DOCSLIB.ORG

Endosomal Escape of Antisense Oligonucleotides Internalized by Stabilin Receptors Is Regulated by Rab5c and EEA1 During Endosomal Maturation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Endosomal Escape of Antisense Oligonucleotides Internalized by Stabilin Receptors Is Regulated by Rab5c and EEA1 During Endosomal Maturation View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UNL | Libraries University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Biochemistry -- Faculty Publications Biochemistry, Department of 2018 Endosomal Escape of Antisense Oligonucleotides Internalized by Stabilin Receptors Is Regulated by Rab5C and EEA1 During Endosomal Maturation Colton M. Miller University of Nebraska - Lincoln W. Brad Wan Ionis Pharmaceuticals Punit P. Seth Ionis Pharmaceuticals Edward N. Harris University of Nebraska - Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/biochemfacpub Part of the Biochemistry Commons, Biotechnology Commons, and the Other Biochemistry, Biophysics, and Structural Biology Commons Miller, Colton M.; Wan, W. Brad; Seth, Punit P.; and Harris, Edward N., "Endosomal Escape of Antisense Oligonucleotides Internalized by Stabilin Receptors Is Regulated by Rab5C and EEA1 During Endosomal Maturation" (2018). Biochemistry -- Faculty Publications. 379. https://digitalcommons.unl.edu/biochemfacpub/379 This Article is brought to you for free and open access by the Biochemistry, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Biochemistry -- Faculty Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. NUCLEIC ACID THERAPEUTICS Volume 28, Number 2, 2018 Mary Ann Liebert, Inc. DOI: 10.1089/nat.2017.0694 Endosomal Escape of Antisense Oligonucleotides Internalized by Stabilin Receptors Is Regulated by Rab5C and EEA1 During Endosomal Maturation Colton M. Miller,1 W. Brad Wan,2 Punit P. Seth,2 and Edward N. Harris1 Second-generation (Gen 2) Antisense oligonucleotides (ASOs) show increased nuclease stability and affinity for their RNA targets, which has translated to improved potency and therapeutic index in the clinic. Gen 2 ASOs are typically modified using the phosphorothioate (PS) backbone modification, which enhances ASO interac- tions with plasma, cell surface, and intracellular proteins. This facilitates ASO distribution to peripheral tissues and also promotes cellular uptake after injection into animals. Previous work identified that Stabilin receptors specifically internalize PS-ASOs in the sinusoidal endothelial cells of the liver and the spleen. By modulating expression of specific proteins involved in the trafficking and maturation of the endolysosomal compartments, we show that Rab5C and EEA1 in the early endosomal pathway, and Rab7A and lysobisphosphatidic acid in the late endosomal pathway, are important for trafficking of PS-ASOs and facilitate their escape from en- dolysosomal compartments after Stabilin-mediated internalization. In conclusion, this work identifies key rate- limiting proteins in the pathway for PS-ASO translocation and escape from the endosome. Keywords: endosome maturation, endosome escape, antisense oligonucleotide, Stabilin, ASO Introduction endosomes (LE) and is involved in the release of ASOs from late endosomal compartments in several common cell lines, ligonucleotide therapeutics have made rapid such as A431, HEK293, and HepG2 [5]. Oprogress in clinical settings, [1] but the precise path- PS-ASOs were recently shown to be rapidly internalized ways by which these agents enter cells and escape from en- by clathrin-mediated endocytosis by a class of membrane- dolysosomal compartments to exert antisense effects are just bound scavenging receptor proteins known as the Stabilin starting to be understood [1,2]. Antisense oligonucleotides receptors in the liver sinusoidal endothelial cells, a site for (ASOs) are short (*16–20 bp), chemically modified nucleic the clearance of many blood-borne matrix and synthetic