGEA136-plex, MART1, stained. Highly trained histologists often can visualize and TYR is overabundant in an RNA sample prepared from micrometasteses, but the ability to visualize such lesions var the lymph node. The overabundance of the mRNA species is ies from histologist-to-histologist. indicative of the presence of melanoma cells in the lymph In many Surgical procedures to remove tumors, biopsies of node. sentinel lymph nodes are taken. The Surgical procedure is 35 In yet a further embodiment, the present invention relates then halted and the excised lymphatic tissue is then analyzed. to an article of manufacture comprising packaging material Once it is determined that the tumor has metastasized, a and one or more nucleic acids specific to one or more of CEA, second, more radical Surgical procedure is performed, remov CK7, CK19, CK20, VIL1, TACSTD1, and PVA. The pack ing regional lymphatics. A rapid method for identifying aging material comprises an indicia, for example and without tumors is therefore warranted, not only because more assays 40 limitation, a writing, illustration, label, tag, book, booklet can be performed in a given time period, thereby increasing and/or package insert, indicating that the one or more nucleic laboratory turnaround, but permitting accurate, intraopera acids can be used in a method of identifying expression of tive decisions to be made, rather than conducting a second markers indicative of the presence of esophageal cancer cells surgical procedure. It is therefore desirable to identify useful in a lymph node of a patient. diagnostics for malignancies, especially that permit rapid 45 and/or intraoperative detection of lymphatic microme In a still further embodiment, the present invention relates taStaSeS. to an article of manufacture comprising packaging material and one or more nucleic acids specific to one or more of CEA, SUMMARY CK19, PTHrP, PVA, TACSTD1 and SCCA1.2. The packag 50 ing material comprises an indicia indicating that the one or The present invention relates to a diagnostic method for more nucleic acids can be used in a method of identifying detecting the presence of cancer cells in a patient by identi expression of markers indicative of the presence of cells of a fying the expression of certain markers indicative of the pres squamous cell carcinoma of the head and neck in a lymph ence of cancer cell. node of a patient. In one embodiment, the present invention relates to a 55 In another embodiment, the present invention relates to an method of identifying the expression of markers indicative of article of manufacture comprising packaging material and the presence of esophageal cancer cells in a lymph node of a one or more nucleic acids specific to one or more of CDX1, patient. The method comprises determining if an mRNA spe TACSTD1 and VIL1. The packaging material comprises an cies specific to one or more of CEA, CK7, CK19, CK20. indicia indicating that the one or more nucleic acids can be VIL1, TACSTD1, and PVA is overabundant in an RNA 60 used in a method of identifying expression of markers indica sample prepared from the lymph node. The overabundance of tive of the presence of colon cancer cells in a lymph node of the mRNA species is indicative of the presence of displaced a patient. cells of the esophagus in the lymph node. Instill another embodiment, the present invention relates to In another embodiment, the present invention relates to a an article of manufacture comprising packaging material and method of identifying the expression of markers indicative of 65 one or more nucleic acids specific to one or more of the presence of cells of squamous cell carcinoma of the head MAGEA136-plex, MART1 and TYR. The packaging mate and neck in a lymph node of a patient. The method comprises rial comprises an indicia indicating that the one or more US 7,662,561 B2 3 4 nucleic acids can be used in a method of identifying expres FIG. 10 is a listing of a cDNA sequence for the parathyroid sion of markers indicative of the presence of melanoma cells hormone-related protein (PTHrP) marker (SEQID NO: 10). in a lymph node of a patient. FIG. 11 is a listing of a cDNA sequence for the pemphigu Instill another embodiment, the present invention relates to Vulgatis antigen (PVA) marker (SEQID NO: 11). an article of manufacture comprising packaging material and FIG. 12 is a listing of a cDNA sequence for the squamous one or more nucleic acids specific to PVA. The packaging cell carcinoma antigen 1 (SCCA1) marker (SEQID NO: 12). material comprises an indicia indicating that the one or more FIG. 13 is a listing of a cDNA sequence for the squamous nucleic acids can be used in a method of identifying expres cell carcinoma antigen 2 (SCCA2) marker (SEQID NO: 13). sion of markers indicative of the presence of cells of a squa FIG. 14 is a listing of a cDNA sequence for the tumor mous cell carcinoma in a lymph node of a patient. 10 associated calcium signal transducer 1 (TACSTD1) marker In yet another embodiment, the present invention relates to (SEQID NO: 14). a composition comprising one or more primers or probes FIG. 15 is a listing of a cDNA sequence for the tyrosinase specific to one or more of CEA, CK7, CK19, CK20, VIL1, (TYR) marker (SEQ ID NO: 15). TACSTD1, and PVA and RNA extracted from the lymph node FIG. 16 is a listing of a cDNA sequence for the villin 1 of a patient diagnosed with or Suspected of having esophageal 15 (VIL1) marker (SEQID NO: 16). cancer, or a nucleic acid, or analog thereof, derived from the FIG. 17 is a scatter plot showing the expression levels of RNA. CEA, CK7, SCCA1.2, CK20, TACSTD1, VIL and CK19 in In a further embodiment, the present invention relates to a primary tumor, tumor-positive lymph nodes and benign composition comprising one or more primers or probes spe lymph nodes of an esophageal cancer patient. cific to one or more of CEA, CK19, PTHrP, PVA, TACSTD1 FIG. 18A-O provide scatter plots illustrating the ability of and SCCA 1.2 and RNA extracted from the lymph node of a two-marker systems to distinguish between benign and patient diagnosed with or Suspected of having squamous cell malignant cells in a lymph node of an esophageal cancer carcinoma of the head and neck, or a nucleic acid, or analog patient (negative gray circle; positive—black circle). thereof, derived from the RNA. FIG. 19 is a scatter plot showing the expression levels of In still a further embodiment, the present invention relates 25 CEA, CK19, PThRP, PVA, SCCA12 and TACSTD1 in pri to a composition comprising one or more primers or probes mary tumor, tumor-positive lymph nodes and benign lymph specific to one or more of CDX1, TACSTD1 and VIL1 and nodes of a head & neck cancer patient. RNA extracted from the lymph node of a patient diagnosed FIG. 20A-F provides scatter plots illustrating the ability of with or Suspected of having colon cancer, or a nucleic acid, or two-marker systems to distinguish between benign and an analog thereof, derived from the RNA. 30 malignant cells in a lymph node of a head & neck cancer In yet a further embodiment, the present invention relates patient (negative—circle; positive—"+). to a composition comprising one or more primers or probes FIG. 21 is a scatter plot showing the expression levels of specific to one or more of MAGEA136-plex, MART1 and MART1, TYR and MAGEA136-plex in primary tumor, TYR and RNA extracted from a lymph node of a patient tumor-positive lymph nodes and benign lymph nodes of a diagnosed with or Suspected of having melanoma, or a 35 melanoma patient. nucleic acid, or analog thereof, derived from the RNA. FIGS. 22A and 22B provide scatter plots illustrating the In another embodiment, the present invention relates to a ability of two-marker systems to distinguish between benign composition comprising one or more primers or probes spe and malignant cells in a lymph node of a melanoma patient cific to PVA and RNA extracted from a sentinel lymph node (negative—circle; positive—"+). of a patient diagnosed with or Suspected of having a squa 40 FIG. 23 is a scatter plot showing the expression levels of mous cell carcinoma, or a nucleic acid, or analog thereof, CDX1, CEA, CK19, CK20, TACSTD1 and VIL1 in primary derived from the RNA. tumor, tumor-positive lymph nodes and benign lymph nodes of a colon cancer patient. BRIEF DESCRIPTION OF THE DRAWINGS 45 DETAILED DESCRIPTION FIG. 1 is a listing of a cDNA sequence of the caudal-type homeo box transcription factor 1 (CDX1) marker (SEQ ID Provided are methods and compositions useful in identify NO: 1). ing esophageal cancer, colon cancer, head and neck cancer FIG. 2 is a listing of a cDNA sequence for the carcinoem and melanoma cells, including micrometastases, in lymph bryonic antigen-related cell adhesion molecule 5 (CEA) 50 nodes. Early detection of metastases typically is related to marker (SEQ ID NO: 2). patient Survival. Very small metastases often go undetected in FIG. 3 is a listing of a cDNA sequence for the cytokeratin histological study of lymph node biopsies, resulting in false 7 (CK7) marker (SEQID NO:3). negative results that result in decreased chances of patient FIG. 4 is a listing of a cDNA sequence for the cytokeratin survival. The nucleic acid detection assays described herein 55 are much more discriminating than are histological studies in 19 (CK19) marker (SEQID NO: 4). most instances (a few, excellent histologists are capable of FIG. 5 is a listing of a cDNA sequence for the cytokeratin identifying micrometastases in lymph node sections), and are 20 (CK20) marker (SEQID NO. 5). robust and repeatable in the hands of any minimally-trained FIG. 6 is a listing of a cDNA sequence for the melanoma technician. Although the methods and compositions antigen gene family A1 (MAGEA1) marker (SEQID NO: 6). 60 described herein are necessarily presented comprising FIG. 7 is a listing of a cDNA sequence for the melanoma expression of specific mRNA markers, this should be under antigen gene family A3 (MAGEA3) marker (SEQID NO: 7). stood that it shall not be deemed to exclude methods and FIG. 8 is a listing of a cDNA sequence for the melanoma compositions comprising combinations of the specific mark antigen gene family A6 (MAGEA6) marker (SEQID NO:8). ers and other markers known in the art. FIG. 9 is a listing of a cDNA sequence for the melanoma 65 To this end, a number of molecular markers are identified, antigen recognized by T cells 1 (MART1) marker (SEQ ID that are expressed in certain cancer types, including esoph NO:9). ageal cancer, colon cancer, head and neck cancer and mela US 7,662,561 B2 5 6 noma. These markers are markers specific to the tissue from amplification techniques, such as conducting the PCR reac which the particular cancer type arises and typically are not tion in a Rayleigh-Bénard convection cell, also can dramati expressed, at least to the same levels, in lymphoid tissue. The cally shorten the PCR reaction time beyond these time limits presence and/or elevated expression of one or more of these (see, Krishnan, My et al., “PCR in a Rayleigh-Bénard con markers in sentinel lymph node tissue is indicative of dis vection cell.” Science 298:793 (2002), and Braun, D. et al., placed cells in the lymphoid tissue, which correlates strongly “Exponential DNA Replication by Lominar Convection.” with a cancer diagnosis. As used herein a 'squamous cell Physical Review Letters, 91:158103). carcinoma’ is a cancer arising, at least in part, from a squa As described in U.S. Ser. No. 10/090,326, each cycle may mous cell population and/or containing, at least in part, a be shortened considerably without substantial deterioration squamous cell population including, without limitation, can 10 of production of amplicons. Use of high concentrations of cers of the cervix, penis; head and neck, including, without primers is helpful in shortening the PCR cycle time. High limitation cancers of the oral cavity, salivary glands, parana concentrations typically are greater than about 400 nM, and sal sinuses and nasal cavity, pharynx and larynx; lung; esoph often greater than about 800 nM, though the optimal concen ageal; skin other than melanoma; Vulva and bladder. tration of primers will vary somewhat from assay-to-assay. As used herein, the terms “expression' and “expressed 15 Sensitivity of RT-PCR assays may be enhanced by the use of mean production of a gene-specific mRNA by a cell. In the a sensitive reverse transcriptase enzyme (described below) context of the present disclosure, a “marker” is a gene that is and/or high concentrations of reverse transcriptase primer to expressed abnormally in a lymphatic biopsy. In one embodi produce the