DOCSLIB.ORG

US 2012/0093772 A1 Horsager Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
US 2012/0093772 A1 Horsager Et Al US 20120093772A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0093772 A1 Horsager et al. (43) Pub. Date: Apr. 19, 2012 (54) VECTORS FOR DELIVERY OF LIGHT Related U.S. Application Data SENSITIVE PROTEINS AND METHODS OF (60) Provisional application No. 61/054,571, filed on May USE 20, 2008, provisional application No. 61/199,241, filed on Nov. 14, 2008, provisional application No. (76) Inventors: Alan Horsager, Los Angeles, CA 61/200,430, filed on Nov. 26, 2008. (US); William Hauswirth, Publication Classification Gainesville, FL (US); Jianwen Liu, (51) Int. Cl. Gainesville, FL (US); Benjamin A6IR 48/00 (2006.01) Matteo, San Francisco, CA (US); CI2N 5/867 (2006.01) Edward S. Boyden, III, Chestnut A6M 37/00 (2006.01) Hill, MA (US) CI2N 5/86 (2006.01) A6IP27/02 (2006.01) CI2N 15/85 (2006.01) (21) Appl. No.: 12/993,092 CI2N 5/863 (2006.01) (52) U.S. Cl. ..................... 424/93.2:435/320.1; 435/455; (22) PCT Filed: May 20, 2009 435/456; 604/20 (57) ABSTRACT (86). PCT No.: PCT/US09/.44753 Provided herein are compositions and methods for gene and etiology-nonspecific and circuit-specific treatment of dis S371 (c)(1), eases, utilizing vectors for delivery of light-sensitive proteins (2), (4) Date: Jun. 10, 2011 to diseased and normal cells and tissues of interest. Patent Application Publication Apr. 19, 2012 Sheet 6 of 13 US 2012/0093772 A1 GRM6 5ATCTCCAGATGGCTAAACTTTTAAATCATGAATGAACGTAGATATTACCAAATTGCTTTTTCAGCATCCAT TTAGATAATCATGTTTTTTGCCTTTAATCTGTTAATGTAGTGAATTACAGAAATACATTTCCTAAATCATTA CATCCCCCAAATCGTTAATCTGCTAAAGTACATCTCTGGCTCAAACAAGACTGGTTG-3 Figure 6 Patent Application Publication Apr. 19, 2012 Sheet 8 of 13 US 2012/0093772 A1 Patent Application Publication Apr. 19, 2012 Sheet 9 of 13 US 2012/0093772 A1 AAF.-3A-FP APistain targe 3X aX Figure 9 Patent Application Publication Apr. 19, 2012 Sheet 10 of 13 US 2012/0093772 A1 rd (AAV5 wild type) rho -f- (AAV2 ta44 mutant) rti 6 (AAV8 t?33 mutat Figure 10 Patent Application Publication Apr. 19, 2012 Sheet 11 of 13 US 2012/0093772 A1 Figure 11 Patent Application Publication Apr. 19, 2012 Sheet 12 of 13 US 2012/0093772 A1 3. Feate as Esty's atti as a sixty & es. & 8, 8 ' ' ' ' , , , , S. '-- s * - as 3) axxx xxx xxxs xxx xxxx xxxxlastasyassass colorkarass 2 4 s 8 E. A. 34 R 1. 13 R raining sessio Fist's try x 3.33 Figure 12 Patent Application Publication Apr. 19, 2012 Sheet 13 of 13 US 2012/0093772 A1 CSS3 in&ge processing trit N / lmage s Š fŠ Retina expressing light sensitive element LEED array laser system Figure 13 US 2012/0093.772 A1 Apr. 19, 2012 VECTORS FOR DELIVERY OF LIGHT embodiments, the recombinant adeno-associated virus is of a SENSTIVE PROTEINS AND METHODS OF serotype selected from the group consisting of AAV1, AAV2. USE AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof. In a related embodi CROSS-REFERENCE ment, the nucleic acid is encapsidated within a recombinant 0001. This application claims the benefit of U.S. Provi virus selected from the group consisting of recombinant sional Application Nos. 61/054,571 filed May 20, 2008, adeno-associated virus (AAV), recombinant retrovirus, 61/199,241 filed Nov. 14, 2008, and 61/200,430 filed Nov. 26, recombinant lentivirus, and recombinant poxvirus. 2008, which applications are incorporated herein by refer 0004. In another aspect the invention provides a vector ence in their entirety. comprising a nucleic acid encoding a light-sensitive protein, said nucleic acid operatively linked to a metabotropic BACKGROUND OF THE INVENTION glutamate receptor 6 (mGluR6) regulatory sequence or frag ment thereof. In one embodiment the light-sensitive protein is 0002. A gene-delivery therapy to treat a disease or disor selected from the group consisting of ChR1, ChR2. VChR1, der independent of treating an underlying mutation could ChR2 C128A, ChR2 C128S, ChR2 C128T, ChR1-ChR2 have