DOCSLIB.ORG

WINNERS Sorted by Study Section

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WINNERS Sorted by Study Section FARE2012 WINNERS Sorted By Study Section NCI-CCR CHEN, YUHONG Postdoctoral Fellow Biochemistry - General and Lipids Fully synthetic virus-like nanoparticles targeting prostate cancer cells Lack of selective delivery of therapeutic agents into the right organ and cells remains a major problem in therapy of many diseases, including cancer. Useful lessons in delivery can be learned from nature. Viruses are able to deliver a variety of biomolecules into certain cell types because they have the abilities to self-assemble and disassemble when needed and enter cells in receptor-mediated manner. However, assembly of molecules generated by chemical synthesis into virus-like particles has yet to be achieved. We have found that analogs of transmembrane (TM) helixes of integral membrane proteins self-assemble into round nanoparticles if equipped with terminal negative charges. A 24-amino acid peptide corresponding to the second transmembrane helix of the CXCR4 chemokine receptor adopts a predominantly beta-type conformation in aqueous solutions and self-assembles into nanoparticles with a diameter around 10 nm. Similar to viruses, nanoparticles fuse with cell membranes. Spontaneous fusion is accompanied by transition into active helical conformation that allows for potent inhibition of CXCR4 activity both in vitro and in a mouse model of metastatic breast cancer. Derivatization of CXCR4 TM antagonist with polyethylene glycol (PEG) chains slows down cell fusion, but results in nanoparticles that are very stable and more than 99% homogeneous in size. To generate nanoparticles that fuse with tumor cells in receptor-mediated manner, we constructed conjugates consisting of self-assembling CXCR4 antagonist, PEG chains and ligands for receptors overexpressed on prostate tumor cells, gastrin releasing peptide (GRP) receptor and luteinizing hormone-releasing hormone (LHRH) receptor. Attachment of peptide receptor ligands to the C-terminal end of CXCR4 TM antagonist not only did not interfere with self- assembly but produced more homogeneous and stable nanoparticles. Microscopy studies showed that targeted nanoparticles fused with receptor-positive cells much more effectively than with receptor-negative cells. In addition, nanoparticles have hydrophobic interior and can efficiently encapsulate hydrophobic anti-cancer agents. The new self-assembling virus-like particles present a new paradigm in drug development: a fully synthetic self-assembling delivery system with intrinsic dual and even triple anti-tumor activity. The approach is likely to be expandable to many tumor types and pathological conditions. NICHD Clokie, Samuel Visiting Fellow Biochemistry - General and Lipids Discovery of a novel small RNA: piYRNA The field of small RNAs has undergone rapid and intense study following the discovery of the mechanism of small RNA mediated gene silencing (siRNA) in the late 1990s. The subsequent discovery of a similar class of RNA termed microRNAs (miRNAs) has expanded the known complexity of RNA interference gene regulation still further. Another class of small RNAs revealed by recent studies is piRNA; these are ~28nt, have a different biogenesis compared to miRNA and are also involved in gene silencing. Here we report the discovery of several previously unreported small RNAs in the pineal gland, based on cloning and next-generation sequencing methodology. One of these, a 27nt RNA was selected for further study because of relatively high expression in comparison to other ‘novel’ small RNAs. Alignment analysis indicated it maps to the stem-loop structure of the 112nt non-coding cytoplasmic RNA YRNA, consistent with a precursor/product relationship. The novel small RNA has been termed piYRNA, reflecting size similarity to piRNA and the apparent origin. A northern blot tissue screen indicated piYRNA is located in all tissues examined at similar levels, except for the retina that has > 100 fold higher levels. An affinity pull down method was used to identify piYRNA-binding proteins. This effort found that piYRNA binds several proteins, the most prominent of which was matrin3, a nuclear matrix- associated protein with two zinc finger domains and two RNA binding domains in close proximity. Related studies with piYRNA mutants revealed a significant degree of sequence specificity and that the piYRNA: matrin 3 interaction is contingent upon the RNA being single stranded. Studies with matrin 3 peptides indicate piYRNA binding requires both RNA binding domains (Kd = 20nM). Preliminary experiments indicate that piYRNA interferes with transcription and/or translation, pointing to the possibility that this may represent the physiological mode of action of piYRNA. In summary, these studies have discovered a novel small RNA, piYRNA, that binds to matrin 3 and has the capacity to inhibit transcription and/or translation. The finding of a high concentration of piYRNA in the retina suggests that it