initial target PCR template. ment, the markers described herein are mRNA species that The specificity of any given PCR reaction relies heavily, are expressed in cells of a specific tumor source at a signifi but not exclusively, on the identity of the primer sets. The cantly higher level as compared to expression in lymphoid primer sets are pairs of forward and reverse oligonucleotide cells. primers that anneal to a target DNA sequence to permit ampli Expression levels of mRNA can be quantified by a number fication of the target sequence, thereby producing a target ofmethods. Traditional methods include Northern blot analy sequence-specific amplicon. PCR primer sets can include two sis. More recently, nucleic acid detection methods have been 25 primers internal to the target sequence, or one primer internal devised that facilitate quantification of transcripts. Examples to the target sequence and one specific to a target sequence of PCR methods are described in U.S. patent application Ser. that is ligated to the DNA or cDNA target, using a technique No. 10/090.326, incorporated herein by reference in its known as “ligation-anchored PCR' (Troutt, A. B., et al. entirety. Other methods for determining expression levels of (1992), “Ligation-anchored PCR: A Simple Amplification a given mRNA include isothermic amplification or detection 30 Technique with Single-sided Specificity.” Proc. Natl. Acad. assays and array technologies, as are known in the art, such as, Sci. USA, 89:9823-9825). without limitation, those described below. As used herein, a "derivative” of a specified oligonucle The improved PCR methods described herein as well as in otide is an oligonucleotide that binds to the same target U.S. Ser. No. 10/090,326, and other nucleic acid detection sequence as the specified oligonucleotide and amplifies the and amplification methods described herein and as are known 35 same target sequence to produce essentially the same ampli in the art permit rapid detection of cancer cells in lymph node con as the specified oligonucleotide but for differences tissue. These rapid methods can be used intraoperatively, and between the specified oligonucleotide and its derivative. The also are useful in detecting rare nucleic acid species, even in derivative may differ from the specified oligonucleotide by multiplexed PCR reactions that concurrently detect a more insertion, deletion and/or substitution of any residue of the prevalent control nucleic acid. 40 specified sequence so long as the derivative Substantially A typical PCR reaction includes multiple amplification retains the characteristics of the specified sequence in its use steps, or cycles that selectively amplify a target nucleic acid for the same purpose as the specified sequence. species. Because detection of transcripts is necessary, the As used herein, "reagents' for any assay or reaction, Such PCR reaction is coupled with a reverse transcription step as a reverse transcription and PCR, are any compound or (reverse transcription PCR, or RT-PCR). A typical PCR reac 45 composition that is added to the reaction mixture including, tion includes three steps: a denaturing step in which a target without limitation, enzyme(s), nucleotides or analogs nucleic acid is denatured; an annealing step in which a set of thereof, primers and primer sets, probes, antibodies or other PCR primers (forward and backward primers) anneal to binding reagents, detectable labels or tags, buffers, salts and complementary DNA strands; and an elongation step in co-factors. As used herein, unless expressed otherwise, a which a thermostable DNA polymerase elongates the prim 50 “reaction mixture' for a given assay or reaction includes all ers. By repeating this step multiple times, a DNA fragment is necessary compounds and/or compositions necessary to per amplified to produce an amplicon, corresponding to the target form that assay or reaction, even if those compounds or com DNA sequence. Typical PCR reactions include 30 or more positions are not expressly indicated. Reagents for many cycles of denaturation, annealing and elongation. In many common assays or reactions. Such as enzymatic reaction, are cases, the annealing and elongation steps can be performed 55 known in the art and typically are provided and/or Suggested concurrently, that is at the same temperature, in which case when the assay or reaction kit is sold. the cycle contains only two steps. As also described in U.S. Ser. No. 10/090,326, multiplexed The lengths of the denaturation, annealing and elongation PCR assays may be optimized, or balanced, by time-shifting stages may be any desirable length of time. However, in the production of amplicons, rather than by manipulating attempting to shorten the PCR amplification reaction to a time 60 primer concentrations. This may be achieved by using two Suitable for intraoperative diagnosis, the lengths of these primer sets, each primer set having a different Tm so that a steps can be in the seconds range, rather than the minutes two-stage PCR assay can be performed, with different range. The denaturation step may be conducted for times of annealing and/or elongation temperatures for each stage to one second or less. The annealing and elongation steps opti favor the production of one amplicon over another. This time mally are less than 10 seconds each, and when conducted at 65 and temperature shifting method permits optimal balancing the same temperature, the combination annealing/elongation of the multiplex reaction without the difficulties faced when step may be less than 10 seconds. Use of recently developed manipulation of primer concentrations is used to balance the US 7,662,561 B2 7 8 reaction. This technique is especially useful in a multiplex detection with a labeled probe, staining with ethidium bro reaction where it is desirable to amplify a rare cDNA along mide and incorporating fluorescent or radioactive tags in the with a control cDNA. amplicons. A quantitative reverse transcriptase polymerase chain reac However, the progress of the quantitative PCR reactions tion (QRT-PCR) for rapidly and accurately detecting low typically is monitored by determining the relative rates of abundance RNA species in a population of RNA molecules amplicon production for each PCR primer set. Monitoring (for example, and without limitation, total RNA or mRNA), amplicon production may be achieved by a number of pro includes the steps of: a) incubating an RNA sample with a cesses, including without limitation, fluorescent primers, reverse transcriptase and a high concentration of a target 10 fluorogenic probes and fluorescent dyes that bind double sequence-specific reverse transcriptase primer under condi stranded DNA. A common method is the fluorescent 5' tions suitable to generate cDNA; b) Subsequently adding Suit nuclease assay. This method exploits the 5' nuclease activity able polymerase chain reaction (PCR) reagents to the reverse of certain thermostable DNA polymerases (such as Taq or Tfl transcriptase reaction, including a high concentration of a DNA polymerases) to cleave an oligomeric probe during the PCR primer set specific to the cDNA and athermostable DNA 15 PCR process. The oligomer is selected to anneal to the ampli polymerase to the reverse transcriptase reaction, and c) fied target sequence under elongation conditions. The probe cycling the PCR reaction for a desired number of cycles and typically has a fluorescent reporter on its 5' end and a fluo under suitable conditions to generate PCR product (“ampli rescent quencher of the reporter at the 3' end. So long as the cons’) specific to the cDNA. By temporally separating the oligomer is intact, the fluorescent signal from the reporter is reverse transcriptase and the PCR reactions, and by using quenched. However, when the oligomer is digested during the reverse transcriptase-optimized and PCR-optimized primers, elongation process, the fluorescent reporter no longer is in excellent specificity is obtained. The reaction may be con proximity to the quencher. The relative accumulation of free ducted in a single tube (all tubes, containers, vials, cells and fluorescent reporterfor a given amplicon may be compared to the like in which a reaction is performed may be referred to the accumulation of the same amplicons for a control sample herein, from time to time, generically, as a “reaction vessel’), 25 and/or to that of a control gene, such as B-actin or 18S rRNA removing a source of contamination typically found in two to determine the relative abundance of a given cINA product tube reactions. These reaction conditions permit very rapid of a given RNA in a RNA population. Products and reagents QRT-PCR reactions, typically on the order of 20 minutes for the fluorescent 5' nuclease assay are readily available from the beginning of the reverse transcriptase reaction to the 30 commercially, for instance from Applied Biosystems. end of a 40 cycle PCR reaction. Equipment and software also are readily available for The reaction c) may be performed in the same tube as the monitoring amplicon accumulation in PCR and QRT-PCR reverse transcriptase reaction by adding Sufficient reagents to according to the fluorescent 5' nuclease assay and other the reverse transcriptase (RT) reaction to create good, or even QPCR/QRT-PCR procedures, including the Smart Cycler, optimal conditions for the PCR reaction to proceed. A single 35 commercially available from Cepheid of Sunnyvale, Calif., tube may be loaded, prior to the running of the reverse tran the ABI Prism 7700 Sequence Detection System (TaqMan), Scriptase reaction, with: 1) the reverse transcriptase reaction commercially available from Applied BioSystems. A car mixture, and 2) the PCR reaction mixture to be mixed with the tridge-based sample preparation system (GenXpert) com cDNA mixture after the reverse transcriptase reaction is com bines a thermal cycler and fluorescent detection device hav pleted. The reverse transcriptase reaction mixture and the 40 ing the capabilities of the Smart Cycler product with fluid PCR reaction mixture may be physically separated by a solid, circuits and processing elements capable of automatically or semi-solid (including amorphous, glassy Substances and extracting specific nucleic acids from a tissue sample and waxy) barrier of a composition that melts at a temperature performing QPCR or QRT-PCR on the nucleic acid. The greater than the incubation temperature of the reverse tran system uses disposable cartridges that can be configured and Scriptase reaction, but below the denaturing temperature of 45 pre-loaded with a broad variety of reagents. Such a system the PCR reaction. The barrier composition may be hydropho can be configured to disrupt tissue and extract total RNA or bic in nature and forms a second phase with the RT and PCR mRNA from the sample. The reverse transcriptase reaction reaction mixtures when in liquid form. One example of Such components can be added automatically to the RNA and the a barrier composition is wax beads, commonly used in PCR QPCR reaction components can be added automatically upon reactions, such as the AMPLIWAXPCRGEM products com 50 completion of the reverse transcriptase reaction. mercially available from Applied Biosystems of Foster City, Further, the PCR reaction may be monitored of production Calif. (or loss) of aparticular fluorochrome from the reaction. When Alternatively, the separation of the reverse transcriptase the fluorochrome levels reach (or fall to) a desired level, the and the PCR reactions may be achieved by adding the PCR automated system will automatically alter the PCR condi reagents, including the PCR primer set and thermostable 55 tions. In one example, this is particularly useful in the multi DNA polymerase, after the reverse transcriptase reaction is plexed embodiment described above, where a more-abundant completed. Preferably the PCR reagents, are added mechani (control) target species is amplified by the first, lower Tm, cally by a robotic or fluidic means to make sample contami primer set at a lower temperature than the less abundant nation less likely and to remove human error. species amplified by the second, higher Tm, primer set. In the The products of the QRT-PCR process may be compared 60 first stage of the PCR amplification, the annealing tempera after a fixed number of PCR cycles to determine the relative ture is lower than the effective Tm of the first primer set. The quantity of the RNA species as compared to a given reporter annealing temperature then is automatically raised above the gene. One method of comparing the relative quantities of the effective