potential value. Methods capable of controlling, regu hybrids/chimeras, ChD, ChEF, ChF ChIEF, NpHR, eNpHR, lating, and/or driving specific neural circuits so as to mediate melanopsin, and variants thereof. In a relate embodiment the naturalistic neural responses and high resolution perception light-sensitive protein is ChR2 or a light-sensitive protein that and control could also be of enormous potential therapeutic is at least about 70%, at least about 80%, at least about 90% or value. Neurons are an example of a type of cell that uses the at least about 95% identical to ChR2. In another embodiment electrical currents created by depolarization to generate com the mGluR6 regulatory sequence fragment is less than about munication signals (e.g., nerve impulses). Other electrically 1000, less than about 750, less than about 500, less than about excitable cells include skeletal muscle, cardiac muscle, and 250, or less than about 100 base pairs. In a related embodi endocrine cells. Neurons use rapid depolarization to transmit ment the mGluR6 regulatory sequence fragment is repre signals throughout the body and for various purposes, such as sented by the sequence in FIG. 6. In another embodiment the motor control (e.g., muscle contractions), sensory responses vector comprises a recombinant adeno-associated virus (e.g., touch, hearing, and other senses) and computational (AAV). In a related embodiment the vector comprises a functions (e.g., brain functions). By facilitating or inhibiting recombinant virus selected from the group consisting of the flow of positive or negative ions through cell membranes, recombinant adeno-associated virus (AAV), recombinant ret the cell can be briefly depolarized, depolarized and main rovirus, recombinant lentivirus, and recombinant poxvirus. In tained in that state, or hyperpolarized. Thus, the control of the a specific embodiment the AAV is of a serotype selected from depolarization of cells can be beneficial for a number of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, different purposes, including visual, muscular and sensory AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and control. Light-sensitive protein channels, pumps, and recep hybrids thereof. In other specific embodiments, the recombi tors can permit millisecond-precision optical control of cells. nant AAV is of a combinatorial hybrid of 2, 3, 4, 5, 6, 7, 8, 9. Although light-sensitive proteins in combination with light 10, 11, 12, 13, 14, 15 or more serotypes or mutants thereof. In can be used to control the flow of ions through cell mem a related embodiment the AAV comprises mutated capsid branes, targeting and delivery remain to be addressed for protein. In one specific embodiment the capsid protein com specific diseases, disorders, and circuits. prises a mutated tyrosine residue. The mutated tyrosine resi due can be selected from the group consisting of Y252F, SUMMARY OF THE INVENTION Y272F, Y444F, Y500F, Y700F, Y704F, Y730F, Y275F, 0003. In one aspect, the invention provides a recombinant Y281F, Y508F, Y576F,Y612G, Y673F and Y720F. In a spe nucleic acid comprising a nucleic acid encoding a light-sen cific embodiment the mutated capsid protein comprises a sitive protein operatively linked to a metabotropic glutamate tyrosine residue mutated to a phenylalanine. receptor 6 (mGluR6) regulatory sequence or fragment 0005. In another aspect the present invention provides a thereof. In one embodiment the light-sensitive protein can be method of treating a Subject Suffering from a disease or dis selected from the group consisting of ChR1, ChR2. VChR1, order of the eye comprising introducing into an affected eye a ChR2 C128A, ChR2 C128S, ChR2 C128T, ChR1-ChR2 recombinant adeno-associated virus (AAV) comprising a hybrids/chimeras, ChD, ChEF, ChF ChIEF, NpHR, eNpHR, light-sensitive protein operatively linked to a metabotropic melanopsin, and variants thereof. In another embodiment the glutamate receptor 