Cryptic and Pseudo-Cryptic Diversity in the World's Most Common Bark

Org Divers Evol (2017) 17:633–652 DOI 10.1007/s13127-017-0334-6

ORIGINAL ARTICLE

Cryptic and pseudo-cryptic diversity in the world’s most common bark beetle—Hypothenemus eruditus

Marius Kambestad1,2 & Lawrence R. Kirkendall1 & Iren L. Knutsen1,2 & Bjarte H. Jordal2

Received: 21 January 2017 /Accepted: 24 May 2017 /Published online: 1 July 2017 # Gesellschaft für Biologische Systematik 2017

Abstract Hypothenemus eruditus is regarded as the world’s Keywords Hypothenemus . Morphology . Molecular most common bark beetle, collected from numerous host markers . Cryptic diversity . Species complex plants on all forested continents. Previous taxonomic treatments remark that the species is morphologically variable and difficult to identify, but to date, no study has analyzed Introduction molecular data to investigate possible cryptic or seemingly cryptic (pseudo-cryptic) diversity in this species. We se- The recent development of genetic analyses (DNA barcoding quenced 216 specimens matching or closely resembling the in particular; Hebert et al. 2003) has provided a powerful tool currently accepted description of H. eruditus for a mitochon- for correcting taxonomic mistakes. The last two decades have drial (COI) and a nuclear marker (28S), and scored six mor- thus seen a rise in the discovery of cryptic and pseudo-cryptic phological characters. We also compared the morphology of diversity (sensu Saez and Lozano 2005) across the tree of life H. eruditus syntypes and type material of 26 synonymized (e.g., Hebert et al. 2004; Blair et al. 2005; Smith et al. 2008), species with the sequenced material. The sequenced material but also many cases of synonymization of what were previ- grouped in 21 operational taxonomic units (OTUs) supported ously thought to be separate species (e.g., Puillandre et al. by both molecular and morphological data, 17 of which were 2011; Bañón et al. 2013; Mutanen et al. 2015). Correcting past part of an apparent H. eruditus species complex. Another nine taxonomic imprecision using genetic markers ideally requires cryptic OTUs, distinguishable only by molecular data, were sequencing of type material of valid species and their syno- also included in the complex. Only one of the OTUs revealed nyms (see Blakemore et al. 2010), but this can be problematic a morphological match with the H. eruditus syntypes. The 26 since type specimens are often old, frequently fragile, and not synonymized species were split into 14 tentative morphs, 11 necessarily preserved in a manner that prevents degradation of of which did not match the H. eruditus syntypes. We argue their DNA (Wandeler et al. 2007 and references therein). that many of our sequenced OTUs deserve species status, and Although probably under-communicated compared to the that many species synonymized under H. eruditus should be many success stories of gene-based taxonomy, such chal- resurrected. lenges can lead to a taxonomic stalemate (Blakemore et al. 2010;Brower2010; Kvist et al. 2010;Kvist2013;Mutanen Electronic supplementary material The online version of this article et al. 2015), impeding the study of ecology, distribution, di- (doi:10.1007/s13127-017-0334-6) contains supplementary material, versity, behavior, and evolution. which is available to authorized users. Bark beetles (Curculionidae, Scolytinae) are small to tiny insects which often can only be identified to species by subtle * Marius Kambestad differences in minuscule morphological characters. Although [email protected] some species have limited geographical distributions, or can be restricted to certain host plants (e.g., Jordal and Hewitt 1 Department of Biology, University of Bergen, Bergen, Norway 2004;Jordaletal.2004), many others are widespread across 2 Department of Natural History, The University Museum, University continents and polyphagous (e.g., Wood 2007;Andersenetal. of Bergen, Bergen, Norway 2012;Gohlietal.2016). Species delimitation based on 634 Kambestad M. et al. geography or ecological traits can therefore be difficult in this group of beetles. Some scolytine species are economically important pests that are becoming increasingly invasive around the globe (e.g., Kirkendall and Faccoli 2010 and references therein), underscoring the importance of accurate species recognition. One example of potentially misleading ecological information due to faulty taxonomy is the diverse list of host plants recently assembled (see Vega et al. 2012)for the pest species Hypothenemus hampei (Ferrari 1867), which in fact probably comprises a species complex (Gauthier 2010). Hypothenemus eruditus Westwood, (1836)isreckonedto be the most widespread and abundant scolytine in the world (Wood 2007). This tiny beetle (∼1 mm) is considered a Bsuper-generalist,^ recorded from an unusually broad range Fig. 1 A piece of the book cover tunneled by beetles of the syntype series of Hypothenemus eruditus of host species and plant tissues on all continents except Antarctica (Wood 1982). H. eruditus is abundant in most tropical and subtropical regions, and consequently, it is widely number of species very similar to H. eruditus have been de- collected. The species is cited in hundreds of scientific papers, scribed (34 in the aforementioned work by Hopkins), 71 of including studies on diversity (e.g., Gray 1974;Flechtmann which were later synonymized (listed in Wood 2007). Most of et al. 2001; Stone et al. 2010; De Abrau et al. 2012), commu- the synonyms were proposed by Wood (1954, 1960, 1972, nity ecology (Beaver 1979; Jordal and Kirkendall 1998), and 1974, 1977b, 1989, 1992, 2007), but three other authors are associations between beetles and organisms other than plants responsible for at least one synonymy each (listed in Wood (Castillo et al. 2004; Romón et al. 2007; Romón et al. 2008), and Bright 1992). In some instances, synonymies are known as well as regional, national, or topical checklists of species to have been based on comparison with homeotype series, (Schedl 1959; Halperin and Holzschuh 1984;BrightandPeck rather than with the H. eruditus syntypes themselves (e.g., 1998;Peck2006; Cognato et al. 2010; Kirkendall and Faccoli Wood 1972, 1977b, 1992). 2010 and many other studies). H. eruditus usually breeds in There is very little detail in Westwood’s(1836) description dead, sometimes quite dry, host tissues, and is generally not of H. eruditus, but this was typical of species descriptions considered to be a pest. However, attacks on commercially from that period; Westwood’s main point was that the anten- important plants such as coffee, cocoa, macadamia nuts, cam- nae and legs of H. eruditus differed greatly from those of the phor trees, plane trees, and timber of rubberwood have been few previously described genera of bark beetles. The accounts reported, as well as the destruction of books and other prod- by Stephen L. Wood are more thorough, but they vary to some ucts made of woody materials (Browne 1961; Wood 1977a; extent from publication to publication (Wood 1954, 1982, Kamnerdratana 1987; Halperin 1990; Vázquez et al. 1993; 2007). All modern taxonomic treatments include remarks that Mitchell and Maddox 2010; Kangkamanee et al. 2011). H. eruditus is difficult to identify, due especially to variability Browne (1961) claims that H. eruditus has been responsible in features of the frons (forehead) and elytra meant to be di- for killing cocoa seedlings and for causing a considerable agnostic. There are also several quite similar species, some of reduction in the growth rate of camphor trees in forest planta- which are not easily distinguished from the admittedly vari- tions in Malaysia. able H. eruditus (see Table 1). Taxonomic difficulties are H. eruditus is one of the earliest described bark beetles and compounded by limits of optical equipment (particularly, dif- has an unusual pedigree. The young John Obadian Westwood, ficulties due to reflections from shiny surfaces). There has a prolific entomologist and artist who went on to become an been a growing recognition that genetic studies are necessary Oxford professor and a president of the Entomological to clarify species limits (Wood 2007), but no study has yet Society of London, described a new genus of Bminute addressed directly the issue of possible cryptic or seemingly Coleopterous insect^ and its type species H. eruditus based cryptic (pseudo-cryptic) diversity in this species. Collections on specimens found tunneling in a pasteboard book cover of BH. eruditus^ are frequently reported in forest biodiversity (Westwood 1836). A rather long syntype series is deposited research, so resolving questions regarding the species’ status is in the Oxford University Museum of Natural History, together not simply an esoteric matter for a few taxonomists. with pieces of the original book cover showing the galleries In the present study, we test the null hypothesis that tunneled by the beetles (Fig. 1). Westwood received the book H. eruditus is a single species, using an integrative taxonomic from a currently unknown source. Hopkins (1915) reports approach (Schlick-Steiner et al. 2010). We analyzed mito- Colombia as the origin of the syntypes, but it is not clear chondrial (COI) and nuclear (28S) sequence data from mate- how he arrived at this conclusion. Since its discovery, a rial matching or closely resembling the currently accepted Cryptic diversity in Hypothenemus eruditus 635

Table 1 Species similar in size to Hypothenemus eruditus and Species Distinguished from H. eruditus Westwood by Reference having very similar descriptions, with the characters said to H. californicus Hopkins, 1915 Tubercle on frons; posterolateral areas of pronotum Wood 2007 separate them from H. eruditus. smooth, shining, coarsely punctured; interstriae as Characters varying between wide as striae recent descriptions (Wood 1982, H. gossypii (Hopkins, 1915) Frons transversely impressed; median pair (or all) of Wood 1982, 2007 2007) are not included asperities on anterior margin of pronotum widely separated H. nanellus Wood 1971 Pronotum narrowly rounded in front; body stouter; Wood 1982 interstrial ground vestiture on declivity absent H. parallelus (Hopkins, 1915) Small, median tubercle on frons Wood 2007 H. plumeriae (Nordlinger, Median tubercle above an impression on frons Wood 2007 1856) H. pubescens Hopkins, 1915 Interstrial scales on declivity short, very broad Wood 2007 H. suspectus Wood, 1974 Transverse callus above impression on frons Wood 2007 H. teretis Wood 1971 Transverse callus above impression on frons; interstrial Wood 2007 scales replaced by hair-like setae on posterior disc and declivity H. vesculus Wood, 1974 No reticulation on pronotum Wood 1982, 2007

description of H. eruditus, including specimens of very similar means Bkeys out to this species, but is not^); BHypothenemus species. We then examined the extent to which genetically sp.^ indicates a potentially new species with unclear affinities defined clades are morphologically distinct. Finally, we ask to other species in the eruditus complex. Although the body which, if any, of the clades we uncovered in our study might color of H. eruditus is described as dark brown to almost black be the H. eruditus found in a London book cover nearly two (Westwood 1836; Wood 1954, 1982, 2007), this character was centuries ago. We also compared the morphology of the ignored when assigning names to specimens in this study syntype series with our sequenced clades and with type mate- because all syntypes of H. eruditus have dark elytra and a rial of many of the species currently considered junior syno- yellow to light brown pronotum (hereafter called Bbicolored^; nyms of H. eruditus. see BResults^ section), and initially we were not sure how variable color might be in the species. Specimens were collected from 14 countries in the Americas, Africa, and Methods Australia, with Panama and Costa Rica being represented with the highest number of individuals (101 and 56 specimens, Taxon sampling respectively).