Tm of the first primer set when production of the first products of the QRT-PCR process is by gel electrophoresis, amplicon by the first primer set is detected. In a system that for instance, by running the samples on a gel and detecting 65 automatically dispenses multiple reagents from a cartridge, those samples by one of a number of known methods includ such as the GeneXpert system, a first PCR reaction may be ing, without limitation, Southern blotting and Subsequent conducted at the first Tm and, when the first PCR reaction US 7,662,561 B2 10 proceeds past a threshold level, a second primer with a dif fluorescent reporters in the same tube. For multiplex moni ferent Tm is added, resulting in a sequential multiplexed toring of the fluorescent 5' nuclease assay, oligomers are reaction. provided corresponding to each amplicon species to be In the above-described reactions, the amounts of certain detected. The oligomer probe for each amplicon species has a reverse transcriptase and the PCR reaction components typi fluorescent reporter with a different peak emission wave cally are atypical in order to take advantage of the faster ramp length than the oligomer probe(s) for each other amplicons times of some thermal cyclers. Specifically, the primer con species. The accumulation of each unduenched fluorescent centrations are very high. Typical gene-specific primer con reporter can be monitored to determine the relative amounts centrations for reverse transcriptase reactions are less than of the target sequence corresponding to each amplicon. about 20 nM. To achieve a rapid reverse transcriptase reaction 10 In traditional multiplex QPCR and QRT-PCR procedures, on the order of one to two minutes, the reverse transcriptase the selection of PCR primer sets having similar annealing and primer concentration was raised to greater than 20 nM, pref elongation kinetics and similar sized amplicons are desirable. erably at least about 50 nM, and typically about 100 nM. The design and selection of appropriate PCR primer sets is a Standard PCR primer concentrations range from 100 nM to process that is well known to a person skilled in the art. The 300 nM. Higher concentrations may be used in standard PCR 15 process for identifying optimal PCR primer sets, and respec reactions to compensate for Tm variations. However, the ref tive ratios thereof to achieve a balanced multiplex reaction erenced primer concentrations are for circumstances where also is known. By “balanced, it is meant that certain ampli no Tm compensation is needed. Proportionately higher con concs) do not out-compete the other amplicon(s) for centrations of primers may be empirically determined and resources, such as dNTPs or enzyme. For instance, by limit used if Tm compensation is necessary or desired. To achieve ing the abundance of the PCR primers for the more abundant rapid PCR reactions, the PCR primer concentrations typically RNA species in an RT-PCR experiment will allow the detec are greater than 200 nM, preferably greater than about 500 tion of less abundant species. Equalization of the Tm (melting nMandtypically about 800 nM. Typically, the ratio of reverse temperature) for all PCR primer sets also is encouraged. See, transcriptase primer to PCR primer is about 1 to 8 or more. for instance, ABI PRISM 7700 Sequence Detection System The increase in primer concentrations permitted PCR experi 25 User Bulletin #5, “Multiplex PCR with TaqManVIC Probes', ments of 40 cycles to be conducted in less than 20 minutes. Applied Biosystems (1998/2001). A sensitive reverse transcriptase may be preferred in cer Despite the above, for very low copy number transcripts, it tain circumstances where either low amounts of RNA are is difficult to design accurate multiplex PCR experiments, present or a target RNA is a low abundance RNA. By the term even by limiting the PCR primer sets for the more abundant “sensitive reverse transcriptase, it is meant a reverse tran 30 control species. One solution to this problem is to run the PCR scriptase capable of producing suitable PCR templates from reaction for the low abundance RNA in a separate tube than low copy number transcripts for use as PCR templates. The the PCR reaction for the more abundant species. However, sensitivity of the sensitive reverse transcriptase may derive that strategy does not take advantage of the benefits of run from the physical nature of the enzyme, or from specific ning a multiplex PCR experiment. A two-tube process has reaction conditions of the reverse transcriptase reaction mix 35 several drawbacks, including cost, the addition of more room ture that produces the enhanced sensitivity. One example of a for experimental error and the increased chance of sample sensitive reverse transcriptase is SensiScript RT reverse tran contamination, which is critical in PCR assays. Scriptase, commercially available from Qiagen, Inc. of Valen A method has been described in WO 02/070751 for per cia, Calif. This reverse transcriptase is optimized for the pro forming a multiplex PCR process, including QRT-PCR and duction of cDNA from RNA samples of <50 ng, but also has 40 QPCR, capable of detecting low copy number nucleic acid the ability to produce PCR templates from low copy number species along with one or more higher copy number species. transcripts. In practice, in the assays described herein, The difference between low copy number and high copy adequate results were obtained for samples of up to, and even number nucleic acid species is relative, but is referred to in excess of about 400 ng RNA. Other sensitive reverse herein as a difference in the prevalence of a low (lower) copy transcriptases having Substantially similar ability to reverse 45 number species and a high (higher) copy number species of at transcribe low copy number transcripts would be equivalent least about 30-fold, but more typically at least about 100-fold. sensitive reverse transcriptase for the purposes described For purposes herein, the relative prevalence of two nucleic herein. Notwithstanding the above, the ability of the sensitive acid species to be amplified is more salient than the relative reverse transcriptase to produce cDNA from low quantities of prevalence of the two nucleic acid species in relation to other RNA is secondary to the ability of the enzyme, or enzyme 50 nucleic acid species in a given nucleic acid sample because reaction system to produce PCR templates from low copy other nucleic acid species in the nucleic acid sample do not number sequences. directly compete with the species to be amplified for PCR As discussed above, the procedures described herein also SOUCS. may be used in multiplex QRT-PCR processes. In its broadest As used herein, the prevalence of any given nucleic acid sense, a multiplex PCR process involves production of two or 55 species in a given nucleic acid sample, prior to testing, is more amplicons in the same reaction vessel. Multiplex ampli unknown. Thus, the “expected number of copies of a given cons may be analyzed by gel electrophoresis and detection of nucleic acid species in an nucleic acid sample often is used the amplicons by one of a variety of methods. Such as, without herein and is based on historical data on the prevalence of that limitation ethidium bromide staining, Southern blotting and species in nucleic acid samples. For any given pair of nucleic hybridization to probes, or by incorporating fluorescent or 60 acid species, one would expect, based on previous determi radioactive moieties into the amplicons and Subsequently nations of the relative prevalence of the two species in a viewing the product on a gel. However, real-time monitoring sample, the prevalence of each species to fall within a range. of the production of two or more amplicons is preferred. The By determining these ranges one would determine the differ fluorescent 5' nuclease assay is the most common monitoring ence in the expected number of target sequences for each method. Equipment is now available (for example, the above 65 species. An mRNA species is identified as “overabundant' if described Smart Cycler and TaqMan products) that permits it is present in statistically significant amounts over normal the real-time monitoring of accumulation of two or more prevalence of the mRNA species in a sample from a normal US 7,662,561 B2 11 12 patient or lymph node. As is abundantly illustrated in the acid amplicons, selectivity no longer is a significantissue, and examples and plots provided herein, a person of skill in the art efficiency of amplicon production is preferred). It, therefore, would be able to ascertain statistically significant ranges or should be noted that although favorable in many instances, cutoffs for determining the precise definition of “overabun the temperature variations may not necessarily result in the dance' for any one or more mRNA species. complete shutdown of one amplification reaction over The multiplex method involves performing a two-(or another. more) stage PCR amplification, permitting modulation of the In another variation of the above-described amplification relative rate of production of a first amplicon by a first primer reaction, a first primer set with a first Tm may target a more set and a second amplicon by a second primer set during the abundant template sequence (for instance, the control tem respective amplification stages. By this method, PCR ampli 10 plate sequence) and a second primerset with a higher Tm may fications to produce amplicons directed to a lower abundance target a less-abundant template sequence. In this case, the nucleic acid species are effectively “balanced with PCR more-abundant template and the less-abundant template may amplifications to produce amplicons directed to a higher both be amplified in a first stage at a temperature below the abundance nucleic acid species. Separating the reaction into (lower) Tm of the first primerset. When a threshold amount of two or more temporal stages may beachieved by omitting the 15 amplicon corresponding to the more abundant template is PCR primer set for any amplicons that are not to be produced reached, the annealing and/or elongation temperature of the in the first amplification stage. This is best achieved through reaction is raised above the Tm of the first primer set, but use of automated processes. Such as the GenXpert prototype below the higher Tm of the second primer set to effectively system described above. Two or more separate amplification shut down amplification of the more abundant template. stages may be used to tailor and balance multiplex assays, Selection of three or more sets of PCR primer sets having along with, or to the exclusion of tailoring the concentration three or more different Tms (for instance, Tm, dTmid-Tm) of the respective primer sets. can be used to amplify sequences of varying abundance in a A second method for temporally separating the PCR stepwise manner, so long as the differences in the Tms are amplification process into two or more stages is to select PCR sufficiently large to permit preferential amplification of primer sets with variation in their respective Tm. In one 25 desired sequences to the Substantial exclusion of undesired example, primers for a lower copy number nucleic acid spe sequences for a desired number of cycles. In that process, the cies would have a higher Tm (Tm) than primers for a higher lowest abundance sequences are amplified in a first stage for abundance species (Tm). In this process, the first stage of a predetermined number of cycles. Next, the lowest abun PCR amplification is conducted for a predetermined number dance and the lesser abundance sequences are amplified in a of cycles at a temperature sufficiently higher than Tm, so that 30 second stage for a predetermined number of cycles. Lastly, all there is substantially no amplification of the higher abun sequences are amplified in a third stage. As with the two-stage dance species. After the first stage of amplification, the reaction described above, the minimum temperature for each annealing and elongation steps of the PCR reaction are con stage may vary, depending on the relative efficiencies of each ducted at a lower temperature, typically about Tm, so that single amplification reaction of the multiplex reaction. It both the lower abundance and the higher abundance 35 should be recognized that two or more amplimers may have amplimers are amplified. It should be noted that Tm, as used Substantially the same Tm, to permit amplification of more herein and unless otherwise noted, refers to “effective Tm. than one species of similar abundance at any stage