acids, which utilize Watson–Crick base pairing for hybrid- molecules [6]. Stabilin receptors (Stabilin-1 and Stabilin-2) izing to their cognate RNA in cells. Second-generation ASOs bind to and internalize a host of negatively charged poly- are typically modified using the phosphorothioate (PS) back- mers, ranging from smaller, *20 nucleotide PS-ASOs [6] bone and 2¢ modifications of the ribose sugar, which enhance (both Stabilin receptors), to large glycosaminoglycans, such ASO stability in biological fluids [3]. PS-ASOs can exert their as *30 kDa unfractionated heparin and 3–400 kDa hyalur- biological effects through a variety of antisense mechanisms onan (Stabilin-2 only) [7,8]. Stabilin-2, also known as the based on the chemical composition of the oligonucleotide. For Hyaluronic-Acid Receptor for Endocytosis (HARE), has two example, DNA gapmer PS-ASOs promote degradation of their distinctly expressed isoforms in native tissue,190-kDa and target RNA by RNase H-mediated hydrolysis while uniformly 315-kDa [9]. The 190-kDa isoform is a truncated version of modified MOE PS-ASOs can modulate RNA splicing [4]. the full 315-kDa isoform, but retains full functionality for Understand the biological mechanisms responsible for bind- binding and endocytosis [10]. Both isoforms have been ing, internalizing, and trafficking PS-ASOs are currently areas shown to be able to internalize PS-ASOs equally; however, of active investigation. Recent work showed that Annexin A2 for this work, we decided to utilize recombinant cells over- facilitates transport of PS-ASOs from early endosomes to late expressing the 190-kDa isoform. The use of this cell line is 1Department of Biochemistry, University of Nebraska, Lincoln, Nebraska. 2Ionis Pharmaceuticals, Carlsbad, California. ª Colton M. Miller et al. 2018 Published by Mary Ann Liebert, Inc. This article is available under the Creative Commons License CC-BY-NC (http://creativecommons.org/licenses/by-nc/4.0). This license permits non-commercial use, distribution and reproduction in any medium, pro- vided the original work is properly cited. Permission only needs to be obtained for commercial use and can be done via RightsLink. 86 ESCAPE OF ASOS DURING ENDOSOMAL MATURATION 87 relevant based on the 1:1 expression ratio of both Stabilin-2 (Life Technologies) and stably transfected in HEK293 Flp-In isoforms in native tissues [11]. cells within the FRT site to eliminate off-target effects of Our initial efforts of this work focused on early endosomal gene disruption (Life Technologies). Cell lines were grown antigen 1 (EEA1), which is a peripheral membrane associ- and maintained in DMEM containing 8% FBS supplemented ated protein found in the early endosome, containing zinc- with 50 mg/mL Hygromycin B. dependent binding motifs [12]. This protein was selected based on its role in early endosomal transport by localizing to Oligonucleotide synthesis and delivery the early endosome with Rab5 and phosphatidylinositol (3)P- kinase [13]. Rab5 has three distinct isoforms, Rab5A, B, and Phosphorothioate PS-ASOs were synthesized using a C, which all bind to EEA1, however, Rab5C has distinct standard phosphoramidite chemistry by using a DNA syn- functional differences compared to Rab5A and Rab5B. Rab5 thesizer at Integrated DNA Technologies (Iowa City, IA) or isoforms have shown preferential differences to specific at Ionis Pharmaceuticals (Carlsbad, CA) against Malat-1. PS- protein targets, along with identification of differing roles in ASOs were delivered to cultured cells utilizing standardized functionality such as EGFR degradation [14]. Rab5C binding gymnotic conditions. PS-ASOs were added to standard to EEA1 confers directionality of the endosomes from early Dulbecco’s modified Eagle’s medium (DMEM) without se- to late stages, by serving as a regulatory element for SNARE rum, and diluted to 1 mM. One hundred microliters of medium protein family members in EE fusion and