Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Loss of gastrokine-2 drives premalignant gastric inflammation and tumor progression

Trevelyan R. Menheniott,1,2 Louise O’Connor,1 Yok Teng Chionh,1 Jan Däbritz,1,2 Michelle Scurr,1 Benjamin N. Rollo,1 Garrett Z. Ng,1 Shelley Jacobs,1 Angelique Catubig,1 Bayzar Kurklu,1 Stephen Mercer,1 Toshinari Minamoto,3 David E. Ong,4 Richard L. Ferrero,5 James G. Fox,6 Timothy C. Wang,7 Philip Sutton,1,8 Louise M. Judd,1,2 and Andrew S. Giraud1,2 1Murdoch Children’s Research Institute, Melbourne, Victoria, Australia. 2Department of Paediatrics, University of Melbourne, Melbourne, Victoria, Australia. 3Division of Translational and Clinical Oncology, Cancer Research Institute, Kanazawa University, Kanazawa, Japan. 4University Medicine Cluster, Division of Gastroenterology and Hepatology, National University Hospital Singapore, Singapore. 5Centre for Innate Immunity and Infectious Diseases, Monash Institute of Medical Research, Monash University, Clayton, Victoria, Australia. 6Division of Comparative Medicine, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA. 7Division of Digestive and Liver Disease, Department of Medicine, Columbia University Medical Center, New York, New York, USA. 8Centre for Animal Biotechnology, School of Veterinary and Agricultural Science, University of Melbourne, Parkville, Victoria, Australia.

Chronic mucosal inflammation is associated with a greater risk of gastric cancer (GC) and, therefore, requires tight control by suppressive counter mechanisms. Gastrokine-2 (GKN2) belongs to a family of secreted proteins expressed within normal gastric mucosal cells. GKN2 expression is frequently lost during GC progression, suggesting an inhibitory role; however, a causal link remains unsubstantiated. Here, we developed Gkn2 knockout and transgenic overexpressing mice to investigate the functional impact of GKN2 loss in GC pathogenesis. In mouse models of GC, decreased GKN2 expression correlated with gastric pathology that paralleled human GC progression. At baseline, Gkn2 knockout mice exhibited defective gastric epithelial differentiation but not malignant progression. Conversely, Gkn2 knockout in the IL-11/STAT3-dependent gp130F/F GC model caused tumorigenesis of the proximal stomach. Additionally, gastric immunopathology was accelerated in Helicobacter pylori–infected Gkn2 knockout mice and was associated with augmented T helper cell type 1 (Th1) but not Th17 immunity. Heightened Th1 responses in Gkn2 knockout mice were linked to deregulated mucosal innate immunity and impaired myeloid- derived suppressor cell activation. Finally, transgenic overexpression of human gastrokines (GKNs) attenuated gastric tumor growth in gp130F/F mice. Together, these results reveal an antiinflammatory role for GKN2, provide in vivo evidence that links GKN2 loss to GC pathogenesis, and suggest GKN restoration as a strategy to restrain GC progression.

Introduction cell lineages of the stomach (6–9). The 3 GKNs are encoded by Gastric cancer (GC) has one of the highest rates of neoplasia- a tightly linked gene cluster on human chromosome 2p13.3 and related mortality worldwide (1). Chronic inflammation after infec- show broad evolutionary conservation in mammals and higher tion with Helicobacter pylori is an established risk factor for the vertebrates (6, 10). GKN1 and GKN2 were identified in differen- most common or “intestinal-type” GC (2), initiating progression tial expression screens as novel genes downregulated in GC (7, 8, to atrophic gastritis, intestinal metaplasia, and adenocarcinoma 11). The recently discovered GKN3 was found in a bioinformatic (2). Nevertheless, causal mechanisms linking inflammation to GC scan for novel BRICHOS proteins. Mouse Gkn3, in contrast to the progression remain incompletely understood. GC is believed to be other GKNs, is overexpressed in atrophic gastritis associated with of epithelial origin, deriving clonally from gastric epithelial cells H. pylori infection (9, 10). While broadly functional in mammals, (GECs) or their progenitors (3, 4). Therefore, elucidation of factors human GKN3 persists only as a nonexpressed pseudogene (9, 10). that counteract the immune-related premalignant transformation Abundantly expressed in surface mucus cells (SMCs) of of GECs (2) is of high priority for the advancement of GC therapies the normal human stomach, GKN1 and GKN2 show coordinate and improved survival. downregulation in H. pylori infection, frequent loss of expression Gastrokines (GKNs) are small (~18-kDa) proteins belonging to in gastric adenocarcinoma, and silencing in tumor cell lines (8). the BRICHOS protein superfamily, characterized by an approxi- Conversely, an expression microarray study identified GKN2 as mately 100–amino acid BRICHOS domain, with established links the most upregulated gene in the gastric transcriptome after erad- to inflammatory disease, dementia, and cancer (5, 6). While all ication of H. pylori and resolution of mucosal inflammation (12). BRICHOS proteins are secreted or processed to generate secreted These observations argue that GKNs and, in particular, GKN2, mature peptides, GKNs are unique in being almost exclusively function either as homeostatic regulators of mucosal immunity expressed within, and secreted by, mucus-producing epithelial and/or as stomach-specific tumor-suppressor genes (TSGs). Bio- activities attributed to GKNs include growth suppression, inhibi- tion of epithelial-to-mesenchymal transition, migration, and inva- Conflict of interest: The authors have declared that no conflict of interest exists. Submitted: May 12, 2015; Accepted: February 4, 2016. sion of tumor cells (reviewed in ref. 6). While ostensibly supportive Reference information: J Clin Invest. 2016;126(4):1383–1400. doi:10.1172/JCI82655. of TSG or anticancer roles, these functional observations derive