of the which is the Tm for any given primer in a given reaction mix, amplification process. As with the two-stage reaction, the which depends on factors, including, without limitation, the three-stage reaction may also proceed stepwise from ampli nucleic acid sequence of the primer and the primer concen 40 fication of the most abundant nucleic acid species at the tration in the reaction mixture. lowest annealing temperature to amplification of the least It should be noted that PCR amplification is a dynamic abundant species at the highest annealing temperature. process. When using temperature to modulate the respective By this sequential amplification method, an additional tool PCR reactions in a multiplex PCR reaction, the higher tem is provided for the “balancing of multiplex PCR reactions perature annealing stage may be carried out at any tempera 45 besides the matching of Tms and using limiting amounts of ture typically ranging from just above the lower Tm to just one or more PCR primer sets. The exploitation of PCR primer below the higher Tm, so long as the reaction favors produc sets with different Tms as a method for sequentially ampli tion of the amplicon by the higher Tm primer set. Similarly, fying different amplicons may be preferred in certain circum the annealing for the lower temperature reaction typically is at stances to the sequential addition of additional primer sets. any temperature below the Tm of the low temperature primer 50 However, the use of temperature-dependent sequencing of Set. multiplex PCR reactions may be coupled with the sequential In the example provided above, in the higher temperature physical addition of primer sets to a single reaction mixture. stage the amplicon for the low abundance RNA is amplified at An internal positive control that confirms the operation of a rate faster than that the amplicon for the higher abundance a particular amplification reaction for a negative result also RNA (and preferably to the substantial exclusion of produc 55 may be used. The internal positive controls (IPC) are DNA tion of the second amplicon), so that, prior to the second oligonucleotides that have the same primer sequences as the amplification stage, where it is desirable that amplification of target gene (CEA or tyrosinase) but have a different internal all amplicons proceeds in a Substantially balanced manner, probe sequence. Selected sites in the IPC's optionally may be the amplicon for the lower abundance RNA is of sufficient synthesized with uracil instead of thymine so that contami abundance that the amplification of the higher abundance 60 nation with the highly concentrated mimic could be con RNA does not interfere with the amplification of the amplicon trolled using uracil DNA glycosylase, if required. The IPCs for the lower abundance RNA. In the first stage of amplifica maybe added to any PCR reaction mastermix in amounts that tion, when the amplicon for the low abundance nucleic acid is are determined empirically to give Ct values typically greater preferentially amplified, the annealing and elongation steps than the Ct values of the endogenous target of the primer set. may be performed above Tm to gain specificity over effi 65 The PCR assays are then performed according to standard ciency (during the second stage of the amplification, since protocols, and even when there is no endogenous target for there is a relatively large number of low abundance nucleic the primerset, the IPC would be amplified, thereby verifying US 7,662,561 B2 13 14 that the failure to amplify the target endogenous DNA is not which also provides primer and probe design software for a failure of the PCR reagents in the mastermix. In this molecular beacon and array assays. Primers and/or probes for embodiment, the IPC probe fluoresces differently than the two or more different mRNAs can be identified, for example probe for the endogenous sequences. A variation of this for and without limitation, by aligning the two or more target use in RT-PCR reactions is where the IPC is an RNA and the sequences according to standard methods, determining com RNA includes an RT primer sequence. In this embodiment, mon sequences between the two or more mRNAs and enter the IPC verifies function of both the RT and PCR reactions. ing the common sequences into a suitable primer design Both RNA and DNA IPCs (with different corresponding computer program. probes) may also be employed to differentiate difficulties in As used herein, a “primer or probe' for detecting a specific the RT and PCR reactions. 10 mRNA species is any primer, primer set and/or probe that can The rapid QRT-PCR protocols described herein may be run be utilized to detect and/or quantify the specific mRNA spe in about 20 minutes. This short time period permits the assay cies. An “mRNA species' can be a single mRNA species, to be run intraoperatively so that a Surgeon can decide on a corresponding to a single mRNA expression product of a Surgical course during a single operation (typically the patient single gene, or can be multiple mRNAS that are detected by a will remain anesthetized and/or otherwise sedated in a single 15 single common primer and/or probe combination, Such as the “operation', though there may be a waiting period between SCCA1.2 and MAGEA136-plex pecies described below. when the sample to be tested is obtained and the time the In the commercialization of the methods described herein, interoperative assay is complete), rather than requiring a sec certain kits for detection of specific nucleic acids will be ond operation, or requiring the Surgeon to perform unneeded particularly useful. A kit typically comprises one or more or overly broad prophylactic procedures. For instance, in the reagents, such as, without limitation, nucleic acid primers or Surgical evaluation of certain cancers, including breast can probes, packaged in a container. Such as, without limitation, a cer, melanoma, lung cancer, esophageal cancer and colon vial, tube or bottle, in a package Suitable for commercial cancer, tumors and sentinel lymph nodes are removed in a distribution, such as, without limitation, a box, a sealed first operation. The sentinel nodes are later evaluated for pouch, a blister pack and a carton. The package typically micrometastases, and, when micrometastases are detected in 25 contains an indicia, for example and without limitation, a a patient's sentinellymph node, the patient will need a second writing, illustration, label, book, booklet, tag and/or packag operation, thereby increasing the patient’s Surgical risks and ing insert, indicating that the packaged reagents can be used patient discomfort associated with multiple operations. With in a method for identifying expression of markers indicative the ability to determine the expression levels of certain tumor of the presence of cancer cells in alymph node of a patient. As specific markers described herein in less than 30 minutes with 30 used herein, "packaging materials” includes any article used increased accuracy, a physician can make an immediate deci in the packaging, for distribution of reagents in a kit, includ sion on how to proceed without requiring the patient to leave ing, without limitation, containers, vials, tubes, bottles, the operating room or associated facilities. The rapid test also pouches, blister packaging, labels, tags, instruction sheets, is applicable to needle biopsies taken in a physicians office. and package inserts. A patient need not wait for days to get the results of a biopsy 35 One example of Such a kit would include reagents neces (such as a needle biopsy of a tumor or lymph node), but can sary for the one-tube QRT-PCR process described above. In now get more accurate results in a very short time. one example, the kit would include the above-described As used herein, in the context of gene expression analysis, reagents, including reverse transcriptase, a reverse tran a probe is “specific to a gene or transcript if under reaction Scriptase primer, a corresponding PCR primer set, a thermo conditions it can hybrizide specifically to transcripts of that 40 stable DNA polymerase, such as Taq polymerase, and a Suit gene within a sample, or sequences complementary thereto, able fluorescent reporter, such as, without limitation, a probe and not to other transcripts. Thus, in a diagnostic assay, a for a fluorescent 5' nuclease assay, a molecular beacon probe, probe is specific to a gene if it can bind to a specific transcript a single dye primer or a fluorescent dye specific to double or desired family of transcripts in mRNA extracted from a stranded DNA, such as ethidium bromide. The primers may specimen, to the practical exclusion (does not interfere Sub 45 be present in quantities that would yield the high concentra stantially with the detection assay) of other transcripts. In a tions described above. Thermostable DNA polymerases are PCR assay, primers are specific to a gene if they specifically commonly and commercially available from a variety of amplify a sequence of that gene, to the practical exclusion of manufacturers. Additional materials in the kit may include: other sequences in a sample. Suitable reaction tubes or vials, a barrier composition, typi Table B provides primer and probe sequences for the 50 cally a wax bead, optionally including magnesium; reaction mRNA quantification assays described and depicted in the mixtures (typically 10x) for the reverse transcriptase and the Examples and Figures. FIGS. 1-16 provide non-limiting PCR stages, including necessary buffers and reagents such as examples of cDNA sequences of the various mRNA species dNTPs; nuclease- or RNase-freewater; RNase inhibitor; con detected in the Examples. Although the sequences provided trol nucleic acid(s) and/or any additional buffers, compounds, in Table B were found effective in the assays described in the 55 co-factors, ionic constituents, proteins and enzymes, poly examples, other primers and probes would likely be equally mers, and the like that may be used in reverse transcriptase suited for use in the QRT-PCR and other mRNA detection and and/or PCR stages of QRT-PCR reactions. quantification assays, either described herein or as are known Components of a kit are packaged in any manner that is in the art. Design of alternate primer and probe sets for PCR commercially practicable. For example, PCR primers and assays, as well as for other mRNA detection assays is well 60 reverse transcriptase may be packaged individually to facili within the abilities of one of average skill in the art. For tate flexibility in configuring the assay, or together to increase example and without limitation, a number of computer soft ease of use and to reduce contamination. Similarly, buffers, ware programs will generate primers and primer sets for PCR salts and co-factors can be packaged separately or together. assays from cDNA sequences according to specified param The kits also may include reagents and mechanical com eters. Non limiting examples of Such software include, 65 ponents Suitable for the manual or automated extraction of NetPrimer and Primer Premier 5, commercially available nucleic acid from a tissue sample. These reagents are known from PREMIER Biosoft International of Palo Alto, Calif., to those skilled in the art and typically are a matter of design US 7,662,561 B2 15 16 choice. For instance, in one embodiment of an automated Detection. Current Opinion in Biotechnology, 12:21-27). A process, tissue is disrupted ultrasonically in a Suitable lysis padlock probe is a linear oligonucleotide or polynucleotide solution provided in the kit. The resultant lysate solution is designed to include one target-complementary sequence at then filtered and RNA is bound to RNA-binding magnetic each end, and which is designed such that the two ends are beads also provided in the kit or cartridge. The bead-bound brought immediately next to each other upon hybridization to RNA is washed, and the RNA is eluted from the beads and the target sequence. The probe also includes a spacer between placed into a Suitable reverse transcriptase reaction mixture the target-complementary sequences that includes a poly prior to the reverse transcriptase reaction. In automated pro merase primer site and a site for binding to a probe, Such as a cesses, the choice of reagents and their mode of packaging molecular beacon probe, for detecting the padlock probe (for instance in disposable single-use cartridges) typically are 10 spacer sequence. If properly hybridized to an RNA template, dictated by the physical configuration of the robotics and the probe ends can then