Most individuals were collected by the authors in 1998–2011 from a wide variety of host taxa and plant tissues PCR amplification and sequencing (supplementary material Table S1). We successfully sequenced 216 Hypothenemus specimens, including 39 speci- DNA was extracted from ethanol-preserved specimens using mens originally collected and sequenced for an unpublished the Qiagen Dneasy® Blood and tissue kit (Qiagen, Hilden, master’s degree thesis (Knutsen 2008). When choosing spec- Germany). For the specimens previously sequenced by imens, we attempted to maximize morphological diversity Knutsen (marked with the prefix BHer^ in figures), the proto- within the alleged species complex. Selected specimens were col provided by the manufacturer was followed, and speci- determined to species using keys and descriptions in the two mens were destroyed by extraction. For the remaining speci- most recent treatments of the genus (Wood 1982, 2007). For mens (marked with prefix BH^ or BHe^), the following excep- characters that vary somewhat between different descriptions tions to the protocol were made to ensure non-destructive of the same species (e.g., declivital vestiture and number of extraction: Specimens were incubated overnight and only pronotal asperities in H. eruditus), a match with at least one of gently vortexed to avoid disintegration. All tubes were flicked the descriptions sufficed for determination. Open nomencla- at least once during incubation to distribute DNA-saturated ture was utilized as follows: Bnear^ indicates that a specimen solution in the tube. The solution was transferred to a new is very close to the description of a given species, and might or tube after incubation, leaving the specimen to be washed in might not be that species; Bnear, not^ indicates that a specimen 96% ethanol before remounting. Membrane-bound DNA was does not match the description of a given species, but still is eluted with 2 × 50 μl buffer. Specimens are held at The closer to this than any other known species (in practice, often University Museum, University of Bergen, Norway, with 636 Kambestad M. et al. voucher numbers identical to specimen codes given in supple- PCR reaction, purified PCR product containing ∼10 ng DNA, mentary material Table S1. and H2O added to a total reaction volume of 10 μl. All sam- An attempt was also made to extract DNA from three spec- ples were sequenced in both directions. The solutions were imens in the H. eruditus syntype series. The non-destructive then run through the following steps in a thermal cycler: 1 cy- protocol described above was used, and the specimens were cle for 5 min at 96 °C and 25 cycles for 10 s at 96 °C, 5 s at remounted on the original glue boards after extraction. 50 °C, and 4 min at 60 °C. Sanger sequencing was executed at While all specimens were sequenced for COI, only a subset University of Bergen DNA sequencing lab. were sequenced for the nuclear marker 28S. At least one specimen from each major COI clade was sequenced for 28S. In DNA sequence analyses clades with multiple COI haplotypes, more than one specimen was usually sequenced for 28S, prioritizing specimens with Sequences were edited in SeqMan Pro version 8.1.5 and the most divergent COI haplotypes within each clade. aligned by eye in MegAlign version 8.1.4 (both DNASTAR, However, only specimens not destroyed during extraction Inc., Madison, WI). Those of 28S were further aligned in the were sequenced for the nuclear gene. software Muscle (Edgar 2004) using default parameter set- All reactions were performed on a Bio Rad C1000 Thermal tings. Alignments were consistent across different alignment Cycler (Bio-Rad Laboratories, Inc., Hercules, CA), except for settings with few ambiguous sites, allowing all sites to be a few PCR reactions for 28S, which were performed on a included in the phylogenetic analyses. Sequences were depos- PTC-220 DNA Engine DYAD™ Peltier Thermal Cycler ited in GenBank under the accession numbers KY800122– (MJ Research, Waltham, MA). Primers are listed in Table 2. KY800336 (COI) and KY744472–KY744565 (28S). In PCR reactions for mitochondrial DNA, a solution Genetic divergence within and between clades was estimat- consisting of 17.4 μlH2O, 2 μl dNTP mix, 1 μl25mM ed in the software MEGA6 (Tamura et al. 2013). Phylogenetic MgCl2, 2.5 μl 10× CoralLoad PCR Buffer, 0.5 μlofeach analyses were based on data matrices of (1) all COI sequences, primer at 10 μM concentration, 0.125–0.150 μlHotStarTaq (2) all 28S sequences, and (3) separate and combined data Plus DNA Polymerase, and 2 μl DNA extract was used. PCR including only COI where 28S data were present. Data matri- was performed under the following conditions: 1 cycle for ces were analyzed in a Bayesian framework using MrBayes 5 min at 95 °C, 36 cycles for 30 s at 94 °C, 45 s at 48 °C, version 3.2 (Ronquist et al. 2012), by distance methods using 1 min at 72 °C, and 1 final cycle for 7 min at 72 °C. Ramping minimum evolution (ME), and parsimony using PAUP* speed was set to 1°/s. For 28S, the PCR cocktail contained (Swofford 2002). The Bayesian and ME analyses implement-

17.85 μlH2O, 0.5 μldNTPmix,2.5μl Ex Taq Buffer, 1 μlof ed evolutionary models (GTR + G + I) as suggested by each primer at 10 μM concentration, 0.15 μlTaKaRaEx MrModelTest (Nylander 2004). The Bayesian analyses were Taq™ enzyme, and 1 μl DNA extract, and PCR was per- run for 20 million generations. Likelihood and posterior formed as follows: 1 cycle for 5 min at 95 °C, 38 cycles for values were checked for stationarity in the software Tracer 30 s at 94 °C, 45 s at 55 °C, 60 s at 72 °C, and 1 final cycle for (Rambaut et al. 2014). Parsimony analyses included 100 heu- 8 min at 72 °C. ristic searches with random additions of taxa. Node support PCR products were purified using exonuclease I (EXO I) was estimated by 100 bootstrap replicates. Due to excessive and shrimp alkaline phosphatase (SAP). Eight microliters of search requirements for the largest COI dataset, we used the PCR product from each sample was added to 0.1 μl EXO I NChuck-NScore command to approximate bootstrap values.

(10 U/μl), 1.0 μl SAP (1 U/μl), and 0.9 μlH2O, and run Trees were rooted with Cryphalus abietis (GenBank accession through the following steps in a thermal cycler: 1 cycle for numbers JX263795 for COI and JX263688 for 28S), 30 min at 37 °C and 1 cycle for 15 min at 85 °C. Ernoporus tiliae (EU191841 for COI and JX263693 for Purified PCR products were sequenced using BigDye® 28S), and Procryphalus mucronatus (JX263804 for COI and Terminator v. 3.1 (Life Technologies, Carlsbad, CA), mixing JX263697 for 28S) as outgroups. Matrices and trees have reactants as follows: 1 μlBigDye,1μlBigDyesequencing been deposited in the Dryad Digital Repository (http://dx. buffer, 1 μl3.2μM primer corresponding to the primer used in doi.org/10.5061/dryad.8j5s7).

Table 2 Primers used in PCR and sequencing reactions Gene Primer name F/R Sequence (5′–3′) First cited

COI C1-J-1718 F ggaggatttggaaattgattagttcc Simon et al. 1994 a2237 R ccgaatgcttcttttttacctctttcttg Normark et al. 1999 a2411 R gctaatcatctaaaaactttaattccwgtwg Normark et al. 1999 28S 3690s F gagagttmaasagtacgtgaaaac Dowton and Austin 1998 a4285 R ctgacttcgtcctgaccaggc Sequeira et al. 2000 Cryptic diversity in Hypothenemus eruditus 637

Integrative OTUs molecular data and thus split into two separately monophyletic, cryptic OTUs (OTU21a and OTU21b). Once phylogenetically delimited clades could be identified The fit between morphological characters and genetic re- based on COI, 28S, or the two genes combined, we attempted latedness was estimated on the most likely Bayesian and par- to integrate these data with clades delimited by morphology to simonious topologies, based on combined 28S and COI data define operational taxonomic units (OTUs). We scored mor- for single OTU representatives. We used three different esti- phological characters for all but 39 beetles destroyed during mates of character congruence as they respond differently to DNA extraction. We used six characters which were invariant the minimum number of character changes: the consistency or nearly so within 28S haplotypes but variable between 28S index (CI) can be inflated if the minimum number of changes haplotypes: (1) body color; (2) width of scale-like setae is high (i.e., many character states), whereas the retention in- (Bscales^) on the venter; (3) density of hair-like, interstrial dex (RI) approaches zero if the actual number of steps ap- declivital vestiture; (4) the number of, size of, and separation proaches the maximum, irrespective of the minimum number between serrations on the anterior margin of the pronotum of changes. The rescaled consistency index (RCI) combines (marginal asperities); (5) the shape and length of a median the two indices. longitudinal groove or carina, or both, located between the upper level of the eyes and epistoma; and (6) shape, width, Type material examined and depth of a median impression on the lower frons. Each of these characters was subdivided into 2–6 character states We borrowed part of the syntype series of H. eruditus from (Table 3 and Figs. 2, 3, 4, 5,and6). In scoring character 2 Oxford University Museum of Natural History. The loan in- (width of ventral scales), the short, hair-like supplemental cluded six whole specimens and body parts of several more ground vestiture was ignored when present, as well as the specimens. Type material for 26 species that have been syn- occasional (usually laterally placed) scales that were consid- onymized with H. eruditus was borrowed from the natural erably broader than the average scale. This character, which history museums in Vienna (NHMW), London (BMNH), to our knowledge has not previously been used to sep- and Paris (MNHN). The morphology of synonymized species arate species in this genus, thus refers to the width of was compared with that of H. eruditus syntypes and to spec- the majority of long, semi-erect scales on ventrites 1 imens representing distinct morphological and genetic clades through 5 (often referred to as sternites 3 through 7; (OTUs) in this study. For some synonyms, only paratypes see Hulcr et al. 2015). were examined, but these were in most cases collected at the Groups of specimens sharing a unique set of morphological same location as the holo-, lecto-, or syntypes, and were thus character states were labeled by numbers (e.g., morph 1) and probably part of the same collection series (see Table 4). mapped onto trees based on COI and 28S data. Morphs sup- Syntypes of Hypothenemus lezhavai Pjatnitskii 1929, ported by available molecular markers are referred to as Hypothenemus tuberculosus Hagedorn 1912,and Bpseudo-cryptic OTUs,^ which are unlikely to be detected Stephanoderes ehlersi Eichhoff, 1878 are lost or unlocatable using published keys and descriptions, but which can be (Wood and Bright 1992). delimited by use of the morphological characters scored in the present study. Clades that were monophyletic for both molecular markers, but not encompassing all specimens of a Results given morph, are referred to as Bcryptic OTUs,^ meaning OTUs indistinguishable from at least one other OTU by mor- Genetic diversity phological characters. For example, morph 1 was monophyletic in both COI and 28S trees, and thus regarded a pseudo- Sequencing yielded 215 COI sequences (457–691 bp), with cryptic OTU (OTU1), while morph 21 was subdivided by an average length of 610 bp. For 28S, 94 sequences were

Table 3 Morphological characters and character states. Main character Character states Number of character states See text and Figs. 2, 3, 4, 5,and6 for details and illustrations of 1. Body color 1, bicolored; 2, dark (brown to black) 2 character states 2. Width of ventral scales 1, narrow; 2, medium; 3, broad 3 3. Interstrial declivital vestiture 1, sparse; 2, medium; 3, abundant 3 4. Marginal asperities 1–6 (Fig. 5)6 5. Frons groove or carina 1–5 (Fig. 6)5 6. Frons impression 1–6 (Fig. 6)6 638 Kambestad M. et al.