6 regulatory sequence (mGluR6) or frag light-sensitive protein is ChR2 or a light-sensitive protein that ment thereof. In one embodiment the disease or disorder of is at least about 70%, at least about 80%, at least about 90% or the eye is caused by photoreceptor cell degeneration. In at least about 95% identical to ChR2. In another embodiment another embodiment the light-sensitive protein is selected the mGluR6 regulatory sequence fragment comprises less from the group consisting of ChR1, ChR2. VChR1, ChR2 than about 1000, less than about 750, less than about 500, less C128A, ChR2 C128S, ChR2 C128T, ChR1-ChR2 hybrids/ than about 250, or less than about 100 base pairs. In a related chimeras, ChD, ChEF, ChF, ChIEF, NpHR, eNpHR, melan embodiment the mGluR6 regulatory sequence or fragment opsin, and variants thereof. In a related embodiment the light thereof is a mGluR6 promoter or enhancer. In a specific sensitive protein is ChR2 or a light-sensitive protein that is at related embodiment the nucleic acid further comprises a least about 70%, at least about 80%, at least about 90% or at green fluorescent protein. In another embodiment the nucleic least about 95% identical to ChR2. In another embodiment acid is encapsidated within a recombinant adeno-associated the mGluR6 promoter fragment is less than about 1000, less virus (AAV). In certain embodiments, the recombinant AAV than about 750, less than about 500, less than about 250, or is of a combinatorial hybrid of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, less than about 100 base pairs. In a related embodiment the 13, 14, 15 or more serotypes or mutants thereof. In certain mGluR6 promoter fragment is represented by the sequence in US 2012/0093.772 A1 Apr. 19, 2012 FIG. 6. In another embodiment the AAV is of a serotype intravitreal injection, subretinal injection, and/or ILM peel. In selected from the group consisting of AAV1, AAV2, AAV3, another embodiment the AAV is of a serotype is selected from AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV12, and hybrids thereof.
Load more

Recommended publications
  • Diversification and Spectral Tuning in Marine Proteorhodopsins
    The EMBO Journal Vol. 22 No. 8 pp. 1725±1731, 2003 Diversi®cation and spectral tuning in marine proteorhodopsins Dikla Man, Weiwu Wang1, Gazalah Sabehi, similarities in their sequence and possibly have a different L.Aravind2, Anton F.Post3, evolutionary origin (Spudich et al., 2000). Ramon Massana4, Elena N.Spudich1, One of the most notable distinguishing properties of John L.Spudich1,5 and Oded Be jaÁ 5 retinal among the various chromophores used in photo- sensory receptors is the large variation in its absorption Department of Biology, Technion-Israel Institute of Technology, Haifa 3 spectrum depending on interaction with the apoprotein 32000, H.Steinitz Marine Biology Laboratory, Interuniversity Institute (`spectral tuning'; Ottolenghi and Sheves, 1989; Birge, for Marine Sciences, Eilat 88103, Department of Microbial and Molecular Ecology, Hebrew University of Jerusalem, Jerusalem, Israel, 1990). In rhodopsins, retinal is covalently attached to the 1Center for Membrane Biology and Department of Biochemistry and e-amino group of a lysine residue, forming a protonated Molecular Biology, The University of Texas Medical School, Houston, retinylidene Schiff base. In methanol, a protonated 2 TX 77030, National Center for Biotechnology Information, National retinylidene Schiff base exhibits a l of 440 nm. The Library of Medicine, National Institutes of Health, Bethesda, MD max 20894, USA and 4Departament de Biologia Marina i Oceanogra®a, protein microenvironment shifts lmax (the `opsin shift'; Institut de CieÁncies del Mar, CSIC, E-08003 Barcelona, Spain Yan et al., 1995) to longer wavelengths, e.g. to 487 nm in sensory rhodopsin II and to 568 nm in bacteriorhodopsin 5Corresponding authors e-mail: [email protected] or [email protected] from Halobacterium salinarum.