maturation to LEs was added to 900 mL of DMEM with 8% FBS to reach a final [13,15]. The role of Rab7A in altering PS-ASO activity was concentration of 0.1 mM of PS-ASO. The PS-ASO used for also evaluated, as this protein is an activator in endosomal this study was GCTTCAGTCATGACTTCCTT, which tar- maturation, lysosome biogenesis, fusion, and morphological gets the long noncoding RNA Malat-1 and previously verified changes of LEs, as well as a variety of interacting partners [6]. The PS-ASO was fully modified using the PS backbone [16–18]. One LE-specific resident of particular interest is and the bold letters indicate 2¢-Methoxyethyl (MOE) RNA lysobisphosphatidic acid (LBPA) (Fig. 1). LBPA is an un- nucleotides. The biotinylated ASO (bASO) used for this study common lipid that is enriched in the LE [19], and has shown was GCTTCAGTCATGACTTCCTT (Ionis AA7141) with a to be involved in controlling cholesterol levels in LEs [20]. modified 5¢ terminus containing a piperidine linker to accept Recent work has suggested that LPBA is an essential com- biotin-NHS. Details of the synthesis and purification proce- ponent for PS-ASO escape in the LE [21]. Taken together, dures are in supplemental materials (Supplementary Fig. S1; manipulation of these endosomal molecules may increase the Supplementary Data are available online at www.liebertpub understanding of PS-ASO activity after internalization by .com/nat). Stabilin-1 and -2. siRNA delivery Materials and Methods Stabilin-2 190-kDa cells were plated in 24-well dishes and grown to 50% confluency followed by transfection of 5 pmol Cell lines siRNAs in duplicate wells, giving a final concentration of Stabilin-2 (190-HARE) and empty vector cell lines were 2.5 pmol siRNA per well. siRNAs were used against specific generated as previously described [9,10]. Briefly, the cDNA protein targets and transfection was
Load more

Recommended publications
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • Structural Basis for Rab Gtpase Recognition and Endosome Tethering by the C2H2 Zinc Finger of Early Endosomal Autoantigen 1 (EEA1)
    Structural basis for Rab GTPase recognition and endosome tethering by the C2H2 zinc finger of Early Endosomal Autoantigen 1 (EEA1) Ashwini Mishra, Sudharshan Eathiraj, Silvia Corvera, and David G. Lambright1 Program in Molecular Medicine and Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, MA 01605 Edited by Pietro De Camilli, Yale University and Howard Hughes Medical Institute (HHMI), New Haven, CT, and approved April 23, 2010 (received for review January 21, 2010) Regulation of endosomal trafficking by Rab GTPases depends on epitopes of Rab GTPases have been identified and can be selective interactions with multivalent effectors, including EEA1 sufficient for effectors to distinguish Rab GTPases from the same and Rabenosyn-5, which facilitate endosome tethering, sorting, phylogenetic group (25, 27–31). Whether these determinants are and fusion. Both EEA1 and Rabenosyn-5 contain a distinctive N- sufficient to account for effector recognition at the family level terminal C2H2 zinc finger that binds Rab5. How these C2H2 zinc fin- remains unclear. gers recognize Rab GTPases remains unknown. Here, we report the Although well characterized as DNA-binding modules, little is crystal structure of Rab5A in complex with the EEA1 C2H2 zinc fin- known about the binding modalities and recognition properties of ger. The binding interface involves all elements of the zinc finger as C2H2 ZFs that interact with proteins. To gain insight into Rab well as a short N-terminal extension but is restricted to the switch GTPase recognition by the EEA1 and Rabenosyn-5 C2H2 ZFs, and interswitch regions of Rab5. High selectivity for Rab5 and, to a we determined the crystal structure of the EEA1 C2H2 ZF, lesser extent Rab22, is observed in quantitative profiles of binding profiled the binding specificity for Rab GTPases, and used to Rab family GTPases.
