Ipht Institut De Physique Théorique De Saclay Evaluation by the AERES

IPhT Institut de Physique Théorique de Saclay

Evaluation by the AERES committee (2013-2014)

Activity Report January 2008 – June 2013

Commissariat à l’énergie atomique Centre national de la recherche scientiﬁque et aux énergies alternatives Institut de physique Direction des sciences de la matière CNRS / INP / URA 2306 CEA / DSM / IPhT

CEA Saclay, 91191 Gif-sur-Yvette, France http://ipht.cea.fr/ - Tel: +33 (0)1 69 08 73 85 2 Activity Report CEA/DSM/IPhT 2008 — 2013 Contents

1 Presentation of the Institute 5 1.1 Activity overview ...... 5 1.2 Three main “themes” ...... 6 1.3 A few publication statistics ...... 6 1.4 Interaction with society at large ...... 6 1.5 Scientiﬁc snapshot ...... 7 1.6 Organization of the Institute ...... 8 1.7 Understanding the past, preparing for the future ...... 10 1.8 External fundings ...... 11 1.9 Coding ...... 13 1.10 Teaching and its asides ...... 13 1.11 More on Visibility ...... 14 1.12 Challenges for the future ...... 16 1.13 A resume of Strategy and Project ...... 17

2 Scientiﬁc production 23 Mathematical physics - structures and models ...... 24 Cosmology and particle physics ...... 37 Statistical and condensed matter physics ...... 49

A Appendices 59 A.1 Executive Summary ...... 60 A.2 Functional organization of the Institute ...... 62 A.3 Prizes ...... 63 A.4 External Fundings and grants ...... 64 A.5 Organization of scientiﬁc events ...... 72 A.6 Publications, 1/1/2008–30/06/2013 ...... 77 A.7 PhDs at IPhT ...... 137 A.8 Teaching activities ...... 142 A.9 Popularizing Science ...... 150 A.10 Scientiﬁc editing ...... 152 A.11 Research administration ...... 153 A.12 List of IPhT members ...... 155

3 4 Activity Report CEA/DSM/IPhT 2008 — 2013 CHAPTER 1

Presentation of the Institute

The Institut de physique théorique (IPhT) is an institute of the Direction des sciences de la matière (DSM) of the Commissariat à l’énergie atomique et aux énergies alternatives (CEA), and a laboratory of Institut national de physique (INP) at the Centre national de la recherche scientifique (CNRS, Unité de recherche associée URA2306). It is part of the Centre de recherches de Saclay, on the Plateau de Saclay. Over the years, the IPhT has gained a worldwide recognition for its many fundamental contributions to theoretical physics. A long tradition of impartial scientific evaluations has helped the Institute to adapt to the many evolutions of theoretical physics from a purely scientific viewpoint, but also to many changes in the management of science, in France and abroad. This report presents an overview of the organization and activities of the IPhT from January 2008 to June 2013.

1.1 Activity overview Our main activity is fundamental research in theoretical physics, resulting in the production of articles in peer-reviewed journals, as well as communications in international conferences or workshops, or in various seminars. We also take part in the organization of such events. Globally this activity may accounts for 80% of our time. We also dedicate a consequent amount of time to the formation of students, mostly at the graduate level (master students or PhD). Many permanent members regularly teach in Master courses, at IPhT, in the Paris area but also farther in France or abroad. We also organize or teach in numerous summer schools. The number of graduate students present in the institute has grown rapidly in the last few years, it almost reaches 30, to which should be added about 10 external PhDs spending a long period in our Institute. Roughly 15% of our work time can be associated with this formation activity. Research administration and animation may account to about 5% of our work time. It mainly consists in participation in various committees: hiring committees at universities, CNRS committee, steering committees of various research structures (Labex, RTRA, academic senate of the new Paris-Saclay University). Our actions towards society at large are relatively few, and account for a negligible part of our work time. The general focus of this detailed introduction is on qualitative trends rather than on quantitative data, but precise statistics are collected in the appendices of the report. These appendices cover also a number of facets of the IPhT: awards, teaching, external fundings,

5 6 Activity Report CEA/DSM/IPhT 2008 — 2013 scientific editing, research administration, organization. My deputies, Anne Capdepon and Stéphane Nonnenmacher, dedicated a lot of time to those. The writing of the scientific part involved a large fraction of the permanents. Special credits for hard work go to the members of the internal scientific council.

1.2 Three main “themes” Over the five and a half years period covered by the report, above one thousand articles, proceedings or books have been published by IPhT members (permanent researchers, PhDs and PostDocs, long term visitors). This large number makes it illusory to include, in a readable and useful report, a complete list of even cursory descriptions. Instead, in Chap. 2 below we illustrate the salient features of our work via three topical surveys, and a selection of about twenty highlights. The surveys: – Models and Structures: Mathematical Physics – Cosmology and Particle Physics – Statistical Physics, Condensed Matter and Biophysics reflect the three main research directions, as well as a formal organization (more on this later) of the Institute, but definitely not a clear-cut division of the people into “teams” working separately from each other. The contributions of many researchers are split between at least two of the three surveys. These surveys, as well as the following highlights, are meant to be gentle general introductions, and we hope that they will trigger the reader’s curiosity to have a closer look at some of the publications.

1.3 A few publication statistics Most of our production consists in publishing articles in peer-reviewed journals, the rest consisting in advanced scientiﬁc softwares, some of them publicly available (see section 1.9). A full list of our publications, with various statistics appear in App. A.6.

Year 2008 2009 2010 2011 2012 June 30, 2013 Total # publications 186 191 186 246 215 86 1100 av. citation # 19.5 15.2 10.4 6.6 2.1 % art. in top 10% 32 28 28 32 34 31 (av.) % art. in top 1% 3.2 4.2 3.8 3.7 5.6 4 (av.)

Table 1: A few data on our publications (after ISI Web of Science)

A significantly high proportion of the IPhT articles made its way to the top 10% or top 1% most cited in Physics over the period 2008-2012. Some papers have had the honor of the front-cover of good journals or have been awarded prizes (see App. A.6). The highlights we propose in Chap. 2 are not meant to reflect these successes. They illustrate some significant projects or scientific trends over the period under review. Though we have chosen those carefully, we are well aware that only the future will tell which ideas and contributions will survive in the long term.

1.4 Interaction with society at large Our interaction with society at large can be considered as relatively minor, the content of our research activities being rather abstract, with no immediate application to everyday Introduction 7 life or to marketable innovations. Still, fundamental science continues to fascinate the general public. Some of our members have given interviews in newspapers or popular science journals, or have written articles in such journals. A few members present their professional activity (as scientists) in high schools, or in general audience conferences. Others have participated in radio programs; this has been the case in particular at the occasion of widely advertised scientiﬁc events (e.g. the recent discovery of a Higgs-like boson, or the cosmological data obtained from the Planck satellite mission). Some detailed actions are listed in App. A.9.

1.5 Scientiﬁc snapshot

The basic goal of IPhT is to contribute to a better understanding of the laws of nature, from the largest scales to the smallest ones. This goal can take a variety of incarnations, depending on the ﬁeld of research and the personality of the researcher. But IPhT can claim to harbor at least one respected specialist in any major physics ﬁeld of current interest, with a handful of exceptions though.

IPhT disposes of several task forces of leading experts. One example is the field of precision perturbative quantum gauge field theory computations. This field is living a revolution which started about a decade ago. The LHC makes this activity particularly timely because high precision computations of the “background signal" are needed in order to detect any “new physics". The activity at IPhT goes from abstract (yet deep) results relating gauge theory and gravity amplitudes to more concrete (but highly tricky) computations of standard model cross sections. The intermediates are numerous, each involving impressive mathematics, and the flow of ideas is by no means one-way. The output is a mixture of publications and software. These activities also have close connections with integrable systems —a tradition at IPhT— used to compute with great success exact properties of supersymmetric gauge theories, and of course with string theory. String theory is a rather recent research direction at IPhT. After several failures to attract seniors, the policy to build a junior group is by now a real success. The group cannot cover all aspects of the subject, but its members have made fundamental contributions to black holes, flux compactifications, AdS/CFT and many more. Another example of a considerable task force at IPhT is the group studying nonperturbative aspects of QCD, extremely competitive in all aspects of this domain, with the notable exception of lattice computations. A large human quota is also devoted to physics beyond the standard model, astroparticles and cosmology. At IPhT perhaps more than elsewhere these subjects are close cousins, due to a large number of cross-collaborations. This activity has benefited from a number of recruitments in the recent past, and its dynamics is an evidence. Condensed matter physics is also a huge theme that IPhT integrated to its scientific policy only recently. This resulted in the recruitment of three physicists, all juniors about ten years ago. This small group was reinforced by a recent hiring. In the meantime, it had been able to provide a “technology watch”, and in particular strongly interact with the other rather large condensed matter physics groups nearby, and with other members of IPhT. This has led to a number of notable contributions. This small group has already attracted two Blaise Pascal chairs (one of which was mainly hosted at IPhT). The emergence of AdS/CFT in condensed matter was a good opportunity to create new contacts within the Institute. 8 Activity Report CEA/DSM/IPhT 2008 — 2013

Several IPhT members also devote a lot of attention to another very important “recent” subject, out-of-equilibrium statistical physics, either via works on paradigmatic models, or via general exact out-of-equilibrium relations, or finally via concrete applications, e.g. to biology. This activity is also close to the study of complex systems in general, disordered systems and spin glasses. There, attention is now focusing on granular materials and structural glasses. Among the obvious gaps in the IPhT spectrum, the Institute cannot claim to have a group working on biophysics. However, several physicists have a deep interest in biology (actually this is a tradition), resulting in a number of important contributions, ranging from biology inspired theoretical physics, to theoretical physics applied to biology and used by biologists. Other activities can make significant progress by the efforts of a few. Mathematical physics has seen some of its representatives get closer to pure mathematics, with great success. One can note the works on dynamical systems and quantum chaos, but also visible contributions to important combinatorial, probabilistic and algebraic geometry problems come to mind: planar maps, Razumov-Stroganov type conjectures, cluster algebras, topological recursion equations coming from random matrix theory, quantum gravity. As shown by work done at the Institute, random geometry can also be a fruitful path to a better understanding of nonunitary quantum field theories, conformal or massive, via logarithmic conformal field theories and super sigma models, with concrete applications in condensed matter. This list also illustrates the importance of the remarkable scientific environment provided by the Saclay area. In particular, the integration of IPhT in the Direction des sciences de la matière of CEA is a crucial asset for us. In high energy physics and astrophysics, we have very close contacts with the Institut de recherches sur les lois fondamentales de l’Univers (IRFU). The same is true for condensed matter and statistical physics, namely with the Institut rayonnement matière de Saclay (IRAMIS), and to a lesser extent with the Institut nanosciences et cryogénie (INAC, Grenoble).

1.6 Organization of the Institute

Demography Compared with other entities devoted to theoretical physics worldwide, the size of IPhT makes it one of the “giants". It hosts a bit more than one hundred and twenty persons (see Table 2 below). The composition ﬂuctuates rapidly due to the large number of temporary researchers: the order of magnitude is thirty PhD students and forty Postdocs. There are about ﬁfty permanent researchers, either employed by CEA (about two thirds) or by CNRS (about one third). The support team comprises less than ten persons (eight CEA and no CNRS employee at the time of this writing), some of whom are shared with other Institutes of the DSM (librarian, system administrators). Temporary work, payed on overheads of external grants, is sometimes the only solution to keep the Institute running.

Functioning of the Institute Even if the director of IPhT has the full responsibility for the decisions, the functioning of the Institute is steeped in collegiality. This tradition has proved its usefulness over the years and is reﬂected in a number of light structures which have a life of their own, but on which the director heavily relies for advice. Introduction 9

1/1/2008 1/1/2009 1/1/2010 1/1/2011 1/1/2012 1/1/2013 CEA phys. 32 32 33 34 34 34 CNRS phys. 14 16 17 16 16 17 Postdocs 18 14 22 22 30 39 Grad. Stud. 16 23 20 21 22 28 CEA non-phys. 8 9 9 9 8 8 CNRS non-phys 1 1

Table 2: IPhT demography, 2008–2013

– The closest help for daily decisions is provided by the two deputy directors and the Institute secretary. A scheduled weekly meeting allows to efficiently cover the points that touch at the same time scientific and administrative aspects of the life at the Institute, and to review the progress of long term actions. This meeting is completed by daily informal discussions. – To deal with scientific issues, a scientific council meets regularly. The scientific council is an internal structure with an advisory role, whose precise composition has fluctuated over the years. The director and his deputies are ex-officio members. The other members are renewed every two years via elections. Only permanent researchers are eligible. During the first meeting after the elections, the scientific council may co-opt one or more members. It also chooses a secretary responsible for preparing and scheduling meetings, and for writing reports. The scientific council takes advice from members of the lab on specific occasions. The main discussions concern recruitments, allocations, financial participation to the organization of conferences, and in general anything that is relevant for the scientific policy of the Institute. Permanent researchers are informed in advance of the agenda of the next meeting, and can suggest further items. – The Institute council is dedicated to daily life issues. The principles for its designation and working are analogous to those governing the scientific council, with the important but natural difference that not only permanent researchers are represented, but also the support team, graduate students and postdocs. The role of the Institute council should become more and more important in the forthcoming years, if only because of the spectacular rise in the number of non-permanent members. Their adequate integration in the Institute is one of the crucial challenges for the next years. – For convenience the Institute has been subdivided into three thematic groups: “Struc- tures and Models: Mathematical Physics”, “Particle Physics and Astrophysics”, and “Sta- tistical Physics and Condensed Matter”. Groups are informal and very light structures. While the frontiers are somewhat artificial, in that many researchers would naturally fit into several groups (but had to choose one at some point), all the members of a group have reasonably close centers of interest, which is the main "raison d’être" of groups. Another one is their moderate size: a group comprises less than twenty permanent researchers. Put together, these two features allow for collective debates which would be much harder to organize and keep focused at the level of the Institute. Groups have no leaders, but each group chooses a secretary, changed every couple of years or so, who is a natural interlocutor for the direction of the Institute and the scientific council. Groups elaborate motivated opinions on all the aspects of the scientific life of the In- stitute, in particular in the case of recruitments. They organize weekly topical seminars at IPhT. Once upon a time, they were in charge of distributing a significant amount of money for long term invitations (postdocs, long- and midterm visitors,...), which were de- 10 Activity Report CEA/DSM/IPhT 2008 — 2013 bated among the groups. These meetings sometimes lead to passionate discussions, which brought as a side effect interesting scientific arguments to the fore. During the last few years, more and more funding has come from individual grants, and the number of postdocs directly funded by the Institute budget has drastically decreased. The relevance and frequency of group meetings have diminished accordingly. – On rarer occasions, a general assembly of the Institute is called by its director. Every two years the Institute organized an 3-day internal workshop, which consisted in scientific presentations, as well as general discussions on various matters. A basic organigram in Appendix A.2 summarizes the administrative organization.

1.7 Understanding the past, preparing for the future The last ﬁve years have witnessed some dramatic changes in the economic environment in France, more generally in Europe. Though what happened at IPhT is doomed to be anecdotal in this perspective, the Institute has changed at an accelerated pace, and some of the world scale events have clearly impacted the French research system, and therefore our Institute. The following remarks attempt to describe and (hopefully) understand the situation of IPhT today and the stakes for tomorrow. They are meant as a detailed counterpart and a useful ﬂexible complement to the more formal SWOT analysis given towards the end.

Explosion of short-term positions One important trend is expansion. Though the number of permanent members has changed only marginally, the number of students and postdocs has progressed extremely fast. It has increased by a factor of 4 or 5 over the last ten years, and now represents signiﬁcantly more than half of the “crew”. The tendency for the next few years is stabilization. However, the number of visitors (from one day visitors to sabbaticals, from trainees to permanent members of neighboring institutions spending part of their time at IPhT) is also rapidly expanding: having 130 people around is now a common situation. An increasing number of foreign visitors come for an extended period with their own funding. The attractiveness of IPhT for all categories of researchers, French and foreigners, from beginners to highly visible seniors (including Blaise Pascal chairs), is clearly one of the major assets of the Institute for the diﬃcult time that we shall be facing.

Year 2008 2009 2010 2011 2012 2013 (-30 Jun) Visitors <1 week 147 183 181 257 202 103 Visitors >1 week 23 38 32 26 34 20 Visitors > 1 month 16 18 14 17 10 12 Visitors > 3 months 3 4 5 4 4 4

Table 3: Visitors at IPhT

Evolution of long-term positions Concerning the evolution for the next ten years, another important fact will superpose to this expansion. In 2010, new rules for retirements have been adopted by the French chambers. Up to 2009, special agreements “forced” CEA employees to retire at the age of 60. Most physicists of this age argue with reason that they are still able to produce high quality research, and IPhT has always found means to allow them to pursue their work Introduction 11 in good material conditions. The new horizon is now the age of 70. Since the number of permanents at IPhT is programmed to decrease, the perspectives of new hirings at CEA are very low, and those at CNRS are only slightly better. This will lead to a dramatic destabilization of the age pyramid of the Institute.

Short-term/long-term positions balance The transition from a “long-term positions dominated era” to a “short-term positions dominated era” seems to be irreversible in the foreseeable future. We might argue that IPhT is one of the counterexamples to the nowadays dominant but nevertheless pre-conceived idea that this evolution is a required condition for competitive research. But whatever our opinion about this trend, we have to face it. This is a delicate challenge by itself. Ideally, it should be combined with a voluntarist policy of hirings of “young senior” permanents. But this is exactly what we shall not be able to do. The situation is quite worrisome. On top of the crude fact that our French competitors will face similar problems —a meager consolation— there are still a few reasons for hope. First, the situation would clearly be worse if we had not succeeded in attracting a large number of nonpermanents (students and postdocs) already. Second, about ten years ago IPhT had the great opportunity to hire a large number of juniors. High quality people from diﬀerent horizons have enriched the lab on the scientiﬁc side, but also on more down-to- earth issues. These people are by now young seniors, and they have already played a major role in the successful adaptation of the Institute to the huge changes that have shaken the traditions of French science over the last years: the transition from a “recurrent distributed funding dominated era” to a “competitive targeted funding dominated era”. This leads us to our next topic.

1.8 External fundings Another trend is the increasing importance of external fundings. Ten years ago, external fundings were totally marginal. In 2013, more than 95% of our postdocs are paid on external fundings, and this figure also concerns invitations and travels. External fundings have become vital for the Institute. They come from a number of sources. Europe is by far our main provider, via Marie Curie programs and European Research Council (ERC) grants. Then comes the French “Agence Nationale de la Recherche” (ANR), whose recent evolutions are really a worry for us. The “Région Ile de France” (the Paris area) and several more targeted sources (fundings for scientific exchanges with specific countries) come as complements (the detail of these fundings is given in Appendix A.4). There was some hope that other sources of funding would take an important role in the near future, via large structures that have come to life in France recently. One of their goals is to make French research more visible from the outside world, allowing to attract top foreign students to French Universities or Grandes Écoles. These structures encompass hundreds to thousands of researchers on specific themes. They started a few years ago with the so-called “Réseaux Thématiques de Recherche Avancée”. The major step was the launch in 2010 of the “Grand emprunt de la France: Investissements d’avenir” (a reaction to the 2008 financial crisis) which is deeply reshaping the French research landscape. Under the flag of “excellence”, new structures called Idex, Equipex, Labex (the generic name “*ex” is used in the sequel) are by now active bodies of the research system. From our viewpoint, the contributions of these structures to the funding of IPhT are bound to be modest. However, it is hard to estimate the impact these new structures will 12 Activity Report CEA/DSM/IPhT 2008 — 2013 have on the more traditional entities devoted to science in France, CNRS and CEA to quote only the ones most relevant for the IPhT. The name “external funding” is to be contrasted with funding directly, and regularly, coming from CEA or CNRS. These two organizations are still paying the salaries of permanents at IPhT, they also provide access to journals. CEA is in charge of the buildings and working environment. This will probably soon be their only role. CEA (mainly) and CNRS still significantly contribute to direct scientific activities (through invitations, travel money, conferences) but this funding is steadily and rapidly decreasing. Obviously, the new structures will sooner or later have a dominant position to orient the scientific policy of French research. This situation is a source of worry for both CEA and CNRS employees at IPhT. In the past years, the CNRS has been reorganized several times, possibly to adapt to this new situation. In the same period, the CEA has not experienced such “jolts”, but its implication in the new structures is a clear sign that important changes are on their way. These changes may also impact the relation between IPhT and University, though it is too early to know exactly in which way. Let me just note that IPhT already harbors a few professors (or assistant professors) for part of their research, and that several members have a notable investment in teaching. IPhT is directly involved in three Labex. P2IO, “Physique des deux infinis et des origines” covers our activities in particle physics and astrophysics. PALM, “Physique : Atomes, Lumière, Matière” covers our activities in statistical mechanics, condensed matter physics and biophysics. Our activities in mathematical physics participate to the “Fondation math- ématique Jacques Hadamard” and the associated “Labex Hadamard”.

ERC Starting Grants 7 ERC Advanced Grants 2 Individual Marie Curie Fellowships 8 European Networks 15 ANR Excellence chair 3 ANR Young researcher 8 ANR "Blanc" 20 ANR Complex systems 1 Other French “Networks” 12 Binational exchange programs 23 Blaise Pascal Chair 1

Table 4: External funding sources since 2008 (details in App. A.4)

Members and small groups at IPhT have in fact been remarkably successful in garnering all kind of fundings. The most spectacular record concerns the highly competitive ERC grants: nine of these have been hosted by IPhT. Some have started last year, but some are already close to their end. The successes at ANR are also very noticeable. Let us just quote, among the 32 ANR contracts involving our Institute, the three ANR excellentia chairs attributed to recently recruited members. These successes are obviously the main reason for the increasing size of the Institute, which should maintain itself for another three or four years at least, and more generally for its visibility and attractiveness. Though the evolutions of the French research landscape have been a great opportunity for IPhT so far, it is clear that they also have had pervert side eﬀects. A minimal amount of recurrent funding is a sine qua non condition if the Institute is to keep some of the features which made its worldwide reputation, and in particular the possibility to work on long-term projects, without worrying too much about the fashion of the day.

Closer to experiment A third important trend is to get closer to experiments. This is particularly striking in Cosmology and Particle Physics. The role of the LHC is of course important, but many other present or future instruments (RHIC, Planck, Euclid, Lisa,...) mobilize IPhT teams. The tendency is also visible in Statistical Mechanics (structural glasses, granular materi- Introduction 13 als,...), Condensed Matter (new materials, heavy fermions, graphene,...) and Biophysics (motors, structure prediction, sequence alignment,...). It is clear enough from this short description that the situation is hardly comparable because experiments in high energy physics and condensed matter have totally diﬀerent scales (time, cost,...). To get closer to experiments, the birth of the “*ex” structures should have a signiﬁcant favorable incidence in the future, because they incorporate theoretical physicists in structures involving a fair majority of instrumentalists, and because one of their goals is to allow transverse research.

1.9 Coding

The importance of computer science related activities has dramatically raised since the previous report. This goes from web servers for biophysics, to advanced software for condensed matter physics, precision gauge theory computations or cosmology and astroparticles (see Table 5). There is of course a long history of numerical computation and simulation in Physics, but there is a clear shift in the approach. The aim is not simply to have a running code for an individual, a team or a community anymore, but to produce/furnish a real software compliant with software standards. Portability and durability imply a need for clarity, simplicity, readability, generality and modularity of the code. This is getting more an more important in physics, and is probably going to lead to some new special- izations in the near future. There is still plenty of room for good physicists inventing good algorithms, because history shows that progress in computing hard problems often (if not always) comes from a better understanding of the physics. But these new creative algorithms have to be implemented respecting professional coding standards and without wasting time in reinventing the standard algorithms. This requires close contacts between physicists and computer scientists. A short term tendency seems to rely for this part on students or postdocs coming from computer science but with a background in physics. The future is likely to lead to more drastic evolutions.

BlackHat Precision calculations of Next-to-Leading-Order processes in QCD TRIQS computations of interacting condensed matter systems PPPC4DMID Cookbook for Dark Matter indirect detection FastJet jet reconstruction and manipulations in QCD collisions MISTRAL multiple protein structure alignment algorithm TT2NE determine the secondary structure of RNA with pseudoknots McGenus determine the secondary structure of RNA with pseudoknots AQUASAXS compute small-angle X ray scattering proﬁles

Table 5: Softward packages partly developed at IPhT. Several of them are publicly available.

1.10 Teaching and its asides

Our implication in teaching activities has also markedly evolved over the last years. We have already alluded to the explosion of the number of PhD students at the Institute (see Table 2 for ﬁgures, and App. A.7 for the list of theses defended at IPhT). To these “full PhD students” one should add numerous master students, as well as a growing number of external PhD students who decide to spend a long period (from 1 month to 1 year) at IPhT. Many of these students are coming with their own funding. 14 Activity Report CEA/DSM/IPhT 2008 — 2013

We try to follow the professional development of our former PhD students after they have left the Institute. Among the students having graduated since 2008, all but one have found (temporary or permanent) academic positions, or jobs outside academia.

2008 2009 2010 2011 2012 2013 (30 Jun) PhD defenses 4 7 6 7 6 External grad. stud. 2 3 1 7 10 Master students 2 7 6 11 15 6

Table 6: Students at IPhT

While the absence of teaching duties is envied by some of our colleagues at University, and enjoyed by a number of permanents at the Institute, it is a fact that members of IPhT are more and more willing to teach and more and more appealed to as well. Officially a PhD advisor should have obtained a Habilitation thesis (HDR). For CNRS members, the HDR is also required in order to be promoted “directeur de recherche”. This is also the case at CEA (albeit with a few exceptions) and we strongly push our colleagues to pass this diploma. During the period 2008–2013, six physicists (all CEA members) have obtained their HDR (see App. A.7.1). In the last 5 years, about half our permanent members have taught at the master or postgraduate level, more rarely at the bachelor level, in nearby universities and Grandes Ecoles, or in more distant places (see App. A.8). The involvement can be either punctual (a few hours) or periodic (up to 60 hours per year). The policy of CEA on these matters is still under elaboration and subject to contra- dictory influences. On one side, CEA is deeply involved in the construction of the new Paris-Saclay University that should officially come to life by the end of the year. On the other side, our teaching activities are watched over by the CEA human resources much more than they used to be. This is a worry for us because they represent a crucial way to spot promising students, make them aware of the existence and quality of the Institute, and attract them for internships and PhDs. One important action of the Institute, recognized as such and copied since then by our “competitors" in the Paris area, is the organization of the “IPhT lectures”, offering every year 5–6 topical courses targeting students and researchers (see the program of these lectures in App. A.8). The lecturers are mostly IPhT permanents, but high-flying visitors are also called upon on occasion. The quality of these lectures and their recognition by the Universities of the Paris area play an important role in our visibility for a macroscopic fringe of the scientific population. Apart from these regular teaching activities, our members deliver lectures in many summer schools all around the world. We have taken our share in the organization of such schools (see App. A.8), most ofen in the “traditional” Les Houches or Cargèse centers. As an example, we have resurrected the annual Statistical physics summer schools in Beg-Rohu.

1.11 More on Visibility

We have already mentioned the increasing number of graduate students, postdocs and (long- and short-term) visitors. Many high-rise foreign academics are coming back every year for several weeks, considering our Institute as a “haven” where they can devote all their time and thought to research. Another face of our visibility consists in the numerous conferences we participate in as invited speakers, or that we (co)-organize. In App. A.5.3 we list all the events organized Introduction 15 at IPhT and outside; most of the events are located in France, but a large number of them take place in Europe or overseas. Our involvement can vary from local, down-to-earth organizer, to member of the advisory committee for large international conferences. More locally, we also co-organize various periodic events in the Paris area. Beside our own seminars at IPhT (see App. A.5.1), some of us co-organize joint seminars: the Sémi- naire Poincaré taking place twice a year at the Institut Henri Poincaré (Paris) and leading to a book series, the Condensed Matter Seminar with LPS Orsay, the joint “Séminaire de la Fédération de physique statistique de Paris-Sud”, the monthly seminar “Spectral problems in mathematical physics” at IHP, the joint IPhT-SPP bi-annual meeting (Service de Physique des Particules of CEA/IRFU), the “Jounrnées de physique statistique” in Paris, as well as several less formal “Groupes de travail”. Some of these joint seminars are funded by collective structures or networks. Other activites also participate in the visibility of our Institute. Many of us are members of editorial boards of journals (see App. A.10). Another, less “visible” but no less important activity, consist in various form of external research administration. Many of our members participate in steering, scientific, evaluation, hiring committees of external bodies or institutions (see App. A.11). A recent example: one of our members was recently elected in the academic senate of the new Université Paris-Saclay. The accumulation of new “collective structures” in the French research system implies that these administrative activities will be more demanding in the coming years. Excellentia As the reader will surely have noticed, “excellence” has been the buzzword over the last few years, and it has become a label, hence possibly also a Grail, at all scales from individuals to vast geographic areas. It is timely to try to explain the position and situation of IPhT. A simple mark of the “excellence” of an Institute consists in the prizes received by its members. In the last 5 years we have obtained some high-level prizes, described in App. A.3. I do hope that the review of the evaluation committee will conclude that, averaged over the Institute, the result is indeed excellent. What I know for sure is that people at IPhT (and elsewhere in the other scientific institutions) do their very best to produce excellent research. The question is more on how much energy we should put in the excellentia structures. These labels have only a modest amount of money per researcher to distribute, but following their development can be time consuming, so they seem better adapted to the possibilities and needs of entities larger than IPhT. The position of IPhT in this respect is contrasted. Some of us feel that we have no choice but to participate in every competition/call, while some others would accept some cuts (in money, invitations, travels) to protect their tranquility and comfort. There is a spectrum of intermediate positions. One can interpret some of the changes at IPhT (and possibly more generally in French research) over the last decade or so, as a metaphor of economic globalization. Some people argue that this passage was totally unavoidable. As the history of real economy shows, even if this is true in average, it does not mean that all other strategies were doomed to failure: in some places original niche strategies have been (even more) successful. In fact, IPhT enjoyed some specificities which made it world famous, and could have made it a successful candidate for alternative development models. One could even argue that some of the evolutions have developed at the cost of part of our originality. It is nevertheless a fact 16 Activity Report CEA/DSM/IPhT 2008 — 2013 that in the 1990’s IPhT firmly engaged in a series of important changes, starting with the implementation of regular reviews by international scientific committees and (soon after) of a new, opened, hiring process. The situation today is clearly very influenced by this move. Most of the members of our former international scientific committees and of the people hired since 1995 had been exposed early to the American (or close to American) research systems. They find it natural to apply for grants and to build a group of students and postdocs around them. But the older (and equally successful as far are producing science is concerned) IPhT “philosophy”, often based on close collaborations among permanents, is still vivid.

1.12 Challenges for the future

It is a deeply human tendency to attribute our successes to ourselves, and our failures to external circumstances. This bias is true at the level of individuals, but pervades all levels of human activities. The IPhT is of course no exception. We are also used to attribute to all these levels of activities some purely human attributes like personality, will, etc. While this can be partly true (for example when a company has a clear emblematic leader), this is often deeply misleading. I would like to argue in the following remarks that these two general facts are crucial to understand the future challenges facing IPhT (among others). The first and clearest challenge for the future is the quality and originality of research, either measured by the “excellentia” or by other traits. Though only the future can tell, the reading of this report gives me strong reasons to be confident. I hope other readers will share this view. It is excessive to view the good work done at IPhT as a scientific success of IPhT. My predecessors, with the help of internal and external scientific committees, deserve credit to have hired and brought together good people. But from then on, whatever is done is done by individuals, or very small groups. So the main challenge is for individuals. For competitive research, one of the important tools today is funding1. The situation is, as already noted, excellent today. But the future is very uncertain. In particular, the sources for the the most competitive and profitable grants are essentially European and it can be feared that our remarkable successes of the past have exhausted our pool. This is reinforced by the low recruitment perspectives. At the same time, the sources for more accessible grants, ANR for instance, see a drastic fall of their means. The motives to be confident despite the aforementioned obstacles are in the qualities of the IPhT crew, and again the challenge of maintaining a high external funding level is mainly for individuals. However, these two individual challenges lead to a cascade of challenges for the administration of IPhT (and of the levels higher up : the DSM, the CEA, the INP, the CNRS...). Here is a non-exhaustive list. The main managing tool for a scientific policy is recruitment, either permanent or long- term positions. In this matter, the situation is quite alarming. As already mentioned, the question of permanent positions is relegated to the far future. This should incite us to be even more careful in the choice of postdocs and long term visitors. But by now the money to pay these visitors mostly comes from targeted individual grants. If the needs fit with a grant goals, I’m confident that the grant holder will make clever choices. But a view at the

1Let us note however that compared to most other scientiﬁc activities, theoretical physics can survive for some time with a very small input of resources, of course with an impact on competitiveness if others, in France or abroad, keep important means. Introduction 17 level of the Institute is crucial as well. For instance, what was done about a decade ago for string theory and condensed matter, namely the creation ex nihilo of a group, would be totally impossible today.

The diversification of financial resources over the last years has mechanically led to an explosion of administrative tasks. The recent hardenings of the implementation of the French employment law have amplified this tendency. Both the number and the complexity of tasks are at least one or two orders of magnitude higher than what they were ten years ago. The situation is critical. The dedication and skill of our administrative group, plus the affectation of more and more time and energy of the deputy directors of IPhT to these tasks (at the cost of neglecting other important issues) are reaching their limits. The same observations apply probably at higher levels in the CEA and CNRS. As already mentioned, the number of people present daily at IPhT well exceeds hundred- and-twenty, and a macroscopic raise, possibly temporary, of the number of offices would be welcome. It is to be noted that, in the meantime, people not interested in getting funding share the inconveniences with people having funding for a number of visitors. The quality of life, at least if measured by the area per physicist, is deteriorating rapidly. But spatial extension comes with another challenge: the population of IPhT is not only larger, but also more and more heterogeneous, with people coming from diverse horizons and expecting to spend a limited period in the Institute. A risk of “phase separation” is emerging, people with the same interests demanding to occupy neighboring offices. At the same time, the new “*ex” structures will sooner or later create an incentive for both permanent and nonpermanent people to be more delocalized. Good or bad, these tendencies are new at IPhT and require some thinking.

The management of short term positions is one of the sources of worry for the Institute. Our conviction is that the Institute, and in particular the supervisors, must feel responsible for people who spend a couple of years (sometimes just a few months) among us. At a time when ﬁnding permanent positions in research and in industry becomes harder and harder, we feel that this is a human duty; but it is also our conviction that our care is necessary if those people are to give their best during their stay, and then take away and spread a positive image of the Institute. Keeping track of all those who spend from a few month to a few years among us, and being able to follow their career development after they have left, is a necessary (but nontrivial) task. Including them in the daily life of the Institute is also a challenge, and we have recently started to tackle this issue, for instance via the representation of nonpermanents in the Institute council, or the organization of monthly get-together events. Yet much remains to be done, and the well-being of our temporary members is one of our priorities.

1.13 A resume of Strategy and Project

A very short resume is that we intend to meet the challenges alluded to above. But to be concrete, the rather long analysis made in the previous sections needs to be summarized and turned into a usable tool. like a SWOT analysis. Though such a formal tool necessarily overlooks some of the intricacies of the context and situation at IPhT, it directly connects to the elements of strategy for the next ﬁve years period. 18 Activity Report CEA/DSM/IPhT 2008 — 2013

SWOT STRENGTHS Science • Old tradition of peer-recognized high-quality long-term research • Quality and homogeneity of hirings over a long period of time • Independence, freedom of themes and collaborations • Large size and and its consequence (at least at IPhT), multidisciplinarity • Presence of leading international experts or expert teams in most themes, giving added value to multidisciplinarity Resources • Large number of grants covering most of our activities and secure for a few more years • The corresponding overheads that can be used to support the rest of the activities Administration • Involvement and dedication of the support team WEAKNESSES Science • Dispersion, an obscure facet of multidisiplinarity • Absence of prominent leading personalities at the level of the Institute, another obscure facet of multidisiplinarity Resources • We are vulnerable to the decrease of perennial funding, crucial for everyday life, scientific policy and in particular to preserve out-of-fashion but important activities • Unclear future of targeted funding : the ANR is on a slippery slope and the Institute has already grabbed a large fraction of its potential ERC’s Administration • Sub-critical support • Complexity of financial management with many different sources of funding • Explosion of administrative tasks and duties OPPORTUNITIES Science • The Paris-Saclay University will allow for a more transparent access to teaching for those who desire • The Paris-Saclay University offers a springboard for the visibility of the Insti- tute via the IPhT lectures • The *ex projects will facilitate the mobility of researchers and their interactions with neighboring institutes • The *ex projects will facilitate the invitation of leading personalities Resources • Indirectly, the explosion of the number of funding sources, because we have a good experience of rapid responsiveness Introduction 19

• Philanthropy (though this raises delicate issues) Administration • We do not identify opportunities THREATS Science • Incentives for many of our members to spend time in other places, a tendency favored by the large scale *ex projects • Dilution in structures poorly adapted to our size and way of functioning. • Dying out of our specificities in a melting pot of large scale governance • An already visible shift from fundamental research to application-targeted research Resources • Complete vanishing of recurrent support, with only a partial transfer towards targeted calls into • Difficulties to pay even the salaries of permanent CEA members Administration • The new structures (*ex, University Paris Saclay, and so on) will significantly contribute to the explosion of administrative tasks

Strategy Though strategy is of crucial importance especially in difficult periods like the one we face today, the room for maneuver is minimal. The IPhT faces a number of problems. The typical situation is that each of these problems taken individually calls for natural counter- measures, but those are unavailable as part of another problem. Realism thus demands that we concentrate on a very few basic and modest, yet concrete actions: Scientific policy at IPhT is a delicate issue. We • Abandon any dream of changing the Institute’s scientific profile via recruitments. Note that during the past, most of the time an opportunistic attitude, hiring of the best candidate1, has prevailed anyway2. • Identify, in the next years, PhD grants funded by CEA as one of our main lever arms to either slightly bend the scientific orientations of the Institute, or keep alive certain themes even if they are not in the fashion of the day. Of course, this can only be efficient if the number of those grants remains comparable to the present figures. • Intend to preserve freedom of research. We shall refrain to interfere high-handedly with the research themes of our permanents (with the exception of the management of severe personal problems if any of course). • Shall enhance our communication towards our hierarchy and towards the scientific community. This effort has already started thanks to the involvement of a small informal “communication unit” inside the Institute. The strategy is to put to the fore not only landmarks (i.e. spectacular single publications) but also highlights (i.e. longer term series of investigation), and explain the importance of even the more technical contributions. 1Being aware of the limits of the objectivity of this qualifier. 2Two notable exceptions took place at the end of the last millennium, at a moment when a sustained flux of recruitments made it possible to set up and pursue a coherent strategy for a long enough period to build a string theory group and a condensed matter group, while keeping an eye on opportunities in non-targeted themes. 20 Activity Report CEA/DSM/IPhT 2008 — 2013

Recruitment is the main black spot for the next years. As far as the Institute’s scientific strategy is concerned, we cannot rely on positions provided by external funding, if only because they are given to individuals, not to the Institute, and are in general nonpermanent. With no recruitment to expect on the CEA side, and little recurrent funding, we need to concentrate on affordable but efficient actions. Our strategy is to capitalize on the dynamics of our present attractiveness: • To obtain the appointments of some new recruits of CNRS (however, although CNRS has consulted its associated units to establish a recruitment strategy, this was done at a collective level, and cannot fit our needs as well as previous CEA recruitments directly managed by the Institute) • To favor targeted mobility toward IPhT (by part-time hosting, CNRS transfers, Uni- versity teaching backbuying,...) • To convince our hierarchy at CEA and CNRS that providing a high quality support team at IPhT is essential and represents a good investment

Funding is another capital issue for the next years. We plan to • Encourage our members to search new fundings. We intend to do this by pedagogy, and not by constraint. Freedom is one of the keywords of our Institute. This is not just an abstract philosophy, but is based on the experience that what is done voluntarily is done well. The next items are meant to promote this pedagogy, • Develop a light-weight structure, capitalizing on our successful past experiences, to help project holders prepare the scientific aspects of the reviews via critical overviews, but also to identify high-potential scientists and encourage them to apply to calls for projects, • Keep and develop the skills of our support team to help project holders prepare the ever more complicated administrative aspects of funding and keep their focus on scientific issues, • Pursue our “technology watch” effort to locate opportunities, and in particular target the most profitable calls, especially in terms of overheads.

Project It is not a totally straightforward task to identify a project for IPhT for the next five years, beyond the vague “dedication to high quality academic research”. The spectrum of theoretical physics studied at the Institute is broad, and though each permanent member has a personal scientific project, integrating them all into a coherent collective project is irrealistic. However • The theme “Cosmology and Particle Physics” is naturally structured by large-scale experimental projects (LHC, Euclid, ...) and focused on fondamental issues (nature of the neutrino masses, electroweak symmetry breaking, dark matter and energy, gravitational waves, quark-gluon plasma properties,...). These unifying trends will cement the individual projects of our permanents for the next few years. • The theme “Models and Structures: Mathematical Physics” works on a rather different model. The notable inflexions of the last decade towards closer relations between mathematical physics and mathematics are most likely to be growing in importance in the near future, and this will be a strong unifying force for the theme. Presentation of the Institute 21

• The theme “Statistical Physics, Condensed Matter and Biophysics” is by nature more diverse and eclectic, but is however marked by a trend towards more concrete appli- cations1, and again this should be of growing relevance in the near future, though this time probably without a unifying effect. It seems that IPhT is in a good position to participate at a high level to all these activities. But their specificities indicate that in the future a good integration in the corresponding larger communities will be crucial. This is why the policy which started in the participation of the IPhT in three Labex will be actively pursued to favor the integration of the Institut in three Departments —still under discussion at the moment, and roughly covering the perimeters of the Labex— of the upcoming Université Paris-Saclay. This deeper rooting in three distinct communities is of course a double-edged gamble and the direction of IPhT is also planning to actively work to preserve the clear theoretical physics blend of the Institute, characterized by its synthetic approach to problems, and by the mastery of unifying physical concepts and mathematical tools. The best guarantee that this is possible is of course the large overlap between the three themes, more than half of the permanents being involved in at least two of them. Put together, the preserved coherence of the Institute and its deeper anchoring in the communities should allow for an efficient flow of new ideas. But finding the right balance between the two is going to be nontrivial, and requires specific actions. In our view, one of the most promising lines of action is via a deeper involvment in teaching, and again the Paris-Saclay University is a great opportunity. Integrating the IPhT lectures in this larger structure, developing them and augmenting their visibility (for instance by making “IPhT Lecture Notes” widely available), making IPhT a reference place for students or more senior researchers looking for high-level concise introductions to current topics, will crucially allow to reinforce the perception of IPhT as a coherent (and useful) entity, both for its members and the outside world. The precise contours of these actions are still vague2, yet the direction is clear. IPhT is ready and willing to enter the next challenges of science and research on the one hand, and of a new, more open, era of the Saclay plateau on the other hand.

In conclusion, the economy of the future at IPhT will require delicate balances: obtain fundings for projects but avoid to see our research targeted by fashion; take our share in the giant structures that are emerging on the Saclay plateau without getting dissolved into them; preserve creative thinking without losing sight of strategic management; leave a lot of room for individual initiative, but keep a strong feeling for collective interests; oﬀer to all the members of the Institute —permanent or not— working conditions that allow them to give their best. The devotion of physicists for physics (at IPhT and elsewhere) is the best guarantee that we shall be able to win the challenges of the future, and I’m already eager to see how the main challenge for our Institute, the one for scientiﬁc inventiveness and originality, will be met in the next years. Michel Bauer

1Though this is the fashion of the day in the French scientific policy, this trend has emerged at IPhT as a natural evolution of the scientific community. 2They could take the form of an individual effort of IPhT, or a component of the ongoing project to create an “Institut de physique avancée” in the Saclay area, or a component of another light-weight structure gathering together a few nearby institutes sharing the same goals, ... 22 Activity Report CEA/DSM/IPhT 2008 — 2013 CHAPTER 2

Scientiﬁc production

We now describe in some detail our research activities. For convenience we divide it into three main themes. For each theme we start with a global (yet, not exhaustive) overview, and then present 7-8 highlights in more detail. Each highlight focusses on a series of articles devoted to a more precise topic, and generally encompass the activities of several members of the Institute. The delicate task of selecting these highlights was done by our scientiﬁc council, it necessarily bears some arbitrariness. Nevertheless, we hope this choice will give the reader a faithful image of our activities.

Mathematical physics - structures and models ...... 24 Quantum dynamics, measurements and decoherence ...... 28 Topological recursion, from random matrices to geometry ...... 29 The nested loop approach to the O(n) loop model on random maps ...... 30 Liouville Quantum Gravity & KPZ ...... 31 Cluster algebras: integrability, combinatorics and statistical physics ...... 32 Extreme conformal ﬁeld theories ...... 33 Integrability and the N = 4 gauge theory ...... 34 A de Sitter landscape? ...... 35 Cosmology and particle physics ...... 37 Precision predictions for collider processes with multiple jets ...... 41 Jet clustering at the LHC ...... 42 Initial state factorization in heavy ion collisions ...... 43 Wave turbulence and di-jet asymmetry at the LHC ...... 44 Observing the minibang through its ﬂuctuation spectrum ...... 45 Cosmological Perturbation Theory ...... 46 Dark Matter and the matter-antimatter asymmetry of the Universe ...... 47 Statistical and condensed matter physics ...... 49 Large deviations of the current in the ASEP ...... 52 Spin models with asymmetric irreversible dynamics ...... 53 Ideal Glass Transitions by Random Pinning ...... 54 Pseudo-gap state from quantum criticality ...... 55 Entanglement in low-dimensional magnets ...... 56 Web servers for biological applications ...... 57 Evolution of spatial networks ...... 58

23 24 Activity Report CEA/DSM/IPhT 2008 — 2013 Mathematical physics - structures and models

This theme spans a wide range of topics, from low-dimensional classical or quantum dynamical systems to string theory, via 2-dimensional quantum gravity, random matrix models, statistical models, integrable systems, conformal or supersymmetric ﬁeld theories. In spite of this variety, many of these subjects are deeply interconnected and use a common ensemble of theoretical tools, many of which having been developed over the years in our Institute.

Classical and quantum dynamical systems

Let us start with very simple systems, namely 1D classical oscillators. We have shown that the presence of a multiplicative noise can drastically modify the long time behaviour of the system, for instance can lead to a form of intermittency, very sensitive to the power spectrum of the noise. Such noisy oscillators can describe as diverse physical phenomena as the population dynamics in a random medium, or the interplay between disorder and nonlinearity in the 1D nonlinear Schrödinger equation. On the opposite, magnetohydrody- namics can be viewed as an infinite dimensional dynamical system. The kinematic dynamo problem addresses the instability of the magnetic field in the induction equation driven by a given velocity field, neglecting the feedback of the magnetic field on the flow. In view of several experimental setups (one of which realized at CEA in Cadarache), the choice of a realistic velocity profile is crucial to determine the instability threshold. As a first approximation to the realistic situation of a turbulent flow, we have added a stochastic component to a regular velocity flow, and analyzed its effect on the instability threshold. Instead of adding noise to a classical dynamical system, one can quantize it, and study the properties of the quantum system in the semiclassical régime. If the original dynamics is chaotic one enters the realm of Quantum Chaos, which addresses the question: “How does chaos manifest itself in the quantum system?” A quest for tractable toy models can lead to number theory: the zeros of Riemann’s zeta function are often presented as a mock spectrum for quantized chaotic systems. We have investigated this spectrum by constructing and carefully analyzing a family of secondary zeta functions. Our attention has also turned to nonhermitian aspects of Quantum Chaos: using common semiclassical tools, we have analyzed the resonance spectra of quantum scattering systems admitting a chaotic classical dynamics (like the scattering by 3 disks on the plane), the decay of damped waves propagating in a chaotic domain, or the decay of correlations of a classical chaotic flow (this decay is also governed by complex valued resonances), thereby using quantum methods to understand classical dynamics! Remaining in quantum mechanics, we have addressed fundamental (“foundational”) questions, like the interplay between reversibility, locality and causality, with the pedagogical aim to clarify the importance and role of each concept. Ancient puzzles concerning quantum measurement and decoherence, rejuvenated by recent cavity QED experiments, have been studied with the help of novel theoretical tools. For instance, we have found that a succession of nondemolition indirect measurements eventually leads to the textbook- like phenomenon of wavefunction collapse. To study the decoherence of a spin interacting with a complex environment, a new random matrix model has been introduced and exactly solved, allowing to observe the transition between Markovian and non-Markovian behaviours, as well as the emergence of classicality. This random matrix model is now being generalized to study the dynamics of a cluster of N interacting spins. Mathematical Physics 25

Random matrices, statistical models, quantum gravity Our Institute has a long tradition of studying statistical models enjoying rich algebraic structures, often referred to as “integrability”. These structures or symmetries can take various forms; uncovering them and using them appropriately allows to compute physi- cally relevant quantities in nonperturbative régimes. Below we give examples of methods and applications to statistical physics and “quantum gravity”, trying to emphasize the intertwining between different methods. Random Matrix Theory (RMT) enjoys applications to many domains in physics, mathematics, statistics or econophysics. IPhT has contributed significantly to the developments of these models since the 1960s. A few years ago we introduced a new method (called topological recursion) to compute the large-N expansions for the partition or correlation functions in such models: each term in the expansion can be computed through a universal recursion formula, which only uses the knowledge of the “spectral curve”, an analytic function representing the asymptotic spectral density of the matrices. A far-reaching idea consisted in extending this recursion method to arbitrary (but well-chosen) analytic curves, such as to compute large-N expansions relevant to various problems (e.g. scattering amplitudes in topological string theory, various models in statistical physics, enumerative geometry, or knot theory). With a view towards nonhermitian matrix models, we have also developed a noncommutative version of the method, which should be connected with refinements of the gauge/gravity dualities. One application of RMT is to generate sums over random surfaces (each “Feynman diagram” of the RMT being viewed as a discrete surface). Random surfaces are relevant to several domains of physics: in “2D quantum gravity”, these surfaces are viewed as 2D universes, and summing over makes up the “path integral” over all possible universes; when attempting to write a quantum theory of strings (observe that space-time trajectories of strings form surfaces); in statistical physics (fluctuating surfaces naturally occur in soft matter physics, in growth phenomena). Beside RMT, random surfaces can be investigated through various approaches. A combinatorial alternative to RMT consists in a direct enumeration of discretized surfaces (called “maps” due to their resemblance with geographic maps). We have obtained recent important results on the exact enumeration of maps, including situations where each map is dressed with a statistical model (“matter” degrees of freedom) like the Ising, Potts or O(n) loop model. Beyond a bare enumeration of random maps, we have shed light on the geometry of geodesics of the random surface, which emerges from the graph distance on the map when considering the continuous limit of large maps. Alternatively, one can investigate continuous random surfaces using the Liouville Quan- tum Gravity (LQG): the associated random measure is obtained by exponentiating the massless Gaussian free field. The Knizhnik-Polyakov-Zamolodchikov (KPZ) equations, discovered 25 years ago, relate the critical exponents (at a phase transition) of statistical models living on the random surface, with the exponents of the same model living on Eu- clidean space. Recent works at IPhT provided, for the first time, a mathematical proof of these relations, using modern probabilistic tools. A rigorous connection between the LQG and the Schramm-Loewner Evolution (SLE) was also established. With a view towards relating the discrete geometry on random maps with LQG, we have been able to show that the latter satisfies the same topological recursion as random maps, and then computed the asymptotic expansions relevant to the Liouville theory. The random surface of a crystal can also be described by using algebraic objects, like Young diagrams, dimer models or lozenge tilings. We have understood the relation between the exact enumeration of lozenge tilings and the multidegrees of some algebraic 26 Activity Report CEA/DSM/IPhT 2008 — 2013 varieties, thus establishing a link with algebraic geometry. Some results concern the exact enumeration of Totally Symmetric Self-Complementary Plane Partitions, related with the quantum Knizhnik-Zamolodchikov equation and the generalized Razumov-Stroganov conjecture. In another approach we have shown how to rewrite a lozenge tiling partition function as a RMT; this identification justified the previous observation that universal continuous limits are related with RMT, but it also allowed us to compute the subleading corrections to the continuous limit, using the topological recursion method. Cluster algebras, a powerful machinery introduced about 10 years ago in mathematics, constitute another promising tool to study integrable statistical models. A cluster algebra consists in a structured dynamical system: the data (cluster variables), defined at the vertices of an infinite regular tree, evolve via rational transformations along the edges. We have been able to identify cluster variables with partition functions of certain integrable statistical models; this observation allowed us to prove an elusive “cluster positivity conjecture”. We have also extended this identification to a noncommutative setting, opening the way to a new form of “noncommutative integrability”. In addition to the minimal (unitary) Conformal Field Theories (CFT) appearing in quantum gravity, applications to the physics of disordered condensed matter often involve logarithmic CFTs (called so due to the appearance of logarithmic terms in correlation functions), which are nonunitary. These CFTs are also relevant in applications to the AdS/CFT correspondence. They are much less understood than their unitary counterparts, due to a more intricate representation theory of the conformal symmetry. Instead of an algebraic representation theory approach, we have developed several new methods to investigate these theories. Our main input was the introduction of lattice regularizations, which could be thoroughly studied using integrability methods, guided by extensive numerical simulations. We thus managed to solve several supersymmetric sigma models, and construct a general formalism allowing to tackle certain boundary logarithmic CFTs, with applications to the spin quantum Hall effect.

Quantum Field Theory and String Theory Integrability methods have also played a crucial role in the study of the AdS/CFT correspondence, namely the conjectured duality between a weakly coupled string theory on Anti-de Sitter spacetime, and a strongly coupled supersymmetric gauge theory on the Minkowski spacetime. We have made important progress in the study of the maximally supersymmetric (N = 4) 4D gauge theory, which appears on the gauge side of this correspondence. The planar limit of this theory is expected to be integrable, a property allowing to compute correlation functions beyond perturbation theory. One of the goals of such computations is to test the AdS/CFT duality. Using integrability techniques like the Bethe Ansatz, we have been able to compute the anomalous dimensions of Konishi operators at 6-loop order, identify the superconformal symmetry in those theories, and compute various gluon scattering amplitudes. All our results agree with the perturbative string theory predictions, which validates the AdS/CFT correspondence so far. By generalizating the gauge/gravity correspondence, we hope to obtain nonperturbative infor- mations for more general strongly coupled gauge theories, possibly relevant to real-world systems (e.g. strongly coupled QCD describing the quark-gluon plasma). An important task performed at IPhT is the construction of new gauge/gravity solutions: 4D theories with less supersymmetry, theories describing the deconfinement phase transition in 3D, nonconformal lower-dimensional theories similar to those appearing in condensed matter physics. Away from integrability methods, the structure of the ultraviolet divergences in string Mathematical Physics 27 and supergravity amplitudes at higher loop order have been investigated using the explicit construction of the automorphic forms representing the duality group of the theory. These divergences have been independently confirmed by explicit amplitude computations. One long term objective is, again, to understand the structure of the amplitudes in less symmetric theories, like QCD or pure quantum gravity. In the context of 4D scalar field theories, the exact renormalization group equations have been carefully analyzed, in order to control the possible singularities of their solutions through rigorous, near-optimal upper bounds. We have already explained how string theory represents a powerful computational tool for certain strongly coupled gauge theories, through the gauge/gravity duality. Another, more fundamental goal of string theory is phenomenological: one wishes to recover the Stan- dard Model of particles and the cosmological structure of our universe (presently thought to be of de Sitter type, due to a positive cosmological constant), as effective low energy limits of a well-chosen string theory. Since the latter lives in 10 dimensions, one needs to wrap the 6 remaining dimensions onto compact spaces (manifolds), the choice of compactification being determinant to both the particle spectrum and the geometry of the universe. In this view, a major activity at IPhT consists in classifying the compactifications on 6D manifolds. One mathematical tool we have used is generalized complex geometry, which allows to represent both matter and metric degrees of freedom into common “geometrical” data. Another related task is the computation of quantum corrections to supergravity, with the consequence to exhibit more realistic effective gauge theories. Finally, recovering our de Sitter universe from a string theory “vacuum” is a difficult task. A scenario had been proposed 10 years ago, starting from the huge “landscape” of Anti de Sitter (AdS) vacua, and lifting these vacua into de Sitter vacua by adding various objects (anti-D-branes). Re- cent investigations at IPhT have discovered that this scenario leads to solutions exhibiting singularities which do not appear to be physical, hence this scenario seems inapplicable. This negative result could drastically modify our view of phenomenological string theory. A third objective of string theory is to understand the structure of black holes, and address longstanding problems attached to them, like the information paradox, the physics of cosmological singularities, or the microscopic origin of the Beckenstein-Hawking black hole entropy. In this aim, we have been intensely pursuing a research programme whose aim is to establish and test the “fuzzball proposal”, according to which a black hole is a statistical ensemble of horizonless, supergravity and string theory solutions that share the same geometry as the black hole away from the horizon. Using various analytical methods (including the AdS/CFT correspondence), we have been constructing more and more classes of supersymmetric, nonsupersymmetric, or nonextremal microstates, with the aim to fully account for the black hole entropy. 28 Activity Report CEA/DSM/IPhT 2008 — 2013 Quantum dynamics, measurements and decoherence

Over the last few years, the experimental and theoretical study of simple quantum systems has progressed at an accelerated pace. The development of ultra-fast electronics and low temperature devices has made it possible to test quantum mechanics to an unprecedented level of detail. As is often the case, these experimental breakthroughs have revived questions of fundamental theoretical impact, including the problems of quantum measurement, wave function collapse and decoherence. Though many aspects of quantum mechanics still puzzle the theoretical physicist, and questions that used to belong to the realm of philosophical interpretations little by little enter the more familiar territory of explicit computations. The dynamics of simple open quantum systems For the non-demolition case (the system-probe in- can be studied exactly when its Hamiltonian (or part teractions preserve a basis of the system Hilbert of it) is modeled by some random matrix ensem- space) a remarquable picture emerges, in which re- ble. A nice illustration is the contact of a quantum peated indirect measurements lead to a progressive spin j with an environment, via the introduction of collapse which, at large times, amounts to a stan- novel classes of random Hamiltonians. Indeed, ran- dard textbook measurement performed directly on dom matrix techniques allow to completely solve the the system: the number of probes up to a cer- quantum dynamics, and to write explicit expressions tain time plays the role (in a quantitative sense) for the evolution super-operator acting on the spin of the size of a standard measurement apparatus density matrix. This allows to study in detail, for [t11/136, t11/273, t12/210, t12/211, t13/100]. instance, decoherence effects and quantum diffusion, going from the well known Markovian regime (given by Lindblad’s master equation), to strongly non- Markovian regimes (where all characteristic time scales are of the same order, and memory effects are important), and at the same time interpolating between “strong quantumness” (j small) and “classicality” (j → ∞) [t10/134]. These methods are presently extended to the more realistic situation of Progressive wave function collapse closed ensembles of quantum spins, looking for the in a 3-level system emergence of classicality from explicit dynamical situations. Here many advanced mathematical tools If the probes interact with the system but are not (representations of symmetric groups, free probabil- measured afterwards, quantum stochastic calculus ities) have to be combined to those developed for the emerges: the analogy between repeated interactions simpler case of open quantum systems. with probes and contact with a bath can be made quantitative [t11/136]. In another approach, explicit quantum models for an ideal measurement process are studied in detail, the apparatus being a macroscopic object re- quiring the use of nonequilibrium statistical mechanics. Explicit dynamical solutions show the decay of the off-diagonal elements of the density matrix of the system spin+pointer, and on longer time scales the Evolution of a “3-state Schrödinger cat” relaxation/registration process. The correlations be- The origin of the wave function collapse in a tween subsets of measures and the identification of measurement can be studied from different view- the physical subensembles of states are studied in de- points, all of them involving some external random- tail, shedding new light on and restrengthening the ness. One approach, closely related to recent exper- standard statistical interpretation of quantum me- iments, consists in repeated indirect measurements: chanics and the frequency interpretation of Born’s a system successively interacts with several “probes”, rule [t11/166, t13/074]. and standard quantum measurements are made on At a more “foundational” or rather pedagogi- the probes entangled with the system, leading to cal level, a series of lectures on the various for- a stochastic evolution of the system density ma- mulations of quantum mechanics has been given trix. Using some cornerstones of classical probabil- at IPhT, insisting on the importance of reversibility, and containing some new or not so well known ity theory, one “proves” the collapse of the system ∗ density matrix, or its purification at large times. points (for instance the role of real C -algebras) [t11/035, t12/042]. Highlights 29

Topological recursion, from random matrices to geometry

Solving a random matrix model leads to new geometric invariants [t08/189], or to a new under- §standing of some known ones (such as Gromov-Witten invariants, Jones polynomials of knots, ¤ intersection numbers. . . ).

¦ Riemann surface ¥ density of eigen-values Invariants Wg,n I z2 h z z 2 g 3 z z z z ... z 1 1 = 1 + ... g−1 z g−h z zn+1 J/I zn+1 topological recursion

Figure 1: The topological recursion

The large N limit of the spectral density of a ran- smallest degree algebraic curve tangent to all bound- dom matrix is an algebraic plane curve, i.e. a certain aries [t08/056, t09/050]. Riemann surface embedded in C2 (e.g. Wigner’s semi-circle). The knowledge of that curve is suffi- cient to reconstruct (by a universal “topological recursion") all subleading terms in the large N expansion of any correlation function. In other words, the plane curve entirely characterizes the probability law of the random matrix. Reversing the point of view, one can use the same recursion to associate a “pseudo"-random matrix law to any algebraic plane curve, i.e. associate a sequence of correlation functions to a curve. This Figure 2: Limit shape of a 3d partition defines “invariants" of the plane curve. These invari- 2 – For Gromov-Witten invariants of – take a toric ants depend on the embedding of the curve in C , 2 6D Calabi-Yau manifold, and take the curve to be modulo symplectomorphisms of C ; this powerful symmetry is closely related to integrability [t11/201] its mirror symmetric: you then compute the the and symplectic geometry. Gromov-Witten invariants of the manifold (appear- Since 2008 we have studied general mathemati- ing in topological string theory) [t10/029, t10/099, cal properties of those invariants, as well as many t11/169]. This important conjecture was proved at applications. IPhT in 2012 [t12/030]. These invariants are often easy to compute, whereas – A recent conjecture by Dijkgraaf-Fuji claims (very often) no other method is known to com- that the invariants of a knot (Jones or Homfly poly- pute the expansions beyond leading order. Also, we nomials) are the invariants of the “character vari- proved that for any curve, the invariants can be writ- ety" of the knot, a well-known curve in knot the- ten as string theory-like amplitudes in a target space ory. This conjecture generalizes Kashaev’s famous constructed from the curve (a kind of mirror sym- “volume conjecture". We have checked many cases metric) [t11/045, t11/200]. This allows to represent [t11/134, t12/037]. the topological recursion as a set of rules of cutting – If the curve is the classical energy-momentum surfaces into pieces (see fig. 1) tensor of Liouville CFT, the invariants compute the Applications of this formalism: choose one’s heavy limit expansion of correlators in the quantum favourite statistical physics or geometric enumera- Liouville CFT [t12/075]. tion problem, and look for (guess) the curve whose - Back to RMT: if the curve is the equilibrium invariants will provide the corresponding correlation density of eigenvalues, the invariants yield corre- functions. Most often the curve is a very natural ob- lation functions to arbitrary order; a simple curve ject in the problem. Vice versa, one may choose a yields the Tracy-Widom distribution. favourite plane curve and try to identify the nature - Applications to statistical physics: if the curve of its invariants. is the generating function of rooted planar maps, Here are a few examples: possibly carrying an O(n) loop model, an Ising – Enumeration of 3D partitions: the curve is the model or a Potts model, then the invariants are the Legendre transform of the limit shape (the "arctic generating series of the same model on random maps circle"). Kenyon-Okounkov-Sheffield proved that for of higher topologies [t09/160]. plane partitions in a box, the arctic circle is the 30 Activity Report CEA/DSM/IPhT 2008 — 2013 The nested loop approach to the O(n) loop model on random maps

A longstanding open question concerns the geometry of random maps coupled to a critical matter £model. We make a ﬁrst step in the exploration of this problem via a combinatorial approach.

¢ ¡

Figure 1: A large random planar triangulation endowed with loops (left) and the corresponding typical conﬁguration inside a given loop (right), as seen after ﬂattening.

The essence of two-dimensional quantum gravity By a recursive decomposition of the configura- consists in defining a “sum over surfaces”. A natural tions upon cutting the loops [t11/148] (see Fig. 2), way to make such a sum meaningful is by discretiza- we obtain a set of self-consistent equations for the tion: the partition function is defined as a sum over partition function of the O(n) loop model. This al- triangulations, or their generalizations called maps, lows to recover combinatorially equations previously possibly carrying decorations modelling matter de- obtained via matrix models and to extend them to grees of freedom. One may for instance consider a larger class of models. Several cases are exactly loops (self- and mutually avoiding curves) drawn solvable, allowing a full determination of the phase onto the maps: this yields the celebrated O(n) loop diagram. These include loops with bending energy model, where n is the weight assigned to each loop [t12/013] and the Potts model [t12/055] (classically (see Fig. 1 for a sample configuration). reformulated in terms of loops) for which we demon- Beyond the computation of the partition func- strate the existence of non self-dual critical points. tion and related critical exponents, interesting questions arise when studying the local geometry of large random maps (such as their metric or fractal properties). In the absence of matter (the case of so- called pure gravity), the situation is by now well understood: the universal scaling limit, the Brown- ian map, has been rigorously defined and many of its properties studied (its Hausdorff dimension is 4, the law of the distances between up to three random points is known exactly, etc). In contrast, almost nothing is known when matter is added to the picture and, in particular, there are several contra- dictory predictions for the Hausdorff dimension at a Figure 2: Recursive decomposition of the configuration matter critical point. of Fig. 1 into a gasket (top), loop rings (middle) and Recently, Le Gall and Miermont introduced a internal configurations (bottom). model of random maps with non generic scaling Most interestingly, our approach shows that the limit, whose Hausdorff dimension may vary between gasket of a critical loop configuration (the map ob- 2 and 4. Their model does not however rely on tained after erasing all loop interiors) falls into the adding matter to the surfaces but requires instead class studied by Le Gall and Miermont, with a non the fine-tuning of infinitely many parameters. In a generic scaling limit. A simple relation between the series of papers [t11/148, t12/013, t12/055], we show loop weight n ∈ [−2, 2] and the gasket Hausdorff that the same model emerges spontaneously at crit- dimension is deduced [t11/148]. ical points of the O(n) loop model on random maps. Highlights 31 Liouville Quantum Gravity & KPZ

In 1988, Knizhnik, Polyakov and Zamolodchikov discovered the celebrated KPZ relation between critical exponents in a planar statistical system and their counterparts in Liouville quantum ¨ gravity. Twenty years later, this relation has been proven rigorously, and in a broader context. A canonical relation to the Schramm-Loewner Evolution (SLE) is also established. Liouville quantum gravity (LQG), intro- relation. The probabilistic proof rests in particu- © duced by Polyakov in 1981, is a canonical way to lar on a crucial Brownian property of the GFF: for produce a random or “quantum” geometry from the fixed z, the circle average hε(z) is standard Brown- Gaussian (massless) free field (GFF). It is believed ian motion Bt in time t := − log ε, so that the KPZ to be the universal, conformally invariant, scaling relation appears as a Brownian exponential martin- limit of random planar maps, possibly including crit- gale property. This proof places the KPZ formula ical statistical models. One replaces the area mea- in a broader context than the original approach: it sure dz on a planar domain D with the random mea- is valid for any fractal set sampled independently γh(z) sure µγ = e dz, where γ ∈ [0, 2) is a universal of the GFF and for any γ < 2. For γ > 2, the parameter and h is an instance of the zero or free measure develops atoms with localized area corre- boundary GFF on D. The GFF h has logarithmic sponding to Liouville quantum bubbles (“baby uni- spatial correlations, and is a distribution, not a func- verses”) of dual parameter γ0 = 4/γ < 2; this Li- tion, that is almost surely infinite. One must resort ouville quantum duality is given a first mathemati- to regularization: the quantum measure µγ is the cal meaning in [t09/033, t09/290, t09/291], together limit for ε → 0 of regularized quantities where h(z) with a probabilistic proof of a dual KPZ relation. is replaced by hε(z), the mean value of h on the cir- The last critical γ = 2 case is rigorously solved in cle of radius ε centered at z [t08/047]. A quantum [t12/145, t12/148]. boundary length measure νγ is similarly constructed. ft ( 0 ) D w=ft ( z )

f (x ) f (x’ ) t h ( z ) t x’ 0 x 0 Figure 2 Liouville quantum gravity and Schramm-Loewner Evolution.— In a companion work with S. Sheffield [t10/223], LQG and SLE, the conformally invariant models for random paths and surfaces, are related in a canonical way (Fig. 2). When two boundary seg- 0 ments of equal quantum lengths νγ [0, x] = νγ [x , 0] are conformally welded (glued) to each other, the Figure 1 resulting interface√ is a conformally invariant path, an SLE for γ = κ < 2. This establishes the sec- The KPZ relation.— This celebrated prediction κ √ √ √ ond KPZ relation γ = ( 25 − c− 1 − c)/ 6 < 2 in from 1988 that critical phenomena in the plane are terms of the central charge c = 1 (6−κ)(6−16/κ) < 1 directly related to their counterparts in quantum 4 of the SLE conformal field theory. We develop the gravity. Twenty years later, with S. Sheffield, we κ theory of quantum fractal measures (consistent with have rigorously proven this relation in LQG. Con- the KPZ relation) and analyze their evolution un- sider the quantum scenery in Fig. 1: the square D is der conformal welding via the introduction of ex- divided into a multitude of small Euclidean squares plicit SLE related exponential martingales; the lat- D , all of small similar quantum areas µ (D ) = δ, i γ i ter play the role (now made mathematically rigor- but of wildly differing Euclidean areas ε2. The i ous) of the so-called “gravitational dressing” of con- probability that an independent random fractal set formal operators in a CFT coupled to LQG. As an (a path in Fig.1), of fractal (Hausdorff) dimension application, one constructs the quantum length and d ≤ 2, intersects any D then scales as ε2−d. In i i quantum boundary intersection measures on the SLE [t08/047, t09/033] we prove that, on average, these curve itself. For instance, the average SLE quan- probabilities scale as δ∆ in terms of the quantum κ tum length contained in any domain D (Fig. 2) is area δ, with a quantum scaling exponent ∆ given explicitly ν (D) = R (sin arg z)8/κ−2dz. by 2 − d = 2 − γ2/2 ∆ + γ2∆2/2, i.e., the KPZ γ D 32 Activity Report CEA/DSM/IPhT 2008 — 2013 Cluster algebras: integrability, combinatorics and statistical physics

The theory of cluster algebras is a powerful machinery that applies to many diﬀerent ﬁelds such as geometry, algebra, combinatorics and physics. We have investigated a large class of discrete ¨ integrable systems that are part of cluster algebras, and found that an elusive positivity conjecture becomes immediate once solutions are expressed as partition functions for statistical models of non-intersecting paths or dimers on graphs.

n+!