    [Show full text]
  • And Functions from Archaea to Humans
    P1: FUI September 12, 2000 16:8 Annual Reviews AR112-14 Annu. Rev. Cell Dev. Biol. 2000. 16:365–92 Copyright c 2000 by Annual Reviews. All rights reserved RETINYLIDENE PROTEINS: Structures and Functions from Archaea to Humans John L. Spudich, Chii-Shen Yang, Kwang-Hwan Jung, and Elena N. Spudich Department of Microbiology and Molecular Genetics, University of Texas Medical School, Houston, Texas 77030; e-mail: [email protected] Key Words rhodopsin, retinal, vision, photosensory reception, ion transport ■ Abstract Retinylidene proteins, containing seven membrane-embedded α-helices that form an internal pocket in which the chromophore retinal is bound, are ubiquitous in photoreceptor cells in eyes throughout the animal kingdom. They are also present in a diverse range of other organisms and locations, such as archaeal prokaryotes, uni- cellular eukaryotic microbes, the dermal tissue of frogs, the pineal glands of lizards and birds, the hypothalamus of toads, and the human brain. Their functions include light-driven ion transport and phototaxis signaling in microorganisms, and retinal iso- merization and various types of photosignal transduction in higher animals. The aims of this review are to examine this group of photoactive proteins as a whole, to summa- rize our current understanding of structure/function relationships in the best-studied examples, and to report recent new developments. CONTENTS INTRODUCTION AND OVERVIEW .................................. 366 STRUCTURES OF RETINYLIDENE PROTEINS .........................367
    [Show full text]
  • Tuning the Electronic Absorption of Protein-Embedded All-Trans-Retinal
    REPORTS are consistent with Wnt inhibiting b-catenin degra- tiple ligands, receptors, extracellular modulators, 5. M. van Noort, J. Meeldijk, R. van der Zee, O. Destree, dation at, or upstream, of phosphorylation (Fig. 2B, and downstream targets. Despite this complexity, H. Clevers, J. Biol. Chem. 277,17901(2002). 6. V. F. Taelman et al., Cell 143,1136(2010). red curve). We can exclude all other points of in- the core behavior of pathways could be relatively 7. L. Li et al., EMBO J. 18,4233(1999). hibition. This mode of inhibition predicts that every simple. Kinetic analysis of systems, particularly 8. N. S. Tolwinski et al., Dev. Cell 4,407(2003). intermediate downstream of phosphorylation shows at steady state, provides a powerful strategy to 9. E. Lee, A. Salic, R. Krüger, R. Heinrich, M. W. Kirschner, PLoS Biol. 1,e10(2003). the same dip and full recovery. We confirmed this interrogate complex mechanisms; it can provide 10. V. S. Li et al., Cell 149,1245(2012). prediction for ubiquitylated b-catenin in cells stim- strong predictions while being insensitive to mech- 11. B. Riggleman, P. Schedl, E. Wieschaus, Cell 63,549 ulated with Wnt (Fig. 2, D and E). Thus, partial anistic details. In Wnt signaling, b-catenin is sub- (1990). inhibition of phosphorylation entirely explains the ject to a conservation law on the protein flux that 12. F. M. Boisvert et al., Mol. Cell. Proteomics 11, M111.011429 (2012). observed dynamics. Full recovery can occur through permits a few kinetic analyses to resolve long- 13. A. R. Peacocke, J.