    [Show full text]
  • The WD40 and FYVE Domain Containing Protein 2 Defines a Class of Early Endosomes Necessary for Endocytosis
    The WD40 and FYVE domain containing protein 2 defines a class of early endosomes necessary for endocytosis Akira Hayakawa*, Deborah Leonard*, Stephanie Murphy*, Susan Hayes*, Martha Soto*, Kevin Fogarty†, Clive Standley†, Karl Bellve†, David Lambright*, Craig Mello*, and Silvia Corvera*‡ *Program in Molecular Medicine and †Biomedical Imaging Group, Department of Physiology, University of Massachusetts Medical School, Worcester, MA 01615 Edited by Pietro V. De Camilli, Yale University School of Medicine, New Haven, CT, and approved June 19, 2006 (received for review October 10, 2005) The FYVE domain binds with high specificity and avidity to phos- Table 1. Genes screened for coelomocyte uptake deficiency phatidylinositol 3-phosphate. It is present in Ϸ30 proteins in Clone Gene Protein Homolog humans, some of which have been implicated in functions ranging from early endosome fusion to signal transduction through the Yk15a2 Aka-1 WP:CE02581 SARA͞AKAP TGF-␤ receptor. To develop a further understanding of the biolog- Yk1334h08 ZK632.12 WP:CE01110 Phafin2 ical roles of this protein family, we turned to the nematode Yk877d04 Pqn-9 WP:CE32574 Hrs Yk1281a05 R160.7 WP:CE33815 KIAA1643 Caenorhabditis elegans, which contains only 12 genes predicted to Yk523h7 Y42H9AR.3 WP:CE29111 Rabenosyn5 encode for phosphatidylinositol 3-phosphate binding, FYVE do- Yk1121h09 VT23B5.2 WP:CE20122 main-containing proteins, all of which have homologs in the Yk1334f06 Ppk-3 WP:CE18979 PIP5K human genome. Each of these proteins was targeted individually Yk1189b03 D2013.2 WP:CE00928 WDFY2 by RNA interference. One protein, WDFY2, produced a strong Yk5g8 T10G3.5 WP:CE31066 EEA1 inhibition of endocytosis when silenced.
    [Show full text]
  • Systems Survey of Endocytosis by Multiparametric Image Analysis
    Vol 464 | 11 March 2010 | doi:10.1038/nature08779 ARTICLES Systems survey of endocytosis by multiparametric image analysis Claudio Collinet1, Martin Sto¨ter2, Charles R. Bradshaw1, Nikolay Samusik1, Jochen C. Rink{, Denise Kenski{, Bianca Habermann1, Frank Buchholz1, Robert Henschel3, Matthias S. Mueller3, Wolfgang E. Nagel3, Eugenio Fava2, Yannis Kalaidzidis1,4 & Marino Zerial1 Endocytosis is a complex process fulfilling many cellular and developmental functions. Understanding how it is regulated and integrated with other cellular processes requires a comprehensive analysis of its molecular constituents and general design principles. Here, we developed a new strategy to phenotypically profile the human genome with respect to transferrin (TF) and epidermal growth factor (EGF) endocytosis by combining RNA interference, automated high-resolution confocal microscopy, quantitative multiparametric image analysis and high-performance computing. We identified several novel components of endocytic trafficking, including genes implicated in human diseases. We found that signalling pathways such as Wnt, integrin/cell adhesion, transforming growth factor (TGF)-b and Notch regulate the endocytic system, and identified new genes involved in cargo sorting to a subset of signalling endosomes. A systems analysis by Bayesian networks further showed that the number, size, concentration of cargo and intracellular position of endosomes are not determined randomly but are subject to specific regulation, thus uncovering novel properties of the endocytic system. Endocytosis is a fundamental process supporting many functions platform, on the basis of the custom-designed image analysis software such as nutrient uptake, intracellular signalling1, morphogenesis MotionTracking12. First, images were segmented to determine mor- during development2 and defence against pathogens3. Dysfunctions phological and positional descriptors for each endosome (Fig.