be joined by enzymatic DNA ligation fluidics of the specific RNA extraction system, for example to form a circular template that can be amplified by poly and without limitation, the GenXpert system. International merase extension of a complementary primer. Thousands of Patent Publication Nos. WO 04/48931, WO 03/77055, WO concatemerized copies of the template can be generated by 03/72253, WO 03/55973, WO 02/52030, WO 02/18902, WO 15 each primer, permitting detection and quantification of the 01/84463, WO 01/57253, WO 01/45845, WO 00/73413, WO original RNA template. Quantification can be automated by 00/73412 and WO 00/72970 provide non-limiting examples use, for example and without limitation, of a molecular bea of cartridge-based systems and related technology useful in con probe or other probe capable of detecting accumulation the methods described herein. of a target sequence. By using padlock probes with different The constituents of the kits may be packaged together or spacers to bind different molecular beacons that fluoresce a separately, and each constituent may be presented in one or different color on binding to the amplified spacer, this auto more tubes or vials, or in cartridge form, as is appropriate. The mated reaction can be multiplexed. Padlock probe sequences constituents, independently or together, may be packaged in target unique portions of the target RNA in order to ensure any useful state, including without limitation, in a dehy specific binding with limited or no cross-reactivity. RCA is an drated, a lyophilized, a glassified oran aqueous state. The kits 25 isothermic method in that the amplification is performed at may take the physical form of a cartridge for use in automated one temperature. processes, having two or more compartments including the Another isothermic method, for example and without limi above-described reagents. Suitable cartridges are disclosed tation, is nucleic acid sequence-based amplification for example in U.S. Pat. Nos. 6,440,725, 6,431,476, 6,403, (NASBA). A typical NASBA reaction is initiated by the 037 and 6,374,684. 30 annealing of a first oligonucleotideprimerto an RNA targetin Array technologies also can facilitate determining the an RNA sample. The 3' end of the first primer is complemen expression level of two or more genes by facilitating perfor tary to the target analyte; the 5' end encodes the T7 RNA mance of the desired reactions and their analysis by running polymerase promoter. After annealing, the primer is extended multiple parallel reactions at the same time. One example of by reverse transcription (AMV-RT, for example) to produce a an array is the GeneChip(R) gene expression array, commer 35 cDNA. The RNA is digested with RNase H, permitting a cially available from Affymetrix, Inc. of Santa Clara, Calif. second primer (sense) to anneal to the cDNA strand, permit Patents illustrating array technology and uses therefor ting the DNA polymerase activity of the reverse transcriptase include, without limitation, U.S. Pat. Nos. 6,040,138, 6.245, to be engaged, producing a double-stranded cDNA copy of 517, 6,251,601, 6,261,776, 6,306,643, 6,309,823, 6,346,413, the original RNA template, with a functional T7 RNA poly 6,406,844 and 6,416,952. A plethora of other "array' patents 40 merase promoter at one end. T7 polymerase is then used to exist, illustrating the multitude of physical forms a useful produce an additional RNA template, which is further ampli array can take. An "array'. Such as a “microarray' can be a fied, though in reverse order, according to the same proce Substrate containing one or more binding reagents, typically dure. A variety of other nucleic acid detection and/or ampli in discrete physical locations, permitting high throughput fication methods are known to those of skill in the art, analysis of the binding of a sample to the array. In the context 45 including variations on the isothermic Strand displacement, of the methods described herein, an array contains probes PCR and RCA methods described herein. specific to transcripts of one or more of the genes described herein affixed to a substrate. The probes can be nucleic acids Example 1 or analogs thereof, as are known in the art. An array also can refer to a plurality of discrete reaction chambers, permitting 50 General Materials and Methods multiple parallel reactions and detection events on a minia turized scale. Identification of Potential Markers. An extensive literature As mentioned above, PCR-based technologies may be and public database Survey was conducted to identify any used to quantify mRNA levels in a given tissue sample. Other potential markers. Resources for this survey included sequence-specific nucleic acid quantification methods may 55 PubMed, OMIM, UniGene, GeneCards, and CGAP, Survey be more or less Suited. In one embodiment, the nucleic acid criteria were somewhat flexible but the goal was to identify quantification method is a rolling circle amplification genes with moderate to high expression in tumors and low method. Non-limiting examples of rolling circle amplifica expression in normal lymph nodes. In addition, genes tion methods are described in U.S. Pat. Nos. 5,854,003: reported to be upregulated in tumors and genes with restricted 6,183,960; 6,344,329; and 6,210,884, each of which are 60 tissue distribution were considered potentially useful. incorporated herein by reference to the extent they teach Finally, genes reported to be cancer-specific, Such as the methods for detecting and quantifying RNA species. In one cancer testis antigens and hTERT, were evaluated. embodiment, a padlock probe is employed to facilitate the Tissues and Pathological Evaluation. Tissue specimens rolling circle amplification process. (See Nilsson, M. et al. were obtained from tissue banks at the University of Pitts (2002), “Making Ends Meet in Genetic Analysis Using Pad 65 burgh Medical Center through IRB approved protocols. All lock Probes. Human Mutation 19:410-415 and Schweitzer, specimens were Snap frozen in liquid nitrogen and later B. etal (2001), “Combining Nucleic Acid Amplification and embedded in OCT for frozen sectioning. Twenty 5-micron US 7,662,561 B2 17 18 sections were cut from each tissue for RNA isolation. In mates of efficiency were performed with 5' nuclease probes addition, sections were cut and placed on slides for H&E and for all assays used in the secondary screen. IHC analysis at the beginning, middle (between the tenth and A mixture of the Universal Human Reference RNA (Strat eleventh sections for RNA), and end of the sections for RNA agene, La Jolla, Calif.) and RNAS from human placenta, isolation. All three H&E slides from each specimen under thyroid, heart, colon, PCI13 cell line and SKBR3 cell line went pathological review to confirm presence of tumor, per served as a universal positive expression control for all the centage of tumor, and to identify the presence of any contami genes in the marker screening process. nating tissues. All of the unstained slides were stored at -20° Quantification with SYBR Green (Primary Screen). For C. Immunohistochemistry evaluation was performed using SYBR Green I-based QPCR, each 50l reaction contained the AE1/AE3 antibody cocktail (DAKO, Carpinteria, Calif.), 10 1xTaqMan buffer A (Applied Biosystems), 300 nM each and Vector Elite ABC kit and Vector AEC Chromagen (Vecta dNTP 3.5 mM MgCl2, 0.06 units/ul Amplitaq Gold (Applied Laboratories, Burlingame, Calif.). IHC was used as needed as Biosystems), 0.25xSYBR Green I (Molecular Probes, needed to confirm the H&E histology. Eugene, Oreg.) and 200 nM each primer. The amplification Screening Approach. The screening was conducted in two program comprised 2-stages with an initial 95°C. Taq acti phases. All potential markers entered the primary screening 15 vation stage for 12 mm followed by 40 cycles of 95° C. phase and expression was analyzed in 6 primary tumors and denaturation for 15s, 60 or 62 or 64° C. anneal/extend for 60 10benign lymph nodes obtained from patients without cancer S and a 10 second data collection step at a temperature 2-4°C. (5 RNA pools with 2 lymph node RNA’s perpool). Markers below the T of the specific PCR product being amplified that showed good characteristics for lymph node metastasis (Tom B. Morrison, et al., 1998). After amplification, a melting detection passed into the secondary screening phase. The curve analysis was performed by collecting fluorescence data secondary Screen consisted of expression analysis on 20-25 while increasing the temperature from 60° C.-95°C. over 20 primary tumors, 20-25 histologically positive lymph nodes minutes. and 21 benign lymph nodes without cancer. Quantification with 5' Nuclease Probes (Secondary RNA Isolation and cDNA Synthesis. RNA was isolated Screen). Probe-based QPCR was performed as described pre using the RNeasy minikit (Qiagen, Valencia, Calif.) essen 25 viously (Godfrey et al., Clinical Cancer Res. 2001 Dec. tially as described by the manufacturer. The only modifica 7(12):4041-8). Briefly, reactions were performed with a tion was that we doubled the volume of lysis reagent and probe concentration of 200 nManda 60 second anneal/extend loaded the column in two steps. This was found to provide phase at 60°C., or 62°C., or 64°C. The sequences of primers better RNA yield and purity, probably as a result of diluting and probes (purchased from IDT, Coralville, Iowa) for genes out the OCT in the tissue sections. Reverse transcription was 30 evaluated in the secondary screen are listed in Table B, below. performed in 100-ul reaction volumes either with random Data Analysis. In the primary Screen, data from the melt hexamer priming or sequence-specific priming using a probe curve was analyzed using the ABI Prism 7700 Dissociation indicated in Table C and Superscript II (Invitrogen, Carlsbad, Curve Analysis 1.0 software (Applied Biosystems). The first Calif.) reverse transcriptase. For the primary screen, three derivative of the melting cure was used to determine the reverse transcription reactions were performed, each with 35 product T, as well as to establish the presence of the specific 500 ng of RNA. The cDNAs were combined and QPCR was product in each sample. In general, samples were analyzed in performed using the equivalent of 20 ng RNA per reaction. duplicate PCR reactions and the average C, value was used in For the secondary screen, the RNA input for primary tumors the expression analysis. However, in the secondary Screen and positive nodes was also 500 ng. For benign nodes how triplicate reactions were performed for each individual ever, the RNA input was 2000 ng resulting in the equivalent of 40 benign node and the lowest C, value was used in the calcula 80 ng RNA per QPCR reaction. tion of relative expression in order to obtain the highest value Quantitative PCR. All quantitative PCR was performed on of background expression for the sample. the ABI Prism 7700 Sequence Detection Instrument (Applied Cancer tissue-specific studies have been conducted, as Biosystems, Foster City, Calif.). Relative expression of the described in the Examples below, in which a variety of marker genes was calculated using the delta-CT methods 45 molecular markers were identified as correlating with patho previously described and with B-glucuronidase as the endog- logical states in cancers including esophageal cancer, colon enous control gene. All assays were designed for use with 5' cancer, head and neck cancer and in melanoma. Table A nuclease hybridization probes although the primary screen- identifies genes used in the following studies. Table B pro ing was performed using SYBR Green quantification in order vides PCR primer and TAOMAN probe sequences used in the to save cost. Assays were designed using the ABI Primer 50 quantitative PCR and RT-PCR amplifications described Express Version 2.0 software and where possible, amplicons herein. Table C provides RT primer sequences as used instead spanned exonjunctions in order to provide cDNA specificity. of random hexamer primers. All PCR and RT-PCR reactions All primer pairs were tested for amplification specificity were conducted using standard methods. For all figures, (generation of a single band on gels) at 60, 62 and 64° C. T-primary tumor; PN-tumor-positive lymph nodes (by his annealing temperature. In addition, PCR efficiency was esti- 55 tological screening, that is, by review of H&E stained tissue mated using SYBR green quantification prior to use in the and, when needed, by IHC, as described above); and primary screen. Further optimization and more precise esti- BN-benign lymph nodes (by histological screening)