!+1

2! −1 2(n−!) 2! −1 "0 2n+2 ! −2 "M

Q-system solutions. Each initial condition (data), associated with a vertex of a cluster tree, determines a target graph and its edge weights. The corresponding cluster variables are expressed as partition functions for non- intersecting paths on the corresponding target graph. Cluster algebra mutations modify the target graph and the weights locally, resulting in different configurations. This is illustrated here with two particular vertices of the Q-system cluster tree. For each vertex we have represented the target graph on the right (Γ0, ΓM ), and a sample non-intersecting path configuration on the left. Both partition functions evaluate to the same solution of the Q- system, expressed in terms of two different sets of initial data. In both cases the paths are in bijection with the domino tilings of plane domains, with possible defects (pink squares).

Cluster algebras are dynamical systems describ- tilings with possible defects. This identification al- ing the evolution of data (cluster variables) defined lowed us to prove the cluster algebra positivity con- at the vertices of an infinite regular tree, via ra- jecture in a number of cases. tional transformations (mutations) along the edges. Cluster algebras have quantum counterparts The axioms of cluster algebra guarantee that all vari- closely related to quantum groups, which describe ables in the tree are Laurent polynomials of initial the evolution of q-commuting data. These allow to data at any given vertex, furthermore conjectured define quantum versions of Q- and T-systems, still in general to have only positive integer coefficients displaying a form of integrability. We proved that (the cluster positivity conjecture). Many applica- solutions of such systems can be used to compute tions have been found since their discovery by Fomin fusion products for quantum group representations and Zelevinsky in 2000: in hyperbolic geometry, cat- [t13/183] and elucidate the known fermionic formu- egory theory, quiver representation theory, (quiver) lae for fusion multiplicities. gauge theory, brane tilings, string theory, quantum groups, discrete integrable systems, combinatorics, We extended our analysis to a fully noncommu- etc. tative setting, by using noncommutative weights and We have shown that a class of discrete integrable quasi-determinants, objects arising in the solution of systems (Q- and T-systems), first introduced in the noncommutative left linear systems. This allowed us study of integrable quantum spin chains, are parts to prove a cluster positivity conjecture for the A1- of cluster algebra structures [t08/255]; the Lau- type Q-system, due to Kontsevich [t09/236], and to rent polynomials are partition functions for weighted derive a noncommutative version of the discrete Hi- combinatorial objects such as paths, tilings or plane rota equation [t10/119]. These extensions should partitions [t08/256]. This is illustrated in the fig- lead to a formulation of statistical models with non- ure: the A-type Q-system solution is interpreted in commutative Boltzmann weights, and to a form of terms of non-intersecting paths, equivalently domino noncommutative integrability. Highlights 33 Extreme conformal field theories

Modern problems in condensed matter physics, statistical mechanics and the AdS/CFT duality involve ‘extreme’ conformal ﬁeld theories in 2D, which are typically nonunitary and noncom- ¨ pact. Important progress in their study has been obtained in the last few years using lattice regularizations and quantum symmetries, combined with tools from representation theory and integrability, as well as numerical simulations.

Despite the immense success of conformal field approach to this problem based on lattice regu-© theory (CFT), experimental applications have been larizations and intensive use of quantum symme- surprisingly few. Indeed, most of the results rely on tries, combined with tools from representation the- the assumption of unitarity, which is natural from a ory and integrability, as well as numerical simula- quantum field theoretic point of view, but less so for tions. This combination of the concrete and the ab- condensed matter physics or statistical mechanics. stract, dubbed associative algebraic approach In these cases – which include the description of the to LCFT has led to major progress. transition between plateaux in the integer quantum Another crucial aspect for physical applications Hall effect (IQHE) and other (2+1)D topological in- is the noncompactness of the target space. This has sulators, or the properties of critical been also very hard to understand due to the technical difficulties of solving noncompact spin chains. Recently however, we discovered a way to construct compact spin chain regularizations of noncompact CFTs. We were able to obtain a lattice model for the SL(2,R)/U(1) black hole sigma model, and to ‘measure’ the density of states [t12/234], in full agreement with the string theory results. Extreme CFTs are thus getting finally under control.

The Renormalization Group ﬂow for the IQHE. Fixed points can be described in terms of a noncompact super- group sigma model at topological angle θ = π. geometrical objects like polymers or percolation in 2D — nonunitarity is in fact the rule. While its physical origin is clear — average over disorder, or nonlocality of the geometrical constraints — its con- The density of states as a function of the (continuous) sequences are deeper and worse than initially re- spin in the SL(2,R)/U(1) black hole sigma model, de- alized. In most cases, nonunitarity indeed implies termined by the Bethe ansatz. indecomposability: the allpowerful, conformal symmetry now acts via representations which are not Early applications of the work have been plenty, in- fully reducible, giving rise in particular to logarith- cluding the discovery of logarithmic correlations in mic contributions to operator product expansions the percolation problem, the determination of (irra- and correlation functions, and thus to so-called Log- tional) critical exponents for edge states in topologi- arithmic Conformal Field Theories (LCFT). cal insulators, or the determination of the spectrum Attempts at tackling LCFTs by general, con- of superprojective sigma models. The methods and structive methods, have never quite succeeded, de- results are also highly relevant to the study of sigma spite a lot of work. In the last ﬁve years (see models with internal supersymmetry arising on the [t13/113] for a short review), we developed a new AdS side of the AdS/CFT duality. 34 Activity Report CEA/DSM/IPhT 2008 — 2013 Integrability and the N = 4 gauge theory

The N = 4 supersymmetric gauge theory became a laboratory to study strongly interacting quantum ﬁeld theories, in particular their relations with string theory through the AdS/CFT correspondence. There is very strong evidence that in the planar limit the theory is integrable. Integrability is a powerful nonperturbative tool, which could lead to a full solution of the theory for any coupling constant. The spectrum of anomalous dimensions is encoded by thermodynamic Bethe Ansatz-like equations, and the information about correlation functions, Wilson loops and gluon amplitudes is also obtained from integrability.

The supersymmetric gauge theory with maximal the link with the O(6) nonlinear sigma model supersymmetry in 3+1 dimensions, or N = 4 SYM, [t08/220, t08/220], the discovery of the duality be- is a nontrivial theory, which captures some of the tween gluon amplitudes and Wilson loops made of main features of quantum chromodynamics (QCD). segments on the light cone [t11/034], the relation be- But unlike QCD the theory is conformally invariant tween correlation functions and amplitudes/Wilson for all values of the coupling constant. According loops [t10/091, t09/102, t10/092, t10/139, t11/036, to the Maldacena conjecture, this gauge theory is t11/037], or the discovery of the dual superconfor- equivalent to a string theory living in the curved mal symmetry [t09/076, t10/013], which is closely 5 spacetime AdS5 × S . In the planar limit, when the related with integrability. Concerning the correla- number of colours tends to inﬁnity, the theory is be- tion functions, let us point out the calculation of the lieved to be integrable. four-point function of the energy-momentum ten- Integrability allows to go beyond the perturba- sor [t11/176, t12/005] up to four loops. Further- tive regime, both on the string and the gauge the- more, using the correspondence with spin chains (see ory side, and provides techniques to compute the Fig. 1), explicit expressions were obtained for the spectrum of anomalous dimensions (or string en- tree-level three-point functions of long operators in ergies) for any coupling constant. The basic idea the su(2) [t09/284] and su(3) [t13/034] sectors of the is that the traces of products of fundamental ﬁelds gauge theory, and the one- and two-loop corrections can be associated with the states of a quantum spin in the su(2) sector [t12/033, t13/110]. chain. In the simplest case the spin chain is the isotropic Heisenberg magnet. Methods used in integrable models, like the Bethe Ansatz, are being developed to determine other basic objects of the theory: correlation functions, gluon amplitudes and Wilson loops. The goal is to obtain a complete description of the theory for any coupling constant, and eventually use this knowledge for more realistic theories like QCD.

θ(1)+i /2 }

Figure 2: Weak and strong coupling results for the di- u } mension of the Konishi operator.

22 22 2 222 An object of particular interest is the Konishi operator, the simplest operator not protected by supersymmetry. Computing the dimension of the

1 1 1 1 1 22 2 2 Konishi operator represents an important test of the 1 AdS/CFT conjecture and of the integrability of the v w 1 } 1 theory. We have calculated this dimension up to } } 1 1 1 1 1 1 1 111

} five loops in the gauge theory [t12/014], and by us- } θ(3)+i /2 θ(2)+i /2 ing integrability up to six loops in the weak coupling regime [t12/085], respectively one-loop in the strong Figure 1: The three-point function in the su(2) sector in coupling regime [t11/017]. The results are in perfect terms of configurations of the six-vertex model. agreement among themselves, with the string theory Our institute has made important contributions predictions, and with the numerical computations to the field. Let us mention the solution of the interpolating between weak and strong coupling (see strong coupling Bethe equations [t08/094, t09/044], Fig. 2). Highlights 35 A de Sitter landscape?

Constructing de Sitter vacua remains one of the major open problems in String Theory. The most generic proposal starts from an anti-de Sitter solution, and argues that one can transform it into a long-lived metastable de Sitter solution by placing appropriate branes and fluxes. This mechanism can in principle be used for any combination of fluxes, giving rise to a huge landscape of string theory de Sitter vacua. The string theory group at IPhT has shown that taking into account the backreaction of the branes always makes the solution singular, which, in the absence of a string theory resolution, seems to invalidate the whole mechanism. This (unexpected) result suggests that string theory does not admit a landscape of de Sitter vacua. The constants entering in the physical laws gov- Unfortunately, all the possible universes thus ob- erning our Universe fit in a very small window, which tained have a negative cosmological constant (and allows the possibility of intelligent life forms. Under- hence an Anti deSitter (AdS) geometry), as opposed standing why this is so is one of the big questions to our own universe, which admits a small positive that puzzles our conception of the world. One per- cosmological constant and is thus of de Sitter (dS) spective on this question, often dubbed "anthropic geometry. To obtain a landscape of dS universes principle," claims that our universe is but one of a one needs to uplift the cosmological constant of the multitude of universes (a multiverse) which admit AdS compactifications; so far the only known mech- all possible physical laws, but only some of these anism to do so is to add objects with (D-brane) universes, e.g. the one we happen to live in, support charges of sign opposite to that of the background. intelligent life. Many famous scientists, like Hawking The best studied model is the so-called Klebanov- or Linde, have invoked String Theory as supporting Strassler (KS) warped deformed conifold; anti-D3 the existence of a multiverse. branes placed in this solution have been argued by String Theory is the most compelling candidate Kachru, Pearson and Verlinde to be metastable, and for a theory that unifies all four interactions ob- became the key ingredient in the KKLT mechanism served in nature, thus realizing Einstein’s dream for uplifting AdS vacua and producing a landscape of a "theory for everything." However, String The- of dS universes. ory lives in ten dimensions, so to obtain real-world Our team at IPhT has been pursuing a vigorous physics one needs to compactify it on certain 6D programme over the past four years, trying to check compact spaces (Calabi-Yau manifolds), whose sizes the validity of this mechanism. First working at lin- are much smaller than any scale accessible to ob- ear order in the ratio betwen brane and background servations. As shown by Kachru, Kallosh, Linde charges, we found that the solution correspond- and Trivedi (KKLT) the overall size of the man- ing to anti-D3 branes in KS presents a singularity ifold is fixed by an interplay between classical ef- [t09/237, t10/174, t11/019, t11/157]; this singular- fects (fluxes) and quantum effects (membrane in- ity remains present at all orders in the charge ratio stantons). Since there exist many Calabi-Yau mani- [t12/199]. We have also attempted to resolve this folds, and a huge number of possibilities of equipping singularity through brane polarization [t13/080], or them with fluxes, one obtains a plethora – of order to cloak it by a black hole horizon [t12/198]. Alas, 10500 – of string theory flux compactification to 4D; none of these "patches" could resolve the singularity, they can be thought of as a string theory realiza- which strongly indicates that anti-D3 branes placed tion of the multiverse. Each vacuum corresponds to in backgrounds do not lead to metastable states. We at local minimum of a 4D flux-dependent potential, have analyzed other species of branes in String The- whose shape depicts the landscape of vacua. ory, yet we always obtained similar singular solutions [t12/036, t13/079, t10/069, t11/199, t13/039, t11/172]. The stakes raised by our investigations are very high. If anti-branes cannot coexist with backgrounds of opposite charge, this invalidates the KKLT mechanism for uplifting AdS vacua to dS ones, and implies that string theory does not admit a landscape (multiverse) of vacua with a small positive cosmological constant. Most of the research done over the past few years on viable cosmological scenarios in string theory would need to be seri- ously revisited, opening the door for new inventive An illustration of the string theory landscape paradigms. 36 Activity Report CEA/DSM/IPhT 2008 — 2013 Cosmology and particle physics 37 Cosmology and particle physics The activities in cosmology and particle physics at IPhT are shared between three subgroups with overlapping interests. The first one comprises research in strong interaction physics, i.e. QCD in its perturbative and non-perturbative regimes, and more formal aspects of gauge theories such as thermal properties or dualities involving extended super- symmetries. Cosmology is also represented with studies on both the early and the late time Universe, i.e. from inflationary models and their features to the non-linear properties of large scale structure. Dark energy, large scale magnetic fields and gravitational waves are also of particular interest. Finally physics beyond the standard models covers both particle physics aspects, such as the electroweak symmetry breaking and beyond, flavour physics and supersymmetry breaking, as well as topics of cosmological origin such as leptogenesis, dark matter and its detection, or modified gravity versus dark energy models.

QCD and Gauge Theories The study of strong interactions is a very active and diverse activity at the IPhT. Our activities cover a broad spectrum of research topics, ranging from the study of amplitudes in perturbative QCD, through jet algorithms applicable both to particle-physics and heavy- ion collisions, to finite-temperature gauge theory, heavy-ion collisions, and the Color Glass Condensate. The study of amplitudes in gauge theories has developed into a rich and exciting subfield of particle physics, in which our group plays a visible role. We have brought important contributions to the development of new, so-called on-shell, techniques for computing amplitudes. These avoid the need for Feynman diagrams and allow for practical computations at far higher multiplicity or loop order than the traditional techniques. The study of amplitudes in the N = 4 supersymmetric gauge theory forms an integral part of this line of research. This theory has served as a laboratory for developing techniques and understanding new structures and symmetries, such as dual superconformal invariance. Our group’s activity ranges from formal studies to practical applications to LHC physics. We have worked to refine and extend this new class of techniques to massive one-loop amplitudes and to higher loop orders. We have developed software libraries that apply these techniques to the computation of one-loop amplitudes of interest for Standard-Model studies at the LHC. We have participated in a theory collaboration (BlackHat) that has used such a library to pursue next-to-leading order calculations with many jets for LHC studies. Another related area of study is the development of new jet algorithms. These are important tools in the experimental study of QCD at high energy colliders such as the LHC in order to make the contact between perturbatively calculable cross-sections, in terms of quarks and gluons, and the actual measurements that see only hadrons. Any suitable jet algorithm must be infrared and collinear safe. In addition, the very large particle multiplicity in final states at the LHC (both in particle-physics and heavy-ion collisions) makes it crucial that these algorithms be computationally efficient. We have played a central role in developing new jet algorithms, such as the kt and anti-kt algorithms, that are now used by the major experimental collaborations at the LHC. An important domain of research at the IPhT is the study of the Color Glass Condensate, an effective theory for the study of hadronic and nuclear wave functions in the high energy regime, where gluon saturation effects become important. These effects are crucial for instance for a first principles study of particle production in nucleus-nucleus and proton- nucleus collisions at high energy. Our group has pioneering works in this domain, with several renowned contributions. Our recent activity covers both formal aspects that aim 38 Activity Report CEA/DSM/IPhT 2008 — 2013 at developing the formalism and justifying its applicability to high energy collisions (e.g. via factorization theorems that relate various types of reactions, and analytic solutions for the JIMWLK equation which governs the high-energy evolution of the cross-sections), and phenomenological studies whose goal is to confront the predictions of the Color Glass Condensate effective theory to experimental results at HERA, RHIC or the LHC. In heavy ion collisions at high energy, the experimental results for bulk observables suggest that the quark-gluon matter produced in these collisions can be described as an almost frictionless fluids in expansion and can be modelled using relativistic hydrodynamics. An important observation is that the final anisotropy of the momentum of the observed particles can be related via the hydrodynamical evolution to the initial shape anisotropies of the system. Our group has played a major role in developing practical methods for mea- suring the parameters that quantify these anisotropies in the data. Another major result has been the realization that event-by-event shape fluctuations are an essential ingredient in interpreting these results. Our team has also worked on some more formal aspects of relativistic hydrodynamics, by obtaining exact solutions in some special cases. The last four years have seen the appearance of new domains of application of the AdS/CFT correspondence (and more generally gauge-gravity dualities). While these ideas were so far employed in order to study formal properties of gauge theory amplitudes, these techniques have now made an incursion into the territory of the phenomenology of quark- gluon matter at high temperature, such as the matter produced in heavy ion collisions. These studies deal with the conformal N=4 SUSY rather than QCD itself, but it is believed that some of their properties at strong coupling are quite close to those of QCD, notably at finite temperature. Thanks to such techniques, we have studied at strong coupling important questions such as the rapid approach towards thermal equilibrium, the validity of the parton picture, the energy loss of a heavy quark in a plasma, the properties of meson bound states in hot matter, and the viscosity of the quark-gluon plasma.

Cosmology Cosmology is a very active research topic at the IPhT with works in this field ranging from the early Universe (e.g., inflationary scenarios) to the large-scale structures observed in the present Universe. A traditional area of expertise in Saclay is the study of the formation of large-scale structures from which one can infer complementary constraints on the background cosmology and primordial fluctuations. This requires precise predictions, up to 1% on weakly nonlinear scales, to reach the accuracy of future surveys (e.g. Euclid) and has led to a recent surge of activity in perturbation theory and the development of new resummation schemes providing more accurate predictions. These approaches can be applied to non- Gaussian initial conditions and combined to phenomenological models to cover the highly nonlinear regime of some modified gravity models. Another major topic of modern cosmology is the generation of primordial fluctuations during inflation. Alternative models to single-field inflation can give rise to significant non- Gaussianities. Nonlinear contributions to higher-order correlations in single-field models have been uncovered and non-Gaussianities generated in multi-field models, including both gravity and non-gravity induced couplings, have been unraveled. We have also studied in detail the signature of this primordial signal on the low-redshift large-scale structures, using both analytical tools and numerical simulations, thus estimating the constraints on scale-dependent non-Gaussianities. A particularly important probe of the early Universe would be the detection of a stochastic background of gravitational waves (GW) of primordial origin. We have analysed the Cosmology and particle physics 39

GW signal generated by a first order phase transition, showing that the proposed space in- terferometer eLISA could detect electroweak symmetry breaking effects in the energy range 0.1-100 TeV, thus probing energy scales beyond the reach of current particle accelerators. We have also worked on the origin of primordial magnetic fields and found that the seeds for the ubiquitous magnetic fields detected on cosmological scales could be formed in the early Universe. We have also built a detailed model for the evolution of magnetic fields in the primordial plasma, obtained new constraints on possible generation mechanisms and evaluated its impact on the Cosmic Microwave Background (CMB). Another rich subject of current cosmology is the study of the CMB anisotropies. We have computed the main contributions at second order to the CMB fluctuations, as well as the full second-order bispectrum, by a consistent implementation of the Boltzmann equation. We have written a CMB code up to second order which will be valuable to the community. We have also computed the cosmic shear to second order, including all relativistic effects and without relying on small-angle approximations. We have also estimated the sensitivity of weak lensing observables on primordial non-Gaussianities. Finally, in an attempt to understand dark energy, we have studied quintessence models with a vanishing sound speed for which dark energy clusters and affects the formation of large-scale structures.

Beyond the standard model The research activities in particle physics beyond the Standard Model take place in a particularly rich experimental context: the Large Hadron Collider (LHC) at CERN is currently exploring the terascale and has already shed some light on the electroweak symmetry breaking sector; neutrino and flavour physics experiments are providing us with complementary information about the flavour structure of the physics relevant at high energies; a variety of astroparticle physics experiments are constraining the properties of dark matter and may help us, in conjunction with the LHC, to identify its nature; and finally, cosmological observations are delivering more and more accurate information about dark energy or a modification of gravity. An important part of our research activities concerns the dynamics of the electroweak symmetry breaking and its signatures at the LHC. For generic models in which the Higgs boson arises as a pseudo-Goldstone boson, the top quark has fermionic partners, whose production at the LHC has been studied in detail. All the composite models for two Higgs bosons have been studied and we have found the most promising as well as the simplest one. Effective field theories have been used to interpret the anomalously large forward-backward asymmetry in tt¯ production measured at the Tevatron, and to assess the sensivity of top quark collider observables to new physics. Simulations of specific observables like four-top production were also performed. Deviations from the standard Higgs mechanism such as double Higgs production or spin-1 resonances of the electroweak gauge bosons have also been studied. The dynamics of the electroweak phase transition are very sensitive to the details of the electroweak symmetry breaking process. We have studied electroweak bubble nucleation when the Higgs boson is a composite bound state from a strongly interacting sector, and showed that the associated signal in gravity waves can be large. We have also studied the hydrodynamics of bubble growth in a first-order phase transition, which is relevant both for electroweak baryogenesis and for the size of the gravity wave signal resulting from bubble collisions. Flavour and neutrino physics is another active line of research. This includes attempts to understand the observed pattern of fermion masses and mixing angles; the study of new physics contributions to flavour-changing processes; and phenomenological analyses 40 Activity Report CEA/DSM/IPhT 2008 — 2013 of neutrino oscillations. Supersymmetry breaking and its mediation to the observable sector have been investigated in the framework of gauge-mediated supersymmetry breaking. Issues like the metastability of the supersymmetry breaking vacuum and the possibility of simultaneous gauge and supersymmetry breakdown in Grand Unified theories were studied. A much strengthened line of research in the last few years has been at the intersection between particle physics and astrophysics and cosmology, in particular leptogenesis, dark matter and dark energy. Baryogenesis via leptogenesis has been studied in the framework of Grand Unified theories, focusing on the possibility of generating the observed matter- antimatter asymmetry in SO(10) models and on the connection between leptogenesis and measurable neutrino parameters. Our research activity on Dark Matter has both pursued a model-building direction (e.g. with the construction and the exploration of the Minimal DM model) and a model-independent analysis of recent puzzling cosmic ray observations. In the latter, the results we obtained have greatly helped in shaping the understanding of the properties that dark matter must have to be able to explain the observations, and their associated constraints. Dark energy and screened modified gravity have been studied using a formalism which unifies all models of the chameleon, dilaton or symmetron types. This has led to N-Body simulations of these screened modified gravity models which have also been compared to semi-analytic predictions. Local effects of modified gravity have also been studied with experiments currently looking for these deviations from the standard model (Casimir effect and bouncing neutrons). Highlights 41 Precision predictions for collider processes with multiple jets

Next-to-leading order calculations in perturbative QCD are required to obtain quantitative pre- §dictions for Standard-Model processes relevant to the LHC. The BlackHat collaboration has ¤ exploited the advent of new ‘on-shell’ techniques to drive an ‘NLO revolution’ for high-multiplicity jet calculations for LHC physics. The ATLAS and CMS experiments at the Large to compute the required one-loop amplitudes nu- ¦ ¥ Hadron Collider (LHC) at CERN discovered a merically, and applying them to high-multiplicity Higgs-like boson last year, ﬁlling out our knowledge NLO computations of electroweak boson produc- of the Standard Model’s particles. They remain at tion accompanied by three [t09/078, t10/040], the frontier of searches for new physics beyond the four [t10/111, t11/255], and ﬁve jets [t13/114]. Standard Model. Their program includes both di- These are important Standard Model backgrounds rect searches for new physics, such as supersymmet- at the LHC. ric extensions or compositeness, and precision stud- 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 -1 -1 10 10

LO ^ % + ies of the Higgs-like boson, of the top quark, and of µ = µ = H’ / 2 s = 7 TeV W + 5 jets + X BlackHat+Sherpa NLO R F T $ -2 -2 self-interactions of the electroweak vector bosons. 10 10

-3 -3 Because the LHC is a proton-proton collider, the 10 10

initial states in short-distance collisions are actually [ pb / GeV ] T

p -4 -4 10 10

/ d jet jet

the partons (quarks and gluons) inside the protons. ! pT > 25 GeV, | " | < 3 d e e -5 E > 20 GeV, | " | < 2.5 -5 10 T 10 This means that all important processes at the LHC # W NLO scale dependence ET > 20 GeV, MT > 20 GeV R = 0.5 [anti-k ] LO scale dependence — potential signals as well as Standard Model back- T 3.5 LO / NLO 3.5 grounds — involve QCD interactions. These short- 3 3 distance processes induce large momentum transfers 2.5 2.5 2 2 compared with the QCD scale of 1 GeV. Accordingly, 1.5 1.5 1 1 they can be computed order-by-order in perturba- 0.5 0.5 tion theory. In order to define the coupling one must 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 First Jet pT [ GeV ] Second Jet pT [ GeV ] Third Jet pT [ GeV ] Fourth Jet pT [ GeV ] Fifth Jet pT [ GeV ] introduce a renormalization scale; and to define the parton distribution functions, giving the probability The figure (drawn from [t13/114]) shows a re- of finding partons inside the proton, one must intro- cent example of W + + 5-jet production at the LHC. duce a factorization scale as well. Physical predic- The upper panels show the transverse momentum tions should of course be independent of these scales, (pT) spectra of the leading five jets, ordered from but a residual dependence remains at fixed order in left to right in decreasing pT. The LO predictions perturbation theory. Because the QCD coupling αs are given by the dashed curves, while the NLO ones is relatively large, and because it runs quickly, the are given by the solid curves. The spectra fall more residual dependence is large at leading order (LO) steeply as one moves to lower-pT jets, because forc- in perturbation theory, sufficiently so to make pre- ing up a given jet’s pT also forces up that of higher- dictions quantitatively unreliable. This problem is pT jets, raising an event’s overall center-of-mass en- exacerbated when considering processes with many ergy more quickly and correspondingly decreasing jets in the final state, which carry a high power of its cross section. αs. The wide dynamical range probed by the calcula- Next-to-leading order (NLO) in perturbation tion forces us to choose renormalization and factor- theory is the first order at which quantitatively re- ization scales independently for each event. This still liable predictions are possible. At this order, vir- leaves room for varying the scales; the corresponding tual corrections from one-loop matrix elements in- uncertainties are conventionally assessed by varying troduce a compensating dependence on the renor- them up and down by a factor of two. The lower malization scale, dramatically reducing the sensitiv- panels show the ratio of the predictions to the NLO ity on unphysical parameters to a 10-15% residual predictions, when varying scales: the hatched band level. The computation of the required one-loop am- shows the LO variation, and the shaded band, the plitudes, particularly for processes with more than NLO variation, the dashed curve shows the LO pre- one or two final-state jets, had posed an obstacle for diction. The LO band is large, allowing a factor of a long time. two up or down from the central value, while the A new generation of ‘on-shell’ techniques has NLO variation shrinks to 10–15% over most of the broken through this bottleneck. The BlackHat range. collaboration, which includes members of the IPhT, Both the ATLAS and CMS collaborations are has lead an ‘NLO revolution’, developing techniques using our calculations to compare with their data. 42 Activity Report CEA/DSM/IPhT 2008 — 2013 Jet clustering at the LHC

Jets are fundamental objects in collider physics and in particular at the LHC. In a series of recent works, we have laid the framework that is currently used by all the LHC experiments ¨ to reconstruct jets: the anti-kt algorithm used to deﬁne jets, the FastJetpackage providing a standard interface to jet clustering and the area-median subtraction method that corrects for soft background (pileup) contamination.

A jet can be seen as a proxy for a parton, quark sion 3.0.3 was released in June 2012, and we recently© or gluon, produced in the final state of a high-energy opened a “contrib space” providing a common loca- collision. Since, in QCD, partons have a large proba- tion for third-party extensions of FastJet. bility to emit further partons at small angles, a hard parton produced in the final state of a collision will develop into a collimated shower of partons; the jet is meant to capture that shower, giving an access to the original hard parton. In practice, jets are obtained by applying a jet definition, which takes as an input the final-state particles, and clusters them into jets. A jet definition contains both the recipe for clustering and adjustable parameters. A typical parameter is the angular opening of jets, often denoted by R, which controls the maximal angle for which two particles are considered collinear and part of the same jet. Example of anti-kt jets and their areas. Over the last 30 years of collider phenomenology, a dozen different jet definitions have been used. The last part of this framework is related to In 2007-08, we have shown that the jet definitions pileup: with the LHC operating at high luminos- commonly used at the Tevatron, as well as the ones ity, many pp collisions happen during a single bunch proposed for the LHC, suffer from an infrared-and- crossing — ≈30 on average at the end of Run I collinear unsafety, i.e. lead to infinite cross-sections — resulting in an important soft hadronic activity, when computed at a large enough order of the per- mostly uniform in the detector. This has two drastic turbation theory. The breakthrough was to provide consequences on jet reconstruction: a shift in energy new algorithms, with behaviours similar to the al- due to the overall pileup activity, and a degradation gorithms they were going to replace, but free of of the energy resolution due to nonuniformities in these unwanted divergences. This was done under the activity in a given event and to the overall pileup the form of the SISCone and anti-kt algorithms activity fluctuations between different events. The [?, t08/319]. This is a major achievement since the LHC subtracts the pileup contamination to jets us- anti-kt algorithm has been adopted as a default by ing a method based on jet areas [t08/320] and a all the LHC experiments1. The main property of median approach to provide an event-by-event es- the anti-kt algorithm is that the hard jets are circu- timation of the pileup activity. The main advan- lar and resilient to soft radiation. tage of this method is that it corrects for the overall In practice, except for situations with very few shift in energy, but also gets rid of the fluctuations particles, one needs to rely on numerical implemen- between events. This method has been extensively tations of the jet definition. The FastJet package studied, and shown suited for both pileup subtrac- [t11/294] has been initially designed to provide fast tion in p-p collisions [t12/305] and Underlying Event implementations of recombination clustering algo- subtraction in P b-P b collisions [t10/298]. It has also rithms (including anti-kt) and has now grown into been extended in many important directions, includ- the standard interface for jet manipulation. This ing positional dependence [t12/305, t10/298], appli- includes a plugin system for commonly used jet def- cation to the fragmentation function [t13/118] (in initions, support for jet areas and background sub- heavy-ion collisions) and jet shapes [t12/304] exten- traction (see below), tools for advanced jet manip- sively used in quark-gluon discrimination or boosted ulation as well as an interface for developing third- jet tagging. party tools. FastJetbeing used in many places (e.g. In summary, our series of works sets the standard high-level triggers in ATLAS and CMS), a great ef- for jet clustering, solving longstanding issues in the fort is put towards keeping improving FastJet. Ver- field and allowing efficient jet clustering at the LHC. 1 Jets being used in about 60% of the LHC papers, anti-kt has become a standard tool in particle phenomenology. With more than 600 citations in 2012, [t08/319] is the seventh most cited paper in high-energy physics in 2012. Highlights 43 Initial state factorization in heavy ion collisions

High energy heavy ion collisions present new challenges to Quantum Chromodynamics, because §they involve a large number of quarks and gluons in their initial state. Some factorization results, ¤ that were known to be valid in the low parton density regime, have been extended to the nonlinear dense regime that prevails in heavy ion collisions. Heavy ion collisions at ultra-relativistic ener- the same transverse (relative to the collision direc- gies,¦ performed at the RHIC (Brookhaven) and at tion) position contribute coherently to this density.¥ the LHC (CERN), probe nuclear matter under ex- In the dense regime, also known as the gluon treme conditions of density and temperature. At saturation regime, a typical collision involves inter- sufficiently large collision energy, one may expect actions between many partons — mostly gluons — that the theoretical study of these collisions would from each projectile, as illustrated in Fig. 1, right. be amenable to controlled calculations in Quantum The dense regime differs from the dilute one by two Chromodynamics, thanks to the asymptotic freedom important complications: (i) one needs to know the property of the strong coupling constant. probability of multi-parton configurations in the col- In collisions involving simpler projectiles, such liding projectiles, and (ii) one needs to sum an in- as protons, the projectiles are described by single finite set of diagrams, at each order in the cou- quark and gluon distributions, that depend on the pling constant. It is possible to do this by using fraction of the total proton momentum they carry the Color Glass Condensate effective description, in and on the resolution scale at which the proton is which the fast partons are described as classical color probed in the collision. The usefulness of this de- currents along the trajectories of the two projec- scription stems from the universality of the parton tiles (see [t10/066, t10/150] for reviews). In this distributions: they are an intrinsic property of a framework, the single parton distributions encoun- given projectile, and do not depend on the nature tered in the dilute regime are replaced by function- of the second projectile involved in the collision, nor als giving the probability of a given configuration of on the nature of the observable being measured. The these color currents, that can be viewed as multi- possibility to break down a cross-section into a con- parton distributions for a dense hadron/nucleus. In volution of two universal parton distributions with [t08/068, t08/116, t08/232] we have also developed matrix elements that describe the interaction at the powerful techniques to organize the calculations in quark-gluon level is known as “factorization”. Uni- the dense regime; we have shown that these gener- versality and factorization are essential, since they alized distributions are also universal, and that the allow to use the parton distributions gathered in a expectation value of inclusive observables can be fac- given reaction, to make predictions about another torized as in the dilute case, despite the contribution reaction. of infinitely many diagrams. In Refs. [t09/164, t10/067] we have applied these results in order to study the correlations measured in heavy ion collisions between pairs of particles sep- arated by a large interval of rapidity. t A B detection

Figure 1: Hadronic/nuclear collisions in the dilute (left) freeze out and dense (right) regimes. latest correlation z So far, factorization results were limited to situations in which the local parton density is small, so that in a given collision at most one parton from Figure 2: Long range rapidity correlations between pairs of particles. each projectile interacts (Fig. 1, left). At high collision energy, this is not true anymore, because the Using causality, (see Fig. 2), one can prove that gluon density increases rapidly with the energy. In- such correlations must have preexisted in the projec- deed, the emission probability of a new gluon by an tiles before the collision, or have been created very already existing gluon increases as the logarithm of shortly after the collision. Guided by this general energy, and is eventually of order one. These succes- argument, and using our earlier results on the fac- sive gluon emissions lead to large occupation num- torization of the initial multi-parton distributions, bers for the gluons in the colliding projectiles. This we have developed a semi-quantitative explanation situation is reached earlier in heavy ion collisions, of these correlations, that reproduces the main fea- because the gluons from all the nucleons sitting at tures of the data. 44 Activity Report CEA/DSM/IPhT 2008 — 2013 Wave turbulence and di-jet asymmetry at the LHC

The study of the propagation of an energetic jet through a dense QCD medium reveals an §interesting phenomenon of weak turbulence, which is new in the context of QCD, and may ¤ provide a natural explanation for a remarkable set of data obtained in heavy ion collisions at the LHC.

¦A major objective of the experimental program cade (see the figure). After a first study [t13/088]¥ of at the LHC is the study of the high-temperature, a simplified version of the ‘parton cascade’ made of deconfined, phase of QCD, known as Quark-Gluon one quark-antiquark pair (a ‘colour antenna’), we Plasma (QGP). Believed to have filled the Early have obtained the first complete calculation of a Universe just after the Big-Bang, this matter is re- gluon branching (g → gg) in the presence of medium produced at the LHC in the intermediate stages of effects [t12/157]. Our work shows that the ‘colour heavy ion collisions. When two P b nuclei, with coherence’ between the emitters is rapidly washed atomic number A = 208, are smashed against each out by the interactions with the medium and, as a other with a center-of-mass energy of 5 TeV, the consequence, the interference effects can be ignored respective wavefunctions (built with 3A ≈ 600 va- in a leading order calculation: the in–medium cas- lence quarks and a few thousands of gluons gen- cade can be assimilated to a classical branching pro- erated via Bremsstrahlung) lose quantum coher- cess (obtained by iterating independent emissions) ence and liberate the partons in the final state. and be treated via a Monte-Carlo calculation. This This leads to a dense fireball of quarks and glu- opens the way towards systematic phenomenological ons, with a temperature T ∼ 1 GeV, which lives studies. for about 10 fm/c. Later on, this plasma cools down and hadronizes, thus producing the myriad of particles (more than 20,000) observed in the detectors. A main challenge is to identify and measure the imprints of the ephemeral QGP phase on the c multi-particle distribution in the final state. One of the observables used in that sense, the energy correlations between pairs of jets, led to an interesting discovery, which motivated our studies in 0 L Refs. [t13/088, t12/157, t13/038]. Specifically, the typical di-jet events observed in A medium-induced jet in a typical event, as emerging from our analysis. P b-P b collisions are highly asymmetric, with one of the two jets carrying much more energy than the A further step has been accomplished in [t13/038], other. This asymmetry is commonly attributed to where we studied the energy distribution within the the interactions between one of the jets and the fire- in-medium gluon cascade. We found that, in suc- ball that it traverses, while the other jet leaves the cessive branchings, the energy gets transmitted from system unaffected. What is surprising though, is one parton generation to the next one at a rate which the magnitude of this effect: a jet can lose as much is independent of the generation: the energy flows as 30 GeV, i.e. much more than the typical energy through the cascade without accumulating at any scale, T ∼ 1 GeV, of the medium. Moreover, the intermediate scale; it rather accumulates at the low- energy lost in this way is recovered as an excess in energy end of the cascade, and is dumped into the the number of soft (E ≤ 1 GeV) quanta propagating medium. This provides an efficient mechanism for at large angles with respect to the jet axis. energy loss via soft gluon radiation at large angles, This remarkable phenomenon led us to recon- which could naturally explain the di-jet asymmetry sider the problem of the evolution of a jet propagat- observed at the LHC. ing through a dense QCD medium. The emission of An energy flow with rate independent of the en- a single gluon which is triggered by the interactions ergy is a distinguished signature of weak wave tur- between an energetic parton and the surrounding bulence. This phenomenon requires the wave inter- medium has been first studied in the mid nineties actions to be quasi-local in energy, an unusual fea- by Baier, Dokshitzer, Mueller, Peigné, Schiff, and tures in the context of QCD. It occurs in the present independently by Zakharov. These early results pre- context because the medium-induced gluon branch- dicted a large probability for the emission of soft ings are quasi-democratic : the offspring gluons share gluons at large angles. We have exploited and gen- commensurable fractions of the energy of their par- eralized these results in order to provide a complete ent gluon. We are currently investigating further picture of multiple gluon emissions and thus globally consequences of this physical picture for the phe- follow the evolution of the in-medium parton cas- nomenology at the LHC. Highlights 45 Observing the minibang through its fluctuation spectrum

Recent progress in our understanding of nucleus-nucleus collisions at LHC energies has highlighted £the importance of quantum fluctuations, thus revealing an analogy with early cosmology. Head-on nucleus-nucleus collisions at the high- Fluctuations also result in a dipole anisotropy ¢ ¡ est energies (RHIC and LHC colliders) produce a v1: high-momentum particles tend to flow in one di- tiny lump of fluid, dubbed the quark-gluon plasma, rection, while low-momentum particles flow in the which expands into the vacuum and eventually opposite direction, thus restoring global momentum transforms into particles which are observed. The balance. We have obtained a first hint of this effect azimuthal (φ) distribution of these particles1 has using public correlation data from RHIC [t10/185]. small anisotropies, which are characterized by their Later, using detailed correlation data released by Fourier spectrum vn. In 2010, it was understood the ALICE collaboration, we were able to release that they are analogous to anisotropies of the cos- the first measurement of v1 at LHC, including full mological radiation, in the sense that they are pro- systematic errors [t12/015]. Our analysis was pub- duced by initial quantum fluctuations, followed by lished a few days prior to a similar analysis by the hydrodynamic expansion. ATLAS collaboration. We have also carried out the We have carried out the first quantitative pre- first viscous hydrodynamic calculation of the dipole diction for the third harmonic v3, which is solely asymmetry. due to fluctuations [t10/095]. Hydrodynamics, once These new observables open up new directions of supplied with a reasonable model for initial fluctu- research. They provide tantalizing evidence that a ations, naturally captures the physics of azimuthal strongly-coupled system containing a few thousand anisotropies, as illustrated below in the Figure. particles may behave collectively like a fluid.

00!10" 10!20" 20!30" 30!40" 40!50" 50!60" 0.24 NeXSPheRIO# NeXSPheRIO! 2 0.16

v PHENIX 0.08 0 NeXSPheRIO# 0.12 NeXSPheRIO!

3 PHENIX v 0.06

0 NeXSPheRIO# 0.08 NeXSPheRIO!

4 PHENIX v 0.04

0 0.06 NeXSPheRIO# NeXSPheRIO! 0.04 5 v 0.02 0 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 pT GeV c

Fourier coeﬃcients v2 to v5 (from top to bottom) as a function of particle momentum pT for central (left) to peripheral (right) Au-Au collisions at 200 GeV per nucleon. Results from hydrodynamic calculations (labeled NeX- SPheRIO) are compared with experimental data from the! PHENIX" # collaboration at RHIC. vn generally decreases with n and increases with pT . The strong increase of v2 from central to peripheral collisions is due to the collision geometry, while the milder increase of higher harmonics (v3 through v5) is mostly due to the reduction in the interaction region, which results in larger ﬂuctuations.

1 π The φ distribution is measured near the equatorial plane θ = 2 , called “midrapidity”. 46 Activity Report CEA/DSM/IPhT 2008 — 2013 Cosmological Perturbation Theory

Perturbation theory is a powerful tool that has been used in a variety of cosmological contexts. With the advent of precision observations, it can be used to explore subdominant eﬀects at linear ¨ order and beyond, at various stages of the thermal history of the universe. This applies to the large scale structure of the local Universe, the mapping of which is done with increasing accuracy, or to the physics of recombination, magniﬁcently probed by the Planck satellite mission.

Even in the context of standard gravity, develop- The Planck satellite has recently measured© the ing methods that can be used to compute the growth anisotropies of the Cosmic Microwave Background rate and resulting statistical properties of the local (CMB) with an unprecedented precision, and put cosmological density fields with the required accu- tight constraints on primordial non-Gaussianities, racy is a challenging theoretical task. In a series of potentially carrying important information on the at papers we have developed new approaches, where we early times. For the sensitivity attained by Planck, reformulate the perturbation series involved in the second-order effects connecting the initial conditions computation of the density power spectrum or the to the observed CMB are potentially detactable, bispectrum. These approaches are based on the in- and can contaminate the primordial signal. Thus, troduction of the multi-point propagators that are the precision of the constraints on primordial non- seen as the new building blocks of the perturbation Gaussianity heavily relies on our ability to control theory expansions [t08/161]. A key result is that these nonlinear effects. Moreover, the detection of these objects enjoy resummation properties in the these nonprimordial nonlinear features would repre- high momentum limit. Later we showed that these sent per se a strong validation of minimal inflation, properties are intimately related with the infrared more generally of the standard cosmological model. behavior of the theory, by introducing the eikonal At IPhT we have pioneered the analytical and approximation [t11/222, t12/083], in analogy with numerical study of these second-order effects, which the scheme in QED. This is a powerful framework to have been used as a reference by the Planck collabo- perform such resummations, which can be employed ration to interpret their constraints. In particular we in a variety of cases, from non-Gaussian initial condi- have expanded the Boltzmann equation to second- tions [t10/090], to quantities defined in Lagrangian order in the relativistic cosmological perturbations rather than Eulerian space [t08/161]. [t08/162, t10/032] and the effects on the anisotropies In [t11/223] we further showed how to incor- [t09/244, t09/353, t10/195]. More recently, we have porate in a single expression both the high mo- developed CosmoLib2nd, the first complete numer- mentum behavior of the propagators, driven by ical Boltzmann code which computes the evolution their resummed properties, and their low momen- of second-order perturbations and the CMB 3-point tum behavior, determined by perturbative expan- function from second-order sources, from recombi- sions. This formalism opened the way to consis- nation until today [t12/155]. tent perturbation theory calculations, to any order. It was exploited when developing publicly released 2 Planck params. without reion. codes that provide fast computations of the matter late-ISW removed in all bispectrums l1 =6, varying l2 =l3 density field at 2-loop order[t12/081, t12/082]. 1 )] 1 l

C 0 3 l C

1.25 + 3 l C

2-loops (std) 2 −1 l 1.20 C z=1 + 2 l

1-loop (std) C 1 L l −2 C k 1.15 H Total [6( / ) squeezed-limit approx. 1.10 S −3 wiggle

(∆ Sachs-Wolfe 3

- 2-loops (RegPT) l 2 l

1 Doppler no l

1.05 b P −4 Rees-Sciama ê L

k time shift H 1.00 P vector −5 linear tensor 0.95 0 500 1000 1500 2000 l 0.90 2 0.05 0.10 0.15 0.20 0.25 k h-1 Mpc The code is involved since many effects need to be taken into account. As shown in the figure above, In the above figure weH compareL theoretical calcula- we could validate our numerical results from a set of tions of the density power spectrum with N-body nontrivial configurations, in the so-called squeezed results (red points with error bars). The dotted line limit, obtained when one of the three modes is much is the linear theory, the dashed and solid lines are longer than the other two, and outside the Hubble respectively the 1- and 2-loop predictions. horizon at recombination [t11/258]. Highlights 47 Dark Matter and the matter-antimatter asymmetry of the Universe

What is the matter in the Universe made of? Where did it originate from? The latest cosmological observations yield a precise answer to the ﬁrst question: 15.9% of the matter in the Universe consists of known particles (essentially protons, neutrons and electrons), while the remaining 84.1% is composed of an unknown species called Dark Matter. Its nature is one of the unexplained mysteries of particle physics and cosmology, despite decades of investigations. The other major mystery is the origin of ordinary matter: there is no understanding of why the Universe possesses an asymmetry between particles and antiparticles and thus why matter survived a complete primordial self-destruction at all.

Understanding the nature of Dark Matter (DM) requires witnessing an explicit manifestation of it, beside the indirect (gravitational) effects it has on the shape of galaxies and larger structures. One possibility is to detect, in the fluxes of cosmic rays, an anomalous component which could originate from DM annihilations and therefore betray its existence. Indeed, from 2008 onwards, a number of very well performing satellite and ground based experiments (Pamela, Fermi, Hess and now Ams-02 on the Dark Matter annihilations in the Milky Way halo pro- ) have reported intriguing excesses. Iss duce fluxes of cosmic rays that, collected on Earth after We have published a string of works which have a complex propagation history, carry important informa- allowed to: 1) identify the properties that DM tion. Precisely computing these fluxes, and comparing must have to explain the data [t08/139]; 2) cross the predictions with data, might shed light on the nature check related constraints (such as from gamma rays of Dark Matter. [t08/184, t09/030, t09/187, t12/034]; 3) predict associated signals in other channels [t10/025] (such as in neutrino fluxes). These works have been influen- Another mystery is the origin of the matter- tial in the field (they collected about 1000 citations antimatter asymmetry of the Universe. One of the since early 2009). Together with other efforts, they possibilities for generating it dynamically is leptoge- opened whole new directions in DM model building: nesis, a mechanism involving the heavy fields that the focus in the community has steered drastically are needed to generate the small neutrino masses from conventional DM candidates such as the su- via the seesaw mechanism. Whether leptogenesis persymmetric neutralino to exotic, multi-TeV, lep- can indeed explain the observed cosmological baryon tophilic new particles. asymmetry in Grand Unified Theories based on the SO(10) gauge group, in which the seesaw mechanism is automatically present, is a crucial question. We showed that this is indeed the case, taking into account effects that were neglected in previous studies, in particular the contribution of the flavour- dependent decays of the second right-handed neutrino [t08/069]. Another long-standing question is the possibility of testing leptogenesis experimentally. While there is in general no correlation between the generated baryon asymmetry and low-energy observables, we identified and analysed a predictive scenario in which the matter-antimatter asymmetry depends on parameters that can be measured in neutrino physics experiments [t08/070]. This scenario, Collisions of clusters of galaxies make apparent the sepa- which requires a yet unobserved CP violation in the ration between ordinary matter and Dark Matter (copy- lepton sector, can therefore be falsified by future ex- right NASA 2006). periments. 48 Activity Report CEA/DSM/IPhT 2008 — 2013 Statistical and condensed matter physics 49 Statistical and condensed matter physics

Our activities in statistical and condensed matter physics can be divided into three main themes: statistical physics, condensed matter physics, and applications to biophysics, networks and complex systems. Out-of-equilibrium systems have been our main research theme in classical statistical mechanics. The conceptual framework of the theory of equilibrium systems is well- established, owing to the notions of statistical ensembles and thermodynamic potentials. This formalism has, however, received no equivalent so far in the realm of non-equilibrium systems. As a result, even simple questions remain unanswered in general, such as the characterization of driven stationary states far from equilibrium and far from the linear response regimes, or the study of the glass transition and of its slow dynamics. In recent years several general results, referred to as fluctuation theorems, have shed some light on the first of these issues, namely the nature of non-equilibrium stationary states. A complementary direction of research consists in studying exactly solvable models of out-of-equilibrium phenomena, such as the asymmetric exclusion process in one dimension, where exact results have been obtained, concerning especially the large deviation functions associated with various observables. Following another line of thought, a series of works has been devoted to the effects of some novel types of dynamics on simple models, such as the one-dimensional Ising chain or the spherical model. This class of dynamics includes asymmetric interactions between spins as well as other kinds of biases which make the dynamics irreversible. A novel type of non-equilibrium dynamical transition has been put forward, which demar- cates two qualitatively different regimes of violation of the fluctuation-dissipation theorem. Various other features of stochastic processes and non-equilibrium phenomena have been studied, including the statistics of excursions of several stochastic processes, the maximal entropy random walk on an arbitrary graph, and new applications of Markov processes to the sampling of complex energy landscapes in Monte-Carlo methods. In glasses, spin glasses, granular systems and some other disordered systems, the relaxation time towards equilibrium becomes so large below some critical temperature that the system never reaches equilibrium and exhibits genuinely non-equilibrium phenomena, referred to as aging. In the field of glasses, a qualitative thermodynamic difference between the high-temperature and deeply supercooled equilibrium glass-forming liquid regimes has been explicitly shown, leading to a renewed discussion of the random first-order transition theory and to new ways of studying the glass transition. Several new results have been obtained in the area of spin glasses, concerning e.g. the nature of the spin-glass phase in low dimensions, the distribution of relaxation time in the Sherrington-Kirkpatrick model, large correlations in individual mean-field samples, and the existence of a static spin-glass phase on soft scalar spin version of the random field Ising model. The non-equilibrium dynamics of magnetic systems in the presence of quenched disorder have also been studied, especially using renormalization techniques. Finally, various aspects of the Anderson localization problem have been revisited, including the relationship with directed polymers, traveling waves and many-body localization. In many-body quantum systems strong interactions give rise to remarkable and unexpected phenomena that deeply challenge our understanding of condensed matter physics. The fractional quantum Hall effect and the high-temperature superconductivity are the two most famous examples, but there are many others, including metal-insulator transitions, the breakdown of the Fermi-liquid behavior in cuprates and in heavy fermions compounds, and exotic orders (charge, spin, orbital) in transition metal oxides. Our research activity in that area spans a very broad range of topics, from traditional ones, such as strongly corre- 50 Activity Report CEA/DSM/IPhT 2008 — 2013 lated electrons in bulk materials, to subjects emerged recently such as the effect of strong interactions in mesoscopic physics, ultra-cold atoms, out-of-equilibrium quantum systems and graphene. An intense research effort is also devoted to improving and developing theoretical methods able to cope with the new challenges of condensed matter physics. Our main contributions concern conformal field theory, renormalization group methods and new numerical techniques. For example, an efficient algorithm for solving the multiple quantum impurity models of (cluster) dynamical mean-field methods was developed and is now routinely used in several groups world-wide. High-temperature superconductivity, and in particular the nature of the pseudo-gap state, are among the most studied and challenging problems of condensed matter physics. Several theoretical ideas have been put forward to explain them, in particular the resonating valence bond (RVB) phase and the proximity to a quantum critical point (QCP). We have actively investigated both of them. Concerning the former, a new picture of a selective Mott transition in momentum space was proposed, based on approximate solutions of microscopic models using cluster dynamical mean-field methods. It was found, in agreement with experiments, that the nodal regions remain metallic while the anti-nodal ones become insulating, suggesting the existence of a dynamical RVB phase, and that superconductivity and pseudo-gap state compete with one another. Moreover, several spin and dimer models, related to RVB physics and also relevant for frustrated magnets, have been studied. It was shown that they can exhibit non-standard states, like spin liquids and dimer phases. Con- cerning the latter, a new theory of the two-dimensional anti-ferromagnetic (AF) quantum critical point has been developed in analogy with the field-theoretical analysis of Anderson localization. It was shown that in the proximity of the AF-QCP a novel state of matter emerges, which is characterized by quadrupolar density wave order and d-wave superconductivity. Its relevance for the pseudo-gap state was put forward and experimental checks are currently performed. Among many new subjects which emerged recently in condensed matter physics, we have been particularly active in the following ones: mesoscopic and nanoscopic systems, for which quantum impurity models, out-of-equilibrium transport and various aspects of nanotubes have been studied; graphene physics, for which many important questions concerning the effects of disorder, of the substrate and of interactions have been addressed; cold atomic systems, which allow one to study fundamental issues of strongly correlated systems by creating artificial solids embedded in optical lattices; out-of-equilibrium dynamics of quantum open and closed systems, for which new methods, such as integrability for out-of-equilibrium steady states, new phenomena, such as out-of-equilibrium phase transitions, and new theoretical aspects, such as quantum fluctuation theorems, have been investigated. In particular, several works have been devoted to the study of entanglement in one- and two-dimensional systems, which is relevant for the dynamics of isolated quantum many-body systems and for the development of numerical algorithms for strongly interacting quantum systems. Our activities in the area of the applications of statistical physics has vastly enlarged their scope beyond biopolymers and electrostatics in biological systems, especially to include combinatorial optimization and complex networks. We have started to deal with questions of direct interest to biological systems. Biopolymers such as DNA, RNA and proteins have a chemical sequence which can be modeled, to a first approximation, as a quenched random sequence. In addition to the melting transition, random RNA undergoes a freezing transition, of the same type as those studied in disordered systems. On the other hand, molecular motors, the dynamics of actin filaments, and the kinetics of protein folding all involve the use of methods and concepts of non-equilibrium statistical physics. Statistical and condensed matter physics 51

Four web servers have been set up in recent years. The first one, entitled Mistral, allows multiple structure alignment of protein structures. By aligning protein structures, one can look for structurally conserved motifs in proteins, and this in turn can be used to determine the function of proteins or their evolution. A second server, TT2NE, predicts secondary structures of RNA with pseudoknots, from their chemical sequence. This is an important information, since loops and pseudoknots are known to embed the binding sites of RNA. The third one, McGenus, allows one to predict RNA structures with pseudoknots for longer sequences, by means of a Monte-Carlo algorithm. Finally, the AquaSAXS server, hosted by Institut Pasteur in Paris, is devoted to the reconstruction of protein surfaces from SAXS data. The tools and methods elaborated in statistical physics also have numerous applications to other fields of the natural and social sciences. Pluridisciplinary applications might even be viewed as one of the most promising facets of the whole discipline. In recent years our activity has strongly expanded in two directions. The first one is concerned with hard problems of combinatorial optimization. Within this framework, let us mention a new concept in signal acquisition referred to as compressed sensing. We wave proposed a scheme based on a message-passing algorithm and on the theory of nucleation, for which compressed sensing is tractable for as few measurements as the size of the compressed signal. The second direction is the study of complex networks, their structure, their evolution, and their spatial properties. Networks are fundamental in theoretical epidemiology, where transportation and mobility networks are the key ingredient in the spread of infectious diseases. The problem is then to understand the coupling between the movement of individuals and the spread of the disease, both processes having their own spatial and temporal scales. In geography and urbanism, networks are also a key ingredient in understanding the structure and the evolution of cities. 52 Activity Report CEA/DSM/IPhT 2008 — 2013 Large deviations of the current in the ASEP

Systems out of equilibrium are often characterized by the transport of a physical quantity at the macroscopic scale, such as a current of particles through a wire. The statistical properties of ¨ this current are encoded in a Large Deviation Function. This function has been calculated for the Asymmetric Simple Exclusion Process, a paradigmatic system for nonequilibrium transport, amenable to exact analytical solutions.

A system containing carriers of energy, mass, or structure of the steady state, the average value© of electrical charge, and subject to a driving field in the current and the corresponding phase diagram are its bulk, or to a difference of potential between its known, thanks to a seminal article of B. Derrida et boundaries, will usually evolve to a nonequilibrium al. (1993). Nevertheless, the statistical properties of steady state with a nonvanishing macroscopic cur- the current had remained an outstanding challenge rent of heat, particles or charges. This current vio- for the last twenty years. lates time reversal invariance and detailed balance: This major unsolved problem has stimulated the principles of equilibrium statistical mechanics many works during the last 20 years; we finally ob- cannot be applied. Hence, for a system which is tained a complete solution recently. bulk-driven, boundary-driven, or both, there exists Our computation proceeded in two steps. First, no fundamental principle that would predict the we focussed on the periodic case with bulk drive, value of the current and its fluctuations. and used the Bethe Ansatz to extract the exact ex- During the last two decades, substantial progress pressions of all the cumulants of the current for a has been made towards a statistical theory of system of arbitrary size. We derived the large devia- nonequilibrium systems; large deviation function function in the continuous, hydrodynamic, limit tions, which encode atypical excursions of a physical and found a breaking of analyticity of this function observable, appear as the best candidates to gener- [?, t08/236]. This corresponds to a phase transition alize the traditional thermodynamic potentials. in the model, emphasizing again the fact that large The study of large deviations in a nonequilibrium deviations play the role of nonequilibrium potentials. system therefore represents a theoretical, numerical This transition was expected from the macroscopic and experimental task of fundamental importance. fluctuation theory (MFT) of Jona-Lasinio et al. At IPhT we have tackled this question for the In a second step we solved the case of the open case of the Asymmetric Simple Exclusion Process ASEP in contact with two reservoirs (see the fig- (ASEP), one of the very few models in nonequilib- ure) [t11/096, t12/118]. Here, because of the open rium physics that can be studied analytically. boundaries, the Bethe Ansatz cannot be applied for generic values of the parameters. Instead we used a technique we had developed in a series of α β q 1 works on exclusion processes with multiple species [t08/133, t08/213, t09/157, t11/238]. The key idea RESERVOIR RESERVOIR was to encode the combinatorial properties of these 1 L models by tensor products of quadratic algebras.

γ δ Applying this method to the open ASEP, we calculated the full current statistics in all the phases Open ASEP coupled to two reservoirs. The asymmetry of the model. Our results are exact and valid for factor is q < 1. Boundary rates are arbitrary. arbitrary system sizes and parameter values. In the limit of large sizes, the asymptotic behavior of the The ASEP is a 1D lattice-gas model in which large deviation function is derived in all regions of particles perform biased random walks and interact the phase diagram, and we show that this function is through an exclusion constraint that mimics a hard- nonanalytic along transition lines. We also find that core repulsion: two particles cannot occupy the same the cumulants of degree higher than 2 do not van- site at a given time. This minimal system appears as ish: this is a signature of a non-Gaussian statistics a building block in a great variety of phenomena that of the current, another footprint of nonequilibrium. involve low-dimensional transport with constraints Our results coincide with the predictions of MFT in (such as the motion of ribosomes along mRNA, sur- the diffusive limit q → 1. For general values of the face growth, traffic flow, or combinatorics of Young asymmetry parameter q, no such macroscopic for- diagrams). malism is available yet, but our formulae can be used In the long time limit, the ASEP reaches a steady as benchmarks for algorithms such as the Density state with a fluctuating macroscopic current. The Matrix Renormalization Group (DMRG) method. Highlights 53 Spin models with asymmetric irreversible dynamics

A new dynamical transition is exhibited by simple spin models with asymmetric irreversible §dynamics. In the stationary state, the response to an external perturbation and the spontaneous ¤ ﬂuctuations are in a constant ratio, which depends continuously on the strength of the asymmetry, and vanishes beyond a critical value.

¦ ¥ Strong violation c X V Weak violation

V T

Left: Fluctuation-dissipation ratio vs velocity. Right: Critical velocity as a function of temperature. (Ising chain.)

The best introduction to the series of works pre- ously on the strength of the asymmetry, quantified sented below is the following quotation of Glauber by a velocity V . For values of V less than a criti- in his celebrated 1963 article: "The principles cal velocity Vc, the FDT is weakly violated, while for of nonequilibrium statistical mechanics remain in values larger than Vc it is strongly violated: the ratio largest measure unformulated. While this lack per- X of the response to the time derivative of the cor- sists, it may be useful to have in hand whatever relation decreases continuously from its equilibrium precise statements can be made about the time- value, at V = 0, until it vanishes at Vc [t11/098]. dependent hehavior of statistical systems, however (See figure.) simple they may be. We have attempted, therefore, The same questions can be addressed in higher to devise a form of the Ising model whose behav- dimension for Ising spins, or for the spherical model ior can be followed exactly, in statistical terms, as a as defined by Berlin and Kac, where spins are real function of time. While certain of the assumptions variables submitted to a spherical constraint. While underlying the model are to a degree arbitrary, it is the 2D asymmetric Ising model can only be inves- surely one of the simplest ones involving N coupled tigated by numerical means, the dynamics of the particles for which exact time-dependent solutions spherical model is solvable in any dimension even can be found". when it is asymmetric. All the phenomenology de- The model considered by Glauber, a 1D chain scribed above holds for these models, namely the of Ising spins relaxing towards equilibrium, was re- Gibbsian nature of the stationary state and the dy- versible. The current trend of nonequilibrium statis- namical transition from weak to strong violation of tical mechanics is oriented towards the investigation the FDT when varying the magnitude of the asym- of models with irreversible dynamics. The sentences metry [t13/035]. quoted above can be transposed without change to the cases presented in this highlight. Coming back to the Ising chain, we noticed that What is the effect of imposing a spatial asym- any choice of flipping rate, depending on the central metry in the rules of the dynamics of a spin chain, spin and its nearest neighours and invariant under such that the process becomes irreversible? At long spin reversal, yields the same stationary measure as times, and at a given finite temperature, the sys- that of the reversible model. In higher dimension, tem reaches a stationary state. The model is still for Ising models on regular lattices, the situation solvable; in particular its stationary measure is un- is different. In two dimensions, only specific rates changed: the weight of any configuration is given by satisfy this condition. In contrast, it is remarkable the same Boltzmann-Gibbs factor as in the reversible to observe that, for the three-dimensional cubic lat- case. Furthermore, irreversibility implies the viola- tice, the only rate functions yielding a Gibbsian station of the fluctuation-dissipation theorem (FDT), tionary measure correspond to reversible dynamics however the degree of violation depends continu- [t09/309, t13/085]. 54 Activity Report CEA/DSM/IPhT 2008 — 2013 Ideal Glass Transitions by Random Pinning

The hallmarks of the glass transition, a very rapid increase of the relaxation time and the freezing in a low temperature unpredictable amorphous phase, are also the main obstacles to study it. ¨ We propose a way to short-circuit these problems. It allows one to cross the glass transition in equilibrium and obtain a million years aged glass in a few seconds. This opens the way to an entire new set of investigations and to crucial tests of the glass transition theories.

Systems generically called "glassy" are central the one in which the initial configuration was© set- to several fields from statistical mechanics and soft tled in. Therefore, through pinning one can induce matter, to material science and biophysics. They an ideal glass transition even at rather high temper- are characterized by an extremely rugged (free) en- atures. The crucial difference with respect to stan- ergy landscape whose global minimum is not known dard cooling protocols is that now one can easily and whose local minima trap the system during its sample the ideal glass in equilibrium: one just has dynamical evolution. Super-cooled molecular liquids to pin a large enough fraction of particles (larger (and their glass transition) are a paradigmatic exam- than fc). In [t11/277, t12/219] we worked out a ple: their typical time scales increase from picosec- complete theory of the random pinning glass transi- onds to hours in a restricted temperature window. tion based on mean-field (static and dynamic) meth- This feature, which is the hallmark of the glass tran- ods and a renormalization group treatment. Our sition, is also the main obstacle to study it because work provides a new and very promising research liquids inevitably fall out of equilibrium before ap- direction in the glass transition field. First, demon- proaching closely the critical point. Moreover, con- strating that pinning does induce a glass transition trary to usual phase transition, the low temperature will allow one to show that our main physical as- phase is unaccessible both in reality and in numer- sumption about the nature of the glass transition ical studies: finding the ideal glass is a daunting is basically correct. Second, since one can now ap- optimization problem. In [t11/282] we proposed a proach the glass transition from the liquid but also way to short-circuit these obstacles, cross the phase from the ideal glass side, thoroughly studying the transition and sample the ideal glass in equilibrium. nature of the transition becomes feasible by using Our starting assumption is that glassy behavior is the usual studying machinery of phase transitions, due to a competition between gaining configura- in particular finite size scaling. A first numerical tional entropy, the part of the entropy counting the analysis of random pinning glass transition by Kob (huge) number of amorphous states in which a liq- and Berthier confirmed our predictions. The figure uid can freeze, and exploring low-energy and hence below vividly shows the effect of pinning particles. less numerous states. Within this scenario the ideal Large spheres represent pinned particles, small dots glass transition takes place at the temperature be- are the superposition of the position of fluid parti- low which the system is forced to only explore the cles obtained from a large number of independent lowest free energy states. Our main idea is that equilibrium configurations. Above a certain fraction by pinning particles at random from an equilibrium of pinned particles, all the other particles just vi- configuration one favors some states over the others, brate around amorphous positions, thus unveiling thus decreasing the number of states which are ex- the thermodynamic nature of the glass transition at plored during the evolution, exactly as it happens which the fluid freezes in the most favorable amor- when lowering the temperature. Eventually, above phous state. a critical pinning fraction fc only one state survives:

Kob and Berthier’s simulations of a mixture of harmonic spheres, to appear in Phys. Rev. Lett. Highlights 55 Pseudo-gap state from quantum criticality

The nature of the pseudo-gap state in high temperature cuprate superconductors remains one of the most enduring mysteries of condensed matter physics. Despite almost twenty five years ¨ of intense research, no consensus has been reached upon questions as fundamental as the role of strong coupling fluctuations or the influence of quantum criticality on the phase diagram of those compounds.

The physics of high temperature superconduc- noticed that quantum fluctuations in 2D induce© a se- tors has triggered a huge body of experimental and ries of diagrams that were not accounted for in the theoretical work in the last twenty five years. It standard theory. These diagrams exhibit a planar could be said that, during all this time, these com- structure. In our study we found an analogy with pounds have been at the forefront of research in the theory of Anderson localization in 2D, which condensed matter physics, leading to strong exper- states that bosonic modes (so-called “Cooperons” imental progresses in techniques like X-ray scat- and “Diffusons”) emerge out of quantum fluctuations tering, angle resolved photoemission (ARPES) or and can be resummed in series of ladder diagrams; scanning tunneling microscopy (STM). Conceptu- this situation is similar with the planar diagrams ally, the main issue has been to decide whether the emerging out of an AF QCP in 2D. Particle-particle physics of these compounds is dominated by the (analogous to “Cooperons”) and particle-hole (anal- Coulomb interaction between the electrons (strong ogous to “Diffusons”) ladders can be identified and coupling approach), or rather by the quantum fluc- resummed. When we linearize around the hot spots, tuations (weak coupling approach). at the mean-field level, those two modes condense into a composite order parameter, which has a component in the Cooper channel in the form of d-wave superconducting (SC) gap, and a component in the charge channel in the form of a quadrupolar density wave order parameter (QDW) showing checkerboard modulations. The two components of this composite order parameter are connected by SU(2) symmetry. When the curvature of the Fermi surface is taken into account, the SU(2) symmetry is broken and the SC component is favored. Alternatively, when a magnetic field is is applied, the SC component is dis- favored and the QDW order parameter is stabilized. The mechanism is controlled by a small parameter, proportional to the angle between the Fermi veloc- ities at two anti-ferromagnetic hot spots. The ele- gance of our solution resides in the fact that complex A pseudo-gap (PG) state is generated around the anti- features emerge out of one of the simplest models of ferromagnetic QCP. This new state of matter is char- correlated electrons, involving only one QCP. acterized by a dual order parameter, made of a d-wave The experimental progresses in STM and soft X- superconductor and a checkerboard quadrupolar density rays have recently revealed the presence of checker- wave, related by SU(2) symmetry. At low temperature, the curvature of the Fermi surface breaks the SU(2) sym- board structures, with modulation related with metry and favors the SC state. When the temperature the positions of the hot spots, in the underdoped is raised, thermal fluctuations restore the symmetry and phases of YBCO and BSCCO compounds where the create the pseudo-gap state. pseudo-gap is large. Quantum oscillations measurements, as well as sound experiments, confirm the In [t13/129] we revisit the longstanding issue of a stabilization of a checkerboard charge ordering un- zero temperature anti-ferromagnetic (AF) transition der a magnetic field ∼17 T. We expect that our con- in the phase diagram of the cuprates. The Quan- trolled solution will shed light on the longstanding tum Critical Point (QCP) in 2D has been introduced issue of the role of AF paramagnons in the physics of shortly after the discovery of the cuprates, in the cuprates. This work was performed during the visit work of Pines and Chubukov. Recently it has been of K. Efetov, recipient of a “Chaire Blaise Pascal”. 56 Activity Report CEA/DSM/IPhT 2008 — 2013

Entanglement in low-dimensional magnets

Quantum entanglement and related quantum information concepts (fidelity, matrix product state, tensor networks, entanglement spectrum,. . . ) have become a active field of research in condensed matter. It aims at a deeper understanding of quantum correlations in strongly interacting systems, and it also lead to progress in the numerical algorithms to simulate quantum many-body problems. Some of these ideas have lead to new efficient ways to detect and characterize numerically some exotic states of matter, called topological liquids, which cannot be distinguished or detected using conventional order parameters (quantum Hall fluids, spin liquids,. . . ). The scaling of entanglement in quantum critical states is also of great conceptual interest.