    [Show full text]
  • In BRCA1 and BRCA2 Breast Cancers, Chromosome Breaks Occur Near Herpes Tumor Virus Sequences
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 20 May 2021 doi:10.20944/preprints202105.0490.v1 Article In BRCA1 and BRCA2 breast cancers, chromosome breaks occur near herpes tumor virus sequences Bernard Friedenson 1* 1 Dept. of Biochemistry and Molecular Genetics, College of Medicine University of Illinois Chicago; [email protected] * Correspondence: [email protected]; Abstract: Inherited mutations in BRCA1 and BRCA2 genes increase risks for breast, ovarian, and other cancers. Both genes encode proteins for accurately repairing chromosome breaks. If mutations inactivate this function, chromosome fragments may not be restored correctly. Resulting chromosome rearrangements can become critical breast cancer drivers. Because I had data from thousands of cancer structural alterations that matched viral infections, I wondered whether infections contribute to chromosome breaks and rearrangements in hereditary breast cancers. There are currently no interventions to prevent chromosome breaks because they are thought to be unavoidable. However, if chromosome breaks come from infections, they can be treated or prevented. I used bioinformatic analyses to test publicly available breast cancer sequence data around chromosome breaks for DNA similarity to all known viruses. Human DNA flanking breakpoints usually had the strongest matches to Epstein-Barr virus (EBV) tumor variants HKHD40 and HKNPC60. Many breakpoints were near sites that anchor EBV genomes, human EBV tumor-like sequences, EBV-associated epigenetic marks, and fragile sites. On chromosome 2, sequences near EBV genome anchor sites accounted for 90% of breakpoints (p<0.0001). On chromosome 4, 51/52 inter-chromosomal breakpoints were close to EBV-like sequences. Five EBV genome anchor sites were near breast cancer breakpoints at precisely defined, disparate gene or LINE locations.
    [Show full text]
  • FGD1 As a Central Regulator of Extracellular Matrix Remodelling
    Hypothesis 3265 FGD1 as a central regulator of extracellular matrix remodelling – lessons from faciogenital dysplasia Elisabeth Genot1,2,3,4, Thomas Daubon1,2,3, Vincenzo Sorrentino5 and Roberto Buccione6,* 1Universite´ de Bordeaux, Physiopathologie du Cancer du Foie, U1053, F-33000 Bordeaux, France 2INSERM, Physiopathologie du Cancer du Foie, U1053, F-33000 Bordeaux, France 3European Institute of Chemistry and Biology, 2 rue Robert Escarpit, 33607 Pessac, France 4CHU de Bordeaux, F-33076 Bordeaux, France 5Department of Neurosciences, Molecular Medicine Section, University of Siena, Siena 53100, Italy 6Tumour Cell Invasion Laboratory, Consorzio Mario Negri Sud, S. Maria Imbaro, Chieti 66030, Italy *Author for correspondence ([email protected]) Accepted 27 March 2012 Journal of Cell Science 125, 3265–3270 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.093419 Summary Disabling mutations in the FGD1 gene cause faciogenital dysplasia (also known as Aarskog-Scott syndrome), a human X-linked developmental disorder that results in disproportionately short stature, facial, skeletal and urogenital anomalies, and in a number of cases, mild mental retardation. FGD1 encodes the guanine nucleotide exchange factor FGD1, which is specific for the Rho GTPase cell division cycle 42 (CDC42). CDC42 controls cytoskeleton-dependent membrane rearrangements, transcriptional activation, secretory membrane trafficking, G1 transition during the cell cycle and tumorigenic transformation. The cellular mechanisms by which FGD1 mutations lead to the hallmark skeletal deformations of faciogenital dysplasia remain unclear, but the pathology of the disease, as well as some recent discoveries, clearly show that the protein is involved in the regulation of bone development. Two recent studies unveiled new potential functions of FGD1, in particular, its involvement in the regulation of the formation and function of invadopodia and podosomes, which are cellular structures devoted to degradation of the extracellular matrix in tumour and endothelial cells.