TABLE A

Accession No. Official Gene Alternative Gene Marker OMIN No.* Symbol Official Gene Name Symbol Alias CDX1 NM 001804 CDX1 caudal type homeo box transcription NA NA 6OO746 factor 1 CEA NM 004363, CEACAMS carcinoembryonic antigen-related CEA, CD66e NA 114890 cell adhesion molecule 5 US 7,662,561 B2 19 20

TABLE A-continued

Accession No. Official Gene Alternative Gene Marker OMIN No.* Symbol Official Gene Name Symbol Alias CK19 NM OO2276. KRT19 keratin 19 K19, CK19, K1CS, cytokeratin 19; 14802O MGC15366 keratin, type I, 40-kd; keratin, type I cytoskeletal 19; 40-kDa keratin intermediate filament precursor gene NM O19010, KRT20 keratin 20 K2O, CK20, MGC35423 cytokeratin 20; 608218 keratin, type I: cytoskeletal 2O TACSTD1 NM 002354, TACSTD1 tumor-associated calcium signal EGP, KSA, M4S1, MK-1 antigen; 185535 transducer 1 MK-1, KS1/4, EGP40, antigen identified by MIC18, TROP1, Ep monoclonal antibody AUA1; CAM, CO17-1A, GA733 membrane component, 2 chromosome 4, Surface marker (35 kD glycoprotein) VIL1 NM 007127. VIL1 willin 1 VIL D2S1471 willin-1 193040 CK7 NM OO5556. KRT7 keratin 7 Sarcollectin; 148059 cytokeratin 7: type II mesothelial keratin K7; keratin, type II cytoskeletal 7; keratin, 55 K type II cytoskeletal; keratin, simple epithelial type I, K7 SCCA1 NM OO6919, SERPINB3 serine (or cysteine) proteinase SCC, T4-A, SCCA1, squamous cell carcinoma 600517 inhibitor, clade B (ovalbumin), SCCA-PD antigen 1 member 3 carcinoma antigen 1 & 2 SCCA2 NM OO2974, SERPINB4 serine (or cysteine) proteinase PI11, SCCA2, LEUPIN eupin: 600518 inhibitor, clade B (ovalbumin), squamous cell carcinoma member 4 antigen 2: protease inhibitor (leucine serpin) PTHrP NM 002820, PTHLH parathyroid hormone-like hormone PTHRP, PTHR, HHM, parathyroid hormone-related 168470 protein; pth-related protein; formerly humoral hypercalcemia of malignancy, included: PVA NM OO1944, DSG3 desmoglein 3 (pemphigus vulgaris PVA, CDHF6 pemphigus vulgaris antigen; 1696.15 antigen) 30-kD pemphigus vulgaris antigen MAGEA1 NM OO4988, MAGEA1 melanoma antigen, family A, 1 MAGE1, MGC9326 melanoma antigen MAGE-1; 3OOO16 (directs expression of antigen MZ2 melanoma-associated antigen E) melanoma-associated antigen MZ2-E MAGEA3 MAGEA3 melanoma antigen, family A, 3 HIP8, HYPD, MAGE3, antigen MZ2-D; MGC14613 MAGE-3 antigen; melanoma-associated antigen 3 MAGEA6 NM OO5363, MAGEA6 melanoma antigen, family A, 6 MAGE6, MAGE3B, MAGE-6 antigen; 3OO176 MAGE-3b, MGC52297 melanoma-associated antigen 6 MART1 NM OO5511. MLANA melan-A MART1, MART-1 melanoma antigen 605513 recognized by tcells 1 TYR NM OOO372, tyrosinase (oculocutaneous albinism OCA1A, OCAIA Tyrosinase 606933 IA)

*Online Mendelian Inheritance in Man.

TABLE B Sequence Listing Gene Oligonucleotide Sequence Reference CDX1 Forward primer CGGTGGCAGCGGTAAGAC SEO ID NO: 1 bases 516 to 533 Reverse primer GATTGTGATGTAACGGCTGTAATG SEO ID NO: 17 Probe ACCAAGGACAAGTACCGCGTGGTCTACA SEO ID NO: 1 bases 538 to 565 US 7,662,561 B2 21 22

TABLE B- continued Sequence Listing Gene Oligonucleotide Sequence (5'-->3') Reference

CEA Forward primer AGACAATCACAGTCTCTGCGGA SEO ID NO: 2, bases 1589 to 161O Rewerse primer ATCCTTGTCCTCCACGGGTT SEO ID NO: 18 Probe CAAGCCCTCCATCTCCAGCAACAACT SEO ID NO: 2, bases 1617 to 1642

CK19 Forward primer AGATCGACAACGCCCGT SEO ID NO: 19 Rewerse primer AGAGCCTGTTCCGTCTCAAA SEO ID NO: 2O Probe TGGCTGCAGATGACTTCCGAACCA SEO ID NO: 4, bases 614 to 637

Forward primer CACCTCCCAGAGCCTTGAGAT SEO ID NO: 5, bases 915 to 935 Rewerse primer GGGCCTTGGTCTCCTCTAGAG SEO ID NO: 21 Probe CCATCTCAGCATGAAAGAGTCTTTGGAGCA SEO ID NO: 5, bases 948 to 977

CK7 Forward primer CCCT CAATGAGACGGAGTTGA SEO ID NO: 3, bases 807 to 827 Rewerse primer CCAGGGAGCGACTGTTGTC SEO ID NO: 22 Probe AGCTGCAGTCCCAGATCTCCGACACATC SEO ID NO: 3, bases 831 to 858

MAGEA136 plex Forward primer GTGAGGAGGCAAGGTTYTSAG SEO ID NO: 23 Rewerse primer AGACCCACWGGCAGATCTTCTC SEO ID NO: 24 Probel AGGATTCCCTGGAGGCCACAGAGG SEO ID NO: 6, bases 80 to 103 Probe2 ACAGGCTGACCTGGAGGACCAGAGG SEO ID NO: 7 bases 9 O to 104

MART1 Forward primer GATGCTCACTTCATCTATGGTTACC SEO ID NO: 9 bases 66 to 9 O Rewerse primer ACTGTCAGGATGCCGATCC SEO ID NO: 25 Probe AGCGGCCTCTTCAGCGGTGGTGT SEO ID NO: 26