Very few exact results have been obtained so far case [t10/117], but obtaining this result from confor- concerning entanglement in space dimension larger mal field theory remains a challenge. This method than one. We have however found a way to efficiently has also been applied to some massive phases with compute the entanglement entropies of some large topological order (of Z2-type) [t11/215] where the subsystems in a particular class of states in d = 2 subleading constant now contains some information [t09/189]. In this class of wave-functions (so-called about the type of topological order (so called total Rokhsar-Kivelson), the amplitudes are given by the quantum dimension). Boltzmann weights of an auxiliary two-dimensional system with short-range interactions .1 Our starting point is the simple but new observation that, for 0.8 these wave-functions, the eigenvalues of the reduced A 0.6 density matrix ρA of the subsystem A (obtained by Ly 0.4 tracing over the degrees of freedom located in region B 0.2 B) are the classical probabilities to observe certain S(L)-0.41*L microscopic configurations at the boundary between 0 Quatum Ising Chain L Triangular lattice regions A and B. In turn, these probabilities can -0.2 Square lattice be efficiently evaluated using transfer matrix tech- 0 5 10 15 20 25 30 35 40 45 niques. This new connection between quantum en- L tanglement in d = 2 + 1 dimensions and classical Left: A two-dimensional system with cylinder geome- probabilities along a line in d = 2+0 allows to short- try is divided into two regions A and B. For Rokhsar- cut two formidable tasks: i) computing ρA by trac- Kivelson wave-functions, the eigenvalues of the reduced ing out the degrees of freedom in B, ii) diagonalizing density matrix ρA are the classical probabilities of some ρA. boundary configurations (here Ising spins, in green). This construction allowed to study the scal- Right: Entanglement entropy of several Ising wave- ing of the entanglement entropy of several wave- functions (square and triangular lattices and for the Ising functions describing quantum (zero temperature) chain in transverse field) at the critical point, as a function of L (linear subtracted for clarity). These data show critical points: The entropy has a leading term pro- different (non-universal) area laws coefficients but a com- portional to the length L of the boundary between mon universal subleading constant (0.254392). A and B (see Fig.), followed by some universal subleading constant s. This last term deserves some Finally, some of these results found some unex- attention since it contains some universal informa- pected applications to quantum 1d systems and to tion about the long-distance physics. For instance, the Shannon entropy of the ground-state in par- for critical states with central charge c = 1, we ticular [t10/225, t11/102]. We also made some showed that s is a related to the boson compact- progress concerning the entanglement of two disjoint 1 ification radius R (through s = log(R) − 2 ), and intervals (called mutual information) in gapless spin hence to the correlation exponents. This study also chains [t08/187], where we showed that it is scale lead to a new connection between Rényi entropies invariant and also gives access to the boson com- and boundary critical phenomena in conformal field pactification radius (Luttinger parameter) in criti- 2 theory [t10/225, t11/215]. cal chains with central charge c = 1 (an information As for other universality classes, we obtained which is absent from the conventional single-interval numerically s with high precision in the Ising entropy).

1We considered situations where the classical conﬁgurations are those of Ising, dimers, or vertex lattice models. 2 We discovered that the entanglement entropy generically contains a singularity, as a function of the replica index usually introduced to compute von Neumann entropies. that the topological property of being knotted takes the difficulty of the folding process to a level that is considerably more challenging than for unknotted proteins.

This consideration is here taken as the motivation for a systematic survey of whether, and to what extent, knotted proteins are discontinuously related by sequence and structure to unknotted ones.

In this section we tackle one facet of the problem. Specifically, we shall examine how primary-sequence similarities reverberate in relatedness of the knotted/unknotted topological state. To this purpose, for each of the 11 representatives in Table 1 we performed a PDB-wide BLAST [35] search for related sequences. The search was restricted to sequences of proteins of known structure (i.e. contained in the PDB) because without the structural data it would not be possible to compare the knottedness of pairs with related primary sequences.

The BLAST queries were run with a stringent E-value threshold (0.1) for returned matches, so that false positives are not expected to occur appreciably among the returned entries. Only for three protein chains, namely 5cacA, 2fg6C and 2ha8A, the number of significant matches was larger or equal to 10. Incidentally we mention that, consistently with the probable artifactual origin of the knot in entry 1s1hI, all the 10 significant BLAST matches of 1s1hI were unknotted protein chains.

All the returned matches for the 5cacA human carbonic anhydrase and the 2ha8A methyltransferase domain of the human TAR RNA binding protein (TARBP1-MTd), consisted esclusively of a dozen knotted proteins, all with the same knot type. These matches are therefore not informative for the purpose of understanding if and how differences in sequence reverberate into differences of knotted state.

On the contrary, the BLAST matches of the trefoil-knotted N-succinyl-ornithine transcarbamylase (SOTCase), associated to the PDB entry 2fg6C [36], proved particularly interesting as only 7 of the tens of matching entries are knotted (all in a trefoil knot).

To advance the understanding of the precise type of sequence relatedness of the SOTCase and its knotted and unknotted homologs, the matching BLAST sequences were used as input for a CLUSTALW multiple sequence alignment [37]. The results were used, in turn, to establish a phylogenetic relationship between the related proteins using a neighbour-joining bootstrapping algorithm [38]. The method associates to each branch of the phylogenetic tree a percent confidence estimated from the occurrence of the branch in 1000 repeated phylogenetic reconstructions using only a subset of the aligned amino acids.

The phylogenetic tree for the SOTCase is represented in Fig. 1a. The tree shows that the knotted entries appear in two terminal branches sharing a common root. Each branch gathers entries that are highly similar in sequence;Highlights in fact their sequence identity 57 (computed by dividing the number of aligned identical amino acids by the average length of the two compared proteins)Web servers is not smaller for biological than 90%. applications The sequence identity across the two branches has the much smaller, but still significant, average value of 40%. The homologyWe haverelation designed fouramong web servers all formembers use by the biochemical of the and phylogenetic biological community. tree Three is further confirmed by the fact that those, for which CATH [39] code is of these servers are hosted in Saclay, and one at the Pasteur Institute in Paris. They all use ¨ known, belong to the same CATH family.algorithms On derived the from other physical hand, formulations the of robustness the problems (in contrast of the to moreseparation standard of the knotted sequence subgroup from the unknotted one is strongly bioinformatics approaches). suggested by the bootstrap algorithm,The with Mistral a confidence web server in level Saclay largeradd an than energy penalty99%. for pseudoknots, proportional http://ipht.cea.fr/protein.php is a multiple to their genus and look for the minimum free energy© protein structure alignment algorithm. It aims at states. The algorithm TT2NE uses exact enumer- ﬁnding the largest common motifs or patterns in ation of structures, but is limited in size (230 nu- three dimensional protein structures. The physical cleotides) while McGenus uses a Monte Carlo algo- idea is to introduce an attractive interaction between rithm (simulated tempering) and allows exploration the amino-acids of the various proteins and search of larger chains (1000 nucleotides). The input is the by Monte Carlo for their lowest energy bound state. sequence of the RNA structure and the output is The algorithm provides a natural scoring function the list of base pairs and the nature of the pseudo- which is the binding energy of the proteins. The knots. It is possible to impose the maximum genus distribution of scores is shown to be very close to of the structures, the genus energy penalty and the a Gumbel law. The input to MISTRAL is a list number of lowest free energy structures displayed. of protein structures from the PDB (Protein Data Bank), and the output is the list of aligned residues, as well as a display of the aligned proteins with emphasized aligned segments.

UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCCA

Secondary structure of the HDV pseudoknot of genus 2 as predicted by TT2NE

The server AQUASAXS, at the Pasteur Institute http://lorentz.dynstr.pasteur.fr/aquasaxs.php, provides tools for computing theoretical SAXS (small angle X-ray scattering) profiles with atomic models from e.g. PDB files, using generalizations of the Poisson-Boltzmann equations to determine the den- Structural alignment of 6 representatives of the SOT- sity of ions and water around the studied molecule. Case homologous proteins The input is the PDB file of the protein. The output is the map of water molecules around the protein, as Figure 1. SOTCase and homologousThe two servers proteins: TT2NE and phylogenetic McGenus, both well as tree the SAXS and profiles. structural This server is alignment a natural core. hosted at http://ipht.cea.fr/rna/mcgenus.php are continuation of our former web server PDB_Hydro (a) The phylogenetic tree wasalgorithms obtained to determine by applying the secondary a structure neighbor of http://lorentz.immstr.pasteur.fr/pdb_hydro.php joining algorithm [38] to the CLUSTALW multiple sequence alignment of SOTCase and its RNAs with pseudoknots. The idea is to properly which provides tools for mutating and solvating sequence homologs. The branches'parametrize length the base-base reflects binding free the energies, percentage to proteins. sequence dissimilarity (5% gauge shown at the top). The numbers at the nodes, calculated by the bootstrap algorithm, indicate the percent robustness of the separation of two bifurcating branches. The two branches involving knotted proteins (all trefoils) are highlighted in green. (b) Two orthogonal views of the MISTRAL alignment core of six representatives of the SOTCase homologous proteins, namely 2fg6C (knotted), 2i6uA, 2g68A, 2at2A, 1pg5A and 1ortA. These proteins are 313 amino acids long on average. Their alignment core consists of 212 amino acids at an average RMSD of 1.9Å. The color scheme red white blue follows the N to C sequence directionality. The rendering of PDB structures was carried out using the VMD [56] software. doi:10.1371/journal.pcbi.1000864.g001 Computation of a SAXS profile from a 3d protein structure

Amongst the knotted and unknotted entries, the average level of sequence identity is about 20%, with a standard deviation of 7%. Indeed, it is interesting to observe that few knotted/unknotted pairs can have a level of mutual sequence identity even larger than knotted pairs. For example the knotted chain 2g68A has a sequence identity of 33% and 38% respectively, against 1js1X (knotted) and 1pvvA (unknotted).

As, to the best of our knowledge, no previous study had pointed out meaningful relationships of knotted and unknotted proteins, the present results offer a novel insight into the possible mechanisms that have led to the appearance of knotted proteins.

In particular, the phylogenetic tree structure suggests the existence of a simple evolutionary lineage between the sets of knotted and unknotted proteins shown in Fig. 1a. In fact, both groups of trefoil knotted proteins, which have a limited mutual sequence identity, appear to have commonly diverged from the main tree of unknotted entries. The implications are twofold. On the one hand, the robust conservation of the knotted fold in the two sequence-diverged knotted groups suggest the functionally-oriented characteristics of the knotted topology. Indeed, it had already been pointed out for one member of this family, see ref. [19], that the active site is located close to the knotted region, a fact that led to speculate that knottedness would confer a necessary mechanical rigidity to the protein as a whole or to the active site [24], [25]. On the other hand, the existence of a single knotted branch indicates that the knot appearance, and its subsequent conservation, are rare evolutionary events.

Further clues about the biological rationale behind the evolutionary pathways that have led to the emergence/conservation of the knotted structures in Fig. 1a ought to be addressed using more powerful tools than the present sequence-based analysis, in particular, a more general reconstruction of the phylogenetic relatedness should be accomplished within a genome-wide perspective for the organisms involved.

“Knot-promoting” loops in SOTCase

Valuable insight into the fundamental similarities and differences in the entries appearing in the tree of Fig. 1a can be obtained by inspecting their structural alignment.

To this purpose we used the MISTRAL [40] multiple structural alignment web server which was recently developed by some of us. The use of this multiple structural 58 Activity Report CEA/DSM/IPhT 2008 — 2013 Evolution of spatial networks

Complex systems are very often organized under the form of ‘spatial networks’ where nodes and edges are embedded in space. Transportation and mobility networks, Internet, mobile phone networks, power grids, social and contact networks, neural networks, are all examples where space is relevant and where topology alone does not contain all the information. Characterizing and modeling the structure and the evolution of spatial networks is thus crucial for many different fields such as engineering, urbanism, neurophysiology, or epidemiology. An important consequence of space on networks exponent, and eventually saturates. These results is that there is a cost associated to the length of —difficult to interpret in the framework of fractal edges, which in turn has dramatic effects on the geometry— can be naturally explained through the topological structure of these networks. In [t11/027], geometric picture of the core and its branches: the we thoroughly present the current state of our un- first regime corresponds to a uniform core, while the derstanding of how the spatial constraints affect the second regime is controlled by the growth of inter- structure and properties of these networks. We re- station distances along the branches. The appar- view the most recent empirical observations and the ent convergence towards a unique network shape in most important models of spatial networks, and we the temporal limit suggests the existence of domi- also discuss various processes taking place on these nant, universal mechanisms governing the evolution spatial networks, such as phase transitions, random of these structures. walks, synchronization, navigation, resilience, and We also considered the evolution of street net- disease spread. works, a key element towards the understanding of If the static structure of these networks is now evolution of cities. We analyzed in Ref. [t12/100] well understood, it is not the case for their forma- a unique data set regarding almost 200 years of tion and evolution. In order to model these sys- evolution of the road network in a large area lo- tems, we need to identify important stylized facts, cated north of Milan (Italy). We find that urbani- and we analyzed empirical data of various systems sation is characterised by the homogenisation of cell [t10/113, t11/246, t12/100]. shapes, and by the stability throughout time of high- centrality roads which constitute the backbone of the urban structure, confirming the importance of historical paths. We show quantitatively that the growth of the network is governed by two elementary processes: (i) ‘densification’, corresponding to an increase in the local density of roads around existing urban centres and (ii) ‘exploration’, whereby Time evolution of the road network analyzed in new roads trigger the spatial evolution of the ur- [t12/100]. banisation front. In addition, we recently analyzed We first studied the temporal evolution of the quantitatively [t13/198] the effect of central plan- structure of the world’s largest subway networks ning on the evolution of the street network of Paris Ref. [t11/246]. Remarkably, all these networks con- in the period 1789-1999. verge to a shape which shares similar generic fea- These various empirical studies suggest the ex- tures, despite their geographic and economic differ- istence of general, simple properties of urbanisation ences. This limiting shape is made of a core with and open new directions for its modelling and quan- branches radiating from it. For most of these net- titative description. In particular, the cost of a link works, the average degree of a node (subway station) has a profound influence on the global structure of within the core has a value ∼ 2.5, and the proportion these network,s which usually display a hierarchical of nodes of degree 2 in the core is larger than 60%. spatial organization. The link between local con- Also, the number of stations lying along branches straints and large scale structure is however not elu- represents about half the total number of stations, cidated, and we introduced in [t13/184] a generic and the average diameter of branches is about twice model for the growth of spatial networks based on the average radial extension of the core. In agree- the general concept of cost benefit analysis. It pro- ment with a simple scaling argument, the number vides the first building block for a better understand- of branches scales roughly as the square root of the ing of the evolution of spatial networks and their number of stations. A spatial measure, the num- properties. In particular, this model suggests that ber of stations at distance ≤ r from the barycen- spatial hierarchy —which we show to be present in ter, displays a first regime (where it grows ∼ r2), real-world networks [t13/184]— is a crucial feature followed by another regime with a different growth for these systems, and probably possesses an important evolutionary advantage. CHAPTER A

Appendices

A.1 Executive Summary ...... 60 A.1.1 Human resources ...... 60 A.1.2 Scientific production ...... 60 A.1.3 Scientific visibility and attractivity of IPhT ...... 60 A.1.4 Teaching and formation ...... 61 A.1.5 Interaction with the socio-cultural environment ...... 61 A.2 Functional organization of the Institute ...... 62 A.3 Prizes ...... 63 A.4 External Fundings and grants ...... 64 A.4.1 European grants ...... 64 A.4.2 Eurotalents ...... 66 A.4.3 Grants from the Agence Nationale de la Recherche ...... 66 A.4.4 Funding structures in the region Ile-de-France ...... 68 A.4.5 National research networks (outside ANR) ...... 68 A.4.6 Binational Exchange programs ...... 69 A.5 Organization of scientific events ...... 72 A.5.1 Weekly seminars at IPhT ...... 72 A.5.2 Claude Itzykson meetings ...... 72 A.5.3 Organization of summer schools, workshops and conferences (minus Conférences Itzykson) ...... 73 A.6 Publications, 1/1/2008–30/06/2013 ...... 77 A.6.1 Some statistics ...... 77 A.6.2 Full publication list ...... 78 A.7 PhDs at IPhT ...... 137 A.7.1 Habilitation thesis - Habilitation à diriger des recherches ...... 137 A.7.2 PhD defenses since 2008 ...... 137 A.7.3 Current PhD students ...... 140 A.8 Teaching activities ...... 142 A.8.1 IPhT graduate lectures ...... 142 A.8.2 Teaching in university or “grandes écoles” ...... 144 A.9 Popularizing Science ...... 150 A.10 Scientific editing ...... 152 A.11 Research administration ...... 153 A.12 List of IPhT members ...... 155

59 60 Activity Report CEA/DSM/IPhT 2008 — 2013

A.1 Executive Summary

Laboratory: Institut de Physique Théorique, CEA/DSM/IPhT, CNRS URA 2306 Director: Michel Bauer

A.1.1 Human resources

CEA phys. CEA oth. CNRS phys. CNRS oth. grad. stud. Pdocs. Total 1/1/2008 32 8 14 0 16 18 88 30/6/2013 34 8 17 0 27 38 125

During the period 1/1/2008 - 30/6/2013, 8 permanent employees have left our Institute: 2 physicists left to other institutes, 3 physicists retired, 1 physicist left academia, 1 staﬀ is on parental leave, 1 staﬀ has moved to another position within CEA We have hired 3 CEA physicists, 1 CEA physicist through internal mutation, 1 CEA librarian through internal mutation. 5 CNRS physicists arrived: 3 new recruits, 2 through mutations. We have obtained 1 CNRS administrative assistant, who left but has been temporarily replaced.

A.1.2 Scientiﬁc production It is diﬃcult to select 5 "most relevant" results across the last 5-year period, due to the vast variety of themes covered by our research. The 22 “highlights" presented below already represent a controversial choice. Here are the total numbers of publications, according to the ISI Web of Science (these data only account for published material).

Year 2008 2009 2010 2011 2012 2013* Total # publications 186 191 186 246 215 86 1110

Most of the publications are articles appearing in peer-reviewed journals.

Apart from our scientific publications, some of our members have contributed to the elaboration of software packages dedicated to specific scientific computations. These soft- wards are freely accessible: – BlackHat: precision computations in gauge theories (D.Kosower) – TRIQS: computations of interacting quantum systems (O.Parcollet) – PPPC4DMID: computing Dark Matter signals (M.Cirelli) – FastJet: jet reconstruction in hard QCD collisions (e.g. at LHC) – MISTRAL, TT2NE and McGenus: predict the spatial structure of proteins (H.Orland)

A.1.3 Scientiﬁc visibility and attractivity of IPhT 1. since 1996, the annual “Conférence Itzykson", dedicated to various themes in theoretical physics, has grown in popularity and visibility. 2. Prizes: J. Hans D. Jensen prize or Heidelberg University to J-P Blaizot (2009). Prix Ernest Déchelle de l’académie des sciences to O. Parcollet (2009). Silver Medal of CNRS to H.Saleur (2011). Grand Prix Mergier-Bourdeix de l’académie des sciences to P.Vanhove (2013). Appendices 61

3. Every year we host about 200 short term visitors, coming from all around the world. An increasing number of long term visitors come with their own funding. 4. Members of IPhT have received 7 junior grants and 2 senior grants from the European Research Council. 5. Within the last 5 years we’ve been involved in 13 European training networks, 3 programs funded by the European Science Foundation, 5 "ANR Jeunes Chercheurs(ses)" projects (3 coordinated at IPhT), 21 "ANR Blanc" projects (12 coordinated at IPhT).

A.1.4 Teaching and formation 1. Each year we propose 4-6 “IPhT graduate courses", taught by our members, long term visitors or external professors. Each course lasts 6-12h, and the topics change every year. They are validated by the Ecole Doctorale de Physique. 2. each year we welcome 6-9 new PhD students at IPhT, and 6-15 master students. We also regularly welcome external PhD students for a few months. 3. 23 permanent members have taught in Bachelors, Masters, or postgraduate courses. Almost all our permanent members have taught in summer schools. Many organize summer schools.

A.1.5 Interaction with the socio-cultural environment 1. several articles in popular science journals, interviews to newspapers or science mag- azines 2. scientiﬁc radio programs 3. popular science conferences 4. talks in High schools 5. edition of Scholarpedia 62 Activity Report CEA/DSM/IPhT 2008 — 2013

A.2 Functional organization of the Institute

Michel BAUER Director of the Institut de Physique Théorique

Anne CAPDEPON Deputy director (administration, budget, security)

Stéphane NONNENMACHER Deputy director (scientific matters, relations with graduate schools, students, activity report)

« Mathematical Physics» group: Bertrand Eynard « Particules and Astrophysics » group : Stéphane Lavignac « Statistical Physics and Condensed Matter » group: Olivier Parcollet

Representative in the «conseil d’unité» : Mariana Graña Chef d’exploitation : Anne Capdepon Security of IT systems: Anne Capdepon Communication : Marc Barthelemy Formation : Sylvie Zaffanella

IPhT does not have a “Règlement intérieur” of its own. We apply the working rules of the Saclay research center. Appendices 63

A.3 Prizes

Jean-Paul Blaizot J. Hans D. Jensen prize awarded by the Ruprecht-Karls University (Heidelberg). February 2009.

Claude Godrèche Chevalier des palmes académiques. September 2009.

Olivier Parcollet Prix Ernest Déchelle awarded by the Academy of Sciences. November 2009.

Matt Luzum 2011 Dissertation in Nuclear Physics Award for his PhD thesis, awarded by the American Physical Society. November 2010.

Jean Zinn-Justin Elected Member of Academy of Science. March 2011.

Hubert Saleur Silver medal of CNRS. May 2011.

Pierre Vanhove Grand Prix Mergier-Bourdeix awarded by the French Academy of Sciences. June 2013.

Roger Balian Honorary Medal “De scientia et humanitate optime meritis” awarded by the Czech Academy of Sciences. September 2013

David Kosower J. J. Sakurai Prize for Theoretical Particle Physics awarded by the American Physical Society. September 2013 64 Activity Report CEA/DSM/IPhT 2008 — 2013

A.4 External Fundings and grants

Apart from direct funding from CEA, we have beneﬁtted from numerous external funding, either from French sources or European sources.

A.4.1 European grants Individual grants from the European Research Council

Person Type Topic Dates 01/07/2008- G. Servant ERC Starting Grant Cosmo@LHC 30/06/2013 01/01/2009- D. Kosower ERC Advanced Grant MM-PGT 31/12/2013 01/01/2010- I. Bena ERC Starting Grant String-QCD-BH 31/12/2014 01/02/2011- M. Graña ERC Starting Grant OberservableString 31/01/2016 01/08/2011- J.-P. Blaizot ERC Advanced Grant QCDMat 31/07/2016 01/11/2011- G. Biroli ERC Starting Grant NPRGGLASS 31/10/2016 01/01/2012- O. Parcollet ERC Starting Grant MottMetals 31/12/2016 01/10/2012- M. Cirelli ERC Starting Grant NewDARK 31/09/2017 ERC Starting Grant 01/01/2013- C. Bena Nano-Graphene (managed by Paris 11) 31/12/2017

Individual Marie-Curie Fellowships (FP6, FP7)

Person Type Topic Dates Intra-European TSINANO : Transport in Strongly 06/11/2006- C. Bena Fellowship, FP6 Interacting Nanosystems 05/11/2008 Outgoing Study of newly-discovered matter in 01/06/2007- C. Marquet International very energetic collisions of hadrons or 31/05/2010 Fellowship, FP6 heavy ions International Reinte 01/09/2007- I. Bena String Theory, QCD and Black Holes -gration Grant, FP6 31/08/2009 BEYOND NEUTRINO MASS : From neutrino mass phenomenology to the European Individual 01/09/2007- M. Frigerio particle physics theory beyond the Fellowships, FP7 31/08/2009 Standard Model and related signatures in cosmology and colliders J. Lopez HICLHC : Heavy Ion Collisions at the Intra-European 01/06/2009- Albacete LHC : Strong coupling techniques for Fellowship, FP7 30/05/2011 high density QCD AGILE : Perturbative Approaches to E. Sefusatti Intra-European 05/01/2010- Gravitational Instability and Lensing Fellowship, FP7 04/01/2012 in Cosmology International Maria 01/10/2011- Outgoing Fellowship, FluidGravity Rodriguez 31/09/2014 FP7 A. International 18/09/2011- LCFTdual Gaynutdinov Incoming Fellowship 17/09/2013 Appendices 65

European Networks The Marie Curie exchange programmes include the Research Training Networks (RTN), the Interna- tional Research Staﬀ Exchange Schemes (IRSES) and the the Initial Training Networks (ITN). The ICT Programme of the FP7 is dedicated to Information and Communication Technologies. We also include programs of the European Science Foundation (ESF).

Local Contact Topic Partners Dates QUEST : The Quest Coord. : I. Antoniadis (Ecole For Unification: 01/10/2004- C. Savoy Polytechnique) Theory Confronts 30/09/2008 12 part. Experiments ForcesUniverse : Constituents, Coord. : Dieter Luest (LMU Munich) 01/11/2004- P. Vanhove Fundamental Forces 25 part. 30/10/2008 and Symmetries of the Universe ENRAGE : European Coord. : R. Loll, Utrecht University 01/09/2005- F. David Network on Random 12 part. 31/08/2009 GEometry ESF INSTANS: Interdisciplinary Statistical and Field 01/05/2005- H. Saleur Coord. G. Mussard (SISSA, Trieste) Theory Approaches to 30/04/2010 Nanophysics and Low Dimensional Systems P. Brax UniverseNet : The C. Caprini origin of our universe: M. Cirelli Coord. : Subir Sarkar (Oxford) Seeking links between 2008-2010 C. Savoy 13 part. fundamental physics F. Vernizzi and cosmology PRACE : Partnership J.-M. Normand for Advanced 20 countries 2008-2012 Computing in Europe CASIMIR, New Trends and 01/01/2008- B. Duplantier Coord. : A. Lambrecht, LKB Applications of the 12/31/2012 Casimir Effect Coord. : I. Antoniadis (Ecole UNILHC : Unification 01/10/2009- C. Savoy Polytechnique) in the LHC era 30/09/2013 12 part. I. Bena G. Korchemsky ESF HOLOGRAV: D. Kosower Holographic methods Coord. N.Evans (Southampton) 2009-2014 I. Kostov in strongly coupled R. Peschanski systems D. Serban LHCPhenoNet : R. Britto Advanced Particle 01/01/2011- D. Kosower Coord. : German Rodrigo (Valencia) Phenomenology in the 31/12/2013 G. Soyez LHC era UNIFY : Unification Coord : M. S. Costa (Porto) 01/06/2011- I. Kostov of Fundamental Forces 6 part. 31/05/2015 and Applications Coord. B. Gavela (Madrid) 01/04/2012- S. Lavignac ITN Invisibles 11 part. 31/03/2016 66 Activity Report CEA/DSM/IPhT 2008 — 2013

01/10/2012- M. Barthelemy ICT EUNOIA Coord. IFISC (Spain) 30/09/2014 01/11/2012- M. Barthelemy ICT Plexmath Coord. A.Arenas (Tarragona) 31/10/2015 ITN GATIS: Gauge Coord. V.Schomerus (Hamburg) 01/01/2013- D. Serban Theory as an Integral 12 part. 31/12/2016 System

A.4.2 Eurotalents Eurotalents, a program of the EU (FP7), partially funding Postdocs in certain domains of science. We used this program to upgrade the salaries of 4 postdocs: G. Zaharijas (2010-2011), J.-M. No (2010-2011), T.S. Ray (2011-2012), Z. Huang (2011-2013).

A.4.3 Grants from the Agence Nationale de la Recherche The ANR mostly funds collaborative projects inside France. At IPhT we mostly beneﬁtted from nonthematic grants ("ANR Blanc"), as well as "young researcher grants" (Jeunes Chercheurs-Jeunes chercheuses). The "Chaire d’excellence" grants are individual grants welcoming exceptional young recruits.

ANR Chaire d’excellence

Person Acronym : Topic Dates 15/12/2009– R. Britto HSPQCD : Hard Scattering in Precision QCD 14/11/2012 CMBSecond : Cosmic Microwave Background Anisotropies 01/12/2009– F. Vernizzi at Second Order 30/11/2013 Jets4LHC : Developing new jet algorithms Optimising their 31/12/2010– G. Soyez parameters for LHC physics 30/12/2013

ANR Jeune chercheurs-jeune chercheuse (Young researchers)

Local contact Acronym : Topic Coordinator Dates RESOCHAOQUAN : Résonances et 30/11/2005– S. Nonnenmacher S. Nonnenmacher décohérence en chaos quantique 29/05/2009 NEUPAC : Propriétés non standard C. Volpe 05/12/2005– S. Lavignac des neutrinos et leur impact en (IPN, Orsay) 04/12/2008 astrophysique et en cosmologie DARKPHYS : Matière noire et 06/11/2006– G. Servant énergie noire : un déﬁ pour la G. Servant 06/11/2010 physique des particules String-QCD-BH : String Theory, 22/07/2008– I. Bena I. Bena QCD and Black Holes 31/12/2013 METHCHAOS : Méthodes spectrales C. Guillarmou 01/11/2009– S. Nonnenmacher en chaos classique et quantique (ENS, Paris) 31/10/2013 CARTAPLUS : Combinatoire des G.Chapuy (Paris 01/01/2013- J. Bouttier cartes et applications 7) 31/12/2015 ASPICS : Application de la physique F. Krzakala 01/01/2013- L. Zdeborova statistique à l’Inférence en (ESPCI) 31/12/2015 Acquisition comprimée LNAQM : Approche de grand-N pour 01/01/2013- G. Misguich les systèmes antiferromagnétiques G. Misguich 31/12/2015 quantiques Appendices 67

Nonthematic ANR grants (“ANR Blanc”’)

Local contact Acronym : Topic Coordinator Dates Phys@col&cos : Physique au-delà du A. Djouadi 01/12/2005– C. Savoy modèle standard : implications pour les (Paris 11) 01/12/2008 collisionneurs et la cosmologie POLINTBIO : Polymères, Interfaces et T. Garel G. Giacomin Systèmes Désordonnés : entre 2005–2008 C. Monthus (Math Paris 7) Mathématiques, Physique et Biologie 06/12/2005– D. Kosower QCD@LHC : QCD, torseurs et le LHC D. Kosower 06/12/2008 INT-AdS/CFT : Structures intégrables et la conjecture AdS/CFT : chaînes de 06/11/2006– H. Saleur H. Saleur spin et modèles sigma non-linéaires 06/11/2008 sypersymétriques BHTSV : Structure of vacuum, 06/11/2006– R. Minasian R. Minasian topological strings and black holes 06/11/2009 ECCE : Extreme conditions correlated D. Braithwaite 06/11/2006– C. Pépin electrons (CEA Grenoble) 06/11/2009 SLE : Outils probabilistes et invariance D. Bernard 06/11/2006– M. Bauer conforme en théorie des champs : SLE (ENS Paris) 01/11/2010 et autres processus de croissance De RHIC à LHC : Interactions fortes 06/11/2006– E. Iancu dans le régime de haute énergie : de E. Iancu 01/11/2010 RHIC à LHC NLDyn : Dynamique gravitationnelle 05/11/2007– F. Bernardeau F. Bernardeau non linéaire en cosmologie 04/11/2010 DynHet : Quantative characterisation of dynamic heterogeneities in glassy F. Ladieu 08/11/2007– G. Biroli materials : models, simulations and new (CEA/SPEC) 07/01/2011 experiments FAMOUS : Far from equilibrium L. Cugliandolo 01/10/2009– G. Biroli phenomena in quantum systems (UPMC) 30/09/2012 hadron@LHC : Hadron phenomenology 01/01/2009– J.-Y. Ollitrault in proton-proton and nucleus-nucleus J.-Y. Ollitrault 31/12/2012 collisions at the LHC A. Guionnet 01/01/2009– B. Eynard GranMA : Large Random Matrices (ENS Lyon) 31/12/2012 TH-EXP@TEV : Confronting theory 20/12/2010– S. Lavignac S. Lavignac with experiments at the Terascale 19/11/2014 DIME : Disorder, interactions, 20/12/2010– H. Saleur transport in low dimensions : exact H. Saleur 19/12/2014 methods and results StongInt : Dynamique à fort couplage E. Sokatchev 01/10/2011- G. Korchemsky et intégrabilité en théories de jauge (Annecy) 30/09/2015 CGC@LHC : Interactions multiples et 01/10/2011- F. Gélis F.Gélis production de particules au LHC 30/09/2015 FSCF : Fluctuations in Structured R. Blossey 01/11/2012- H.Orland Coulomb Fluids (Lille) 31/10/2015 QST : Propriétés quantiques 01/01/2013- R. Minasian fondamentales des théories R. Minasian 31/12/2016 supersymétriques COSMO@NLO : Les grandes structures 01/01/2013- F. Bernardeau F.Bernardeau de l’univers au-delà le l’ordre linéaire 31/12/2016 68 Activity Report CEA/DSM/IPhT 2008 — 2013

ANR “Systèmes complexes et modélisation mathématique"

Local contact Acronym : Topic Coordinator Dates Dyxi : Dynamiques Citadines J.-P. Nadal M. Barthélémy Collectives : Hétérogénéités Spatiales et 2009-2012 (ENS&EHESS) Individuelles

A.4.4 Funding structures in the region Ile-de-France Chaire Blaise Pascal In 2012-2013 we hosted Konstantin Efetov, who was awarded a Chaire internationale de recherche Blaise Pascal funded by the Région Ile-de-France.

RTRA - Triangle de la Physique RTRA stands for "Réseau thématique de recherche avancée". The RTRA -Triangle de la Physique is a collaborative structure on the Plateau de Saclay which started in 2007 and is now part of the IDEX (Ini- tiative d’Excellence") Paris-Saclay. It provides grants for postdocs, summer schools or long term visitors.

Person Topic Dates G. Biroli Beg-Rohu summer school 2008 A. Lefèvre H. Orland Invitation D. Andelman 2008 V. Pasquier Les Houches summer school 2008 D. Serban D. Serban 15th Itzykson Meeting "New Trends In Quantum Integrability" 2010 V. Pasquier “Ecole de travail sur les méthodes exactes en physique", Les Houches 2010 D. Serban C. Godrèche 16th Itzkykson Meeting "Extremes and Records" 2011 L. Zdeborova starting/installation grant, DySpaN "Dynamics on sparse networks" 2011-2014 G. Biroli Beg-Rohu summer school 2012 L. Zdeborova Tasc: Postdoc F.Caltagirone 2012-2013 G. Biroli Beg-Rohu summer school 2013

Labex A LaBex ("Laboratoire d’Excellence") is a large collaborative structure, centered thematically and geo- graphically. IPhT is aﬃliated to 3 Labex: PALM (Physique: Atomes, Lumère, Matière"), P2IO (Physique des 2 Inﬁnis et des Origines), Hadamard (mathematics).

Labex Person Topic Dates PALM L. Zdeborova Tasc: Postdoc F.Caltagirone (2d year) 2012-2013 Gravitational Waves as a New Probe P2IO C.Caprini of the Dark Side of the Universe 2014-2016 2-year postdoc

A.4.5 National research networks (outside ANR) P2I stands for "Groupement d’intérêt scientiﬁque Physique des 2 Inﬁnis". GDR stands for "Groupement de recherche" of CNRS. PNCG stands for "Programme National de Cosmologie et Galaxies" of CNRS. GRAM stands for "Gravitation, Références, Astronomie, Métrologie" of CNRS. PEPS stands for "Projets Exploratoires Pluridisciplinaire" of CNRS. Appendices 69

Dates Program Theme Contact Matière Noire et Nouvelle 2008-2010 P2I Physique: une attaque sur F. Bernardeau plusieurs fronts Des micro interactions M. Cirelli 2008-2010 P2I élémentaires aux macro structures cosmiques et retour Calculs de précision pour grands 2011 PNCG F. Bernardeau relevés cosmologiques Progress on Old and New Themes in Cosmology 2011 PNCG M. Cirelli (conference PONT Avignon 2011) Progress on Old and New Themes in Cosmology 2011 GRAM P. Brax (conference PONT Avignon 2011) S.De Bièvre (coord., Lille) 2009–2012 GDR Quantum Dynamics S. Nonnenmacher Alain Joye (Grenoble) Alain Joye (coord., Grenoble) 2013–2016 GDR Quantum Dynamics S. Nonnenmacher F. Hérau (Nantes) P. Serpico (coord. Decaying Dark Matter, matière Annecy) noire asymétrique et eﬀet de M. Cirelli 2010-2011 PEPS l’annihilation de matière noire F. Iocco sur la formation de galaxies G. Servant G. Zaharijas 2010 PEPS SLE & Quantum Gravity B. Duplantier ASPIT: Applying Statistical Physics to Information Theory, 2013 PEPS L. Zdeborova Signal Processing and Machine Learning

A.4.6 Binational Exchange programs Binational programs funded by the CNRS PICS stands for "Projet International de Coopération Scientiﬁque". GDRI stands for "Groupe de recherche international".

Dates Program Theme Partner Contact CNRS-USA 2006-2008 Exchange USA C. Grojean Program CNRS-USA Fluctuations et longueur de 2007-2008 Exchange corrélation dynamiques dans les USA G. Biroli Program systemes vitreux 70 Activity Report CEA/DSM/IPhT 2008 — 2013

I. Bena Aspects of String Theory with M. Graña 2010-2012 PICS England ﬂuxes M. Petrini (coord.) Systemes intégrables discrets, 2011 PICS USA P. Di Francesco algébres d’amas et positivité Symétries cachées des 2010 PICS amplitudes de diﬀusion dans les Russie G. Korchemsky théories de Yang-Mills I. Kostov J.-M. Maillet French-Russian network in Académie des (coord.) 2008-2012 GDRI Theoretical and Mathematical Sciences V. Terras Physics Russe (coord.)

Fluctuations et hydrodynamique J-Y Ollitrault 2012-2013 CNRS-FAPEPS dans les collisions d’ions lourds Brésil ultrarelativistes

Partenariats Hubert Curien PHC stands for "Partenariats Hubert Curien", they are binational exchange programs co-funded by the French Ministry of foreign aﬀairs.

Dates Program Theme Partner Contact Institut de recherche nucléaire et Géométrie aléatoire, gravité 2007–2008 PHC Rila de l’énergie I. Kostov quantique et théories conformes nucléaire, Soﬁa (Bulgarie) Jagellonian 2008–2009 PHC Polonium QGP and Strings University R. Peschanski (Pologne) The Early Universe and Dark Université de 2010 PHC Pessoa P. Brax Energy Lisbonne Vienna Du RHIC au LHC sur une University of 2009–2010 PHC Amadeus E. Iancu supercorde technology (Autriche) Physics from the grand 2010–2011 PHC Proteus uniﬁcation scale to LHC Slovenia S. Lavignac energies Precision calculations for RESCEU, PHC Sakura cosmological large-scale University of F. Bernardeau 2011–2012 structure observations Tokyo

Other exchange programs

These binational exchange programs are (co-)sponsored by the French ministry of foreign aﬀairs. ECO-NET stands for "Programmes de collaboration avec l’Europe de l’est et l’ex-URSS". COFECUB stands for "Comité Français d’Evaluation de la Coopération Universitaire et Scientiﬁque avec le Brésil". CEFIPRA stands for Indo French Centre for the Promotion of Advanced Research. Appendices 71

Dates Program Theme Partner Contact Skobeltsyn Inst. Nucl. Phys., Lomonosov Intégrales de Feynman à deux Moscow State 2006–2008 ECO-NET D. Kosower boucles et au-delà Univ.; Chelkowski Inst. Phys., Univ. Silesia, Pologne La frontière des hautes énergies: exploration des nouveaux COFECUB modèles de la physique des 2007-2009 Brasil C. Savoy Capes particules au collisionneur LHC du CERN et aux expériences avec des neutrinos M. Graña Generalizing Geometry in String COFECUB R. Minasian 2008–2012 Theory : its phenomenological Argentine ECOS-SUD M. Petrini implications (coord.) Les premiers instants d’une 2008–2011 COFECUB USP collision d’ions lourds Brasil J.-Y. Ollitrault ultra-relativistes Théories eﬀectives et techniques COFECUB 2009–2013 non-perturbatives pour des Brasil E. Iancu Capes systèmes de quarks et de gluons COFECUB The mystery of the hidden order 2012–2015 Brasil C. Pépin Capes in URu2Si2 Coopération Institut Niels Hidden structures of gauge and 2010 scientiﬁque et Bohr, P. Vanhove quantum gravity amplitudes universitaire Copenhague Perturbative amplitudes in Echange France - D. Kosower - 2008–2009 gauge theory and quantum MIT MIT P. Vanhove gravity 01/01/2011- Echange France - The Mathematics of Liouville MIT-France B. Duplantier 08/31/2012 MIT Quantum Gravity Seed Fund TIFR 2011–2013 CEFIPRA Extreme QCD in the LHC era J.-Y. Ollitrault Mumbai 72 Activity Report CEA/DSM/IPhT 2008 — 2013

A.5 Organization of scientiﬁc events

A.5.1 Weekly seminars at IPhT

Monday 11:00 Mathematical Physics 14:00 Statistical Physics Tuesday 11:00 Colloquium (every 2 weeks) Wednesday 14:15 Particle Physics and Cosmology Thursday 16:00 PhD seminar Friday 10:00 IPhT lectures 14:15 Matrices, Strings & Random Geometries

Usually, seminars take place in the IPhT seminar room (Claude Itzykson room), which can contain up to 50 persons. For larger events, we can use in the same building an amphitheater for 140 persons (Amphi Claude Bloch).

A.5.2 Claude Itzykson meetings The Claude Itzykson meetings are the main scientiﬁc events at IPhT. Created to honour the memory of Claude Itzykson, they have become a tradition. Every year in June, scientists from all over the world (mainly but not only physicists) meet for a few days to cover the main recent advances on a targeted theme. Two important features are the insistence on pedagogical seminars and the opportunity given to young researchers as well as established experts to give a talk. Puzzles of Growth 13th Claude Itzykson Meeting, June 9–11, 2008 Org: M. Bauer, D. Bernard (LPTENS), Z. Burda (Univ. Jagiellonski, Krakow), F. David, A. Lefèvre.

Recent Advances in String Theory 14th Claude Itzykson Meeting, June 17–19, 2009 Org: I. Bena, M. Graña, R. Minasian, P. Vanhove.

New Trends In Quantum Integrability 15th Claude Itzykson Meeting, June 21–23, 2010 Org: D. Lebedev (ITEP Moscow), V. Pasquier, R. Santachiara (LPTMS Orsay), D. Serban.

Extremes and Records 16th Claude Itzykson Meeting, June 14–17, 2011 Org: C. Godrèche, S. N. Majumdar (LPTMS) and G. Schehr (LPTMS).

Heart of Darkness: Dark energy and modiﬁed gravity 17th Claude Itzykson Meeting, June 18–20, 2012 Org: Philippe Brax, Chiara Caprini, Lam Hui (Columbia) and Filippo Vernizzi.

Frontiers of String Theory 18th Claude Itzykson Meeting, July 1–3, 2013 Org: Iosif Bena, Mariana Graña, Ruben Minasian, Pierre Vanhove. Appendices 73

A.5.3 Organization of summer schools, workshops and conferences (minus Conférences Itzykson)

Recurrent Events Nonnenmacher Stéphane Mathematical aspects of quantum chaos, Montreal; Lavignac Stéphane Jun 2–7, 2008. École de Gif, (French summer school on particle Biroli Giulio, Lefèvre Alexandre physics); since 2001. Manifolds in random media, random matrices and Luck Jean-Marc extreme value statistics, summer school, Beg Rohu; Rencontres de physique statistique, Paris; every Jun 16–28, 2008. January. Vanhove Pierre Nonnenmacher Stéphane Theory and particle physics: the LHC perspective Spectral problems in mathematical physics, and beyond, summer school, Cargèse; Jun 16–28, (monthly seminar at IHP), Paris; since 2006. 2008. Duplantier Bertrand, Pasquier Vincent Kosower David, Vanhove Pierre Séminaire Poincaré, bi-annual, IHP, Paris; since Wonders of gauge theory and supergravity, Paris 2002. and Saclay; Jun 23–28, 2008. Korchemsky Gregory Pasquier Vincent, Serban Didina International School of Theoretical Physics, Parma; Exact methods in low-dimensional statistical physics 2009–. and quantum computing, Les Houches; Jun 30 – Aug Nonnenmacher Stéphane 1, 2008. Seminaire Itzykson de physique mathématique, Parcollet Olivier IHES; 3 times/yr since Nov 2012. Frontiers in strongly correlated systems, Aspen; Jul 2008 Events 27 – Sep 7, 2008. Biroli Giulio Mallick Kirone, Peschanski Robi, Dynamical heterogeneities in glasses, colloids and Sauboy Laure granular media, Leiden; Aug 25 – Sep 5, 2008. Forum de la théorie, Saclay; Feb 7–8, 2008. Lavignac Stéphane Monthus Cécile NNN08 Next generation nucleon decay and neutrino Disorder and localization phenomena, from theory detectors, Paris; Sep 11–13, 2008. to applications, Paris; Mar 17–19, 2008. Billoire Alain, Bouttier Jérémie, Zaf- Gélis François, Iancu Edmond, Olli- fanella Sylvie trault Jean-Yves Colloque IPhT, Batz-sur-mer; 15–17 Oct 2010. Hadronic collisions at the LHC and QCD at high Olivier density, school, Les Houches; Mar 25 – Apr 4, 2008. Parcollet Quantum coherence and many-body correlations: Brax Philippe, Cirelli Marco, Servant from mesoscopic to macroscopic scales, Saclay; Oct Géraldine 22–23, 2008. Progress on old and new themes in cosmology (PONT), Avignon; Apr 21-25, 2008. Cirelli Marco, Grojean Christophe Physics of electroweak symmetry breaking and the Di Francesco Philippe, Duplantier LHC, workshop, Saclay; Oct 27–29, 2008; Mar 2–3, Bertrand 2009. Statistical-mechanics and quantum-ﬁeld theory methods in combinatorial enumeration, Cambridge, UK; Apr 21–25, 2008. 2009 Events Bena Iosif Gravitational scattering, black holes and the infor- Nonnenmacher Stéphane mation paradox, workshop, Paris; May 26–28, 2008. Resonances in physics and mathematics, Marseille; Jan 19–23, 2009. Bauer Michel, David François, Lefèvre Alexandre Nonnenmacher Stéphane On growth and shapes, Enrage topical school, Paris; Quantum chaos, winter school, Bordeaux; Jan 26– Jun 2–6, 2008. 30, 2009. 74 Activity Report CEA/DSM/IPhT 2008 — 2013

Blaizot Jean-Paul Vanhove Pierre Phases of strongly interacting matter, school, Orsay; String theory: formal developments and applica- Mar 9–13, 2009. tions, summer school Cargèse; Jun 21 – Jul 3, 2010.

Gélis François, Iancu Edmond, Olli- Iancu Edmond, Peschanski Robi trault Jean-Yves Low X meeting, Kavala, Greece; Jun 23–27, 2010. Quantum ﬁeld theory in extreme environments, Saclay; Apr 23–25, 2009. Grana Mariana String phenomenology, Paris; Jul 5–9, 2010. Cirelli Marco TANGO in PARIS: Testing astroparticle with the Bernardeau Francis, Vernizzi Filippo new GeV/TeV observations: positrons and electrons, Xème école de cosmologie, Cargèse; Jul 5–10, 2010. identifying the sources, Paris; May 4–6, 2009. Cirelli Marco, Zaharijas Gabrijela Biroli Giulio, Lefèvre Alexandre TeV particle astrophysics, Paris; Jul 19–23, 2010. Quantum physics out of equilibrium, summer school, Beg-Rohu; Jun 15–27, 2009. Orland Henri, Francesco Philippe Di Statphys24, Cairns, Australia; Jul 19–23, 2010. Pépin Catherine Emergent quantum phenomena from the nano to the Grojean Christophe, Servant Géraldine macro world, Cargèse; Jul 6–19, 2009. Physics at TeV colliders - from Tevatron to LHC, Cargèse; Jul 19–31, 2010. Pépin Catherine Correlated behavior and quantum criticality in Cirelli Marco heavy fermion and related systems, Aspen; Aug 9 ICHEP – International conference on high energy – Sep 13, 2009. physics, Paris; Jul 22–28, 2010. Bouttier Jérémie Bena Iosif Statistical physics, combinatorics and probability: ICHEP Track 12 – Beyond quantum ﬁeld theory ap- from discrete to continuous models, trimester at proaches (including string theories), Paris; Jul 22– IHP, Paris; Sep 7 – Dec 18, 2009. 28, 2010. Kostov Ivan, Serban Didina Facets of integrability, Saclay and Paris; Nov 5–7, Biroli Giulio, Lefèvre Alexandre 2009. Concepts and methods of statistical mechanics, summer school, Beg Rohu; Aug 23 – Sep 4, 2010.

2010 Events Minasian Ruben Advances in string theory, wall crossing, and quater- nion Kähler geometry, IHP, Paris; 30 Aug–3 Sept. Misguich Grégoire 2010. Novel physics on the kagome network, Orsay; Jan 18–20, 2010. Cirelli Marco Cosmic rays for particle and astroparticle physics Vincent, Didina Pasquier Serban (ICATPP), Como, Italy; Oct 7–8, 2010. Physics in the plane: From condensed matter to string theory, Les Houches; Feb 28 – Mar 5, 2010. Gélis François, Misguich Grégoire, Zaf- Sylvie Orland Henri, Vanhove Pierre fanella Rencontres IHÉS-IPhT, IHÉS; Mar 18, 2010. Colloque IPhT, Batz-sur-mer; 13–15 Oct 2010. Brax Philippe, Lavignac Stéphane, Cirelli Marco Sauboy Laure ECFA study of physics and detectors for a linear GDR Terascale, Saclay; Mar 29–31, 2010. collider, Geneva; Oct, 2010. Grojean Christophe, Servant Géraldine Goi Enrico, Orsi Francesco Planck 2010: from the Planck scale to the elec- Strings, cosmology and gravity student conference troweak scale, CERN; May 31 – Jun 4, 2010. (SCGSC), Paris; Nov 3–5, 2010.

Bernardeau Francis, Sefusatti Emiliano, Cirelli Marco Vernizzi Filippo Dark matter all around, Paris; Dec 13-17, 2010. The almost gaussian universe: a workshop on the observable eﬀects of primordial non-gaussianity, Saclay; Jun 9–11, 2010. 2011 Events Appendices 75

Iancu Edmond Bernardeau Francis Excited QCD 2011, Les Houches; Feb 20–25, 2011. Worskhop “PTChat", IPhT; 20–22 Sep 2011. Gélis François Graña Mariana Winter Workshop on Recent QCD Advances at the Workshop “Hierarchies and Symmetries", Univ. LHC, Les Houches; 13–18 Feb 2011. Paris 6; Sept 2011. Brax Philippe, Caprini Chiara, Cirelli Eynard Bertrand Marco, Servant Géraldine Conference GranMa, IHP, Paris; 3–6 Oct 2011. Progress on old and new themes in cosmology Nonnenmacher Stéphane (PONT), Avignon; 18–22 Apr 2011. Work study “Quantum Ergodicity", Oberwolfach, Pépin Catherine Allemagne; 10–14 Oct 2011. Quantum criticality, Natal, Brésil; May 2011. Bena Iosif, Graña Mariana Ollitrault Jean-Yves Workshop “The supersymmetric, the extremal and Quark Matter 2011, Annecy; 22–28 May 2011. the ugly - solutions in string theory", IPhT; 15 Nov 2011. Nonnenmacher Stéphane Spectral gap in dynamical systems, number theory Biroli Giulio, Lenka Zdeborova and PDEs, Peyresq, France; 30 May – 3 Jun 2011. Unifying concepts in glass physics V, IHP, Paris; 12– 16 Dec 2011. Soyez Gregory Workshop “Physics at TeV colliders", Les Houches; Gélis François 30 May – 17 Jun 2011. "Workshop on Thermalization in heavy ion collisions", Heidelberg; Dec 2011. Peschanski Robi Low X meeting, Univ. Santiago de Compostela, 2012 Events Spain; 3–7 Jun 2011.

Cirelli Marco Lenka Zdeborova Workshop on the Interconnections between Particle Workshop Bridging statistical physics and optimiza- Physics and Cosmology, CERN, Geneva; Jun 2011. tion, inference and Learning, Les Houches; 19–24 Serban Didina Feb 2012. Double aﬃne Hecke algebras, the Langlands pro- Biroli Giulio gram, super Yang-Mills theories and AdS-CFT cor- Rejuvenating concepts in glass physic, IHP, Paris; respondence, Cargèse; 20 Jun – 16 Jul 2011. March 2012. Serban Didina Di Francesco Philippe Hecke algebras, the Langlands Program and connec- Workshop “Statistical Mechanics and Conformal In- tions to physics, Cargèse; 4–15 July 2011. variance", MSRI, Berkeley; March 2012. David François Gélis François Congrès de la SFP 2011, Bordeaux; 4–8 July 2011. Quarks in Nuclear Physics 2012, Ecole Polytech- Cirelli Marco nique; Apr 2012. Dark Matter Undeground and in the Heavens, Eynard Bertrand CERN, Geneva; July 2011. Integrable systems and random matrices, IHP Paris; Gélis François 21-23 May 2012. Workshop "Standard and novel QCD phenomena at Biroli Giulio hadron colliders", ECT*, Trento; Jun 2011. Glass and Jamming Transitions, Beg Rohu Summer School; May 28 – Jun 8, 2012. Biroli Giulio Statistical Physics and Complex Systems, Beg Rohu Soyez Gregory Summer School; Jul 19–31, 2011. Workshop “Physics at TeV colliders", Les Houches; 3–21 Jun 2013. Bena Iosif Workshop "Holography and Singularities in String Nonnenmacher Stéphane Theory and Quantum Gravity", Aspen Center for Work study "Chaotic waves", Peyresq; 11–15 Jun Physics; 24 July – 21 August 2011. 2012. Saleur Hubert Di Francesco Philippe Semester ‘Advanced Conformal Field Theory’, IHP, Conf. “Conformal Invariance, Discrete Holomor- Paris; Fall 2011. phicity and Integrability", Helsinki; June 2012. 76 Activity Report CEA/DSM/IPhT 2008 — 2013

Vanhove Pierre Bernardeau Francis, Valageas Patrick Gauge theory and String theory, Cargese; Jun 2012. Workshop “PTChat", Cargèse; 30 Apr–3 May 2013. Soyez Gregory Serban Didina Jet workshop, UPMC, Paris; 1–4 July 2013. Sakura in Saclay: Integrability in Gauge Theory, Korchemsky Gregory IPhT; 29–31 May 2013. Workshop "Scattering Amplitudes: from QCD to Bauer Michel, Mallick Kirone maximally supersymmetric Yang-Mills theory and Statistical Mechanics and its Applications to Biol- back", ECT*, Trento; 16–20 July 2012. ogy and Soft Matter, IPhT; May 22-23, 2013. Stéphane Lavignac Edmond Conf. “Higgs hunting 2012", LAL, Orsay; 18–20 July Iancu Standard and novel QCD phenomena, ECT*, 2012. Trento; 30 May–2 Jun 2013. Nonnenmacher Stéphane Quantum Chaos Summer School, ESI Vienna; 30 Lenka Zdeborova July–3Aug 2012. Czech Workshop on Complex Systems, Prague; June 3–4, 2013. Parcollet Olivier, Saleur Hubert Summer school, “Strongly interacting quantum sys- Biroli Giulio tems out of equilibrium", Les Houches; Aug 2012., Disordered Systems, Beg Rohu Summer School; 3– 15 Jun 2013. syst quant fort correles hors eq. Ollitrault Jean-Yves Iancu Edmond Quark Matter 2012, Washington, USA; 13–18 Aug High energy, high density and hot QCD June 17-21, 2012. 2013, ECT*, Trento; 17–21June 2013. Lenka Zdeborova Nonnenmacher Stéphane Summer program "Disorder, Algorithms and Com- Conf "Quantum chaos, resonances and semi-classical plexity", Aspen, USA; 19 Aug – 9 Sep 2012. measures", Roscoﬀ; 17–12 Jun 2013. Gregory Korchemsky Bouttier Jérémie Conf. “Integrability in Gauge and String Theory", Journées “cartes", IPhT; 20–21 June 2013. ETH Zurich; 20–24 Aug 2012. Gélis François Bena Iosif Workshop "h3QCD (high energy, high density and The 42’nd Paris Summer Institute, ENS Paris; 20– hot QCD)", ECT*; Jun 2013. 31 Aug 2012. Pépin Catherine, , François David Zaf- David François fanella Sylvie Congrès de la SFP 2013, Marseille; 1–5 July 2013. Colloque IPhT, L’Isle-sur-la-Sorgue; 15–17 Oct Bernardeau Francis 2012. Post-Planck cosmology, Les Houches; July 2013. Francis Bernardeau Lavignac Stéphane Rencontres de Moriond de cosmologie, Moriond; Conf. “Higgs hunting 2013", Orsay; 25–27 July 2012. 2012–. Bernardeau Francis Vanhove Pierre, Korchemsky Gregory Trimestre “Gravasco", IHP, Paris; Fall 2013. Conf. "Amplitudes and periods", IHES; Dec 2012. Cirelli Marco Misguich Grégoire TeV Particle Astrophysics Conference, Mumbai, In- Summer School "Quantum spin liquids: from the- dia; Dec 2012. ory to numerical simulations", SISSA, Trieste; 9–20 Sept 2013. 2013 Events Ollitrault Jean-Yves Ecole Joliot-Curie 2013, Fréjus; 29 Sep–4 Oct 2013. David François Quantum gravity in Paris, LPT Orsay; 18–22 March Lenka Zdeborova 2013. Autumn school, "Statistical physics, Optimization, Inference and Message-Passing algorithms", Les Marc, Mariana, Barthelemy Graña Houches; Sep 30 – Oct 11, 2013. Peschanski Robi Forum de la théorie, IPhT; 3–4 Apr 2013. Kostov Ivan 4th conf. honor A.Zamolodchikov, “CFT and Inte- Britto Ruth Conf. "Amplitudes 2013", Tegernsee, Allemagne; 28 grability", Seoul; 16–20 Dec 2013. Apr –03 May 2013. Appendices 77

A.6 Publications, 1/1/2008–30/06/2013

A.6.1 Some statistics

The data in the following table have been compiled by the CEA central library, using the ISI Web of Science database. They include published material submitted to the peer-review process: articles, letters, reviews, comments, proceedings published in peer-reviewed journals. They exclude books, proceedings published in books or series. “Expected IF" means that each article is weighted by the current impact factor of the journal. The top n% corresponds to the best cited articles in physics, for the corresponding year. We also give the percentage of our publications in collaboration with foreign, resp. European colleagues.

Year 2008 2009 2010 2011 2012 2013 (30 Jun) Total/average # publications 186 191 187 246 215 86 1100 (total) Expected IF 4,12 3,88 3,80 3,96 4,24 4.01 (av.) aver. citation # 19.5 15.2 10.4 6.6 2.1 % articles in top 10% 32 28 28 32 34 31 (av.) % articles in top 1% 3.2 4.2 3.8 3.7 5.6 4 (av.) % collaborations world 65 69 64 69 79 % collaborations EU 31 38 37 33 47

Table 20: Quantitative data on our publications (after ISI Web of Science)

The above statistics does not differentiate between peer-reviewed articles and proceedings. Below we present the statistics of our own database. The figures do not match the above table, because we count our publications according to the year they are registered in our database, which mostly happens several months (or years) before they are published. Our database allows to differentiates between preprints, articles published in peer-reviewed journals, proceedings, books, theses.

Year of registration 2008 2009 2010 2011 2012 2013 (30 Jun) Total preprints 5 11 10 5 17 28 76 published articles 191 206 212 213 178 91 1091 proceedings 25 49 43 24 30 10 181 books, book chapters 7 7 9 7 1 0 31 lecture notes 8 8 6 8 6 0 43 theses 4 10 7 9 6 0 36

Table 21: Our publication database (on 30 June 2013)

In the following table we provide the list of journals where we have published most during the period 2008-2012.

Journal # art. Journal # art. J. High Energy Physics 149 J. Phys.G-Nucl. Part. Phys. 17 Phys. Rev. D 105 Eur. Phys. J. C 14 J. of Stat. Mech. 68 Nucl. Phys. B-Proc. Suppl. 14 Phys. Rev. Lett. 67 Acta Phys. Polon. B 14 J. Phys. A-Math. Gen. 60 EPL 13 Phys. Rev. B 56 J. Stat. Phys. 13 J. Cosm. Astropart. Phys. 53 Astron. & Astrop. 12 Nucl. Phys. B 45 Class. Quant. Grav. 11 Nucl. Phys. A 43 Commun. Math.Phys. 10 Phys.Lett. B 30 J. Chem. Phys. 10 Phys.Rev. E 26 Lett. Math. Phys. 8 Phys. Rev. C 25 Eur. Phys.J. B 8 78 Activity Report CEA/DSM/IPhT 2008 — 2013

Some distinguished articles Quantum Gravity and the KPZ formula [after Duplantier-Sheﬃeld] by C. Garban appeared in Séminaire Bourbaki in March 2012, describing the results of [t08/047].

[t11/096] by A.Lazarescu and K.Mallick was awarded the Best J. Phys. A Paper Prize 2012. [t12/118] by the same authors was in the Editor’s choice, and deserved a Viewpoint in Phys. Rev. Lett., 2012

[t11/148] and [t12/013] by G.Borot, J.Bouttier and E.Guitter made it to the section IOP Select for J.Phys A.

[t13/129] by K.Efetov, H.Meier and C.Pépin was on focus in Nature Phys. online, 2013.

[t11/054] by J.Dubail, J.Jacobsen and H.Saleur was awarded the Best J. Phys. A Paper Prize 2011

The article by J.M. Drummond, G.P. Korchemsky, E. Sokatchev, Nucl. Phys. B 795 385–408 (2008) received the Nucl. Phys. B Most Cited Article 2006-2010.

[t12/193] by R.Vasseur and J.Jacobsen was selected in IOP Select and made the cover of the Issue 16, Vol. 45 of J. Phys. A.

[t10/124] and [t11/092] by H.Orland et al. made the cover of, respectively, the vol. 134, no. 2 of J. Chem. Phys. and the vol. 34, no. 6 of EPJ E.

[t12/159] by Z.Bern, L.J.Dixon and D.Kosower made the cover of the May 2012 volume of Scientiﬁc American.

A.6.2 Full publication list Below we present our full publication list for the period. This list comes from our own publication database, which slightly diﬀers from the one of ISI Web of Science. Our database is searchable on http://ipht.cea.fr/Docspht/search/search.php. We have included the preprints, published articles, proceedings (published in journals or books), books, lecture notes, PhD and Habilitation theses. We excluded the seminars or reports. Apart from printed material, our scientiﬁc production also consists in a software packages, which have already been listed in Table 5. Bibliography

[t08/001] M. Boonekamp, J. Cammin, R. Peschanski, and C. Royon. Threshold scans in diffractive W pair production via QED processes at the LHC. Phys. Lett. B, 654, 104–109, (2007), arXiv:0709.2742. [t08/003] Y. Avishai and J.M. Luck. Tight-binding electronic spectra on graphs with spherical topology. I. The effect of a magnetic charge. J. Stat. Mech., P06007, (2008), arXiv:0801.1460. [t08/004] C. Monthus and T. Garel. Non-equilibrium dynamics of polymers and interfaces in random media : conjecture ψ = ds/2 for the barrier exponent. J. Phys. A, 41, 115002, (2008), arXiv:0712.3358. [t08/007] I.K. Kostov, D. Serban, and D. Volin. Functional BES equation. JHEP, 0808, 101, (2008), arXiv:0801.2542. [t08/010] B.-Y. Park, M. Rho, and V. Vento. The Role of the Dilaton in Dense Skyrmion Matter. Nucl. Phys. A, 807, 28–37, (2008), arXiv:0801.1374. [t08/013] P. Desrosiers. Duality in random matrix ensembles for all Beta. Nucl. Phys. B, 817, 224–251, (2009), arXiv:0801.3438. [t08/014] B.G. Giraud. Scalar Nature of the Nuclear Density Functional. Phys. Rev. C, 78, 014307, (2008), arXiv:0801.3447. [t08/015] M. Douspis, P.G. Castro, C. Caprini, and N. Aghanim. Optimising large galaxy surveys for ISW detection. Astron. Astrophys., 485, 395–401, (2008), arXiv:0802.0983. [t08/016] P. Valageas. Expansion schemes for gravitational clustering: computing two-point and three-point functions. Astron. Astrophys., 484, 79–101, (2008), arXiv:0711.3407. [t08/017] N. Gromov, S. Schafer-Nameki, and P. Vieira. Quantum Wrapped Giant Magnon. Phys. Rev. D, 78, 026006, (2008), arXiv:0801.3671. [t08/018] N.E.J. Bjerrum-Bohr and P. Vanhove. Explicit Cancellation of Triangles in One-loop Gravity Ampli- tudes. JHEP, 0804, 065, (2008), arXiv:0802.0868. [t08/019] P.A. Grassi and P. Vanhove. Higher-loop amplitudes in the non-minimal pure spinor formalism. JHEP, 0905, 089, (2009), arXiv:0903.3903. [t08/020] A. Bilandzic, N.v.d. Kolk, J.-Y. Ollitrault, and R. Snellings. Event-plane flow analysis without non-flow effects. Phys. Rev. C, 83, 014909, (2011), arXiv:0801.3915. [t08/021] F. Bernardeau. Cosmologie, des fondements théoriques aux observations. EDP Sciences, (2007). [t08/022] J.-P. Uzan, F. Bernardeau, and Y. Mellier. Time drift of cosmological redshifts and its variance. Phys. Rev. D, 77, 021301, (2008), arXiv:0711.1950. [t08/024] Y. Avishai and J.M. Luck. Tight-binding electronic spectra on graphs with spherical topology. II. The effect of spin-orbit interaction. J. Stat. Mech., P06008, (2008), arXiv:0802.0795. [t08/026] B. Eynard. Large N expansion of convergent matrix integrals, holomorphic anomalies, and background independence. JHEP, 0903, 003, (2009), arXiv:0802.1788. [t08/027] G. Biroli, J.-P. Bouchaud, and M. Potters. The Student ensemble of correlation matrices: eigenvalue spectrum and Kullback-Leibler entropy. Acta Phys. Pol. B, 38, 4009–4026, (2007), arXiv:0710.0802. [t08/028] G. Biroli and J.-P. Bouchaud. Scenarii for slow dynamics and cooperative lengthscales in glass-formers. Eur. Phys. J. B, 64, 327, (2008). [t08/029] J.-P. Bouchaud and G. Biroli. Quantum plasticity and dislocation-induced supersolidity. C.R. Physique, 9, 1067–1075, (2008), arXiv:0710.3087. [t08/030] F. Lechenault, O. Dauchot, G. Biroli, and J.-P. Bouchaud. Lower bound on the four-point dynamical susceptibility: Direct experimental test on a granular packing. Europhys. Lett., 83, 46002, (2008), arXiv:0712.2036v1.