    [Show full text]
  • Physiological Effects of Heterologous Expression of Proteorhodopsin Photosystems
    Physiological Effects of Heterologous Expression of Proteorhodopsin Photosystems by MASSACHUSETTS NSTITUTE Justin David Buck Bachelor of Science, Chemical Engineering Colorado School of Mines, 2004 Submitted to the Department of Biological Engineering ARCHIVES in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Engineering at the Massachusetts Institute of Technology February, 2012 0 2012 Massachusetts Institute of Technology. All Rights Reserved. S i g n a tu r e o f A u th o r : J u st inD ._Bu ck Justin D. Buck Department of Biological Engineering January 6, 2012 Certified by: -j / Edward F. Delong Professor of Civil and Environmen ngi ering, and Biological Engineering Thesis Advisor z/ 7 0 Accepted by: Forest White Associate Professor of Biological Engineering Course 20 Graduate Program Committee Chairperson This doctoral thesis has been examined by a committee of the Biological Engineering Department as follows: Chairperson, Graduate Thesis Committee: John M. Essigmann Professor of Chemistry, Toxicology and Biological Engineering Thesis Advisor, Committee Member: ard F. DeL ng Department of Civil and Environmental, and B' logical Engine ing Thesis Committee Member: Y/ Kristala Jones Prather Associate Professor of Chemical Engineering Thesis Committee Member: Michael Laub Associate Professor of Biology Physiological Effects of Heterologous Expression of Proteorhodopsin Photosystems by Justin David Buck Submitted to the Department of Biological Engineering in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Engineering Abstract Proteorhodopsin (PR) phototrophy plays an important role in the marine ecosystem, harvesting energy from sunlight for a diverse community of hetertrophic organisms. The simple proteorhodopsin photosystem (PRPS) composed of six to seven genes is sufficient for producing a functional light-driven proton pump, capable of powering cellular processes.
    [Show full text]
  • Doctor of Philosophy, Phd Nicola Meola Functional Characterization of Non-Coding Rnas in the Mammalian Retina O] F
    Open Research Online The Open University’s repository of research publications and other research outputs Functional Characterization of Non-Coding RNAs in the Mammalian Retina Thesis How to cite: Meola, Nicola (2011). Functional Characterization of Non-Coding RNAs in the Mammalian Retina. PhD thesis The Open University. For guidance on citations see FAQs. c 2011 The Author https://creativecommons.org/licenses/by-nc-nd/4.0/ Version: Version of Record Link(s) to article on publisher’s website: http://dx.doi.org/doi:10.21954/ou.ro.0000f18b Copyright and Moral Rights for the articles on this site are retained by the individual authors and/or other copyright owners. For more information on Open Research Online’s data policy on reuse of materials please consult the policies page. oro.open.ac.uk UNRGSTRi CT6D Doctor of Philosophy, PhD Nicola Meola Functional Characterization of Non-Coding RNAs in The Mammalian Retina o] f i c (U Q. O 0) .c cavsAntiA mrmnt vusccxAtte J- ( l£ A l T M M U i m CCNlTtCHl Discipline: Life and Biomolecular Sciences Affiliated Research Center: Telethon Institute of Genetics and Medicine Thesis submitted in accordance with the requirements of the Open University for the degree of “Doctor of Philosophy” August 2011 Date oj S\^bmx66wv; |G 1 2_oM Date oJ M\rardL- 15 D %oi\ ProQuest Number: 13837557 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted.