Fig. 2 Character states for Bbody color.^ a Bicolored (state 1). b Dark (state 2)

ab obtained (597–672 bp), with an average length of 647 bp. One of H. eruditus, while we identified eight as Bnear eruditus^ specimen (He60) was removed from the COI data set due to and one as Bnear, not eruditus.^ One morph was identified as suspected contamination, but was still included in the 28S Hypothenemus teretis,fourasBnear plumeriae,^ two as Bnear, data. Two specimens (H6, H253) were removed from the not sparsus^ (referring to Hypothenemus sparsus Hopkins, 28S data set for the same reason, but included in the COI data. 1915), one as Bnear, not ascitus^ (Hypothenemus ascitus We were not able to get usable sequences from syntype spec- Wood 1971), and three as BHypothenemus sp.^ imens of H. eruditus. All other specimens were included in The fit between morphological characters and the com- both data sets. We did not find any indications of non- bined molecular tree topology was generally very low functional nuclear copies of COI (NUMTs), such as stop co- (Table 6), indicating a high level of homoplasy across the dons, indels, or double peaks in the sequencing chromato- different morphs, for all characters. The retention index was grams (see Jordal and Kambestad 2014). highest for interstrial declivital vestiture and width of ventral The COI sequences included 160 haplotypes, with many scales. Within each OTU, body color, marginal asperities, and clades separated by ≥10% uncorrected sequence divergence frons groove or carina were the most consistent characters (Fig. 7). For 28S, 66 haplotypes were present among the suc- (Table 5). For specimens where all characters were undam- cessfully sequenced specimens (Fig. 8), but distances between aged and clearly visible, body color was consistent within all sequences were generally much smaller than for COI. OTUs, and marginal asperities and frons groove or carina The phylogenetic analyses indicated a high level of con- were variable only within one (21b) and two (10e and 10g) cordance between COI and 28S (Figs. 7 and 8,supplementary OTUs, respectively. The remaining characters were variable material Fig. S1). The two markers only disagreed by a within several OTUs, with specimens representing a narrow paraphyletic group 16a in the full COI analysis (Fig. 7), a continuum of phenotypes for any given character (e.g., ventral paraphyletic group 14 in the reduced COI analysis (Fig. S1), scales varying from narrow to medium or from medium to and a paraphyletic group 10f in both COI analyses. The broad) rather than being identical. Bayesian and parsimony analyses revealed less resolution between clades compared to the ME analyses, while generally supporting the same major clades with high node support for Cryptic and pseudo-cryptic diversity both COI and 28S. Among the 25 identified morphs, 17 were supported by both COI and 28S sequence data (Figs. 7 and 8). The 28S data Morphology of sequenced material supported the separation of morphs 14 and 15, but morph 14 was not monophyletic for COI with respect to morph 15, so Morphological analyses resulted in 25 morphs (Table 5), each these two morphs were counted as a single pseudo-cryptic including from 1 to 58 specimens, with six morphs including OTU. Morphs 13, 20, and 22 contained single specimens sup- only a single specimen. Five morphs matched the descriptions ported by the single marker for which they were successfully

Fig. 3 Character states for Bwidth of ventral scales.^ a Narrow (state 1). b Medium (state 2). c Broad (state 3)

abc Cryptic diversity in Hypothenemus eruditus 639

Fig. 4 Character states for Binterstrial declivital vestiture.^ a Sparse (state 1). b Medium (state 2). c Abundant (state 3)

acb sequenced, adding up to a total of 21 pseudo-cryptic OTUs. morphs 21a, 21b, and 22 (all Bnear, not sparsus^) and morphs Among these 21 OTUs, within-clade variation exceeded ge- 24 and 25 (both BHypothenemus sp.^) formed a cluster distant netic distance to the nearest clade for three (OTUs 12, 14 + 15, from the remaining ingroup taxa. and 18) for COI and for one (OTU14 + 15) for 28S (Table 7). For 35 of the 39 specimens not available for morphological Among pseudo-cryptic OTUs with multiple specimens sam- examination, COI data clearly indicated affiliation to one of pled, the uncorrected within-clade COI variation ranged from the cryptic or pseudo-cryptic OTUs defined in Fig. 7.COI 0.0 to 15.9% (mean = 4.7) and from 0.0 to 2.2% (mean = 0.4) distance between Her08CAT + Her38CAH and the closest for 28S (Table 7). Minimum distance to other clades ranged OTU (10e) was 7.1%, suggesting that these two specimens from 9.1 to 13.9% for COI (mean = 11.4%) and from 0.5 to could be considered a separate OTU. The same is true for 7.8% (mean = 1.5%) for 28S. Her73CNB and Her98NA (the latter tentatively included in The three remaining morphs were not monophyletic for OTU18), which were both separated from all other specimens any genetic marker (Figs. 7 and 8). Morphs 16 and 21 were by a COI distance of ≥11.6 and ≥11.7% respectively. both split into two cryptic OTUs with support from each of the Specimens within most OTUs originated from the same molecular markers. Morph 10 was split into seven cryptic continent (Table 7). However, four OTUs (8, 9, 10a, and 18) OTUs supported by both COI and 28S, and OTU 10f split included specimens from both South or Central America and into a further two subclades for COI. Africa, and one OTU (10b) consisted of one specimen from Morphs which we had identified as H. eruditus, Bnear Tanzania and one from New Caledonia. eruditus,^ or Bnear, not eruditus^ were not monophyletic (Figs. 7 and 8). Rather, these clades were intermixed with all Morphology of type material clades identified as Bnear plumeriae^ and the two clades identified as H. teretis and Bnear, not ascitus^ (identifications All borrowed H. eruditus syntypes were bicolored. Where based on published descriptions and keys; Table 7). In the visible, the ventral scales were broad, the interstrial declivital Bayesian and parsimony analyses of the smaller combined vestiture was moderately abundant (character state 2), there COI and 28S data (supplementary material Figs S2, S3), and were 5–7 marginal asperities on pronotum, and the frons had a in separate analyses of the 28S data, morph 23 short groove above a shallow, rounded impression. This set of (BHypothenemus sp.^) was clustered with the outgroups, and morphological characters separates the syntypes from all

a b c

d e f Fig. 5 Character states for Bmarginal asperities.^ a Five to nine of width of a tooth (state 3). d Four of roughly the same size, all roughly the same size, median pair often closer (state 1). b Five separated by ≥ basal width of a tooth (state 4). e Four with of roughly the same size, median three contiguous (state 2). c median pair much larger and closer (state 5). f Four of roughly Four of roughly the same size, distance between lateral and the same size, distance between lateral and median teeth ≥ length median teeth < length of median teeth, all separated by ≤ basal of median teeth (state 6) 640 Kambestad M. et al.

Fig. 6 Character states for Bfrons groove or carina^ and for Bfrons impression.^ a Long groove (state 1ofBfrons groove or carina^). b Obtuse ridge, usually with short groove above (state 2 of Bfrons groove or carina^). c Long carina, usually with short groove above (state 3 of Bfrons groove or carina^). d Short carina with short a b c groove above (state 4 of Bfrons groove or carina^). e Short groove at upper level of eyes (state 5 of Bfrons groove or carina^)and weak, transverse impression above epistoma (state 2 of Bfrons impression^). f Rounded, shallow impression (state 3 of Bfrons impression^). g Rounded, deeper impression (state 4 of Bfrons impression^). h Broad, deep d e f impression with carina-like upper edge (state 5 of Bfrons impression^). i Broad, deep impression with smooth upper edge (state 6 of Bfrons impression^). Frons impression state 1 (no impression) not shown

g h i

morphs sequenced in this study, other than morph 4. This Discussion OTU consists of only a single specimen collected in Panama, from a fallen Cecropia leaf petiole. Cryptic and pseudo-cryptic diversity Of the 26 species synonymized with H. eruditus,13were represented by one or more type specimens in which all char- This study provides strong evidence for the presence of a acters were visible. In the remaining 13, one or more charac- species complex involving cryptic and pseudo-cryptic species ters were not visible. Nevertheless, we could sort these 26 matching or closely resembling currently accepted descrip- synonymized species into 14 morphs. Seven of the synony- tions of H. eruditus, Hypothenemus plumeriae, H. teretis, mized species were morphologically unique (Table 8). and H. ascitus (Wood 1982, 2007). OTUs here labeled Archeophalus ealaensis Eggers 1944, Hypothenemus bicolor BHypothenemus sp.^ or Bnear, not sparsus^ are likely Schedl, 1941, and Hypothenemus cylindripennis Schedl 1957 undescribed species, but do not appear to be closely related were identical in all visible characters to the Westwood spec- to H. eruditus, and are henceforth not considered part of the imens, but at least one character was hidden for each of these. species complex. Sixteen of the synonymized species could be tentatively Within the H. eruditus complex, a total of 15 distinct OTUs matched to specimens in sequenced OTUs. Due to relatively were separated by consistent differences in morphological poor condition of some type specimens, eight of these are characters and both mitochondrial and nuclear molecular listed as potential matches with more than one OTU (see markers, another two by differences in morphology and a Table 8). Among the remaining ten, six were separable from single molecular marker, and at least nine additional deeply sequenced OTUs by combinations of the six characters listed divergent, cryptic OTUs were supported by differences in in Table 3, and four had character states not represented in any each of the two molecular markers. The COI divergence be- of our sequenced specimens. Of particular note are Cryphalus tween OTUs was in most of these cases larger than previously minutus Schedl 1978, which has three marginal asperities on reported for other species of Scolytinae (Cognato et al. 1999; the pronotum and a strikingly different body shape from all Cognato and Sperling 2000; Kerdelhué et al. 2002;Kohlmayr other specimens in this study, and Hypothenemus vianai et al. 2002; Cognato et al. 2003;Jordaletal.2004;Cognato Schedl 1958, with only two marginal asperities. and Sun 2007; Avtzis et al. 2008;Andersenetal.2012;Jordal Cryptic diversity in Hypothenemus eruditus 641