79 80 Activity Report CEA/DSM/IPhT 2008 — 2013

[t08/031] L. Berthier and G. Biroli. Glasses and Aging: a statistical mechanics perspective. (2008). [t08/032] C. Normand. Modal versus energy stability analysis of kinematic dynamos in cylindrical configurations. Phys. Fluids, 20, 084105, (2008). [t08/033] I. Bena, N. Bobev, and N.P. Warner. Spectral Flow, and the Spectrum of Multi-Center Solutions. Phys. Rev. D, 77, 125025, (2008), arXiv:0803.1203. [t08/034] M. Cirelli, R. Franceschini, and A. Strumia. Minimal Dark Matter predictions for galactic positrons, anti-protons, photons. Nucl. Phys. B, 800, 204–220, (2008), arXiv:0802.3378. [t08/035] A. Poteryaev, M. Ferrero, A. Georges, and O. Parcollet. Effect of Crystal-Field Splitting and Inter-Band Hybridization on the Metal-Insulator Transitions of Strongly Correlated Systems. Phys. Rev. B, 78, 045115, (2008), arXiv:0801.4356. [t08/037] G.E. Brown, C.-H. Lee, and M. Rho. Kaon condensation, black holes and cosmological natural selection. Phys. Rev. Lett., 101, 091101, (2008), arXiv:0802.2997. [t08/038] Vanhove P., editor. String Theory and the Real World: From particle physics to astrophysics. Elsevier, (2008). [t08/042] L. Auvray, B. Duplantier, A. Echard, and C. Sykes. Physique des polymères et membranes biologiques, partie 1. Ecole Polytechnique, Département de Physique, 262 pages, 2008-01-31, (2008). [t08/043] B. Duplantier, A. Echard, and C. Sykes. Physique des polymères et membranes biologiques, partie 2. Approfondissements Physique, Biologie, Mécanique, Ecole Polytechnique, Département de Physique, 45 pages, 2008-02-14, (2008). [t08/044] B. Duplantier and I.A. Binder. Harmonic measure and winding of random conformal paths: A Coulomb gas perspective. Nucl. Phys. B, 802 [FS], 494–513, (2008), arXiv:0802.2280. [t08/045] Z. Bern, L.J. Dixon, D.A. Kosower, R. Roiban, M. Spradlin, C. Vergu, and A. Volovich. The Two-Loop Six-Gluon MHV Amplitude in Maximally Supersymmetric Yang-Mills Theory. Phys. Rev. D, 78, 045007, (2008), arXiv:0803.1465. [t08/047] B. Duplantier and S. Sheffield. Liouville Quantum Gravity and KPZ. Invent. math., 185, 333–393, (2011), arXiv:0808.1560. [t08/048] C. Monthus and T. Garel. Non equilibrium dynamics of disordered systems : understanding the broad continuum of relevant time scales via a strong-disorder RG in configuration space. J. Phys. A, 41, 255002, (2008), arXiv:0802.2502. [t08/049] R. Einert T., P. Näger, H. Orland, and R.R. Netz. Impact of loop statistics on the thermodynamics of RNA folding. Phys. Rev. Lett., 101, 048103, (2008), arXiv:0802.3272. [t08/050] N.E.J. Bjerrum-Bohr and P. Vanhove. On Cancellations of Ultraviolet Divergences in Supergravity Amplitudes. volume 56 of Fortschr. Phys., 824–832, (2008), arXiv:0806.1726. 3rd RTN Workshop (Valencia, Spain), Valencia. [t08/051] T. Bargheer, N. Beisert, and N. Gromov. Quantum Stability for the Heisenberg Ferromagnet. New J. Phys., 10, 103023, (2008), arXiv:0804.0324. [t08/052] R.V. Gavai, S. Gupta, and R. Lacaze. Eigenvalues and Eigenvectors of the Staggered Dirac Operator at Finite Temperature. Phys. Rev. D, 77, 114506, (2008), arXiv:0803.0182. [t08/053] R.V. Gavai, S. Gupta, and R. Lacaze. Screening correlators with chiral Fermions. Phys. Rev. D, 78, 014502, (2008), arXiv:0803.1368. [t08/054] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, H. Ita, D.A. Kosower, and D. Maitre. Automated Implementation of On-Shell Methods for One-Loop Amplitudes. Phys. Rev. D, 78, 036003, (2008), arXiv:0803.4180. [t08/055] S. Nonnenmacher and E. Schenck. Resonance distribution in open quantum chaotic systems. Phys. Rev. E, 78, 045202(R), (2008), arXiv:0803.1075. [t08/056] B. Eynard. All order asymptotic expansion of large partitions. J. Stat. Mech., P07023, (2008), arXiv:0804.0381. [t08/057] N.E.J. Bjerrum-Bohr and P. Vanhove. Absence of Triangles in Maximal Supergravity Amplitudes. JHEP, 0810, 006, (2008), arXiv:0805.3682. [t08/060] R. Peschanski. On the maximal noise for stochastic and QCD travelling waves. Nucl. Phys. B [FS], 805, 377–390, (2008), arXiv:0803.2626. [t08/062] G. Beuf, R. Peschanski, C. Royon, and D. Salek. Systematic Analysis of Scaling Properties in Deep Inelastic Scattering. Phys. Rev. D, 78, 074004, (2008), arXiv:0803.2186. [t08/064] R. Balian. Pourquoi le Soleil n’explose pas, ou les bienfaits d’une chaleur spécifique négative. Reflets phys., 10, 14–15, (2008). Appendices 81

[t08/066] F. Dominguez, C. Marquet, A.H. Mueller, B. Wu, and B.-W. Xiao. Comparing energy loss and p⊥- broadening in perturbative QCD with strong coupling N = 4 SYM theory. Nucl. Phys. A, 811, 197–222, (2008), arXiv:0803.3234. [t08/067] T. Lappi. The glasma initial state at the LHC. volume 35 of J. Phys. G, 104052, (2008), arXiv:0804.2338. Quark Matter 2008, Jaipur, Inde, 2008-04-02/2008-10-02. [t08/068] F. Gelis, T. Lappi, and R. Venugopalan. High energy factorization in nucleus-nucleus collisions. 1. Phys. Rev. D, 78, 054019, (2008), arXiv:0804.2630. [t08/069] A. Abada, P. Hosteins, F.-X. Josse-Michaux, and S. Lavignac. Successful Leptogenesis in SO(10) Unifica- tion with a Left-Right Symmetric Seesaw Mechanism. Nucl. Phys. B, 809, 183–217, (2009), arXiv:0808.2058. [t08/070] M. Frigerio, P. Hosteins, S. Lavignac, and A. Romanino. A new, direct link between the baryon asymmetry and neutrino masses. Nucl. Phys. B, 806, 84–102, (2009), arXiv:0804.0801. [t08/071] A. Bialas, A. Bzdak, and R. Peschanski. Limiting fragmentation from scale-invariant merging of fast partons. Phys. Lett. B, 665, 35–38, (2008), arXiv:0804.2364. [t08/072] B. Eynard and A. Prats-Ferrer. Topological expansion of the chain of matrices. JHEP, 0907, 096, (2009), arXiv:0805.1368. [t08/074] G.E. Brown, M. Harada, J.W. Holt, M. Rho, and C. Sasaki. A Hidden Local Field Theory Description of Dileptons in Relativistic Heavy Ion Collisions. Prog. Theor. Phys., 121, 1209–1236, (2009), arXiv:0804.3196. [t08/075] I. Bena, N. Bobev, C. Ruef, and P. Warner. Entropy Enhancement and Black Hole Microstates. Phys. Rev. Lett., 105, 231301, (2010), arXiv:0804.4487. [t08/076] R. Peschanski. Introduction to String Theory and Gauge/Gravity duality for students in QCD and QGP phenomenology. Acta Phys. Pol. B, 39, 2479–2509, (2008), arXiv:0804.3210. [t08/077] S. Nonnenmacher. Some open questions in "wave chaos". Nonlinearity, 21, T113–T121, (2008), arXiv:0805.4137. [t08/078] J. Bouttier and E. Guitter. The three-point function of planar quadrangulations. J. Stat. Mech., P07020, (2008), arXiv:0805.2355. [t08/079] G. Misguich, V. Pasquier, and F. Alet. Correlations and order parameter at a Coulomb-crystal phase transition in a three-dimensional dimer model. Phys. Rev. B, 78, 100402(R), (2008), arXiv:0803.2196. [t08/081] M. Bergère and B. Eynard. Some properties of angular integrals. J. Phys. A, 42, 265201, (2009), arXiv:0805.4482. [t08/083] M. Rho. Baryons and Vector Dominance in Holographic Dual QCD. Prog. Theor. Phys. Suppl., 174, 326–333, (2008), arXiv:0805.3342. [t08/084] E. Iancu, M.S. Kugeratski, and D.N. Triantafyllopoulos. Geometric Scaling in Mueller-Navelet Jets. Nucl Phys. A, 808, 95–116, (2008), arXiv:0802.0343. [t08/085] Y. Hatta, E. Iancu, and A.H. Mueller. Jet evolution in the N=4 SYM plasma at strong coupling. JHEP, 0805, 037, (2008), arXiv:0803.2481. [t08/086] E. Gull, P. Werner, O. Parcollet, and M. Troyer. Continuous-time auxiliary field Monte Carlo for quantum impurity models. Europhys. Lett., 82, 57003, (2008), arXiv:0802.3222. [t08/087] C. Marquet. Azimuthal correlations of forward dijets in d+Au collisions at RHIC. J. Phys. G, 35, 10–104049, (2008), arXiv:0804.4893. [t08/088] C. Marquet, H. Kowalski, T. Lappi, and R. Venugopalan. Nuclear diffractive structure functions at high energies. (2008), arXiv:0805.4809. [t08/089] H. Kowalski, T. Lappi, C. Marquet, and R. Venugopalan. Nuclear enhancement and suppression of diffractive structure functions at high energies. Phys. Rev. C, 78, 045201, (2008), arXiv:0805.4071. [t08/090] R. Balian. Recension du livre d’Alexandre Moatti : Einstein, un siècle contre lui. Reflets phys., 11, 31, (2008). [t08/091] R. Balian. La mesure en mécanique quantique : une révolution conceptuelle. (2011). [t08/092] C. Monthus and T. Garel. Non-equilibrium dynamics of disordered systems: renormalization flow towards an ’infinite disorder’ fixed point at large times. J. Stat. Mech., P07002, (2008), arXiv:0804.1847. [t08/093] Vanhove P., editor. String Theory and the Real World: From Particle Physics to Astrophysics. Elsevier, (2008). [t08/094] N. Gromov. Generalized Scaling Function at Strong Coupling. JHEP, 0811, 085, (2008), arXiv:0805.4615. [t08/095] R. Suzuki, T. Kruppa A., B.G. Giraud, and K. Kato. Continuum Level Density of a Coupled Channel System in the Complex Scaling Method. Prog. Theor. Phys., 119, 949–963, (2008). 82 Activity Report CEA/DSM/IPhT 2008 — 2013

[t08/100] M.B. Green, J.G. Russo, and P. Vanhove. Modular properties of two-loop maximal supergravity and connections with string theory. JHEP, 0807, 126, (2008), arXiv:0807.0389. [t08/101] M. Rho. Chiral nuclear dynamics II: From quarks to nuclei to compact stars. World Scientific, 2008, (2008). [t08/104] S.Y. Alexandrov, B. Pioline, F. Saueressig, and S. Vandoren. Linear Perturbations of Hyperkähler Metrics. Lett. Math. Phys., 87, 225–265, (2009), arXiv:0806.4620. [t08/106] S.D. Badger. Direct Extraction Of One Loop Rational Terms. JHEP, 0901, 049, (2009), arXiv:0806.4600. [t08/107] S.D. Badger. Generalised Unitarity At One-Loop With Massive Fermions. volume 183 of Nucl. Phys. B (Proc. Suppl.), 220–225, (2008), arXiv:0807.1245. Loops And Legs In Quantum Field Theory, Sondershausen, Germany, 2008-04-20/2008-04-25. [t08/108] I. Affleck, L. Borda, and H. Saleur. Friedel oscillations and the Kondo screening cloud. Phys. Rev. B, 77, 180404(R), (2008), arXiv:0802.0280. [t08/109] J.L. Jacobsen and H. Saleur. Exact valence bond entanglement entropy and probability distribution in the XXX spin chain and the Potts model. Phys. Rev. Lett., 100, 087205, (2008), arXiv:0711.3391. [t08/110] E. Dudas, S. Lavignac, and J. Parmentier. A light neutralino in hybrid models of supersymmetry breaking. Nucl. Phys. B, 808, 237–259, (2009), arXiv:0808.0562. [t08/111] J.P. Keating, S. Nonnenmacher, M. Novaes, and M. Sieber. On the resonance eigenstates of an open quantum baker map. Nonlinearity, 21, 2591–2624, (2008), arXiv:0806.1678. [t08/112] S. Marmi, P. Moussa, and J.-C. Yoccoz. Affine interval exchange maps with a wandering interval. Proc. London Math. Soc., 100, 639–669, (2010), arXiv:0805.4737. [t08/113] A. Mehta, G.C. Barker, and J.M. Luck. Heterogeneities in granular dynamics. Proc. Nat. Acad. Sci., 105, 8244–8249, (2008). [t08/114] Y.Y. Suzuki, M. Tokita, and S. Mukai. Kinetics of water flow through polymer gel. Eur. Phys. J. E, 29, 415–422, (2009), arXiv:0807.1789. [t08/115] S.Y. Alexandrov, B. Pioline, F. Saueressig, and S. Vandoren. Linear perturbations of quaternionic metrics. Commun. Math. Phys., 296, 353–403, (2010), arXiv:0810.1675. [t08/116] F. Gelis, T. Lappi, and R. Venugopalan. High energy factorization in nucleus-nucleus collisions 2 - Multigluon correlations. Phys. Rev. D, 78, 054020, (2008), arXiv:0807.1306. [t08/117] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, H. Ita, D.A. Kosower, and D. Maitre. One-Loop Calculations with BlackHat. volume 183 of Nucl. Phys. B (Proc. Suppl.), 313–319, (2008), arXiv:0807.3705. [t08/118] M. Graña, R. Minasian, M. Petrini, and D. Waldram. T-duality, Generalized Geometry and Non- Geometric Backgrounds. JHEP, 0904, 075, (2009), arXiv:0807.4527. [t08/120] C. Vergu. Twistors, strings and supersymmetric gauge theories. PhD thesis, (2008), arXiv:0809.1807. 2008-07-15. [t08/121] N. Gromov and P. Vieira. The all loop AdS4/CFT3 Bethe ansatz. JHEP, 0901, 016, (2009), arXiv:0807.0777. [t08/122] C. Monthus and T. Garel. Equilibrium of disordered systems : constructing the appropriate valleys in each sample via strong disorder renormalization in configuration space. J. Phys. A, 41, 375005, (2008), arXiv:0806.3335. [t08/123] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, H. Ita, D.A. Kosower, and D. Maitre. One-Loop Multi-Parton Amplitudes with a Vector Boson for the LHC. (2008), arXiv:0808.0941. [t08/125] G.E. Brown, J.W. Holt, and M. Rho. Understanding Dilepton Production in Heavy Ion Collisions by Vector Mesons of Different Varieties. (2008), arXiv:0808.2300.

[t08/126] F. Bazzocchi, M. Frigerio, and S. Morisi. Fermion masses and mixing in models with SO(10)xA4 symmetry. Phys. Rev. D, 78, 116018, (2008), arXiv:0809.3573. [t08/128] N. Gromov and P. Vieira. The AdS4/CFT3 algebraic curve. JHEP, 0902, 040, (2009), arXiv:0807.0437. [t08/129] N. Gromov and V. Mikhaylov. Comment on the Scaling Function in AdS4 x CP3. JHEP, 0904, 083, (2009), arXiv:0807.4897. [t08/130] N. Gromov, S. Schafer-Nameki, and P. Vieira. Eﬃcient precision quantization in AdS/CFT. JHEP, 0812, 013, (2008), arXiv:0807.4752. [t08/131] G. Beuf. An alternative scaling solution for high-energy QCD saturation with running coupling. (2008), arXiv:0803.2167. Appendices 83

[t08/132] G. Beuf. Universality of QCD traveling-waves with running coupling beyond leading logarithmic accuracy. Acta Phys. Pol. B, 39, 2557–2560, (2008), arXiv:0806.0764. [t08/133] S. Fishman, A. Iomin, and K. Mallick. Asymptotic localization of stationary states in the nonlinear Schroedinger equation. Phys. Rev. E, 78, 066605, (2008), arXiv:0807.5005. [t08/134] M.R. Evans, P. Ferrari, and K. Mallick. Matrix representation of the stationary measure for the multispecies TASEP. J. Stat. Phys., 135, 217–239, (2009), arXiv:0807.0327. [t08/135] F. David, M. Dukes, T. Jonsson, and S. Stefansson. Random tree growth by vertex splitting. J. Stat. Mech., P04009, (2009), arXiv:0811.3183. [t08/139] M. Cirelli, M. Kadastik, M. Raidal, and A. Strumia. Model-independent implications of the e+, e-, anti- proton cosmic ray spectra on properties of Dark Matter. Nucl. Phys. B, 813, 1–21, (2009), arXiv:0809.2409. [t08/140] B. Eynard and O. Marchal. Topological expansion of the Bethe ansatz, and non-commutative algebraic geometry. JHEP, 0903, 094, (2009), arXiv:0809.3367. [t08/141] A. Amariti, L. Girardello, and A. Mariotti. Stringy Instantons as Strong Dynamics. JHEP, 0811, 041, (2008), arXiv:0809.3432. [t08/142] C. Godrèche and J.M. Luck. A record-driven growth process. J. Stat. Mech., P11006, (2008), arXiv:0809.3377. [t08/144] G. Beuf, R. Peschanski, and E.N. Saridakis. Entropy flow of a perfect fluid in (1+1) hydrodynamics. Phys. Rev. C, 78, 064909, (2008), arXiv:0808.1073. [t08/145] M. Chemtob. Contact interactions in low scale string models with intersecting D6-branes. Phys. Rev. D, 78, 125020, (2008), arXiv:0808.1242. [t08/147] M. Frigerio. A tight SO(10) connection between leptogenesis and neutrino masses. volume 1078 of AIP Conf. Proc., 369–371, (2008). SUSY08, Seoul, South Korea. [t08/148] C. Monthus and T. Garel. Driven interfaces in random media at finite temperature: Existence of an anomalous zero-velocity phase at small external force. Phys. Rev. E, 78, 041133, (2008), arXiv:0803.4125. [t08/149] F. Gelis, T. Lappi, and R. Venugopalan. The glasma initial state and JIMWLK factorization. volume 820 of Nucl. Phys. A, 111C–114C, (2009), arXiv:0810.1610. Strong and Electroweak Matter 2008 (SEWM08), Amsterdam, 2008-08-26/2008-08-29. [t08/150] M. Tarzia and G. Biroli. The Valence Bond Glass phase. Europhys. Lett., 82, 67008, (2008), arXiv:0802.2653. [t08/151] G. Biroli, J.-P. Bouchaud, A. Cavagna, T.S. Grigera, and P. Verrocchio. Thermodynamic signature of growing amorphous order in glass-forming liquids. Nature Phys., 4, 771–775, (2008), arXiv:0805.4427. [t08/152] M. Bauer, D. Bernard, and T. Kennedy. Conditioning Schramm-Loewner evolutions and loop erased random walks. J. Math. Phys., 50, 043301, (2009), arXiv:0806.2246. [t08/153] I. Safi, C. Bena, and A. Crépieux. ac conductance and nonsymmetrized noise at finite frequency in quantum wires and carbon nanotubes. Phys. Rev. B, 78, 205422, (2008), arXiv:0805.3932. [t08/154] Y. Abe, C. Shen, G. Kosenko, D. Boilley, and B.G. Giraud. Di-nucleus dynamics towards fusion of heavy nuclei. Int. J. Mod. Phys. E, 17, 2214–2220, (2008). [t08/155] E. Babichev, P. Brax, C. Caprini, J. Martin, and D. Steer. Dirac Born Infeld (DBI) Cosmic Strings. JHEP, 0903, 091, (2009), arXiv:0809.2013. [t08/156] S.D. Badger, N.E.J. Bjerrum-Bohr, and P. Vanhove. Simplicity in the Structure of QED and Gravity Amplitudes. JHEP, 0902, 038, (2009), arXiv:0811.3405. [t08/159] F. David and M. Bauer. Another derivation of the geometrical KPZ relations. J. Stat. Mech., P03004, (2009), arXiv:0810.2858. [t08/160] F. Bernardeau and P. Valageas. Propagators in Lagrangian space. Phys. Rev. D, 78, 083503, (2008), arXiv:0805.0805. [t08/161] F. Bernardeau, M. Crocce, and R. Scoccimarro. Multi-Point Propagators in Cosmological Gravitational Instability. Phys. Rev. D, 78, 103521, (2008), arXiv:0806.2334. [t08/162] C. Pitrou, J.-P. Uzan, and F. Bernardeau. Cosmic microwave background bispectrum on small angular scales. Phys. Rev. D, 78, 063526, (2008), arXiv:0807.0341. [t08/163] M. Cirelli and A. Strumia. Minimal Dark Matter predictions and the PAMELA positron excess. volume idm2008 of PoS, 089, (2008), arXiv:0808.3867. Identification of dark matter 2008, Stockholm. [t08/164] B. Eynard and M. Mariño. A holomorphic and background independent partition function for matrix models and topological strings. J. Geom. Phys., 61, 1181–1202, (2011), arXiv:0810.4273. 84 Activity Report CEA/DSM/IPhT 2008 — 2013

[t08/165] Z. Burda, J. Duda, J.M. Luck, and B. Waclaw. Localization of the maximal entropy random walk. Phys. Rev. Lett., 102, 160602, (2009), arXiv:0810.4113. [t08/178] K.-S. Kim, A. Benlagra, and C. Pépin. Grüneisen ratio at the Kondo breakdown quantum critical point. Phys. Rev. Lett., 101, 246403, (2008), arXiv:0808.3908. [t08/179] A. Benlagra and C. Pépin. Model of Quantum Criticality in He3 bilayers Adsorbed on graphite. Phys. Rev. Lett., 100, 176401, (2008), arXiv:0709.0354. [t08/180] A. Benlagra and C. Pépin. He3 bi-layers as a simple example of de-confinement. Phys. Rev. B, 79, 045112, (2009), arXiv:0810.2280. [t08/181] P. Valentin and R. Balian. A second order equation for deriving the pV T equation of state from the sound velocity...with a method to derive the equation itself. 18th European Conference on Thermophysical Properties, Pau, France 31 Aug-4 Sep 2008, (2008). [t08/182] J. Bouttier and E. Guitter. Confluence of geodesic paths and separating loops in large planar quadrangulations. J. Stat. Mech., P03001, (2009), arXiv:0811.0509. [t08/183] Y.Y. Suzuki and M. Williams D. R. Ribbon polymers in poor solvents: layering transitions in annular and tubular condensates. Europhys. Lett., 85, 63001, (2009), arXiv:0811.0536. [t08/184] G. Bertone, M. Cirelli, A. Strumia, and M. Taoso. Gamma-ray and radio tests of the e+e- excess from DM annihilations. JCAP, 0903, 009, (2009), arXiv:0811.3744. [t08/185] J. Evslin and R. Minasian. Topology Change from (Heterotic) Narain T-Duality. Nucl. Phys. B, 820, 213–236, (2009), arXiv:0811.3866. [t08/186] C. Monthus and T. Garel. Anderson transition on the Cayley tree as a traveling wave critical point for various probability distributions. J. Phys. A, 42, 075002, (2009), arXiv:0811.1422. [t08/187] S. Furukawa, V. Pasquier, and J. Shiraishi. Mutual Information and Boson Radius in a c=1 Critical System in One Dimension. Phys. Rev. Lett., 102, 170602, (2009), arXiv:0809.5113. [t08/188] V. Gorini, U. Moschella, A.Y. Kamenshchik, V. Pasquier, and A. Starobinsky. Tolman-Oppenheimer- Volkoff equations in presence of the Chaplygin gas: stars and wormhole-like solutions. Phys. Rev. D, 78, 064064, (2008), arXiv:0807.2740. [t08/189] B. Eynard and N. Orantin. Topological recursion in enumerative geometry and random matrices. J. Phys. A, 42, 293001, (2009), arXiv:0811.3531. [t08/190] T.L. Dao, M. Ferrero, A. Georges, M. Capone, and O. Parcollet. Polarized superfluidity in the attractive Hubbard model with population imbalance. Phys. Rev. Lett., 101, 236405, (2008), arXiv:0807.2923. [t08/191] L De Leo, C. Kollath, A. Georges, M. Ferrero, and O. Parcollet. Trapping and cooling fermionic atoms into the Mott and Néel states. Phys. Rev. Lett., 101, 210403, (2008), arXiv:0807.0790. [t08/192] M. Ferrero, P Cornaglia, L De Leo, O. Parcollet, G. Kotliar, and A. Georges. Valence-Bond Dynamical Mean-Field Theory of Doped Mott Insulators with Nodal/Antinodal Differentiation. Europhys. Lett., 85, 57009, (2009), arXiv:0806.4383. [t08/193] J.-E. Bourgine and K. Hosomichi. Boundary operators in the O(n) and RSOS matrix models. JHEP, 0901, 009, (2009), arXiv:0811.3252. [t08/194] N. Anantharaman and S. Nonnenmacher. Vibrations chaotiques et grosses balafres. Gazette des Math- ématiciens, 119, 16–32, (2009). [t08/196] M. Bertola and O. Marchal. The partition function of the two-matrix model as an isomonodromic tau-function. J. Math. Phys., 50, 013529, (2009), arXiv:0809.1598. [t08/198] S. Prolhac. Fluctuations and skewness of the current in the partially asymmetric exclusion process. J. Phys. A, 41, 365003, (2008), arXiv:0805.4118. [t08/199] P. Valageas. Statistical properties of the Burgers equation with Brownian initial velocity. J. Stat. Phys., 134, 589–640, (2009), arXiv:0810.4332. [t08/200] M. Cirelli. Non-standard neutrinos and Cosmology. volume 188 of Nucl. Phys. B (Proc. Suppl.), 339–341, (2009). Neutrino Oscillation Workshop, Conca Specchiulla, Otranto, Italie, 2008-09-06/2008-09-13. [t08/201] P. Valageas. Ballistic aggregation for one-sided Brownian initial velocity. Physica A, 388, 1031–1045, (2009), arXiv:0812.2308. [t08/202] Y. Avishai and J.M. Luck. Magnetization of two coupled rings. J. Phys. A, 42, 175301, (2009), arXiv:0812.2347. [t08/203] S. Alexandrov, B. Pioline, F. Saueressig, and S. Vandoren. D-instantons and twistors. JHEP, 0903, 044, (2009), arXiv:0812.4219. Appendices 85

[t08/204] F. Alet, D. Braun, and G. Misguich. Comment on "Regional Versus Global Entanglement in Resonating- Valence-Bond States". Phys. Rev. Lett. (Comment), 101, 248901, (2008), arXiv:0812.1932. [t08/206] L. Messio, J.C. Domenge, C. Lhuillier, L. Pierre, P. Viot, and G. Misguich. Thermal destruction of chiral order in a two-dimensional model of coupled trihedra. Phys. Rev. B, 78, 054435, (2008), arXiv:0806.2259. [t08/207] P. Ranjith, D. Lacoste, K. Mallick, and J.F. Joanny. Non-equilibrium self-assembly of a filament coupled to ATP/GTP hydrolysis. Biophys. J., 96, 2146–2159, (2009), arXiv:0809.2228. [t08/209] S.N. Majumdar, K. Mallick, and S. Sabhapandit. Statistical Properties of the Final State in One- dimensional Ballistic Aggregation. Phys. Rev. E, 79, 021109, (2009), arXiv:0811.0908. [t08/210] D. Lacoste and K. Mallick. Fluctuation Theorem for the flashing ratchet model of molecular motors. Phys. Rev. E, 80, 021923, (2009), arXiv:0907.1570. [t08/211] I. Bena, N. Bobev, C. Ruef, and N.P. Warner. Supertubes in Bubbling Backgrounds: Born-Infeld Meets Supergravity. JHEP, 0907, 106, (2009), arXiv:0812.2942. [t08/213] S. Prolhac, M.R. Evans, and K. Mallick. Matrix product solution of the multispecies partially asymmetric exclusion process. J. Phys. A, 42, 165004, (2009), arXiv:0812.3293. [t08/214] P. Bialas, L. Daniel, A. Morel, and B. Petersson. Thermodynamics of SU(3) Gauge Theory in 2 + 1 Dimensions. Nucl. Phys. B, 807, 547–565, (2009), arXiv:0807.0855. [t08/220] B. Basso and G. Korchemsky. Nonperturbative scales in AdS/CFT. J. Phys. A, 42, 254005, (2009), arXiv:0901.4945. [t08/221] R.P.G. Andrade, A.L.V.R. dos Reis, F. Grassi, Y. Hama, W.L. Qian, T. Kodama, and J.-Y. Ollitrault. Fluctuations and initial state granularity in heavy ion collisions and their effects on observables from hydrodynamics. volume 40 of Acta Phys. Pol. B, 993–998, (2009), arXiv:0812.4143. Fourth Workshop on Particle Correlations and Femtoscopy (WPCF2008), Krakow, 2008-09-11/2008-09-14. [t08/222] C. Marquet. Heavy-quark energy loss in pQCD and SYM plasmas. volume 62 of Eur. Phys. J. C, 15–20, (2009), arXiv:0810.2572. papier de conference Hot Quarks 08. [t08/223] G. Beuf, C. Marquet, and B.W. Xiao. Heavy-quark energy loss and thermalization in a strongly coupled SYM plasma. Phys. Rev. D, 80, 085001, (2009), arXiv:0812.1051. [t08/224] C. Marquet. Particle production and saturation at RHIC and LHC. papier de conference ISMD 08, (2008), arXiv:0812.1610v1. [t08/226] F. Dominguez, C. Marquet, and B. Wu. On multiple scatterings of mesons in hot and cold QCD matter. Nucl. Phys. A, 823, 99–119, (2009), arXiv:0812.3878. [t08/227] A.C. Davis, P. Brax, and C. van de Bruck. Brane Inflation and Defect Formation. Phil. Trans. R. Soc. A, Phys. Sci. Eng. (UK), A366, 2833–2842, (2008), arXiv:0803.0424. [t08/228] P. Brax, C. van de Bruck, A.C. Davis, S.C. Davis, R. Jeannerot, and M. Postma. Racetrack inflation with matter fields and cosmic strings. JCAP, 0807, 018, (2008), arXiv:0805.1171. [t08/229] P. Brax, C. van de Bruck, A.C. Davis, and D. Shaw. f(R) Gravity and Chameleon Theories. Phys. Rev. D, 78, 104021, (2008), arXiv:0806.3415. [t08/230] P. Brax, C.A. Savoy, and A. Sil. Intermediate Scale Inflation and Metastable Supersymmetry Breaking. Phys. Lett. B, 671, 374–377, (2009), arXiv:0807.1569. [t08/232] F. Gelis, T. Lappi, and R. Venugopalan. High energy factorization in nucleus-nucleus collisions. 3. Long range rapidity correlations. Phys. Rev. D, 79, 094017, (2009), arXiv:0810.4829v2. [t08/233] P. Brax, C. van de Bruck, and A.C. Davis. Fermionic Zero Modes of Cosmic Strings. In Geometry, Topology QFT and Cosmology. Editions Hermann, Paris, (2009). Geometry, Topology, QFT and Cosmology, Paris, 2008-05-28/2008-05-30. [t08/234] P. Brax and C. van de Bruck. String Cosmology Scenarios and the Quest for the Big Bang. In Beyond the big bang. Springer Verlag, (2009). [t08/235] P. Brax, C. van de Bruck, L.M.H. Hall, and J.M. Weller. Slow-Roll Inflation in the Presence of a Dark Energy Coupling. Phys. Rev. D, 79, 103508, (2009), arXiv:0812.2843. [t08/236] S. Prolhac and K. Mallick. Cumulants of the current in the weakly asymmetric exclusion process. J. Phys. A, 42, 175001, (2009), arXiv:0902.0570. [t08/237] C. Candu. Discrétisation des modèles sigma invariants conformes sur des supersphères et superespaces projectifs. PhD thesis, (2008). 2008-10-31. [t08/238] C. Delaunay. Brisure de symétrie électrofaible : origine et conséquences. PhD thesis, (2008). Université Paris-Sud XI, 2008-10-02. 86 Activity Report CEA/DSM/IPhT 2008 — 2013

[t08/239] Duplantier B., Raimond J.-M., and Rivasseau V., editors. Poincaré Seminar 2007: The Spin, volume 55 of Prog. Math. Phys. Birkaeuser Verlag, Basel, (2009). [t08/241] R. Balian. Emergences en physique statistique. Emergences, Académie Européenne Internationale des Sciences, Paris, 2008-12-15/2008-12-16, (2009). [t08/242] R. Balian. Emergences in Statistical Physics. In Emergences. Springer Verlag (2011), (2009). Emergences, Académie Européenne Internationale des Sciences, Paris, 2008-12-15/2008-12-15. [t08/244] E. Boulat, H. Saleur, and P. Schmitteckert. Twofold advance in the theoretical understanding of far-from- equilibrium properties of interacting nanostructures. Phys. Rev. Lett., 101, 140601, (2008), arXiv:0806.3731. [t08/246] Venuti L. Campos, H. Saleur, and P. Zanardi. Universal sub-leading terms in ground state fidelity. Phys. Rev. B, 79, 092405, (2009), arXiv:0807.0104. [t08/247] A. Ayyer and D. Zeilberger. A bijectional attack on the Razumov-Stroganov conjecture. (2009), arXiv:0812.0447. [t08/248] A.E. Allahverdyan, R. Balian, and T.M. Nieuwenhuizen. Simultaneous measurement of non-commuting observables. Physica E, 42, 339–342, (2010). c [t08/249] G. Beuf, C. Royon, and D. Salek. Geometric Scaling of F2 and F2 in data and QCD Parametrisations. (2008), arXiv:0810.5082. [t08/250] G. Misguich. Quantum spin liquids. In Jacobsen J.L., Ouvry S., Pasquier V., Serban D., and Cugliandolo L.F., editors, Les Houches summer school on "Exact methods in low-dimensional statistical physics and quantum computing, August 2008, (2009), arXiv:0809.2257. [t08/251] D. Seery, S. Sloth, and F. Vernizzi. Inflationary trispectrum from graviton exchange. JCAP, 0903, 018, (2009), arXiv:0811.3934. [t08/252] J. Evslin and R. Minasian. Topological strings live on attractive manifolds. (2008), arXiv:0804.0750. [t08/253] A. Butti, D. Forcella, L. Martucci, R. Minasian, M. Petrini, and A. Zaffaroni. On the geometry and the moduli space of beta-deformed quiver gauge theories. JHEP, 0807, 53, (2008), arXiv:0712.1215. [t08/254] J. Zinn-Justin and R. Guida. Gauge invariance. Scholarpedia, 3, 8287, (2008). [t08/255] P. Di Francesco and R. Kedem. Q-systems as cluster algebras II: Cartan matrix of finite type and the polynomial property. Lett. Math. Phys., 89, 183–216, (2008), arXiv:0803.0362. [t08/256] P. Di Francesco and R. Kedem. Q-systems, Heaps, Paths and Cluster Positivity. Commun. Math. Phys., 293, 727–802, (2008), arXiv:0811.3027. [t08/257] M. Ebbinghaus, H. Grandclaude, and M. Henkel. Absence of logarithmic scaling in the ageing behaviour of the 4D spherical model. Eur. Phys. J. B, 63, 85–91, (2008), arXiv:0709.3220. [t08/258] G. Ripka. The classical pion field in a nucleus. Nucl. Phys. A, 814, 33–47, (2008), arXiv:0711.1280. [t08/259] J.-P. Blaizot. Non Perturbative Renormalization Group and Bose-Einstein Condensation. 2006 ECT* School "Renormalization Group and Effective Field Theory Approaches to Many-Body Systems", Trento, Italy, (2008), arXiv:0801.0009.

[t08/260] J.-P. Blaizot and M.A. Nowak. Large Nc confinement and turbulence. Phys. Rev. Lett., 101, 102001, (2008), arXiv:0801.1859. [t08/261] J.-P. Blaizot and Y. Mehtar-Tani. The classical field created in early stages of high energy nucleus-nucleus collisions. Nucl. Phys. A, 818, 97–119, (2009), arXiv:0806.1422. [t08/262] A. Beraudo, J.-P. Blaizot, and C. Ratti. Real and imaginary-time quarkonium correlators in a hot plasma. 8-th Conference Quark Confinement and the Hadron Spectrum, 1-6 September 2008, Mainz, Germany, (2008), arXiv:0812.1130. [t08/263] E. Iancu. Partons and jets in a strongly-coupled plasma from AdS/CFT. volume 39 of Acta Phys. Pol. B, 3213, (2008), arXiv:0812.0500. XLVIII Cracow School of Theoretical Physics, ‘Aspects of duality’, Zakopane, Poland, June 13-22, 2008. [t08/264] N.v.d. Kolk and J.-Y. Ollitrault. Flow analysis methods in ALICE: Event plane from Lee-Yang zeroes. 8th Conference on Quark Confinement and the Hadron Spectrum, Mainz, Allemagne, 2008-09-01/2008-09- 06, (2008). [t08/265] P. Calabrese and A. Lefèvre. Entanglement spectrum in one-dimensional systems. Phys. Rev. A, 78, 032329, (2008), arXiv:0806.3059. [t08/267] C. Pépin. Selective Mott transition and heavy fermions. Phys. Rev. B, 77, 245129, (2008), arXiv:0802.1498. [t08/268] I. Paul, C. Pépin, and M.R. Norman. Multi-scale fluctuations near a Kondo Breakdown Quantum Critical Point. Phys. Rev. B, 78, 035109, (2008), arXiv:0804.1808. Appendices 87

[t08/269] K.-S. Kim and C. Pépin. Violation of Wiedemann-Franz law at the Kondo breakdown quantum critical point. Phys. Rev. Lett., 102, 156404, (2009), arXiv:0811.0638. [t08/270] C. Royon, G. Beuf, R. Peschanski, and D. Salek. Scaling properties in deep inelastic scattering. DIS 2008 workshop, London, England, 2008-04-07/2008-04-11, (2008), arXiv:0811.2257. [t08/271] C. Csaki, C. Delaunay, C. Grojean, and Y. Grossman. A Model of Lepton Masses from a Warped Extra Dimension. JHEP, 0810, 055, (2008), arXiv:0806.0356. [t08/272] J. Bros, H. Epstein, and U. Moschella. Particle decays and stability on the de Sitter universe. Ann. Henri Poincaré, 11, 611–658, (2010), arXiv:0812.3513. [t08/273] M.S. Kugeratski, V.P. Gon¸calves, M.V.T. Machado, and F.S. Navarra. An Unified Description of HERA and RHIC Data. volume 39 of Acta Phys. Pol. B, 2583, (2008). [t08/274] E. Avsar and Y. Hatta. Quantitative study of the transverse correlation of soft gluons in high energy QCD. JHEP, 0809, 102, (2008), arXiv:0805.0710. [t08/275] E. Avsar. On the High Energy Behaviour of The Total Cross Section in the QCD Dipole Model. JHEP, 0804, 033, (2008), arXiv:0803.0446. [t08/276] G. Brooijmans, A. Delgado, B.A. Dobrescu, C. Grojean, J. Alwall, K. Black, E. Boos, T. Bose, V. Bunichev, R. Contino, A. Djouadi, L. Dudko, Y. Gershtein, M. Gigg, M. Herquet, J. Hirn, G. Landsberg, K. Lane, E. Maina, A. Martin, G. Moreau, M.M. Nojiri, A. Pukhov, P. Ribeiro, E. Ros, V. Sanz, H.J. Schreiber, G. Servant, E.H. Simmons, R.K. Singh, P. Skands, S. Su, T.M.P. Tait, M. Takeuchi, and M. Vos. New Physics at the LHC: A Les Houches Report. Physics at Tev Colliders 2007 – New Physics Working Group. (2010), arXiv:0802.3715. [t08/277] U. Moschella and R. Schaeffer. A note on canonical quantization of fields on a manifold. JCAP, 0902, 33, (2009), arXiv:0802.2447. [t08/278] R. Peschanski, M. Rangel, and C. Royon. Hybrid Pomeron Model of exclusive central diffractive production. Acta Phys. Pol. B, 40, 2323–2344, (2009), arXiv:0808.1691. [t08/279] P. Heller, R.A. Janik, and R. Peschanski. Hydrodynamic Flow of the Quark-Gluon Plasma and Gauge/Gravity Correspondence. Acta Phys. Pol. B, 39, 3183–3204, (2008), arXiv:0811.3113. [t08/281] R. Peschanski. Gauge/Gravity Duality for an Expanding Plasma. Prog. Theor. Phys. Suppl., 174, 153–159, (2008). [t08/282] M. Sega, P. Faccioli, F. Pederiva, and H. Orland. Kramers Theory for Conformational Transitions of Macromolecules. (2010), arXiv:0809.0027. [t08/283] E. Autieri, P. Faccioli, M. Sega, F. Pederiva, and H. Orland. Dominant Reaction Pathways in High Dimensional Systems. J. Chem. Phys., 130, 064106, (2009), arXiv:0806.0236. [t08/284] J.-L. Sikorav, H. Orland, and A. Braslau. Mechanism of thermal renaturation and hybridization of nucleic acids: Kramers process and universality in Watson-Crick base pairing. J. Phys. Chem. B, 113, 3715–3725, (2009), arXiv:0808.1233. [t08/285] H. Orland. Accelerated Sampling of Boltzmann distributions. J. Phys. Soc. Jpn., 78, 103002, (2009), arXiv:0812.2587. [t08/286] C. Azuara, H. Orland, M. Bon, P. Koehl, and M. Delarue. Incorporating Dipolar Solvents with Variable Density in Poisson-Boltzmann Electrostatics. Biophys. J., 95, 5587–5605, (2008). [t08/287] P. Faccioli, M. Sega, F. Pederiva, and H. Orland. Stochastic dynamics and dominant protein folding pathways. Philos. Mag., 88, 4093–4099, (2008). [t08/288] T. Lari, G. Servant, and al.+ et. Collider aspects of flavour physics at high Q. Eur. Phys. J. C, 57, 183–307, (2008), arXiv:0801.1800. [t08/289] Exact Methods in Low-Dimensional Statistical Physics and Quantum Computing. In Jacobsen J.L., Ou- vry S., Pasquier V., Serban D., and Cugliandolo L.F., editors, Exact Methods In Low-Dimensional Statistical Physics And Quantum Computing: Lecture Notes Of The Les Houches Summer School: Volu synopsis. Ox- ford, (2010). [t08/290] F. Gelis. High Energy Factorization in Nucleus-Nucleus Collisions. Prog. Theor. Phys. Suppl., 174, 190–197, (2008). [t08/291] F. Gelis. Gluon Saturation from DIS to Nucleus-Nucleus Collisions. Acta Phys. Pol. B, 39, 2419–2453, (2008). [t08/292] F. Gelis. Initial two-gluon correlations in nucleus-nucleus collisions. J. Phys. G, 35, 104050, (2008). [t08/293] G. Biroli. Glass transition and out-of-equilibrium systems. Giulio Biroli, IPhT, Saclay - cours de physique théorique, 2008-03-21/2008-04-25, (2008). 88 Activity Report CEA/DSM/IPhT 2008 — 2013

[t08/294] doucot . Cohérence quantique de systèmes macroscopiques. Cours de Physique Théorique, 2008-05- 16/2008-06-27, (2008). [t08/295] L. Boubekeur, P. Creminelli, J. Norena, and F. Vernizzi. Action approach to cosmological perturbations: the 2nd order metric in matter dominance. JCAP, 0808, 028, (2008), arXiv:0806.1016. [t08/297] J. Camps, R. Emparan, P. Figueras, S. Giusto, and A. Saxena. Black Rings in Taub-NUT and D0-D6 interactions. JHEP, 0902, 021, (2009), arXiv:0811.2088. [t08/298] L. Simon, C. Bena, F. Vonau, D. Aubel, H. Nasrallah, M. Habar, and C. Peruchetti J. Symmetry of standing waves generated by a point defect in epitaxial graphene. Eur. Phys. J. B, 69, 351, (2009), arXiv:0807.2813. [t08/300] C. Bena. Greens functions and impurity scattering in graphene. Phys. Rev. B, 79, 125427, (2009), arXiv:arXiv:0807.1981. [t08/303] A. Barrat and M. Barthélémy. Dynamical processes on complex networks. (2008). [t08/304] C. Douarche, J.-L. Sikorav, and A. Goldar. Aggregation and Adsorption at the Air-Water Interface of Bacteriophage PhiX174 Single-Stranded DNA. Biophys. J., 94, 134–146, (2008). [t08/305] C. Douarche, R. Cortès, S.J. Roser, J.-L. Sikorav, and A. Braslau. DNA Adsorption at Liquid/Solid Interfaces. J. Phys. Chem. B, 112, 13676–13679, (2008), arXiv:0809.4639. [t08/306] J.L. Jacobsen. Unbiased sampling of globular lattice proteins in three dimensions. Phys. Rev. Lett., 100, 118102, (2008). [t08/307] P. Fendley and J.L. Jacobsen. Critical points in coupled Potts models and critical phases in coupled loop models. J. Phys. A, 41, 215001, (2008). [t08/308] D. Das, S. Dey, J.L. Jacobsen, and D. Dhar. Critical behavior of loops and biconnected clusters on fractals of dimension d < 2. J. Phys. A, 41, 485001, (2008). [t08/309] J.L. Jacobsen, P. Le Doussal, M. Picco, R. Santachiara, and K.J. Wiese. Critical interfaces in the random-bond Potts model. Phys. Rev. Lett., 102, 070601, (2009). [t08/312] I.K. Kostov. Boundary Loop Models and and 2D Quantum Gravity. Summer school on Exact methods in low-dimensional statistical physics and quantum computing, Les Houches, (2008). [t08/313] E. Iancu. Parton picture for the strongly coupled SYM plasma. (2011), arXiv:0805.4110 [hep-th]. [t08/314] E. Iancu. Partons and jets at strong coupling from AdS/CFT. (2008), arXiv:0807.0489 [hep-ph]. [t08/315] C. Pépin. Points critiques quantiques dans les composés à fortes corrélations électroniques. 2008-11-06, (2008). [t08/316] M. Shuntaro, K. Kayuna, F. Vernizzi, and D. Wands. Primordial non-Gaussianities in new ekpyrotic cosmology. AIP Conf. Proc., (2008).

[t08/319] M. Cacciari, G.P. Salam, and G. Soyez. The anti-kt jet clustering algorithm. JHEP, 0804, 063, (2008), arXiv:0802.1189. [t08/320] M. Cacciari, G.P. Salam, and G. Soyez. The Catchment Area of Jets. JHEP, 0804, 005, (2013), arXiv:0802.1188. [t09/010] M. Cirelli and A. Strumia. Minimal Dark Matter: model and results. New J. Phys., 11, 105005, (2009), arXiv:0903.3381v1. [t09/011] C. Caprini, R. Durrer, T. Konstandin, and G. Servant. General Properties of the Gravitational Wave Spectrum from Phase Transitions. Phys. Rev. D, 79, 083519, (2009), arXiv:0901.1661. [t09/012] D. Benedetti, P.F. Machado, and F. Saueressig. Asymptotic safety in higher-derivative gravity. Mod. Phys. Lett. A, 24, 2233–2241, (2009), arXiv:0901.2984. [t09/013] E. Schenck. Weyl laws for partially open quantum maps. Ann. Henri Poincaré, 10, 711–747, (2009), arXiv:0811.3134v2. [t09/015] M. Bergère and B. Eynard. Determinantal formulae and loop equations. (2009), arXiv:0901.3273. [t09/017] T. Lappi. Initial conditions of heavy ion collisions and small x. volume 827 of Nucl. Phys. A, 365c– 370c, (2009), arXiv:0901.1949. International Conference on Particles And Nuclei (PANIC08), Eilat, Israelt, 2009-11-08/2014-11-08. [t09/018] C. Gombeaud, T. Lappi, and J.-Y. Ollitrault. Does interferometry probe thermalization? Phys. Rev. C, 79, 054914, (2009), arXiv:0901.4908. [t09/019] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, and D. Maitre. Precise Predictions for W + 3 Jet Production at Hadron Colliders. Phys. Rev. Lett., 102, 222001, (2009), arXiv:0902.2760. Appendices 89

[t09/020] I. Bena, Gianguido Dall’Agata, S. Giusto, C. Ruef, and N.P. Warner. Non-BPS Black Rings and Black Holes in Taub-NUT. JHEP, 0906, 015, (2009), arXiv:0902.4526. [t09/021] G. Heinrich, T. Huber, D.A. Kosower, and V.A. Smirnov. Nine-Propagator Master Integrals for Massless Three-Loop Form Factors. Phys. Lett. B, 678, 359–366, (2009), arXiv:0902.3512. [t09/022] R. Minasian, D. Andriot, and M. Petrini. Flux backgrounds from Twists. JHEP, 0912, 028, (2009), arXiv:0903.0633. [t09/023] H.K. Lee and M. Rho. Dilatons in Hidden Local Symmetry for Hadrons in Dense Matter. Nucl. Phys. A, 829, 76–99, (2009), arXiv:0902.3361. [t09/024] D. Benedetti, P.F. Machado, and F. Saueressig. Taming perturbative divergences in asymptotically safe gravity. Nucl. Phys. B, 824, 168–191, (2010), arXiv:0902.4630. [t09/025] A. Ayyer. Towards a human proof of Gessel’s conjecture. J. Integer Sequences, 12, 09.4.2, (2009), arXiv:0902.2329v1. [t09/026] A. Benlagra, K.-S. Kim, and C. Pépin. The Luttinger-Ward functional approach in the Eliashberg framework : A systematic derivation of scaling for thermodynamics near a quantum critical point. J. Phys. C, 23, 145601, (2011), arXiv:0902.3630. [t09/027] C. Bräuninger and M. Cirelli. Anti-deuterons from heavy Dark Matter. Phys. Lett. B, 678, 20–31, (2009), arXiv:0904.1165. [t09/028] C. Monthus and T. Garel. Random wetting transition on the Cayley tree : a disordered first-order transition with two correlation length exponents. J. Phys. A, 42, 165003, (2009), arXiv:0901.2797. [t09/029] R. Balian. La physique quantique en conflit avec notre intuition, 57–71. (2009). [t09/030] M. Cirelli and P. Panci. Inverse Compton constraints on the Dark Matter e+e- excesses. Nucl. Phys. B, 821, 399–416, (2009), arXiv:0904.3830. [t09/031] C. Caprini, F. Finelli, D. Paoletti, and A. Riotto. The cosmic microwave background temperature bispectrum from scalar perturbations induced by primordial magnetic fields. JCAP, 0906, 021, (2009), arXiv:0903.1420. [t09/032] P. Vanhove and N.E.J. Bjerrum-Bohr. Surprising simplicity of N=8 supergravity. Int. J. Mod. Phys. D, 18, 2295–2301, (2009). [t09/033] B. Duplantier and S. Sheffield. Duality and KPZ in Liouville Quantum Gravity. Phys. Rev. Lett., 102, 150603, (2009), arXiv:0901.0277. [t09/036] O. Bernardi, B. Duplantier, and P. Nadeau. A Bijection between well-labelled positive paths and matchings. Séminaire Lotharingien de Combinatoire, B63e, 1–13, (2010), arXiv:0903.5379. [t09/037] K. Mallick. Some Recent Developments in Non-Equilibrium Statistical Physics. International Conference on Non-Hermitian Hamiltonians in Quantum Physics, Bombay (inde), 2009-01-12/2009-01-18, (2009). [t09/038] R. Balian. Recension du livre de Sébastien Balibar : The Atom and the Apple: Twelve Tales from Contemporary Physics. Amer. J. Phys., 77, 575–576, (2009). [t09/039] M. Graña, J. Louis, A. Sim, and D. Waldram. E7(7) formulation of N=2 backgrounds. JHEP, 0907, 104, (2009), arXiv:0904.2333. [t09/040] T. Lappi. RHIC data and small x physics. volume 196 of Nucl. Phys. B (Proc. Suppl.), 44–49, (2009), arXiv:0902.0455. 15th International Symposium on Very High Energy Cosmic Ray Interactions (ISVHECRI 2008), Paris. [t09/041] J.-E. Bourgine. Boundary changing operators in the O(n) matrix model. JHEP, 0909, 020, (2009), arXiv:0904.2297. [t09/044] D. Volin. The 2-loop generalized scaling function from the BES/FRS equation. (2009), arXiv:0812.4407. [t09/045] M. Cirelli. PAMELA, ATIC and Dark Matter, or: Seeing Dark Matter in Cosmic Rays? Neutrino Telescopes, Venise, Italie, 2009-03-07/2009-03-14, (2009). [t09/046] S. Galli, F. Iocco, G. Bertone, and A. Melchiorri. CMB constraints on dark matter models with large annihilation cross section. Phys. Rev. D, 80, 023505, (2009), arXiv:0905.0003. [t09/047] J.-Y. Ollitrault, A.M. Poskanzer, and S.A. Voloshin. Effect of flow fluctuations and nonflow on elliptic flow methods. Phys. Rev. C, 80, 014904, (2009), arXiv:0904.2315. [t09/048] S. Prolhac. A combinatorial solution for the current fluctuations in the exclusion process. (2009), arXiv:0904.2356. [t09/049] K. Mallick. Influence of the noise spectrum on the anomalous diffusion in a stochastic system. Phys. Rev. E, 80, 011124, (2009). [t09/050] B. Eynard. A Matrix model for plane partitions. J. Stat. Mech., P10011, (2009), arXiv:0905.0535. 90 Activity Report CEA/DSM/IPhT 2008 — 2013

[t09/051] C. Monthus and T. Garel. Statistics of the two-point transmission at Anderson localization transitions. Phys. Rev. B, 79, 205120, (2009), arXiv:0903.1988. [t09/052] S. Nonnenmacher and M. Zworski. Semiclassical resolvent estimates in chaotic scattering. Appl. Math. Res. Express, 2009, abp003, (2009), arXiv:0904.2986. [t09/054] E. Sefusatti. One-loop Perturbative Corrections to the Matter and Galaxy Bispectrum with non- Gaussian Initial Conditions. Phys. Rev. D, 80, 123002, (2009), arXiv:0905.0717 [astro-ph.CO]. [t09/055] G. Borot, B. Eynard, M. Mulase, and B. Safnuk. A matrix model for simple Hurwitz numbers, and topological recursion. J. Geom. Phys., 61, 522–540, (2011), arXiv:0906.1206. [t09/056] G. Giecold, E. Iancu, and A.H. Mueller. Stochastic trailing string and Langevin dynamics from AdS/CFT. JHEP, 0907, 033, (2009), arXiv:0903.1840. [t09/057] G. Giecold. Heavy quark in an expanding plasma in AdS/CFT. JHEP, 0906, 002, (2009), arXiv:0904.1874. [t09/058] G. Giecold. Fermionic Schwinger-Keldysh Propagators from AdS/CFT. JHEP, 0910, 057, (2009), arXiv:0904.4869. [t09/059] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, and D. Maitre. Multi-jet cross sections at NLO with BlackHat and Sherpa. XLIIIth Rencontres de Moriond (QCD and High Energy Interactions), La Thuile, Italy, 2008-03-08/2008-03-15, (2009), arXiv:0905.2735. [t09/060] M. Cirelli. Dark Matter and the PAMELA/ATIC data. Rencontres de Moriond Electroweak 2009, La Thuile, Italie, 2009-03-07/2009-03-14, (2009). [t09/061] R. Balian. Recension du livre d’Hans Christian von Baeyer : Petites leçons de physique dans les jardins de Paris. Reﬂets phys., 17, 34, (2009). [t09/062] T. Lappi. Initial conditions of heavy ion collisions and high energy factorization. volume 40 of Acta Phys. Pol. B, 1997–2012, (2009), arXiv:0904.1670. XV Cracow Epiphany Conference, Cracovie, Pologne. [t09/063] F. Gelis, T. Lappi, and L. McLerran. Glittering Glasmas. Nucl. Phys. A, 828, 149–160, (2009), arXiv:0905.3234. [t09/064] A. Mehta, G.C. Barker, and J.M. Luck. Heterogeneities in granular materials. Phys. Today, 62, 40–45, (2009). [t09/065] M. Cirelli, F. Iocco, and P. Panci. Constraints on Dark Matter annihilations from reionization and heating of the intergalactic gas. JCAP, 0910, 009, (2009), arXiv:0907.0719. [t09/066] S. Alexandrov and F. Saueressig. Quantum mirror symmetry and twistors. JHEP, 0909, 108, (2009), arXiv:0906.3743. [t09/067] H.K. Lee and M. Rho. Half-Skyrmion Hadronic Matter at High Density, 147–163. World Scientiﬁc, (2010), arXiv:0905.0235. [t09/068] J.L. Jacobsen and H. Saleur. Boundary chromatic polynomial. J. Stat. Phys., 132, 707–719, (2008), arXiv:0803.2665. [t09/070] A. Ayyer, Carlen E. A., Lebowitz J. L., Mohanty P. K., D. Mukamel, and E.R. Speer. Phase diagram of the ABC model on an interval. J. Stat. Phys., 137, 1166–1204, (2009), arXiv:0905.4849. [t09/071] J. Dubail, J.L. Jacobsen, and H. Saleur. Conformal two-boundary loop model on the annulus. Nucl. Phys. B [FS], 813, 430–459, (2009), arXiv:0812.2746. [t09/072] Y. Ikhlef, J.L. Jacobsen, and H. Saleur. A Temperley-Lieb quantum chain with two- and three-site interactions. J. Phys. A, 42, 292002, (2009), arXiv:0901.4685. [t09/073] J. Dubail, J.L. Jacobsen, and H. Saleur. Conformal boundary conditions in the critical O(n) model and dilute loop models. Nucl. Phys. B, 827, 457–502, (2010), arXiv:0905.1382. [t09/074] F. David and K.J. Wiese. Field Theory of the RNA Freezing Transition. J. Stat. Mech., P10019, (2009), arXiv:0906.1472. [t09/075] E. Sefusatti, M. Liguori, A. Yadav, P. S., G. Jackson, M., and E. Pajer. Constraining Running Non- Gaussianity. JCAP, 0912, 022, (2009), arXiv:0906.0232. [t09/076] G. Korchemsky and E. Sokatchev. Symmetries and analytic properties of scattering amplitudes in N=4 SYM theory. Nucl. Phys. B, 882, 1–51, (2010), arXiv:0906.1737. [t09/077] N.E.J. Bjerrum-Bohr and P. Vanhove. Simplicity of Amplitudes in Gravity and Yang-Mills Theories. volume CLAQG08 of PoS, 004, (2011). International Workshop on Continuum and Lattice Approaches to Quantum Gravity (CLAQG08), Brighton, UK, 2008-09-17/2008-09-19. [t09/078] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, and D. Maitre. Next-to-Leading Order QCD Predictions for W+3-Jet Distributions at Hadron Colliders. Phys. Rev. D, 80, 074036, (2009), arXiv:0907.1984. Appendices 91

[t09/079] D. Volin. Minimal solution of the AdS/CFT crossing equation. J. Phys. A, 42, 372001, (2009), arXiv:0904.4929. [t09/081] D. Volin. From the mass gap at large (N) to the non-Borel-summability in O(3) and O(4) sigma-models. Phys. Rev. D, 81, 105008, (2010), arXiv:0904.2744. [t09/082] F. Iocco. An idea for detecting capture dominated Dark Stars. volume 194 of Nucl. Phys. B (Proc. Suppl.), 82–85, (2009), arXiv:0906.4106. GGI 2009 conference on Dark Matter. [t09/084] J.-Y. Ollitrault, A.M. Poskanzer, and S.A. Voloshin. Effect of nonflow and flow fluctuations on elliptic flow methods. volume 830 of Nucl. Phys. A, 279c–282c, (2009), arXiv:0906.3463. 21st International Conference on Ultrarelativistic Nucleus-Nucleus collisions (Quark Matter 2009), Knoxville, Tennessee, 2009- 03-30/2009-04-04. [t09/085] A. Voros. Zeta functions over zeros of zeta functions. Springer, (2010). [t09/086] N. Berkovits, M.B. Green, J.G. Russo, and P. Vanhove. Non-renormalization conditions for four-gluon scattering in supersymmetric string and field theory. JHEP, 0911, 063, (2009), arXiv:0908.1923. [t09/087] C. Monthus and T. Garel. Anderson transitions : multifractal or non-multifractal statistics of the transmission as a function of the scattering geometry. J. Stat. Mech., P07033, (2009), arXiv:0904.4547. [t09/088] C. Monthus and T. Garel. Statistics of renormalized on-site energies and renormalized hoppings for An- derson localization models in dimensions d=2 and d=3. Phys. Rev. B, 80, 024203, (2009), arXiv:0905.4127. [t09/089] J.M. Stéphan, S. Furukawa, G. Misguich, and V. Pasquier. Shannon and entanglement entropies of one- and two-dimensional critical wave functions. Phys. Rev. B, 80, 184421, (2009), arXiv:0906.1153. [t09/090] Y. Abe, C. Shen, D. Boilley, and B.G. Giraud. From Di-Nucleus to Mono-Nucleus - Neck Evolution in Fusion of Massive Systems. Int. J. Mod. Phys. E, 18, 2169–2174, (2009), arXiv:0901.0470. [t09/091] B.G. Giraud and P. Moussa. Schroedinger equations for the square root density of an eigenmixture and the square root of an eigendensity spin matrix. Phys. Rev. C, 82, 024301, (2010), arXiv:0906.2668. [t09/092] N.E.J. Bjerrum-Bohr, P.H. Damgaard, and P. Vanhove. Minimal Basis for Gauge Theory Amplitudes. Phys. Rev. Lett., 103, 161602, (2009), arXiv:0907.1425. [t09/093] C. Caprini. L’espace et le temps en cosmologie. ScintillationS, Journal du DAPNIA, 79, 12–13, (2009). [t09/094] T. Sarlat, A. Billoire, G. Biroli, and J.-P. Bouchaud. Predictive power of MCT: Numerics and Finite size scaling for a mean field spin glass. J. Stat. Mech., P08014, (2009), arXiv:0905.3333. [t09/095] F. Chevallier, O. Kepka, C. Marquet, and C. Royon. Gaps between jets at hadron colliders in the next-to-leading BFKL framework. Phys. Rev. D, 79, 094019, (2009), arXiv:0903.4598. [t09/096] C. Marquet. Multiple partonic interactions in heavy-ion collisions. 1st International Workshop on Multiple Partonic Interactions at the LHC, Perugia, Italy, 2008-10-27/2008-10-31, (2009), arXiv:0905.1878. [t09/097] C. Marquet, B.-W. Xiao, and F. Yuan. Semi-inclusive Deep Inelastic Scattering at small x. Phys. Lett. B, 682, 207–211, (2009), arXiv:0906.1454. [t09/098] C. Marquet. Large parton densities and high-pT physics in heavy-ion collisions. volume High-pT physics09 of PoS, 039, (2009), arXiv:0906.3184. 4th International Workshop on High-pT physics at LHC, Prague, Czech Republic, 2009-02-04/2009-02-07. [t09/099] C. Gombeaud, T. Lappi, and J.-Y. Ollitrault. Effects of partial thermalization on HBT interferometry. volume 830 of Nucl. Phys. A, 817c–820c, (2009), arXiv:0907.1392. The 21st International Conference on Ultra-Relativistic Nucleus-Nucleus Collisions (Quark Matter 2009), Knoxville, TN, 2009-03-30/2009-04-04. [t09/100] C. Godrèche, H. Grandclaude, and J.M. Luck. Finite-time fluctuations in the degree statistics of growing networks. J. Stat. Phys., 137, 1117–1146, (2009), arXiv:0907.1470. [t09/101] B. Eynard, M. Mulase, and B. Safnuk. The Laplace transform of the cut-and-join equation and the Bouchard-Mariño conjecture on Hurwitz numbers. Publ. RIMS, 47, 629–670, (2011), arXiv:0907.5224. [t09/102] G. Korchemsky and E. Sokatchev. Twistor transform of all tree amplitudes in N=4 SYM theory. Nucl. Phys. B, 829, 478–522, (2010), arXiv:0907.4107. [t09/103] G.E. Brown, M. Harada, J.W. Holt, M. Rho, and C. Sasaki. Hidden Local Field Theory and Dileptons in Relativistic Heavy Ion Collisions. Prog. Theor. Phys., 121, 1209–1236, (2009), arXiv:0901.1513. [t09/104] K. Fukushima, F. Gelis, and T. Lappi. Multiparticle correlations in the Schwinger mechanism. Nucl. Phys. A, 831, 184–214, (2009), arXiv:0907.4793. [t09/105] P. Werner, E. Gull, O. Parcollet, and A.J. Millis. Momentum-selective metal-insulator transition in the two-dimensional Hubbard model: An 8-site dynamical cluster approximation study. Phys. Rev. B, 80, 045120, (2009), arXiv:0903.3012. 92 Activity Report CEA/DSM/IPhT 2008 — 2013

[t09/106] C. Gombeaud and J.-Y. Ollitrault. Effects of flow fluctuations and partial thermalization on v4. Phys. Rev. C, 81, 014901, (2010), arXiv:0907.4664. [t09/107] T. Lappi. Understanding saturation and AA collisions with an eA collider. volume 830 of Nucl. Phys. A, 403c–410c, (2009), arXiv:0907.4588. Quark Matter 2009, Knoxville, TN, USA. [t09/108] T. Lappi, H. Kowalski, C. Marquet, and R. Venugopalan. Diffractive structure functions in nuclei. volume 3 of Progress in High Energy Physics, 36, (2009), arXiv:0906.3637. DIS 2009, Madrid, Espagne, 2009-04-26/2009-04-30. [t09/109] R. Minasian, M. Petrini, and A. Zaffaroni. New families of interpolating type IIB backgrounds. JHEP, 1004, 080, (2010), arXiv:0907.5147. [t09/111] C. Marquet, G. Beuf, and B.-W. Xiao. Energy loss and thermalization of heavy quarks in a strongly- coupled plasma. volume 830 of Nucl. Phys. A, 307c–310c, (2009), arXiv:0907.5292. Quark Matter 2009, Knoxville, TN, USA. [t09/112] H. Masui, J.-Y. Ollitrault, R. Snellings, and A. Tang. The centrality dependence of v2/epsilon: the ideal hydro limit and eta/s. volume 830 of Nucl. Phys. A, 463c–466c, (2009), arXiv:0908.0403. The 21st International Conference on Ultra-Relativistic Nucleus-Nucleus Collisions (Quark Matter 2009), Knoxville, TN, 2009-03-30/2009-04-04. [t09/113] I. Bena, S. Giusto, C. Ruef, and N.P. Warner. Multi-Center non-BPS Black Holes - the Solution. JHEP, 0911, 032, (2009), arXiv:arXiv:0908.2121. [t09/114] M. Ferrero, P Cornaglia, L De Leo, O. Parcollet, G. Kotliar, and A. Georges. Pseudogap opening and formation of Fermi arcs as an orbital-selective Mott transition in momentum space. Phys. Rev. B, 80, 064501, (2009), arXiv:0903.2480. [t09/115] M. Aichhorn, L. Pourovskii, V. Vildosola, M. Ferrero, O. Parcollet, T. Miyake, A. Georges, and S. Bier- mann. Dynamical Mean-Field Theory within an Augmented Plane-Wave Framework: Assessing Electronic Correlations in the Iron Pnictide LaFeAsO. Phys. Rev. B, 80, 085101, (2009), arXiv:0906.3735. [t09/116] M. Bergère and B. Eynard. Universal scaling limits of matrix models, and (p,q) Liouville gravity. (2009), arXiv:0909.0854. [t09/121] C. Caprini, R. Durrer, and G. Servant. The stochastic gravitational wave background from turbulence and magnetic fields generated by a first-order phase transition. JCAP, 0912, 024, (2009), arXiv:0909.0622. [t09/122] C. Marquet and T. Renk. Jet quenching in the strongly-interacting quark-gluon plasma. Phys. Lett. B, 685, 270–276, (2010), arXiv:0908.0880. [t09/123] C. Marquet and B. Wu. Exclusive vs. diffractive vector meson production in DIS at small x or off nuclei. volume 3 of Progress in High Energy Physics, 176, (2009), arXiv:0908.4180. XVIIth International Workshop on Deep Inelastic Scattering (DIS09), Madrid, Spain, 2009-04-26/2006-04-30. [t09/124] T. Lappi and L. McLerran. Long range rapidity correlations as seen in the STAR experiment. Nucl. Phys. A, 832, 330–345, (2009), arXiv:0909.0428. [t09/125] G. Beuf. Gravity dual of N=4 SYM theory with fast moving sources. Phys. Lett. B, 686, 55–58, (2010), arXiv:0903.1047. [t09/126] G. Beuf, M.P. Heller, R.A. Janik, and R. Peschanski. Boost-invariant early time dynamics from AdS/CFT. JHEP, 0910, 043, (2009), arXiv:0906.4423. [t09/127] S. Nonnenmacher. Quelques aspects de chaos quantique. 2009-06-05, (2009). [t09/129] E. Gull, O. Parcollet, P. Werner, and A.J. Millis. On the momentum-sector-selective transition in the 8 site dynamical mean field approximation to the two dimensional Hubbard model. Phys. Rev. B, 80, 245102, (2009), arXiv:0909.1795. [t09/130] I. Bena, S. Giusto, C. Ruef, and N.P. Warner. A (Running) Bolt for New Reasons. JHEP, 0911, 089, (2009), arXiv:arXiv:0909.2559. [t09/131] E. Schenck. Energy decay for the damped wave equation under a pressure condition. Commun. Math. Phys., 300, 375–410, (2010), arXiv:0909.2093v1. [t09/132] M. Bauer, D. Bernard, and L. Cantini. Off-Critical SLE(2) and SLE(4): a Field Theory Approach. J. Stat. Mech., P07037, (2009), arXiv:0903.1023. [t09/133] P. Di Francesco. Integrable Combinatorics. Integrable Combinatorics, Institut Henri Poincaré, 2009-09- 09/2009-09-30, (2009). [t09/136] D. Maitre, C.F. Berger, Z. Bern, F. Febres Cordero, H. Ita, L.J. Dixon, D. Forde, T. Gleisberg, and D.A. Kosower. NLO QCD Predictions for W+3 jets. volume EPS-HEP 2009 of PoS, 367, (2009), arXiv:0909.4949. EPS-HEP 2009, Krakow, Poland, 2009-07-16/2009-07-22. Appendices 93