might have an important role in this tissue in modulating transcription and or translation. NICHD Jovic, Marko Visiting Fellow Biochemistry - General and Lipids Regulation of PI4KIIa Retrograde Transport Proper function of each cellular compartment relies on maintenance of the unique lipid composition of its membrane. In the Golgi, phosphatidylinositol 4-phosphate (PtdIns4P) is the key regulatory lipid that mediates sorting of proteins out of this compartment. Interestingly, while several PtdIns4P lipid kinases (PI4Ks) localize to the Golgi, a large fraction of PI4KIIa is also found on endosomes. Tight membrane association of PI4KIIa through a palmitoyl moiety implies that this enzyme must continuously cycle between endosomes and Golgi. The importance of PI4KIIa localization is underscored by its role in EGF receptor degradation, Wnt signaling and a late-onset neurodegeneration developing in PI4KIIa gene- trapped mice. Surprisingly, little is known about the molecular events determining the localization and functions of PI4KIIa in various cellular compartments. This study was designed to address the regulation of PI4KIIa transport between Golgi and endosomes. To this aim we performed a proteomic screen of potential binding partners of PI4KIIa using tandem mass-spectrometry analysis of proteins that were co- immunoprecipitated (Co-IP) with PI4KIIa. Intriguingly, among the highest affinity partners was a vesicular fusion protein VAMP-3 that is known to facilitate fusion of endosome-originated membranes with the Golgi. This interaction was confirmed in Co-IP experiments, by performing a pull-down of either VAMP-3 or PI4KIIa followed by blotting against the other binding partner. In control experiments VAMP- 3 pull-down did not bring down PI4KIIIb, a PI4K that localizes to the Golgi. Remarkably, expression of Tetanus toxin (TeNT), which cleaves VAMP-3 and inhibits one of the retrograde trafficking routes, resulted in accumulation of PI4KIIa on endosomes as determined by live-cell confocal microscopy. In a control rescue experiment, overexpression of TeNT together with mutant VAMP-3 resistant to TeNT recovered the Golgi localization of PI4KIIa. TeNT will, therefore, serve as a valuable method in our future kinetic studies where a photoactivatable variant of PI4KIIa will be used to assess the rate of its retrograde transport back to the Golgi in the presence of TeNT. Taken together, these findings provided the first evidence of the potential mechanism regulating PI4KIIa retrograde transport, and revealed new approaches by which to study the role of PI4KIIa in cellular processes relevant to human health and disease. NEI Subramanian, Preeti Postdoctoral Fellow Biochemistry - General and Lipids Structure-function Relationships of Pigment Epithelium-derived Factor Receptor (PEDFR): Identification of a PEDF Binding Region Retinal degenerations lead to retina cell death and to irreversible blindness. Pigment epithelium-derived factor (PEDF) is a natural ocular protein with potent retinal survival properties, however, its molecular mechanisms of action remain unknown. We propose that extracellular PEDF acts by interacting on cell surfaces with PEDFR, a novel membrane-linked lipase protein identified in our laboratory. The PEDFR amino acid sequence reveals a patatin-like phospholipase domain near its N-terminus, four transmembrane domains, three intracellular regions and two extracellular loops (L2 and L4). The PEDFR protein exhibits phospholipase A2 (PLA2) activity, and specifically binds PEDF with high affinity resulting in stimulation of fatty acid release from phospholipids. The purpose of this work is to identify a PEDF binding site on PEDFR and its significance for cell survival. Surface plasmon resonance (SPR), affinity chromatography and pulldown experiments showed that the recombinant catalytic site variant PEDFR[D166A], loop L4 (L159-M325), and C-terminal truncated PEDFR4 (M1-L232) polypeptide fragments bound PEDF with similar affinity as the full length PEDFR (M1- L504) (KD=3-14nM). While the alteration D166A abolished, the PEDFR4 retained PLA2 activity, which PEDF stimulated. We designed synthetic peptides spanning L4 for PEDF binding assays. Ligand blot, SPR and affinity chromatography proved that only peptides E5b (I193–L232), P1 (T210-L249) and E5d (T210- L232) specifically bound PEDF. Moreover, removal of the E5b region from PEDFR and PEDFR4 did not affect PLA2 activity but decreased PEDF-mediated PLA2 stimulation. In experiments with rat retina R28 cells, active PEDFR protein was identified in plasma membranes and PEDF stimulated its activity. Real- time microelectronic
Load more

Recommended publications
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • (2017) Emerging Significance of Bile Acids