PTHrP Forward primer GCGGTGTTCCTGCTGAGCTA SEO ID NO: 1.O. bases 356 to 375 Rewerse primer TCATGGAGGAGCTGATGTTCAGA SEO ID NO: 27 Probe TCTCAGCCGCCGCCT CAAAAGA SEO ID NO: 1.O. bases 4 O9 to 43 O

PWA Forward primer AAAGAAACCCAATTGCCAAGATTAC SEO ID NO: 11, bases 28 O to 3 O4 Rewerse primer CAAAAGGCGGCTGATCGAT SEO ID NO: 28 Probe CCAAGCAACCCAGAAAATCACCTACCG SEO ID NO: 11, bases 314 to 340

SCCA1.27 Forward primer AAGCTGCAACATATCATGTTGATAGG SEO ID NO: 12, bases 267 to 292 Rewerse primer GGCGATCTTCAGCTCATATGC SEO ID NO: 29 Probe TGTTCATCACCAGTTTCAAAAGCTTCTGACT SEO ID NO: 12, bases 3 O1 to 331

TACSTD1 Forward primer TCATTTGCTCAAAGCTGGCTG SEO ID NO: 14, bases 348 to 368 Rewerse primer GGTTTTGCTCTTCTCCCAAGTTT SEO ID NO: 3 O Probe AAATGTTTGGTGATGAAGGCAGAAATGAATGG SEO ID NO: 14, bases 371 to 4 O2

TYR Forward primer ACTTACTCAGCCCAGCATCATTC SEO ID NO: 15 bases 1284 to 1306 Rewerse primer ACTGATGGCTGTTGTACTCCTCC SEO ID NO: 31 Probe TCTCCTCTTGGCAGATTGTCTGTAGCCGA SEO ID NO: 15 bases 13 O8 to 1336

Willin1 Forward primer TGGTTCCTGGCTTGGGATC SEO ID NO: 16, bases 2152 to 217O Rewerse primer TTGCCAGACTCCGCCTTC SEO ID NO: 32 Probe TCAAGTGGAGTAACACCAAATCCTATGAGGACC SEO ID NO: 16, bases 2174 to 22O6 A universal primer set designed to recognize transcripts of MAGEA1, MAGEA3 and MAGEA6. A universal primer set designed to recognize transcripts of both SCCA1 AND SCCA2. US 7,662,561 B2 23 24 Example 2 TABL E C Esophageal Cancer Gene RT Specific Sequence Listing Marker Primer (5'-->3') Reference Expression levels of CEA, CK7, CK19, CK20, TACSTD1 CEA GTGAAGGCCACAGCAT SEQ ID NO : 33 and VIL 1 were determined by the methods described in AACTGGCTGCTGTAACG SEQ ID NO: 34 Example 1. FIG. 17 is a scatter plot showing the expression levels of CEA, CK7, CK19, CK20, TACSTD1 and VIL1 in MART1 GCCGATGAGCAGTAAGACT SEO ID NO : 35 10 primary tumor, tumor-positive lymph nodes and benign PWA TGTCAACAACAAAGATTCCA SEQ ID NO: 36 lymph nodes. FIGS. 18A-O provide scatter plots illustrating the ability of two-marker systems to distinguish between SCCA12 TCTCCGAAGAGCTTGTTG SEO ID NO : 37 benign and malignant cells in a lymph node. Tables D and E TACSTD1 AGCCCATCATTGTTCTG SEQ ID NO: 38 provide the raw data from which the graphs of FIGS. 17 and 15 18A-O were generated. This data illustrates the strong corre TYR CGTTCCATTGCATAAAG SEQ ID NO: 40 lation of expression of CEA, CK7, CK19, CK20, TACSTD1 WIL1 GCTCCAGTCCCTAAGG SEQ ID NO: 41 and VIL1 markers, alone or in combination, in sentinellymph nodes with the presence of malignant cells arising from an esophageal cancer in the sentinel lymph nodes.

TABLED

Single Marker Prediction Characteristics for Esophageal Cancer

Observed Data Parametric Bootstrap Estimates*

Classification Classification Sensitivity Specificity AUC Accuracy Sensitivity Specificity Accuracy

CEA 95 95 95 .93 .93 .93 CK7 95 86 90 82 89 .85 CK19 1.O 1.O 1.O 1.O .99 .94 97 CK2O 1.O 95 .98 .98 92 95 TACSTD1 1.O 1.O 1.O 1.O .96 .99 .98 Willin1 95 95 95 92 .93 92

optimism =.02-.05 1000 parametric bootstrap samples of lymph node expression levels were generated and a new decision rule based on the most accurate cutoff was formulated each time (total of 1000 decision rules). The boot strap estimates are the average prediction properties from classifying the original 41 lymph nodes 1000 times.

TABLE E Two Marker Prediction Characteristics for Esophageal Cancer Observed Data Parametric Bootstrap Estimates Classification Classification Sensitivity Specificity Accuracy Sensitivity Specificity Accuracy CEA- CK7 95 O .98 .93 .99 .96 CEA- CK19 95 O .98 97 .99 .98 CEA- CK2O 95 O .98 97 .99 97 CEA- TACSTD1 O O 1.O .99 1.O .99 CEA+ Willin1 95 O .98 95 1.O .98 CK7 - CK19 O O 1.O .99 .99 .99 CK7 - CK2O 95 O .98 .93 .99 97 CK7 - TACSTD1 O O 1.O .99 1.0. .99 CK7+ Willin1 95 O .98 95 .99 .98 CK19 - CK2O 95 O .98 97 .99 .98 CK19 - TACSTD1 O O 1.O .99 1.O .99 CK19 + Willin1 O O 1.O .99 .99 .99 CK2O - TACSTD1 O O 1.O .99 1.O .99 CK2O+Willin1 95 O .98 .94 1.O 97 TACSTD1 + Willin1 O O 1.O .99 1.O .99 1000 parametric bootstrap samples of 41 lymph node marker pair expression levels were generated. For each new sample a new decision rule was devised to split the region into 2 Zones equal prediction probabil ity (see methods) (total of 1000 decision rules). The bootstrap estimates are the average prediction proper ties from classifying the original 41 lymph nodes 1000 times. US 7,662,561 B2 25 26 Example 3 ability of two-marker systems to distinguish between benign and malignant cells in a lymph node. Tables F and G provide Head and Neck Cancer the raw data from which the graphs of FIGS. 19 and 20A-F were generated. This data illustrates the strong correlation 5 between expression of CEA, CK19, PTHrP, PVA, SCCA1.2 FIG. 19 is a scatter plot showing the expression levels of and TACSTD1 markers, alone or in combination, in sentinel CEA, CK19, PTHrP, PVA, SCCA1.2 and TACSTD1 in pri lymph nodes and the presence of malignant cells arising from mary tumor, tumor-positive lymph nodes and benign lymph a squamous cell carcinoma of the head and neck in the sen nodes. FIGS. 20A-F provides scatter plots illustrating the tinel lymph nodes.

TABLE F

Single Marker Prediction Characteristics-Head and Neck Cancer Non Parametric Bootstrap Observed Data Estimates

Classification Classification Sensitivity Specificity AUC Accuracy Sensitivity Specificity Accuracy bias:*

CEA 1.O 90S 990 950 .974 88O 872 O78 CK19 .895 90S .917 900 867 88O 872 O28 EGFR .895 1.O 945 947 873 979 .925 O22 PTHrP 947 1.O 990 975 .938 .988 .963 O12 PVA 1.O 1.O 1.O 1.O 1.O 1.O 1.O OOO SCCA12 1.O 1.O 1.O 1.O .998 .98S 991 O09 TACSTD1 1.O 952 997 975 983 944 962 O13

*500 bootstrap samples of lymph node expression levels were generated and a new decision rule based on the most accurate cutoff was formulated each time (total of 500 decision rules). 500 bootstrap samples of lymph node expression levels were generated and a new decision rule based on the most accurate cutoff was formulated each time (total of 500 decision rules).The optimism in for each bootstrap sample is calculated as the difference between the classification statistic applied to the original data and applied to the bootstrap data. The average over all bootstrap samples is computed and reported as the bias in the values derived from the observed data (Efron's enhanced bootstrap prediction error estimate, see Efron and Tibshirani, An Introduction to the Bootstrap, Chapman and Hall/CRC Press Boca Raton, 1993). **bias = enhanced bootstrap estimate of optimism, or the amount that classification accuracy is overestimated when tested on the original data.