    [Show full text]
  • WINNERS Sorted by Study Section
    FARE2012 WINNERS Sorted By Study Section NCI-CCR CHEN, YUHONG Postdoctoral Fellow Biochemistry - General and Lipids Fully synthetic virus-like nanoparticles targeting prostate cancer cells Lack of selective delivery of therapeutic agents into the right organ and cells remains a major problem in therapy of many diseases, including cancer. Useful lessons in delivery can be learned from nature. Viruses are able to deliver a variety of biomolecules into certain cell types because they have the abilities to self-assemble and disassemble when needed and enter cells in receptor-mediated manner. However, assembly of molecules generated by chemical synthesis into virus-like particles has yet to be achieved. We have found that analogs of transmembrane (TM) helixes of integral membrane proteins self-assemble into round nanoparticles if equipped with terminal negative charges. A 24-amino acid peptide corresponding to the second transmembrane helix of the CXCR4 chemokine receptor adopts a predominantly beta-type conformation in aqueous solutions and self-assembles into nanoparticles with a diameter around 10 nm. Similar to viruses, nanoparticles fuse with cell membranes. Spontaneous fusion is accompanied by transition into active helical conformation that allows for potent inhibition of CXCR4 activity both in vitro and in a mouse model of metastatic breast cancer. Derivatization of CXCR4 TM antagonist with polyethylene glycol (PEG) chains slows down cell fusion, but results in nanoparticles that are very stable and more than 99% homogeneous in size. To generate nanoparticles that fuse with tumor cells in receptor-mediated manner, we constructed conjugates consisting of self-assembling CXCR4 antagonist, PEG chains and ligands for receptors overexpressed on prostate tumor cells, gastrin releasing peptide (GRP) receptor and luteinizing hormone-releasing hormone (LHRH) receptor.
    [Show full text]
  • Crystal Structure of a FYVE-Type Zinc Finger Domain from the Caspase Regulator CARP2
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Structure, Vol. 12, 2257–2263, December, 2004, ©2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.str.2004.10.007 Crystal Structure of a FYVE-Type Zinc Finger Domain from the Caspase Regulator CARP2 Michael D. Tibbetts,1 Eric N. Shiozaki,1 tion and lack the three signature sequences (Ostermeier Lichuan Gu,1 E. Robert McDonald III,2 and Brunger, 1999; Stenmark and Aasland, 1999). FYVE Wafik S. El-Deiry,2 and Yigong Shi1,* and FYVE-related domains have been identified in sev- 1Department of Molecular Biology eral proteins, such as EEA1 and Rabphilin-3A, respec- Lewis Thomas Laboratory tively, both of which are involved in membrane traffick- Princeton University ing and bind to members of the Rab subfamily of GTP Princeton, New Jersey 08544 hydrolases (Simonsen et al., 1998; Stahl et al., 1996). 2 Laboratory of Molecular Oncology The crystal structure of the EEA1 FYVE domain in and Cell Cycle Regulation complex with the soluble phosphoinositide analog inosi- Howard Hughes Medical Institute tol-(1,3)-bisphosphate (Ins(1,3)P2) revealed the molecu- Departments of Medicine, Pharmacology, lar mechanism for specific binding to PtdIns(3)P (Dumas and Genetics et al., 2001). As predicted by the structure of an unli- University of Pennsylvania School of Medicine ganded FYVE domain and mutagenesis studies, the li- Philadelphia, Pennsylvania 19104 gand is coordinated exclusively by residues from the conserved motifs, primarily the basic pocket R(R/K) HHCR and the WxxD motif (Gaullier et al., 2000; Misra Summary and Hurley, 1999).