Table 4 Type specimens for species synonymized under Synonym Specimens (n) Origin Synonymy Museum Hypothenemus eruditus that were examined for this study. Archeophalus ealaensis Eggers 1944 Paratypes (2) Congo Schedl NHMW Designation, origin, and current Cryphalus aspericollis Wollaston, 1860 Assumed syntypes Madeira Schedl BMNH location (museum) are given, as (3) well as author of the synonymy. Cryphalus basjoo Niisima, 1910 Cotypes (2) Japan Wood NHMW All paratypes and cotypes Cryphalus minutus Schedl 1978 Holotype (1) Brazil Wood NHMW examined are from the same location as the holo-, lecto-, or Hypothenemus argentinensis Schedl, Lectotype (1) Argentina Wood NHMW syntypes for any given synonym, 1939 unless otherwise stated. Hypothenemus bicolor Schedl, 1939 Lectotype (1) Indonesia Schedl NHMW References to original Hypothenemus cylindricus Schedl, 1939 Lectotype + paratype Argentina Wood NHMW descriptions and synonymies are (2) in Wood and Bright (1987)and Hypothenemus cylindripennis Schedl Paratype (1) Congo Wood NHMW Bright and Skidmore (1997, 1957 2002) Hypothenemus dubiosus Schedl, 1940 Paratype (1) Costa Rica Wood NHMW Hypothenemus ehlersi rotroui Syntypes (15) Algeria Balachowsky MNHN Peyerimhoff, 1919 Hypothenemus glabratellus Schedl, 1953 Lectotype (1) Malaysia Schedl NHMW Hypothenemus glabratus Schedl, 1942 Lectotype (1) Malaysia Schedl NHMW Hypothenemus insularis Perkins, 1900 Syntype (1) Hawaii Wood BMNH Hypothenemus lezhavai Pjatnitskii 1929 Cotypes (2)a Georgia Schedl NHMW Hypothenemus mauiensis Schedl, 1941 Lectotype (1) Hawaii Wood NHMW Hypothenemus mesoleius Schedl, 1959 Paratypes (2) Sri Lanka Wood NHMW Hypothenemus minutulus Schedl, 1972 Paratypes (2)b Sri Lanka Wood NHMW Hypothenemus obscuriceps Schedl, 1952 Lectotype + paratype Argentina Wood NHMW (2) Hypothenemus parilis Schedl 1951 Holotype (1) Brazil Wood NHMW Hypothenemus pusillus Eggers, 1927 Cotypes (2) Congo Wood NHMW Hypothenemus tuberculosus Hagedorn Cotype (1)a Congo Wood NHMW 1912 Hypothenemus vianai Schedl 1958 Paratype (1) Argentina Wood NHMW Stephanoderes communis Schaufuss, Holotype (1) Madagascar Wood NHMW 1891 Stephanoderes ehlersi Eichhoff, 1878 BTyp. Occ.^ (2)a Spain Balachowsky NHMW Stephanoderes nanulus Schedl, 1948 Lectotype (1) Brazil Wood NHMW Stephanoderes tigrensis Schedl, 1952 Lectotype + Argentina Wood NHMW paratypes (7)

a Syntypes lost or not located (Wood and Bright 1992) b Holotype collected at Peradeniya; paratypes collected at Kandy and Monaragala: all ≤700 mas. on Sri Lanka and Kambestad 2014), including other Hypothenemus species Andersen et al. 2012; Jordal and Kambestad 2014), whereas (Mitchell and Maddox 2010). Gauthier (2010) found COI the minimum 28S distance between OTUs in this study variation to be as high as 11.8% within H. hampei, but a (cryptic or pseudo-cryptic) ranged from 0.3 to 1.7% within geographically structured species complex was suspected in the H. eruditus complex. Furthermore, Mitchell and Maddox that species. The presence of cryptic species is also strongly (2010) found the interspecific COI divergence between six suspected for Dendroctonus valens LeConte 1860,forwhich Hypothenemus species to be in the range of 14.1–18.7%, intraspecific COI variation has been found to reach 12.8% while minimum divergence between the abovementioned 26 (Cai et al. 2008). The most extreme example of intraspecific cryptic or pseudo-cryptic OTUs in this study ranged from 9.1 COI variation is found within the sibling mating species to 13.5%. This suggests that most of the OTUs here uncovered Coccotrypes advena Blandford 1894 (uncorrected divergence within the H. eruditus complex deserve species status, at least 19%), although the haplotypes analyzed were not monophy- considering the 17 OTUs where molecular monophyly is ac- letic (Jordal et al. 2002), again suggestive of a species com- companied by consistent morphological differences. plex. As for 28S, published data indicate typical intraspecific Importantly, several OTUs that are relatively easy to distin- variation to be less than 1%, and most often zero or close to guish by morphology alone (e.g., OTUs 1, 2, and 3) are no zero, for various scolytines (Duan et al. 2004;Doleetal.2010; more than 0.5 and 10–11% different from other OTUs at 28S 642 Kambestad M. et al.

H204 hampei H283 africanus 100** 23 sp A * 100

6 eruditus

14 near eruditus 100** near eruditus ** 15 71 16a 13 near eruditus ** 16a near eruditus * 12 eruditus

** 100 8 near, not ascitus ** 100 2 eruditus

near eruditus ** 3 100 16b near eruditus 100**

1 near eruditus

H205_c.f._areccae ** 24 sp B 100 17 near eruditus ** near, not sparsus 73 21b 10c near plumeriae 100** near eruditus ** 5 near eruditus 100 7 ** near plumeriae 100 sp C 10b 25 near, not sparsus eruditus 22 4 ** 100 21a near, not sparsus * 100 9 near plumeriae **70 ** 100 near plumeriae 11 ** 74

** 100 near plumeriae 10a

** 100 94 ** 93 near plumeriae ** 10e

** 100 19 near plumeriae

* 10f near plumeriae

near plumeriae 10d near plumeriae 100** 10f 18 eruditus

10g near plumeriae

0.2 Cryptic diversity in Hypothenemus eruditus 643

Fig. 7 Phylogenetic tree resulting from the minimum evolution analysis Some junior synonyms were clearly different with regard to of all COI data, using a GTR + I + G model. Bootstrap support values diagnostic characters such as body color, frons sculpture, or higher than 50 below nodes, posterior probabilities above (internal clade support omitted). Numbered clades are considered cryptic (colored)or marginal asperities on the pronotum, making it surprising that pseudo-cryptic (not colored) OTUs, corresponding to morphs 1–25. they were all synonymized under the same name. Some of the Morphs 14 + 15 are treated as a single pseudo-cryptic OTU. OTU20 species synonymized by Wood (Wood and Bright 1992; not included due to suspected contamination. The tree is rooted with Wood 2007) do not match Wood’s own descriptions of the Cryphalus abietis, Ernoporus tiliae,andProcryphalus mucronatus as outgroups (not shown). Scale bar indicates nucleotide substitutions per species; for example, C. minutus has only three marginal as- site perities and an atypical body shape. Such discrepancies can probably partly be explained by the fact that Wood usually did not use the H. eruditus syntypes as a reference, but rather and COI, respectively (Table 7), clearly suggesting that this compared museum specimens and other collections to his level of genetic divergence is indicative of species boundaries own homeotypes (specimens which had been compared pre- in these beetles. Within-clade variation was relatively high for viously to syntypes or to other specimens previously com- both COI (≥5% in nine OTUs and ≥10% in six OTUs) and pared to the syntypes). For example, in his monograph on 28S (≥0.5% in six OTUs and >1% in four OTUs), which leads North and Central American bark beetles, Wood based his us to believe that the number of cryptic OTUs may be even treatment of the species on examination of one syntype of higher than reported here. More detailed studies of morphol- H. eruditus, type specimens of 41 of its synonyms, and a ogy, and possibly also ecology and distribution, are needed to staggering 894 Bother specimens^ (Wood 1982). This could evaluate the status of such species candidates. also account for the notion that H. eruditus is Bsomewhat Although there was a high degree of agreement between variable and not always identified with ease^ (Wood 2007), COI and 28S with respect to terminal clusters (OTUs), deeper as his homeotype series probably consisted of several different nodes in the trees generally had low support, with partial dis- species. An example of confusion stemming from this practice cordance between the two genes. Combined analyses of COI is that Wood (1954, 1982, 2007), and surprisingly also and 28S data also produced trees with low support between Westwood (1836), claimed that H. eruditus is uniformly dark OTUs. Lack of support for evolutionary relationships between in color, while all syntypes deposited in the Oxford University OTUs is probably due to the short time frame where rapid Museum of Natural History are in fact distinctly bicolored (J. diversification occurred in this group, resulting in short inter- Hogan, Oxford University Museum of Natural History, pers. nodes in both genes. While each OTU can be firmly delimited comm.). Most recently, body color of this species was de- based on highly congruent genetic and morphological charac- scribed as varying between unicolored and bicolored (Vega ters, more molecular data will be needed to infer phylogenetic et al. 2015). relationships between them. Type specimens of the synonymized species examined in Among our 26 OTUs comprising a part of the H. eruditus this study were collected in Costa Rica, South America, complex, 19 include specimens from Panama or Costa Rica Hawaii, Spain, and various parts of Africa and Asia (see Table 7). Five of these OTUs also contain specimens from (Table 4). Considering the genetic and morphological diversi- South America, but no OTU is solely South American. Six ty found within a more limited geographic range of sampling OTUs include only African specimens, four OTUs include in this study, this alone gives reason to suspect cryptic or both African and Central American specimens, and one pseudo-cryptic diversity among these junior synonyms. OTU consists of one specimen from Tanzania and one from Inspection of six morphological characters indicated that there New Caledonia. The high number of cryptic and pseudo- are at least 14 different OTUs within this type material, further cryptic OTUs we discovered, despite rather limited geograph- strengthening our hypothesis that many of the junior syno- ical sampling, indicates that the global diversity of nyms of H. eruditus represent taxonomic mistakes. H. eruditus-like species is substantial. Specimens identified Considering the strong concordance between morphological as H. eruditus have been collected in tropical and subtropical characters and molecular markers in this study, we find it areas on all forest-clad continents (Wood 1982), and the type likely that the examined synonyms of H. eruditus comprise specimens of more than 40 of the species synonymized under at least 14, but likely many more, valid species. H. eruditus were collected in regions not sampled in this study (e.g., Spain, Georgia, mainland Australia, West Indies, and Closely related species various parts of Asia; Wood 2007). Within what is here considered the H. eruditus complex, four Diversity among junior synonyms morphs were labeled Bnear plumeriae.^ H. plumeriae,according to Wood (2007), is separated from H. eruditus only by Inspection of type material of 26 species synonymized under frons sculpture: plumeriae has a small, conspicuous tubercle H. eruditus revealed considerable morphological variation. above a definite, very small median impression, while 644 Kambestad M. et al.