[t09/137] I. Bena, S. Giusto, C. Ruef, and N.P. Warner. Supergravity Solutions from Floating Branes. JHEP, 1003, 047, (2010), arXiv:arXiv:0910.1860 [hep-th]. [t09/138] J. Bouttier and E. Guitter. Distance statistics in quadrangulations with a boundary, or with a self- avoiding loop. J. Phys. A, 42, 465208, (2009), arXiv:0906.4892. 5 [t09/143] B. Vicedo. Hamiltonian dynamics and the hidden symmetries of the AdS5xS superstring. JHEP, 1001, 102, (2010), arXiv:0910.0221. 2 [t09/152] C. Gombeaud and J.-Y. Ollitrault. Why is v4/(v2) larger than predicted by hydrodynamics? volume 834 of Nucl. Phys. A, 295c–297c, (2010), arXiv:0910.0392. The 10th International Conference on Nucleus- Nucleus collisions, Beijing, China, 2009-08-16/2009-08-21. [t09/153] R. Balian. Une crise en physique ? Entre déterminisme et imprévisibilité. Nouvelles Archimède, 53, 21–24, (2010). [t09/154] M. Chemtob and P. Hosteins. Searching singlet extensions of the supersymmetric standard model in Z6−II orbifold compactification of heterotic string. Eur. Phys. J. C, 68, 539–559, (2010), arXiv:0909.4497. [t09/155] C. Monthus and T. Garel. Statistical properties of two-particle transmission at Anderson transition. J. Phys. A, 42, 475007, (2009), arXiv:0909.1894v1. [t09/156] A. Ayyer. A Natural Bijection between Permutations and a Family of Descending Plane Partitions. Eur. J. Comb., 31, 1785–1791, (2010), arXiv:0909.4732. [t09/157] A. Ayyer and K. Mallick. Exact results for an asymmetric annihilation process with open boundaries. J. Phys. A, 43, 045003, (2010), arXiv:0910.0693. [t09/158] L. Calibbi, M. Frigerio, S. Lavignac, and A. Romanino. Flavour violation in supersymmetric SO(10) unification with a type II seesaw mechanism. JHEP, 0912, 057, (2009), arXiv:0910.0377. [t09/159] P. Vanhove. La cosmologie : un laboratoire pour la théorie des cordes. FORME ET ORIGINE DE L’UNIVERS, Lyon 3, 2009-10-12/2009-10-14, (2009). [t09/160] G. Borot and B. Eynard. Enumeration of maps with self avoiding loops and the O(n) model on random lattices of all topologies. J. Stat. Mech., 2011, P01010, (2011), arXiv:0910.5896. [t09/161] S. Prolhac. Méthodes exactes pour le modèle d’exclusion asymétrique. PhD thesis, (2009). Université Pierre et Marie Curie, 2009-09-23. [t09/162] M. Cirelli. Pamela, ATIC, Fermi, HESS and Dark Matter, or: Seeing signals of Dark Matter in cosmic rays? CCAPP Symposium, Columbus, OH, (2009). [t09/163] P. Desrosiers and B. Eynard. Supermatrix models, loop equations, and duality. J. Math. Phys., 51, 123304, (2010), arXiv:0911.1762. [t09/164] A. Dumitru, F. Gelis, L. McLerran, and R. Venugopalan. Glasma flux tubes and the near side ridge phenomenon at RHIC. Nucl. Phys. A, 810, 91, (2008), arXiv:0804.3858. [t09/165] F. Gelis, S. Jeon, and R. Venugopalan. How particles emerge from decaying classical fields in heavy ion collisions: towards a kinetic description of the Glasma. Nucl. Phys. A, 817, 61, (2009), arXiv:0706.3775. [t09/166] A.J. Baltz, F. Gelis, and al.+ et. The Physics of Ultraperipheral Collisions at the LHC. Phys. Rep., 458, 1–171, (2008), arXiv:0706.3356. [t09/167] A. Bessa, C.A. de Carvalho, E.S. Fraga, and F. Gelis. Semiclassical thermodynamics of scalar fields. JHEP, 0708, 007, (2007), arXiv:0705.1531. [t09/168] F. Gelis, T. Lappi, and R. Venugopalan. High energy scattering in Quantum Chromodynamics. volume 16 of Int. J. Mod. Phys. E, 2595–2637, (2007), arXiv:0708.0047. 10th International Workshop on Hadron Physics (X Hadron Physics), Florianopolis, Bresil. [t09/169] C. Caprini, R. Durrer, and E. Fenu. Can the observed large scale magnetic fields be seeded by helical primordial fields? JCAP, 0911, 001, (2009), arXiv:0906.4976. [t09/170] B. Eynard, A. Kashani-Poor, and O. Marchal. A matrix model for the topological string I: Deriving the matrix model. (2009), arXiv:1003.1737. [t09/171] E. Avsar, E. Iancu, L. McLerran, and D.N. Triantafyllopoulos. Shockwaves and deep inelastic scattering within the gauge/gravity duality. JHEP, 0911, 105, (2009), arXiv:0907.4604. [t09/172] E. Iancu and A.H. Mueller. A lattice test of strong coupling behaviour in QCD at finite temperature. Phys. Lett. B, 681, 247–252, (2009), arXiv:0906.3175. [t09/173] E. Avsar and E. Iancu. CCFM Evolution with Unitarity Corrections. Nucl. Phys. A, 829, 31–75, (2009), arXiv:0906.2683. [t09/174] E. Avsar and E. Iancu. BFKL and CCFM evolutions with saturation boundary. Phys. Lett. B, 673, 24–29, (2009), arXiv:0901.2873. 94 Activity Report CEA/DSM/IPhT 2008 — 2013

[t09/175] L. Chekhov, B. Eynard, and O. Marchal. Topological expansion of the Bethe ansatz, and quantum algebraic geometry. (2009), arXiv:0911.1664. [t09/176] M. Rho, S.-J. Sin, and I. Zahed. Dense QCD: a Holographic Dyonic Salt. Phys. Lett. B, 01, 077, (2010), arXiv:0910.3774. [t09/177] C. Monthus, B. Berche, and C. Chatelain. Symmetry relation for multifractal spectra at random critical points. J. Stat. Mech., P12002, (2009), arXiv:0909.0584. [t09/178] P. Brun, G. Bertone, M. Cirelli, E. Moulin, J.-F. Glicenstein, F. Iocco, and L. Pieri. The cosmic ray lepton puzzle. Annual meeting of the French Astronomical & Astrophysical Society (sf2a), (2009), arXiv:1001.5408. [t09/179] P. Valageas. Some statistical properties of the Burgers equation with white-noise initial velocity. J. Stat. Phys., 137, 729–764, (2009), arXiv:0903.0956. [t09/180] P. Valageas. Quasi-linear regime and rare-event tails of decaying Burgers turbulence. Phys. Rev. E, 80, 016305, (2009), arXiv:0905.1910. [t09/181] P. Valageas. Mass functions and bias of dark matter halos. Astron. Astrophys., 508, 93–106, (2009), arXiv:0905.2277. [t09/182] P. Valageas. Mass function and bias of dark matter halos for non-Gaussian initial conditions. Astron. Astrophys., 514, A46, (2010), arXiv:0906.1042. [t09/183] D. Munshi, P. Valageas, A. Cooray, and A. Heavens. Secondary non-Gaussianity and Cross-Correlation Analysis. Mon. Not. R. Astron. Soc., 414, 3173–3197, (2011), arXiv:0907.3229. [t09/184] C. Godrèche, H. Grandclaude, and J.M. Luck. Statistics of leaders and lead changes in growing networks. J. Stat. Mech., P02001, (2010), arXiv:0911.3057. [t09/185] C. Normand. Finite gap effects on the instability of stratified circular Couette Flow. Eur. J. Mech. B, Fluids, 29, 192–200, (2010). [t09/186] J.-E. Bourgine, K. Hosomichi, and I.K. Kostov. Boundary transitions of the O(n) model on a dynamical lattice. Nucl. Phys. B, 882, 462–499, (2010), arXiv:0910.1581. [t09/187] M. Cirelli, P. Panci, and D. Serpico P. Diffuse gamma ray constraints on annihilating or decaying Dark Matter after Fermi. Nucl. Phys. B, 840, 284–303, (2010), arXiv:0912.0663. [t09/189] Brown G.-E. and Rho M., editors. The Multifaceted Skyrmion. World Scientific, (2010). [t09/190] P. Vanhove. On the ultraviolet behaviour of N=8 supergravity amplitudes. In Marcel Grossmann Meeting on General Relativity, 2351–2355. World Scientific, (2012). 12th Marcel Grosmann Meeting, Paris, 2009-07-12/2009-07-18. [t09/193] C. Candu, Mitev V., Quella T., H. Saleur, and V. Schomerus. The Sigma Model on Complex Projective Superspaces. JHEP, 1002, 015, (2010), arXiv:0908.0878. [t09/194] C. Candu, J.L. Jacobsen, N. Read, and H. Saleur. Universality classes of polymer melts and conformal sigma models. J. Phys. A, 43, 142001, (2010), arXiv:0908.1081. [t09/195] H. Saleur and B. Pozsgay. Scattering and duality in the 2 dimensional OSP(2|2) Gross Neveu and sigma models. J. Phys. C, 6, 41, (2009), arXiv:0910.0637. [t09/196] B. Eynard and N. Orantin. Geometrical interpretation of the topological recursion, and integrable string theories. (2009), arXiv:0911.5096. [t09/199] P. Creminelli, G. D’Amico, J. Norena, L. Senatore, and F. Vernizzi. Spherical collapse in quintessence models with zero speed of sound. JCAP, 1004, 027, (2010), arXiv:0911.2701. [t09/200] F. Bernardeau, C. Bonvin, and F. Vernizzi. Full-sky lensing shear at second order. Phys. Rev. D, 81, 083002, (2010), arXiv:0911.2244. [t09/201] L. Boubekeur, P. Creminelli, G. D’Amico, J. Norena, and F. Vernizzi. Sachs-Wolfe at second order: the CMB bispectrum on large angular scales. JCAP, 0908, 029, (2009), arXiv:0906.0980. [t09/202] P. Creminelli, G. D’Amico, J. Norena, and F. Vernizzi. The Effective Theory of Quintessence: the w<-1 Side Unveiled. JCAP, 0902, 018, (2009), arXiv:0811.0827. [t09/203] D. Langlois, F. Vernizzi, and D. Wands. Non-linear isocurvature perturbations and non-Gaussianities. JCAP, 0812, 004, (2008), arXiv:0809.4646. [t09/206] B.G. Giraud and S. Karataglidis. Algebraic Density Functionals. Phys. Lett. B, 703 (1)„ 88, (2011), arXiv:0908.0593. [t09/207] B.G. Giraud. Open Problems in Nuclear Density Functional Theory. J. Phys. G, 37, 064002, (2010), arXiv:0911.5654. Appendices 95

[t09/208] C. Monthus and T. Garel. Eigenvalue method to compute the largest relaxation time of disordered systems. J. Stat. Mech., P12017, (2009), arXiv:0910.4833. [t09/209] P. Brax, C. Burrage, A.C. Davis, D. Seery, and A. Weltman. Higgs production as a probe of dark energy interactions. Phys. Rev. D, 81, 103524, (2010), arXiv:0911.1267. [t09/210] P. Brax, C. van de Bruck, A.C. Davis, and D. Shaw. Laboratory Tests of Chameleon Models. 5th Patras Workshop, PATRAS 2009, Durham, UK, 2009-07-13/2009-07-17, (2009), arXiv:0911.1086. [t09/211] P. Brax, C. van de Bruck, J. Martin, and A.C. Davis. Decoupling Dark Energy from Matter. JCAP, 0909, 032, (2009), arXiv:0904.3471. [t09/212] P. Brax, C. Burrage, A.C. Davis, D. Seery, and A. Weltman. Collider constraints on interactions of dark energy with the Standard Model. JHEP, 0909, 128, (2009), arXiv:0904.3002. [t09/213] P. Brax, C.A. Savoy, and A. Sil. SQCD Inflation & SUSY Breaking. JHEP, 0904, 092, (2009), arXiv:0902.0972. [t09/214] P. Brax. La cosmologie: un laboratoire de l’infiniment petit. Forme et Origine de l’univers : philosophie et cosmologie, Lyon, (2010). [t09/216] F. Bernardeau and P. Valageas. Eulerian and Lagrangian propagators for the adhesion model (Burgers dynamics). Phys. Rev. D, 81, 043516, (2010), arXiv:0912.0356. [t09/217] D.A. Kosower. New Technologies in the Hunt for New Physics. In XVIth International Congress on Mathematical Physics. World Scientific, (2010). ICMP 2009, Prague, 2009-08-03/2009-08-08. [t09/219] S. Nonnenmacher. Entropy of chaotic eigenstates. In D. Jakobson, Nonnenmacher S., and I. Polterovich, editors, Spectrum and Dynamics, CRM Proceedings and Lecture Notes vol.52, 1–42. American Mathematical Society, (2010), arXiv:1004.4964. Spectre et Dynamique, Montréal, Canada, 2008-04-07/2008-04-11. [t09/220] S. Nonnenmacher. Quantum transfer operators and chaotic scattering. Spectrum of transfer operators: recent developments and applications, Mathematisches Forschungsinstitut Oberwolfach, 2009-11-08/2009- 11-14, (2009), arXiv:1001.3459. [t09/221] G. Giecold. Finite-Temperature Fractional D2-Branes and the Deconfinement Transition in 2+1 Dimen- sions. JHEP, 1003, 109, (2010), arXiv:0912.1558. [t09/222] M. Cirelli. Indirect search of Dark Matter in space: theoretical and phenomenological aspects. In Marcel Grossmann Meeting on General Relativity, 905–907. World Scientific, (2012). 12th Marcel Grossmann Meeting on General Relativity, UNESCO, Paris, 2009-07-12/2009-07-18. [t09/223] R. Candelier, O. Dauchot, and G. Biroli. Dynamical facilitation decreases when approaching the granular glass transition. Europhys. Lett., 92, 24003, (2010), arXiv:0912.0472v1. [t09/224] R. Candelier, A. Widmer-Cooper, J.K. Kummerfeld, O. Dauchot, G. Biroli, P. Harrowell, and D.R. Reichman. Spatiotemporal Hierarchy of Relaxation Events, Dynamical Heterogeneities, and Structural Reorganization in a Supercooled Liquid. Phys. Rev. Lett., 105, 135702, (2010), arXiv:0912.0193v1. [t09/225] Darst Richard K., D.R. Reichman, and G. Biroli. Dynamical Heterogeneity in Lattice Glass Models. J. Chem. Phys., 132, 044510, (2010), arXiv:0911.0479. [t09/226] G. Biroli, C. Kollath, and A. Läuchli. Effect of Rare Fluctuations on the Thermalization of Isolated Quantum Systems. Phys. Rev. Lett., 105, 250401, (2010), arXiv:0907.3731v2. [t09/227] F. Sausset, C. Toninelli, G. Biroli, and G. Tarjus. Bootstrap Percolation and Kinetically Constrained Models on Hyperbolic Lattices. J. Stat. Phys., 138, 411–430, (2010), arXiv:0907.0938v2. [t09/228] A. Andreanov, G. Biroli, and J.-P. Bouchaud. Mode-Coupling as a Landau Theory of the Glass Tran- sition. Europhys. Lett., 88, 16001, (2009), arXiv:0903.4619. [t09/229] M. Tarzia, G. Biroli, J.-P. Bouchaud, and A. Lefèvre. Anomalous non-linear response of glassy liquids: general arguments and a Mode-Coupling approach. J. Chem. Phys., 132, 054501, (2010), arXiv:0812.3514. [t09/230] R. Candelier, O. Dauchot, and G. Biroli. The building blocks of dynamical heterogeneities in dense granular media. Phys. Rev. Lett., 102, 088001, (2009), arXiv:0811.0201. [t09/231] C. Aron, G. Biroli, and L.F. Cugliandolo. Driven quantum coarsening. Phys. Rev. Lett., 102, 050404, (2009), arXiv:0809.0590. [t09/232] G. Biroli, C. Chamon, and F. Zamponi. Theory of the superglass phase. Phys. Rev. B, 78, 224306, (2009), arXiv:0807.2458. [t09/233] P. Di Francesco and R. Kedem. Q-system Cluster Algebras, Paths and Total Positivity. SIGMA, 6, 014, (2010), arXiv:0906.3421. [t09/234] P. Di Francesco and N.Y. Reshetikhin. Asymptotic shapes with free boundaries. Commun. Math. Phys., 309, 87–121, (2012), arXiv:0908.1630. 96 Activity Report CEA/DSM/IPhT 2008 — 2013

[t09/235] P. Di Francesco and R. Kedem. Positivity of the T-system cluster algebra. Electr. J. Combin., 16(1), R140, (2009), arXiv:0908.3122. [t09/236] P. Di Francesco and R. Kedem. Discrete non-commutative integrability: the proof of a conjecture by M. Kontsevich. Int. Math. Res. Not., 2 March 2010, 024, (2010), arXiv:0909.0615. [t09/237] I. Bena, M. Graña, and N. Halmagyi. On the Existence of Meta-stable Vacua in Klebanov-Strassler. JHEP, 1009, 087, (2011), arXiv:0912.3519. [t09/238] F. Bernardeau. The growth of cosmological density perturbations. volume 1132 of AIP Conf. Proc., 42–85, (2009). COSMOLOGY AND GRAVITATION: XIII Brazilian School on Cosmology and Gravitation (XIII BSCG), Rio de Janeiro, Brazil, 2008-07-20/2008-08-02. [t09/239] G. Biroli and J.-P. Bouchaud. The Random First-Order Transition Theory of Glasses: a critical assess- ment, 31–113. (2012), arXiv:0912.2542v1. [t09/241] M. Rho. Dileptons Get Nearly Blind to Mass-Scaling Effects In Hot and/or Dense Matter. (2009), arXiv:0912.3116. [t09/242] B.Y. Park, J.I. Kim, and M. Rho. Kaons in Dense Half-Skyrmion Matter. Phys. Rev. C, 81, 035203, (2009), arXiv:0912.3213. [t09/244] C. Pitrou, F. Bernardeau, and J.-P. Uzan. The y-sky: diffuse spectral distortions of the cosmic microwave background. JCAP, 1007, 019, (2010), arXiv:0912.3655. [t09/245] C. Gombeaud and J.-Y. Ollitrault. Are eccentricity fluctuations able to explain the centrality dependence of v4 ? volume 37 of J. Phys. G, 094024, (2010), arXiv:0912.3623. International Conference on Strangeness in Quark Matter (SQM09), Buzios, Brasil, 2009-09-27/2009-10-02. [t09/246] D. Lacoste and K. Mallick. Fluctuation relations for molecular motors, 61–88. Spinger, (2011), arXiv:0912.0391. [t09/247] P. Ranjith, K. Mallick, J.F. Joanny, and D. Lacoste. Role of ATP-hydrolysis in the treadmilling of a single Role of ATP-hydrolysis in the treadmilling of a single actin filament. Biophys. J., 98, 1418–1427, (2010), arXiv:0908.0657. [t09/249] K. Mallick. Developpements Recents en Physique Statistique Loin de l’Equilibre. (2009). [t09/250] F. Bernardeau and P. Valageas. Merging and fragmentation in the Burgers dynamics. Phys. Rev. E, 82, 016311, (2010), arXiv:0912.3603. [t09/251] M. Barthélémy, J.P. Nadal, and H. Berestycki. Disentangling collective trends from local dynamics. Proc. Nat. Acad. Sci., 107, 7629–7634, (2010), arXiv:0909.1490. [t09/252] M. Woelki and K. Mallick. Transfer matrices for the totally asymmetric simple exclusion process. J. Phys. A, 43, 185003, (2010), arXiv:1001.1064. [t09/253] R. Balian and al.+ et. Quand la science rencontre ses limites. Science & Vie, 1103, 56–61, (2009). [t09/254] G. Ripka. Density functionals derived from Feynman diagrams. (2010), arXiv:0910.1935. [t09/255] R Chetrite and K. Mallick. Fluctuation Relations for Quantum Markovian Dynamical Systems. J. Stat. Phys., 148, 480–501, (2010), arXiv:1002.0950. [t09/256] M. Bon. Prédiction de structures secondaires d’ARN avec pseudo-noeuds. PhD thesis, (2009). Ecole Polytechnique, Palaiseau, 2009-09-21. [t09/257] F. Benitez, J.-P. Blaizot, H. Chaté, B. Delamotte, R. Mendez-Galain, and N. Wschebor. Solutions of renormalization group flow equations with full momentum dependence. Phys. Rev. E, 80, 030103(R), (2009), arXiv:0901.0128. [t09/258] J.-P. Blaizot and M.A. Nowak. Confinement, Turbulence and Diffraction Catastrophes. Nucl. Phys. A, 827, 383c–385c, (2009), arXiv:0901.2284. [t09/259] J.-P. Blaizot and M.A. Nowak. Universal shocks in random matrix theory. Phys. Rev. E, 82, 051115 [6 pp.], (2010), arXiv:0902.2223v1. [t09/260] A. Beraudo, J.-P. Blaizot, P. Faccioli, and G. Garberoglio. Heavy-quarks in the QGP: study of medium effects through euclidean propagators and spectral functions. Nucl. Phys. A, 830, 319c–322c, (2009), arXiv:0907.1797. [t09/261] J.-P. Blaizot and M.A. Nowak. Large Nc Confinement, Universal Shocks and Random Matrices. Acta Phys. Pol. B, 40, 3321–3354, (2009), arXiv:0911.3683. [t09/262] J.-P. Blaizot. Phases of hot and dense QCD matter. volume 834 of Nucl. Phys. A, 515c–520c, (2010), arXiv:0911.5059. 10th International Conference on Nucleus-Nucleus Collisions, Aug 16-21, 2009, Beijing, China. Appendices 97

[t09/263] J.-P. Blaizot. Exact renormalization group at finite temperature. volume QCD-TNT09 of PoS, 053 [11 pp.], (2009), arXiv:0912.3896v1. International Workshop on QCD Green’s Functions, Confinement and Phenomenology (QCD-TNT09), ECT Trento, Italy, 2009-09-07/2009-09-11. [t09/265] P. Brax and E. Cluzel. Brane Bremsstrahlung in DBI Inflation. JCAP, 1003, 016, (2010), arXiv:0912.0806. [t09/266] E. Schenck. Systèmes quantiques ouverts et méthodes semi-classiques. PhD thesis, (2009). Université Pierre et Marie Curie, 2009-11-17. [t09/267] A. Lefèvre. Aging is - almost - like equilibrium. (2009), arXiv:0910.0397. [t09/268] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, and D. Maitre. Next-to-Leading Order Jet Physics with BlackHat. PoS RADCOR, 065, (2010), arXiv:0912.4927. [t09/269] J. Bros, H. Epstein, M. Gaudin, U. Moschella, and V. Pasquier. Triangular invariants, three-point functions and particle stability on the de Sitter universe. Commun. Math. Phys., 295, 261–288, (2010), arXiv:0901.4223. [t09/270] C. Ruef. Bubbling solutions, entropy enhancement and the fuzzball proposal. Nucl. Phys. B (Proc. Suppl.), 192-193, 174–175, (2009), arXiv:0901.3237. [t09/271] N. Bobev and C. Ruef. The Nuts and Bolts of Einstein-Maxwell Solutions. JHEP, 1001, 124, (2010), arXiv:0912.0010. [t09/272] A. Crisanti, C. De Dominicis, and T. Sarlat. Low temperature spin glass fluctuations: expanding around a spherical approximation. Eur. Phys. J. B, 74, 139–149, (2010), arXiv:0909.2556. [t09/274] A. Benlagra. Criticalité quantique dans les bi-couches d’ He3 et les composés à fermions lourds. PhD thesis, (2009). Université Paris-Sud 11, 2009-11-09. [t09/275] K.-S. Kim and C. Pépin. Quantum Boltzman equation study for the Kondo breakdown quantum critical point. J. Phys.: Condens. Matter, 22, 025601, (2010), arXiv:0904.1041. [t09/276] B. Efetov K., C. Pépin, and H. Meier. Exact bosonization for an interacting Fermi gas in arbitrary dimensions. Phys. Rev. Lett., 103, 186403, (2009), arXiv:0907.3243. [t09/277] B. Basso. Dynamique fortement couplée et intégrabilité dans l’extension supersymétrique maximale de la théorie de Yang-Mills. PhD thesis, (2009). Université Paris-Sud 11, 2009-09-28. [t09/278] J. Bros, E. De Micheli, and G.A. Viano. Nonlocal potentials and complex angular momentum theory. Ann. Henri Poincaré, 11, 659–764, (2010), arXiv:0912.2902.

[t09/279] A. Crisanti and C. De Dominicis. Sherrington-Kirkpatrick model near T = Tc: expanding around the Replica Symmetric Solution. J. Phys. A, 43, 055002, (2010), arXiv:0910.4091. [t09/280] P. Bialas, L. Daniel, A. Morel, and B. Petersson. Three dimensional ﬁnite temperature SU(3) gauge theory in the conﬁned region and the string picture. Nucl. Phys. B, 836, 91–99, (2010), arXiv:0912.0206. [t09/281] J. Dubail, J.L. Jacobsen, and H. Saleur. Exact solution of the anisotropic special transition in the O(n) model in 2D. Phys. Rev. Lett., 103, 145701, (2009), arXiv:0909.2949.

[t09/282] Y. Ikhlef, J.L. Jacobsen, and H. Saleur. The Z2 staggered vertex model and its applications. J. Phys. A, 43, 225201, (2010), arXiv:0911.3003. [t09/283] D. Volin. Quantum integrability and functional equations. PhD thesis, (2009), arXiv:1003.4725. Univer- sité Paris-Sud 11, 2009-09-25. [t09/284] G. Korchemsky. Surprising symmetry of scattering amplitudes in gauge theories. Mod. Phys. Lett. A, 24, 2868–2881, (2009). [t09/285] M. Frigerio and T. Hambye. Dark matter stability and uniﬁcation without supersymmetry. Phys. Rev. D, 81, 075002, (2010), arXiv:0912.1545. [t09/286] N. Gromov. Integrability in AdS/CFT correspondence: quasi-classical analysis. J. Phys. A, 42, 254004, (2009). [t09/287] E. Avsar, Y. Hatta, and T. Matsuo. Soft gluons away from jets: distribution and correlation. JHEP, 0906, 011, (2009), arXiv:0903.4285. [t09/289] Duplantier B. and Rivasseau V., editors. Séminaire Poincaré XII, Bio-Physique. Centre Poly-Média de l’Ecole Polytechnique, (2009). Séminaire Poincaré, Institut Henri Poincaré, Paris, 2009-01-31. [t09/290] B. Duplantier. A Rigorous Perspective on Liouville Quantum Gravity and the KPZ Relation, 529–561. Oxford University Press, (2009). [t09/291] B. Duplantier. Liouville Quantum Gravity & the KPZ Relation: A Rigorous Perspective. In XVIth International Congress on Mathematical Physics, 56–85. World Scientiﬁc Publishing Co., (2010). ICMP09, Prague, 2009-08-03/2009-08-08. 98 Activity Report CEA/DSM/IPhT 2008 — 2013

[t09/292] Duplantier B., Halsey T.C., and Rivasseau V., editors. Séminaire Poincaré XIII, Verres et Grains. Centre Poly-Média de l’Ecole polytechnique, (2009). Séminaire Poincaré, Institut Henri Poincaré, Paris, 2009-11-21. [t09/293] M. Antonelli, D.M. Asner, D. Bauer, T. Becher, M. Beneke, A.J. Bevan, M. Blanke, C. Bloise, M. Bona, A. Bondar, C. Bozzi, J. Brod, A.J. Buras, N. Cabibbo, A. Carbone, G. Cavoto, M. Ciuchini, D.P. Cronin, C.H. Davies, J. Dingfelder, S. Donati, W. Dungel, U. Egede, G. Eigen, R. Faccini, T. Feldmann, P. Gambino, E. Gardi, T.J. Gershon, S. Giagu, T. Goto, C. Greub, C. Grojean, and al.+ et. Flavor Physics in the Quark Sector. Phys. Rep., 494, 197–414, (2010), arXiv:0907.5386. [t09/294] A. De Roeck, J. Ellis, C. Grojean, and al.+ et. From the LHC to Future Colliders. Eur. Phys. J. C, 66, 525–583, (2010), arXiv:0909.3240. [t09/295] C. Grojean. New theories for the Fermi scale. volume EPS-HEP of PoS, 008, (2009), arXiv:0910.4976. EPS-HEPP’09 and Lepton-Photon 2009 conferences. [t09/296] T. Sarlat. Un modèle de dimension finie pour la transition vitreuse. PhD thesis, (2009). Université Pierre et Marie Curie, 2009-11-13. [t09/297] U. Moschella and R. Schaeffer. Quantum fields on curved spacetimes and a new look at the Unruh effect. volume 1132 of AIP Conf. Proc., 303–332, (2009), arXiv:0904.3751. [t09/298] R. Peschanski. Traveling wave solution of the Reggeon Field Theory. Phys. Rev. D, 79, 105014, (2009), arXiv:0903.3373. [t09/299] R. Peschanski and E.N. Saridakis. Exact hydrodynamic solution for the elliptic flow. Phys. Rev. C, 80, 024907, (2009), arXiv:0906.0941. [t09/300] R. Peschanski. Traveling wave solution of the Reggeon Field Theory (EPS proceedings). volume EPS- HEP2009 of PoS, 338, (2009), arXiv:0909.5612. EPS-HEP 2009, Krakow. [t09/301] R.A. Janik and R. Peschanski. Bjorken Flow of the quark-gluon plasma and Gauge/Gravity Correspon- dence. volume EPS-HEP2009 of PoS, 040, (2009), arXiv:0909.5614. EPS-HEP 2009, Krakow, Poland. [t09/302] R. Peschanski. Extended Geometric Scaling from Generalized Traveling Waves. Phys. Rev. D, 81, 054014, (2010), arXiv:0912.1762. [t09/303] R. Peschanski. Gauge-gravity duality and high energy collisions. volume 191 of Nucl. Phys. B (Proc. Suppl.), 320–330, (2009). [t09/304] C. Royon, G. Beuf, R. Peschanski, and D. Salek. Geometric Scaling in Deep Inelastic Scattering. volume 1105 of AIP Conf. Proc., 274–277, (2009). [t09/305] P. Faccioli, A. Lonardi, and H. Orland. Dominant reaction pathways in protein folding: A direct validation against molecular dynamics simulations. J. Chem. Phys., 133, 045104, (2010), arXiv:0912.0037. [t09/306] O. Corradini, P. Faccioli, and H. Orland. Simulating Stochastic Dynamics Using Large Time Steps. Phys. Rev. E, 80, 061112, (2009), arXiv:0907.2948. [t09/307] U.D. Jentschura, A. Surzhykov, and J. Zinn-Justin. Generalized Nonanalytic Expansions, PT-Symmetry and Large-Order Formulas for Odd Anharmonic Oscillators. SIGMA, 5, 005, (2009), arXiv:0901.1858. [t09/308] U.D. Jentschura, A. Surzhykov, and J. Zinn-Justin. Unified Treatment of Even and Odd Anharmonic Oscillators of Arbitrary Degree. Phys. Rev. Lett., 102, 011601, (2009), arXiv:0901.4964. [t09/309] C. Godrèche and A.J. Bray. Nonequilibrium stationary states and phase transitions in directed Ising. J. Stat. Mech., 2009, P12016, (2009). [t09/310] C. Godrèche, S.N. Majumdar, and G. Schehr. The longest excursion of stochastic processes in nonequilibrium systems. Phys. Rev. Lett., 102, 240602, (2009). [t09/311] P. Koehl, H. Orland, and M. Delarue. Beyond the Poisson-Boltzmann Model: Modeling Biomolecule- Water and Water-Water Interactions. Phys. Rev. Lett., 102, 087801, (2009). [t09/312] P. Koehl, H. Orland, and M. Delarue. Computing Ion Solvation Free Energies Using the Dipolar Poisson Model. J. Phys. Chem. B, 113, 5694–5697, (2009). [t09/313] C. Micheletti and H. Orland. MISTRAL: a tool for energy-based multiple structural alignment of proteins. Bioinformatics, 25, 2663–2669, (2009). [t09/314] G. Beuf. Contributions à l’étude des interactions fortes à haute énergie et haute densité. PhD thesis, (2009). Université Pierre et Marie Curie, 2009-06-26. [t09/315] C.B. Jackson, G. Servant, G. Shaughnessy, T.M.P. Tait, and M. Taoso. Higgs in Space! JCAP, 1004, 004, (2010), arXiv:0912.0004. [t09/316] F. Gelis, T. Lappi, and R. Venugopalan. Long range rapidity correlations and the ridge in A+A collisions. Nucl. Phys. A, 830, 591c–594c, (2009), arXiv:0907.4381. Appendices 99

[t09/317] G. Beuf, F. Gelis, and al.+ et. Parton Distributions. (2009), arXiv:0901.2504. [t09/318] G. Beuf, F. Gelis, and al.+ et. Proceedings of the workshop: HERA and the LHC workshop series on the implications of HERA for LHC physics. Verlag DESY, (2009), arXiv:0903.3861. [t09/320] Y. Abe, C. Shen, D. Boilley, B.G. Giraud, and G. Kosenko. Heavy-Ion Fusion Mechanism and Predictions of Super-Heavy Elements Production. volume 1165 of AIP Conf. Proc., 128–131, (2009). [t09/321] E. Sefusatti, M. Liguori, A. Yadav, P. S., G. Jackson, M., and E. Pajer. Constraining Running Non- Gaussianity. JCAP, 0912, 022–067, (2009), arXiv:0906.0232. [t09/322] K. Mallick. Some recent developments in non-equilibrium statistical physics. volume 73 of Pramana J. Phys., 417–451, (2009). [t09/323] A. Gautreau, A. Barrat, and M. Barthélémy. Microdynamics in stationary complex networks. Proc. Nat. Acad. Sci., 106, 8847, (2009), arXiv:0811.1051. [t09/324] M. Bauer. Probabilité et processus stochastiques, pour les physiciens (et les curieux). Cours de Physique Théorique, IPhT, Saclay, 2009-03-06/2009-04-10, (2009). [t09/325] K. Mallick. Développements récents en Physique Statistique loin de l’équilibre. Cours de Physique Théorique, IPhT, Saclay, 2009-05-15/2009-06-05, (2009). [t09/326] N. Bobev, N. Halmagyi, K. Pilch, and P. Warner. Holographic, N=1 Supersymmetric RG Flows on M2 Branes. JHEP, 0909, 043, (2009), arXiv:0901.2736. [t09/327] N. Halmagyi. Non-geometric Backgrounds and the First Order String Sigma Model. (2011), arXiv:0906.2891. [t09/329] C. Bena. Effects of decoherence on the shot noise in carbon nanotubes. Phys. Rev. B, 81, 033404, (2010), arXiv:0906.0894. [t09/330] C. Bena. The local density of states in the presence of impurity scattering in graphene at high magnetic field. Phys. Rev. B, 83, 045409, (2010), arXiv:0906.2282. [t09/331] C. Bena. The tunneling conductance between a superconducting STM tip and an out-of-equilibrium carbon nanotube. Phys. Rev. B, 82, 035312, (2010), arXiv:0909.0867. [t09/332] R. Britto and B. Feng. Solving for tadpole coefficients in one-loop amplitudes. Phys. Lett. B, 681, 376–381, (2009), arXiv:0904.2766. [t09/333] P. Koehl, H. Orland, and M. Delarue. Solvation of Ion Pairs: The Poisson-Langevin Model. International Conference on Signal Processing Systems (ICSPS 2009), Singapore, SINGAPORE, (2009). [t09/334] C. Azuara, H. Orland, M. Bon, P. Koehl, and M. Delarue. Incorporating dipolar solvents with variable density in Poisson-Boltzmann electrostatics. Biophys. J., 95, 5587–5605, (2009). [t09/336] J.L. Jacobsen and F. Alet. The semiflexible fully-packed loop model and interacting rhombus tilings. Phys. Rev. Lett., 102, 145702, (2009). [t09/337] J. Zinn-Justin. Zinn-Justin equation. Scholarpedia, 4, 7120, (2009). [t09/338] J. Zinn-Justin. Path integral. Scholarpedia, 4, 8674, (2009). [t09/339] E. Iancu and A.H. Mueller. Light-like mesons and deep inelastic scattering in finite-temperature AdS/CFT with flavor. JHEP, 1002, 023, (2010), arXiv:0912.2238 [hep-th]. [t09/341] E. Iancu. Color Glass Condensate and its relation to HERA physics. volume 191 of Nucl. Phys. B (Proc. Suppl.), 281–294, (2009), arXiv:0901.0986. Rindberg Workshop - New Trends in HERA Physics 2008, Ringberg Castle, Tegernsee, Germany, 2008-10-05/2008-10-10. [t09/342] C. Grojean. New physics: Theoretical developments. 24th International Symposium on Lepton-Photon Interactions at High Energy (LP09), Hambourg (Allemagne), 2009-08-17/2009-08-22, (2009). [t09/343] J. Houdayer. Ondelettes et analyse numérique. Cours de Physique Théorique, IPhT, Saclay, 2009-06- 09/2009-07-10, (2009). [t09/344] S. Nonnenmacher. Chaotic dynamical systems. Cours de Physique Théorique, IPhT, Saclay, 2009-09- 18/2009-10-23, (2009). [t09/347] I. Bena. Black Holes, Black Rings and their Microstates. 2009-06-16, (2009). [t09/348] M. Cirelli and C. Bonvin. Théorie de la Matière Noire. Clefs CEA, 58, 77–79, (2012). [t09/352] F. Bernardeau, C. Bonvin, and F. Vernizzi. Full-sky lensing shear at second order. Phys. Rev. D, 81, 083002, (2010), arXiv:0911.2244. [t09/353] L. Boubekeur, P. Creminelli, G. D’Amico, J. Norena, and F. Vernizzi. Sachs-Wolfe at second order: the CMB bispectrum on large angular scales. JACP, 0908, 029, (2009), arXiv:95.30.Sf, 98.65.Dx, 98.80.Es, 98.80.Jk. 100 Activity Report CEA/DSM/IPhT 2008 — 2013

[t09/354] P. Creminelli, D’Amico Guido, J. Norena, and F. Vernizzi. The effective theory of quintessence: the w < −1 side unveiled. JCAP, 0902, 018, (2009), arXiv:0811.0827. [t10/001] M.B. Green, J.G. Russo, and P. Vanhove. Automorphic properties of low energy string amplitudes in various dimensions. Phys. Rev. D, 81, 086008, (2010), arXiv:1001.2535. [t10/002] C. Monthus and T. Garel. Random walk in two-dimensional self-affine random potentials : strong disorder renormalization approach. Phys. Rev. E, 81, 011138, (2010), arXiv:0910.0111. [t10/004] C. Monthus and T. Garel. Statistics of first-passage times in disordered systems using backward master equations and their exact renormalization rules. J. Phys. A, 43, 095001, (2010), arXiv:0911.5649. [t10/005] C. Marquet, C. Roiesnel, and S. Wallon. Virtual Compton Scattering off a Spinless Target in AdS/QCD. JHEP, 1004, 051, (2010), arXiv:1002.0566. [t10/006] S. Giusto, J Morales, and R. Russo. D1D5 microstate geometries from string amplitudes. JHEP, 1003, 130, (2010), arXiv:0912.2270. [t10/007] J. Germer, W. Hollik, E. Mirabella, and K. Trenkel M. Hadronic production of squark-squark pairs: the electroweak contributions. JHEP, 1008, 023, (2010), arXiv:1004.2621. [t10/009] C. Monthus and T. Garel. Matching between typical fluctuations and large deviations in disordered systems : application to the statistics of the ground state energy in the SK spin-glass model. J. Stat. Mech., 2010, P02023, (2010), arXiv:0912.2875. [t10/010] L. Albacete J. and C. Marquet. Single Inclusive Hadron Production at RHIC and the LHC from the Color Glass Condensate. Phys. Lett. B, 687, 174–179, (2010), arXiv:1001.1378. [t10/012] M.B. Green, J.G. Russo, and P. Vanhove. String theory dualities and supergravity divergences. JHEP, 1006, 075, (2010), arXiv:1002.3805. [t10/013] G. Korchemsky and E. Sokatchev. Superconformal invariants for scattering amplitudes in N=4 SYM theory. Nucl. Phys. B, 839, 377–419, (2010), arXiv:1002.4625. [t10/014] M. Rho. Cold Compressed Baryonic Matter with Hidden Local Symmetry and Holography. Int. J. Mod. Phys. A, 25, 5040–5054, (2010), arXiv:1002.2503. [t10/015] B. Efetov K., C. Pépin, and H. Meier. Describing systems of interacting fermions by boson models: exact mapping in arbitrary dimension and applications. Phys. Rev. B, 82, 235120, (2010), arXiv:1001.1552. [t10/017] W.G. Paeng and M. Rho. Toward an effective field theory for cold compressed baryonic matter. Mod. Phys. Lett. A, 25, 399–422, (2010), arXiv:1002.3022. [t10/018] B. Efetov K., C. Pépin, and H. Meier. Reply to the Comment by Galanakis et al on the paper "Exact bosonization for an interacting Fermi gas in arbitrary dimensions". Phys. Rev. Lett., 105, 159702, (2010), arXiv:1001.1626. [t10/019] K.-S. Kim and C. Pépin. The thermopower as a signature of quantum criticality in heavy fermions. Phys. Rev. B, 81, 205108, (2010), arXiv:1002.2612. [t10/020] J. Bouttier and E. Guitter. Distance statistics in quadrangulations with no multiple edges and the geometry of minbus. J. Phys. A, 43, 205207, (2010), arXiv:1002.2552. [t10/021] J. Dubail, J.L. Jacobsen, and H. Saleur. Conformal field theory at central charge c=0: a measure of the indecomposability (b) parameters. Nucl. Phys. B, 834, 399–422, (2010), arXiv:1001.1151. [t10/022] D. Andriot, E. Goi, R. Minasian, and M. Petrini. Supersymmetry breaking branes on solvmanifolds and de Sitter vacua in string theory. JHEP, 1105, 028, (2011), arXiv:1003.3774. [t10/023] N.E.J. Bjerrum-Bohr and P. Vanhove. Monodromy and Kawai-Lewellen-Tye Relations for Gravity Amplitudes. In Proceedings of the Twelfth Marcel Grossmann Meeting on General Relativity, 2332–2337. World Scientific, (2011), arXiv:1003.2396. 12th Marcel Grossmann Meeting, Paris. [t10/024] E. Guitter. Distance statistics in large toroidal maps. J. Stat. Mech., 2010, P04018, (2010), arXiv:1003.0372. [t10/025] M. Cirelli, G. Corcella, A. Hektor, G. Hütsi, M. Kadastik, P. Panci, M. Raidal, F. Sala, and A. Strumia. PPPC4DMID: the Poor Particle Physicist Cookbook for Dark Matter indirect detection. JCAP, 1103, 051, (2010), arXiv:1012.4515.

[t10/026] B. Vicedo. The classical R-matrix of Z4-graded supercoset sigma-models. Lett. Math. Phys., 95, 249–274, (2011). [t10/028] C. Marquet and H. Weigert. New observables to test the Color Glass Condensate beyond the large-Nc limit. Nucl. Phys. A, 843, 68–97, (2010), arXiv:1003.0813. [t10/029] B. Eynard, A. Kashani-Poor, and O. Marchal. A matrix model for the topological string I: Deriving the matrix model. (2010), arXiv:1003.1737. Appendices 101

[t10/030] N.E.J. Bjerrum-Bohr, P.H. Damgaard, T. Sondergaard, and P. Vanhove. Monodromy and Jacobi-like Relations for Color-Ordered Amplitudes. JHEP, 1006, 003, (2010), arXiv:1003.2403. [t10/031] R. Contino, C. Grojean, M. Moretti, F. Piccinini, and R. Rattazzi. Strong Double Higgs Production at the LHC. JHEP, 1010, 5, (2010), arXiv:1002.1011. [t10/032] C. Pitrou, J.-P. Uzan, and F. Bernardeau. The cosmic microwave background bispectrum from the non-linear evolution of the cosmological perturbations. JCAP, 1007, 003, (2010), arXiv:1003.0481. [t10/033] M. Giordano and R. Peschanski. High Energy Bounds on Soft N=4 SYM Amplitudes from AdS/CFT. JHEP, 1005, 037, (2010), arXiv:1003.2309. [t10/034] J. Zinn-Justin. Summation of divergent series: Order-dependent mapping. Appl. Numer. Math, 60, 1454–1464, (2010), arXiv:1001.0675. [t10/035] U.D. Jentschura, A. Surzhykov, and J. Zinn-Justin. Multi-Instantons and Exact Results III: Unified Description of the Resonances of Even and Odd Anharmonic Oscillators. Ann. Phys., 325, 1135–1172, (2010), arXiv:1001.3910. [t10/036] U.D. Jentschura and J. Zinn-Justin. Calculation of the Characteristic Functions of Anharmonic Oscil- lators. Appl. Numer. Math, 60, 1332–1341, (2010), arXiv:1001.4313. [t10/038] F. Bernardeau. Gravity and non-gravity mediated couplings in multiple-field inflation. Class. Quantum Grav., 27, 124004, (2010), arXiv:1003.2869. [t10/039] M.B. Green, S.D. Miller, J.G. Russo, and P. Vanhove. Eisenstein series for higher-rank groups and string theory amplitudes. Commun. Numb. Theor. Phys., 4, 551–596, (2010), arXiv:1004.0163. [t10/040] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, and D. Maitre. Next-to-Leading Order QCD Predictions for Z, gamma∗ + 3-Jet Distributions at the Tevatron. Phys. Rev. D, 82, 074002, (2010), arXiv:1004.1659. [t10/041] R. Balian. Mon itinéraire quantique. Belin, (2010). [t10/042] D. Serban. Integrability and the AdS/CFT correspondence. J. Phys. A, 44, 124001, (2010), arXiv:1003.4214. [t10/043] C. Monthus and T. Garel. Many-body localization transition in a lattice model of interacting fermions: statistics of renormalized hoppings in configuration space. Phys. Rev. B, 81, 134202, (2010), arXiv:1001.2984. [t10/044] Z. Bern, J.J.M. Carrasco, and H. Johansson. Perturbative Quantum Gravity as a Double Copy of Gauge Theory. Phys. Rev. Lett., 105, 061602, (2010), arXiv:1004.0476. [t10/045] P. Vanhove. The critical ultraviolet behaviour of N=8 supergravity amplitudes. (2010), arXiv:1004.1392. [t10/046] J.-H. Zhang. On the two-loop hexagon Wilson loop remainder function in N=4 SYM. Phys. Lett. B, 697, 370–377, (2011), arXiv:1004.1606. [t10/048] S. Nonnenmacher. Quantum transfer operators and quantum scattering. Séminaire X-EDP, Exposé no 7, CMAT, Ecole Polytechnique, 2009-12-15/2009-12-15, (2010), arXiv:1001.4073. [t10/049] M. Barthélémy, C. Godrèche, and J.M. Luck. Fluctuation effects in metapopulation models: percolation and pandemic threshold. J. Theor. Biol., 267, 554–564, (2010), arXiv:1004.1553. [t10/051] Z. Burda, J. Duda, J.M. Luck, and B. Waclaw. The various facets of random walk entropy. Acta Phys. Pol. B, 41, 949–987, (2010), arXiv:1004.3667. [t10/052] M. Cirelli. Recent Developments in Theory and Phenomenology of Dark Matter. volume C033 of Nuovo Cimento, 35–42, (2010). Les Rencontres de Physique de la Vallée d’Aoste, La Thuile, Italie, 2010- 02-28/2010-03-06. [t10/055] S. Nonnenmacher, J. Sjöstrand, and M. Zworski. From open quantum systems to open quantum maps. Commun. Math. Phys., 304, 1–48, (2010), arXiv:1004.3361. [t10/056] C. Hagendorf, D. Bernard, and M. Bauer. The Gaussian free field and SLE(4) on doubly connected domains. J. Stat. Phys., 140, 1–26, (2010), arXiv:1001.4501. [t10/057] B.R. Barret and B.G. Giraud. Spin density matrices for nuclear density functionals with parity violations. (2010), arXiv:1004.4542. [t10/058] K. Kong, K. Matchev, and G. Servant. Extra Dimensions at the LHC. Cambridge ; New York : Cambridge University Press, (2010), arXiv:1001.4801. [t10/059] M. Luzum and J.-Y. Ollitrault. Constraining the viscous freeze out distribution function with RHIC data. Phys. Rev. C, 82, 014906, (2010), arXiv:1004.2023. [t10/060] M. Luzum, C. Gombeaud, and J.-Y. Ollitrault. v4 in ideal and viscous hydrodynamics for RHIC and LHC. Phys. Rev. C, 81, 054910, (2010), arXiv:1004.2024. 102 Activity Report CEA/DSM/IPhT 2008 — 2013

[t10/062] M. Cirelli and J.M. Cline. Can multistate dark matter annihilation explain the high-energy cosmic ray lepton anomalies? Phys. Rev. D, 82, 023503, (2010), arXiv:1005.1779. [t10/063] L. Krapivsky P. and K. Mallick. Fluctuations in polymer translocation. J. Stat. Mech., 2010, P07007, (2010). [t10/064] K. Mallick. COURS ALEA 2010: Processus d’Exclusion Asymetrique. ALEA, CIRM (Luminy), (2010). [t10/065] C.F. Berger, D.A. Kosower, and al.+ et. Vector Boson + Jets with BlackHat and Sherpa. volume 205-206 of Nucl. Phys. B (Proc. Suppl.), 92–97, (2010), arXiv:1005.3728. [t10/066] F. Gelis, E. Iancu, J. Jalilian Marian, and R. Venugopalan. The Color Glass Condensate. Annu. Rev. Nucl. Part. Sci., 60, 463–489, (2010), arXiv:1002.0333. [t10/067] K. Dusling, F. Gelis, T. Lappi, and R. Venugopalan. Long range two-particle rapidity correlations in A+A collisions from high energy QCD evolution. Nucl. Phys. A, 836, 159–182, (2010), arXiv:0911.2720. [t10/068] H.K. Lee, B.Y. Park, and M. Rho. Half-Skyrmions, Tensor Forces and Symmetry Energy in Cold Dense Matter. Phys. Rev. C, 83, 025206, (2010), arXiv:1005.0255. [t10/069] C. Monthus and T. Garel. Random cascade models of multifractality : real-space renormalization and travelling-waves. J. Stat. Mech., P06014, (2010), arXiv:1004.1537. [t10/070] R. Balian. Naissance de la Mécanique Quantique. (2010). [t10/071] C. Bonvin and C. Caprini. CMB temperature anisotropy at large scales induced by a causal primordial magnetic field. JCAP, 1005, 022, (2010), arXiv:1004.1405. [t10/072] C. Caprini. Gravitational waves from cosmological phase transitions. 45th Moriond cosmology conference 2010, La Thuile (Italie), (2010), arXiv:1005.5291. [t10/073] L. Albacete J. and C. Marquet. Azimuthal correlations of forward di-hadrons in d+Au collisions at RHIC in the Color Glass Condensate. Phys. Rev. Lett., 105, 162301, (2010), arXiv:1005.4065. [t10/074] A. Alexandrov. Matrix Models for Random Partitions. Nucl. Phys. B, 851, 620–650, (2011), arXiv:1005.5715. [t10/075] Z. Bern, J.J.M. Carrasco, L.J. Dixon, H. Johansson, and R. Roiban. Complete Four-Loop Four-Point Amplitude in N=4 Super-Yang-Mills Theory. Phys. Rev. D, 82, 125040, (2010), arXiv:1008.3327. [t10/078] C. Godrèche and J.M. Luck. On leaders and condensates in a growing network. J. Stat. Mech., P07031, (2010), arXiv:1006.0587. [t10/079] C. Normand. Influence of a multiplicative noise on the threshold of helical dynamo. Geophys. Astrophys. Fluid Dyn., 105, 90–108, (2011). [t10/080] C. Monthus and T. Garel. Anderson localization of phonons in dimension d=1,2,3 : finite-size properties of the Inverse Participation Ratios of eigenstates. Phys. Rev. B, 81, 224208, (2010), arXiv:1003.5988. [t10/081] I. Bena, N. Bobev, S. Giusto, C. Ruef, and N.P. Warner. An Infinite-Dimensional Family of Black-Hole Microstate Geometries. JHEP, 1103, 022, (2011), arXiv:1006.3497. [t10/082] J.M. Luck and A. Mehta. The effects of grain shape and frustration in a granular column near jamming. Eur. Phys. J. B, 77, 505–521, (2010), arXiv:1006.3397. [t10/083] C. Ruef. Black holes in string theory: towards an understanding of quantum gravity. PhD thesis, (2010). Université Paris-Sud 11, 2010-06-18. [t10/084] Y. Abe, C. Shen, D. Boilley, G. Kosenko, and B.G. Giraud. Mechanism of Fusion Hindrance and Predictions of SHE Production. volume 834 of Nucl. Phys. A, 349c–352c, (2010). The 10th International Conference on Nucleus-Nucleus Collisions (NN2009). [t10/085] A. Voros. Zeta-regularization and exact WKB method for a general 1D Schrödinger equation. Cosmology, the Quantum Vacuum and Zeta Functions, UAB, Bellaterra, Espagne, 2010-03-08/2010-03-10, (2010). [t10/086] Z. Bern, J.J.M. Carrasco, and H. Johansson. The Structure of Multiloop Amplitudes in Gauge and Gravity Theories. volume 205-206 of Nucl. Phys. B (Proc. Suppl.), 54–60, (2010), arXiv:1007.4297. Loops & Legs in Quantum Field Theory – Proceedings of the 10th DESY Workshop on Elementary Particle Theory, Woerlitz (RFA). [t10/088] Y. Abe, C. Shen, D. Boilley, and B.G. Giraud. Compound Nucleus Reaction Theory for Synthesis of Super-Heavy Elements. volume 2 of EPJ Web of Conferences, 10002, (2010). CNR*09 - Second International Workshop on Compound Nuclear Reactions and Related Topics. [t10/089] J. Gluza, K. Kajda, and D.A. Kosower. Towards a Basis for Planar Two-Loop Integrals. Phys. Rev. D, 83, 045012, (2011), arXiv:1009.0472. [t10/090] F. Bernardeau, M. Crocce, and E. Sefusatti. Multi-Point Propagators for Non-Gaussian Initial Condi- tions. Phys. Rev. D, 82, 083507, (2010), arXiv:1006.4656. Appendices 103

[t10/091] F. Alday, B. Eden, G. Korchemsky, E. Sokatchev, and J Maldacena. From correlation functions to Wilson loops. JHEP, 1109, 123, (2011), arXiv:1007.3243. [t10/092] B. Eden, G. Korchemsky, and E. Sokatchev. From correlation functions to scattering amplitudes. JHEP, 1112, 002, (2011), arXiv:1007.3246. [t10/093] G. Aldazabal, E. Andres, P. Camara, and M. Graña. U-dual fluxes and Generalized Geometry. JHEP, 1011, 083, (2010), arXiv:1007.5509. [t10/094] A. Kaminska and S. Lavignac. Higgs as a pseudo-Goldstone boson, the mu problem and gauge-mediated supersymmetry breaking. Eur. Phys. J. C, 71, 1811–1824, (2011), arXiv:1007.2649. [t10/095] B.H Alver, C. Gombeaud, M. Luzum, and J.-Y. Ollitrault. Triangular flow in hydrodynamics and transport theory. Phys. Rev. C, 82, 034913, (2010), arXiv:1007.5469. [t10/096] D.A. Kosower, R. Roiban, and C. Vergu. The Six-Point NMHV Amplitude in Maximally Supersymmetric Yang-Mills Theory. Phys. Rev. D, D83, 065018, (2011), arXiv:1009.1376. [t10/097] E. Dudas, S. Lavignac, and J. Parmentier. Non-standard Susy spectra in gauge mediation. in: Proceed- ings of the XLVth Rencontres de Moriond on ElectroWeak Interactions and Unified Theories, La Thuile, Aosta Valley, Italy, 2010-03-06/2010-03-13, (2010). [t10/098] M. Cirelli. Hoping to indirectly detect Dark Matter with cosmic rays. volume 1304 of AIP Conf. Proc., 152, (2010). Carpathian Summer School of Physics 2010, Sinaia, Romania, 2010-06-20/2010-07-03. [t10/099] B. Eynard, A. Kashani-Poor, and O. Marchal. A matrix model for the topological string II: The spectral curve and mirror geometry. Ann. Henri Poincaré, 14, 119–158, (2010), arXiv:1007.2194. [t10/100] A. Ayyer and V. Strehl. The spectrum of an asymmetric annihilation process. DMTCS Proceedings, (2010), arXiv:1008.2134. 22nd International Conference on Formal Power Series and Algebraic Combina- torics (FPSAC 2010). [t10/101] J.-Y. Ollitrault. Phenomenology of the little bang. volume 312 of J. Phys.: Conf. Ser., 012002, (2011), arXiv:1008.3323. International Nuclear Physics Conference (INPC 2010), Vancouver, Canada, 2010-07- 04/2010-07-09. [t10/102] C. Monthus and T. Garel. Random walk in a two-dimensional self-affine random potential : properties of the anomalous diffusion phase at small external force. Phys. Rev. E, 82, 021125, (2010), arXiv:1003.1627. [t10/105] P. Brax, C. van de Bruck, A.C. Davis, and D. Shaw. Modifying Gravity at Low Redshift. JCAP, 1004, 032, (2010), arXiv:0912.0462. [t10/106] S. Prolhac. Tree structures for the current fluctuations in the exclusion process. J. Phys. A, 43, 105002, (2010), arXiv:0911.3618. [t10/109] G. Biroli, L.F. Gugliandolo, and A. Sicilia. Kibble-Zurek mechanism and infinitely slow annealing through critical points. Phys. Rev. E, 81, 050101, (2010), arXiv:1001.0693. [t10/110] F. Sausset, G. Biroli, and J. Kurchan. Do solids flow? J. Stat. Phys., 140, 718–721, (2010), arXiv:1001.0918. [t10/111] C.F. Berger, Z. Bern, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, and D. Maitre. Precise Predictions for W + 4 Jet Production at the Large Hadron Collider. Phys. Rev. Lett., 106, 092001, (2011), arXiv:1009.2338. [t10/112] N. Anantharaman and S. Nonnenmacher. Chaotic vibrations and strong scars. EMS Newsletter, 74, 19–24, (2010), arXiv:1001.3458. [t10/113] C. Roth, S.M. Kang, M. Batty, and M. Barthélémy. Structure of urban movements: polycentric activity and entangled hierarchical flows. PLoS One, 6, e15923, (2011), arXiv:1001.4915. [t10/114] F. Bernardeau. Mode coupling evolution in arbitrary inflationary backgrounds. JCAP, 1102, 017, (2010), arXiv:1003.3575. [t10/115] C. Kollath, G. Roux, G. Biroli, and A. Läuchli. Statistical properties of the spectrum the extended Bose-Hubbard model. J. Stat. Mech., P08011, (2010), arXiv:1004.2203. [t10/116] A. Branschadel, E. Boulat, H. Saleur, and P. Schmitteckert. Shot noise in the self-dual Interacting Resonant Level Model. Phys. Rev. Lett., 105, 146805, (2010), arXiv:1004.4811. [t10/117] J.M. Stéphan, G. Misguich, and V. Pasquier. Rényi entropy of a line in two-dimensional Ising models. Phys. Rev. B, 82, 125455, (2010), arXiv:1006.1605. [t10/119] P. Di Francesco and R. Kedem. Noncommutative integrability, paths and quasi-determinants. Adv. Math., 228, 97–152, (2011), arXiv:1006.4774. [t10/120] C. Caprini, R. Durrer, and X. Siemens. Detection of gravitational waves from the QCD phase transition with pulsar timing arrays. Phys. Rev. D, 82, 063511, (2010), arXiv:1007.1218. 104 Activity Report CEA/DSM/IPhT 2008 — 2013

[t10/121] C. Cammarota, G. Biroli, M. Tarzia, and G. Tarjus. Renormalization Group Analysis of the Random First-Order Transition. Phys. Rev. Lett., 106, 115705, (2011), arXiv:1007.2509v1. [t10/122] E. Gull, M. Ferrero, O. Parcollet, A. Georges, and A.J. Millis. Momentum space anisotropy and pseu- dogaps: a comparative cluster dynamical mean field analysis of the doping-driven metal-insulator transition in the two dimensional Hubbard model. Phys. Rev. B, 82, 155101, (2010), arXiv:1007.2592. [t10/123] B. Sciolla and G. Biroli. Quantum Quenches and Off-Equilibrium Dynamical Transition in the Infinite- Dimensional Bose-Hubbard Model. Phys. Rev. Lett., 105, 220401, (2010), arXiv:1007.5238v2. [t10/124] S. a Beccara, P. Faccioli, G. Garberoglio, M. Sega, F. Pederiva, and H. Orland. Dominant folding pathways of a peptide chain, from ab-initio quantum-mechanical simulations. J. Chem. Phys., 134, 024501, (2011), arXiv:1007.5235. [t10/125] I.K. Kostov and N. Orantin. CFT and topological recursion. JHEP, 1011, 056, (2010), arXiv:1006.2028. [t10/126] S. Nonnenmacher. Anatomy of quantum chaotic eigenstates. Séminaire Poincaré "Le Chaos", Institut Henri Poincaré, 2010-06-05/2010-06-05, (2013), arXiv:1005.5598. [t10/127] J.D. Pillet, C. Quay, P. Morfin, C. Bena, A. Levy Yeyati, and P. Joyez. Revealing the electronic structure of a carbon nanotube carrying a supercurrent. Nature Phys., 6, 965, (2010), arXiv:1005.0443. [t10/130] J. Manschot. Wall-crossing of D4-branes using flow trees. Adv. Theor. Math. Phys., 15, 1–42, (2011), arXiv:1003.1570. [t10/132] I. Bena, G. Giecold, M. Graña, N. Halmagyi, and F. Orsi. Supersymmetric Consistent Truncations of IIB on T(1,1). JHEP, 1011, 083, (2010), arXiv:1008.0983. [t10/133] A. Ayyer, J.L. Lebowitz, and E.R. Speer. On Some Classes of Open Two-Species Exclusion Processes. Markov Proces. Relat. Fields, 18, 157–176, (2012), arXiv:1008.4721. [t10/134] F. David. A general and solvable random matrix model for spin decoherence. J. Stat. Mech., 2011, P01001, (2011), arXiv:1009.1282. [t10/135] J. Bouttier and E. Guitter. Planar maps and continued fractions. Commun. Math. Phys., 309, 623–662, (2012), arXiv:1007.0419. [t10/136] C. Monthus and T. Garel. Anderson localization transition with long-ranged hoppings : analysis of the strong multifractality regime in terms of weighted Levy sums. J. Stat. Mech., 2010, P09015, (2010), arXiv:1006.1510. [t10/137] G. Borot, B. Eynard, S.N. Majumdar, and C. Nadal. Large deviations of the maximal eigenvalue of random matrices. J. Stat. Mech., 2011, P11024, (2011), arXiv:1009.1945. [t10/138] K. Bringmann and J. Manschot. From sheaves on P2 to a generalization of the Rademacher expansion. (2010), arXiv:1006.0915. [t10/139] B. Eden, G. Korchemsky, and E. Sokatchev. More on the duality correlators/amplitudes. Phys. Lett. B, 709, 247–253, (2010), arXiv:1009.2488. [t10/140] M. Liguori, E. Sefusatti, R. Fergusson, J., and E.P.S. Shellard. Primordial non-Gaussianity and Bis- pectrum Measurements in the Cosmic Microwave Background and Large-Scale Structure. Advances in Astronomy, 2010, 980523, (2010), arXiv:1001.4707. [t10/141] E. Sefusatti, M. Crocce, and V. Desjacques. The Matter Bispectrum in N-body Simulations with non-Gaussian Initial Conditions. Mon. Not. R. Astron. Soc., 406, 1014–1028, (2010), arXiv:1003.0007. [t10/142] J. Bros, E. De Micheli, and G.A. Viano. Nonlocal potentials and complex angular momentum theory. Ann. Henri Poincaré, 11, 659–764, (2010), arXiv:0912.2902. [t10/144] L. Messio. Etats fondamentaux et excitations de systèmes magnétiques frustrés, du classique au quantique. PhD thesis, (2010). LPTMC, Université P. et M. Curie, Paris, 2010-09-14. [t10/145] N.E.J. Bjerrum-Bohr, P.H. Damgaard, T. Sondergaard, and P. Vanhove. The Momentum Kernel of Gauge and Gravity Theories. JHEP, 1101, 001, (2010), arXiv:1010.3933. [t10/146] A. Alexandrov. Cut-and-Join operator representation for Kontsewich-Witten tau-function. Mod. Phys. Lett. A, 29, 2193–2199, (2011), arXiv:1009.4887. [t10/148] K. Dusling, T. Epelbaum, F. Gelis, and R. Venugopalan. Role of quantum fluctuations in a system with strong fields: Onset of hydrodynamical flow. Nucl. Phys. A, 850, 69–109, (2010), arXiv:1009.4363. [t10/149] A. Dumitru, K. Dusling, F. Gelis, J. Jalilian Marian, T. Lappi, and R. Venugopalan. The ridge in proton-proton collisions at the LHC. Phys. Lett. B, 697, 21–25, (2010), arXiv:1009.5295. [t10/150] F. Gelis. Color Glass Condensate and Glasma. Nucl. Phys. A, 854, 10–17, (2011), arXiv:1009.0093. [t10/151] E. Avsar, C. Flensburg, Y. Hatta, J.-Y. Ollitrault, and T. Ueda. Eccentricity and elliptic flow in proton-proton collisions from parton evolution. Phys. Lett. B, 702, 394–397, (2011), arXiv:1009.5643. Appendices 105

[t10/152] E. Meggiolaro and M. Giordano. High-energy hadron-hadron (dipole-dipole) scattering on the lattice. Prog. Theor. Phys. Suppl., 187, 200–209, (2011), arXiv:1010.0914. [t10/153] M. Giordano. High-energy bounds on total cross sections in N=4 SYM from AdS/CFT. "Low x 2010" workshop, Kavala (Greece), June 23-27 2010, (2010), arXiv:1009.2971. [t10/154] L. Chekhov, B. Eynard, and O. Marchal. Topological expansion of beta-ensemble model and quantum algebraic geometry in the sectorwise approach. Theor. Math. Phys., 166, 141–185, (2011), arXiv:1009.6007. [t10/157] A. Billoire. Distribution of time scales in the Sherrington-Kirkpatrick model. J. Stat. Mech., 2010, P11034, (2010), arXiv:arXiv:1003.6086v3. [t10/158] A. Billoire, I. Kondor, J Lukic, and E. Marinari. Large random correlations in individual mean field spin glass sample. J. Stat. Mech., 2011, P02009, (2011), arXiv:arXiv:1010.3237v2. [t10/159] M. Beccaria, M. Kreuzer, and A. Puhm. Counting charged massless states in the (0, 2) heterotic CFT/geometry connection. JHEP, 1101, 077, (2011), arXiv:1010.4564. [t10/160] I Melnikov and R. Minasian. Heterotic sigma-models with N=2 space-time supersymmetry. JHEP, 1109, 065, (2011), arXiv:arXiv:1010.5365. [t10/161] J.T. Liu and R. Minasian. Computing 1/N 2 corrections in AdS/CFT. (2010), arXiv:arXiv:1010.6074. [t10/164] M. Harada and M. Rho. Holographic Vector Dominance for the Nucleon. (2010), arXiv:1010.1971. [t10/165] M. Rho. Subtle is the manifestation of chiral symmetry in nuclei and dense nuclear matter. In From Nuclei to Stars: Festschrift in Honor of Gerald E Brown, 379–410. World Scientific, (2011), arXiv:1011.0135. Gerry Brown Festschrift. [t10/166] G. Borot and B. Eynard. Tracy-Widom GUE law and symplectic invariants. (2010), arXiv:1011.1418. [t10/167] M. Cirelli. Dark Matter, Cosmic Rays and Neutrinos: status circa 2010. volume 217 of Nucl. Phys. B (Proc. Suppl.), 237, (2010). Neutrino Oscillation Workshop NOW 2010, Conca Specchiulla, Otranto, Italie, 2010-09-04/2010-09-11. [t10/168] J.-E. Bourgine. Modèles de matrices et problèmes de bord dans la gravité de Liouville. PhD thesis, (2010). Bourgine Jean-Emile, Université d’Orsay - Paris Sud XI - IPhT, 2010-06-18. [t10/169] I. Bena, G. Giecold, and N. Halmagyi. The Backreaction of Anti-M2 Branes on a Warped Stenzel Space. JHEP, 1104, 120, (2011), arXiv:1011.2195. [t10/170] P. Valageas. Impact of shell crossing and scope of perturbative approaches in real and redshift space. Astron. Astrophys., 526, A67, (2011), arXiv:1009.0106. [t10/171] P. Valageas and Takahiro Nishimichi. Combining perturbation theories with halo models. Astron. Astrophys., 527, A87, (2011), arXiv:1009.0597. [t10/172] P. Valageas. Large-scale bias of dark matter halos. Astron. Astrophys., 525, A98, (2011), arXiv:1009.1131. [t10/173] P. Valageas and F. Bernardeau. Density fields and halo mass functions in the Geometrical Adhesion toy Model. Phys. Rev. D, 83, 043508, (2011), arXiv:1009.1974. [t10/174] I. Bena, G. Giecold, M. Graña, and N. Halmagyi. On The Inflaton Potential From Antibranes in Warped Throats. JHEP, 1207, 140, (2012), arXiv:1011.2626. [t10/175] E. Dudas, S. Lavignac, and J. Parmentier. On messengers and metastability in gauge mediation. Phys. Lett. B, 698, 162–170, (2011), arXiv:1011.4001. [t10/176] T. Konstandin and M. No J. Hydrodynamic Obstructions in Bubble Expansions. JCAP, 1102, 008, (2011), arXiv:1011.3735. [t10/177] W. Staessens and B. Vercnocke. Lectures on Scattering Amplitudes in String Theory. 5th Modave School on Mathematical Physics, (2010), arXiv:1011.0456. [t10/179] A. Billoire. What makes slow samples slow in the Sherrington-Kirkpatrick model. J. Phys. A, 44, 075001, (2011), arXiv:1011.3420. [t10/180] K. Kubodera and M. Rho. Effective Field Theory and High-Precision Calculations of Nuclear Electroweak Processes. In From Nuclei to Stars: Festschrift in Honor of Gerald E Brown, 223–252. World Scientific, (2011), arXiv:1011.4919. Gerry Brown Festschrift. [t10/182] M. Luzum. Elliptic flow at energies available at the CERN Large Hadron Collider: Comparing heavy-ion data to viscous hydrodynamic predictions. Phys. Rev. C, 83, 044911, (2011), arXiv:1011.5173. [t10/183] M. Luzum. v4 for identified particles at RHIC from viscous hydrodynamics. volume 270 of J. Phys.: Conf. Ser., 012044, (2010), arXiv:1009.6056. Hot Quarks 2010, La Londe Les Maures, 2010-06-21/2010-06- 26. [t10/184] M. Luzum. Collective flow and long-range correlations in relativistic heavy ion collisions. Phys. Lett. B, 696, 499–504, (2011), arXiv:1011.5773. 106 Activity Report CEA/DSM/IPhT 2008 — 2013

[t10/185] M. Luzum and J.-Y. Ollitrault. Directed flow at midrapidity in heavy-ion collisions. Phys. Rev. Lett., 106, 102301, (2011), arXiv:1011.6361. [t10/186] D. Jakobson, Nonnenmacher S., and I. Polterovich, editors. Spectrum and Dynamics. AMS, (2010). [t10/187] G. Borot and B. Eynard. The asymptotic expansion of Tracy-Widom GUE law and symplectic invariants. (2010), arXiv:1012.2752. [t10/188] P. Moussa. Localisation of algebraic integers and polynomial iteration. In Kolyada S., Manin Y., Möller M., Moree P., and Ward T., editors, Dynamical Numbers, 83–96. AMS, (2010). Dynamical Numbers, MPI for Mathematics, Bonn. [t10/190] R. Balian. Préface du livre "Question sur... le nucléaire". (2010). [t10/191] L. Krapivsky P. and K. Mallick. Diffusion and Multiplication in Random Media. J. Stat. Mech., 2011, P01015, (2011), arXiv:1011.6276. [t10/192] J. Olejarz, L. Krapivsky P., and S. Redner. Zero-Temperature Freezing in Three-Dimensional Kinetic Ising Model. Phys. Rev. E, 83, 030104(R), (2011), arXiv:1011.2903. [t10/193] L. D’Alessio and L. Krapivsky P. A Light impurity in an Equilibrium Gas. Phys. Rev. E, 83, 011107, (2011), arXiv:1009.3814. [t10/194] L. Krapivsky P. and S. Redner. First Passage in Infinite Paraboloidal Domains. J. Stat. Mech., P11028, (2010), arXiv:1009.2530. [t10/195] F. Bernardeau, C. Pitrou, and J.-P. Uzan. CMB spectra and bispectra calculations: making the flat-sky approximation rigorous. JCAP, 1102, 015, (2011), arXiv:1012.2652. [t10/196] W.T. Giele, D.A. Kosower, and Z. Skands P. Higher-Order Corrections to Timelike Jets. Phys. Rev. D, 849, 054003, (2011), arXiv:1102.2126. [t10/197] L. Albacete J., N. Armesto, J.G. Milhano, P. Quiroga Arias, and A. Salgado C. AAMQS: A non-linear QCD analysis of new HERA data at small-x including heavy quarks. Eur. Phys. J. C, 71, 1705, (2011), arXiv:1012.4408 [hep-ph]. [t10/198] J. Dubail. Conditions aux bords dans des théories conformes non unitaires. PhD thesis, (2010). Jérôme Dubail, Université Paris 11-Orsay, 2010-07-09. [t10/199] C. Gombeaud. Thermalisation dans les collisions d’ions lourds ultrarelativistes. PhD thesis, (2010). Gombeaud Clément, UNIVERSITÉ PARIS 6 - PIERRE ET MARIE CURIE - IPhT, 2010-07-02. [t10/200] O. Marchal. Aspects géométriques et intégrables des modèles de matrices aléatoires. PhD thesis, (2010). Marchal Olivier, Université de Montréal Faculté des études supérieures - Université Paris Diderot - IPhT, 2010-12-20. [t10/202] R. Balian. Le paradoxe de l’irréversibilité. Pour la Science, 397, 56–62, (2010). [t10/203] P. Valageas. Formation des structures de grande échelle en Cosmologie: dynamique gravitationnelle. Formation des structures de grande échelle en Cosmologie: dynamique gravitationnelle, IPhT, Saclay, (2010). [t10/205] P. Brax, J.F. Dufaux, and S. Mariadassou. Preheating after Small-Field Inflation. Phys. Rev. D, 83, 103510, (2011), arXiv:1012.4656. [t10/206] P. Brax and C. Burrage. Atomic Precision Tests and Light Scalar Couplings. Phys. Rev. D, 83, 035020, (2011), arXiv:1010.5108. [t10/207] P. Brax, C. Burrage, A.C. Davis, D. Seery, and A. Weltman. Anomalous coupling of scalars to gauge fields. Phys. Lett. B, 699, 5–9, (2011), arXiv:1010.4536. [t10/209] P. Brax and C. Burrage. Chameleon Induced Atomic Afterglow. Phys. Rev. D, 82, 095014, (2010), arXiv:1009.1065. [t10/210] P. Brax and R. Peschanski. Gauge/Cosmology Brane-to-Brane Duality. Acta Phys. Pol. B, 41, 2645– 2667, (2010), arXiv:1006.3054. [t10/211] P. Brax, C. van de Bruck, D.F. Mota, J. Nunes N., and A. Winther. Chameleons with Field Dependent Couplings. Phys. Rev. D, 82, 083503, (2010), arXiv:1006.2796. [t10/212] P. Brax, C. van de Bruck, A.C. Davis, and D. Shaw. The Dilaton and Modified Gravity. Phys. Rev. D, 82, 063519, (2010), arXiv:1005.3735. [t10/213] P. Brax, R. Rosenfeld, and D.A. Steer. Spherical Collapse in Chameleon Models. JCAP, 1008, 033, (2010), arXiv:1005.2051. [t10/214] P. Brax and K. Zioutas. Solar Chameleons. Phys. Rev. D, 82, 043007, (2010), arXiv:1004.1846. [t10/215] P. Brax, C. van de Bruck, A.C. Davis, D. Shaw, and D. Iannuzzi. Tuning the Mass of Chameleon Fields in Casimir Force Experiments. Phys. Rev. Lett., 104, 241101, (2010), arXiv:1003.1605. Appendices 107

[t10/216] P. Brax. Producing Chameleons in the Sun. 6th Patras Workshop on Axions, WIMPs and WISPs, PATRAS 2010, Zurich, July 2010, (2010). [t10/217] K. Mallick, M. Moshe, and H. Orland. A field-theoretic approach to nonequilibrium work identities. J. Phys. A, 44, 095002, (2011), arXiv:arXiv:1009.4800. [t10/218] K. Tsekouras, D. Lacoste, K. Mallick, and J.F. Joanny. Force generation by a parallel array of actin filaments. New J. Phys., 13, 103032, (2011), arXiv:1101.1180. [t10/219] K. Mallick. Some exact results for the exclusion process. J. Stat. Mech., 2011, P01024, (2011). [t10/220] Duplantier B. and Rivasseau V., editors. Séminaire Poincaré XIV, Le Chaos. Centre Poly-Média de l’Ecole polytechnique, (2010). Séminaire Poincaré, Institut Henri Poincaré, Paris, 2010-06-05. [t10/221] Duplantier B., editor. Séminaire Poincaré XV, Le Temps. Centre Poly-Média de l’Ecole polytechnique, (2010). Séminaire Poincaré, Institut Henri Poincaré, Paris, 2010-12-04/2010-12-18. [t10/222] Duplantier B. and Rivasseau V., editors. Poincaré Seminar 2009: Biological Physics, volume 60 of Prog. Math. Phys., (2011). [t10/223] B. Duplantier and S. Sheffield. Schramm-Loewner Evolution and Liouville Quantum Gravity. Phys. Rev. Lett., 107, 131305–1–131305–4, (2011), arXiv:1012.4800. [t10/224] Duplantier B., Halsey T.C., and Rivasseau V., editors. Poincaré Seminar 2009: Glasses and Grains, volume 61 of Prog. Math. Phys., (2011). [t10/225] J.M. Stéphan, G. Misguich, and F. Alet. Geometric entanglement and Affleck-Ludwig boundary entropies in critical XXZ and Ising chains. Phys. Rev. B, 82, 180406(R), (2011), arXiv:1007.4161. [t10/229] G. Zaharijas and A Abdo. Constraints on Cosmological Dark Matter Annihilation from the Fermi-LAT Isotropic Diffuse Gamma-Ray Measurement. JCAP, 1004, 014, (2010), arXiv:1002.4415. [t10/230] G. Zaharijas and M. Ackerman. Searches for Cosmic-Ray Electron Anisotropies with the Fermi Large Area Telescope. Phys. Rev. D, 82, 092003, (2010), arXiv:1008.5119.