jci.org Volume 126 Number 4 April 2016 1383 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation mostly from studies in transformed cell lines and, thus, have lim- QRT-PCR revealed progressive loss of Gkn2 mRNA from the proxi- ited in vivo relevance. Modes of action of GKNs are poorly under- mal or corpus stomach, commencing between 7 days and 2 months stood, with cognate receptors and signal transduction pathways after infection (MPI) with mouse-adapted H. pylori Sydney strain remaining elusive (see commentary in ref. 6). However, reports of 1 (SS1), with more pronounced loss (in whole stomach) at 12 MPI a gastric secreted GKN2/trefoil factor 1 (TFF1) heterodimer (13, (Figure 1E). Similarly, decreased Gkn2 mRNA expression occurred 14) have suggested that GKN2 might act via homeostatic and/or in stomachs of mice with genetic induction of gastric inflamma- tumor-suppressor activities of TFFs. Current literature implicates tion (stomach-overexpressing H+K+ATPase subunit [Atp4b] pro- GKN2 loss as a determinant of GC pathogenesis, yet evidence of moter Gm-CSf transgenic [Gm-CSfTg] mice), atrophy/metaplasia/ a causal role is lacking. Despite their likely clinical importance, hypertrophy (HK–/– mice), and tumorigenesis (gp130F/ F mice; HK none of the GKNs have been tested functionally in mouse genetic promoter IL1 transgenic [IL1Tg mice]) (Figure 1F). Gkn2 mRNA models. As such, physiological and pathological roles of GKN2 expression was unchanged in the distal (antral) stomach during (and of other GKNs) remain unsubstantiated in vivo. the early stages of H. pylori infection (7 days and 2 MPI; Figure 1E) To address the impact of GKN2 loss on GC pathogenesis in but strongly downregulated in antral tumors of gp130F/ F mice (Fig- vivo, here we report the generation and phenotype analysis of Gkn2 ure 1F). Therefore, GKN2/Gkn2 expression levels were inversely knockout mice. Our studies show that GKN2 has antiinflammatory correlated with (H. pylori–related) gastric pathology. These results activity in the stomach sufficient to restrain progression of cytokine- reveal conservation of GKN2 loss in GC pathogenesis in humans driven gastric tumorigenesis and H. pylori infection–related prema- and mice, thereby validating a mouse genetic approach to investi- lignancy. Moreover, transgenic expression of human GKNs in a val- gate GKN2 loss in vivo. idated gastric tumor model restrains pathological progression. The Targeted deletion of the mouse Gkn2 locus. We derived a Gkn2 mechanism for GKN2 activity involves expansion and activation knockout allele using VelociGene embryonic stem cell lines of suppressive myeloid cells and inhibition of antigen-presenting (Knockout Mouse Project) in which Gkn2-coding exons were cells (APCs), including macrophages and DCs, leading to, leading replaced with a lacZ reporter and floxed neomycin selection cas- to attenuated mucosal Th1 immunity. These studies reveal anti- sette. The neomycin cassette was excised by crossing Gkn2+/– hete- inflammatory and tumor inhibitory roles for GKN2 and elucidate rozygotes with germline-specific Cre-recombinase–deleter trans- GKN2 loss as a key event underlying GC progression. genic mice (20), and the resulting progeny were mated to obtain homozygous mutants (Figure 2, A and B). Homozygous Gkn2–/– Results mice were functionally null, showing a complete absence of GKN2 Conserved GKN2 expression loss in human and mouse GC progres- protein in gastric lysates, but expressed normal levels of GKN1 sion. Human GKN2 and mouse Gkn2 are highly conserved in their and GKN3 proteins (Figure 2C). Additionally, Gkn2–/– mice showed genomic organization, intron/exon structure, and genetic linkage to normal fertility, viability, and postnatal survival (Supplemental other GKN paralogs (Supplemental Figure 1; supplemental material Tables 1 and 2 and Supplemental Figure 3). To identify cell lineages available online with this article; doi:10.1172/JCI82655DS1) and