    [Show full text]
  • Focusing on Vascular Tone and Breathing Regulations
    Georgia State University ScholarWorks @ Georgia State University Biology Dissertations Department of Biology 5-9-2016 Insight Into Autonomic Dysfunctions With Novel Interventions: Focusing On Vascular Tone And Breathing Regulations Shuang Zhang Follow this and additional works at: https://scholarworks.gsu.edu/biology_diss Recommended Citation Zhang, Shuang, "Insight Into Autonomic Dysfunctions With Novel Interventions: Focusing On Vascular Tone And Breathing Regulations." Dissertation, Georgia State University, 2016. https://scholarworks.gsu.edu/biology_diss/164 This Dissertation is brought to you for free and open access by the Department of Biology at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Biology Dissertations by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. INSIGHT INTO AUTONOMIC DYSFUNCTIONS WITH NOVEL INTERVENTIONS: FOCUSING ON VASCULAR TONE AND BREATHING REGULATIONS by SHUANG ZHANG Under the Direction of Chun Jiang, PhD ABSTRACT The autonomic nervous system (ANS) controls most involuntary functions of the body. Dysfunctions of the ANS can be life-threatening. However, several critical questions related to cardiovascular and breathing regulations remain unclear. One of the open questions is how the system lose control of the vascular tones under certain circumstances. Using the septic shock model induced by lipopolysaccharide (LPS) in isolated and perfused mesenteric arterial rings, we found the vascular hyporeactivity is attributed to the decreased vasoconstriction to α-adrenoceptor agonists. The endotoxin-induced vasodilation can be intervened with endothelin-1 (ET-1), serotonin (5-HT) or vasopressin, which have never been used in clinical treatment. It is unclear how the excitability of endothelium affects vascular tones.
    [Show full text]
  • Light-Stimulated Growth of Proteorhodopsin-Bearing Sea-Ice Psychrophile Psychroflexus Torquis Is Salinity Dependent
    The ISME Journal (2013) 7, 2206–2213 & 2013 International Society for Microbial Ecology All rights reserved 1751-7362/13 OPEN www.nature.com/ismej ORIGINAL ARTICLE Light-stimulated growth of proteorhodopsin-bearing sea-ice psychrophile Psychroflexus torquis is salinity dependent Shi Feng1, Shane M Powell1, Richard Wilson2 and John P Bowman1 1Food Safety Centre, School of Agriculture Science, Tasmanian Institute of Agriculture, University of Tasmania, Hobart, Tasmania, Australia and 2Central Science Laboratory, University of Tasmania, Hobart, Tasmania, Australia Proteorhodopsins (PRs) are commonly found in marine prokaryotes and allow microbes to use light as an energy source. In recent studies, it was reported that PR stimulates growth and survival under nutrient-limited conditions. In this study, we tested the effect of nutrient and salinity stress on the extremely psychrophilic sea-ice bacterial species Psychroflexus torquis, which possesses PR. We demonstrated for the first time that light-stimulated growth occurs under conditions of salinity stress rather than nutrient limitation and that elevated salinity is related to increased growth yields, PR levels and associated proton-pumping activity. PR abundance in P. torquis also is post- transcriptionally regulated by both light and salinity and thus could represent an adaptation to its sea-ice habitat. Our findings extend the existing paradigm that light provides an energy source for marine prokaryotes under stress conditions other than nutrient limitation. The ISME Journal (2013) 7, 2206–2213; doi:10.1038/ismej.2013.97; published online 20 June 2013 Subject Category: Microbial ecology and functional diversity of natural habitats Keywords: post-transcriptional regulation; proteomics; proteorhodopsin; salinity stress; sea-ice Introduction then exhibited increased proton pumping (Be´ja` et al., 2000).
    [Show full text]
  • Aci Actinobacteria Assemble a Functional Actinorhodopsin With
    bioRxiv preprint doi: https://doi.org/10.1101/367102; this version posted July 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 acI Actinobacteria Assemble a Functional Actinorhodopsin with 2 Natively-synthesized Retinal 3 4 Running Title: (54 characters and spaces) Actinorhodopsin and Carotenoid Synthesis in acI 5 6 Jeffrey R. Dwulit-Smitha,b, Joshua J. Hamiltona, David M. Stevensona, Shaomei Hea,c, Ben O. 7 Oysermand, Francisco Moya-Floresd, Daniel Amador-Nogueza, Katherine D. McMahona,d, Katrina T. 8 Foresta,b# 9 10 aDepartment of Bacteriology; bProgram in Biophysics; cDepartment of Geoscience, and dDepartment of Civil 11 and Environmental Engineering, University of Wisconsin-Madison, Madison, WI, USA. 12 # Address correspondence to Katrina T. Forest, 1550 Linden Drive, Madison, WI 53706, tel. 608 265-3566, 13 email [email protected]. 14 15 KEYWORDS 16 Freshwater, photoheterotrophy, opsin, rhodopsin, xanthorhodopsin, proton pump, carotenoid, blh 17 bioRxiv preprint doi: https://doi.org/10.1101/367102; this version posted July 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dwulit-Smith et al. Actinorhodopsin and Carotenoid Synthesis in acI 18 ABSTRACT 19 Freshwater lakes harbor complex microbial communities, but these ecosystems are often dominated by acI 20 Actinobacteria from three clades (acI-A, acI-B, acI-C).