H204 hampei 23 sp A H283africanus ** near, not sparsus 100 21a H205_c.f._areccae sp C 89 ** 25 * 85 ** 56 100 * 24 sp B 100 21b near, not sparsus

near eruditus ** 5 89 10c near plumeriae 7 near eruditus ** 94 6 eruditus * 82 near, not ascitus 100** 8 85 3 near eruditus 4 eruditus ** 83 eruditus 96 2

97 1 near eruditus

** 10a near plumeriae 100 ** 11 near plumeriae **93 69 88 9 near plumeriae 16b near eruditus ** 16a near eruditus ** 96 82

** near plumeriae 100 10b * 77 12 eruditus 15 near eruditus 62 14 near eruditus 10d near plumeriae ** 94 * 85 18 eruditus

61 10e near plumeriae *

10f near plumeriae

* 66 10g near plumeriae

17 near eruditus 20 teretis * 56 19 near plumeriae 0.02 Cryptic diversity in Hypothenemus eruditus 645

Fig. 8 Phylogenetic tree resulting from the minimum evolution analysis Table 6 Diagnostics of morphological characters estimated on the of the large ribosomal subunit (28S) sequences, using a GTR + I + G most parsimonious combined molecular data tree (33 OTUs, treating model. Bootstrap support values higher than 50 below nodes, posterior morphs 14 and 15 as separate clades). The two characters with best probabilities above. Numbering and coloring of clades as in Fig. 7. OTUs score are in italics. The same characters had best scores also when 13 and 22 not included due to suspected contamination. The tree is rooted optimized on the Bayesian tree topology with Cryphalus abietis, Ernoporus tiliae,andProcryphalus mucronatus as outgroups (not shown). Scale bar indicates nucleotide substitutions per Character Min Max Actual CI RI RCI site steps

1. Body color 1 5 5 0.20 0.00 0.00 2. Width of ventral scales 2 18 12 0.17 0.38 0.06 Table 5 Character states for the six morphological characters 3. Interstrial declivital 2 12 6 0.33 0.60 0.20 examined, for the OTUs sequenced in the present study. Morphology of vestiture the H. eruditus syntypes is also included, and the only OTU which 4. Marginal asperities 5 8 7 0.71 0.33 0.24 matches the eruditus syntypes is in italics. For illustrations of character states (indicated by numbers 1 through 6), see Figs. 2, 3, 4, 5,and6 5. Frons groove or carina 4 13 12 0.33 0.11 0.04 6. Frons impression 5 16 12 0.42 0.36 0.15 OTU Body Ventral Declivital Marginal Frons Frons color scales vestiture asperities groove/ impression carina eruditus lacks both features. None of the specimens in this 1113 1 53 study have what we would consider a Bconspicuous tubercle^ 2123 1 21 on the frons, but neither do two specimens collected by one of 3113 1 11 the authors, which were determined by Wood as H. plumeriae. 4132 1 53 The holotype of H. plumeriae was inspected during this study, 5122 1 21 but several important characters were hidden, precluding 6213 1 21 proper comparisons with the sequenced material. Two 7212 4 31 syntypes of Hypothenemus guadeloupensis Schedl 1951,a 8213 1 11 junior synonym of H. plumeriae, were also inspected, and 9232 1 5?4 based on differences in the shape of the impression on frons, 10a 2 3 1/2 1 5 2 we suggest that these are not the same species as H. plumeriae. 10b232 1 5 2 Importantly, the syntypes of H. eruditus have an impression 10c NA 3 1/2 1 5 2 on the frons which is very similar to the one described for 10d NA 3 2 1 5 2 H. plumeriae (and found in the H. plumeriae holotype), sug- 10e 2 3 1/2 1 2/5 1/2 gesting that other characters should be used to diagnose the 10f 2 1/2/3 1/2 1 5 2 two species if they are truly different. We note that the holo- 10 g 2 3 1/2 1 2/5 1/2 type of H. plumeriae is uniformly dark in color and thus prob- 11 2 3 2 1 5 3 ably not the same species as H. eruditus, but the two are 12 2 2/3 3 1 2 1 closely allied. Given the very slight difference between 13 NA 1 2 5 5 3 H. plumeriae and Hypothenemus parallelus (Wood 2007), 14 2 1/2 1/2 6 5 1/2 we also find it likely that the latter species is a member of this 15 2 1 2 5 5 1/2 complex. 16a 2 1/2/3 1/2 1 3 1/2 In light of the morphology of the inspected type ma- 16b NA NA NA 1 3 1/2 terial, it should be emphasized that the naming of OTUs 17 2 2 2 1 4 1 in this study was based on current circumscriptions, 18 2 2 1/2 1 1 1 which at least for H. eruditus are clearly inaccurate. B ^ 19 2 1/2 2/3 1 5 3 Furthermore, OTUs labeled near plumeriae in this 20 2 1 2 1 5 6 study were often hard to separate from OTUs identified B ^ 21a 2 2/3 1 3 5 2 as H. eruditus or near eruditus if only characters of 21b231 3/45 2 the frons were considered. This difficulty was due to a 22 2 1 1 3 5 2 gradual cline in variation between OTUs, from no im- 23 2 2/3 1 2 1 1 pression to an obvious impression on the frons. 24 2 1/2 3 1 5 1/2 However, some of these OTUs were readily distin- 25 2 2/3 NA 1 5? 5 guished by other characters. The specimen determined as H. teretis (OTU20) was relatively easily separated Syntypes 1 3 2 1 5 3 from all other specimens by a unique frons and lack NA not applicable of interstrial scales on the posterior half of the elytra. 646 Kambestad M. et al.

Table 7 Number of individuals in each OTU sequenced for COI OTU n n Geographic origin Identification Max within- Min D to other and 28S, with geographic origin COI 28S clade D (%) clades (%) and identification (based on published descriptions and keys) COI 28S COI 28S of its specimens. Maximum within-clade uncorrected se- 1 18 4 Pan, CR, Ecu Near H. eruditus 2.5 0.2 10.4 0.5 quence distance (D) and mini- 2 14 3 Pan, CR H. eruditus 3.8 0.2 10.2 0.5 mum distance to the genetically 322Pan NearH. eruditus 0.4 0.0 10.6 0.5 closest clade are given for each –– gene. OTUs 10, 16, and 21 are 411CR H. eruditus 10.2 0.8 split into cryptic OTUs according 5 2 1 Tanz Near, not H. eruditus 0.4 – 11.7 1.5 to Figs. 7 and 8 (see also Table 5). 6 19 3 Pan, CR H. eruditus 2.3 0.0 10.6 0.5 Specimens not assigned to an 7 2 1 CR Near H. eruditus 1.3 – 13.3 1.7 OTU (Her08CAT, Her38CAH, and Her73CNB: see Fig. 7)were 8 4 2 Pan, CR, Tanz, Mad Near, not H. ascitus 4.0 0.0 11.9 0.5 excluded from distance calcula- 944Pan,MadNearH. plumeriae 4.2 0.2 9.1 0.5 tions. Note that OTUs 21 through 10a 15 3 Pan, CR, Ecu, Cam Near H. plumeriae 7.4 0.0 10.8 0.5 25 are not considered part of the H. eruditus complex (see 10b 2 2 Tanz, NC Near H. plumeriae 4.8 0.0 13.0 1.4 BDiscussion^ section) 10c 1 1 Tanz Near H. plumeriae ––13.5 0.9 10d 1 1 SL Near H. plumeriae ––12.0 0.6 10e 12 5 Pan, CR Near H. plumeriae 5.9 0.0 10.0 0.3 10f 14 9 Tanz, Cam, SL, UG Near H. plumeriae 15.6 1.0 10.0 0.3 10g 29 10 Pan, CR, Col, Bra, Ecu Near H. plumeriae 14.2 1.1 10.0 0.5 11 11 2 Pan, CR Near H. plumeriae 0.3 0.0 9.1 0.5 12 9 4 Pan, CR H. eruditus 13.7 0.5 11.3 1.4 13 1 0 Tanz Near H. eruditus ––11.3 – 14+15a 5 4 Mad Near H. eruditus 14.5 2.2 10.9 1.3 16a 5 5 Pan, CR, Ecu Near H. eruditus 14.0 2.2 11.3 0.9 16b 1 1 Pan Near H. eruditus ––10.4 0.9 17 1 1 CR Near H. eruditus ––13.0 0.6 18 8 5 Pan, CR, Ecu, Tanz H. eruditus 15.9 0.3 10.6 0.6 19 15 8 Pan, CR Near H. plumeriae 7.1 0.6 10.0 0.5 20 0 1 Pan H. teretis –––0.5 Not H. eruditus 21a 2 2 Uga, Tanz Near, not H. sparsus 3.4 0.0 12.9 4.0 21b 7 5 Uga, Tanz Near, not H. sparsus 11.6 0.3 11.7 2.8 22 1 0 Tanz Near, not H. sparsus ––13.7 – 23 3 1 CR H. sp. 0.0 − 13.9 4.2 24 2 2 Pan H. sp. 0.0 0.0 13.4 7.8 25 1 1 Cam H. sp. ––12.6 4.1 Mean (cryptic OTUs not included)b 4.7 0.4 11.4 1.5 Mean (all OTUs included) 6.4 0.4 11.4 1.4

CR Costa Rica, Tanz Tanzania, Mad Madagascar, Cam Cameroon, NC New Caledonia, Ecu Ecuador, Pan Panama, SL Sierra Leone, Col Colombia, Bra Brazil, Uga Uganda a Morphs 14 and 15 are counted as a single pseudo-cryptic OTU b OTUs 10a–g, 16a–b, and 21a–b are here considered Bcryptic^; see text for details

It is thus somewhat surprising that molecular analyses Reasons for taxonomic confusion place this specimen within the H. eruditus complex. The same could be said about the OTU labeled Bnear, not The current circumscription of H. eruditus is based on tradi- ascitus^ (OTU8), in which the marginal asperities on tional, morphology-based taxonomy. Although data on geo- the pronotum of all specimens are much more widely graphic distribution, host plants, and ecology have also been separated than in any other OTU with the same number available, this has not been used in taxonomic decisions, and of marginal asperities. the species has therefore been regarded a cosmopolitan super- Cryptic diversity in Hypothenemus eruditus 647

Table 8 Possible matches between species synonymized with Hypothenemus eruditus and H. eruditus syntypes, other synonymized type material, or with morphs defined in this study. The condition of the type specimen(s) is indicated

Synonymized species Condition Matches H. eruditus syntypes? Other match Morph

Archeophalus ealaensis Moderate Possibly Several 4, 10, 11 Cryphalus aspericollis Moderate No: dark color; declivity too hairy; frons not impressed Several Several Cryphalus basjoo Good No: dark color Several 10 Cryphalus minutus Moderate No: dark color; different body shape Unique None Hypothenemus Good No: dark color; longitudinal carina on frons Unique 16 argentinensis Hypothenemus bicolor Moderate Possibly Several 4 Hypothenemus Good No: dark color; 4 marginal asperities H. parilis None cylindricus Hypothenemus Poor Possibly, but body longer and more slender C. basjoo, H. lezhavai Several cylindripennis Hypothenemus dubiosus Poor No: dark color; declivity too hairy Several Several Hypothenemus ehlersi Good No: dark color; declivity too hairy; frons not impressed C. aspericollis 17 rotroui Hypothenemus Moderate No: dark color; frons not impressed H. obscuriceps, 10 glabratellus H. tuberculosus Hypothenemus glabratus Moderate No: dark color; transverse carina on frons Unique None Hypothenemus insularis Poor No: dark color Several Several Hypothenemus lezhavai Moderate No: ventral scales narrow C. basjoo, 16, 10, H. cylindripennis 19 Hypothenemus Good No: dark color; prominent groove on frons H. insularis None mauiensis Hypothenemus mesoleius Good No: dark color; declivity too hairy; ventral scales narrow; prominent S. communis None groove on frons Hypothenemus minutulus Good No: dark color; 4 marginal asperities; frons not impressed Unique None Hypothenemus Good No: dark color C. basjoo, H. tuberculosus 10 obscuriceps Hypothenemus parilis Good No: dark color; prominent groove on frons H. cylindricus None Hypothenemus pusillus Moderate No: dark color; declivity too hairy Several Several Hypothenemus Moderate No: dark color Several 10 tuberculosus Hypothenemus vianai Good No: dark color; 2 marginal asperities; longitudinal carina in frons Unique None Stephanoderes communis Poor No: dark color; declivity too hairy Several 6, 12, 19 Stephanoderes ehlersi Good No: dark color; declivity too hairy; prominent groove on frons S. communis None Stephanoderes nanulus Good No: dark color; frons not impressed Unique None Stephanoderes tigrensis Good No: dark color; declivity too hairy; ventral scales too narrow; carina on Unique 14 frons