[t10/231] P. Di Francesco. The solution of the Ar T-system for arbitrary boundary. Electr. J. Combin., 17, R89, (2010), arXiv:1002.4427. [t10/232] P. Di Francesco. Discrete integrable systems, positivity, and continued fraction rearrangements. Lett. Math. Phys., 96, 299–324, (2011), arXiv:1009.1911. [t10/234] S. Marmi, P. Moussa, and J.-C. Yoccoz. Linearization of Generalized Interval Exchange Maps. (2010), arXiv:1003.1191v2 [math.DS] 7 Mar 2010. [t10/236] J. Zinn-Justin and U.D. Jentschura. Order-dependent mappings: strong coupling behaviour from weak coupling expansions in non-Hermitian theories. J. Math. Phys., 51, 072106, (2010), arXiv:1006.4748. [t10/237] J. Bros, H. Epstein, and U. Moschella. Scalar tachyons in the de Sitter universe. Lett. Math. Phys., 93, 203–211, (2011), arXiv:1003.1396. [t10/238] J. Zinn-Justin and U.D. Jentschura. Imaginary cubic perturbation: numerical and analytic study. J. Phys. A, 43, 425301, (2010), arXiv:1006.5303. [t10/239] R. Peschanski and E.N. Saridakis. Exact (1+1)-dimensional flows of a perfect fluid. Nucl. Phys. A, 849, 147–164, (2011), arXiv:1006.1603. [t10/241] C. Royon and R. Peschanski. Studies of scaling properties in deep inelastic scattering. volume 2010 of PoS, 19–23, (2010), arXiv:1008.0261. XVIII International Workshop on Deep-Inelastic Scattering and Related Subjects, DIS 2010, Firenze, Italy. [t10/242] A. Bialas and R. Peschanski. Asymmetric 1+1-dimensional hydrodynamics in collision. Phys. Rev. C, 83, 054905, (2010), arXiv:1012.4687. [t10/243] E. Dudas, v. Gersdorff G., J. Parmentier, and S. Pokorski. Flavour in supersymmetry: horizontal symmetries or wave function renormalisation. JHEP, 1012, 015, (2010), arXiv:1007.5208. [t10/244] D. Langlois and F. Vernizzi. A geometrical approach to nonlinear perturbations in relativistic cosmology. Class. Quantum Grav., 27, 124007, (2010), arXiv:1003.3270. [t10/245] N. Halmagyi. Missing Mirrors: Type IIA Supergravity on the Resolved Conifold. (2011), arXiv:1003.2121. [t10/246] N. Bobev, N. Halmagyi, K. Pilch, and P. Warner. Supergravity Instabilities of Non-Supersymmetric Quantum Critical Points. Class. Quantum Grav., 27, 5013, (2011), arXiv:1006.2546. [t10/247] M. Guica and A. Strominger. Microscopic Realization of the Kerr/CFT Correspondence. JHEP, 1102, 010, (2011), arXiv:1009.5039. [t10/248] J. Raeymaekers, D.V.d. Bleeken, and B. Vercnocke. Chronology protection and the stringy exclusion principle. JHEP, 1104, 037, (2011), arXiv:1011.5693. 108 Activity Report CEA/DSM/IPhT 2008 — 2013

[t10/249] F. Vonau, P.B. Pillai, D. Aubel, M.M. De Souza, C. Bena, and L. Simon. Superlattice of resonators on monolayer graphene created by intercalated gold nanoclusters. Europhys. Lett., 91, 66004, (2011), arXiv:1006.5850. [t10/251] C. Bena and L. Simon. Dirac point metamorphosis from third-neighbor couplings in graphene and related materials. Phys. Rev. B, 83, 115404, (2011), arXiv:1007.3907. [t10/254] R. Britto and E. Mirabella. Single Cut Integration. JHEP, 1101, 135, (2011), arXiv:1011.2344. [t10/256] S.D. Badger and R. Britto. The SM and NLO multileg working group: Summary report. 6th Les Houches Workshop: Physics at TeV Colliders, Les Houches, (2010), arXiv:1003.1241. [t10/257] R. Britto. Loop amplitudes in gauge theories: modern analytic approaches. J. Phys. A, 44, 454006, (2011), arXiv:1012.4493. [t10/258] J. Bouttier. Enumeration of maps. Oxford University Press, (2011), arXiv:1104.3003. [t10/259] M. Ferrero, O. Parcollet, A. Georges, G. Kotliar, and Basov D. Interplane charge dynamics in a valence-bond dynamical mean-field theory of cuprate superconductors. Phys. Rev. B, 82, 054502, (2010), arXiv:1001.5051. [t10/260] Z. Bertalan, H. Nishimori, and H. Orland. Accelerated stochastic sampling of discrete statistical systems. Phys. Rev. E, 82, 056704, (2010). [t10/261] M. Bon and H. Orland. Prediction of RNA secondary structures with pseudoknots. Physica A, 389, 2987–2992, (2010). [t10/262] X. Man, D. Andelman, and H. Orland. Block Copolymer at Nano-Patterned Surfaces. Macromolecules, 43, 7261–7268, (2010), arXiv:1011.2578. [t10/263] R. Potestio, C. Micheletti, and H. Orland. Knotted vs. Unknotted Proteins: Evidence of Knot-Promoting Loops. PLoS Comput Biol, 6, e1000864, (2010). [t10/264] G. Mazzola, S. a Beccara, P. Faccioli, and H. Orland. Fluctuations in the Ensemble of Reaction Pathways. J. Chem. Phys., 134, 164109, (2011), arXiv:1012.3424. [t10/265] J. Dubail and J.M. Stéphan. Universal behavior of a bipartite fidelity at quantum criticality. J. Stat. Mech., 2011, L03002, (2011), arXiv:1010.3716. [t10/268] L. Berthier, G. Biroli, J.-P. Bouchaud, and R.L. Jack. Overview of different characterisations of dynamic heterogeneity. Oxford University Press, (2011), arXiv:1009.4765v2. [t10/269] C. Aron, G. Biroli, and L.F. Cugliandolo. Symmetries of generating functionals of Langevin processes with colored multiplicative noise. J. Stat. Mech., 2010, P11018, (2010), arXiv:1007.5059v2. [t10/270] C. Aron, G. Biroli, and L.F. Cugliandolo. Coarsening of disordered quantum rotors under a bias voltage. Phys. Rev. B, 82, 174203, (2010), arXiv:1005.2414v2. [t10/271] G. Biroli, G. Semerjian, and M. Tarzia. Anderson Model on Bethe Lattices: Density of States, Local- ization Properties and Isolated Eigenvalue. volume 184 of Prog. Theor. Phys. (Suppl. ), 187–199, (2010), arXiv:1005.0342v2. 17th Yukawa International Seminar 2009 (YKIS2009) “Frontiers in Nonequilibrium Physics – Fundamental Theory, Glassy & Granular Materials, and Computational Physics”, Yukawa Insti- tute for Theoretical Physics (YITP), Kyoto University, Kyoto, Japan, 2009-07-21/2009-08-21. [t10/272] G. Biroli, B. Clark, L. Foini, and F. Zamponi. Leggett’s bound for amorphous solids. Phys. Rev. B, 83, 094530, (2011), arXiv:1011.2863. [t10/273] L. Berthier and G. Biroli. A theoretical perspective on the glass transition and nonequilibrium phenomena in disordered materials. Rev. Mod. Phys., 83, 587, (2011), arXiv:1011.2578v1. [t10/274] A. Crisanti and C. De Dominicis. Low-temperature mass spectrum in the Ising spin glass. Europhys. Lett., 92, 17003, (2010), arXiv:1010.0637v1. [t10/275] C. Brito, O. Dauchot, G. Biroli, and J.-P. Bouchaud. Elementary excitation modes in a granular glass above jamming. Soft Matter, 6, 3013–3022, (2010), arXiv:1003.1529v1. [t10/276] A. Bedini and J.L. Jacobsen. A tree-decomposed transfer matrix for computing exact Potts model partition functions for arbitrary graphs. J. Phys. A, 43, 385001, (2010). [t10/277] J.L. Jacobsen. Demixing of compact polymers chains in three dimensions. Phys. Rev. E, 82, 051802, (2010). [t10/278] J.L. Jacobsen. Bulk, surface and corner free energy series for the chromatic polynomial on the square and triangular lattices. J. Phys. A, 43, 315002, (2010). [t10/280] C. Crauste-Thibierge, C. Brun, F. Ladieu, D. L’Hote, G. Biroli, and J.-P. Bouchaud. Evidence of Growing Spatial Correlations at the Glass Transition from Nonlinear Response Experiments. Phys. Rev. Lett., 104, 165703, (2010), arXiv:1002.0498v2. Appendices 109

[t10/281] J. Zinn-Justin. Critical Phenomena: field theoretical approach. Scholarpedia, 5, 8346, (2010). [t10/282] F. Lechenault, R. Candelier, O. Dauchot, J.-P. Bouchaud, and G. Biroli. Super-diffusion around the rigidity transition: Lévy and the Lilliputians. Soft Matter, 6, 3059–3064, (2010), arXiv:1001.1765v1. [t10/283] I.K. Kostov. Matrix models as conformal field theories: genus expansion. Nucl. Phys. B, 837, 221–238, (2010), arXiv:arXiv:0912.2137 [hep-th]. [t10/284] M. Beccaria, Dovier , G. Macorini, E. Mirabella, L. Panizzi, F.M. Renard, and C. Verzegnassi. Semi- inclusive bottom-Higgs production at LHC: The complete one-loop electroweak effect in the MSSM. Phys. Rev. D, 82, 093018, (2010), arXiv:1005.0759. [t10/285] J. Zinn-Justin. Path Integrals in Quantum Mechanics. Oxford University Press, USA, (2010). [t10/286] A. Rancon-Schweiger, A. Benlagra, and C. Pépin. Activation gap in the specific heat measurements for 3He bilayers. Phys. Rev. B, 83, 073102, (2011), arXiv:1005.1905. [t10/287] K.-S. Kim and C. Pépin. The thermopower as a fingerprint of the Kondo breakdown quantum critical point. Phys. Rev. B, 83, 073104, (2011), arXiv:1005.3354. [t10/288] C. Pépin, M.R. Norman, S. Burdin, and A. Ferraz. Modulated Spin Liquid: A New Paradigm for URu2Si2. Phys. Rev. Lett., 106, 106601, (2011), arXiv:1010.1237. [t10/289] Y. Hatta, E. Iancu, A.H. Mueller, and D.N. Triantafyllopoulos. Aspects of the UV/IR correspondence : energy broadening and string fluctuations. JHEP, 1102, 065, (2011), arXiv:1011.3763. [t10/290] E. Iancu. Parton saturation at strong coupling from AdS/CFT. volume 854 of Nucl. Phys. A, 18–31, (2010), arXiv:1009.1278 [hep-ph]. [t10/291] E. Iancu. Parton branching and medium-induced radiation in a strongly coupled plasma. volume 854 of Nucl. Phys. A, 18–31, (2011), arXiv:1012.3527 [hep-ph]. [t10/292] J.-P. Blaizot, J.M. Pawlowski, and U. Reinosa. Exact renormalization group and Φ-derivable approximations. Phys. Lett. B, 696, 523–528, (2011), arXiv:1009.6048. [t10/293] J.-P. Blaizot. Heavy ion collisions: puzzles and hopes. In Proceedings of the Fifth Conference on Physics at the LHC PLHC2010, 373–378. Verlag Deutsches Elektronen-Synchrotron, (2010), arXiv:1009.1566v2. Physics At The LHC 2010 (PLHC2010), Hamburg, Germany, 7-12 Jun 2010, 2010-06-07/2010-06-12. [t10/294] J.-P. Blaizot, A. Ipp, and N. Wschebor. Calculation of the pressure of a hot scalar theory within the Non-Perturbative Renormalization Group. Nucl. Phys. A, 849, 165–181, (2011), arXiv:1007.0991v1. [t10/295] A. Beraudo, J.-P. Blaizot, P. Faccioli, and G. Garberoglio. A path integral for heavy quarks in a hot plasma. Nucl. Phys. A, 846, 104–142, (2010), arXiv:1005.1245v1. [t10/296] J.-P. Blaizot, T. Lappi, and Y. Mehtar-Tani. On the gluon spectrum in the glasma. Nucl. Phys. A, 846, 63–82, (2010), arXiv:1005.0955v1. [t10/297] G. Soyez. Optimal jet radius in kinematic dijet reconstruction. JHEP, 1007, 075, (2010), arXiv:1006.3634. [t10/298] M. Cacciari, J. Rojo, G.P. Salam, and G. Soyez. Jet Reconstruction in Heavy Ion Collisions. Eur. J. Phys., C 71, 1539, (2011), arXiv:1010.1759. [t10/299] J.R. Espinosa, T. Konstandin, G. Servant, and M. No J. Energy Budget of Cosmological First-order Phase Transitions. JCAP, 1006, 028, (2010), arXiv:1004.4187. [t10/300] M. Battaglia and G. Servant. Four-top production and t tbar + missing energy events at multi TeV e+e- colliders. volume C033 of Nuovo Cimento, 203–208, (2010), arXiv:1005.4632. Linear Collider Workshop 2009 (LC09), Perugia (Italie). [t10/301] G. Servant. Four-top events at the LHC. Physics at the LHC 2010, DESY, Hambourg (Allemagne), 2010-06-07/2010-06-12, (2010). [t10/302] C. Degrande, J.M. Gérard, C. Grojean, F. Maltoni, and G. Servant. Non-resonant New Physics in Top Pair Production at Hadron Colliders. JHEP, 1103, 125, (2011), arXiv:1010.6304. [t10/303] G. Servant. Dark matter at the electroweak scale: non-supersymmetric candidates, 164–189. Cambridge University Press, (2010). [t10/304] J.R. Espinosa, C. Grojean, and M. Muhlleitner. Composite Higgs Search at the LHC. JHEP, 1005, 065, (2010), arXiv:1003.3251. [t10/305] G. Brooijmans, C. Grojean, G.D. Kribs, and C. Shepherd-Themistocleous, editors. New Physics at the LHC. A Les Houches Report: Physics at TeV Colliders 2009, (2010), arXiv:1005.1229. Les Houches 2009, Physics at TeV Colliders, Les Houches, France, 2009-06-08/2009-06-26. [t10/306] C. Grojean and M. Spiropulu, editors. Proceedings of the 2009 CERN-Latin-American School of High- Energy Physics, (2010), arXiv:1010.5976. 5th CERN-Latin American School of High-Energy Physics, Recinto Quirama, Colombia, 2009-03-15/2009-03-28. 110 Activity Report CEA/DSM/IPhT 2008 — 2013

[t10/307] C. Grojean and M. Spiropulu, editors. Proceedings of the 2009 European School of High-Energy Physics, (2010), arXiv:1012.4643. 2009 European School of High-energy Physics, Bautzen (Allemagne), 2009-06- 14/2009-06-27. [t10/308] J.R. Espinosa, C. Grojean, and M. Muhlleitner. Higgs and electroweak symmetry breaking. Physics at the LHC 2010, DESY, Hambourg (Allemagne), 2010-06-07/2010-06-12, (2010). [t10/309] M. Barthélémy. Dynamical processes on complex networks. Cours de Physique Théorique, IPhT, Saclay, 2010-01-08/2010-02-05, (2010). [t10/311] M. Shifman. Dynamics of supersymmetric gauge theories. Cours de Physique Théorique, 2010-05- 28/2010-07-02, (2010). [t10/312] M. Petrini. The AdS/CFT correspondence. Cours de Physique Théorique, IPhT, Saclay, 2010-03- 19/2010-04-16, (2010). [t10/313] L. Albacete J. and A. Dumitru. A model for gluon production in heavy-ion collisions at the LHC with rcBK unintegrated gluon densities. (2010), arXiv:1011.5161 [hep-ph]. [t10/314] R.P.G. Andrade, A. Vezzoni Ramos Dos Reis, F. Grassi, Y. Hama, W.L. Qian, T. Kodama, and J.-Y. Ollitrault. NeXSPheRIO results on elliptic flow and directed flow for Au plus Au and Cu plus Cu collisions at RHIC. volume 84 of Pramana J. Phys., 1657–1661, (2010). Quark Matter 2008: 20th International Conference On Ultra-Relativistic Nucleus Nucleus Collisions (QM 2008), Jaipur, India, 2008-02-04/2008- 02-10. [t10/315] D. Van Den Bleeken, J. Raeymaekers, and B. Vercnocke. Chronology protection and the stringy exclusion principle. JHEP, 1104, 037, (2011), arXiv:1011.5693. [t10/318] P. Brax. Producing Chameleons in the sun. 6th Patras Workshop on Axions, WIMPs adn WISPs, Zurich, (2010). [t10/319] P. Brax and C. Burrage. Chameleon Induced Atomic Afterglow. Phys Rev Letters D, 82, 095014, (2010), arXiv:1009.1065. [t10/320] P. Brax, C. van de Bruck, F. Mota David, J.Nunes Nelson, and A. Winther. Chameleons with Field Dependent Couplings. Phys Rev Letters D, 82, 083503, (2013), arXiv:1006.2796. [t10/321] P. Brax and R. Peschanski. Gauge/Cosmology Brane-to-Brane Duality. Acta Phys. Pol., B41, 2645–2667, (2010), arXiv:1006.3054. [t10/322] P. Brax, R. Rosenfeld, and D.A. Steer. Spherical Collapse in Chameleon Models. JCAP, 1008, 033, (2010), arXiv:1005.2051. [t10/323] P. Brax, C. van de Bruck, A.C. Davis, and J. Shaw. The Dilaton and Modified Gravity. Phys Rev Letters D, 82, (2010), arXiv:1005.3735. [t10/324] P. Brax and K. Zioutas. Solar Chameleons. Phys Rev Letters D, 82, (2010), arXiv:1004.1846. [t10/325] P. Brax, C. van de Bruck, A.C. Davis, D.J. Shaw, and D. Iannuzzi. Tuning the Mass of Chameleon Fields in Casimir Force Experiments. Phys. Rev. Lett., 104, (2010), arXiv:1003.1605. [t10/326] P. Brax. Gif Lectures on Cosmic Acceleration. (2010), arXiv:0912.3610. [t10/327] P. Brax and E. Cluzel. Brane Bremsstrahlung in DBI Inflation. JACP, 1003, 016, (2010), arXiv:0912.0806. [t10/329] R. Vasseur and T. Lookman. Effects of disorder in ferroelastics: A spin model for strain glass. Phys. Rev. B, 81, 094107, (2010). [t10/330] N. Champagne, R. Vasseur, A. Montourcy, and D. Bartolo. Traffic jams and intermittent flows in microfluidic networks. Phys. Rev. Lett., 105, 044502, (2010), arXiv:1005.5003. [t10/332] G. Korchemsky. Review of AdS/CFT Integrability, Chapter IV.4: Integrability in QCD and N < 4 SYM. Lett. Math. Phys., 99, 3–32, (2010), arXiv:1012.4000. [t10/334] I.K. Kostov and N. Orantin. CFT and topological recursion. JHEP, 1011, 056, (2010), arXiv:1006.2028. [t10/335] M. Rybczynski and W. Broniowski. Two-body nucleon-nucleon correlations in Glauber-like models. VI Workshop on Particle Correlations and Femtoscopy, BITP, Kiev, (2010), arXiv:1012.5607. [t10/336] E.R. Arriola and W. Broniowski. Scalar-isoscalar states, gravitational form factors, and dimension-2 condensates in a large-Nc Regge approach. volume 1343 of AIP Conf. Proc., 361–363, (2011), arXiv:1011.5176. THE IX INTERNATIONAL CONFERENCE ON QUARK CONFINEMENT AND THE HADRON SPEC- TRUM, Madrid. [t10/339] H. Triendl. Generalized Geometry and Partial Supersymmetry Breaking. Fortschr. Phys., 59, 76–164, (2010), arXiv:1010.1159. Appendices 111

[t10/340] L. Albacete J. CGC and initial state effects in Heavy Ion Collisions. volume 270 of J. Phys.: Conf. Ser., 012052, (2011), arXiv:1010.6027. Hot Quarks 2010: Workshop for young scientists on the physics of ultrarelativistic nucleus-nucleus collisions, La Londe-les-Maures. [t10/342] J.G. Milhano, L. Albacete J., N. Armesto, P. Quiroga Arias, and A. Salgado C. A predictive phenomenological tool at small Bjorken-x. volume 270 of J. Phys.: Conf. Ser., 012056, (2013), arXiv:1009.6136. Hot Quarks 2010: Workshop for young scientists on the physics of ultrarelativistic nucleus-nucleus collisions, La Londe-les-Maures. [t10/345] F. Zamponi, A. Lubke, T. kampfer, I. uschmann, E. Forster, A.P.L. Robinson, A. Giulietti, P. Koster, L. Labate, and T. Levato. Directional Bremsstrahlung from a Ti Laser-Produced X-Ray Source at Rela- tivistic Intensities in the 3 − 12 keV Range. Phys. Rev. Lett., 105, 085001, (2010). [t11/005] D. Gredat, I. Dornic, and J.M. Luck. On an imaginary exponential functional of Brownian motion. J. Phys. A, 44, 175003, (2011), arXiv:1101.1173. [t11/007] E. Sefusatti and F. Vernizzi. Cosmological structure formation with clustering quintessence. JCAP, 1103, 047, (2011), arXiv:1101.1026. [t11/009] L. Krapivsky P. and J.M. Luck. Dynamics of a quantum particle in low-dimensional disordered systems with extended states. J. Stat. Mech., 2011, P02031, (2011), arXiv:1101.2101. [t11/010] C. Monthus and T. Garel. Elastic random networks : strong disorder renormalization approach. J. Phys. A, 44, 085001, (2011), arXiv:1010.1627. [t11/011] S. Nonnenmacher. Quantized open chaotic systems. In P. Exner, editor, Mathematical Results in Quantum Physics, 221–226. World Scientific, (2011), arXiv:1011.2557. QMath11, Hradec Kralove, rep. tchèque, 2010-09-06/2010-09-10. [t11/012] G. Verley, K. Mallick, and D. Lacoste. Modified Fluctuation-dissipation theorem for nonequilibrium steady-states and applications to molecular motors. Europhys. Lett., 93, 10002, (2011), arXiv:arXiv:1009.4123. [t11/013] P. Vanhove. Monodromies and the structure of gauge and gravity amplitudes. 35th ICHEP, Paris, (2011). [t11/014] Gerardo Aldazabal, D. Marques, A. Nunez, Carmen, and Alejandro Rosabal. On Type IIB moduli stabilization and N = 4, 8 supergravities. Nucl. Phys. B, 849, 80–111, (2011), arXiv:arXiv:1101.5954. [t11/015] P. Vanhove. Perturbative Quantum Gravity. (2011). [t11/017] N. Gromov, D. Serban, I. Shenderovich, and D. Volin. Quantum folded string and integrability: from finite size effects to Konishi dimension. JHEP, 1108, 046, (2011), arXiv:1102.1040. [t11/018] C. Lhuillier and G. Misguich. Introduction to Quantum Spin Liquids, 23–41. Springer, (2011). [t11/019] I. Bena, G. Giecold, M. Graña, N. Halmagyi, and S Massai. On Metastable Vacua and the Warped Deformed Conifold: Analytic Results. Class. Quantum Grav., 2013, 015003, (2011), arXiv:1102.2403. [t11/020] C. Monthus and T. Garel. Anderson localization on the Cayley tree : multifractal statistics of the transmission at criticality and off criticality. J. Phys. A, 44, 145001, (2011), arXiv:1101.0982. [t11/021] J. Germer, W. Hollik, and E. Mirabella. Hadronic production of bottom-squark pairs with electroweak contributions. JHEP, 2011, 068, (2011), arXiv:1103.1258. [t11/022] M. Cirelli, G. Zaharijas, G. Servant, and P. Panci. Consequences of DM/antiDM Oscillations for Asymmetric WIMP Dark Matter. JCAP, 1203, 015, (2011), arXiv:1110.3809. [t11/024] K. Kim, H.K. Lee, and M. Rho. Dense Stellar Matter with Strange Quark Matter Driven by Kaon Condensation. Phys. Rev. C, 84, 035810, (2011), arXiv:1102.5167. [t11/025] M. Harada and M. Rho. Integrating Holographic Vector Dominance to Hidden Local Symmetry for the Nucleon Form Factor. Phys. Rev. D, 83, 114040, (2011), arXiv:1102.5489. [t11/026] C. Sasaki, H.K. Lee, W.G. Paeng, and M. Rho. Conformal anomaly and the vector coupling in dense matter. Phys. Rev. D, 84, 034011, (2011), arXiv:1103.0184. [t11/027] M. Barthélémy. Spatial Networks. Phys. Rep., 499, 1–101, (2011), arXiv:1010.0302. [t11/029] J.J.M. Carrasco and H. Johansson. Generic Multiloop Methods and Application to N = 4 Super-Yang- Mills. J. Phys. A, 44, 454004, (2011), arXiv:1103.3298. [t11/030] Z. Bern, J.J.M. Carrasco, L.J. Dixon, H. Johansson, and R. Roiban. Amplitudes and Ultraviolet Behavior of N=8 Supergravity. Fortschr. Phys., 59, 561–578, (2011), arXiv:1103.1848. [t11/031] P. Ciafaloni, M. Cirelli, D. Comelli, A. De Simone, A. Riotto, and A. Urbano. On the Importance of Electroweak Corrections for Majorana Dark Matter Indirect Detection. JCAP, 1106, 018, (2011), arXiv:1104.2996. 112 Activity Report CEA/DSM/IPhT 2008 — 2013

[t11/032] M. No J. Large Gravitational Wave Background Signals in Electroweak Baryogenesis Scenarios. Phys. Rev. D, 84, 124025, (2011), arXiv:1103.2159. [t11/034] A.V. Belitsky, G. Korchemsky, and E. Sokatchev. Are scattering amplitudes dual to super Wilson loops? Nucl. Phys. B, 855, 333–360, (2012), arXiv:1103.3008. [t11/035] F. David. Importance of Reversibility in the Quantum Formalism. Phys. Rev. Lett., 107, 180401, (2011), arXiv:1103.3454v3. [t11/036] B. Eden, P. Heslop, G. Korchemsky, and E. Sokatchev. The super-correlator/super-amplitude duality: Part I. Nucl. Phys. B, 869, 329–377, (2013), arXiv:arXiv:1103.3714. [t11/037] B. Eden, P. Heslop, G. Korchemsky, and E. Sokatchev. The super-correlator/super-amplitude duality: Part II. Nucl. Phys. B, 869, 378–416, (2013), arXiv:arXiv:1103.4353. [t11/039] F.G. Gardim, F. Grassi, Y. Hama, M. Luzum, and J.-Y. Ollitrault. Directed flow at mid-rapidity in event-by-event hydrodynamics. Phys. Rev. C, 83, 064901, (2011), arXiv:1103.4605. [t11/040] Z. Bern, L.J. Dixon, F. Febres Cordero, g. diana, D. Forde, T. Gleisberg, S. Hoeche, H. Ita, D.A. Kosower, D. Maitre, and K. Ozeren. Left-Handed W Bosons at the LHC. Phys. Rev. D, 84, 034008, (2011), arXiv:1103.5445. [t11/041] N.E.J. Bjerrum-Bohr, P.H. Damgaard, H. Johansson, and T. Sondergaard. Monodromy-like relations for finite loop amplitudes. JHEP, 1105, 039, (2011), arXiv:1103.6190. [t11/042] M. Colangeli, C. Maes, and B. Wynants. A meaningful expansion around detailed balance. J. Phys. A, 44, 095001, (2011), arXiv:1101.3487. [t11/043] M. Baiesi, C. Maes, and B. Wynants. The modified Sutherland–Einstein relation for diffusive nonequi- libria. Proc. R. Soc. A, 467, 2792–2134, (2011), arXiv:1101.3227. [t11/044] R. Guida and C. Kopper. All-order uniform momentum bounds for the massless φ4 theory in four dimensional Euclidean space. In Oberwolfach Reports Volume 8, Issue 1, 2011. European Mathematical Society, (2011), arXiv:1103.5692. [t11/045] B. Eynard. Intersection numbers of spectral curves. (2011), arXiv:1104.0176. [t11/046] Arita C., A. Ayyer, K. Mallick, and S. Prolhac. Recursive structures in the multispecies TASEP. J. Phys. A, 44, (2011), arXiv:1104.3752.

[t11/047] P. Di Francesco and R. Kedem. The solution of the quantum A1 T-system for arbitrary boundary. Commun. Math. Phys., 313, 329–350, (2012), arXiv:1102.5552. [t11/048] R.E. Behrend, P. Di Francesco, and P. Zinn-Justin. On the weighted enumeration of Alternating Sign Matrices and Descending Plane Partitions. J. Combin. Theory Ser. A, 119, 331–363, (2012), arXiv:1103.1176. [t11/049] C. Monthus and T. Garel. A critical Dyson hierarchical model for the Anderson localization transition. J. Stat. Mech., 2011, P05005, (2011), arXiv:1102.4701. [t11/050] C. Monthus. Non-equilibrium steady states : maximization of the Shannon entropy associated to the distribution of dynamical trajectories in the presence of constraints. J. Stat. Mech., 2011, P03008, (2011), arXiv:1011.1342. [t11/051] D. Jeong, F. Schmidt, and E. Sefusatti. Primordial Non-Gaussianity and the Statistics of Weak Lensing and other Projected Density Fields. Phys. Rev. D, 82, 123005, (2011), arXiv:1104.0926. [t11/052] C. Normand. Threshold shift of helical dynamo induced by stochastic ﬂow ﬂuctuations. Geophys. Astrophys. Fluid Dyn., 106, 277–304, (2012). [t11/053] A. Branschaedel, E. Boulat, H. Saleur, and P. Schmitteckert. Numerical Evaluation of Shot Noise using Real Time Simulations. Phys. Rev. B, 82, 205414, (2010), arXiv:1004.4784. [t11/054] J. Dubail, J.L. Jacobsen, and H. Saleur. Critical exponents of domain walls in the two-dimensional Potts model. J. Phys. A, 43, 482002, (2010), arXiv:1008.1216. [t11/055] J. Dubail, J.L. Jacobsen, and H. Saleur. Bulk and boundary critical behaviour of thin and thick domain walls in the two-dimensional Potts model. J. Stat. Mech., 2010, P12026, (2010), arXiv:1010.1700. [t11/056] R. Bondesan, J.L. Jacobsen, and H. Saleur. Edge states and conformal boundary conditions in super spin chains and super sigma models. Nucl. Phys. B, 849, 461–502, (2011), arXiv:1101.4361. [t11/057] R. Vasseur, J.L. Jacobsen, and H. Saleur. Indecomposability parameters in chiral Logarithmic Conformal Field Theory. Nucl. Phys. B, 851, 341–345, (2011), arXiv:1103.3134. [t11/058] G. Marozzi, M. Rinaldi, and R. Durrer. On infrared and ultraviolet divergences of cosmological perturbations. Phys. Rev. D, 83, 105017, (2011), arXiv:1102.2206. [t11/061] R. Durrer. What do we really know about Dark Energy? Cosmological Tests of General Relativity, Kavli Royal Society Center for the Advancement of Science, (2011), arXiv:1103.5331. Appendices 113

[t11/062] A. Bernamonti and R. Peschanski. Time-dependent AdS/CFT correspondence and the Quark-Gluon plasma. Nucl. Phys. B, 216, 94–120, (2011), arXiv:1102.0725. [t11/063] E. Dudas, v. Gersdorff G., D. Ghilencea, S. Lavignac, and J. Parmentier. On non-universal Goldstino couplings to matter. Nucl. Phys. B, 855, 570–591, (2012), arXiv:1106.5792. [t11/064] C. Caprini. Limits for primordial magnetic fields. 25th Texas Symposium, Heidelberg, (2011), arXiv:1103.4060. [t11/065] I. Bena, S. Giusto, and C. Ruef. A Black Ring with two Angular Momenta in Taub-NUT. JHEP, 1106, 140, (2011), arXiv:1104.0016. [t11/066] N. Halmagyi, M. Petrini, and A. Zaffaroni. Non-Relativistic Solutions of N=2 Gauged Supergravity. JHEP, 1108, 41, (2011), arXiv:1102.5740. [t11/067] M. Castellana and L. Zdeborova. Adversarial Satisfiability Problem. J. Stat. Mech., 2011, P03023, (2011), arXiv:1011.1273v1. [t11/068] S. El-Showk, Y. Nakayama, and S. Rychkov. What Maxwell Theory in D<>4 teaches us about scale and conformal invariance. Nucl. Phys. B, 848, 578–593, (2011), arXiv:1101.5385. [t11/069] S. El-Showk and K. Papadodimas. Emergent Spacetime and Holographic CFTs. JHEP, 1210, 106, (2012), arXiv:1101.4163. [t11/070] F. Krzakala, F. Ricci-Tersenghi, D. Sherrington, and L. Zdeborova. No spin glass phase in ferromagnetic random-field random-temperature scalar Ginzburg-Landau model. J. Phys. A, 44, 042003, (2011), arXiv:1008.4497v1. [t11/071] F. Krzakala and L. Zdeborova. Glassy aspects of melting dynamics (On melting dynamics and the glass transition, Part I). J. Chem. Phys., 134, 034512, (2011), arXiv:1006.2480. [t11/072] F. Krzakala and L. Zdeborova. Glassy dynamics as a melting process (On melting dynamics and the glass transition, Part II). J. Chem. Phys., 134, 034513, (2011), arXiv:1006.2479. [t11/073] Y. Matsuda, H. Nishimori, L. Zdeborova, and F. Krzakala. Random-field p-spin glass model on regular random graphs. J. Phys. A, 44, 185002, (2011), arXiv:1101.5863. [t11/074] A. Decelle, F. Krzakala, C. Moore, and L. Zdeborova. Phase transition in the detection of modules in sparse networks. Phys. Rev. Lett., 107, 065701, (2011), arXiv:1102.1182. [t11/075] Z. Huang. The Art of Lattice and Gravity Waves from Preheating. Phys. Rev. D, 83, 123509, (2011), arXiv:1102.0227. [t11/077] I. Brihuega, P. Mallet, S. Bose, C. Bena, C. Michaelis, L. Vitali, F. Varchon, L. Magaud, K. Kern, and J. Veuillen Y. Quasiparticle Chirality in Epitaxial Graphene Probed at the Nanometer Scale. Phys. Rev. Lett., 101, 206802, (2008), arXiv:arXiv:0806.2616. [t11/078] J. Manschot. The Betti numbers of the moduli space of stable sheaves of rank 3 on P2. Lett. Math. Phys., 98, 65–78, (2011), arXiv:1009.1775. [t11/079] C. Bena and Montambaux . Remarks on the tight-binding model of graphene. New J. Phys., 11, 095003, (2009), arXiv:arXiv:0712.0765. [t11/080] J. Manschot, B. Pioline, and A. Sen. Wall-Crossing from Boltzmann Black Hole Halos. JHEP, 1107, 059, (2011), arXiv:1011.1258. [t11/081] J. Manschot. BPS invariants of N=4 gauge theory on a surface. Commun. Numb. Theor. Phys., 6, 497–516, (2012), arXiv:1103.0012. [t11/082] J. Manschot, B. Pioline, and A. Sen. A fixed point formula for the index of multi-centered N=2 black holes. JHEP, 1105, 057, (2011), arXiv:1103.1887. [t11/084] B. Bauer, Carr L.D., H.G. Evertz, A. Feiguin, J. Freire, S. Fuchs, L. Gamper, J. Gukelberger, E. Gull, S. Guertler, A. Hehn, R. Igarashi, S.V. Isakov, D. Koop, P.N. Ma, P. Mates, H. Matsuo, O. Parcollet, G. Pawlowski, J.D. Picon, L. Pollet, E. Santos, V.W. Scarola, U. Schollwoeck, C. Silva, B. Surer, S. Trebst, M. Troyer, M.L. Wall, P. Werner, and S. Wessel. The ALPS project release 2.0: Open source software for strongly correlated systems. J. Stat. Mech., 2011, P05001, (2011), arXiv:1101.2646. [t11/085] T. Danckaert, J. Louis, D. Martinez-Pedrera, B. Spanjaard, and H. Triendl. The N=4 effective action of type IIA supergravity compactified on SU(2)-structure manifolds. JHEP, 1108, 024, (2011), arXiv:1104.5174. [t11/086] P.V. Bushlanov, A.M. Gainutdinov, and I.Yu. Tipunin. Kazhdan-Lusztig equivalence and fusion of Kac modules in Virasoro logarithmic models. Nucl. Phys. B, 862, 232–269, (2011), arXiv:1102.0271. [t11/088] G. Vernizzi and H. Orland. Random matrix theory and RNA folding. Oxford University Press, (2011). [t11/089] M. Bon and H. Orland. TT2NE: A novel algorithm to predict RNA secondary structures with pseudoknots. Nucl. Acids Res., 39, e93, (2011), arXiv:1010.4490. 114 Activity Report CEA/DSM/IPhT 2008 — 2013

[t11/090] X. Man, D. Andelman, H. Orland, P. Thebault, P.H. Liu, P. Guenoun, J. Daillant, and S. Landis. Or- ganization of Block Copolymers using NanoImprint Lithography: Comparison of Theory and Experiments. Macromolecules, 44, 2206–2211, (2011), arXiv:1007.4733. [t11/091] H. Orland. Generating Transition Paths by Langevin Bridges. J. Chem. Phys., 134, 174114, (2011), arXiv:1102.3442. [t11/092] R. Einert T., H. Orland, and R.R. Netz. Secondary structure formation of homopolymeric single- stranded nucleic acids including force and loop entropy: implications for DNA hybridization. Eur. Phys. J. E, 34, 55, (2011). [t11/096] A Lazarescu and K. Mallick. An Exact Formula for the Statistics of the Current in the TASEP with Open Boundaries. J. Phys. A, 44, 315001, (2011). [t11/098] C. Godrèche. Dynamics of the directed Ising chain. J. Stat. Mech., 2011, P04005, (2011), arXiv:1102.0141. [t11/099] F. Bernardeau and P. Brax. Cosmological Large-scale Structures beyond Linear Theory in Modified Gravity. JCAP, 1106, 019, (2011), arXiv:1102.1907. [t11/100] A. Alexandrov, A. Mironov, A. Morozov, and S. Natanzon. Integrability of Hurwitz Partition Functions. I. Summary. J. Phys. A, 45, 045209, (2011), arXiv:1103.4100. [t11/101] A. Crisanti and C. De Dominicis. Stability of the Parisi solution for the Sherrington-Kirkpatrick model near T = 0. J. Phys. A, 44, 15006, (2011), arXiv:1101.5233v1. [t11/102] J.M. Stéphan, G. Misguich, and V. Pasquier. Phase transition in the Rényi-Shannon entropy of Luttinger liquids. Phys. Rev. B, 84, 195128, (2011), arXiv:1104.2544. [t11/103] L. Messio, C. Lhuillier, and G. Misguich. Lattice symmetries and regular states in classical frustrated antiferromagnets. Phys. Rev. B, 83, 184401, (2011), arXiv:1101.1212. [t11/105] A. Ayyer, R. Cori, and D. Gouyou-Beauchamps. Monotone triangles and 312 Pattern Avoidance. Electr. J. Combin., 18, P26, (2011), arXiv:1101.1666. [t11/106] Berthier L., Biroli G., Bouchaud J.-P., Cipelletti L., and van Saarloos W., editors. Dynamical Hetero- geneities in Glasses, Colloids, and Granular Media. Oxford University Press, USA, (2011). [t11/108] A. Ayyer. Algebraic Properties of a Disordered Asymmetric Glauber Model. J. Stat. Mech., 2011, P02034, (2011), arXiv:1012.0875. [t11/109] I.K. Kostov. Two-dimensional quantum gravity. (2011). [t11/110] R.S. Bhalerao, M. Luzum, and J.-Y. Ollitrault. Determining initial-state fluctuations from flow measurements in heavy-ion collisions. Phys. Rev. C, 84, 034910, (2011), arXiv:1104.4740. [t11/111] J.-P. Blaizot. The status of parton saturation and the CGC. volume 854 of Nucl. Phys. A, 237–256, (2011), arXiv:1101.0260v1. Saturation, the Color Glass Condensate and Glasma: What Have we Learned from RHIC?, Brookhaven National Laboratory, 2010-05-10/2010-05-12. [t11/112] P. Brax and E. Cluzel. Perturbation Theory in k-Inflation Coupled to Matter. JCAP, 1104, 014, (2011), arXiv:1102.1917. [t11/113] P. Brax, C. van de Bruck, A.C. Davis, B. Li, and D. Shaw. Nonlinear Structure Formation with the Environmentally Dependent Dilaton. Phys. Rev. D, 83, 104026, (2011), arXiv:1102.3692. [t11/115] J. Zinn-Justin. From Slavnov-Taylor Identities to the ZJ Equation. In Proceedings of the Steklov Institute of Mathematics, 272, 288–292, (2011). Gauge fields yesterday, today, tomorrow, moscou. [t11/118] Y. Hatta, E. Iancu, A.H. Mueller, and D.N. Triantafyllopoulos. Radiation by a heavy quark in N=4 SYM at strong coupling. Nucl. Phys. B, 850, 31–52, (2011), arXiv:1102.0232 [hep-th]. [t11/122] C.A. Savoy and M. Thormeier. Exotic particles below the TeV from low scale flavour theories. JHEP, 1103, 128, (2011), arXiv:1003.2090. [t11/124] G. bossard, P. Vanhove, P.S. Howe, and K.S. Stelle. The vanishing volume of D=4 superspace. Class. Quantum Grav., 28, 215005, (2011), arXiv:1105.6087. [t11/125] G. Soyez. A simple description of jet cross-section ratios. Phys. Lett. B, 698, 59–62, (2011), arXiv:1101.2665. [t11/126] M. Cacciari, G.P. Salam, and G. Soyez. Fluctuations and asymmetric jet events in PbPb collisions at the LHC. Eur. Phys. J. C, 71, 1692, (2011), arXiv:1101.2878. [t11/127] M. Graña and F. Orsi. N=1 vacua in Exceptional Generalized Geometry. JHEP, 1108, 109, (2011), arXiv:1105.4855. [t11/128] C. Degrande, J.M. Gérard, C. Grojean, F. Maltoni, and G. Servant. An effective approach to same sign top pair production at the LHC and the forward-backward asymmetry at the Tevatron. Phys. Lett. B, 703, 306–309, (2011), arXiv:1104.1798. Appendices 115

[t11/129] T. Konstandin and G. Servant. Cosmological Consequences of Nearly Conformal Dynamics at the TeV scale. JCAP, 1112, 009, (2011), arXiv:1104.4791. [t11/130] T. Konstandin and G. Servant. Natural Cold Baryogenesis from Strongly Interacting Electroweak Symmetry Breaking. JCAP, 1107, 024, (2011), arXiv:1104.4793. [t11/131] C. Grojean, E. Salvioni, and R. Torre. A weakly constrained W’ at the early LHC. JHEP, 1107, 002, (2011), arXiv:1103.2761. [t11/132] E. Iancu. Multiparticle Dynamics in the LHC Era. International Symposium on Multiparticle Dynamics 2010, Anvers, (2011), arXiv:1105.0751. [t11/134] A. Brini, B. Eynard, and M. Mariño. Torus knots and mirror symmetry. Ann. Henri Poincaré, 13, 1873–1910, (2011), arXiv:1105.2012. [t11/135] J. Kempe. Quantum Algorithms and Information. Cours de physique théorique de Saclay, IPhT Saclay, 2011-05-03/2011-06-10, (2011). [t11/136] M. Bauer and D. Bernard. Quantum Stochastic Processes: A Case Study. J. Stat. Mech., 2011, P04016, (2011), arXiv:1101.3472. [t11/137] A. Bessa, C.A. de Carvalho, E.S. Fraga, and F. Gelis. Effective potential in the BET formalism. Phys. Rev. D, 83, (2011), arXiv:1104.1084. [t11/138] R. Britto. Introduction to Scattering amplitudes. Cours de Physique Théorique, IPhT, Saclay, 2011-01- 21/2011-02-11, (2011). [t11/139] R. Durrer. Cosmology and the Cosmic Microwave Background. Cours de Physique Théorique, IPhT, Saclay, 2011-03-04/2011-04-08, (2011). [t11/141] K. Jo, M. Rho, S.-J. Sin, and Y. Seo. The dropping of in-medium hadron mass in holographic QCD. JHEP, 2011, 008, (2011), arXiv:1104.2362. [t11/142] R.K.P. Zia. Exploring Nonequilibrium Statistical Mechanics with Driven Diffusive Systems. Cours de Physique Théorique de l’IPhT, IPhT Saclay, 2011-05-20/2011-05-27, (2011). [t11/143] S. Nonnenmacher, J. Sjöstrand, and M. Zworski. Fractal Weyl law for open quantum chaotic maps. Ann. Math. (to appear), (2013), arXiv:1105.3128. [t11/144] S. Nonnenmacher. Spectral problems in open quantum chaos. Nonlinearity, 24, R123–R167, (2011), arXiv:1105.2457. [t11/145] M. Bergère, B. Eynard, and O. Marchal. Loop equations and topological recursion for the arbitrary-β two-matrix model. JHEP, 2012, 98, (2012), arXiv:1106.0332. [t11/146] Z. Bern, g. diana, L.J. Dixon, F. Febres Cordero, S. Hoche, H. Ita, D.A. Kosower, D. Maitre, and K. Oz- eren. Driving Missing Data at Next-to-Leading Order. Phys. Rev. D, 84, 114002, (2011), arXiv:1106.1423. [t11/147] I. Bena, C. Ruef, and N.P. Warner. Imaginary Soaring Branes: A Hidden Feature of Non-Extremal Solutions. JHEP, 1205, 143, (2012), arXiv:1105.6255. [t11/148] G. Borot, J. Bouttier, and E. Guitter. A recursive approach to the O(n) model on random maps via nested loops. J. Phys. A, 45, 045002, (2012), arXiv:1106.0153. [t11/149] A. Billoire and I.A. Campbell. Dynamics in the Sherrington-Kirkpatrick Ising spin glass at and above Tg. Phys. Rev. B, 84, 054442, (2011), arXiv:1105.1902v1. [t11/150] K. Fukushima and F. Gelis. The evolving Glasma. Nucl. Phys. A, 874, 108–129, (2011), arXiv:1106.1396. [t11/151] I. Bena, Jan deBoer, M Shigemori, and N.P. Warner. Double, Double Supertube Bubble. JHEP, 1110, 116, (2011). [t11/152] J.J.M. Carrasco and H. Johansson. Five-Point Amplitudes in N = 4 Super-Yang-Mills Theory and N = 8 Supergravity. Phys. Rev. D, 85, 025006, (2011). [t11/153] Z. Bern, C. Boucher-Veronneau, H. Johansson, and H. Ita. N ≥ 4 Supergravity Amplitudes from Gauge Theory at One Loop. Phys. Rev. D, 84, 105035, (2011), arXiv:1107.1935. [t11/154] C. Maes, K. Netocny, and B. Wynants. Monotone return to steady nonequilibrium. Phys. Rev. Lett., 107, 010601, (2011), arXiv:1102.3028. [t11/155] E. Avsar, Y. Hatta, C. Flensburg, J.-Y. Ollitrault, and T. Ueda. Eccentricity and elliptic flow in pp collisions at the LHC. volume 38 of J. Phys. G, 124053, (2011), arXiv:1106.4356. XXII International Conference on Ultrarelativistic Nucleus-Nucleus collisions (Quark Matter 2011), Annecy, 2011-05-22/2011- 05-28. [t11/156] C. Monthus and T. Garel. Random field Ising model : statistical properties of low-energy excitations and of equilibrium avalanches. J. Stat. Mech., 2011, P07010, (2011), arXiv:1106.1742. 116 Activity Report CEA/DSM/IPhT 2008 — 2013

[t11/157] I. Bena, G. Giecold, M. Graña, N. Halmagyi, and S Massai. The backreaction of anti-D3 branes on the Klebanov-Strassler geometry. JHEP, 2013, 060, (2013), arXiv:1106.6165. [t11/158] K. Dusling, F. Gelis, and R. Venugopalan. Ekpyrosis and inflationary dynamics in heavy ion collisions: the role of quantum fluctuations. volume 38 of J. Phys. G, 124120, (2011), arXiv:1107.0247. 22nd International Conference On Ultra-Relativistic Nucleus-Nucleus Collisions (Quark Matter 2011), Annecy, France. [t11/159] S. Nonnenmacher. Lectures on the spectral theory of damped quantum chaotic systems. Analyse spectrale des opérateurs non auto-adjoints et applications, Rennes, 2011-06-13/2011-06-17, (2011). [t11/160] T. Epelbaum and F. Gelis. Role of quantum fluctuations in a system with strong fields: Spectral properties and Thermalization. Nucl. Phys. A, 872, 1210–244, (2011), arXiv:1107.0668. [t11/161] R.S. Bhalerao, M. Luzum, and J.-Y. Ollitrault. New flow observables. volume 38 of J. Phys. G, 124055, (2011), arXiv:1106.4940. XXII International Conference on Ultrarelativistic Nucleus-Nucleus collisions (Quark Matter 2011), Annecy, 2011-05-23/2011-05-28. [t11/162] A. Mehta and J.M. Luck. Power-law forgetting in synapses with metaplasticity. J. Stat. Mech., P09025, (2011), arXiv:1107.1160. [t11/163] M. Luzum. Flow fluctuations and long-range correlations: elliptic flow and beyond. volume 38 of J. Phys. G, 124026, (2011), arXiv:1107.0592. 22nd International Conference On Ultra-Relativistic Nucleus-Nucleus Collisions (Quark Matter 2011), Annecy, France. [t11/164] I. Bena, D. Borun, B.D. Chowdhuri, J. de Boer, S. El-Showk, and M Shigemori. Moulting Black Holes. JHEP, 1203, 094, (2012), arXiv:1108.0411. [t11/165] I. Bena, A. Puhm, and B. Vercnocke. Metastable Supertubes and non-extremal Black Hole Microstates. JHEP, 1203, 100, (2012), arXiv:1109.5180. [t11/166] A.E. Allahverdyan, R. Balian, and T.M. Nieuwenhuizen. Understanding quantum measurement from the solution of dynamical models. Phys. Rep., 525, 1–166, (2012), arXiv:1107.2138v2. [t11/167] P. Ciafaloni, M. Cirelli, D. Comelli, A. De Simone, A. Riotto, and A. Urbano. Initial State Radiation in Majorana Dark Matter Annihilations. JCAP, 1110, 034, (2011), arXiv:1107.4453. [t11/168] J.-P. Blaizot, F. Gelis, J. Liao, L. McLerran, and R. Venugopalan. Bose–Einstein Condensation and Thermalization of the Quark Gluon Plasma. Nucl. Phys. A, 873, 68–80, (2012), arXiv:1107.5296. [t11/169] B. Eynard and C. Kozcaz. Mirror of the refined topological vertex from a matrix model. (2011), arXiv:1107.5181v1. [t11/170] R.S. Bhalerao, M. Luzum, and J.-Y. Ollitrault. Understanding anisotropy generated by fluctuations in heavy-ion collisions. Phys. Rev. C, 84, 054901, (2011), arXiv:1107.5485. [t11/172] G. Giecold, E. Goi, and F. Orsi. Assessing a candidate IIA dual to metastable supersymmetry-breaking. JHEP, 1202, 019, (2012). [t11/173] L. Krapivsky P., J.M. Luck, and K. Mallick. On stochastic differential equations with random delay. J. Stat. Mech., 2011, P10008, (2011), arXiv:1108.1298. [t11/174] A. Billoire, L.A. Fernandez, A. Maiorano, E. Marinari, V Martin-Mayor, and D. Yllanes. Finite-size scaling analysis of the distributions of pseudo-critical temperatures in spin glasses. J. Stat. Mech., (2011), arXiv:1108.1336v1. [t11/175] Z. Bern, J.J.M. Carrasco, H. Johansson, L.J. Dixon, and R. Roiban. Simplifying Multiloop Integrands of Gauge Theory and Gravity Amplitudes. Phys. Rev. D, 85, 105014, (2012). [t11/176] B. Eden, P. Heslop, G. Korchemsky, and E. Sokatchev. Hidden symmetry of four-point correlation functions and amplitudes in N=4 SYM. Nucl. Phys. B, 862, 193–231, (2011), arXiv:1108.3557. [t11/177] S. Nonnenmacher. Spectral theory of damped quantum chaotic systems. Journées EDP 2011, Biarritz, 2011-06-06/2011-06-10, (2013), arXiv:1109.0930. [t11/178] P. Valageas and Takahiro Nishimichi. Combining perturbation theories with halo models for the matter bispectrum. Astron. Astrophys., 532, A4, (2011), arXiv:1102.0641. [t11/179] M. Pierre, F. Pacaud, J.B. Juin, J.B. Melin, P. Valageas, N. Clerc, and S. Corasaniti P. Precision cosmology with a wide area XMM cluster survey. Mon. Not. R. Astron. Soc., 414, 1732–1746, (2011), arXiv:1009.3182. [t11/180] P. Valageas, N. Clerc, F. Pacaud, and M. Pierre. Covariance matrices for halo number counts and correlation functions. Astron. Astrophys., 536, A95, (2011), arXiv:1104.4015. [t11/181] P. Brax and G. Pignol. Strongly Coupled Chameleons and the Neutronic Quantum Bouncer. Phys. Rev. Lett., 107, 111301, (2011), arXiv:arXiv:1105.3420. Appendices 117

[t11/182] P. Brax, C. Burrage, and A.C. Davis. Laboratory Tests of the Galileon. JCAP, 1109, 020, (2011), arXiv:arXiv:1106.1573. [t11/183] P. Brax, Bruck c. van de, A.C. Davis, B. Li, Schmauch B., and Shaw D. Linear Growth of Structure in the Symmetron Model. Phys. Rev. D, 84, 123524, (2011), arXiv:arXiv:1108.3082. [t11/184] P. Brax and A.C. Davis. Supersymmetron. Phys. Lett. B, 707, 1–7, (2011), arXiv:arXiv:1109.0468. [t11/185] R. Britto and E. Mirabella. External leg corrections in the unitarity method. JHEP, 1201, 045, (2012). [t11/186] J. Baglio, M. Beccaria, A. Djouadi, G. Macorini, E. Mirabella, N. Orlando, F.M. Renard, and C. Verzeg- nassi. The Left-Right asymmetry of top quarks in associated top-charged Higgs bosons at the LHC as a probe of the tan β parameter. Phys. Lett. B, 705, 212–216, (2011). [t11/187] N.v.d. Kolk and J.-Y. Ollitrault. Reaction plane from Lee-Yang Zeroes for elliptic ﬂow analysis in ALICE. volume 85 of Indian Journal of Physics, 1069–1073, (2011). Quark Matter 2008: 20th International Conference On Ultra-Relativistic Nucleus Nucleus Collisions (QM 2008), Jaipur, India, 2008-02-04/2008- 02-10. [t11/188] M.B. Green, S.D. Miller, and P. Vanhove. Small representations, string instantons, and Fourier modes of Eisenstein series (with an appendix by D. Ciubotaru and P. Trapa). (2011), arXiv:1111.2983. [t11/189] piotr tourkine and P. Vanhove. An R4 non-renormalisation theorem in N = 4 supergravity. Classicum and Quantum Gravity, 29, 115006, (2012), arXiv:1202.3692. [t11/190] A.A. Bhat, G. Mahajan, and A. Mehta. Learning with a Network of Competing Synapses. PLoS One, 6, e25048, (2011). [t11/191] W.G. Paeng, H.K. Lee, M. Rho, and C. Sasaki. Dilaton-Limit Fixed Point in Hidden Local Symmetric Parity Doublet Model. Phys. Rev. D, 85, 054022, (2011), arXiv:1109.5431. [t11/192] H.K. Lee, M. Rho, and S.-J. Sin. Cold dense baryonic matter and compact stars. Int. J. Mod. Phys. A, 26, 4311–4334, (2011), arXiv:1109.5915. [t11/193] G. D’Amico and E. Sefusatti. The nonlinear power spectrum in clustering quintessence cosmologies. JCAP, 1111, 013, (2011), arXiv:1106.0314. [t11/194] D. Serpico P., E. Sefusatti, M. Gustafsson, and G. Zaharijas. Extragalactic gamma-ray signal from Dark Matter annihilation: a power spectrum based computation. Mon. Not. R. Astron. Soc., 421, 87–91, (2011), arXiv:1109.0095. [t11/196] V. Cortés, J. Louis, P. Smyth, and H. Triendl. On certain Kähler quotients of quaternionic Kähler manifolds. Commun. Math. Phys., 317, 787–816, (2011), arXiv:1111.0679. [t11/197] Estienne , V. Pasquier, R. Santachiara, and D. Serban. Conformal blocks in Virasoro and W theories: duality and the Calogero-Sutherland model. Nucl. Phys. B, 860, 337–420, (2011), arXiv:arXiv:1110.1101. [t11/198] IPhT . Rapport d’activité juin 2007 - mai 2011. Technical report, (2011). [t11/199] S Massai. Metastable Vacua and the Backreacted Stenzel Geometry. JHEP, 1206, 059, (2011). [t11/200] B. Eynard. Invariants of spectral curves and intersection theory of moduli spaces of complex curves. (2011), arXiv:1110.2949. [t11/201] G. Borot and B. Eynard. Geometry of spectral curves and all order dispersive integrable system. SIGMA, 8, 100, (2011). [t11/202] L. Boehnke, H. Hafermann, M. Ferrero, F. Lechermann, and O. Parcollet. Orthogonal Polynomial Representation of Imaginary-Time Green’s Functions. Phys. Rev. B, 84, 075145, (2011), arXiv:1104.3215. [t11/203] B.D. Chowdhuri and B. Vercnocke. New instability of non-extremal black holes: spitting out supertubes. JHEP, 1202, 116, (2011), arXiv:1110.5641. [t11/204] Pire B., Cirelli M., Colas P., Djouadi A., Lounis A., Machefert F., and Wormser G., editors. High energy physics. Proceedings, 35th International Conference, ICHEP 2010, Paris, France, July 22-28, 2010. Proceedings of Physics, (2011). [t11/205] M. Cirelli. Dark Matter Indirect Detection Phenomenology: status circa 08.2010. 15th Lomonosov Conference on Elementary Particle Physics, Moscow, 2011-08-18/2011-08-24, (2011). [t11/206] M. Cirelli. Indirect Searches for Dark Matter: a status review. volume 79 of Pramana J. Phys., 1021– 1043, (2012), arXiv:1202.1454. The XXV International Symposium on Lepton Photon Interactions at High Energies (Lepton Photon 11), Mumbai (India), 2011-08-22/2011-08-27. [t11/208] D.A. Kosower and J. Larsen K. Maximal Unitarity at Two Loops. Phys. Rev. D, 85, 045017, (2012), arXiv:1108.1180. [t11/210] B. Vercnocke, H. Triendl, and I. Bena. Camouﬂaged supersymmetry in solutions of extended supergravities. Phys. Rev. D, 86, 061701, (2012), arXiv:1111.2601. 118 Activity Report CEA/DSM/IPhT 2008 — 2013

