US 20120093772A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0093772 A1 Horsager et al. (43) Pub. Date: Apr. 19, 2012 (54) VECTORS FOR DELIVERY OF LIGHT Related U.S. Application Data SENSITIVE PROTEINS AND METHODS OF (60) Provisional application No. 61/054,571, filed on May USE 20, 2008, provisional application No. 61/199,241, filed on Nov. 14, 2008, provisional application No. (76) Inventors: Alan Horsager, Los Angeles, CA 61/200,430, filed on Nov. 26, 2008. (US); William Hauswirth, Publication Classification Gainesville, FL (US); Jianwen Liu, (51) Int. Cl. Gainesville, FL (US); Benjamin A6IR 48/00 (2006.01) Matteo, San Francisco, CA (US); CI2N 5/867 (2006.01) Edward S. Boyden, III, Chestnut A6M 37/00 (2006.01) Hill, MA (US) CI2N 5/86 (2006.01) A6IP27/02 (2006.01) CI2N 15/85 (2006.01) (21) Appl. No.: 12/993,092 CI2N 5/863 (2006.01) (52) U.S. Cl. ..................... 424/93.2:435/320.1; 435/455; (22) PCT Filed: May 20, 2009 435/456; 604/20 (57) ABSTRACT (86). PCT No.: PCT/US09/.44753 Provided herein are compositions and methods for gene and etiology-nonspecific and circuit-specific treatment of dis S371 (c)(1), eases, utilizing vectors for delivery of light-sensitive proteins (2), (4) Date: Jun. 10, 2011 to diseased and normal cells and tissues of interest. Patent Application Publication Apr. 19, 2012 Sheet 6 of 13 US 2012/0093772 A1 GRM6 5ATCTCCAGATGGCTAAACTTTTAAATCATGAATGAACGTAGATATTACCAAATTGCTTTTTCAGCATCCAT TTAGATAATCATGTTTTTTGCCTTTAATCTGTTAATGTAGTGAATTACAGAAATACATTTCCTAAATCATTA CATCCCCCAAATCGTTAATCTGCTAAAGTACATCTCTGGCTCAAACAAGACTGGTTG-3 Figure 6 Patent Application Publication Apr. 19, 2012 Sheet 8 of 13 US 2012/0093772 A1 Patent Application Publication Apr. 19, 2012 Sheet 9 of 13 US 2012/0093772 A1 AAF.-3A-FP APistain targe 3X aX Figure 9 Patent Application Publication Apr. 19, 2012 Sheet 10 of 13 US 2012/0093772 A1 rd (AAV5 wild type) rho -f- (AAV2 ta44 mutant) rti 6 (AAV8 t?33 mutat Figure 10 Patent Application Publication Apr. 19, 2012 Sheet 11 of 13 US 2012/0093772 A1 Figure 11 Patent Application Publication Apr. 19, 2012 Sheet 12 of 13 US 2012/0093772 A1 3. Feate as Esty's atti as a sixty & es. & 8, 8 ' ' ' ' , , , , S. '-- s * - as 3) axxx xxx xxxs xxx xxxx xxxxlastasyassass colorkarass 2 4 s 8 E. A. 34 R 1. 13 R raining sessio Fist's try x 3.33 Figure 12 Patent Application Publication Apr. 19, 2012 Sheet 13 of 13 US 2012/0093772 A1 CSS3 in&ge processing trit N / lmage s Š fŠ Retina expressing light sensitive element LEED array laser system Figure 13 US 2012/0093.772 A1 Apr. 19, 2012 VECTORS FOR DELIVERY OF LIGHT embodiments, the recombinant adeno-associated virus is of a SENSTIVE PROTEINS AND METHODS OF serotype selected from the group consisting of AAV1, AAV2. USE AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof. In a related embodi CROSS-REFERENCE ment, the nucleic acid is encapsidated within a recombinant 0001. This application claims the benefit of U.S. Provi virus selected from the group consisting of recombinant sional Application Nos. 61/054,571 filed May 20, 2008, adeno-associated virus (AAV), recombinant retrovirus, 61/199,241 filed Nov. 14, 2008, and 61/200,430 filed Nov. 26, recombinant lentivirus, and recombinant poxvirus. 2008, which applications are incorporated herein by refer 0004. In another aspect the invention provides a vector ence in their entirety. comprising a nucleic acid encoding a light-sensitive protein, said nucleic acid operatively linked to a metabotropic BACKGROUND OF THE INVENTION glutamate receptor 6 (mGluR6) regulatory sequence or frag ment thereof. In one embodiment the light-sensitive protein is 0002. A gene-delivery therapy to treat a disease or disor selected from the group consisting of ChR1, ChR2. VChR1, der independent of treating an underlying mutation could ChR2 C128A, ChR2 C128S, ChR2 C128T, ChR1-ChR2 have potential value. Methods capable of controlling, regu hybrids/chimeras, ChD, ChEF, ChF ChIEF, NpHR, eNpHR, lating, and/or driving specific neural circuits so as to mediate melanopsin, and variants thereof. In a relate embodiment the naturalistic neural responses and high resolution perception light-sensitive protein is ChR2 or a light-sensitive protein that and control could also be of enormous potential therapeutic is at least about 70%, at least about 80%, at least about 90% or value. Neurons are an example of a type of cell that uses the at least about 95% identical to ChR2. In another embodiment electrical currents created by depolarization to generate com the mGluR6 regulatory sequence fragment is less than about munication signals (e.g., nerve impulses). Other electrically 1000, less than about 750, less than about 500, less than about excitable cells include skeletal muscle, cardiac muscle, and 250, or less than about 100 base pairs. In a related embodi endocrine cells. Neurons use rapid depolarization to transmit ment the mGluR6 regulatory sequence fragment is repre signals throughout the body and for various