generalist (e.g., Wood 1982, 2007; Vega et al. 2015). The variability has thus been an important reason for the current same is essentially true for H. plumeriae, although Wood taxonomic confusion in this complex. (2007) considers this species to be rare. Seemingly continuous All bark beetles tunnel through plant tissues and spend only clines in morphological variation between and within series of short periods outside this concealed habitat. This represents a specimens led Wood to label several thousand specimens as major constraint on possible morphological diversification in H. eruditus throughout his career, although, to his credit, he Scolytinae, which in general display a high degree of homo- did point out that the patterns of slight morphological variabil- plasy in characters that commonly vary between taxa (Hulcr ity were difficult to interpret without molecular data (Wood et al. 2015). Furthermore, regular inbreeding (as in 1982, 2007). This challenge is exacerbated by the small size of Hypothenemus; see Kirkendall 1983, 1993) leads to relaxed the beetles in question and the difficulty in examining tiny selection on characters involved in mate recognition (Jordal characters such as frons sculpture, especially in old, poorly et al. 2002), which in bark beetles include most of the charac- mounted museum specimens. A general lack of knowledge ters used in separating closely related species, such as surface of the degree of intra- and interspecific morphological features and setation of the frons and declivity. It is thus 648 Kambestad M. et al. possible that rate of divergence in external morphology is very Our approach is thus best described as a form of genealogical slow among Hypothenemus lineages and reflects only weakly species concept (Baum and Shaw 1995). However, a more the rate of genetic divergence, as the latter is probably largely comprehensive library of DNA sequences from various in- driven by genetic drift. This is likely to cause substantial cryp- breeding scolytines is still needed to increase our understand- tic and pseudo-cryptic diversity, as documented here not only ing of rates of evolution at individual molecular markers and for H. eruditus but also for H. plumeriae.Highlevelsofho- thus also allow for more confident species delimitation in moplasy in morphological characters were indeed seen in the these species groups. current study, where any given character state may be found in numerous OTUs spread over trees constructed with molecular What, then, is Hypothenemus eruditus? data. For example, bicolored specimens are found only in OTUs 1 through 5, which together are clearly not monophy- Among the 26 cryptic and pseudo-cryptic OTUs treated here as letic, making this character diagnostic for individual OTUs members of the H. eruditus complex, only OTU4 is a morpho- within the species complex, but of little use for inferring rela- logical match with the H. eruditus syntypes we examined. This tionships on a higher taxonomic level. OTU, however, consists of only a single specimen, and a Ecological specialization between lineages could potential- BLAST search (Altschul et al. 1990) produced no similar se- ly speed up the rate of divergence in external morphology. The quences for COI (all ≤87% identity) or 28S (all ≤97% identity) oft-cited extraordinary host breadth of H. eruditus (Browne in online databases. Considering the extensive cryptic diversity 1961; Wood 1982;Vegaetal.2015) might in part be an arti- revealed among morphologically uniform clades in this study fact of being a complex of many cryptic and pseudo-cryptic (e.g., OTUs 10a–f), we cannot conclude that this specimen, or species differing in host preferences. However, different spe- any of the three H. eruditus synonyms that appear to match the cies (or OTUs) in this and other inbreeding species complexes syntypes, is in fact H. eruditus sensu stricto without further in Scolytinae appear to be ecologically very similar when genetic analyses. Sequencing of the H. eruditus syntypes was living in sympatry and often highly polyphagous (Jordal unsuccessful in this study, but recent advances in amplification et al. 2002;Kambestad2011;Andersenetal.2012). of short sequences from old type material (e.g., Hernández- Seventeen of the OTUs here considered members of the Triana et al. 2014; Mutanen et al. 2015) give hope that infor- Beruditus-complex^ include specimens collected from fallen mative sequence data could be recovered from the syntypes in leaf petioles of Cecropia in Panama or Costa Rica, and 15 of thefuture(seealsoSpiedeletal.2015; Prosser et al. 2016). the OTUs include specimens collected from host plants from Although the lack of molecular data from type material at least two different families (supplementary material currently limits proper identification of specimens belonging Table S1). Host plant data thus appears to be of limited taxo- to the H. eruditus complex, the concordance between morpho- nomic value in this group of beetles. logical and genetic data revealed by this study strongly sug- One a more theoretical note, it is not obvious how to define gests that morphological comparisons alone in most cases will a species within obligately inbreeding organisms such as bark be enough to determine that a specimen does not belong to beetles in the genus Hypothenemus. Their mating system H. eruditus sensu stricto. Accepting this prerequisite, we con- could be described as pseudo-clonal, at any given time pro- clude that 25 out of 26 sequenced OTUs and 23 out of 26 ducing numerous sympatric lineages with varying degrees of examined synonyms are not H. eruditus. Some of the se- genetic and morphological differentiation, with no or very quenced material almost certainly represents new species, little interbreeding between lineages (see Kirkendall 1983; and many of the synonyms should clearly be resurrected. Andersen et al. 2012; Gohli et al. 2016). If outbreeding is rare, each such pseudo-clonal line might be considered an OTU, for which the applicability of the biological species concept (i.e., Conclusions reproductive isolation defining species) will be questionable at best due to a conflict between actual and potential gene flow The substantial cryptic and pseudo-cryptic diversity we un- (see Petersen and Hughes 1999;Tayloretal.2000 and covered underscores the need for a comprehensive taxonomic references therein). The phylogenetic species concept (i.e., revision of the H. eruditus species complex. Considering the shared ancestry and a unique set of characters defining spe- modest number of individuals sequenced for both genes and cies) thus seems more appropriate for such organisms, though the incomplete geographic sampling of our study, the global a strict interpretation of this concept could quickly lead to diversity within the group must be considerably larger than rampant over-splitting, with very shallow nodes in phyloge- demonstrated here. Initial analyses of DNA sequence data netic trees representing the diversification of large numbers of from other Hypothenemus species indicate that (among recently diverged species. This problem can be overcome by others) Hypothenemus africanus (Hopkins, 1915), analyzing several molecular markers and morphology in con- Hypothenemus brunneus (Hopkins, 1915), and cert, as done in the present study (see also Gohli et al. 2016). Hypothenemus obscurus (Fabricius 1801) may also be species Cryptic diversity in Hypothenemus eruditus 649 complexes (B. H. Jordal, unpublished data): clearly, a major References revision of Hypothenemus is needed, one which integrates morphological and molecular characters. Such an effort Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. would provide the means to properly identify and study (1990). Basic local alignment search tool. Journal of Molecular – actual or potential pest species, as well as offering crucial Biology, 215(3), 403 410. Andersen, H. F., Jordal, B. H., Kambestad, M., & Kirkendall, L. R. insight into the diversity and evolution of a major group of (2012). Improbable but true: the invasive inbreeding ambrosia beetle regularly inbreeding animals. However, Wood and Bright Xylosandrus morigerus has generalist genotypes. Ecology and (1992)list179Hypothenemus species worldwide, and with Evolution, 2(1), 247–257. the potential for encountering many species complexes, the Avtzis, D. N., Arthofer, W., & Stauffer, C. (2008). Sympatric occurrence of diverged mtDNA lineages of Pityogenes chalcographus prospect of revising the genus is daunting. (Coleoptera, Scolytinae) in Europe. Biological Journal of the As for H. eruditus, the obvious next step would be to rein- Linnean Society, 94(2), 331–340. state names that were incorrectly synonymized. We have here Bañón, R., Arronte, J. C., Vázquez-Dorado, S., Del Río, J. L., & de provided a set of morphological characters that now makes Carlos, A. (2013). DNA barcoding of the genus Lepidion this task possible. However, such taxonomic acts must be (Gadiformes: Moridae) with recognition of Lepidion eques as a junior synonym of Lepidion lepidion. Molecular Ecology Resources, based on examination of all type material of the 71 synony- 13(2), 189–199. mies to assure one follows the rules of taxonomic priority. Baum, D. A., & Shaw, K. L. (1995). Genealogical perspectives on the Some type specimens are in poor condition (including several species problem. Monographs in Systematic Botany from the – of the ones examined in this study), and holotypes or syntypes Missouri Botanical Garden, 53,289 303. Beaver, R. A. (1979). Non-equilibrium Bisland^ communities. A guild of for six synonyms are listed as lost or not located (Wood 2007). tropical bark beetles. Journal of Animal Ecology, 48,987–1002. Furthermore, even if all type specimens for H. eruditus syno- Blair, C. P., Abrahamson, W. G., Jackman, J. A., & Tyrrell, L. (2005). nyms were accessed, the results of the current study suggest Cryptic speciation and host-race formation in a purportedly gener- that morphological comparison alone in some cases will fail to alist tumbling flower beetle. Evolution, 59,304–316. separate deeply diverged lineages within this complex, neces- Blakemore, R., Kupriyanova, E., & Grygier, M. (2010). Neotypification of Drawida hattamimizu Hatai, 1930 (Annelida, Oligochaeta, sitating molecular data from numerous type specimens to sup- Megadrili, Moniligastridae) as a model linking mtDNA (COI) se- plement morphological observations. This taxonomic stale- quences to an earthworm type, with a response to the ‘Can of mate would seem to preclude description of new species Worms’ theory of cryptic species. ZooKeys, 41,1–29. among other collections of H. eruditus-like specimens (such Blandford, W. F. H. (1894). IV. The Rhynchophorous Coleoptera of – as the OTUs treated in the current study), as these would also Japan. Part III. Scolytidae. Trans. Ent. Soc. London, 1894,53 141. Bright, D. E., & Peck, S. B. (1998). Scolytidae from the Galápagos have to be compared to type material of all species erroneous- Islands, Ecuador, with descriptions of four new species, new distri- ly synonymized under that name. Including more morpholog- bution records, and a key to species (Coleoptera: Scolytidae). ical characters in analyses may increase resolution, but we Koleopterologishe Rundschau, 68,233–252. suspect that molecular data will continue to be vital in the Bright, D. E., & Skidmore, R. E. (1997). A catalog of Scolytidae and Platypodidae (Coleoptera), supplement 1 (1990–1994). Ottawa: discovery and classification of diversity in the complex. In NRCResearchPress. cases where lack of molecular or morphological data con- Bright, D. E., & Skidmore, R. E. (2002). A catalog of Scolytidae and strains the ability to perform vital taxonomic acts, we suggest Platypodidae (Coleoptera), supplement 2 (1995–1999). Ottawa: that those junior synonyms that can be properly analyzed are NRCResearchPress. given precedence over senior synonyms for which necessary Brower, A. V. Z. (2010). Alleviating the taxonomic impediment of DNA barcoding and setting a bad precedent: names for ten species of data proves unobtainable by current methods. As pointed out ‘Astraptes fulgerator’ (Lepidoptera: Hesperiidae: Eudaminae) with by Brower (2010), this approach could result in description of DNA-based diagnoses. Systematics and Biodiversity, 8(4), 485–491. species that are later determined to be junior synonyms, but Browne, F. G. (1961). The biology of Malayan Scolytidae and this is surely preferable to an indefinite taxonomic gridlock. Platypodidae. Malayan Forest Records, 22,1–255. Cai, Y.-W., Cheng, X.-Y., Xu, R.-M., Duan, D.-H., & Kirkendall, L. R. (2008). Genetic diversity and biogeography of red turpentine beetle Acknowledgements This research was funded by grants 214232/F20 Dendroctonus valens in its native and invasive regions. Insect Sci., and 170565/V40 from the Research Council of Norway, a grant from the 15(4), 291–301. Meltzer Research Fund to BHJ (2009), and a student grant from the Castillo, A., Infante, F., López, G., Trujillo, J., Kirkendall, L. R., & Vega, Meltzer Research Fund to MK (2010). We thank Kamilla Kambestad F. E. (2004). Laboratory parasitism by Phymastichus coffea for drawings of morphological characters, and curators at the natural (Hymenoptera: Eulophidae) upon non-target bark beetles associated history museums in Vienna, Oxford, London, and Paris for organizing with coffee plantations. Florida Entomologist, 87(3), 274–277. specimen loans. Two anonymous reviewers provided valuable comments Cognato, A. I., & Sperling, F. A. H. (2000). Phylogeny of Ips DeGeer on an earlier draft of this article. species (Coleoptera: Scolytidae) inferred from mitochondrial cyto- chrome oxidase I DNA sequence. Molecular Phylogenetics and Compliance with ethical standards Evolution, 14(3), 445–460. Cognato, A. I., & Sun, J. H. (2007). DNA based cladograms augment the Conflict of interest The authors declare that they have no conflict of discovery of a new Ips species from China (Coleoptera: interest. Curculionidae: Scolytinae). Cladistics, 23(6), 539–551. 650 Kambestad M. et al.