    Texas Medical Center Digestive Diseases Center 8th Annual Frontiers in Digestive Diseases Symposium: Emerging Significance of Bile Acids in Digestive & Liver Diseases Saturday, February 11, 2017 Onstead Auditorium, Houston, Texas 77030 Table of Contents ....................................................................................................................................................................... 1 Agenda .......................................................................................................................................................................................... 2 CME Activity............................................................................................................................................................................... 3 List of Abstracts .................................................................................................................................................................... 4 - 6 Abstracts............................................................................................................................................................................... 7 - 41 TMC DDC Leadership ............................................................................................................................................................ 42 List of Participants ............................................................................................................................................................ 43 - 46 Acknowledgements
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Comprehensive Identification and Characterization of Somatic Copy Number Alterations in Triple‑Negative Breast Cancer
    INTERNATIONAL JOURNAL OF ONCOLOGY 56: 522-530, 2020 Comprehensive identification and characterization of somatic copy number alterations in triple‑negative breast cancer ZAIBING LI1,2*, XIAO ZHANG3*, CHENXIN HOU4, YUQING ZHOU4, JUNLI CHEN1, HAOYANG CAI5, YIFENG YE3, JINPING LIU3 and NING HUANG1 1Department of Pathophysiology, West China School of Basic Medical Sciences and Forensic Medicine, Sichuan University, Chengdu, Sichuan 610041; 2Department of Pathophysiology, School of Basic Medical Science, Southwest Medical University, Luzhou, Sichuan 646000; 3Department of Breast Surgery, Sichuan Provincial People's Hospital, University of Electronic Science and Technology of China, Chengdu, Sichuan 611731; 4West China Medical School, Sichuan University, Chengdu, Sichuan 610041; 5Center of Growth, Metabolism and Aging, Key Laboratory of Bio‑Resources and Eco‑Environment, College of Life Sciences, Sichuan University, Chengdu, Sichuan 610064, P.R. China Received January 30, 2019; Accepted August 30, 2019 DOI: 10.3892/ijo.2019.4950 Abstract. Triple-negative breast cancer (TNBC) accounts hierarchical clustering of tumors resulted in three main for ~15% of all breast cancer diagnoses each year. Patients subgroups that exhibited distinct CNA profiles, which with TNBC tend to have a higher risk for early relapse and may reveal the heterogeneity of molecular mechanisms in a worse prognosis. TNBC is characterized by extensive TNBC subgroups. These results will extend the molecular somatic copy number alterations (CNAs). However, the DNA understanding of TNBC and will facilitate the discovery of CNA profile of TNBC remains to be extensively investigated. therapeutic and diagnostic target candidates. The present study assessed the genomic profile of CNAs in 201 TNBC samples, aiming to identify recurrent CNAs that Introduction may drive the pathogenesis of TNBC.
    [Show full text]
  • A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author J Dent Res Manuscript Author . Author manuscript; Manuscript Author available in PMC 2017 October 01. Published in final edited form as: J Dent Res. 2017 October ; 96(11): 1322–1329. doi:10.1177/0022034517716914. A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts L.M. Moreno Uribe1, T. Fomina2, R.G. Munger3, P.A. Romitti4, M.M. Jenkins5, H.K. Gjessing2,6, M. Gjerdevik2,6, K. Christensen7, A.J. Wilcox8, J.C. Murray9, R.T. Lie2,6,*, and G.L. Wehby10,* 1Department of Orthodontics and Dows Institute, College of Dentistry, University of Iowa, Iowa City, IA, USA 2Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway 3Department of Nutrition and Food Sciences, Utah State University, Logan, UT, USA 4Department of Epidemiology, College of Public Health, University of Iowa, Iowa City, IA, USA 5National Center on Birth Defects and Developmental Disabilities, Centers for Disease Control and Prevention, Atlanta, GA, USA 6Norwegian Institute of Public Health, Bergen and Oslo, Norway 7Department of Public Health, University of Southern Denmark; Department of Clinical Genetics and Department of Biochemistry and Pharmacology, Odense University Hospital, Odense, Denmark 8Epidemiology Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Durham, NC, USA 9Department of Pediatrics, Carver College of Medicine, University of Iowa, Iowa City, IA, USA 10Departments of Health Management and Policy, Economics, and Preventive and Community Dentistry, and Public Policy Center, University of Iowa, Iowa City, IA, USA Abstract Prior genome-wide association studies for oral clefts have focused on clinic-based samples with unclear generalizability.