TABLE G

Two Marker Prediction Characteristics for Head & Neck Cancer Observed Data Non Parametric Bootstrap Estimates Classification Classification Sensitivity Specificity Accuracy Sensitivity Specificity Accuracy Bias:* PVA- 1.O 1.O 1.O 993 1.O 997 OO3 TACSTD1 PVA- 1.O 1.O 1.O 1.O 1.O 1.O OOO PTHrP PVA- 1.O 1.O 1.O 1.O 1.O 1.O OOO SCCA12 TACSTD1 - 947 1.O 975 .944 1.O .974 OO1 PTHrP TACSTD1 - 1.O 1.O 1.O 984 1.O 992 OO8 SCCA12 PTHrP- 1.O 1.O 1.O 1.O 1.O 1.O OOO SCCA12 *500 bootstrap samples of lymph node expression levels were generated and a new decision rule based on the most accurate cutoff was formulated each time (total of 500 decision rules). 500 bootstrap samples of lymph node expression levels were generated and a new decision rule based on the most accurate cutoff was formu lated each time (total of 500 decision rules). The optimism in for each bootstrap sample is calculated as the difference between the classification statistic applied to the original data and applied to the bootstrap data. The average over all bootstrap samples is computed and reported as the bias in the values derived from the observed data (Efron's enhanced bootstrap prediction error estimate, see Efron and Tibshirani, An Intro duction to the Bootstrap, Chapman and Hall/CRC Press Boca Raton, 1993). **bias = enhanced bootstrap estimate of optimism, or the amount that classification accuracy is overestimated when tested on the original data. US 7,662,561 B2 27 28 Example 4 Example 5

Melanoma

FIG. 21 is a scatter plot showing the expression levels of 5 Colon Cancer MART1, TYR and MAGEA136-plex in primary tumor, tumor-positive lymph nodes and benign lymph nodes. FIGS. FIG. 23 is a scatter plot showing the expression levels of 22A and 22B provide scatter plots illustrating the ability of CDX1, CEA, CK19, CK20, TACSTD1 and VIL1 in primary two-marker systems to distinguish between benign and 10 tumor, tumor-positive lymph nodes and benign lymph nodes. malignant cells in a lymph node. This data illustrates the This data illustrates the strong correlation between expres strong correlation between expression of MART1, TYR and sion of CDX1, CEA, CK19, CK20, TACSTD1 and VIL1 MAGEA136-plex markers, alone or in combination, in sen- markers, in sentinel lymph nodes and the presence of malig tinel lymph nodes and the presence of malignant cells arising nant cells arising from colon cancer in the sentinel lymph from melanoma in the sentinel lymph nodes. nodes.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 4 O

<21 Os SEQ ID NO 1 &211s LENGTH: 1699 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 1

aggtgagcgg ttgct C9tcg tcggggcggc C9gcagoggc ggct CC aggg CCC agcatgc 60

gcgggggacc cc.gcggccac catgitatgtg ggctatgtgc tiggacaagga titcgc.ccgtg 12O

taccc.cggcc cagoc aggcc agc.ca.gc.ctic ggcctgggcc cqgcaaact a cdgc.ccc.ccg 18O

gcc.ccgc.ccc. c9c.gc.cccc gcagtacccc gactitct coa gctact citca cqtggagc.cg 24 O

gcc.ccc.gc.gc ccc.cgacggc ctggggggcg ccct tcc ctg. c9cc caagga cactgggcc 3 OO

gcc.gc.ctacg gcc.cgggc.cc cqcggcc cct gcc.gc.ca.gcc cagctt.cgct ggcatt.cggg 360

cc.ccctic cag actittagc.cc ggtgc.cggcg cc cc ctgggc ccggc.ccggg cct cctggcg 42O

cagcc cct cq ggggc.ccggg cacaccgtcc togc.ccggag cqcagaggcc gacgcc ctac 48O

gagtggatgc gg.cgcagogt gcgg.ccgga gC9gcggtg gCag.cggtaa gacticggaCC 54 O

aagga caagt accgc.gtggit ct acaccgac caccaacgcc tdgagctgga galaggagttt 6 OO

Cattacagcc gttacat cac aatc.cggcgg aaat cagagc tiggctgccala totggggctic 660

actgaacggc aggtgaagat ctggttccala aaccggcggg caaaggagcg caaagtgaac 72O

aagaagaaac agcagcagca acagcc.ccca cagcc.gc.cga tiggcc.cacga catcacggcc 78O

accc.ca.gc.cg ggc.catc cct ggggggcctg tdtcc.ca.gca acaccago:ct Cotggccacc 84 O

to Ctctic caa ticctgtgaa agaggagttt Ctgc.cat agc cc catgcc.ca gcctgtgcgc 9 OO

cgggggacct giggacticgg gtgctgggag ttggctCct gtgggccCag gaggtotggit 96.O

cc.gagt citca gcc.ctgacct tctggga cat ggtggacagt caccitat coa cc ct citgcat 102O

cc ccttggcc cattgtgtgc agtaa.gc.ctg ttggataaag acct tccagc ticct gtgttc 108O

tagacct ctg ggggata agg gagtcCaggg togatgatct caat ct cocg tdggcatctg 114 O

aagc.cccaaa tigttggggg aggggcc tag acaaggctcc aggc.cccacc to ct cotc.ca 12 OO

US 7,662,561 B2 63 64

- Continued

SEQ ID NO 36 LENGTH: 2O TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 36 tgtcaacaac aaagatticca

SEO ID NO 37 LENGTH: 18 TYPE: DNA ORGANISM: Homo sapiens <4 OO > SEQUENCE: 37 tctic.cgaaga gcttgttg 18

SEQ ID NO 38 LENGTH: 17 TYPE: DNA ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 38 agcc catcat tdttctg 17

SEO ID NO 39 LENGTH: 17 TYPE: DNA ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 39 cgttccattg cataaag 17

SEQ ID NO 4 O LENGTH: 16 TYPE: DNA ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 4 O gctic cagt cc cta agg 16

45 We claim: pared to the level of pemphigus Vulgaris antigen mRNA in 1. A method of identifying expression of markers indica benign lymph nodes, wherein the overabundance of the pem tive of the presence of displaced cells of a squamous cell phigus Vulgaris antigen mRNA indicative of the presence of carcinoma of the head & neck in a lymph node of a human displaced cells of a squamous cell carcinoma of the head & patient Suspected of having a squamous cell carcinoma of the 50 neck is at least 100-fold as compared to a level of pemphigus head & neck, comprising detecting a quantity of pemphigus Vulgaris antigen mRNA in benign lymph nodes. Vulgaris antigen mRNA in an RNA sample prepared from the 3. The method of claim 1, further comprising determining lymph node of the patient and determining if pemphigus if tumor-associated calcium signal transducer 1 mRNA is Vulgaris antigen mRNA is overabundant in the RNA sample 55 overabundant in an RNA sample prepared from the lymph as compared to a level of pemphigus Vulgaris antigen mRNA node of the patient as compared to the level of tumor-associ in benign lymph nodes, wherein the overabundance pemphi gus Vulgaris antigen mRNA is statistically significant and ated calcium signal transducer mRNA in benign lymph indicates the presence of displaced cells of squamous cell nodes. carcinoma of the head & neck in the lymph node, and wherein 60 4. The method of claim 1, in which the level of pemphigus the overabundance of the pemphigus Vulgaris mRNA identi Vulgaris antigen mRNA in one or more benign lymph nodes is fies the expression of RNA indicative of the presence of determined by quantifying pemphigus Vulgaris antigen displaced cells of a squamous cell carcinoma of the head & mRNA levels in benign lymph nodes as determined by neck in the lymph node of the patient. pathology. 2. The method of claim 1, comprising determining if pem 65 5. The method of claim 1, wherein a nucleic acid amplifi phigus Vulgaris antigen mRNA is overabundant in an RNA cation assay is used to quantify levels of the pemphigus sample prepared from the lymph node of the patient as com Vulgaris antigen mRNA in the RNA sample. US 7,662,561 B2 65 66 6. The method of claim 5, wherein the nucleic acid ampli pemphigus Vulgaris antigen mRNA and the tumor-asso fication assay is one of a PCR assay and an isothermic ampli ciated calcium signal transducer 1 mRNA, found in fication assay. RNA samples prepared from benign lymph nodes, 7. The method of claim 6, wherein the nucleic acid ampli wherein the overabundance of the pemphigus Vulgaris anti fication assay is an assay selected from the group consisting gen mRNA, or the combination of the pemphigus Vul of RT-PCR, QRT-PCR, rolling circle amplification and garis antigen mRNA and the tumor-associated calcium nucleic acid sequenced-based amplification assays. signal transducer 1 mRNA, is statistically significant 8. The method of claim 7, wherein the assay is a rolling and indicates the presence of displaced cells of squa circle amplification assay in which a padlock primer is used. mous cell carcinoma of the head & neck in the lymph 9. The method of claim 5, wherein the assay is a multiplex 10 node of the patient. assay. 14. The method of claim 13, comprising quantifying a level 10. The method of claim 5, wherein the assay is an RT-PCR of the pemphigus Vulgaris antigen mRNA in an RNA sample assay. prepared from the lymph node of the human patient and 11. The method of claim 10, wherein the RT-PCR assay determining if the quantity of the pemphigus Vulgaris antigen uses one or more primer pairs for amplification of pemphigus 15 mRNA in the RNA sample is overabundant as compared to an Vulgaris antigen mRNA. amount of the pemphigus Vulgaris antigen mRNA in RNA 12. The method of claim 11, wherein the primer pairs samples prepared from benign lymph nodes, and wherein the consist essentially of at least ten contiguous nucleotides of overabundance of the pemphigus Vulgaris antigen mRNA one or both of SEQID NO: 28 and positions 208-304 of SEQ that is sufficiently large to identify the presence of displaced ID NO: 11. cells of squamous cell carcinoma of the head & neck in the 13. A method of identifying expression of markers indica lymph node is at least 100-fold higher than the amount of the tive of the presence of displaced cells of a squamous cell pemphigus Vulgaris antigen mRNA in RNA samples pre carcinoma of the head & neck in a lymph node of a human pared from benign lymph nodes. patient Suspected of having a squamous cell carcinoma of the 15. The method of claim 13, comprising quantifying the head & neck comprising: 25 combination of a pemphigus Vulgaris antigen mRNA and a a. detecting a quantity of pemphigus Vulgaris antigen tumor-associated calcium signal transducer 1 mRNA in an mRNA or the combination of a pemphigus Vulgaris anti RNA sample prepared from the lymph node of the human gen mRNA and a tumor-associated calcium signal trans patient and determining if the quantity of the combination of ducer 1 mRNA from alymph node of the human patient; the pemphigus Vulgaris antigen mRNA and the tumor-asso and 30 ciated calcium signal transducer 1 mRNA in the RNA sample b, determining if the quantity of the pemphigus Vulgaris is overabundantas compared to an amount of the combination antigen mRNA, or the combination of the pemphigus of the pemphigus vulgaris antigen mRNA and the tumor Vulgaris antigen mRNA and the tumor-associated cal associated calcium signal transducer 1 mRNA in RNA cium signal transducer 1 mRNA in the RNA sample is samples prepared from benign lymph nodes. overabundant as compared to an amount of the pemphi 35 guS Vulgaris antigen mRNA, or the combination of the k k k k k