purposes, such as sented by the sequence in FIG. 6. In another embodiment the motor control (e.g., muscle contractions), sensory responses vector comprises a recombinant adeno-associated virus (e.g., touch, hearing, and other senses) and computational (AAV). In a related embodiment the vector comprises a functions (e.g., brain functions). By facilitating or inhibiting recombinant virus selected from the group consisting of the flow of positive or negative ions through cell membranes, recombinant adeno-associated virus (AAV), recombinant ret the cell can be briefly depolarized, depolarized and main rovirus, recombinant lentivirus, and recombinant poxvirus. In tained in that state, or hyperpolarized. Thus, the control of the a specific embodiment the AAV is of a serotype selected from depolarization of cells can be beneficial for a number of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, different purposes, including visual, muscular and sensory AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and control. Light-sensitive protein channels, pumps, and recep hybrids thereof. In other specific embodiments, the recombi tors can permit millisecond-precision optical control of cells. nant AAV is of a combinatorial hybrid of 2, 3, 4, 5, 6, 7, 8, 9. Although light-sensitive proteins in combination with light 10, 11, 12, 13, 14, 15 or more serotypes or mutants thereof. In can be used to control the flow of ions through cell mem a related embodiment the AAV comprises mutated capsid branes, targeting and delivery remain to be addressed for protein. In one specific embodiment the capsid protein com specific diseases, disorders, and circuits. prises a mutated tyrosine residue. The mutated tyrosine resi due can be selected from the group consisting of Y252F, SUMMARY OF THE INVENTION Y272F, Y444F, Y500F, Y700F, Y704F, Y730F, Y275F, 0003. In one aspect, the invention provides a recombinant Y281F, Y508F, Y576F,Y612G, Y673F and Y720F. In a spe nucleic acid comprising a nucleic acid encoding a light-sen cific embodiment the mutated capsid protein comprises a sitive protein operatively linked to a metabotropic glutamate tyrosine residue mutated to a phenylalanine. receptor 6 (mGluR6) regulatory sequence or fragment 0005. In another aspect the present invention provides a thereof. In one embodiment the light-sensitive protein can be method of treating a Subject Suffering from a disease or dis selected from the group consisting of ChR1, ChR2. VChR1, order of the eye comprising introducing into an affected eye a ChR2 C128A, ChR2 C128S, ChR2 C128T, ChR1-ChR2 recombinant adeno-associated virus (AAV) comprising a hybrids/chimeras, ChD, ChEF, ChF ChIEF, NpHR, eNpHR, light-sensitive protein operatively linked to a metabotropic melanopsin, and variants thereof. In another embodiment the glutamate receptor 6 regulatory sequence (mGluR6) or frag light-sensitive protein is ChR2 or a light-sensitive protein that ment thereof. In one embodiment the disease or disorder of is at least about 70%, at least about 80%, at least about 90% or the eye is caused by photoreceptor cell degeneration. In at least about 95% identical to ChR2. In another embodiment another embodiment the light-sensitive protein is selected the mGluR6 regulatory sequence fragment comprises less from the group consisting of ChR1, ChR2. VChR1, ChR2 than about 1000, less than about 750, less than about 500, less C128A, ChR2 C128S, ChR2 C128T, ChR1-ChR2 hybrids/ than about 250, or less than about 100 base pairs. In a related chimeras, ChD, ChEF, ChF, ChIEF, NpHR, eNpHR, melan embodiment the mGluR6 regulatory sequence or fragment opsin, and variants thereof. In a related embodiment the light thereof is a mGluR6 promoter or enhancer. In a specific sensitive protein is ChR2 or a light-sensitive protein that is at related embodiment the nucleic acid further comprises a least about 70%, at least about 80%, at least about 90% or at green fluorescent protein. In another embodiment the nucleic least about 95% identical to ChR2. In another embodiment acid is encapsidated within a recombinant adeno-associated the mGluR6 promoter fragment is less than about 1000, less virus (AAV). In certain embodiments, the recombinant AAV than about 750, less than about 500, less than about 250, or is of a combinatorial hybrid of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, less than about 100 base pairs. In a related embodiment the 13, 14, 15 or more serotypes or mutants thereof. In certain mGluR6 promoter fragment is represented by the sequence in US 2012/0093.772 A1 Apr. 19, 2012 FIG. 6. In another embodiment the AAV is of a serotype intravitreal injection, subretinal injection, and/or ILM peel. In selected from the group consisting of AAV1, AAV2, AAV3, another embodiment the AAV is of a serotype is selected from AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV12, and hybrids thereof.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages38 Page
-
File Size-