    [Show full text]
  • Differentiation of the Human PAX7
    © 2020. Published by The Company of Biologists Ltd | Development (2020) 147, dev187344. doi:10.1242/dev.187344 HUMAN DEVELOPMENT TECHNIQUES AND RESOURCES ARTICLE Differentiation of the human PAX7-positive myogenic precursors/satellite cell lineage in vitro Ziad Al Tanoury1,2,3, Jyoti Rao2,3, Olivier Tassy1,Bénédicte Gobert1,4, Svetlana Gapon2, Jean-Marie Garnier1, Erica Wagner2, Aurore Hick4, Arielle Hall5, Emanuela Gussoni5 and Olivier Pourquié1,2,3,6,* ABSTRACT SC derive from the paraxial mesoderm, the embryonic tissue that Satellite cells (SC) are muscle stem cells that can regenerate adult forms the vertebral column and skeletal muscles (Chal and Pourquié, muscles upon injury. Most SC originate from PAX7+ myogenic 2017; Gros et al., 2005; Hutcheson et al., 2009; Kassar-Duchossoy precursors set aside during development. Although myogenesis has et al., 2005; Lepper and Fan, 2010; Relaix et al., 2005; Schienda et al., + been studied in mouse and chicken embryos, little is known about 2006). Pax3 myogenic precursors arise from the dorsal epithelial + human muscle development. Here, we report the generation of human compartment of the somite called the dermomyotome. Pax3 cells of induced pluripotent stem cell (iPSC) reporter lines in which fluorescent the dermomyotome lips activate Myf5, then downregulate Pax3 and proteins have been introduced into the PAX7 and MYOG loci. We use delaminate and differentiate into elongated post-mitotic myocytes single cell RNA sequencing to analyze the developmental trajectory of expressing myogenin (Myog) to form the first embryonic muscles + the iPSC-derived PAX7+ myogenic precursors. We show that the called myotomes (Chal and Pourquié, 2017). At the same time, Pax3 PAX7+ cells generated in culture can produce myofibers and self- myogenic precursors delaminate from the lateral edge of the renew in vitro and in vivo.
    [Show full text]
  • Senescence Induced by RECQL4 Dysfunction Contributes to Rothmund–Thomson Syndrome Features in Mice
    Citation: Cell Death and Disease (2014) 5, e1226; doi:10.1038/cddis.2014.168 OPEN & 2014 Macmillan Publishers Limited All rights reserved 2041-4889/14 www.nature.com/cddis Senescence induced by RECQL4 dysfunction contributes to Rothmund–Thomson syndrome features in mice HLu1, EF Fang1, P Sykora1, T Kulikowicz1, Y Zhang2, KG Becker2, DL Croteau1 and VA Bohr*,1 Cellular senescence refers to irreversible growth arrest of primary eukaryotic cells, a process thought to contribute to aging- related degeneration and disease. Deficiency of RecQ helicase RECQL4 leads to Rothmund–Thomson syndrome (RTS), and we have investigated whether senescence is involved using cellular approaches and a mouse model. We first systematically investigated whether depletion of RECQL4 and the other four human RecQ helicases, BLM, WRN, RECQL1 and RECQL5, impacts the proliferative potential of human primary fibroblasts. BLM-, WRN- and RECQL4-depleted cells display increased staining of senescence-associated b-galactosidase (SA-b-gal), higher expression of p16INK4a or/and p21WAF1 and accumulated persistent DNA damage foci. These features were less frequent in RECQL1- and RECQL5-depleted cells. We have mapped the region in RECQL4 that prevents cellular senescence to its N-terminal region and helicase domain. We further investigated senescence features in an RTS mouse model, Recql4-deficient mice (Recql4HD). Tail fibroblasts from Recql4HD showed increased SA-b-gal staining and increased DNA damage foci. We also identified sparser tail hair and fewer blood cells in Recql4HD mice accompanied with increased senescence in tail hair follicles and in bone marrow cells. In conclusion, dysfunction of RECQL4 increases DNA damage and triggers premature senescence in both human and mouse cells, which may contribute to symptoms in RTS patients.