[t11/211] J. Zinn-Justin. Semiclassical methods: From quantum mechanics to quantum field theory. Cours de Physique Théorique de l’IPhT, (2011). [t11/212] F.G. Gardim, F. Grassi, M. Luzum, and J.-Y. Ollitrault. Mapping the hydrodynamic response to the initial geometry in heavy-ion collisions. Phys. Rev. C, 85, 024908, (2012), arXiv:1111.6538. [t11/214] D. Poilblanc and G. Misguich. Competing valence bond crystals in the kagome quantum dimer model. Phys. Rev. B, 84, 214401, (2011), arXiv:arXiv:1109.5616. [t11/215] J.M. Stéphan, G. Misguich, and V. Pasquier. Rényi entanglement entropies in quantum dimer models : from criticality to topological order. J. Stat. Mech., 2012, P02003, (2012), arXiv:arXiv:1108.1699v1. [t11/216] L.S. Schulman, J.M. Luck, and A. Mehta. Spectral properties of zero temperature dynamics in a model of a compacting granular column. J. Stat. Phys., 146, 924–954, (2012). [t11/217] J.M. Stéphan and J. Dubail. Local quantum quenches in critical one-dimensional systems: entanglement, the Loschmidt echo, and light-cone effects. J. Stat. Mech., 2011, P08019, (2011), arXiv:1105.4846. [t11/218] R. Balian. Recension du livre "Le nucléaire : un choix raisonnable ?" (Hervé Nifenecker (X 55). EDP Sciences, 2011). La Jaune et la Rouge, (2011). [t11/219] F. Bernardeau and P. Valageas. Exact Results for Propagators in the Geometrical Adhesion Model. Phys. Rev. D, 85, 023516, (2012), arXiv:1109.4223. [t11/220] C. Monthus and T. Garel. Random Transverse Field Ising Model in dimension d = 2, 3 : Infinite Disorder scaling via a non-linear transfer approach. J. Stat. Mech., 2012, P01008, (2012), arXiv:1111.3468. [t11/221] E. Sefusatti, M. Crocce, and V. Desjacques. The Halo Bispectrum in N-body Simulations with non- Gaussian Initial Conditions. Mon. Not. R. Astron. Soc., 425, 2903–2930–2930, (2011), arXiv:1111.6966. [t11/222] F. Bernardeau, N. van de Rijt, and F. Vernizzi. Resummed propagators in multi-component cosmic fluids with the eikonal approximation. Phys. Rev. D, 85, 063509, (2011), arXiv:1109.3400. [t11/223] F. Bernardeau, M. Crocce, and R. Scoccimarro. Constructing Regularized Cosmic Propagators. Phys. Rev. D, 85, 123519, (2011), arXiv:1112.3895. [t11/224] G. Giecold. Gauge/gravity duality and field theories at strong coupling. PhD thesis, (2011). 2011-06-17. [t11/225] G. Borot. Quelques problèmes de géométrie énumérative, de matrices aléatoires, d’intégrabilité, étudiés via la géométrie des surfaces de Riemann. PhD thesis, (2011). 2011-06-23. [t11/226] J. Parmentier. Aspects phénoménologiques de la brisure de supersymétrie. PhD thesis, (2011). 2011-07- 11. [t11/227] E. Goi. Aspects of supersymmetry breaking in type IIA string theory: vacua and deformations. PhD thesis, (2011). 2011-09-21. [t11/228] E. Cluzel. Inflation in string theory. PhD thesis, (2011). 2011-09-22. [t11/229] F. Bernardeau, C. Bonvin, N. van de Rijt, and F. Vernizzi. Cosmic shear bispectrum from second-order perturbations in General Relativity. Phys. Rev. D, 86, 023001, (2011), arXiv:1112.4430. [t11/230] H. Grandclaude. Effets de taille finie, extrêmes et propagation de défaillances dans des réseaux hors d’équilibre. PhD thesis, (2011). 2011-11-10. [t11/231] J.M. Stéphan. Intrication dans des systèmes quantiques à basse dimension. PhD thesis, (2011). 2011- 12-12. [t11/232] F. Gelis. The initial stages of high energy heavy ion collisions. PhD thesis, (2011). 2011-12-07. [t11/233] M. Albenque and J. Bouttier. Constellations and multicontinued fractions: application to Eulerian triangulations. volume AR of DMTCS Proceedings, 805–816, (2012), arXiv:1112.6379. 24th International Conference on Formal Power Series and Algebraic Combinatorics (FPSAC 2012), Nagoya, Japan, 2012-07- 30/2012-08-03. [t11/234] R. Balian. Emergences in Quantum Measurement Processes. KronoScope, 13, 85–95, (2013). [t11/235] J. Olejarz, L. Krapivsky P., S. Redner, and K. Mallick. Growth Inside a Corner: The Limiting Interface Shape. Phys. Rev. Lett., 108, 016102, (2012), arXiv:1109.1253. [t11/236] Chou T., K. Mallick, and KP Zia, Royce. Non-equilibrium statistical mechanics: From a paradigmatic model to biological transport. Rep. Prog. Phys., 74, 116601, (2011), arXiv:1110.1783. [t11/237] R Chetrite and K. Mallick. Quantum Fluctuation Relations for the Lindblad Master Equation. J. Stat. Phys., 148, 480–501, (2012), arXiv:1112.1303. [t11/238] Arita C., A. Ayyer, K. Mallick, and S. Prolhac. Generalized matrix Ansatz in the multispecies exclusion process - partially asymmetric case. J. Phys. A, 45, 195001, (2012), arXiv:1201.0388. [t11/242] R. Peschanski. Two-body Regge amplitudes as holograms. Acta Phys. Pol. B, B42, 2751–2790, (2012). Appendices 119

[t11/243] M. Giordano, R. Peschanski, and S. Seki. N=4 SYM Regge Amplitudes and Minimal Surfaces in AdS/CFT Correspondence. Acta Phys. Pol. B, 43, 1289–1332, (2012), arXiv:1110.3680. [t11/244] M. Giordano and R. Peschanski. Reggeon exchange from gauge/gravity duality. JHEP, 1110, 108, (2011), arXiv:1105.6013. [t11/245] F. Gelis and al.+ et. Gluons and the quark sea at high energies: Distributions, polarization, tomography. Technical report, (2011), arXiv:1108.1713. [t11/246] C. Roth, S.M. Kang, M. Batty, and M. Barthélémy. A long-time limit of world subway networks. J. R. Soc. Interface, 9, 2540–2550, (2012), arXiv:1105.5294. [t11/247] F. Cerina, V. De Leo, M. Barthélémy, and A. Chessa. Spatial correlations in attribute communities. PLoS One, 7, e37507, (2012), arXiv:1112.3308. [t11/248] F. Krzakala, C. Moore, and L. Zdeborova. Asymptotic analysis of the stochastic block model for modular networks and its algorithmic applications. Phys. Rev. E, 84, 066106, (2011), arXiv:1109.3041. [t11/253] A. Decelle, F. Krzakala, C. Moore, and L. Zdeborova. Asymptotic analysis of the stochastic block model for modular networks and its algorithmic applications. Phys. Rev. E, 84, 066106, (2011), arXiv:1109.3041. [t11/254] B. Duplantier. The Hausdorff Dimension of Two-Dimensional Quantum Gravity. (2011), arXiv:1108.3327. [t11/255] H. Ita, Z. Bern, L.J. Dixon, F. Febres Cordero, D.A. Kosower, and D. Maitre. Precise Predictions for Z + 4 Jets at Hadron Colliders. Phys. Rev. D, 85, 031501, (2012), arXiv:1108.2229. [t11/256] Z. Bern, g. diana, L.J. Dixon, F. Febres Cordero, H. Ita, D.A. Kosower, D. Maitre, and K. Ozeren. Four-Jet Production at the Large Hadron Collider at Next-to-Leading Order in QCD. Phys. Rev. Lett., 109, 042001, (2013), arXiv:1112.3940. [t11/258] P. Creminelli, C. Pitrou, and F. Vernizzi. The CMB bispectrum in the squeezed limit. JCAP, 2011, 025, (2011), arXiv:arxiv.org/abs/arXiv:1109.1822. [t11/259] P. Brax and G. Pignol. Strongly Coupled Chameleons and the Neutronic Quantum Bouncer. Phys. Rev. Lett. (Comment), 107, (2011), arXiv:1105.3420. [t11/260] P. Brax, C. van de Bruck, A.C. Davis, and B. Li. Nonlinear Structure Formation with the Environmen- tally Dependent Dilaton. Phys Rev Letters D, 83, (2011), arXiv:1102.3692. [t11/261] F. Bernardeau and P. Brax. Cosmological Large-scale Structures beyond Linear Theory in Modified Gravity. JACP, 1106, 019, (2011), arXiv:1102.1907. [t11/262] P. Brax, J.F. Dufaux, and S. Mariadassou. Preheating after Small-Field Inflation. Phys. Rev. D, 23, (2011), arXiv:1012.4656. [t11/264] P. Brax and C. Burrage. Atomic Precision Tests and Light Scalar Couplings. Phys Rev Letters D, 83, (2013), arXiv:1010.5108. [t11/265] P. Brax and C. Burrage. Atomic precision tests and light scalar couplings. Phys. Rev. D, 83, 035020, (2011), arXiv:1010.5108. [t11/266] P. Brax, C. Burrage, A.C. Davis, D. Seery, and A. Weltman. Anomalous coupling of scalars to gauge fields. Phys. Lett. B, 699, 5–9, (2011), arXiv:1010.4536. [t11/267] H. Ueberschaer. Quantum Chaos for point scattered on hyberbolic surfaces. PhD thesis, (2011). Depart- ment of Mathematics, University of Bristol, 2011-01-01/2011-01-01. [t11/268] R. Vasseur and T. Dauxois. Resurrecting Dead-water Phenomenon. Processes Geophys, 18, 193–208, (2011), arXiv:1103.0903. [t11/269] R. Vasseur and T. Lookman. Spin Models for Ferroelastics : towards a Spin Glass Description of Strain Glass,. volume 172-174 of Solid State Phenomena, 1078, (2011). [t11/270] B. Braraunecker, C. Bena, and P. Simon. Spectral properties of Luttinger liquids: A comparative analysis of regular, helical, and spiral Luttinger liquids. Phys. Rev. B, 85, 035136, (2013), arXiv:1110.5171. [t11/271] Doru Sticlet, P. Simon, and C. Bena. Spin and Majorana polarization in topological superconducting wires. Phys. Rev. Lett., 108, 096802, (2011), arXiv:1109.5697. [t11/272] L. Simon, C. Bena, and F. Vonau. Fourier Transform Scanning Tunneling Spectroscopy: the possibility to obtain constant energy maps and the band dispersion using a local measurement. J. Phys. D, 44, 464010, (2011), arXiv:1107.3648. [t11/273] M. Bauer and D. Bernard. Convergence of repeated quantum non-demolition measurements and wave function collapse. Phys. Rev. A, 84, 1–4, (2011), arXiv:1106.4953. [t11/275] D. Bernard and B. Doyon. Full Counting Statistics in the Resonant-Level Model. J. Math. Phys., 53, 122302, (2012), arXiv:1105.1695. 120 Activity Report CEA/DSM/IPhT 2008 — 2013

[t11/277] C. Cammarota and G. Biroli. Aging and relaxation near Random Pinning Glass Transitions. Europhys. Lett., 98, 16011, (2011), arXiv:1112.4068. [t11/279] G. Biroli and F. Zamponi. A tentative replica theory of glassy Helium 4. Journal of Low Temperature Physics, 168, 101–116, (2011), arXiv:1107.2758. [t11/281] G. Biroli and F. Zamponi. A tentative replica theory of glassy Helium 4. Journal of Low Temperature Physics, 168, 101, (2011), arXiv:1107.2758. [t11/282] C. Cammarota and G. Biroli. Ideal Glass Transitions by Random Pinning. volume 109 of Proc. Nat. Acad. Sci., 8850–8855, (2011), arXiv:1106.5513. [t11/284] R. Bondesan, J. Dubail, J.L. Jacobsen, and H. Saleur. Conformal boundary state for the rectangular geometry. Nucl. Phys. B, 862, 553–676, (2012), arXiv:1110.6861. [t11/286] A.M. Gainutdinov, N. Read, and H. Saleur. Continuum limit and symmetries of the periodic gl(1|1) spin chain. Nucl. Phys. B, 871, 245–288, (2013), arXiv:1112.3403. [t11/287] A.M. Gainutdinov, N. Read, and H. Saleur. Bimodule structure in the periodic gl(1|1) spin chain. Nucl. Phys. B, 871, 289–329, (2013), arXiv:1112.3407. [t11/288] A. Komnik and H. Saleur. Quantum fluctuation theorem in an interacting setup: point contacts in fractional quantum Hall edge state devices. Phys. Rev. Lett., 107, 100601, (2013), arXiv:1109.3874. [t11/289] J.-P. Blaizot. Renormalization group flow equations with full momentum dependence. Phil.Trans.R.Soc.A, 369, 2735–2758, (2011), arXiv:1110.3413. [t11/290] J.-P. Blaizot. Quantum Fields at Finite TemperaturQuantum Fields at Finite Temperature "from tera to nano Kelvin". (2011), arXiv:1108.3482. [t11/291] J.-P. Blaizot. Weakly and strongly coupled degrees of freedom in the quark-gluon plasma. volume 4 of Acta Phys. Polon. B Proc. Supp., 641, (2011), arXiv:1108.3049. International Meeting Excited QCD. [t11/293] K. Dusling, F. Gelis, and R. Venugopalan. The initial spectrum of fluctuations in the little bang. Nucl. Phys. A, 842, 161–195, (2011), arXiv:1106.3927. [t11/294] M. Cacciari, P.G. Salam, and G. Soyez. FastJet user manual. Eur. Phys. J. C, 72, 1896, (2012), arXiv:1111.6097. [t11/296] P. Koehl, H. Orland, and M. Delarue. Adapting Poisson-Boltzmann to the self-consistent mean field theory: Application to protein side-chain modeling. J. Chem. Phys., 135, 055104, (2011). [t11/297] F. Poitevin, H. Orland, S. Doniach, P. Koehl, and M. Delarue. AquaSAXS: a web server for computation and fitting of SAXS profiles with non-uniformally hydrated atomic models. Nucl. Acids Res., 39, 184–189, (2011). [t11/298] H. Meier, C. Pépin, and B. Efetov K. Low energy excitations and singular contributions in the thermodynamics of clean Fermi liquids. Phys. Rev. B, 84, 205131, (2011), arXiv:1109.3642. [t11/299] J. Bros, H. Epstein, M. Gaudin, U. Moschella, and V. Pasquier. Anti de Sitter quantum field theory and a new class of hypergeometric identities. Commun. Math. Phys., 309, 255–291, (2012), arXiv:1107.5161. [t11/300] J.-E. Bourgine and I.K. Kostov. On the Yang-Lee and Langer singularities in the O(n) loop model. J. Stat. Mech., 1201, 01024, (2012), arXiv:1110.1108. [t11/301] J. Casalderrey-Solana and E. Iancu. Interference Phenomena in Medium Induced Radiation. J. Phys. B, 38, 124062, (2011), arXiv:1106.3864. [t11/303] E. Bertuzzo and M. Farina. Detecting the Higgs boson(s) in LambdaSUSY. Eur. Phys. J. C, 72, 2054, (2012), arXiv:1112.2190. [t11/304] E. Bertuzzo. On the MSSM with hierarchical squark masses and a heavier Higgs boson. Nuovo Cimento C, 034-s01, 15–21, (2011), arXiv:1106.3253. [t11/305] J. Moreira, P. Bozec, and W. Broniowski. Forward-backward rapidity correlations in relativistic heavy ion collisions : torqued fireball. volume 5 of Acta Phys. Polon. B Proc. Supp., 433, (2012), arXiv:1112.0884. Strangeness in Quark Matter 2011. [t11/306] W. Broniowski, E.R. Arriola, and E. Dorokhov. Transversity structure of the pion in chiral quark models. Understanding Hadronic Spectra, Bled, Solvenia, (2011), arXiv:1110.2972. [t11/307] E.R. Arriola and W. Broniowski. 0++ states in a large-Nc Regge approach. Understanding Hadronic Spectra, Bled, Solvenia, (2011), arXiv:1110.2863. [t11/308] W. Broniowski. Wounded nucleon model with realistic nucleon-nucleon collision profile and observables in relativistic heavy-ion collisions. Phys. Rev. C, 84, 064913, (2011), arXiv:1110.2609. [t11/309] P. Bozec, W. Broniowski, and J. Moreira. Torqued fireballs in relativistic heavy-ion collisions. Phys. Rev. C, 83, 034911, (2013), arXiv:1011.3354. Appendices 121

[t11/311] C. Caprini and J.M. No. Supersonic Electroweak Baryogenesis: Achieving Baryogenesis for Fast Bubble Walls. JCAP, 1201, 031, (2012), arXiv:1111.1726. [t11/312] M. Giordano, R. Peschanski, and S. Seki. Eikonal Approach to N=4 SYM Regge Amplitudes in the AdS/CFT Correspondence. Acta Phys. Pol. B, 43, (2012), arXiv:1110.3680. [t11/313] A. Chikashi, A. Ayyer, K. Mallick, and S. Prolhac. Recursive structures in the multispecies TASEP. J. Phys. A, 44, 335004, (2011), arXiv:1104.3752. [t11/314] C.v.d. Bruck, A.C. Davis, B. Li, B. Schmauch, and J. Shaw. Linear Growth of Structure in the Symmetron Model. Phys. Rev. D, 84, 123524, (2011), arXiv:1108.3082. [t11/315] E. Vernier and J.L. Jacobsen. Corner free energies and boundary effects for Ising, Potts and fully-packed loop models on the square and triangular lattices. J. Phys. A, 45, 045003, (2011), arXiv:1110.2158. [t11/316] E. Vernier, D. Pekker, M.W. , Zwierlein, and E. Demler. Bound states of a localized magnetic impurity in a superfluid of paired ultracold fermions. Phys. Rev. A, 83, 033619, (2011), arXiv:1010.6085. [t11/317] A. Mukhopadhyay. The unconditional RG flow of the relativistic holographic fluid. JHEP, 1111, 130, (2011), arXiv:1105.4530. [t11/318] Y. Mehtar-Tani, . Salgado A., and K. Tywoniuk. The radiation pattern of a QCD antenna in a dilute medium. JHEP, 1204, 64, (2012), arXiv:1112.5031. [t11/320] L.G Almeida, O. Erdo, Juknevich José, J. Lee, G. Sterman, and G. Perez. Three-particle templates for boosted Higgs. Phys. Rev. D, 85, 14046, (2013), arXiv:1112.1957. [t11/322] L. Albacete J., N. Armesto, J.G. Milhano, and A. Salgado. AAMQS: a non-linear QCD description of new HERA data at small-x. J. Phys. G, 38, 124124, (2011), arXiv:1107.0625. [t11/324] L. Albacete J., A. Dumitru, and Y. Nara. CGC initial conditions at RHIC and LHC. volume 316 of J. Phys.: Conf. Ser., 012011, (2011), arXiv:1106.0978. 27th Winter Workshop on Nuclear Dynamics (WWND 2011). [t11/325] A.J. Buras, C. Grojean, S. Pokorski, and R. Ziegler. FCNC Effects in a Minimal Theory of Fermion Masses. JHEP, 2011-08, 028, (2011), arXiv:1105.3725. [t11/326] A. Falkowski, C. Grojean, A. Kaminska, S. Pokorski, and A. Weiler. If no Higgs then what? JHEP, 2011-11, 028, (2011), arXiv:1108.1183. [t11/327] C. Grojean and S. Gupta. Theory and LHC Phenomenology of Classicalon Decays. JHEP, 2012-05, 114, (2013), arXiv:1110.5317. [t11/328] D.S. Hiroshi and R. Rosenfeld. Radion-Higgs mixing effects on bounds from LHC Higgs Searches. Phys. Rev. D, 85, 053003, (2011), arXiv:1111.2006. [t11/329] T.S. Ray. On the possibility of generating leading order gaugino masses in direct gauge mediation scenario. Phys. Rev. D, 85, 035003, (2011), arXiv:1111.4266. [t11/330] O.J.P. Eboli, C.A. Savoy, and R Zukanovich-Funchal. A Rationale for Long-lived Quarks and Leptons at the LHC: Low Energy Flavour Theory. JHEP, 2012-02, 123, (2012), arXiv:1112.5108. [t11/331] D. Boilley, Lu Hongliang, Shen Caiwan, Y. Abe, and B.G. Giraud. Fusion hindrance of heavy ions: Role of the neck. Phys. Rev. C, 84, 054608–1–054608–8, (2011). [t12/002] M. Graña and D. Marques. Gauged Double Field Theory. JHEP, 1204, 20, (2012). [t12/003] I. Bena, S. El-Showk, and B. Vercnocke. Black holes in string theory. Cours de Physique Théorique de l’IPhT, 2012-01-13/2012-02-17, (2012). [t12/004] C. Monthus and T. Garel. Random Transverse Field Ising Model in dimension d > 1 : scaling analysis in the disordered phase from the Directed Polymer model. J. Phys. A, 45, 095002, (2012), arXiv:1110.3145. [t12/005] B. Eden, P. Heslop, G. Korchemsky, and E. Sokatchev. Constructing the correlation function of four stress-tensor multiplets and the four-particle amplitude in N=4 SYM. Nucl. Phys. B, 862, 503, (2012), arXiv:1201.5329. [t12/006] A. Voros. Zeta-regularisation for exact-WKB resolution of a general 1D Schrödinger equation. J. Phys. A, 45, 374007, (2012), arXiv:1202.3100 [math-ph]. [t12/007] M. Cirelli. Tools for Dark Matter Indirect Detection. Linear Collider 2011: Understanding QCD at Linear Colliders in searching for old and new physics, Trento, Italy, 2011-09-12/2011-09-16, (2012). [t12/008] S Massai. A comment on anti-brane singularities in warped throats. (2012), arXiv:1202.3789. [t12/009] B. Bajc, S. Lavignac, and T. Mede. Supersymmetry breaking induced by radiative corrections. JHEP, 1207, 185, (2012), arXiv:1202.2845. [t12/010] H.K. Lee and M. Rho. Flavor Symmetry and Nuclear Symmetry Energy for Compact Stars. Int. J. Mod. Phys. E, 22, 1330005, (2012), arXiv:1201.6486. 122 Activity Report CEA/DSM/IPhT 2008 — 2013

[t12/012] K. Kim, H.K. Lee, and M. Rho. Triple layered compact star with strange quark matter. volume 10 of Int. J. Mod. Phys. Conf. Ser., 123–130, (2012), arXiv:1202.2645. Symposium on Cosmology and Particle Astrophysics (CosPA2011), Beijing, China. [t12/013] G. Borot, J. Bouttier, and E. Guitter. More on the O(n) model on random maps via nested loops: loops with bending energy. J. Phys. A, 45, 275206, (2012), arXiv:1202.5521. [t12/014] B. Eden, P. Heslop, G. Korchemsky, V.A. Smirnov, and E. Sokatchev. Five-loop Konishi in N=4 SYM. Nucl. Phys. B, 862, 136, (2012), arXiv:1202.5733. p [t12/015] E. Retinskaya, M. Luzum, and J.-Y. Ollitrault. Directed flow at midrapidity in (sN N) = 2.76 T eV Pb+Pb collisions. Phys. Rev. Lett., 108, 252302, (2012), arXiv:1203.0931. [t12/016] P.M. Petropoulos and P. Vanhove. Gravity, strings, modular and quasimodular forms. (2012), arXiv:1206.0571. [t12/018] F.G. Gardim, F. Grassi, M. Luzum, and J.-Y. Ollitrault. Anisotropic flow in event-by-event ideal p hydrodynamic simulations of (sNN ) = 200 GeV Au+Au collisions. Phys. Rev. Lett., 109, 202302, (2012), arXiv:1203.2882. [t12/019] M. Trigiante, Riet Van, and B. Vercnocke. Fake supersymmetry versus Hamilton-Jacobi. JHEP, 1205, 078, (2012), arXiv:1203.3194. [t12/020] B. Efetov K. Supersymmetry in Condensed Matter and Statistical physics. Cours de Physique Théorique de l’IPhT, 2012-03-09/2012-04-13, (2012). [t12/021] M. Cirelli. Les Houches 2011: Physics at TeV Colliders New Physics Working Group Report. Les Houches, 2011-05-30/2011-06-17, (2012), arXiv:1203.1488. [t12/024] G. Rivière and S. Nonnenmacher. Eigenmodes of the damped wave equation and small hyperbolic subsets. Ann. Inst. Fourier (to appear), (2013), arXiv:1202.5123. [t12/025] C. Monthus and T. Garel. Strong Disorder RG principles within a fixed cell-size real space renormalization : application to the Random Transverse Field Ising model on various fractal lattices. J. Stat. Mech., P05002, (2012), arXiv:1201.6136. [t12/026] M. Cirelli. Dark Matter Searches: a Theoretical Perspective. Les Rencontres de Physique de la Vallée d’Aoste, La Thuile, Italie, 2012-02-26/2012-03-03, (2012). [t12/027] J. Larsen K. Global poles of the two-loop six-point N=4 SYM integrand. Phys. Rev. D, 86, 085032, (2012), arXiv:1205.0297. [t12/028] S. Caron-Huot and J. Larsen K. Uniqueness of two-loop master contours. JHEP, 1210, 26, (2012), arXiv:1205.0801. [t12/030] B. Eynard and N. Orantin. Computation of open Gromov-Witten invariants for toric Calabi-Yau 3-folds by topological recursion, a proof of the BKMP conjecture. (2012), arXiv:1205.1103. [t12/031] J. Louis, P. Smyth, and H. Triendl. Supersymmetric Vacua in N=2 Supergravity. JHEP, 039, (2012), arXiv:1204.3893. [t12/033] D. Serban. A note on the eigenvectors of long-range spin chains and their scalar products. JHEP, 1301, 012, (2013), arXiv:1203.5842. [t12/034] M. Cirelli, E. Moulin, P. Panci, D. Serpico P., and A. Viana. Gamma ray constraints on Decaying Dark Matter. Phys. Rev. D, 86, 083506, (2012), arXiv:1205.5283. [t12/036] I. Bena, D Junghans, S Kuperstein, T. Van Riet, T Wrase, and M. Zagermann. Persistent anti-brane singularities. JHEP, 1210, 078, (2012), arXiv:1205.1978. [t12/037] G. Borot and B. Eynard. All-order asymptotics of hyperbolic knot invariants from non-perturbative topological recursion of A-polynomials. (2012), arXiv:1205.2261. [t12/039] P. Valageas, M. Sato, and Takahiro Nishimichi. Modeling of weak lensing statistics. I. Power spectrum and bispectrum. Astron. Astrophys., 541, A161, (2012), arXiv:1111.7156. [t12/040] P. Valageas, M. Sato, and Takahiro Nishimichi. Modeling of weak lensing statistics. II. Configuration- space statistics. Astron. Astrophys., 541, A162, (2012), arXiv:1112.1495. [t12/042] F. David. A short introduction to the quantum formalism[s]. Cours de Physique Théorique de Saclay, IPhT, Saclay, 2012-05-04/2012-06-01, (2012), arXiv:1211.5627. [t12/043] J. Conrad, A. Cuoco, Z. Yang, and G. Zaharijas. Constraints on the Galactic Halo Dark Matter from Fermi-LAT Diffuse Measurements. Astrophys. J., 761, 91, (2012), arXiv:1205.6474. [t12/044] Y. Mambrini, M.H.G. Tytgat, G. Zaharijas, and B. Zaldivar. Complementarity of Galactic radio and collider data in constraining WIMP dark matter models. JCAP, 1211, 038, (2012), arXiv:1206.2352. Appendices 123

[t12/045] I Melnikov, R. Minasian, and S. Theisen. Heterotic ﬂux backgrounds and their IIA duals. (2012), arXiv:1206.1417. [t12/047] I. Bena, H. Triendl, and B. Vercnocke. Black Holes and Fourfolds. JHEP, 1208, 124, (2012), arXiv:1206.2349. [t12/048] M. Cirelli, D. Serpico P., and G. Zaharijas. Bremsstrahlung gamma rays from light Dark Matter. (2013), arXiv:1307.7152. [t12/050] B. Vercnocke, Riet Van, J Blaback, and B. Janssen. Fractional branes, warped compactiﬁcations and backreacted orientifold planes. JHEP, 1210, 139, (2012), arXiv:1207.0814. [t12/051] M. Graña and F. Orsi. N=2 vacua in Generalized Geometry. JHEP, 1211, 052, (2012), arXiv:arXiv:1207.3004.

[t12/053] Maxime Gabella, J. Sparks, D. Martelli, and A. Passias. N=2 supersymmetric AdS4 solutions of M- theory. (2012), arXiv:1207.3082. [t12/054] G. Bélanger, C. Boehm, M. Cirelli, and J. Da Silva. PAMELA and FERMI limits on the neutralino- chargino mass degeneracy. JCAP, 1211, 028, (2012), arXiv:1208.5009. [t12/055] G. Borot, J. Bouttier, and E. Guitter. Loop models on random maps via nested loops: case of domain symmetry breaking and application to the Potts model. J. Phys. A, 45, 494017, (2012), arXiv:1207.4878. [t12/056] Z. Bern, J.J.M. Carrasco, H. Johansson, and R. Roiban. The Five-Loop Four-Point Amplitude of N = 4 super-Yang-Mills Theory. Phys. Rev. Lett., 109, 241602, (2012), arXiv:1207.6666. [t12/057] piotr tourkine and P. Vanhove. One-loop four-graviton amplitudes in N=4 supergravity models. Phys. Rev. D, 87, 045001, (2012), arXiv:1208.1255. [t12/061] A. Gehrmann-De Ridder, T. Gehrmann, and M. Ritzmann. Antenna subtraction at NNLO with hadronic initial states: double real initial-initial configurations. JHEP, 1210, 47, (2012), arXiv:1207.5779. [t12/062] I. Bena, A. Puhm, and B. Vercnocke. Non-extremal Black Hole Microstates: Fuzzballs of Fire or Fuzzballs of Fuzz ? JHEP, 1212, 014, (2012), arXiv:1208.3468. [t12/065] Y.L. Ma, Y. Oh, G.S. Yang, M. Harada, H.K. Lee, B.Y. Park, and M. Rho. Hidden Local Symmetry and Infinite Tower of Vector Mesons for Baryons. Phys. Rev. D, 86, 074025, (2012), arXiv:1206.5460. [t12/068] H. Dong, H.K. Lee, R. Machleidt, and M. Rho. Half-Skyrmions and the Equation of State for Compact- Star Matter. Phys. Rev. C, 87, 054332, (2012), arXiv:1207.0429. [t12/069] Y. Kim, M. Rho, T. Tsukioka, and Yi Deokhyun. Towards Dense Nuclear Matter in A Modified Sakai- Sugimoto Model. volume 20 of EPJ Web of Conferences, 03004, (2012). Hadron Nuclear Physics 2011 (HNP2011) “Quarks in Hadrons, Nuclei, and Hadronic Matter”, Pohang, Corée. [t12/070] A. Comtet, J.M. Luck, C. Texier, and Y. Tourigny. The Lyapunov exponent of products of random 2×2 matrices close to the identity. J. Stat. Phys., 150, 13–65, (2013), arXiv:1208.6430. [t12/073] C. Monthus and T. Garel. Random Transverse Field Ising model in d = 2 : analysis via Boundary Strong Disorder Renormalization. J. Stat. Mech., P09016, (2012), arXiv:1206.6997. [t12/074] M. Luzum and J.-Y. Ollitrault. Eliminating experimental bias in anisotropic-flow measurements of high-energy nuclear collisions. Phys. Rev. C, 87, 044907, (2013), arXiv:1209.2323. [t12/075] L. Chekhov, B. Eynard, and S. Ribault. Seiberg-Witten equations and non-commutative spectral curves in Liouville theory. J. Math. Phys., 54, 022306–022306–21, (2013). [t12/076] Y-t. Huang and H. Johansson. Equivalent D=3 Supergravity Amplitudes from Double Copies of Three- Algebra and Two-Algebra Gauge Theories. Phys. Rev. Lett., 110, 171601, (2012). [t12/077] C. Monthus and T. Garel. Random Transverse Field Ising model on the Cayley Tree : analysis via Boundary Strong Disorder Renormalization. J. Stat. Mech., P10010, (2012), arXiv:1205.4512. [t12/078] C. Godrèche and J.M. Luck. Condensation in the inhomogeneous zero-range process: an interplay between interaction and diffusion disorder. J. Stat. Mech., P12013, (2012), arXiv:1209.4749. [t12/079] R. Britto and A. Ochirov. On-shell recursion for massive fermion currents. JHEP, 1301, 2, (2012), arXiv:1210.1755. [t12/080] N. van de Rijt. Signatures of the primordial universe in large-scale structure surveys. PhD thesis, (2012). 2012-06-21. [t12/081] M. Crocce, R. Scoccimarro, and F. Bernardeau. MPTbreeze: A fast renormalized perturbative scheme. Mon. Not. R. Astron. Soc., 427, 2537–2551, (2012), arXiv:1207.1465. [t12/082] A. Taruya, F. Bernardeau, T. Nishimichi, and S. Codis. RegPT: Direct and fast calculation of regularized cosmological power spectrum at two-loop order. Phys. Rev. D, 86, 103528, (2012), arXiv:1208.1191. 124 Activity Report CEA/DSM/IPhT 2008 — 2013

[t12/083] F. Bernardeau, N. van de Rijt, and F. Vernizzi. Power spectra in the eikonal approximation with adiabatic and non-adiabatic modes. Phys. Rev. D, 87, 043530, (2012), arXiv:1209.3662. [t12/084] G. Misguich. Schwinger boson mean field theory: numerics for the energy landscape and gauge excitations in two-dimensional antiferromagnets. Phys. Rev. B, 86, 245132, (2012), arXiv:1207.4058. [t12/085] S. Leurent, D. Serban, and D. Volin. Six-loop Konishi anomalous dimension from the Y-system. Phys. Rev. Lett., 109, 241601–241605, (2012), arXiv:1209.0749. [t12/089] M. Luzum and J.-Y. Ollitrault. Extracting the shear viscosity of the quark-gluon plasma from flow in ultra-central heavy-ion collisions. volume 904-905 of Nucl. Phys. A, 377–380, (2013), arXiv:1210.6010. Quark Matter 2012, Washington DC, USA, 2012-08-12/2012-08-18. [t12/090] N. Anantharaman, M. Leautaud, and S. Nonnenmacher. Decay rates for the damped wave equation on the torus. A&PDE (to appear), (2013), arXiv:1210.6879. [t12/091] P. Valageas and N. Clerc. Redshift-space correlation functions in large galaxy cluster surveys. Astron. Astrophys., 547, A100, (2012), arXiv:1205.4847. [t12/092] P. Brax and P. Valageas. Structure Formation in Modified Gravity Scenarios. Phys. Rev. D, 86, 063512, (2012), arXiv:1205.6583. [t12/093] F. Gelis. The early stages of a high energy heavy ion collision. volume 381 of J. Phys.: Conf. Ser., 012021, (2012), arXiv:1110.1544. Rutherford Centennial Conference on Nuclear Physics, Manchester, UK, 2011-08-08/2011-08-12. [t12/094] J. Berges, J.-P. Blaizot, and F. Gelis. EMMI Rapid Reaction Task Force on ‘Thermalization in Non- abelian Plasmas’. volume 39 of J. Phys. G, 08511, (2012), arXiv:1203.2042. [t12/095] K. Dusling, T. Epelbaum, F. Gelis, and R. Venugopalan. Instability induced pressure isotropization in a longitudinally expanding system. Phys. Rev. D, 86, 085040, (2012), arXiv:1206.3336. [t12/096] K. Dusling, T. Epelbaum, F. Gelis, and R. Venugopalan. Initial state and thermalization. Hard Probes 2012, Cagliari, Italie, 2012-05-28/2012-06-01, (2012), arXiv:1207.5401. [t12/098] J.-P. Blaizot, F. Gelis, J. Liao, L. McLerran, and R. Venugopalan. Thermalization and Bose-Einstein Condensation in Overpopulated Glasma. volume 904 of Nucl. Phys. A, 829–832, (2012), arXiv:1210.6838. [t12/099] M. Graña and H. Triendl. Generalized N=1 and N=2 structures in M-theory and type II orientifolds. JHEP, 1303, 145, (2013), arXiv:1211.3867. [t12/100] E. Strano, V. Nicosia, V. Latora, S. Porta, and M. Barthélémy. Elementary processes governing the evolution of road networks. Scientific Report, 2, 296, (2012), arXiv:1203.0300. [t12/101] B. Eynard and N. Orantin. Erratum to "Topological expansion of mixed correlations in the hermitian 2 Matrix Model and x-y symmetry of the Fg invariants". (2012). [t12/102] R.G. Morris and M. Barthélémy. Transport on coupled spatial networks. Phys. Rev. Lett., 109, 128703, (2012), arXiv:1205.2776. [t12/103] M. Ritzmann, D.A. Kosower, and Z. Skands P. Antenna Showers with Hadronic Initial States. Phys. Lett. B, 718, 1345–1350, (2012), arXiv:1210.6345. [t12/104] J.-Y. Ollitrault and F.G. Gardim. Hydro overview. volume 904-905 of Nucl. Phys. A, 75–82, (2013), arXiv:1210.8345. Quark Matter 2012, Washington DC, USA, 2012-08-13/2012-08-18. [t12/105] A. Coja Oghlan and L. Zdeborova. The condensation transition in random hypergraph 2-coloring. ACM Digital Library, (2012), arXiv:1107.2341. [t12/107] F. Krzakala, M. Mézard, F. Sausset, Y. Sun, and L. Zdeborova. Statistical physics-based reconstruction in compressed sensing. Phys Rev X, 2, 021005, (2012), arXiv:1109.4424. [t12/108] P. Zhang, A. Ramezanpour, L. Zdeborova, and R. Zecchina. Message passing for quantified Boolean formulas. J. Stat. Mech., P05025, (2012), arXiv:1202.2536. [t12/109] F. Krzakala, M. Mézard, and L. Zdeborova. Reweighted belief propagation and quiet planting for random K-SAT. (2012), arXiv:1203.5521. [t12/110] Y. Sun, A. Crisanti, F. Krzakala, L. Leuzzi, and L. Zdeborova. Following states in temperature in the spherical s+p-spin glass model. J. Stat. Mech., P07002, (2012), arXiv:1204.3734. [t12/111] F. Krzakala, M. Mézard, F. Sausset, Y. Sun, and L. Zdeborova. Probabilistic Reconstruction in Com- pressed Sensing: Algorithms, Phase Diagrams, and Threshold Achieving Matrices. J. Stat. Mech., P08009, (2012), arXiv:1206.3953. [t12/112] A. Billoire, A. Maiorano, and E. Marinari. Correlated Domains in Spin Glasses. J. Stat. Mech., 2012, P12008, (2012), arXiv:1205.2759. Appendices 125

[t12/113] A. Billoire, L.A. Fernandez, A. Maiorano, E. Marinari, V Martin-Mayor, G. Parisi, F. Ricci-Tersenghi, J Ruiz-Lorenzo, and D. Yllanes. Comment on "Evidence of Non-Mean-Field-Like Low-Temperature Behavior in the Edwards-Anderson Spin-Glass Model". Phys. Rev. Lett., 110, 219701, (2013), arXiv:1211.0843. [t12/114] V bouchard. and B. Eynard. Think globally, compute locally. JHEP, 1302, 143, (2012), arXiv:1211.2302. [t12/115] J. barbier, F. Krzakala, M. Mézard, and L. Zdeborova. Compressed Sensing of Approximately-Sparse Signals: Phase Transitions and Optimal Reconstruction. In 2012 50th Annual Allerton Conference on Communication, Control, and Computing (Allerton 2012), 800–807. IEEE, (2012), arXiv:1207.2079. 50th Annual Allerton Conference on Communication, Control, and Computing, 2012, Allerton retreat center, Monticello, Illinois, USA. [t12/116] P. Zhang, F. Krzakala, J. Reichardt, and L. Zdeborova. Comparative Study for Inference of Hidden Classes in Stochastic Block Models. J. Stat. Mech., 2012, P12021, (2012), arXiv:1207.2328. [t12/117] X. Yan, E. Jensen, F. Krzakala, C. Moore, C.R. Shalizi, L. Zdeborova, P. Zhang, and Y. Zhu. Model Selection for Degree-corrected Block Models. (2012), arXiv:1207.3994. [t12/118] M. Gorissen, A Lazarescu, K. Mallick, and Vanderzande . Exact Current Statistics of the ASEP with Open Boundaries. Phys. Rev. Lett., 109, 170601, (2012), arXiv:1207.6879. [t12/119] F.G. Gardim, F. Grassi, M. Luzum, and J.-Y. Ollitrault. Characterizing the hydrodynamic response to the initial conditions. volume 904-905 of Nucl. Phys. A, 503–506, (2013), arXiv:1210.8422. Quark Matter 2012, Washington DC, USA, 2012-08-13/2012-08-18. [t12/120] F.G. Gardim, F. Grassi, M. Luzum, and J.-Y. Ollitrault. Breaking of factorization of two-particle correlations in hydrodynamics. Phys. Rev. C, 87, 031901, (2013), arXiv:1211.0989. [t12/121] F. Gelis. Color Glass Condensate and Glasma. Nucl. Phys. A, 854, 10–17, (2011). [t12/122] P. Valageas. Impact of a Warm Dark Matter late-time velocity dispersion on large-scale structures. Phys. Rev. D, 86, 123501, (2012), arXiv:1206.0554. [t12/129] F. Orsi. Vacuum configurations of string theory in the presence of fluxes. PhD thesis, (2012). 2012-02-02. [t12/130] B. Sciolla. Dynamique quantique hors-équilibre et systèmes désordonnés pour des atomes ultrafroids bosoniques. PhD thesis, (2012). 2012-09-13. [t12/131] R. Bondesan. Edge states and supersymmetric sigma models. PhD thesis, (2012). 2012-09-14. [t12/132] I. Shenderovich. Integrable structures in the gauge theories and in the supersymmetric string theories. PhD thesis, (2012). 2012-10-03. [t12/133] Z. Peng. Topics in super-Yang-Mills N=4 theory. PhD thesis, (2012). 2012-10-19. [t12/134] J. Olejarz, L. Krapivsky P., S. Redner, and K. Mallick. Olejarz, Krapivsky, Redner, and Mallick Reply. Phys. Rev. Lett., 259602, (2012), arXiv:1212.0946. [t12/135] Arita C. and K. Mallick. Matrix product solution of an inhomogeneous multi-species TASEP. J. Phys. A, 46, 085002, (2013), arXiv:1209.1913. [t12/138] P. Ronceray and P. Harrowell. Influence of liquid structure on the thermodynamics of freezing. Phys. Rev. E, 87, 052313, (2013), arXiv:1212.4223. [t12/140] F. Bernardeau, A. Taruya, and T. Nishimichi. Cosmic propagators at two-loop order. (2013), arXiv:1211.1571. [t12/141] M.R. Evans, S.N. Majumdar, and K. Mallick. Optimal diffusive search: nonequilibrium resetting versus equilibrium dynamics. J. Phys. A, 46, 185001, (2013), arXiv:1212.4096. [t12/142] K. Mallick. Recent Developments in Nonequilibrium Statistical Physics. (2012). [t12/143] R. Balian. Interprétation statistique de la mécanique quantique et théorie de la mesure. Conférences du Collège de Physique et de Philosophie, Collège de Physique et de Philosophie, 2012-05-14, (2012). [t12/145] B. Duplantier, R. Rhodes, S. Sheffield, and V. Vargas. Critical Gaussian Multiplicative Chaos: Conver- gence of the Derivative Martingale. (2012), arXiv:1206.1671. [t12/146] B. Duplantier, C Nguyen Thi Phuong, N. Nguyen Thi Thuy, and M. Zinsmeister. The Coefficient Problem and Multifractality of Whole-Plane SLE and LLE. (2012), arXiv:1211.2451. [t12/147] Duplantier B. and Rivasseau V., editors. Séminaire Poincaré XVI, Poincaré 1912-2012. Centre Poly- Média de l’Ecole polytechnique, (2012). Séminaire Poincaré, Institut Henri Poincaré, Paris, 2012-11-24/2012- 11-24. [t12/148] B. Duplantier, R. Rhodes, S. Sheffield, and V. Vargas. Renormalization of Critical Gaussian Multiplica- tive Chaos and KPZ formula. (2012), arXiv:1212.0529. [t12/149] B. Duplantier. Benoit B. Mandelbrot et le mouvement brownien. Gazette des Mathématiciens, 61–113, (2013). 126 Activity Report CEA/DSM/IPhT 2008 — 2013

[t12/152] L. Messio and F. Mila. Entropy dependence of correlations in one-dimensional SU(N) antiferromagnets. Phys. Rev. Lett., 109, 205306, (2012), arXiv:1207.1320. [t12/153] L. Hollenstein, R.K. Jain, and F.R. Urban. Cosmological Ohm’s law and dynamics of non-minimal electromagnetism. JACP, 1301, 013, (2013), arXiv:1208.6547. [t12/154] Poincaré Seminar 2010: Time. volume 63 of Prog. Math. Phys., 1–220, (2013). [t12/155] Z. Huang and F. Vernizzi. The CMB bispectrum from recombination. Phys. Rev. Lett., 110, 101303, (2013), arXiv:1212.3573. [t12/156] G. Gubitosi, F. Piazza, and F. Vernizzi. The Effective Field Theory of Dark Energy. JCAP, 1302, 032, (2013), arXiv:1210.0201. [t12/157] J.-P. Blaizot, F. Dominguez, E. Iancu, and Y. Mehtar-Tani. Medium-induced gluon branching. JHEP, 1301, 143, (2013), arXiv:1209.4585. [t12/158] Z. Bern, g. diana, L.J. Dixon, F. Febres Cordero, D. Forde, T. Gleisberg, H. Ita, D.A. Kosower, D. Maitre, K. Ozeren, and S. Hoeche. NLO Vector Boson Production with Light Jets. volume 35(3) of Nuovo Cimento C, 25–28, (2012), arXiv:1201.5288. TOP2011 - 4th International Workshop on Top Quark Physics, Sant Feliu de Guixols, Spain. [t12/159] Z. Bern, L.J. Dixon, and D.A. Kosower. Loops, trees and the search for new physics. Scientific American, 306, 34–41, (2012). [t12/160] Z. Bern, g. diana, L.J. Dixon, F. Febres Cordero, S. Hoeche, H. Ita, D.A. Kosower, D. Maitre, and K. Ozeren. Missing Energy and Jets for Supersymmetry Searches. Phys. Rev. D, 87, 03402, (2012), arXiv:1206.6064. [t12/161] H. Johansson, D.A. Kosower, and J. Larsen K. Two-Loop Maximal Unitarity with External Masses. Phys. Rev. D, 87, 025030, (2013), arXiv:1208.1754. [t12/162] M. Ritzmann, D.A. Kosower, and Z. Skands P. Antenna Showers with Hadronic Initial States. Phys. Lett. B, 718, 1345–1350, (2013), arXiv:1210.6345. [t12/163] Z. Bern, K. Ozeren, L.J. Dixon, S. Hoeche, F. Febres Cordero, H. Ita, D.A. Kosower, and D. Maitre. High multiplicity processes at NLO with BlackHat and Sherpa. volume LL2012 of PoS, 018, (2012), arXiv:1210.6684. Loops & Legs in QFT 2012, Wernigerode, Germany. [t12/164] M. Field, G. Gur-Ari, D.A. Kosower, L. Mannelli, and G. Perez. Three-Prong Distribution of Massive Narrow QCD Jets. Phys. Rev. D, 87, 094013, (2012), arXiv:1212.2106. [t12/165] H. Johansson, D.A. Kosower, and J. Larsen K. An Overview of Maximal Unitarity at Two Loops. volume LL2012 of PoS, 066, (2012), arXiv:1212.2132. Loops & Legs in QFT 2012, Wernigerode, Germany. [t12/166] L. Amendola, L. Hollenstein, and F. Vernizzi. Cosmology and fundamental physics with the Euclid satellite. Living Rev. Relativity, 16, 6, (2013), arXiv:1206.1225. [t12/167] D.G. Figueiroa, E. Sefusatti, A. Riotto, and F. Vernizzi. The Effect of Local non-Gaussianity on the Matter Bispectrum at Small Scales. JCAP, 1208, 036, (2012), arXiv:1205.2015. [t12/168] Z. Huang, L. Verde, and F. Vernizzi. Constraining inflation with future galaxy redshift surveys. JCAP, 1204, 005, (2012), arXiv:1201.5955. [t12/169] F. Bernardeau, C. Bonvin, N. van de Rijt, and F. Vernizzi. Cosmic shear bispectrum from second-order perturbations in General Relativity. Phys Rev Letters D, 86, (2012), arXiv:1112.4430. [t12/171] P. Brax, A.C. Davis, and Jeremy Sakstein. SUPER-Screening. Phys. Lett. B, 719, 210–217, (2013), arXiv:1212.4392. [t12/172] P. Brax. Lectures on Screened Modified Gravity. volume 43 of Acta Phys. Pol. B, 2307, (2012), arXiv:1211.5237. 52d Cracow School of Theoretical Physics, "Astroparticle Physics in the LHC Era", Zakopane, Poland. [t12/173] P. Brax, C. Burrage, and A.C. Davis. Screening fifth forces in k-essence and DBI models. JCAP, 1301, 020, (2013), arXiv:1209.1293. [t12/174] P. Brax, A.C. Davis, B. Li, A. Winther, and Zhao Gong-Bo. Systematic simulations of modified gravity: symmetron and dilaton models. JACP, 1210, 002, (2012), arXiv:arXiv:1206.3568. [t12/175] P. Brax, C. Burrage, and A.C. Davis. Shining Light on Modifications of Gravity. JCAP, 1210, 016, (2012), arXiv:1206.1809. [t12/176] P. Brax and P. Valageas. Structure Formation in Modified Gravity Scenarios. Phys. Rev. D, 86, 063512, (2012), arXiv:1205.6583. [t12/177] P. Brax, P Mimoso José, and J.Nunes Nelson. Brane Isotropisation in Extra-Dimensional Tolman-Bondi Universe. Phys. Rev. D, 85, 123516, (2012), arXiv:1203.5687. Appendices 127

[t12/178] P. Brax, A.C. Davis, B. Li, and H.A. Winther. A Unified Description of Screened Modified Gravity. Phys. Rev. D, 86, 044015, (2012), arXiv:1203.4812. [t12/179] P. Brax. Lorentz Invariance Violation in Modified Gravity. Phys. Lett. B, 712, 155–160, (2012), arXiv:1202.0740. [t12/180] P. Brax, A.C. Davis, and A. Winther. The Cosmological Supersymmetron. Phys. Rev. D, 85, 083512, (2012), arXiv:1112.3676. [t12/181] P. Brax, A.C. Davis, and B. Li. Modified Gravity Tomography. Phys. Lett. B, 715, 38–43, (2013), arXiv:1111.6613. [t12/182] P. Brax, A. Lindner, and K. Zioutas. Detection prospects for solar and terrestrial chameleons. Phys. Rev. D, 85, 043014, (2012), arXiv:1110.2583. [t12/183] P. Brax and A.C. Davis. Modified Gravity and the CMB. Phys. Rev. D, 85, 023513, (2012), arXiv:1109.5862. [t12/184] P. Brax and A.C. Davis. Supersymmetron. Phys. Lett. B, 707, 1–7, (2012), arXiv:1109.0468. [t12/187] Z. Rudnick and H. Ueberschaer. On the eigenvalue spacing distribution for a point scatterer on the flat torus. Ann. Henri Poincaré, (2013), arXiv:1208.5920v1. [t12/189] Z. Rudnick and H. Ueberschaer. Statistics of wave functions for a point scatterer on the torus. Commun. Math. Phys., 316, 763–782, (2012), arXiv:1109.4582. [t12/190] H. Ueberschaer. The trace formula for a point scatterer on a compact hyperbolic surface. J.Math.Phys, 53, 012108, (2012), arXiv:1109.4329v2. [t12/192] R. Vasseur, A.M. Gainutdinov, J.L. Jacobsen, and H. Saleur. The puzzle of bulk conformal field theories at central charge c=0. Phys. Rev. Lett., 108, 161602, (2012), arXiv:1110.1327. [t12/193] R. Vasseur and J.L. Jacobsen. Critical properties of joint spin and Fortuin-Kasteleyn observables in the two-dimensional Potts model. J. Phys. A, 45, 165001, (2013), arXiv:1111.4033. [t12/194] R. Vasseur, J.L. Jacobsen, and H. Saleur. Logarithmic observables in critical percolation. J. Stat. Mech., 2012, L07001, (2012), arXiv:1206.2312. [t12/195] R. Vasseur, D. Xue, Y.-K. Zhou, W. Ettoumi, X. Ding, X. Ren, and T. Lookman. Phase Diagram of Ferroelastic Systems in the Presence of Disorder: Analytical Model and Experimental Verification. Phys. Rev. B, 86, 184103, (2012), arXiv:1210.5919. [t12/197] B. Bauer, P. Corboz, A.M. Lauchli, L. Messio, K. Penc, M. Troyer, and F. Mila. Three-sublattice order in the SU(3) Heisenberg model on the square and triangular lattice. Phys. Rev. B, 85, 125116, (2012), arXiv:1112.1100. [t12/198] I. Bena and A Buchel. Horizons cannot save the Landscape. Phys. Rev. D, 87, 063012, (2012), arXiv:1212.5162. [t12/199] I. Bena, M. Graña, S Kuperstein, and S Massai. Anti-D3’s - Singular to the Bitter End. Phys. Rev. D, 87, 106010, (2013), arXiv:1206.6369. [t12/200] I. Bena, M. Berkooz, J. Boer (de), S. El-Showk, and D.V.d. Bleeken. Scaling BPS Solutions and pure-Higgs States. JHEP, 1211, 171, (2012), arXiv:1205.5023. [t12/201] P. Di Francesco. Truncated determinants and the refined enumeration of Alternating Sign Matrices and Descending Plane Partitions. Algebraic Combinatorics related to Young diagram and statistical physics, I.I.A.S., Nara, Japan, (2012), arXiv:1212.3006. [t12/202] P. Di Francesco. Integrable Combinatorics. 2012-08-11/2012-08-11, (2012), arXiv:1210.4514. [t12/203] I. Bena, M. Guica, and W. Song. Un-twisting the NHEK with spectral flows. JHEP, 1303, 028, (2013), arXiv:1203.4227. [t12/204] I. Bena, S. Giusto, M Shigemori, and P.N. Warner. Supersymmetric Solutions in Six Dimensions: A Linear Structure. JHEP, 1203, 084, (2012), arXiv:1110.2781. [t12/205] C. Dutreix, Liviu Bilteanu, A. Jagnannathan, and C. Bena. Friedel oscillations at the Dirac-cone-merging point in anisotropic graphene. Phys. Rev. B, 87, 245413, (2012), arXiv:1210.5104. [t12/206] L. Bilteanu, C. Dutreix, A. Jagnannathan, and C. Bena. Interplay between edge states and simple bulk defects in graphene nanoribbons. Eur. Phys. J. B, 86, 240, (2012), arXiv:1205.5146. [t12/207] D. Bernard and A. Le Clair. Scrutinizing the Cosmological Constant Problem and a possible resolution. Phys. Rev. D, 87, 063010, (2012), arXiv:1211.4848. [t12/210] M. Bauer, T. Benoist, and D. Bernard. Iterated Stochastic Measurements. J. Phys. A, 45, 494020, (2012), arXiv:1210.0425. 128 Activity Report CEA/DSM/IPhT 2008 — 2013

[t12/211] M. Bauer, T. Benoist, and D. Bernard. Repeated quantum non-demolition measurements: convergence and continuous-time limit. Ann. Henri Poincaré, 14, 639–679, (2013), arXiv:1206.6045. [t12/214] D. Bernard, E.A. Kim, and A. Le Clair. Edge states for topological insulators in two dimensions and their Luttinger-like liquids. Phys. Rev. B, 86, 205116, (2012), arXiv:1202.5040. [t12/215] D. Bernard and B. Doyon. Energy flow in non-equilibrium conformal field theory. J. Phys. A, 45, 362011, (2012), arXiv:1202.0239. [t12/216] M. Bauer, R Chetrite, K. Ebrahimi-Fard, and F. Patras. Time-ordering and a generalized Magnus expansion. Lett. Math. Phys., 103, 331–350, (2013), arXiv:1206.3990. [t12/217] A. Taruya, F. Bernardeau, T. Nishimichi, and S. Codis. RegPT: Direct and fast calculation of regularized cosmological power spectrum at two-loop order. Phys. Rev. D, 86, 103528, (2012), arXiv:1208.1191. [t12/218] B. Sciolla and G. Biroli. Quantum quenches, dynamical transitions and off-equilibrium quantum criticality. (2012), arXiv:1211.2572. [t12/219] C. Cammarota and G. Biroli. Random Pinning Glass Transition: Hallmarks, Mean-Field Theory and Renormalization Group Analysis. J. Chem. Phys., 138, 12A547–12A547–22, (2013), arXiv:1210.8399. [t12/220] S. Brade and G. Biroli. The Generalized Arrhenius Law in Out of Equilibrium Systems. (2012), arXiv:1204.6027. [t12/221] L. Berthier, G. Biroli, D. Caslovitch, W. Kob, and C. Toninelli. Finite size effects in the dynamics of glass-forming liquids. Phys. Rev. E, 86, 031502, (2012), arXiv:1203.3392. [t12/222] V. Bucci, S. Bradde, G. Biroli, and J.B. Xavier. Social interaction, noise and antibiotic-mediated switches in the intestinal microbiota. PLoS Comput Biol, 8(4), e1002497, (2012), arXiv:1203.2883. [t12/223] C. Cammarota and G. Biroli. Patch-repetition correlation length in glassy systems. Europhys. Lett., 98, 36005, (2012), arXiv:1201.2164. [t12/224] B. Sciolla and G. Biroli. Dynamical transitions and quantum quenches in mean-field models. J. Stat. Mech., 2011, 11003, (2011), arXiv:1108.5068. [t12/225] R. Bondesan, J.L. Jacobsen, and H. Saleur. Rectangular amplitudes, conformal blocks, and applications to loop models. Nucl. Phys. B, 867, 913–949, (2012), arXiv:1207.7005. [t12/226] R. Bondesan, A. Gruzberg, J.L. Jacobsen, H. Obuse, and H. Saleur. Exact exponents for the spin quantum Hall transition in the presence of multiple edge channels. Phys. Rev. Lett., 108, 126801, (2012), arXiv:1109.4866. [t12/228] J.-P. Blaizot, E.S. Fraga, and L.F. Palhares. Effect of quark masses on the QCD presssure in a strong magnetic background. Phys. Lett. B, 772, 167–171, (2013), arXiv:1211.6412. [t12/229] A.M. Gainutdinov, N. Read, and H. Saleur. Associative algebraic approach to logarithmic CFT in the bulk: the continuum limit of the gl(1|1) periodic spin chain, Howe duality and the interchiral algebra. (2013), arXiv:1207.6334. [t12/231] A.M. Gainutdinov, H. Saleur, and I.Yu. Tipunin. Lattice W-algebras and logarithmic CFTs. (2013), arXiv:1212.1378. [t12/232] J.-P. Blaizot, A.M. Nowak, and P. Warchol. Universal shocks in the Wishart random matrix ensemble - 1. Phys. Rev. E, 87, 052134, (2013), arXiv:1211.0029. [t12/234] Y. Iklef, J.L. Jacobsen, and H. Saleur. An integrable spin chain for the SL(2,R)/U(1) black hole sigma model. Phys. Rev. Lett., 108, 081601, (2012), arXiv:1109.1119. [t12/235] K. Dusling, T. Epelbaum, F. Gelis, and R. Venugopalan. Quantum chaos in the perfect fluid: spectrum of initial fluctuations in the little bang. Quark Matter 2012, (2012), arXiv:1210.6053. [t12/236] F. Gelis and J. Laidet. Next-to-Leading Order correction to inclusive particle spectra in the Color Glass Condensate framework. Phys. Rev. D, 87, 045019, (2012), arXiv:1211.1191. [t12/237] F. Gelis. Color Glass Condensate and Glasma. Int. J. Mod. Phys. A, 28, 1330001, (2013), arXiv:1211.3327. [t12/238] A. dymarsky and S Kuperstein. Non-supersymmetric Conifold. JHEP, 1208, 033, (2012), arXiv:1111.1731. [t12/239] P. Thebault, S. Niedermayer, S. Landis, N. Chaix, P. Guenoun, J. Daillant, X. Man, D. Andelman, and H. Orland. Tailoring Nanostructures Using Copolymer Nanoimprint Lithography. Adv. Mater., 24, 1952–1955, (2012), arXiv:1203.5318. [t12/240] A. Levy Yeyati, D. Andelman, and H. Orland. The Dielectric Constant of Ionic Solutions: A Field- Theory Approach. Phys. Rev. Lett., 108, 227801, (2012), arXiv:1201.6081. Appendices 129

[t12/241] X. Man, D. Andelman, and H. Orland. Block Copolymer Films with Free Interfaces: Ordering by Nano-Patterned Substrates. Phys. Rev. E, 86, 010801, (2012), arXiv:1109.0833. [t12/242] Tran Minh-Tien, A. Benlagra, C. Pépin, and Kim Ki-Seok. Preformed heavy electrons: A possible origin of characteristic energy scale in YbRh2Si2. Phys. Rev. B, 85, 165118, (2013), arXiv:1105.6161. [t12/243] I.K. Kostov and Y. Matsuo. Inner products of Bethe states as partial domain wall partition functions. JHEP, 1210, 168, (2012), arXiv:1207.2562. [t12/244] I.K. Kostov. Three-point function of semiclassical states at weak coupling. J. Phys. A, 45, 494018, (2012), arXiv:1205.4412. [t12/245] I.K. Kostov. Classical Limit of the Three-Point Function from Integrability. Phys. Rev. Lett., 108, 261604, (2012), arXiv:1203.6180. [t12/246] L.G Almeida, E. Bertuzzo, P.A.N Machado, and R Zukanovich-Funchal. Does H → γγ taste like vanilla new physics? JHEP, 1211, 85, (2012), arXiv:1207.5254. [t12/247] E. Bertuzzo, T.S. Ray, de.H. Sandes, and C.A. Savoy. On Composite Two Higgs Doublet Models. JHEP, 1305, 153, (2013), arXiv:1206.2623.