    [Show full text]
  • Study of Photo Reaction at Atomic Resolution in a Rhodopsin Mimic and Studies of Domain Swapping in Ilbp Family Members
    STUDY OF PHOTO REACTION AT ATOMIC RESOLUTION IN A RHODOPSIN MIMIC AND STUDIES OF DOMAIN SWAPPING IN ILBP FAMILY MEMBERS By Nona Ehyaei A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of Chemistry - Doctor of Philosophy 2020 ABSTRACT STUDY OF PHOTO REACTION AT ATOMIC RESOLUTION IN A RHODOPSIN MIMIC AND STUDIES OF DOMAIN SWAPPING IN ILBP FAMILY MEMBERS By Nona Ehyaei Signal transduction usually involves the binding of signaling molecules, ligands to the receptors. Herein, we will explore signal transduction in vision, a family of GPCR, and, more specifically, its rhodopsin subfamily, which plays a crucial role in color vision and sensing. There have been many mutagenesis studies done using Raman spectroscopy, crystallography, and NMR to understand the mechanism of the wavelength regulation and the photoisomerization of rhodopsin proteins. Moreover, recent studies have successfully indicated the intermediates of rhodopsin's photocycle, using time-resolved experiments, femtosecond x-ray laser (x-ray free-electron laser, XFEL), and cryokinetic data. All of these studies demonstrate the different important biophysical characteristics of rhodopsin systems; however, they have some limitations. Rhodopsins are membrane proteins, and their expression, purification, mutagenesis, and crystallization are very challenging. Also, these proteins evolve a lot during evolution. As a result of environmental changes and developments during evolution, many amino acid residues in rhodopsins become conserved residues; therefore, it is hard to illustrate every single residue's effect on wavelength tuning through mutagenesis studies. Therefore, we use Cellular Retinoic Acid Binding Protein II (CRABPII) and Cellular Retinol Binding Protein II (CRBPII) as mimics to study rhodopsin systems.
    [Show full text]
  • Summary of the Lecture "'Senses"'
    Summary of the lecture "‘Senses"’ by Susanne Duncker Contents 1 Senses I - primary sensory cells (Knipper)4 1.1 Smell..................................4 1.1.1 Summary............................7 2 Senses II - Secondary sensory cells (Knipper)9 2.1 Taste...................................9 2.1.1 Salty...............................9 2.1.2 Sour............................... 11 2.1.3 Sweet.............................. 12 2.1.4 Bitter.............................. 13 2.1.5 Umami............................. 13 2.1.6 Signal transduction....................... 14 2.2 Summary................................ 14 3 BK and its physiologic relevance in the cardiovascular system - an inno- vative target for drug design? (Sausbier) 16 3.1 The meaning of BK for vasoconstriction................ 16 4 The vestibular system (Engel) 19 4.1 Structure of the vestibular system................... 19 5 Senses III - Coding of sensory information (Knipper) 25 5.1 Afferent and efferent nerves...................... 25 5.2 The coding of sound frequency.................... 25 5.3 The coding of loudness......................... 27 6 Mast cell activation and anaphylaxis is blunted in mice with targeted de- letion of the SK4 channel (Ruth) 29 6.1 What is a SK4 channel?........................ 29 6.2 Mast cells and their role in allergic disorders............. 30 6.3 The SK4 knockout mouse....................... 31 7 Senses IV - Vision (Knipper) 32 7.1 Accommodation and its disorders................... 32 7.2 The structure of the retina....................... 34 7.3 Photoreceptors and how they work.................. 35 7.4 Colour vision disorders......................... 36 7.5 Retinal circuitry............................. 36 2 8 Forensic genetics (Blin) 40 8.1 A little history of forensics....................... 40 8.2 Identification of individuals...................... 40 8.2.1 Technical limitations...................... 41 8.2.2 Wrongful diagnosis......................