    [Show full text]
  • Genome‑Wide Profiling of Lncrna Expression Patterns in Patients with Acute Promyelocytic Leukemia with Differentiation Therapy
    ONCOLOGY REPORTS 40: 1601-1613, 2018 Genome‑wide profiling of lncRNA expression patterns in patients with acute promyelocytic leukemia with differentiation therapy JIAN YU1*, XIAO-LING GUO2*, YUAN-YUAN BAI1, JUN-JUN YANG1, XIAO-QUN ZHENG1, JI-CHEN RUAN3 and ZHAN-GUO CHEN1 1Department of Clinical Laboratory, 2Research Center, 3Department of Pediatric Hematology, The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China Received January 11, 2018; Accepted June 18, 2018 DOI: 10.3892/or.2018.6521 Abstract. Long non-coding RNAs (lncRNAs) are crucial polymerase chain reaction (RT-qPCR) analysis. The lncRNA factors in acute promyelocytic leukemia (APL) cell differ- functions were predicted through co-expressed messenger entiation. However, their expression patterns and regulatory RNA (mRNA) annotations. Co-expressed lncRNA-mRNA functions during all-trans-retinoic acid (ATRA)-induced networks were constructed to analyze the functional pathways. APL differentiation remain to be fully elucidated. The In total, 825 lncRNAs and 1,218 mRNAs were dysregulated profile of dysregulated lncRNAs between three bone marrow in the treated APL BM group, compared with the untreated (BM) samples from patients with APL post-induction and APL BM group. The expression of 10 selected lncRNAs three BM samples from untreated matched controls was was verified by RT‑qPCR analysis. During APL differentia- examined with the Human Transcriptome Array 2.0. The tion, NONHSAT076891 was the most upregulated lncRNA, dysregulated lncRNA expression of an additional 27 APL BM whereas TCONS_00022632-XLOC_010933 was the most samples was validated by reverse transcription-quantitative downregulated. Functional analysis revealed that several lncRNAs may exert activities in biological pathways associ- ated with ATRA-induced APL differentiation through cis and/or trans regulation of mRNAs.
    [Show full text]
  • Ultrastructural and Dynamic Studies of the Endosomal Compartment in Down Syndrome
    Botté et al. Acta Neuropathologica Communications (2020) 8:89 https://doi.org/10.1186/s40478-020-00956-z RESEARCH Open Access Ultrastructural and dynamic studies of the endosomal compartment in Down syndrome Alexandra Botté1, Jeanne Lainé1,2, Laura Xicota1, Xavier Heiligenstein3,4, Gaëlle Fontaine1, Amal Kasri1, Isabelle Rivals5, Pollyanna Goh6, Orestis Faklaris7, Jack-Christophe Cossec1, Etienne Morel8, Anne-Sophie Rebillat9, Dean Nizetic6,10, Graça Raposo4 and Marie-Claude Potier1* Abstract Enlarged early endosomes have been visualized in Alzheimer’s disease (AD) and Down syndrome (DS) using conventional confocal microscopy at a resolution corresponding to endosomal size (hundreds of nm). In order to overtake the diffraction limit, we used super-resolution structured illumination microscopy (SR-SIM) and transmission electron microscopies (TEM) to analyze the early endosomal compartment in DS. By immunofluorescence and confocal microscopy, we confirmed that the volume of Early Endosome Antigen 1 (EEA1)-positive puncta was 13–19% larger in fibroblasts and iPSC-derived neurons from individuals with DS, and in basal forebrain cholinergic neurons (BFCN) of the Ts65Dn mice modelling DS. However, EEA1-positive structures imaged by TEM or SR-SIM after chemical fixation had a normal size but appeared clustered. In order to disentangle these discrepancies, we imaged optimally preserved High Pressure Freezing (HPF)-vitrified DS fibroblasts by TEM and found that early endosomes were 75% denser but remained normal-sized. RNA sequencing of DS and euploid fibroblasts revealed a subgroup of differentially-expressed genes related to cargo sorting at multivesicular bodies (MVBs). We thus studied the dynamics of endocytosis, recycling and MVB- dependent degradation in DS fibroblasts.