Cognato, A. I., Seybold, S. J., & Sperling, F. A. H. (1999). Incomplete Halperin, J., & Holzschuh, C. (1984). Contribution to the knowledge of barriers to mitochondrial gene flow between pheromone races of the bark beetles (Coleoptera: Scolytidae) and associated organisms in NorthAmericanpineengraver,Ips pini (Say) (Coleoptera, Israel. Israel Journal of Entomology, 18,21–37. Scolytidae). Proceedings of the Royal Society of London Series B- Hebert, P. D., Cywinska, A., Ball, S. L., & deWaard, J. R. (2003). Biological Sciences, 266(1431), 1843–1850. Biological identifications through DNA barcodes. Proceedings of Cognato, A. I., Harlin, A. D., & Fisher, M. L. (2003). Genetic structure the Royal Society of London Series B-Biological Sciences, among pinyon pine beetle populations (Scolytinae: Ips confusus). 270(1512), 313–321. Environmental Entomology, 32(5), 1262–1270. Hebert, P. D. N., Penton, E. H., Burns, J. M., Janzen, D. H., & Hallwachs, Cognato, A. I., Barc, N., Philip, M., Mech, R., Smith, A. D., Galbraith, E., W. (2004). Ten species in one: DNA barcoding reveals cryptic spe- Storer, A. J., & Kirkendall, L. R. (2010). The native and introduced cies in the neotropical skipper butterfly Astraptes fulgerator. bark and ambrosia beetles of Michigan (Curculionidae: Scolytinae). Proceedings of the National Academy of Sciences of the United Great Lakes Entomologist, 42(3–4), 101–120. States of America, 101, 14812–14817. De Abrau, R. L. S., de Aráujo Ribeiro, G., Vianez, B. F., & Sales- Hernández-Triana, L. M., Prosser, S. W., Rodríguez-Perez, M. A., Campos, C. (2012). Insects of the subfamily Scolytinae (Insecta: Chaverri, L. G., Hebert, P. D. N., & Ryan Gregory, T. (2014). Coleoptera, Curculionidae) collected with pitfall and ethanol traps Recovery of DNA barcodes from blackfly museum specimens in primary forests of Central Amazonia. Psyche.doi:10.1155/2012/ (Diptera: Simuliidae) using primer sets that target a variety of se- 480520. quence lengths. Molecular Ecology Resources, 14(3), 508–518. Dole,S.A.,Jordal,B.H.,&Cognato,A.I.(2010).Polyphylyof Hopkins, A. D. (1915). Classification of the Cryphalinae, with descrip- Xylosandrus Reitter inferred from nuclear and mitochondrial genes tions of new genera and species. United States Department of (Coleoptera: Curculionidae: Scolytinae). Molecular Phylogenetics Agriculture Report, 99,1–75. and Evolution, 54(3), 773–782. Hulcr, J., Atkinson, T. H., Cognato, A. I., Jordal, B. H., & McKenna, D. Dowton, M., & Austin, A. D. (1998). Phylogenetic relationships among D. (2015). Morphology, taxonomy, and phylogenetics of bark bee- the microgastroid wasps (Hymenoptera: Braconidae): combined tles. In F. E. Vega & R. W. Hofstetter (Eds.), Bark beetles. Biology analysis of 16S and 28S rDNA genes and morphological data. and ecology of native and invasive species (pp. 41–84). USA: Molecular Phylogenetics and Evolution, 10,354–366. Academic Press. Duan, Y., Kerdelhue, C., Ye, H., & Lieutier, F. (2004). Genetic study of Jordal, B. H., & Hewitt, G. M. (2004). The origin and radiation of the forest pest Tomicus piniperda (Col., Scolytinae) in Yunnan prov- Macaronesian beetles breeding in Euphorbia: the relative impor- ince (China) compared to Europe: new insights for the systematics tanceofmultipledatapartitions and population sampling. and evolution of the genus Tomicus. Heredity, 93(5), 416–422. Systematic Biology, 53(5), 711–734. Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high Jordal, B. H., & Kambestad, M. (2014). DNA barcoding of bark and accuracy and high throughput. Nucleic Acids Research, 32(5), ambrosia beetles reveals excessive NUMTs and consistent east- 1792–1797. west divergence across Palearctic forests. Molecular Ecology Eggers, H. (1944). Neue Borkenkäfer (Col., Scolytidae) aus Afrika. Rev. Resources, 14(1), 7–17. Zool. Bot. Afr., 38,92–98. Jordal, B. H., & Kirkendall, L. R. (1998). Ecological relationships of a Eichhoff, W. J. (1878). Ratio, descripto, emendatio eorum Tomicinorum guild of tropical beetles breeding in Cecropia petioles in Costa Rica. qui sunt in Dr. Medin. Chapuisi et authoris ipsius collectionibus et JournalofTropicalEcology,14,153–176. quous praeterea recognovit. Societe Entomologique de Liege, Jordal, B. H., Normark, B. B., Farrell, B. D., & Kirkendall, L. R. (2002). Memoires, 2(8), 1–531. Extraordinary haplotype diversity in haplodiploid inbreeders: phy- Fabricius, J. C. (1801). Systema eleutheratorum, secundum ordines, gen- logenetics and evolution of the bark beetle genus Coccotrypes. era, species, adjectis synonymis, locis observationibut, Molecular Phylogenetics and Evolution, 23(2), 171–188. descriptionibus. Kiliae, Bibliopol. Acad, 1-2,368–378–395. Jordal, B. H., Kirkendall, L. R., & Harkestad, K. (2004). Phylogeny of a Ferrari, J. A. (1867). Die Forst- und Baumzuchtschädlichen Borkenkäfer Macaronesian radiation: host-plant use and possible cryptic specia- (Tomicides Lac.) aus der Familie der Holzverderber (Scolytides tion in Liparthrum bark beetles. Molecular Phylogenetics and Lac.), mit besonderer Berücksichtigung vorzüglich der Evolution, 31(2), 554–571. europäischen Formen, und der Sammulung des. k. k. zoologischen Kambestad, M. (2011). Coexistence of habitat generalists in Neotropical Kabinetes in Wien. Wien, Austria. petiole-breeding bark beetles: molecular evidence reveals cryptic Flechtmann, C. A. H., Ottati, A. L. T., & Berisford, C. W. (2001). diversity, but no niche segregation. MSc thesis: University of Ambrosia and bark beetles (Scolytidae: Coleoptera) in pine and Bergen, Bergen, Norway. eucalypt stands in southern Brazil. Forest Ecology and Kamnerdratana, P. Y.(1987). The economically significant insect pests of Management, 142,183–191. trees and timber in Thailand. In E. D. Guzman & S. T. Nuhamara Gauthier, N. (2010). Multiple cryptic genetic units in Hypothenemus (Eds.), Forest pests and diseases in Southeast Asia.Bogor:Biotrop hampei (Coleoptera: Scolytinae): evidence from microsatellite and Special Publication No. 26. mitochondrial DNA sequence data. Biological Journal of the Kangkamanee, T., Sittichaya, W., Ngampongsai, A., Permkam, S., & Linnean Society, 101,113–129. Beaver, R. (2011). Wood-boring beetles (Coleoptera: Bostrichidae, Gohli, J., Selvarajah, T., Kirkendall, L. R., & Jordal, B. H. (2016). Curculionidae; Platypodinae and Scolytinae) infesting rubberwood Globally distributed Xyleborus species reveal recurrent interconti- sawn timber in southern Thailand. Journal of Forest Research, nental dispersal in a landscape of ancient worldwide distributions. 16(4), 302–308. BMC Evolutionary Biology.doi:10.1186/s12862-016-0610-7. Kerdelhué, C., Roux-Morabito, G., Forichon, J., Chambon, J.-M., Gray, B. (1974). Observations on insect flight in a tropical forest planta- Robert, A., & Lieutier, F. (2002). Population genetic structure of tion. Zeitschrift für Angewandte Entomologie, 75(1–4), 178–186. Tomicus piniperda L. (Curculionidae: Scolytinae) on different pine Hagedorn, J. M. (1912). Borkenkäfer (Ipidae) Welche in species and validation of T. destruens (Woll.) Molecular Ecology, Kautschukbäumen leben. Review Zoologique Africaine, 1(3), 336– 11(3), 483–494. 346. Kirkendall, L. R. (1983). The evolution of mating systems in bark and Halperin, J. (1990). Arthropod fauna and main insect pests of plane trees ambrosia beetles (Coleoptera, Scolytidae and Platypodidae). in Israel. Phytoparasitica, 18(4), 309–319. Zoological Journal of the Linnean Society, 77,293–352. Cryptic diversity in Hypothenemus eruditus 651