    [Show full text]
  • Steric Trigger (Phototansdoucton/Halobacterium Halobium/L Ng State/Bacteriorhodopuln/Retinal Alos) BING YAN*Tt, Koji Nakanishit, and JOHN L
    Proc. Natd. Acad. Sci. USA Vol. 88, pp. 9412-9416, November 1991 Biophysics Mechanism of activation of sensory rhodopsin I: Evidence for a steric trigger (phototansdoucton/Halobacterium halobium/l ng state/bacteriorhodopuln/retinal alos) BING YAN*tt, Koji NAKANISHIt, AND JOHN L. SPUDICH*f§ *Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, NY 10461; and tDepartment of Chemistry, Columbia University, New York, NY 10027 Communicated by W. Stoeckenius, July 17, 1991 ABSTRACT Sensory rhodopsin I (SR-I) and bacteri- cycle as long as the chromophore is in the active all-trans orhodopsin (BR) from Halobacterium halobium show broad configuration. structural and spectroscopic similarities and yet perform dis- Another retinylidene protein in H. halobium is sensory tinct functions: photosensory reception and proton pumping, rhodopsin I (SR-I; M, 25,000, see ref. 11), a phototaxis respectively. Probing the photoactive sites ofSR-I and BR with receptor with absorption properties similar to BR (12). The 24 retinal analogs reveals differences in the protein environ- close absorption maxima of SR-I and BR result in cell ments near the retinal 13-methyl group and near the J-ionone accumulation in the optimal spectral region for efficient use ring. 13-cis-Retinal does not form a retinylidene pigment with of solar energy. The retinal-binding pockets of BR and SR-I the SR-I apoprotein, although this isomer binds to the BR are closely similar in their electrostatic and hydrophobic apoprotein even more rapidly than all-tans-retinal, the func- interactions with the chromophore, as shown by spectro- tional isomer ofboth pigments.
    [Show full text]
  • Macular Pigment and Its Contribution to Visual Performance in the Older Human Eye
    Macular pigment and its contribution to visual performance in the older human eye A thesis submitted to the University of Manchester for the degree of a Doctor of Philosophy in the Faculty of Life Sciences 2014 Laura Patryas Optometry Contents 1 Introduction 19 1.1 Impact of ageing on the anatomy and physiology of the visual system . 20 1.1.1 The pupil . 22 1.1.2 The crystalline lens . 23 1.1.3 The retina . 24 1.1.4 Rods and cones . 26 1.1.5 Retinal pigment epithelium . 28 1.1.6 The interphotoreceptor matrix . 29 1.1.7 Bruch’s membrane . 30 1.1.8 Choriocapillaris and choroid . 30 1.2 Psychophysical function in ageing . 31 1.2.1 Spatial vision . 31 1.2.1.1 Visual acuity . 31 1.2.1.2 Contrast sensitivity . 32 1.2.2 Temporal vision . 33 1.2.3 Visual adaptation . 33 1.2.3.1 Dark adaptation . 33 1.2.3.2 Glare recovery . 36 1.3 Environmental factors in ageing . 37 1.3.1 Smoking . 38 1.3.2 Alcohol . 39 1.3.3 Radiation exposure . 39 1.3.4 Physical activity . 41 1.4 Ageing and age-related macular degeneration . 41 2 The macular pigment 43 2.1 Bio- and stereochemistry of macular pigment . 43 2.2 Location of macular pigment . 44 2 2.3 The function of macular pigment . 46 2.3.1 The potential role of macular pigment in normal healthy eyes . 49 2.4 Characteristics of macular pigment . 50 2.4.1 Composition . 50 2.4.2 Distribution .
    [Show full text]