[t12/248] E. Bertuzzo and C. Frugiuele. Fitting Neutrino Physics with a U(1)R Lepton Number. JHEP, 1205, 100, (2013), arXiv:1203.5340. [t12/252] P. Masjuan, E.R. Ariola, and W. Broniowski. Radial and angular-momentum Regge trajectories: a systematic approach. volume 37 of EPJ Web of Conferences, 09024, (2013), arXiv:1208.4477. [t12/256] R. Britto and E. Mirabella. Massive particles and unitarity cuts. International Workshop on Future Linear Colliders LCWS 2011, Granada, Espagne, (2012), arXiv:1202.2426. [t12/257] P. Masjuan, E.R. Arriola, and W. Broniowski. Systematics of radial and angular-momentum Regge trajectories of light non-strange qq¯-states. Phys Rev Letters D, 85, 094006, (2012), arXiv:1203.4782. [t12/258] P. Bozec and W. Broniowski. Transverse-momentum fluctuations in relativistic heavy-ion collisions from event-by-event viscous hydrodynamics. Phys. Rev. C, 85, 044910, (2013), arXiv:1203.1810. [t12/259] M. Rybczycski, W. Florkowski, and W. Broniowski. Single-freeze-out model for ultra relativistic heavy- ion collisions at sqrtsrmNN = 2.76 TeV and the LHC proton puzzle. Phys. Rev. C, 85, 054907, (2012), arXiv:1202.5639. [t12/262] A. Kisiel, W. Florkowski, and W. Broniowski. THERMINATOR 2: THERMal heavy IoN generATOR 2. Comput. Phys. Commun., 183, 746–773, (2012), arXiv:1102.0273. [t12/263] J. Bros and J. Mund. Braid group statistics implies scattering in three-dimensional local quantum physics. Commun. Math. Phys., 315, 465–488, (2012), arXiv:1112.5785. [t12/264] S. Aoudia, S. Babak, P. Binétruy, E. Berti, C. Caprini, M. Colpi, N.J. cornish, K. Danzmann, o. Du- faux, J. Gair, O. Jennrich, P. Jetzer, A. Klein, N. Lang, T. Littenberg, A. Lobo, G. Nelemans, A. Petiteau, K. Porter, F. Schutz, A. Sesana, R. Stebbins, T. Sumner, M. Vallisneri, S. Vitale, T. McWilliams, M. Volon- teri, and H. Ward. Low-frequency gravitational-wave science with eLISA/NGO. Class. Quantum Grav., 29, 124016, (2012), arXiv:1202.0839. [t12/265] S. Aoudia, P.A. Seoane, and C. Caprini. eLISA: Astrophysics and cosmology in the millihertz regime. GW Notes, 6, 4–110, (2013), arXiv:1201.3621. [t12/266] P. Binétruy, A. Bohé, C. Caprini, and Jean-Fran¸cois Dufaux. Cosmological Backgrounds of Gravita- tional Waves and eLISA/NGO: Phase Transitions, Cosmic Strings and Other Sources. JACP, 1206, 027, (2012), arXiv:1201.0983. [t12/268] C. Bonvin, C. Caprini, and R. Durrer. Magnetic fields from inflation: the transition to the radiation era. Phys. Rev. D, 86, 02351, (2012), arXiv:1112.3901. [t12/270] T.S. Ray, de.H. Sandes, and C.A. Savoy. Gluino, wino and Higgsino-like particles without supersymmetry. Phys. Lett. B, 712, 401–406, (2012), arXiv:1112.6180. [t12/272] E. Gouillart, F. Krzakala, M. Mézard, and L. Zdeborova. Belief Propagation Reconstruction for Discrete Tomography. Inverse Problems, 29, 035003, (2013), arXiv:1211.2379. [t12/273] G. Giesen, J. Lesgourgues, B. Audren, and Y. Ali Aïmoud. CMB photons shedding light on dark matter. JACP, 1212, 008, (2012), arXiv:1209.0247. [t12/275] I. Bena, A. Buchel, and O. Dias. Horizons cannot save the Landscape. Phys. Rev. D, 87, 063012, (2012), arXiv:1212.5162. [t12/276] O. Dias, G.T. Horowitz, D. Marolf, and E. Santos. On the Nonlinear Stability of Asymptotically Anti-de Sitter Solutions. Class. Quantum Grav., 29, 235019, (2012), arXiv:1208.5772. [t12/277] O. Dias, P. Figueras, S. Minwalla, R. Monteiro, E. Santos J., and P. Mitra. Hairy black holes and solitons in global AdS 5. JHEP, 1208, 117, (2012), arXiv:1112.4447. 130 Activity Report CEA/DSM/IPhT 2008 — 2013

[t12/278] O. Dias, E. Santos, and M. Stein. Kerr-AdS and its Near-horizon Geometry: Perturbations and the Kerr/CFT Correspondence. JHEP, 1210, 182, (2012), arXiv:1208.3322. [t12/279] F. Dominguez, B.W. Xiao, J.W. Qiu, and F. Yuan. On the linearly polarized gluon distributions in the color dipole model. Phys. Rev. D, 85, 045003, (2013), arXiv:1109.6293. [t12/280] G. Gradenigo, A. Sarracino, D. Villamaina, and A. Vulpiani. Einstein relation in superdiffusive systems. J. Stat. Mech., 2012, L06001, (2012), arXiv:1205.6621. [t12/281] G. Gradenigo, A. Puglisi, and A. Sarracino. Entropy production in non-equilibrium fluctuating hydrodynamics. J. Chem. Phys., 137, 014509, (2013), arXiv:1205.3639. [t12/282] G. Gradenigo, A. Puglisi, A. Sarracino, D. Villamaina, and A. Vulpiani. Out-of-equilibrium generalized fluctuation-dissipation relations, 285–318. Wiley, (2013), arXiv:1203.4941. [t12/283] Y. Mehtar-Tani, . Salgado A., and K. Tywoniuk. New picture of jet quenching dictated by color coherence. Phys. Lett. B, 725, 357–360, (2013), arXiv:1210.7765. [t12/284] N. Armesto, H. Ma, M. Martinez, Y. Mehtar-Tani, and A. Salgado C. Coherence and broadening effects in medium induced gluon radiation. Hard Probes 2012, Sardaigne (Italie), (2012), arXiv:1209.2288. [t12/285] N. Armesto, H. Ma, M. Martinez, Y. Mehtar-Tani, and A. Salgado C. In-medium antenna radiation in t-channel. volume QNP2012 of PoS, 151, (2012), arXiv:1207.1584. Sixth International Conference on Quarks and Nuclear Physics, Ecole Polytechnique, France. [t12/286] N. Armesto, H. Ma, M. Martinez, Y. Mehtar-Tani, and . Salgado A. Interference between initial and final state radiation in a QCD medium. Mod. Phys. Lett. B, 717, 280–286, (2012), arXiv:1207.0984. [t12/288] Y. Mehtar-Tani, A. Salgado C., and K. Tywoniuk. The radiation pattern of a QCD antenna in a dense medium. JHEP, 1210, 197, (2012), arXiv:1205.5739. [t12/289] S. Ehlert, S.W. Allen, Y. Xue Q., W. Brandt. N, B. Luo, A. Von Der Linden, A. Mantz, and R.G. Morris. X-ray Bright Active Galactic Nuclei in Massive Galaxy Clusters I: Number Counts and Spatial Distribution. Mon. Not. R. Astron. Soc., 428, 3509–3525, (2013), arXiv:1209.2132. [t12/290] D.R. gerhrmann, T. Gehrmann, and M. Ritzmann. Antenna subtraction at NNLO with hadronic initial states: double real initial-initial configurations. JHEP, 1210, 47, (2013), arXiv:1207.5779. [t12/292] S. El-Showk. Bootstrapping Conformal Field Theories with the Extremal Functional Method. (2012), arXiv:1211.2810. [t12/293] I. Bena, M. Berkooz, J.d. Boer, S. El-Showk, and D.V.d. Bleeken. Scaling BPS Solutions and pure-Higgs States. JHEP, 1211, 171, (2012), arXiv:1205.5023. [t12/294] S. El-Showk, F. Paulos, D. Poland, S. Rychkov, D. Simmons Duffy, and A. Vichi. Solving the 3D Ising Model with the Conformal Bootstrap. Phys. Rev. D, 86, 025022, (2012), arXiv:1203.6064. [t12/296] S. El-Showk and M. Guica. Kerr/CFT, dipole theories and nonrelativistic CFTs. JHEP, 1212, (2012), arXiv:1108.6091. [t12/297] I. Bena, D. Borun, J.d. Boer, S. El-Showk, and M. Shigemori. Moulting Black Holes. JHEP, 1203, 094, (2012), arXiv:1108.0411. [t12/298] Z. Bern, J.J.M. Carrasco, L.J. Dixon, M.R. Douglas, M. Von Hippel, and H. Johansson. D = 5 maximally supersymmetric Yang-Mills theory diverges at six loops. Phys. Rev. D, 87, 025018, (2013), arXiv:1210.7709. [t12/299] G. Gubitosi and F. Paci. Constraints on cosmological birefringence energy dependence from CMB polarization data. JCAP, 1302, (2013), arXiv:1211.3321. [t12/300] E. Ozan, J. Juknevich, S.J. Lee, G. Perez, and G. Sterman. Three-particle templates for boosted Higgs. Phys. Rev. D, 85, 114046, (2013), arXiv:1112.1957. [t12/301] G. Bhattacharyya and T.S. Ray. Pushing the SUSY Higgs mass towards 125 GeV with a color adjoint. Phys. Rev. D, 87, 015017, (2013), arXiv:1210.0594. [t12/302] E. Bertuzzo, T.S. Ray, D.S. Hiroshi, and A. Savoy. On Composite Two Higgs Doublet Models. JHEP, 1305, 153, (2013), arXiv:1206.2623. [t12/304] G. Soyez, J. Kim, G.P. Salam, S. Dutta, and M. Cacciari. Pileup subtraction for jet shapes. Phys. Rev. Lett., 110, 162001, (2013), arXiv:1211.2811. [t12/305] al. Alcaraz Maestre, J. et and G. Soyez. The SM and NLO Multileg and SM MC Working Groups: Summary Report. Physics at TeV colliders, Les Houches, 2011-05-31/2011-06-08, (2013), arXiv:1203.6803. [t12/306] P.A.N Machado, H. Nunokawa, A. Pereira dos Santos F., and R Zukanovich-Funchal. Bulk neutrinos as an alternative cause of the gallium and reactor anti-neutrino anomalies. Phys. Rev. D, 85, 073012, (2012), arXiv:1107.2400. Appendices 131

[t13/003] A. Adare, M. Luzum, and H. Petersen. Initial state fluctuations and final state correlations: Status and open questions. Phys. Scripta, 87, 048001, (2013), arXiv:1212.5388. [t13/004] C. Monthus and T. Garel. Dynamical Barriers in the Dyson Hierarchical model via Real Space Renor- malization. J. Stat. Mech., P02023, (2013), arXiv:1212.4361. [t13/005] A. Kashani-Poor, R. Minasian, and H. Triendl. Enhanced supersymmetry from vanishing Euler number. JHEP, 1304, 058, (2013), arXiv:1301.5031. [t13/006] M. Cirelli and G. Giesen. Antiprotons from Dark Matter: Current constraints and future sensitivities. JCAP, 1304, 015, (2013), arXiv:1301.7079. [t13/008] R Zukanovich-Funchal. The Physics of Neutrinos. Cours de Physique Théorique de l’IPhT, (2013). [t13/010] F. David. Pascal Elleaume (1956-2011). LÁrchicube (to appear), (2013). [t13/011] L. Messio, C. Lhuillier, and G. Misguich. Time-reversal-symmetry-breaking chiral spin liquids: a projective symmetry group approach of bosonic mean-field theories. Phys. Rev. B, 87, 125127, (2013), arXiv:1301.2038. [t13/013] C. Monthus and T. Garel. Dynamics of Ising models near zero temperature : Real Space Renormalization Approach. J. Stat. Mech., P02037, (2013), arXiv:1212.0643. [t13/018] Alexander Kahle and R. Minasian. D-brane couplings and Generalised Geometry. (2013), arXiv:1301.7238. [t13/021] M. Cirelli. Dark Matter Indirect searches: phenomenological and theoretical aspects. DISCRETE 2012, Lisbon, 2012-12-03/2012-12-07, (2013). [t13/024] D.G. Figueroa, E. Sefusatti, A. Riotto, and F. Vernizzi. The Effect of Local non-Gaussianity on the Matter Bispectrum at Small Scales. JCAP, 08, 036, (2012), arXiv:1205.2015. [t13/027] V. Pasquier. Some remarks on the Quantum Hall Effect. In Symmetries, Integrable Systems and Representations, 497–513. Springer, (2013). [t13/034] Y. Jiang, I.K. Kostov, D. Serban, and O. Foda. A tree-level 3-point function in the su(3)-sector of planar N=4 SYM. (2013), arXiv:1302.3539. [t13/035] C. Godrèche and J.M. Luck. Asymmetric Langevin dynamics for the ferromagnetic spherical model. J. Stat. Mech., P05006, (2013), arXiv:1302.4658. [t13/037] P. Fleury, H. Dupuy, and J.-P. Uzan. Interpretation of the Hubble diagram in a non-homogeneous universe. Phys. Rev. D, 87, 123526, (2013), arXiv:1302.5308. [t13/038] J.-P. Blaizot, E. Iancu, and Y. Mehtar-Tani. Medium-induced QCD cascade: democratic branching and wave turbulence. Phys. Rev. Lett., 111, 052001, (2013), arXiv:1301.6102. [t13/039] J. Bouttier and E. Guitter. On irreducible maps and slices. (2013), arXiv:1303.3728. [t13/040] P. baratella, M. Cirelli, J. Pata, and A. Strumia. PPPC 4 DMnu: A Poor Particle Physicist Cookbook for Neutrinos from DM annihilations in the Sun. (2013). [t13/041] C.B. Jackson, G. Servant, G. Shaughnessy, T.M.P. Tait, and M. Taoso. Gamma Rays from Top-Mediated Dark Matter Annihilations. JCAP, 1307, 006, (2013), arXiv:1303.4717. [t13/042] M. Graña and H. Triendl. Lectures on String Theory Compactifications. Cours de Physique Theorique, IPhT, Saclay, 2013-03-22/2013-04-26, (2013). [t13/043] J.T. Liu and R. Minasian. Higher-derivative couplings in string theory: dualities and the B-field. (2013), arXiv:1304.3137. [t13/044] P. Brax and A.C. Davis. SUPER-Screening. Phys. Lett. B, 719, 210–217, (2013), arXiv:1212.4392. [t13/045] P. Brax, b. Clesse, and A.C. Davis. Signatures of modified gravity on the 21 cm power spectrum at reionisation. JCAP, 1301, 003, (2013), arXiv:arXiv:1207.1273. [t13/048] T. Ayral, S. Biermann, and P. Werner. Screening and Non-local Correlations in the Extended Hubbard Model from Self-Consistent Combined GW and Dynamical Mean Field Theory. Phys. Rev. B, 2013, 125149, (2013), arXiv:1210.2712. [t13/049] T. Ayral, P. Werner, and S. Biermann. Spectral Properties of Correlated Materials: Local Vertex and Nonlocal Two-Particle Correlations from Combined GW and Dynamical Mean Field Theory. Phys. Rev. Lett., 109, 226401, (2013), arXiv:1205.5553. [t13/050] H. Berestycki, R.G. Morris, and T. Sadhu. Reaction-diffusion and propagation in non-homogeneous media. IPhT, 2013-02-08/2013-03-08, (2013). [t13/053] C. Monthus and T. Garel. Dynamical barriers for the random ferromagnetic Ising model on the Cay- ley tree : traveling-wave solution of the real space renormalization flow. J. Stat. Mech., P05012, (2013), arXiv:1303.2483. 132 Activity Report CEA/DSM/IPhT 2008 — 2013

[t13/055] M. Graña, D. Marques, Alejandro Rosabal, and Gerardo Aldazabal. Extended geometry and gauged maximal supergravity. JHEP, 1306, 046, (2013), arXiv:1302.5419. [t13/056] P. Brax and C. Burrage. Atomic Precision Tests and Light Scalar Couplings. Nucl. Phys. B, 873, 614–681, (2013), arXiv:1010.5108. [t13/057] G. bossard and S. katmadas. Duality covariant multi-centre black hole systemslack holes. JHEP, 1308, 007, (2013), arXiv:1304.6582. [t13/060] H. Ueberschaer. Quantum Chaos for point scatterers on flat tori. Phil.Trans.R.Soc.A (to appear), (2013), arXiv:1212.1086v1. [t13/062] A.M. Gainutdinov and R. Vasseur. Lattice fusion rules and logarithmic operator product expansions. Nucl. Phys. B, 868, 223–270, (2013), arXiv:1203.6289. [t13/063] A.M. Gainutdinov, J.L. Jacobsen, H. Saleur, and R. Vasseur. A physical approach to the classification of indecomposable Virasoro representations from the blob algebra. Nucl. Phys. B, 873, 614–681, (2013), arXiv:1212.0093. [t13/064] M. Graña, R. Minasian, H. Triendl, and Riet Van. The quantization problem in Scherk-Schwarz compactifications. Phys. Rev. D (to appear), (2013), arXiv:1305.0785. [t13/067] H.K. Lee and M. Rho. Hyperons and Condensed Kaons in Compact Stars. (2013), arXiv:1301.0067. [t13/068] H.K. Lee, W.G. Paeng, M. Rho, and C. Sasaki. Omega-nucleon interaction and nucleon mass in dense baryonic matter. (2013), arXiv:1303.2898. [t13/069] Y.L. Ma, M. Harada, H.K. Lee, Y. Oh, B.Y. Park, and M. Rho. Dense Baryonic Matter in Hidden Local Symmetry Approach: Half-Skyrmions and Nucleon Mass. Phys. Rev. D, 88, 014016, (2013), arXiv:1304.5638. [t13/070] H.K. Lee and M. Rho. Dilatons in Dense Baryonic Matter. (2013), arXiv:1304.6447. [t13/071] P. Fleury, H. Dupuy, and J.-P. Uzan. Can all cosmological observations be accurately interpreted with a unique geometry? Phys. Rev. Lett., 111, 091302, (2013), arXiv:1304.7791. [t13/073] Bah.I . Quarter-BPS AdS5 solutions in M-theory with a T2 bundle over a Riemann surface. JHEP, 1308, 137, (2013), arXiv:1304.4954. [t13/074] A.E. Allahverdyan, R. Balian, and Nieuwenhuizen Theo M. Statistical theory of ideal quantum measurement processes. (2013), arXiv:1303.7257. [t13/075] C. Monthus and T. Garel. Dynamical barriers of pure and random ferromagnetic Ising models on fractal lattices. J. Stat. Mech., P06007, (2013), arXiv:1304.2134. [t13/076] J. Bouttier and E. Guitter. A note on irreducible maps with several boundaries. (2013), arXiv:1305.4816. [t13/077] C. Godrèche. Processus stochastiques et dynamique des systèmes hors d’équilibre. Cours de Physique Théorique, IPhT, Saclay, 2013-05-17/2013-06-28, (2013). [t13/078] I. Bena, A. Puhm, O. Vasilakis, and P.N. Warner. Almost BPS but still not renormalized. JHEP, 1309, 062, (2013), arXiv:1303.0841. [t13/079] I. Bena, J. Blaback, U.H. Danielsson, and T. Van Riet. Antibranes don’t go black. Phys. Rev. D (submitted), (2013), arXiv:1301.7071. [t13/080] I. Bena, M. Graña, S Kuperstein, and S Massai. Polchinski-Strassler does not uplift Klebanov-Strassler. JHEP, 1309, 142, (2013), arXiv:1212.4828v2. [t13/082] I. Bena, M. Guica, and W. Song. Un-twisting the NHEK with spectral flows. JHEP, 1303, 028, (2013), arXiv:1203.4227. [t13/083] Doru Sticlet, C. Bena, and P. Simon. Josephson effect in superconducting wires supporting multiple Majorana edge states. Phys. Rev. B, 87, 104509, (2013), arXiv:1211.3070. [t13/085] C. Godrèche. Rates for irreversible Gibbsian Ising models. J. Stat. Mech., 2013, P05011, (2013). [t13/086] Y. Hatta, E. Iancu, A.H. Mueller, and D.N. Triantafyllopoulos. Jet evolution from weak to strong coupling. JHEP, 1212, 114, (2012), arXiv:1210.1534. [t13/087] C. Godrèche. Dynamics of the directed Ising chain. J. Stat. Phys., 2011, P04005, (2011). [t13/088] J. Casalderrey-Solana and E. Iancu. Interference effects in medium-induced gluon radiation. JHEP, 1108, 015, (2011), arXiv:1105.1760. [t13/089] E. Iancu and D.N. Triantafyllopoulos. Higher-point correlations from the JIMWLK evolution. JHEP, 1111, 105, (2011), arXiv:1109.0302. [t13/090] E. Iancu and D.N. Triantafyllopoulos. JIMWLK evolution in the Gaussian approximation. JHEP, 1204, 025, (2012), arXiv:1112.1104. Appendices 133

[t13/096] E. Iancu and J. Laidet. Gluon splitting in a shockwave. Nucl. Phys. A, 916, 48–78, (2013), arXiv:1305.5926. [t13/098] E. Iancu. QCD in heavy ion collisions. 2011 European School of High-Energy Physics, Cheile Gradistei, Romania, (2013), arXiv:1205.0579. [t13/100] M. Bauer, D. Bernard, and A. Tilloy. Open quantum random walks: bi-stability on pure states and ballistically induced diffusion. (2013), arXiv:1303.6658. [t13/102] S. Codis, D. Pogosyan, F. Bernardeau, and T. Matsubara. Non-Gaussian Minkowski functionals and extrema counts in redshift space. (2013), arXiv:1305.7402. [t13/103] A. Taruya, T. Nishimichi, and F. Bernardeau. Precision modeling of redshift-space distortions from multi-point propagator expansion. Phys. Rev. D, 87, 083509, (2013), arXiv:1301.3624. [t13/104] G. Biroli and J.P. Garrahan. Perspective: The Glass Transition. AIP Conf. Proc., 138, 12A301, (2013), arXiv:1303.3542. [t13/105] G. Borot, B. Eynard, and N. Orantin. Abstract loop equations, topological recursion, and applications. (2013), arXiv:1303.5808. [t13/106] H. Saleur, P. Schmitteckert, and R. Vasseur. Entanglement in quantum impurity problems is non perturbative. Phys. Rev. B, 085413, (2013), arXiv:1305.1482. [t13/107] R. Vasseur, K. Trinh, S. Haas, and H. Saleur. Crossover physics in the non-equilibrium dynamics of quenched quantum impurity systems. Phys. Rev. Lett., 110, 240601, (2013), arXiv:1303.6655. [t13/108] L. Freton, E. Boulat, and H. Saleur. Infra-red expansion of entanglement entropy in the Interacting Resonant Level Model. Nucl. Phys. B, 874, 279–311, (2013), arXiv:1301.6535. [t13/109] R. Bondesan. Rectangular amplitudes, conformal blocks, and applications to loop models. Nucl. Phys. B, 847, 913–949, (2013), arXiv:1207.7005. [t13/110] D. Serban. Eigenvectors and scalar products for long range interacting spin chains II: the finite size effects. JHEP, 1308, 128, (2013), arXiv:1302.3350. [t13/111] J.-P. Blaizot, J. Liao, and L. McLerran. Gluon Transport Equation in the Small Angle Approximation and the Onset of Bose-Einstein Condensation. (2013), arXiv:1305.2119. [t13/112] J.-P. Blaizot, A.M. Nowak, and P. Warchol. Burgers-like equation for spontaneous breakdown of the chiral symmetry in QCD. Phys. Lett. B, 724, 170–175, (2013), arXiv:1303.2357. [t13/113] A.M. Gainutdinov, J.L. Jacobsen, N. Read, H. Saleur, and R. Vasseur. Logarithmic Conformal Field Theory: a Lattice Approach. (2013), arXiv:1303.2082. [t13/114] Z. Bern, L.J. Dixon, F. Febres Cordero, S. Hoeche, H. Ita, D.A. Kosower, D. Maitre, and J. Oz- eren K. Next-to-Leading Order W + 5-Jet Production at the LHC. Phys. Rev. D, 88, 014025, (2013), arXiv:1304.1253. [t13/115] F. Gelis. Factorization in high energy nucleus-nucleus collisions. Acta Phys. Pol. B, 6, 561–566, (2013), arXiv:1301.5784. [t13/117] G. Soyez, P. Salam, J. Kim, and S. Dutta. Pileup subtraction for jet shapes. Phys. Rev. Lett., 110, 162001, (2013), arXiv:1211.2811. [t13/118] M. Cacciari, P. Quiroga Arias, P.G. Salam, and G. Soyez. Jet Fragmentation Function Moments in Heavy Ion Collisions. Eur. Phys. J. C, 73, 2319, (2013), arXiv:1209.6086. [t13/119] Y. Hatta, C. Marquet, C. Royon, and G. Soyez. A QCD description of the ATLAS jet veto measurement. Phys. Rev. D, 87, 054016, (2013). [t13/120] M. alvioli, G. Soyez, and D.N. Triantafyllopoulos. Testing the Gaussian approximation to the JIMWLK equation. Phys. Rev. D, 87, 014016, (2013), arXiv:1212.1656. [t13/122] Alfimov.M , A. Belavin, and G.M. Tarnopolsky. Coset conformal field theory and instanton counting on C2=Zp. JHEP, 1308, 134, (2013), arXiv:1306.3938. [t13/124] X. Man, K.T. Delaney, C. Michael, H. Orland, G.H. Fredrickson, and C. Villet. Coherent States Formulation of Polymer Field Theory. (2013), arXiv:1301.1357. [t13/125] M. Bon, C. Micheletti, and H. Orland. McGenus: a Monte Carlo algorithm to predict RNA secondary structures with pseudoknots. Nucl. Acids Res., 41, 1895–1900, (2013). [t13/126] H. Meier, P. Auban-Senzier, C. Pépin, and D. Jerome. Resistor model for the electrical transport in quasi-one-dimensional organic (TMTSF)(2)PF6 superconductors under pressure. Phys. Rev. B, 87, 125128, (2013), arXiv:1209.6058. [t13/127] I. Paul, C. Pépin, and M.R. Norman. Equivalence of Single-Particle and Transport Lifetimes from Hybridization Fluctuations. Phys. Rev. Lett., 110, 066402, (2013). 134 Activity Report CEA/DSM/IPhT 2008 — 2013

[t13/128] C. Thomas, S. Burdin, and C. Pépin. Three-dimensional modulated spin liquid model applied to URu2Si2. Phys. Rev. B, 87, 014422, (2013), arXiv:1206.5778. [t13/129] B. Efetov K., H. Meier, and C. Pépin. Pseudogap state from quantum criticality. Nature Phys., 9, 442–446, (2013), arXiv:1210.3276. [t13/131] H. Meier, M. Einenkel, C. Pépin, and K.B. Efetov. Effect of the magnetic field on the competition between superconductivity and charge order below the pseudogap state. Phys. Rev. B, 88, 020506, (2013), arXiv:1306.6871. [t13/132] E. Iancu. From jet quenching to wave turbulence. 48th Rencontres de Moriond: QCD and Hadronic Interactions, La Thuile (Italie), (2013), arXiv:1305.7023. [t13/133] E. Bertuzzo, P.A.N Machado, and R Zukanovich-Funchal. Neutrino Mass Matrix Textures: A Data- driven Approach. JHEP, 1306, 097, (2013), arXiv:1302.0653. [t13/134] E. Bertuzzo, P.A.N Machado, and R Zukanovich-Funchal. Can New Colored Particles Illuminate the Higgs? JHEP, 1302, 86, (2013), arXiv:1209.6359. [t13/135] P. Valageas, T. Nishimichi, and A. Taruya. Matter power spectrum from a Lagrangian-space regularization of perturbation theory. Phys. Rev. D, 87, 083522, (2013), arXiv:1302.4533. [t13/136] P. Brax and P. Valageas. Impact on the power spectrum of Screening in Modified Gravity Scenarios. Phys. Rev. D, 88, 023527, (2013), arXiv:1305.5647. [t13/138] E.R. Ariola and W. Broniowski. Scalar-isoscalar states, gravitational form factors, and dimension-2 condensates in a large-Nc Regge approach. volume 1343 of AIP Conf. Proc., 361–363, (2011), arXiv:1011.5176. [t13/139] P. Bozec and W. Broniowski. Collective dynamics of the high-energy proton-nucleus collisions. Phys. Rev. C, 88, 014903, (2013), arXiv:1304.3044. [t13/140] A. Olszewski and W. Broniowski. Forward-backward multiplicity correlations in relativistic heavy-ion collisions in a superposition approach. (2013), arXiv:1303.5280. [t13/141] P. Bozec and W. Broniowski. Size of the emission source and collectivity in ultra-relativistic p-Pb collisions. Phys. Lett. B, 720, 250–253, (2013), arXiv:1301.3314. [t13/142] P. Bozec and W. Broniowski. Charge balancing and the fall off of the ridge. Nucl. Phys. A, 904, 482, (2013), arXiv:1210.4315. [t13/143] P. Masjuan, E.R. Arriola, and W. Broniowski. Meson dominance of hadron form factors and large-Nc phenomenology. Phys. Rev. D, 87, 014005, (2013), arXiv:1210.0760. [t13/145] S.E. Derkachov, G. Korchemsky, and A. Manashov. Dual conformal symmetry on the light-cone. (2013), arXiv:1306.5951. [t13/148] S. Nonnenmacher and M. Zworski. Decay of correlations for normally hyperbolic trapping. (2013), arXiv:1302.4483. [t13/149] E. Gull, O. Parcollet, and J. Millis. Superconductivity and the Pseudogap in the two-dimensional Hubbard model. Phys. Rev. Lett., 110, 216405, (2013), arXiv:1207.2490. [t13/150] R. Peschanski. Dynamical entropy of dense QCD states. Phys. Rev. D, 87, 034042, (2013), arXiv:1211.6911. [t13/152] F. Krzakala, C. Moore, E. Mossel, J. Neeman, A. Sly, L. Zdeborova, and P. Zhang. Spectral redemption: clustering sparse networks. (2013), arXiv:1306.5550. [t13/153] C. Schülke, F. Castalgirone, F. Krzakala, and L. Zdeborova. Blind Calibration in Compressed Sensing using Message Passing Algorithms. (2013), arXiv:1306.4355. [t13/154] J. barbier, F. Krzakala, L. Zdeborova, and P. Zhang. The hard-core model on random graphs revisited. International Meeting on "Inference, Computation, and Spin Glasses" (ICSG2013), Sapporo, Japon, (2013), arXiv:1306.4121. [t13/155] J Barbier, F. Krzakala, L. Zdeborova, and Z. Pan. Robust error correction for real-valued signals via message-passing decoding and spatial coupling. IEEE Information Theory Workshop, Sevilla, Espagne, (2013), arXiv:1304.6599. [t13/156] Y. Lokhov, M. Mézard, H. Ohta, and L. Zdeborova. Inferring the origin of an epidemy with dynamic message-passing algorithm. (2013), arXiv:1303.5315. [t13/157] P. Zhang, F. Krzakala, M. Mézard, and L. Zdeborova. Non-adaptive pooling strategies for detection of rare faulty items. (2013), arXiv:1302.0189. [t13/158] F. Krzakala, M. Mézard, and L. Zdeborova. Phase Diagram and Approximate Message Passing for Blind Calibration and Dictionary Learning. (2013), arXiv:1301.5898. [t13/159] G. Giecold, F. Orsi, and A. Puhm. Insane Anti-Membranes? (2013), arXiv:1303.1809. Appendices 135

[t13/160] M.R. smaoui, F. Poitevin, M. Delarue, P. Koehl, H. Orland, and J. Waldispuhl. Computational Assembly of Polymorphic Amyloid Fibrils Reveals Stable Aggregates. Biophys. J., 104, 683–693, (2013). [t13/161] A Lazarescu. Matrix Ansatz for the Fluctuations of the Current in the ASEP with Open Boundaries. J. Phys. A, 46, 145003, (2013), arXiv:1212.3366. [t13/163] O. Dias and E. Santos. Boundary Conditions for Kerr-AdS Perturbations. (2013), arXiv:1302.1580. [t13/164] O. Dias and H.S. Reall. Algebraically special perturbations of the Schwarzschild solution in higher dimensions. Class. Quantum Grav., 30, 095003, (2013), arXiv:1301.7068. [t13/165] F. Dominguez, A.M. Stasto, C. Marquet, and B.W. Xiao. Universality of multi-particle production in QCD at high energies. Phys. Rev. D, 87, 034007, (2013), arXiv:1210.1141. [t13/166] T. Difmote, M. Gabella, and A.B. Goncharov. K-Decompositions and 3d Gauge Theories. (2013), arXiv:1301.0192. [t13/167] G. Gradenigo, A. Sarracino, A. Puglisi, and H. Touchette. Fluctuation relations without uniform large deviations. J. Phys. A, 46, 335002, (2013), arXiv:1303.2851. [t13/168] Hafermann.H , P. Werner, and E. Gull. Efficient implementation of the continuous-time hybridization expansion quantum impurity solver. Comput. Phys. Commun., 184, 1280–1286, (2013), arXiv:1302.4083. [t13/170] A.L. Erickcek, N. Barnaby, C. Burrage, and Z. Huang. Catastrophic Consequences of Kicking the Chameleon. Phys. Rev. Lett., 110, 171101, (2013), arXiv:1304.0009. [t13/172] B. Efetov K. Quantum criticality and high-temperature superconductivity. 2013-09-13/2013-10-11, (2013). [t13/174] K. Hristov, S. katmadas, and V. Pozzoli. Ungauging black holes and hidden supercharges. JHEP, 1301, (2013), arXiv:1211.0035. [t13/176] J Kim. A Thermal Infrared Imaging Study of Very Low-Mass, Wide Separation Brown Dwarf Com- panions to Upper Scorpius Stars: Constraining Circumstellar Environments. Astrophys. J., 767, 31, (2013), arXiv:1302.0582. [t13/177] R.S. Bhalerao, J.-Y. Ollitrault, and S. Pal. Event-plane correlators. Phys. Rev. C, 88, 024909, (2013), arXiv:1307.0980. [t13/179] Y. Mehtar-Tani, J.G. Mihano, and K. Tywoniuk. Jet physics in heavy-ion collisions. Int. J. Mod. Phys. A, 28, 1340013, (2013), arXiv:1302.2579. [t13/181] S. Chakdar, T. Li, S. Nandi, and S.K. Rai. Top SU(5) Models: Baryon and Lepton Number Violating Resonances at the LHC. Phys. Rev. D, 87, 096002, (2013), arXiv:1302.6942. [t13/182] W.T. Giele, L. Hartgring, D.A. Kosower, E. Laenen, J. Larkoski, J. Lopez-Villarejo, M. Ritzmann, and Z. Skands P. The Vincia Parton Shower. XXI. International Workshop on Deep-Inelastic Scattering and Related Subjects (DIS2013), Marseille, France, (2013), arXiv:1307.1060. [t13/183] R. Kedem and P. Di Francesco. Quantum cluster algebras and fusion products. Int. Math. Res. Not., 2013, rnt004, (2013), arXiv:1109.6261. [t13/184] R. Louf, P. Jensen, and M. Barthélémy. Emergence of hierarchy in cost-driven growth of spatial networks. Proc. Nat. Acad. Sci., 110, 8824–8829, (2013), arXiv:1305.3282. [t13/185] F. Gelis and N. Tanji. Formulation of the Schwinger mechanism in classical statistical field theory. Phys. Rev. D, 87, 125035, (2013), arXiv:1303.4633. [t13/186] C.B. Jackson, G. Servant, G. Shaughnessy, T.M.P. Tait, and M. Taoso. Gamma-ray lines and One-Loop Continuum from s-channel Dark Matter Annihilations. JCAP, 1307, 021, (2013), arXiv:1302.1802. [t13/187] B. Wu. On holographic thermalization and gravitational collapse of tachyonic scalar fields. JHEP, 1304, 44, (2013), arXiv:1301.3796. [t13/188] T. Liou, A.H. Mueller, and B. Wu. Radiative pT-broadening of high energy quarks and gluons in QCD matter. Nucl. Phys. A, 916, 102–125, (2013), arXiv:1304.7677. [t13/193] P. Brax, C. Burrage, A.C. Davis, and G. Gubitosi. Cosmological Tests of the Disformal Coupling to Radiation. (2013), arXiv:1306.4168. [t13/198] M. Barthélémy, P. Bordin, H. Berestycki, and M. Gribaudi. Self-organization versus top-down planning in the evolution of a city. Scientific Report, 3, 2153, (2013), arXiv:1307.2203. [t13/205] D. Maitre, Z. Bern, L.J. Dixon, F. Febres Cordero, S. Hoeche, H. Ita, D.A. Kosower, and J. Ozeren K. High multiplicity W+jets predictions at NLO. XXI. International Workshop on Deep-Inelastic Scattering and Related Subjects (DIS2013), Marseille, France, (2013), arXiv:1308.3986. [t13/216] C. Caprini. Magnetic fields from inflation: the transition to the radiation era. Moriond 2012 Cosmology session, (2013). 136 Activity Report CEA/DSM/IPhT 2008 — 2013

[t13/220] E. Moulin, M. Cirelli, P. Panci, D. Serpico P., and A. Viana. High energy gamma-ray constraints on decaying Dark Matter. 33ND INTERNATIONAL COSMIC RAY CONFERENCE, Rio de Janeiro, (2013), arXiv:1307.7983. [t13/223] S. Ribault. Conformal ﬁeld theory in two dimensions. (2013). [t13/224] H.K. Lee and M. Rho. Topology Change and Tensor Forces for the EoS of Dense Baryonic Matter. (2013), arXiv:1306.4584. Appendices 137

A.7 PhDs at IPhT

Graduate schools - Écoles doctorales Presently IPhT is aﬃliated to 2 “écoles doctorales”:

ED 107 École doctorale de physique de la région parisienne. ED 447 (alias EDX) École doctorale de l’École polytechnique.

A.7.1 Habilitation thesis - Habilitation à diriger des recherches Since 2008, 6 permanent members of IPhT have defended their Habilitation thesis, which brings to 16 the total number of HDR in our Institute (14 CEA + 2 CNRS).

Pépin Catherine Quantum critical points in strongly correlated electron compounds (Points critiques quantiques dans les composés à fortes corrélations électroniques) [t08/315], Université Pierre et Marie Curie - Paris 6, Spécialité : Physique Théorique, 06/11/2008.

Serban Didina Integrability and the AdS/CFT correspondence (Intégrabilité et correspondance AdS/CFT) [t10/042], Université Paris-Sud 11, Spécialité : Physique Théorique, 29/05/2009.

Nonnenmacher Stéphane A few aspects of quantum chaos (Quelques aspects de chaos quantique) [t09/127], Université Paris-Sud 11, Spécialité : Mathématiques (option Physique Mathématique), 05/06/2009.

Bena Iosif Black Holes, Black Rings and their Microstates (Trous noirs, anneaux noirs et leur microétats) [t09/347], Université Pierre et Marie Curie - Paris 6, Spécialité : Physique, 16/06/2009.

Valageas Patrick Formation of large-scale structures in cosmology: gravitational dynamics (Formation des structures de grande échelle en cosmologie: dynamique gravitationnelle) [t10/203], Université Paris Diderot - Paris 7, Spécialité : Astrophysique, 03/12/2010.

Gélis François The initial stages of high energy heavy ion collisions (Les premières étapes des collisions d’ions lourds à haute énergie) [t11/232], Université Paris-Sud 11, Spécialité : Physique Théorique, 07/12/2011.

A.7.2 PhD defenses since 2008 Between January 2008 and June 2013, 30 PhD theses prepared at IPhT have been defended:

Vergu Cristian Twistors, strings and supersymmetric gauge theories (Twisteurs, cordes et théories de jauge super- symétriques) [t08/120], supervised by D. Kosower, 15/07/2008.

Delaunay Cédric Electroweak symmetry breaking: origin and consequences (Brisure de symétrie électrofaible : origine et conséquences) [t08/238], supervised by C. Grojean, 02/10/2008.

Candu Constantin Discretisation of conformal sigma models on superspheres and projective superspaces (Discrétisation des modèles sigma invariants conformes sur des supersphères et superespaces projectifs) [t08/237], supervised by H. Saleur, 31/10/2008. 138 Activity Report CEA/DSM/IPhT 2008 — 2013

Michel Yann Properties of extremal black holes in supergravity and string theory (Aspect des trous noirs extrémaux en supergravité et en théorie des cordes), supervised by P. Vanhove and B. Pioline, 01/12/2008.

Beuf Guillaume Contributions to the study of strong interactions at high energy and high density (Contributions à l’étude des interactions fortes à haute énergie et haute densité) [t09/314], supervised by R. Peschanski, 26/06/2009.

Bon Michaël Prediction of secondary structures of RNA with pseudoknots (Prédiction de structures secondaires d’ARN avec pseudo-noeuds) [t09/256], supervised by H. Orland, 21/09/2009.

Prolhac Sylvain Exact results for the asymmetric simple exclusion process (Méthodes exactes pour le modèle d’exclusion asymétrique) [t09/161], supervised by K. Mallick, 23/09/2009.

Volin Dmytro Quantum integrability and functional equations (Intégrabilité quantique et équations fonctionnelles) [t09/283], supervised by I. Kostov and D. Serban, 25/09/2009.

Benlagra Adel Quantum criticality in 3He bi layers and heavy fermion compounds (Criticalité quantique dans les bi-couches d’ 3He et les composés à fermions lourds) [t09/274], supervised by C. Pépin, 09/11/2009.

Sarlat Thomas A ﬁnite dimensional model for the glass transition (Un modèle de dimension ﬁnie pour la transition vitreuse) [t09/296], supervised by A. Billoire, 13/11/2009.

Schenck Emmanuel Open quantum systems and semiclassical methods (Systèmes quantiques ouverts et méthodes semi- classiques) [t09/266], supervised by S. Nonnenmacher, 17/11/2009.

Ruef Clément Black holes in string theory: towards an understanding of quantum gravity (Trous noirs en théorie des cordes : vers une compréhension de la gravité quantique) [t10/083], supervised by I. Bena, 18/06/2010.

Bourgine Jean-Émile Matrix models and boundary problems in Liouville gravity (Modèles de matrices et problèmes de bord dans la gravité de Liouville) [t10/168], supervised by I. Kostov, 18/06/2010.

Gombeaud Clément Thermalization in ultrarelativistic heavy ion collisions (Thermalisation dans les collisions d’ions lourds ultrarelativistes) [t10/199], supervised by J.-Y. Ollitrault, 02/07/2010.

Dubail Jérôme Boundary conditions in some non-unitary conformal ﬁeld theories (Conditions aux bords dans des théories conformes non unitaires) [t10/198], supervised by H. Saleur and J. Jacobsen, 07/09/2010. Appendices 139

Messio Laura Ground states and excitations of frustrated magnetic systems, from the classical limit to the quantum case (Etats fondamentaux et excitations de systèmes magnétiques frustrés, du classique au quantique) [t10/144], supervised by G. Misguich and C. Lhuillier (LPTMC-UPMC), 14/09/2010. Marchal Olivier Geometrical and integrable aspects of random matrix models (Aspects géométriques et intégrables des modèles de matrices aléatoires) [t10/200], supervised by B. Eynard and J. Harnad (Montreal), 20/12/2010. Parmentier Jeanne Phenomenological aspects of supersymmetry breaking (Aspects phénoménologiques de la brisure de supersymétrie) [t11/226], supervised by S. Lavignac and E. Dudas (X-CPhT), 11/07/2011. Borot Gaëtan Some problems in enumerative geometry, random matrices, integrability, studied via geometry on Rie- mann surfaces (Quelques problèmes de géométrie énumérative, de matrices aléatoires, d’intégrabilité, étudiés via la géométrie des surfaces de Riemann) [t11/225], supervised by B. Eynard, 23/06/2011. Cluzel Émeline Inflation in string cosmology (Inflation en cosmologie des cordes) [t11/228], supervised by P. Brax and J. Martin (IAP), 22/09/2011. Giecold Grégory Gauge/String duality and field theories at strong coupling (Correspondance AdS/CFT, ses extensions et applications aux théories de champs à fort couplage) [t11/224], supervised by I. Bena and E. Iancu, 2008–17/06/2011. Goi Enrico Aspects of supersymmetry breaking in type IIA superstring theory: vacua and deformations (Quelques aspects de la brisure de supersymétrie en théorie des cordes de type IIA: vides et déformations) [t11/227], supervised by R. Minasian, 21/09/2011. Grandclaude Hélène Dynamics of out-of-equilibrium networks (Dynamique des réseaux hors-équilibre) [t11/230], supervised by C. Godrèche, 10/11/2011. Stephan Jean-Marie Entanglement in low-dimensional quantum systems (Intrication dans des systèmes quantiques à basse dimension) [t11/231], supervised by V. Pasquier, 12/12/2011. Orsi Francesco Flux Compactifications in String Theory (Compactifications avec flux en théorie des cordes) [t12/129], supervised by M. Grana, 02/02/2012. Bondesan Roberto Supersymmetric field theory and statistical mechanics models (Théorie de champs supersymétrique et mécanique statistique) [t12/131], supervised by H. Saleur and J. Jacobsen, 14/09/2012. Peng Zongren Topics in N=4 Yang-Mills theory (Sujets dans la théorie de Yang-Mills N=4) [t12/133], supervised by D. Kosower, 19/10/2012. Sciolla Bruno Out-of-equilibrium quantum dynamics for cold atoms (Dynamique quantique hors-équilibre pour atomes froids) [t12/130], supervised by G. Biroli, 13/09/2012. 140 Activity Report CEA/DSM/IPhT 2008 — 2013

Shenderovich Igor Integrable structures in gauge theories and supersymmetric string theories (Structures intégrables dans les théories de jauge et dans les théories des cordes supersymétriques) [t12/132], supervised by I. Kostov and D. Serban, 03/10/2012.

Van de Rijt Nicolas Signatures of the primordial universe in large scale surveys (Signatures de l’univers primordial dans les grands relevés cosmologiques) [t12/080], supervised by F. Bernardeau and F. Vernizzi, 31/06/2012.

A.7.3 Current PhD students In June 2013, IPhT encompasses 21 “local" PhD students (listed below), plus 5 external graduate students visiting our lab for several months.

Laidet Julien Frontiers for QCD at the LHC (Frontières de la chromodynamique quantique au LHC), supervised by F. Gelis and E. Iancu, 2010–2013.

Lazarescu Alexandre Finite size results for the open asymmetric exclusion process (Le processus d’exclusion asymétrique ouvert: quelques résultats en taille ﬁnie), supervised by K. Mallick, 2010–2013.

Massai Stefano Non-supersymmetric compactiﬁcations of string theory (Compactiﬁcations non supersymétriques de la théorie des cordes), supervised by M. Grana, 2010–2013.

Puhm Andrea Black holes in string theory (Trous noirs en théorie de cordes), supervised by I. Bena, 2010–2013.

Tourkine Piotr UV completeness of quantum gravity theories (Complétude ultraviolette des théories de gravité quantique), supervised by P. Vanhove, 2010–2014.

Vasseur Romain Field Theory and non-interacting fermionic systems with quenched disorder (Théorie des champs et systèmes d’électrons libres désordonnés), supervised by H. Saleur and J. Jacobsen, 2010–2013.

Epelbaum Thomas Approach to equilibrium in high energy hadron collisions (Approche de l’équilibre dans les collisions hadroniques à haute énergie), supervised by F. Gélis, 2011–2014.

Ochirov Alexander Symmetry and precision for hard processes in QCD (Symétries et calculs de précision des processus fortement inélastiques en QCD), supervised by R. Britto, 2011–2014.

Penteado-Sabetta Thiago Quantum antiferromagnets and spin liquids (Systèmes antiferromagnétiques quantiques et liquides de spin), supervised by G. Misguich, 2011–2014.

Retinskaya Ekaterina Phenomenology of nucleus-nucleus collisions at the LHC (Phénoménologie des collisions noyau-noyau au LHC), supervised by J.-Y. Ollitrault, 2011–2014. Appendices 141

Vernier Eric Geometrical models for the quantum Hall transitions and disordered electronic systems (Modèles géométriques pour la transition de Hall et les systèmes électroniques désordonnés), supervised by H. Saleur, 2011–2014.

Dutreix Clément Electronic Properties of Graphene (Propriétés électroniques du graphène), supervised by C. Bena, 2011–2014.

Ayral Thomas New approaches to the strong correlation problem and applications (Nouvelles approches des problèmes de corrélations fortes, et applications), supervised by O. Parcollet, 2012–2015.

Dupuy Hélène Precision cosmology with large cosmological structures (Cosmologie de précision avec les grandes structures de l’univers), supervised by F. Bernardeau, 2012–2015.

Duval Antoine Integrable models and geometry (Modèles intégrables et géométrie), supervised by V. Pasquier, 2012–2015.

Giesen Gaëlle Dark matter phenomenology (Phénoménologie de la matière noire), supervised by M. Cirelli, 2012–2015.

Gleyzes Jérôme Dark energy and the formation of large cosmological structures (L’énergie noire et la formation des grandes structures de l’univers), supervised by F. Vernizzi, 2012–2015.

Grönqvist Hanna Singularities of scattering amplitudes in gauge theory (Singularités des amplitudes de diﬀusion dans les théories de jauge), supervised by R. Britto, 2012–2015.

Jiang Yunfeng Correlation functions in supersymmetric gauge and string theories (Fonctions de corrélation en théorie des champs supersymétriques et en théorie des cordes), supervised by I. Kostov & D. Serban, 2012–2015.

Louf Rémy Formation and temporal evolution of spatial networks (Formation et évolution temporelle des réseaux spatiaux), supervised by M. Barthelemy, 2012–2015.

Schmauch Benoît New physics in the leptonic sector (Nouvelle physique dans le secteur des leptons), supervised by S. Lavignac, 2012–2015. 142 Activity Report CEA/DSM/IPhT 2008 — 2013

A.8 Teaching activities

A.8.1 IPhT graduate lectures Each year we organize 5-6 graduate lectures, each one taking place at IPhT, 2 hours/week during 4-6 weeks. Most of these lectures are part of the PhD program of the ED 107 “École doctorale de physique de la région parisienne”. They are mainly intended for PhD students, but they are open for everybody. More details are given on the IPhT web site.

Fayet Pierre (LPT, ENS Paris) Le modèle standard supersymétrique; 12 h; Jan 2008.

Biroli Giulio (IPhT) Transition vitreuse et systèmes hors d’équilibre; 12 h; Mar 2008.

Douçot Benoît (LPTHE, Paris 6-7) Cohérence quantique de systèmes macroscopiques; 12 h; May 2008.

Wiegmann Paul (Chicago Univ.) Hydrodynamic instabilities in quantum liquids; 6 h; Sep 2008.

Saleur Hubert (IPhT) Théorie des champs à basse dimension : introduction et applications; 16 h; Oct 2008.

Deruelle Nathalie (APC, Paris 7) Les trous noirs en relativité générale; 12 h; Jan 2009.

Bauer Michel (IPhT and LPT-ENS Paris) Probabilités et processus stochastiques, pour les physiciens (et les curieux); 12 h; Mar 2009.

Mallick Kirone (IPhT) Développements récents en mécanique statistique loin de l’équilibre; 8 h; May 2009.

Houdayer Jérôme (IPhT) Ondelettes et analyse numérique; 10 h; Jun 2009.

Nonnenmacher Stéphane (IPhT) Chaotic dynamical systems; 12 h; Sep 2009.

Parcollet Olivier (IPhT) Quantum many body problem: selected topics; 10 h; Nov 2009.

Barthelemy Marc (IPhT) Dynamical processes on complex networks; 8 h; Jan 2010.

Petrini Michela (LPTHE, Paris 6) The AdS/CFT correspondence; 10 h; Mar 2010.

Shifman Mikhail (Minnesota Univ. and Chaire Blaise Pascal) and Yung Alexei V. (PNPI, S. Petersburg) Dynamics of supersymmetric gauge theories; 12 h; May 2010.

Peschanski Robi (IPhT) and Janik Romuald (Jagellonian Univ., Krakow) The dynamics of quark-gluon plasma and AdS/CFT correspondence; 8 h; Nov 2010.

Britto Ruth (IPhT) Introduction to scattering amplitudes; 8 h; Jan 2011.

Durrer Ruth (Geneva Univ.) Cosmology and the cosmic microwave background; 12 h; Mar 2011.

Kempe Julia (LRI, Paris 11) Quantum algorithms and information; 6 h; Apr 2011. Appendices 143

Zia Royce (Virginia Tech.) Exploring nonequilibrium statistical mechanics with driven diﬀusive systems; 6 h; May 2011.

Zinn-Justin Jean (IRFU& IPhT) Semiclassical methods: From quantum mechanics to quantum ﬁeld theory; 10 h; Nov-Dec 2011.

Bena Iosif (IPhT) and El-Showk Sheer (IPhT) Black holes in string theory; 12 h; Jan-Fev 2012.

Efetov Konstantin (Bochum & IPhT) Supersymmetry in condensed matter and statistical physics; 10 h; Mar-Apr 2012.

David François (IPhT) A quick introduction to the quantum formalism; 8 h; May 2012.

Zukanovich-Funchal Renata (San Paolo & IPhT) The physics of neutrinos; 4 h; Jan 2013.

Graña Mariana (IPhT) and Triendl Hagen (IPhT) String theory compactiﬁcations; 12 h; Mar-Apr 2013.

Godrèche Claude (IPhT) Processus stochastiques et dynamique des systèmes hors d’équilibre; 10 h; May-Jun 2013. 144 Activity Report CEA/DSM/IPhT 2008 — 2013

A.8.2 Teaching in university or “grandes écoles” In french universities, the undergraduate studies last three years, L1, L2 and L3; the master lasts two years, M1 and M2; ﬁnally, the PhD lasts generally three years.

Barthelemy Marc Master Science des systèmes complexes ISC-PIF, Paris Dec 2011 Master complex systems,U. Cergy-Pontoise, Nov 2011 Graduate lectures, U. Lyon, Ethics and publicationApr 2011 Postdoctoral lectures U. Cagliari Feb 2011

Bauer Michel M1 ENS, Introduction to quantum ﬁeld theory, 30 h/year, 2007–2011 M2 ENS, Probability and stochastic processes for physicists, 45 h/year 2011-2012

Bernardeau Francis Prof temps incomplet, École polytechnique, ,General physics, special relativity and quantum physics, 64 h/year, 2008–

Biroli Giulio Prof temps incomplet École polytechnique, Quantum mechanics and statistical physics, 72 h, 2011–

Blaizot Jean-Paul Graduate course University of Tokyo, Quantum fields at finite temperature: from tera to nano Kelvin, 15 h, 2009 Graduate course, University of Nanjing (China) Quantum fields at finite temperature: from tera to nano Kelvin, 15 h, 2011

Bouttier Jérémie L3 ESPCI, Mathematical methods for physicists, 24 h/year, 2009–2012 PAST ENS Ulm, Math-Physique, 2012–

Britto Ruth M1/M2 EPFL Lausanne, Constructing scattering amplitudes, 14 h, 2010

Caprini Chiara L3 ESPCI, Exercises in Mathematics

David François M2 ENS, Introduction to statistical ﬁeld theory, 40 h/year, 2007 – 2011 Master Perimeter Scholar International, Perimeter Institute, Quantum ﬁeld theory II, 20 h/year, 2009–2013

Di Francesco Philippe Graduate courses Univ. Illinois, Urbana-Champaign, Apr 2012 Graduate courses Univ. Helsinki, Random Geometry, Apr 2012 Chern-Simons Research Lectures Univ. Berkeley, 45 h, 2009

Duplantier Bertrand M1 École polytechnique Physics of polymers and biological membranes 36 h 2008 M2 EPFL, Lausanne, The polymer physics of DNA, 16 h, 2009 Graduate course, KTH Stockholm, 29 mai - 4 juin 2012

Gelis François M2 NPAC, Paris 11, Introduction to the physics of heavy ion collisions, 6 h/year, 2008 – 2013

Graña Mariana Graduate course Univ. Buenos Aires, Topics in compactiﬁcations, dualities and phenomenology in String Theory, 2011 Graduate course Univ. Buenos Aires, Generalized Geometries and String Compactiﬁcations, 2012 Appendices 145

Grojean Christophe M2 EPFL Lausanne, Introduction to SM, 39 h, 2011

Kosower David Graduate course Weizmann Institute, On-shell methods in gauge ﬁeld theory, 12 h, 2010

Lavignac Stéphane M2 ENS, Exercises in gauge theory of electroweak interactions, 12 h/year, 2008 – 2013 M2 NPAC, Paris 11, Cours physique des neutrinos, 2012–

Mallick Kirone M2 ENS, TD physique statistique, 20 h, 2012 Graduate course, Weizmann Institute, 2012

Minasian Ruben M2 ENS, Geometrical methods of theoretical physics, 39 h/year, 2008 – 2013

Ollitrault Jean-Yves L3, M1 École polytechnique, Quantum physics, statistical mechanics, particle physics, 64 h/year, 2008 – 2013

Soyez Grégory M2 ENS, Exercises in quantum chromodynamics, 8 h, 2011–2013

Vanhove Pierre Graduate course IHES, Perturbative quantum gravity, 20 h, 2011 M1, Ecole Polytechnique, TD relativity, quantum mechanics, 2012–2013

Vernizzi Filippo Graduate course Astronomy Astrophysics IdF, Primordial cosmology, 2011,2013 Graduate course, Scuola Normale di Pisa, 2011–1013

Zdeborova Lenka M1, M2, PhD Tokyo Institute of Technology, Statistical physics on random graphs, 9 h, 2010 M1, ESPCI, Paris. Tutorials in statistical physics, 16 h/year, 2008, 2012,2013 M2 Complex Systems, ENS Lyon, 2012 L3, “Ateliers Energies”, ENS Ulm, 2011 146 Activity Report CEA/DSM/IPhT 2008 — 2013

Teaching in summer schools

Barthelemy Marc Complex Systems summer school, Paris, July 2011 Complex Systems summer school, Paris, July 2012 Visitor program, Center for discrete mathematics, Queen Mary Univ., London, Nov 2012 Complex Systems summer school, Le Havre, July 2013

Bauer Michel School on stochastic geometry, the stochastic Loewner evolution, and non-equilibrium growth processes, Trieste, A short introduction to critical interfaces in 2d, 4 h, July 2008 Modern applications of conformal invariance, topical school in statistical physics, Nancy, A short introduction to critical interfaces in 2d, 4 h, March 2011

Bernardeau Francis Trimestre “Gravasco”, IHP, Paris, fall 2013 “Post-Planck cosmology”, Les Houches , July 2013

Biroli Giulio Beg Rohu summer school 2010, Statistical dynamics, 13.5 h Aug 2010

Brax Philippe Cracow school of theoretical physics, Zakopane, Poland, Astroparticle Physics in the LHC Era, May 2012

Britto Ruth Dutch research school of theoretical physics, Driebergen, NL, Scattering amplitudes in gauge theories, 14 h, Feb 2010 Spring course of the international graduate school Bielefeld-Paris-Helsinki, Orsay, Multi-leg amplitudes, 3 h, Mar 2010 Summer school on the structure of local quantum ﬁelds, Les Houches, Recursive construction of amplitudes, 6 h, Jun 2010

Cirelli Marco Universenet summer school and meeting, Barcelona, Spain, Dark matter, 2 h, Sep 2009 Carpathian summer school of physics, Sinaia, Romania, Hoping to indirectly detect dark matter with cosmic rays, 3 h, Jun 2010 Universenet summer school and meeting, Lecce, Italy, Dark matter indirect detection, 1 h, Sep 2010 International School on Astro-Particle Physics, Heidelberg, Introduction to the dark components of the universe, 3 h, Jul 2011 ICTP School on Cosmology, Trieste, 4h, July 2012 Graduate School “Symmetry Breaking” Mainz, Bad Kreuznach, 2h, Sep 2012 6th TRR33 Winter School, Passo del Tonale, Italy, 5h, Dec 2012

David François Summer school of mathematical physics, Shanghai institute of advanced studies, Quantum ﬁeld theory and renormalisation group, 20 h, Aug 2009

Di Francesco Philippe Combinatorics and statistical mechanics , ESI Vienna, Integrable models of statistical physics and enumerative combinatorics, 13 h,Jul 2008 Semester “Statistical physics, combinatorics and probability: from discrete to continuous models” IHP Paris, Integrable combinatorics, 16 h, fall 2009 Center for quantum geometry of moduli spaces Aarhus Univ., Denmark Master class: cluster algebras, 4 h, Jun 2010 Appendices 147

Clay mathematics institute 2010 summer school “Probability and statistical physics in two and more dimensions”, Buzios, Brazil Integrable combinatorics, 6 h, Jul 2010 Workshop/school “Representation Theory in Mathematics and Physics”, ETH Zurich, June 4-8 2012 NCGOA 2012 conference, “Conformal Field Theory and von Neumann algebras”, Vanderbilt Univer- sity, Nashville, U.S.A., May 4-10, 2012 International Summer School in Math Physics III, “Probabilistic aspects of contemporary physics”, Feza Gürsey Institute, Istanbul, June-July 2012

Duplantier Bertrand Exact methods in low-dimensional statistical physics and quantum computing, Les Houches, A rigorous perspective on Liouville quantum gravity and the KPZ relation, 1.5 h, Jul 2008 Winter School UK-Japan "String Theory, Geometry, and Mathematical Physics", Jan 2012, Oxford

Eynard Bertrand From integrable structures to topological strings and back, Sissa, Trieste, Symplectic invariants of spectral curves and their applications to enumerative geometry, 6 h, Sep 2008 A new recursion from random matrices and topological string theory, IPMU Tokyo Symplectic invariants of spectral curves and their applications to enumerative geometry, 5 h, Dec 2008 Statcomb school on embedded random graphs, IHP, Paris Enumeration of maps, 5 h, Autumn 2009 Trimester matrix models and geometry CAMGSD thematic period, IST Lisbon Matrix models for topological strings, 5 h, Autumn 2009 From matrix models to algebraic geometry, Northeastern, Boston From matrix models to algebraic geometry, 4 h, Oct 2010

Gelis François Hadronic collisions at the LHC and QCD at high density, Les Houches, France, Gluon saturation from DIS to AA collisions, 6 h, Apr 2008 Nuclear astrophysics and heavy ion collisions, Dubna, Russia Color glass condensate and initial stages of heavy-ion collisions, 3 h, Jul 2008 Initial conditions in heavy ion collisions collisions, Goa, India Initial conditions in AA collisions, 3 h, Sep 2008 Aspects of perturbative QCD, Orsay, France Introduction to perturbative QCD, 3 h, Mar 2010

Grojean Christophe Third graduate school in physics at colliders: from twistors to Monte Carlos, Turin, Italy, Beyond the Higgs: new ideas on electroweak symmetry breaking, 6 h, Jan 2008 IPM international school and workshop on electroweak physics, Teheran, Iran Beyond the Higgs: new ideas on electroweak symmetry breaking, 3 h, May 2008 Ecole de Gif 2008, Ecole Polytechnique, France Beyond the Higgs: new ideas on electroweak symmetry breaking, 4h30, Sep 2008 VII latin american symposium on high energy physics (SILAFAE) + IX Argentine symposium of particles and ﬁelds (SAPyC), Bariloche, Argentina Beyond the standard model at the LHC: new ideas on electroweak symmetry breaking, 2 h, Jan 2009 CERN academic training, CERN Electroweak symmetry breaking: to Higgs or not to Higgs , 3 h, Feb 2009 Ecole de physique des particules et cosmologie, Oran, Algeria Beyond the Higgs, 4 h, May 2009 The XIV LNF spring school "Bruno Touschek" in nuclear, subnuclear and astroparticle physics, Frascati, Italy Beyond the standard model: the LHC reach, 4h30, May 2009 148 Activity Report CEA/DSM/IPhT 2008 — 2013

Fourth graduate school in physics at colliders: on the eve of the LHC, Turin, Italy Beyond the standard model, 5 h, Jul 2009 Parma international school of theoretical physics, Parma, Italy Extra dimensions for TeV physics, 4h30, Sep 2009 Particle, astrophysics and cosmology winter school, Sesimbra, Portugal New physics at the LHC, 2 h, Dec 2009 PSI summerschool on particle physics: Gearing up for LHC physics, Zuoz, Switzerland Electroweak symmetry breaking, 1h30, Aug 2010 German particle physics school, Maria Laach, Germany Beyond the standard model, 4 h, Sep 2010 Second school on the LHC physics, Islamabad, Pakistan Electroweak symmetry breaking, 2 h, May 2010

Iancu Edmond Winter school on hadronic collisions at the LHC and QCD at high density, Les Houches, Gluon saturation and the color glass condensate, 6 h, Mar 2008 48th Cracow school of theoretical physics: aspects of duality, Zakopane, Poland Partons and jets in a strongly-coupled plasma from AdS/CFT, 4.5 h, Jun 2008 First high energy physics school, Magurele, Roumanie High energy scattering : from weak to strong coupling, 3 h, Oct 2008 European School of High??Energy Physics, Cheile Gradistei, Romania, Sep 2011

Korchemsky Gregory International School On Strings And Fundamental Physics, Hamburg, July 2012 Mathematica School in Theoretical Physics: Integrability and Super Yang-Mills, Sao Paulo, Nov 2012, Mathematica School in Theoretical Physics: Advanced Topics in Conformal Field Theory, ICTP Trieste, March 2013

Kosower David String theory - from theory to experiment, Weizmann Institute, Israel, On-shell methods in gauge ﬁeld theory, 4.5 h, Apr 2008 Taiwan Summer Institute, Chi-Tou, Taiwan On-shell methods in gauge theory, 4.5 h, Aug 2008 Computer Algebra and Particle Physics School, Zeuthen, Germany, March 21-25, 2011 Les Houches Summer School, "Theoretical Physics Confronts the Challenges of the LHC", August 2011 Arnold Sommerfeld Center Summer School, "New Methods for Field Theory Amplitudes", Munich, Germany, Sept 2012

Kostov Ivan Exact methods in low-dimensional statistical physics and quantum computing, Les Houches, Bound- ary loop models and 2D quantum gravity, 3 h, Jul 2008

Lavignac Stéphane France-Asia particle physics school, Les Houches, Physics beyond the standard model, 3 h, Sep 2008 Univ. Catholique de Louvain-la-Neuve, Belgium Supersymmetry 6 h Dec 2008

Mallick Kirone ALEA (School of combinatorics and probabilities) CIRM Marseille Exact results for the exclusion process 6 h Apr 2010 Summer School, Fundamental Problems in Statistical Physics XIII, Leuven, June 2013 Appendices 149

Misguich Grégoire Exact methods in low-dimensional statistical physics and quantum computing, Les Houches, Quan- tum spin liquids, 2 h, Jul 2008

Nonnenmacher Stéphane Spectrum and dynamics, CRM, Montreal, Canada , Entropy of chaotic eigenstates, 2 h, Apr 2008 Summer school “Nonselfadjoint operators”, Rennes, Jun 2011 (4h)

Ollitrault Jean-Yves Hadronic collisions at the LHC and QCD at high density, Les Houches, Relativistic hydrodynamics, 3 h, Mar 2008

Saleur Hubert Summer School ‘Strongly interacting quantum systems out of equilibrium’, Les Houches , summer 2012

Servant Géraldine French physics teachers programme, CERN, Introduction to cosmology, 2 h, Apr 2008 International physics teachers programme, CERN Introduction to cosmology, 2 h, Jul 2010 Annual particle physics retreat, Mainz University Cosmological and astroparticle aspects of physics beyond the Standard Model, 3 h, Sep 2010

Soyez Grégory BND school 2010 (Belgian-Dutch-German graduate school in particle physics), Ostend (Belgium), Phenomenology of hadronic colliders, 9 h, Sep 2010

Vanhove Pierre Fundamental aspects of superstring theory, KITP, Santa Barbara, California, Introductory lectures on pure spinor formalism, 3 h, Jan 2009 International School "Gravity and string theory", Natal, may 2012

Zdeborova Lenka Statistical physics of complexity, optimization and biological information, Les Houches, Probing the energy landscape of random optimization problem, 2 h, Mar 2010 150 Activity Report CEA/DSM/IPhT 2008 — 2013

A.9 Popularizing Science

Here we list our actions to popularize science among the general public, during the last 3 years. They consist in articles in popular science journals, interviews, talks in secondary schools.

Barthelemy Marc PRL article featured in NewScientist: “City road networks grow like biological systems” (2008) Interview in Le Figaro, La Tribune, 2008. Radio Interview for Deutschlandfunk, 2008 Article "Entretiens" for Le Monde, May 2009. Radio interview, Les matins de France-culture, May 2009. Technology reviews on “Commuting in a polycentric city” Emerging Health Threats forum: article “Where local policy matters” in the PNAS, April 2010 Article in Science & Vie, July 2011 Interviews for Wired, Spiegel Online, Scientiﬁc American (2012) Article in La Recherche, Dec 2012 Interview for: Le Monde (Sciences et Technologie), Science & Vie, 2013 Popular Science conference Le marathon des sciences, Fleurance, Aug 2013

Bauer Michel & Di Francesco Philippe Article in Maths Enigmes Express (journal of the Comité International des Jeux Mathématiques), 2008

Bernardeau Francis Public lecture at the Bar des sciences, Meudon, March 2009: “Cosmologie, en route vers le Big-Bang”. Article in ScintillationS (IRFU journal), June 2012: “Des étoiles aux grandes structures de l’univers” Radio program “Peut-on croire à la matière noire ?”, France Culture, 3 Feb 2012 Public conference at CEA: “Planck et les mystères du Big bang”, Apr. 2013

Blaizot Jean-Paul Public lecture at the Deutsch-Amerikanischen Institut, Heidelberg, May 2009: "Matter a few mi- crosecond after the big bang" Article in La Recherche, June 2013: "Retrouver le plasma de l’univers primordial"

Brax Philippe Interview to popular science Web site Futura Sciences, Sept. 2010

Caprini Chiara Article in Scintillations, “L’espace et le temps en cosmologie”, June 2009

Cirelli Marco General public seminars: CERN (2009-2012) CERN oﬃcial guide, including CMS and AD (since 2010) Article in ScintillationS (IRFU journal), June 2012, “Shedding light on the dark sides of the Universe” Article in Clefs du CEA, 2009, “Théorie de la matière noire”. Interviews for Science&Vie, Science& Avenir (France), CERN Bulletin (CH), Nature, Physics Today, The Times Online (UK), Scientiﬁc American, ScienceNews (USA), Cosmos Magazine, The Australian (Australia), Mumbai News (India), Emme- CiQuadro, ilSussidiario.net (Italy)

Duplantier Bertrand Article in La Gazette des Mathématiciens, Apr 2013

Guida Riccardo & Zinn-Justin Jean Article Gauge invariance in Scholarpedia (2008)

Kosower David Article in Scientiﬁc American, 2012

Lavignac Stéphane Article in ScintillationS (IRFU journal) Appendices 151

Mallick Kirone “Les Emerveillements d’un Théoricien”, Conf. Cyclope, Saclay, 2011 RencontreS3: “Qu’est-ce qu’un matheux?”, Gif-sur-Yvette, May 2011 “Les Sciences en Inde, hier et aujourd’hui”, Centre Andre Malraux, Paris, Nov 2011 “La Physique Théorique”, Institut Ruchpaul, Mar 2013) Presentation at the Lycée Franco-Allemand de Bucq and the Collège la Guyonnerie, Orsay

Nonnenmacher Stéphane Article in La gazette des mathématiciens, 2009, transl. in EMS Newsletter, 2010

Ollitrault Jean-Yves 2 articles, new edition of collective book Panorama de la physique, Oct 2012, Belin

Vanhove Pierre France Culture, Les chemins de la connaissance, september 2013. Talk, Cité des géométries, Jeumont (59) 22 march 2013 Bar des Sciences, MJC Savigny-sur-Orge, 14 dec 2012 Talk, Lycée Benjamin Franklin, Orléans Talk, Lycée Les Iscles, Manosque, 26 march 2012 Talk, Lycée d’excellence de Douai Interview, “Théorie des cordes: elle sert enﬁn à quelque chose!”, Science & Vie, nov. 2009 152 Activity Report CEA/DSM/IPhT 2008 — 2013

A.10 Scientiﬁc editing

Below we list our activities in the edition of scientiﬁc journals or proceeding series.

Who Role Journal I. Bena Advisory panel Journal of Physics A (2009–2012) F. Bernardeau Editorial Board Report on Progress in Physics (2009–) JSTAT (Journal of statistical mechanics: theory and G. Biroli Editorial Board experiment) (2011–) J.-P. Blaizot Editor Physics Letters B P. Di Francesco Editorial Board JSTAT B. Eynard Editorial Board JSTAT C. Godrèche Editorial Board JSTAT (2004–) B. Duplantier Editor Nuclear Physics B (1991–) Executive Annales Henri Poincaré Committee Poincaré Seminar Series in Progress in Mathematical Editor-in-Chief Physics, Birkhäuser Science B. Eynard Editor Random Matrix Theory and Applications (2012–) R. Guida Editor Scholarpedia G. Korchemsky Editor Journal of Physics A (2010–) J.-M. Luck Editorial Board Journal of Statistical Physics (–2012) Advisory Panel Journal of Physics A K. Mallick Editor Journal of Statistical Physics (2013–) S. Nonnenmacher Editor Nonlinearity (2004—) Editor European Physical Journal B (2007–2010) H. Orland Editor Physics Reports H. Saleur Senior Editor Nuclear Physics B Editor Topological Order D. Serban Editor JSTAT P. Vanhove Editor European Journal of Physics C (2012–) Editor Journal of High Energy Physics (2013–) Appendices 153

A.11 Research administration

In this Appendix we list our activities in research administration outside IPhT.

Who Assignment Institution Chairman of the AERES F. Bernardeau LUTH evaluation committee (2009) Scientific committee (CSTS) Irfu/SAP Scientific committee (since Cargèse School 2008) Hiring committee (2012) Scuola Normale Superiore, Pisa Board (2013–) Astrophysics division of the SFP Jury member (2013) Prix du jeune chercheur de la SFP Coordinator, CRIBLE projects A. Billoire Région Rhône-Alpes (2006–) Steering committee (2010-) Labex PALM G. Biroli Board “Axe 2” Labex PALM Hiring committee Univ. Cergy-Pontoise Chairman of AERES evaluation J.-P. Blaizot LPTHE committee (2012) Dean advisory committee MIT LNS laboratory Spanish excellence centers (Severo Evaluation committee Ochoa) Board Ecole des Houches C. Caprini Scientific committee GRAM action (CNRS) Scientific advisory committee F. David Institut Henri Poincaré, Paris (–2009) Evaluation panel, Starting European Research Council (ERC) grants (2007–) Institut Jean Lamour and the labora- AERES evaluation committee tories UMR 7040, 7555, 7556, 7570 & (2008) 7584 (Nancy) AERES evaluation committee Fédération Dynamique des Systèmes (2008) Complexes (UPMC, Paris) Institut Non-Linéaire de Nice (INLN) AERES evaluation committee and the Federation Wolfgang Döblin (2011) (CNRS - Univ. Nice Sophia Antipolis) In charge of the “Intergroupe French Physical Society des théoriciens” B. Duplantier Scientific committee IHÉS Univ. Diderot-Paris 7, Univ. Versailles- Hiring committee Saint Quentin F. Gélis Board of directors (2012–) ECT*, Trento Evaluation committee GENCI – Grand équipement national O. Golinelli (2009–2011) de calcul intensif Scientific committee Service de Physique des Particules, C. Grojean (2007–2009) CEA Saclay (IRFU/SPP) International Detector Advisory International Linear Collider Group (2008–2012) Commission consultative de Univ. Paris XI spécialistes (2010–2014) AERES evaluation committee E. Iancu SUBATECH, Nantes (2013) Selection committee Université Pierre et Marie Curie - Paris S. Lavignac (2007–2008, 2011) 6 Steering committee (2012–) Labex P2IO 154 Activity Report CEA/DSM/IPhT 2008 — 2013

Board of “Axe B” & Comité de J.-M. Luck RTRA Triangle de la physique la vie scientifique Section 02 of the national committee of Elected member (up to 2008) CNRS Standing committee Sections 29 & 34, Univ. Paris XI (Or- (2010–2014) say) S. Nonnenmacher Hiring committee (2009) ENS Paris Hiring committee (2013) Univ. Nantes Steering committee GDR Quantum Dynamics (2009–2016)) Work package “Future Petaflop/s computer technologies beyond 2010” Partnership for advanced computing in J.-M. Normand (co-leader), Work package Europe (PRACE), Preparatory phase “Petaflop/s systems for 2009/2010” (2008–2010) Work package “Future PRACE, 1st implementation phase technologies” (2010–2011) J.-Y. Ollitrault Board of directors (2009–2011) ECT* Trento Steering committee (–2012) Labex P2IO IUPAP (International Union of Pure H. Orland Vice-president and Applied Physics) Statistical physics Commission (C3) of Chair the IUPAP Thematic committee 5 GENCI – Grand équipement national O. Parcollet (2009–2011) de calcul intensif Board of “Axe 2” Labex PALM C. Pépin Scientific committee (2011) RTRA Triangle de la physique Elected member (2013–) Adademic senate, Univ. Paris-Saclay Panel SIMI5 (2013–) ANR Institut d’Etudes Scientifiques de G. Servant Scientific committee (2008–) Cargèse G. Soyez Elected member (2012–2016) CNRS national committee, section 02 Institute for Physics and Mathematics P. Vanhove Founding member (2009) of the Universe LHC safety commitee for the Autorité de Sûreté Nucléaire LHC (2008) Elected member (2008–2012) CNRS national committee, section 02 Appendices 155

A.12 List of IPhT members

Below we give the list of people who are working at IPhT on 30/06/2013, and will still be here on 1/1/2015. This list comprises 48 physicists, 6 non-physicists, 4 postdocs and 2 emerita.

AGUIAR HUALDE Juan Manuel KORCHEMSKY Gregory BARTHELEMY Marc KOSOWER David BAUER Michel KOSTOV Ivan BENA Iosif LAVIGNAC Stéphane BENA Cristina LOUAIL Thomas BERNARDEAU Francis LUCK Jean-Marc BERTHELOT Patrick MALLICK Kirone BERVAS Loïc MINASIAN Ruben BILLOIRE Alain MISGUICH Grégoire BIROLI Giulio MONTHUS Cécile BLAIZOT Jean-Paul MUKHOPADHYAY Ayan BOUTTIER Jérémie NONNENMACHER Stéphane BRAX Philippe OLLITRAULT Jean-Yves BRITTO Ruth ORLAND Henri CAPRINI Chiara PARCOLLET Olivier CIRELLI Marco PASQUIER Vincent DAVID François PÉPIN Catherine DE LABORDERIE Emmanuelle PESCHANSKI Robert DI FRANCESCO Philippe RIBAULT Sylvain DUPLANTIER Bertrand SADHU Tridib EYNARD Bertrand SALEUR Hubert GELIS François SAUBOY Laure GODRÈCHE Claude SENGMANIVANH Laurent GOLINELLI Olivier SERBAN Didina GRAÑA Mariana SOYEZ Grégory GUIDA Riccardo VALAGEAS Patrick GUITTER Emmanuel VANHOVE Pierre HOUDAYER Jérôme VERNIZZI Filippo IANCU Edmond VOROS André ZAFFANELLA Sylvie ZDEBOROVA Lenka