Kirkendall, L. R. (1993). Ecology and evolution of biased sex ratios in Romón, P., Troya, M., Fernández de Gamarra, M. E., Eguzkitza, A., bark and ambrosia beetles. In D. L. Wrensch & M. A. Ebbert (Eds.), Iturrondobeitia, J. C., & Goldarazena, A. (2008). Fungal communi- Evolution and diversity of sex ratio in insects and mites (pp. 234– ties associated with pitch canker disease of Pinus radiata caused by 345). New York: Chapman & Hall. Fusarium circinatum in northern Spain: association with insects and Kirkendall, L. R., & Faccoli, M. (2010). Bark beetles and pinhole borers pathogen-saprophyte antagonistic interactions. Canadian Journal of (Curculionidae, Scolytinae, Platypodinae) alien to Europe. ZooKeys, Plant Pathology, 30(2), 241–253. 56,227–251. Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D. L., Darling, A., Knutsen, I. L. (2008). Investigating the Hypothenemus eruditus H hna, S., Larget, B., Liu, L., Suchard, M. A., & Huelsenbeck, J. P. Westwood species complex (Coleoptera: Curculionidae: (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and Scolytinae) in Costa Rica using DNA barcoding (CO1 and EF-1a), model choice across a large model space. Systematic Biology, 61(3), morphology and host usage and geographical distribution. MSc the- 539–542. sis, University of Bergen, Bergen, Norway. Saez, A. G., & Lozano, E. (2005). Body doubles. Nature, 433, 111–111. Kohlmayr, B., Riegler, M., Wegensteiner, R., & Stauffer, C. (2002). Schedl, K. E. (1939). Scolytidae und Platypodidae. 47 Beitrag. Tijdschrift Morphological and genetic identification of the three pine pests of voor Entomologie, 82,30–53. the genus Tomicus (Coleoptera, Scolytidae) in Europe. Agricultural Schedl, K. E. (1951). Neotropische Scolytidae IV. 112 Beitrag. Dusenia, and Forest Entomology, 4(2), 151–157. 2(2), 71–130. Kvist, S. (2013). Barcoding in the dark?: a critical view of the sufficiency Schedl, K. E. (1957). Scolytoidea nouveaux du Congo Belge, II. Mission of zoological DNA barcoding databases and a plea for broader inte- R. Mayne-K.E. Schedl 1952. Annales du Musee Royale du Congo gration of taxonomic knowledge. Molecular Phylogenetics and Belge Tervuren (Belgique), Ser. 8, Sciences Zoologiques, 56, 1– Evolution, 69(1), 39–45. 162. Kvist, S., Oceguera-Figueroa, A., Siddall, M. E., & Erséus, C. (2010). Schedl, K. E. (1958). Fauna Argentinensis, VII. 136 Beitrag. Acta Barcoding, types and the Hirudo files: using information content to Zoologica Lilloana, 16,33–46. critically evaluate the identity of DNA barcodes. Mitochondrial Schedl, K. E. (1959). A check list of the Scolytidae and Platypodidae DNA, 21(6), 198–205. (Coleoptera) of Ceylon with descriptions of new species and biolog- LeConte, J. L. (1860). Report upon insects collected on the survey. ical notes. Transactions of the Royal Entomological Society of Reports of explorations and surveys for a railroad route from the London, 111(15), 469–516. Mississippi River to the Pacific Ocean 9(1), 1–72. Schedl, K. E. (1978). Neotropische Scolytoidea, XIV (Coleoptera). 335 Mitchell, A., & Maddox, C. (2010). Bark beetles (Coleoptera: Beitrag. Entomologische Abhandlungen Staatliches Museum fur Curculionidae: Scolytinae) of importance to the Australian Tierkunde in Dresden, 41(8), 291–309. macadamia industry: an integrative taxonomic approach to species Schlick-Steiner, B. C., Steiner, F. M., Seifert, B., Stauffer, C., Christian, diagnostics. Australian Journal of Entomology, 49,104–113. E., & Crozier, R. H. (2010). Integrative taxonomy: a multisource Mutanen, M., Kekkonen, M., Prosser, S. W. J., Hebert, P. D. N., & Kaila, approach to exploring biodiversity. Annual Review of Entomology, L. (2015). One species in eight: DNA barcodes from type specimens 55,421 –438. resolve a taxonomic quagmire. Molecular Ecology Resources, Sequeira, A. S., Normark, B. B., & Farrell, B. D. (2000). Evolutionary 15(4), 967–984. assembly of the conifer fauna: distinguishing ancient from recent Nordlinger, H. (1856). Nachtrage zur Ratzeburg’s Forstinsekten. associations in bark beetles. Proceedings of the Royal Society of Stuttgart: Germany. London Series B-Biological Sciences, 267,2359–2366. Normark, B. B., Jordal, B. H., & Farrell, B. D. (1999). Origin of a Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., & Flook, P. haplodiploid beetle lineage. Proceedings of the Royal Society of (1994). Evolution, weighting, and phylogenetic utility of mitochon- London Series B-Biological Sciences, 266,2253–2259. drial gene sequences and a compilation of conserved polymerase Nylander,J.A.A.(2004).Mr Model test. Version 2. Uppsala University: chain reaction primers. Annals of the Entomological Society of Evolutionary Biology Centre. America, 87,651–701. Peck, S. B. (2006). The beetle fauna of Dominica, Lesser Antilles Smith, M. A., Rodriguez, J. J., Whitfield, J. B., Deans, A. R., Janzen, D. (Insecta: Coleoptera): diversity and distribution. Insecta Mundi, H., Hallwachs, W., & Hebert, P. D. N. (2008). Extreme diversity of 20(3–4), 165–209. tropical parasitoid wasps exposed by iterative integration of natural Petersen, R. H., & Hughes, K. W. (1999). Species and speciation in history, DNA barcoding, morphology, and collections. Proceedings mushrooms: development of a species concept poses difficulties. of the National Academy of Sciences, 105, 12359–12364. Bioscience, 49(6), 440–452. Spiedel, W., Hausmann, A., Muller, G. C., Kravchenko, V., Mooser, J., Pjatnitskii, G. K. (1929). Hypothenemus lezhavai n. sp. Lezhava Izd. Witt, T. J., Khallaayoune, K., Prosser, S., & Hebert, P. D. N. (2015). Narod. Kom. Zem. Gruzii, 1929,1–15. Taxonomy 2.0: sequencing of old type specimens supports the de- Prosser, S. W. J., deWaard, J. R., Miller, S. E., & Hebert, P. D. N. (2016). scription of two new species of the Lasiocampa decolorata group DNA barcodes from century-old type specimens using next- from Morocco (Lepidoptera, Lasiocampidae). Zootaxa, 3999(3), generation sequencing. Molecular Ecology Resources, 16(2), 487– 401–412. 497. Stone, C., Goodyer, G., Sims, K., Penman, T., & Carnegie, A. (2010). Puillandre, N., Macpherson, E., Lambourdière, J., Cruaud, C., Boisselier- Beetle assemblages captured using static panel traps within New Dubayle, M.-C., & Samadi, S. (2011). Barcoding type specimens South Wales pine plantations. Australian Journal of Entomology, helps to identify synonyms and an unnamed new species in 49,304–316. Eumunida Smith, 1883 (Decapoda: Eumunididae). Invertebrate Swofford, D. L. (2002). PAUP*. Phylogenetic analysis using parsimony Systematics, 25(4), 322–333. (*and other methods). Version 4. Sunderland: Sinauer Associates. Rambaut, A., Suchard, M. A., Xie, D., & Drummond, A. J. (2014). Tracer Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). v1.6. Available from http://beast.bio.ed.ac.uk/Tracer. MEGA6: moleular evolutionary genetics analyses version 6.0. Romón, P., Zhou, X., Iturrondobeitia, J. C., Wingfield, M. J., & Molecular Biology and Evolution, 30,2725–2729. Goldarazena, A. (2007). Ophiostoma species (Ascomycetes: Taylor, J. W., Jacobson, D. J., Kroken, S., Kasuga, T., Geiser, D. M., Ophiostomatales) associated with bark beetles (Coleoptera: Hibbett, D. S., & Fisher, M. C. (2000). Phylogenetic species recog- Scolytinae) colonizing Pinus radiata in northern Spain. Canadian nition and species concepts in fungi. Fungal Genetics and Biology, JournalofMicrobiology,53(6), 756–767. 31(1), 21–32. 652 Kambestad M. et al.

Vázquez, L. L., Tur, N., & Monteagudo, S. (1993). Insects of the family Wood, S. L. (1972). New synonymy in the bark beetle tribe Cryphalini Scolytidae (Coleoptera) which attack coffee in Cuba. Revista de (Coleoptera: Scolytidae). Great Basin Naturalist, 32(1), 40–54. Proteccíon Vegetal, 8(1), 27–30. Wood, S. L. (1974). New synonymy and records of American bark bee- Vega, F. E., Davis, A. P.,& Jaramillo, J. (2012). From forest to plantation? tles (Coleoptera: Scolytidae). Great Basin Naturalist, 34(4), 277– Obscure articles reveal alternative host plants for the coffee berry 290. borer, Hypothenemus hampei (Coleoptera: Curculionidae). Wood, S. L. (1977a). Introduced and exported American Scolytidae Biological Journal of the Linnean Society, 107(1), 86–94. (Coleoptera). Great Basin Naturalist, 37(1), 67–74. Vega, F. E., Infante, F., & Johnson, A. J. (2015). The genus Wood, S. L. (1982). The bark and ambrosia beetles of North and Central Hypothenemus, with emphasis on H. hampei, the coffee berry borer. America (Coleoptera: Scolytidae), a taxonomic monograph. Great In F. E. Vega & R. W. Hofstetter (Eds.), Bark beetles. Biology and Basin Naturalist Memoirs, 6,1–1359. – ecology of native and invasive species (pp. 427 494). USA: Wood, S. L. (1989). Nomenclatural changes and new species of Academic Press. Scolytidae (Coleoptera), part IV. Great Basin Naturalist, 49(2), Wandeler, P., Hoeck, P. E. A., & Keller, L. F. (2007). Back to the future: 167–185. museum specimens in population genetics. Trends in Ecology & Wood, S. L. (1992). Nomenclatural changes in Scolytidae and Evolution, 22(12), 634–642. Platypodidae (Coleoptera). Great Basin Naturalist, 52(1), 89.–92 Westwood, J. O. (1836). Description of a minute Coleopterous insect, forming the type of a new subgenus allied to Tomicus,withsome Wood, S. L. (2007). Bark and ambrosia beetles of South America observations upon the affinities of the Xylophaga. Transactions of (Coleoptera, Scolytidae). Provo: Monte L. Bean Life Science the Entomological Society of London, 1,34–36. Museum, Brigham Young University. Wood, S. L. (1954). A revision of North American Cryphalini Wood, S. L., & Bright, D. E. (1987). A catalog of Scolytidae and (Scolytidae, Coleoptera). University of Kansas Science Bulletin, Platypodidae (Coleoptera), part 1: bibliography. Great Basin – 36,959–1089. Naturalist Memoirs, 11,1 696. Wood, S. L. (1960). Insects of Micronesia, Coleoptera: Platypodidae and Wood, S. L., & Bright, D. E. (1992). A catalog of Scolytidae and Scolytidae. Insects of Micronesia, 18,1–73. Platypodidae (Coleoptera), part 2: taxonomic index volume A. Wood, S. L. (1971). New records and species of neotropical bark beetles Great Basin Naturalist Memoirs, 13,1–833. (Scolytidae: Coleoptera). Brigham Young University science bulletin. Biological series, 15(3), 1–54.