    [Show full text]
  • Introductory Remarks on the Milieux of the Egg and the Early Embryo
    REPRODUCTIONREVIEW Use of proteomics to identify highly abundant maternal factors that drive the egg-to-embryo transition Piraye Yurttas, Eric Morency1 and Scott A Coonrod1 Weill Graduate School of Medical Sciences, Cornell University, 1300 York Avenue, New York, New York 10065, USA and 1College of Veterinary Medicine, Baker Institute for Animal Health, Cornell University, Hungerford Hill Road, Ithaca, New York 14853, USA Correspondence should be addressed to S A Coonrod; Email: [email protected] P Yurttas and E Morency contributed equally to this work P Yurttas is now at Celmatix, Inc., 7 Hubert Street, New York, New York 10013, USA Abstract As IVF becomes an increasingly popular method for human reproduction, it is more critical than ever to understand the unique molecular composition of the mammalian oocyte. DNA microarray studies have successfully provided valuable information regarding the identity and dynamics of factors at the transcriptional level. However, the oocyte transcribes and stores a large amount of material that plays no obvious role in oogenesis, but instead is required to regulate embryogenesis. Therefore, an accurate picture of the functional state of the oocyte requires both transcriptional profiling and proteomics. Here, we summarize our previous studies of the oocyte proteome, and present new panels of oocyte proteins that we recently identified in screens of metaphase II-arrested mouse oocytes. Importantly, our studies indicate that several abundant oocyte proteins are not, as one might predict, ubiquitous housekeeping proteins, but instead are unique to the oocyte. Furthermore, mouse studies indicate that a number of these factors arise from maternal effect genes (MEGs). One of the identified MEG proteins, peptidylarginine deiminase 6, localizes to and is required for the formation of a poorly characterized, highly abundant cytoplasmic structure: the oocyte cytoplasmic lattices.
    [Show full text]
  • Snapshot: Mammalian Rab Proteins in Endocytic Trafficking Thierry Galvez, Jérôme Gilleron, Marino Zerial, and Gregory A
    SnapShot: Mammalian Rab Proteins in Endocytic Traffi cking Thierry Galvez, Jérôme Gilleron, Marino Zerial, and Gregory A. O’Sullivan Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany RAB35 Plasma membrane RAB Cellular Functions Main Effectors (Main Location) CCV Rab recruitment Transport RAB4A,B,C Endocytic recycling ZFYVE20- VPS45, RABEP1, (CCV, EE, RE) RUFY1, GRIPAP1, AKAP10, RAB5 GDI Actin RAB11FIP1, CD2AP GDP GDI RAB5A,B,C EE fusion, EE biogenesis EEA1, ZFYVE20- VPS45, RAB5 RAB5 RAB4 RAB11 (CCV, EE, PG) APPL1/2, ANKFY1, RABEP1, GDP GDF GDI GTP RAB11 RABEP2, PIK3R4, PIK3CB, RAB5 OCRL, INPP5B, INPP4A, GDP MYO5B + F8A1, VPS8 (yeast) RABGEF1 RAB11 + RAB13 (EE, TJ) RE- to- PM transport, GLUT4 MICALL2, MICALL1 RAB5 GTP RAB5 traffi cking GTP RAB11FIP2 RAB21 (EE) Integrin endocytosis, N.D. RABEP1 cytokinesis RABGEF1 Early RAB22A EE- to- Golgi transport TBC1D2B, EEA1 endosome RAB5 RAB4 RAB31/RAB22B TGN- to- EE transport, PG TBC1D2B, OCRL (EE, TGN, PG) maturation Endosome RAB11 RAB23 (PM, EE) PG- LY fusion, Hedgehog N.D. fusion signaling, ciliogenesis PIK3R4 PIK3C3 RAB35 (PM, Endocytic recycling, cytokine- OCRL, ACAP2, FSCN1 CCV, EE) sis, actin dynamics RAB5 RAB5 RAB3A,B,C,D Regulated exocytosis (SV RPH3A, RPH3AL, RIMS1/2, GTP GTP (SG, SV) cycle) RAB3IP, SYN1, SYTL4/5 VTI1A RAB11 RAB25 RAB6A,B,C Golgi- to- PM, Golgi- to- GOLGB1, GCC2, OCRL, VAMP4 Recycling Ptdins(3)P (Golgi) endosome, intra- Golgi and KIF20A, MYH9, MYH10, RAB5 endosome ER- to- Golgi transport, DENND5A, BICD1, CCDC64,
    [Show full text]