    [Show full text]
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • Differentially Expressed on Collagen Networks 1, 2, 10 © 2000-2009 Ingenuity Systems, Inc. All Rights Reserved. Symbol Entrez
    Differentially expressed on collagen Networks 1, 2, 10 © 2000-2009 Ingenuity Systems, Inc. All rights reserved. Symbol Entrez Gene Name Affymetrix Fold Change Location Family ALDH1A3 aldehyde dehydrogenase 1 family, member A3 203180_at -5.43125168 Cytoplasm enzyme 209772_s_ Plasma CD24 CD24 molecule at -4.32890229 Membrane other HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 204130_at -4.1099197 Cytoplasm enzyme Plasma AMOTL2 angiomotin like 2 203002_at -2.82872773 Membrane other transcription DLX2 distal-less homeobox 2 207147_at -2.74996362 Nucleus regulator 221215_s_ RIPK4 receptor-interacting serine-threonine kinase 4 at -2.56556472 Nucleus kinase PLK2 polo-like kinase 2 (Drosophila) 201939_at -2.47054478 Nucleus kinase ALDH3A1 aldehyde dehydrogenase 3 family, memberA1 205623_at -2.30532989 Cytoplasm enzyme TXNRD1 thioredoxin reductase 1 201266_at -2.27936909 Cytoplasm enzyme Extracellular CYR61 cysteine-rich, angiogenic inducer, 61 201289_at -2.09052668 Space other 214212_x_ FERMT2 fermitin family homolog 2 (Drosophila) at -1.87478183 Cytoplasm other Plasma RIT1 Ras-like without CAAX 1 209882_at -1.77586775 Membrane enzyme 210297_s_ Extracellular MSMB microseminoprotein, beta- at -1.72177723 Space other Extracellular PI3 peptidase inhibitor 3, skin-derived 203691_at -1.68135697 Space other ALDH3B1 aldehyde dehydrogenase 3 family, member B1 205640_at -1.67376791 Cytoplasm enzyme 202124_s_ Plasma TRAK2 trafficking protein, kinesin binding 2 at -1.6367793 Membrane transporter BMP and activin membrane-bound inhibitor Plasma BAMBI
    [Show full text]
  • Methylation of the NT5E Gene Is Associated with Poor Prognostic Factors in Breast Cancer
    diagnostics Article Methylation of the NT5E Gene Is Associated with Poor Prognostic Factors in Breast Cancer Young Ju Jeong 1,* , Hoon Kyu Oh 2 , Hye Ryeon Choi 3 and Sung Hwan Park 1 1 Department of Surgery, Catholic University of Daegu School of Medicine, Daegu 42471, Korea; [email protected] 2 Department of Pathology, Catholic University of Daegu School of Medicine, Daegu 42471, Korea; [email protected] 3 Department of Thyroid and Endocrine Surgery, Thyroid Cancer Center, Severance Hospital, Yonsei University College of Medicine, Seoul 03722, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-53-560-4875 Received: 8 October 2020; Accepted: 11 November 2020; Published: 12 November 2020 Abstract: Cluster of differentiation (CD) 73, which is encoded by the NT5E gene, regulates production of immunosuppressive adenosine and is an emerging checkpoint in cancer immunotherapy. Despite the significance of CD73 in immuno-oncology, the roles of the NT5E gene methylation in breast cancer have not been well-defined yet. Therefore, we aimed to investigate the prognostic significance of the NT5E gene methylation in breast cancer. The DNA methylation status of the NT5E gene was analyzed using pyrosequencing in breast cancer tissues. In addition, the levels of inflammatory markers and lymphocyte infiltration were evaluated. The mean methylation level of the NT5E gene was significantly higher in breast cancer than in normal breast tissues. In the analysis of relevance with clinicopathologic characteristics, the mean methylation levels of the NT5E gene were significantly higher in patients with large tumor size, high histologic grade, negative estrogen receptor expression, negative Bcl-2 expression, and premenopausal women.
    [Show full text]
  • MOLECULAR G EN ETICS of the January, HUMAN X
    MOLECULAR GENETICS OF THE HUMAN X CHROMOSOME BY DAVID ANDREW HARTLEY a thesis submitted for the degree of Doctor of Philosophy in the University of London January, 1984 Department of Biochemistry St. Mary's Hospital Medical School London W2 IPG 1 Abstract The comparison of frequency of recombination with chromosomal position has been possible only in Drosophila melanogaster but it is known that chiasma distribution in the human male (and many other species) is not random. A number of cloned DNA sequences have been isolated from a library enriched for X chromosome DNA by flow cytometry. The chromosomal loci complementary to these cloned sequences have been investigated by hybridization to somatic cell hybrid DNAs and by direct hybridization 1 in situ' to human metaphase spreads. In this way a cytological map of the X chromosome defined by DNA sequence markers has been constructed. Genetic distances complementary to the physical separations determined have been estimated by determining the segregation of DNA sequence variants at each locus in three generation p e d i g r e e s . The sequence variation is manifested as altered restriction fragment migration in agarose gels. It is intimated from these analyses that the pattern of recombination frequency along the human X chromosome mirrors the non-random chiasma distribution seen along male autosomes. This supports the chiasmatype theory and has implications on the availability of genetic components of the X chromosome to recombination. 2 To ray father in the hope of convincing him of life outside o f E.coli 3 ...scientists getting their kicks when deadly disease can do as it pleases results ain't hard to predict Gil Scott-Heron 4 Ack n ov; ledgements To my supervisor Bob Williamson for support.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]