primarily affected by targeting the Gkn2 locus, we histochemically are thus predicted to show similar regulation in vivo. Mouse genetic assessed lacZ reporter gene (-gal) expression by staining whole- models have revealed key mechanisms underlying the premalig- mount stomachs with X-gal (Supplemental Methods). Consistent nant transformation of GECs (15–19) and collectively reproduce with the pattern of endogenous Gkn2 expression (Figure 1D), we many of the histopathologic features of human GC progression observed intense -gal expression in the corpus and antral-pyloric (Supplemental Figure 2). To confirm clinical relevance and estab- mucosa of Gkn2+/– mice (Figure 2, D and E), which ceased abruptly lish a rationale for using a mouse genetic approach to GKN2 loss, at the proximal limiting ridge at the corpus/forestomach (Figure we compared GKN2 expression in human and mouse GC patho- 2F) and pyloric/duodenal (Figure 2G) junctions, respectively. His- genesis. Quantitative RT-PCR (QRT-PCR) revealed progressive tological analysis showed specific localization of -gal expression loss of GKN2 mRNA in human gastric epithelial tissues from indi- to SMCs of the corpus (Figure 2, H and I) and antrum (Figure 2, viduals with H. pylori infection/gastritis (fold change –3.61 ± 0.56; J and K). Double staining in Gkn2+/– stomachs confirmed over- P < 0.001) and intestinal metaplasia (fold change –10.62 ± 3.51; lapping distribution of GKN2 and -gal in SMCs (Figure 2, L–N). P < 0.001) relative to normal (disease-free) controls; GKN2 mRNA Therefore, expression of this Gkn2-lacZ reporter/null allele mir- was either marginally expressed or undetected in the majority of rors that of endogenous GKN2 protein, suggesting that gastric gastric tumors (GC; fold change –84,223 ± 31,909; P < 0.001; Fig- SMC is the only lineage autonomously affected by GKN2 loss of ure 1A). Loss of GKN2 mRNA was also reflected at the protein level. function in Gkn2–/– mice. Immunohistochemical staining revealed abundant GKN2 expres- Gkn2–/– mice show impairment of gastric epithelial differentiation sion in SMCs of normal antral mucosa, whereas GKN2 expression that does not progress to malignant disease. Stomachs from 6-, 12-, was reduced in H. pylori–infected tissues and absent in the majority and 30-week-old Gkn2–/– mice were examined by standard histo- of intestinal metaplasia and GC tissues (Figure 1B). pathology. Although cell-autonomous TSG roles have been long In mice, GKN2 protein was also stomach specific (Figure 1C), suspected of GKN family proteins (6), Gkn2–/– mice showed no and, as previously shown in humans (15), it localized to SMCs of the evidence of spontaneous gastric tumors to support this supposi- gastric corpus and antrum (Figure 1D). We assessed Gkn2 mRNA tion. Gkn2–/– mice presented with clear abnormalities of the corpus expression levels in mouse H. pylori infection, transgenic, and mucosa, including focal hypertrophic lesions, which were evident knockout models, which collectively reproduce H. pylori inflam- macroscopically and histologically. Lesions were first apparent at matory, premalignant, and tumorigenic stages of human GC. 6 weeks of age and persisted, but did not increase in severity, in

1384 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Figure 1. Loss of GKN2 expression in human and mouse GC progression. (A) QRT-PCR analysis of GKN2 mRNA in human GC. Scatter plots show mRNA fold changes for H. pylori–infected tissue (HP; n = 16), premalignant tissue adjacent to tumor with intestinal metaplasia (IM; n = 28), and GC tissue (n = 28) relative to normal (N; n = 6) gastric epithelial tissues. (B) Representative photomicrographs showing GKN2 immunostaining in human gastric tissues (see above). Normal and H. pylori–infected tissue show antral mucosa. Scale bar: 50 m. Intestinal metaplasia shows corpus mucosa; presence of goblet cells is confirmed by AB-PAS staining of an adjacent section. GC shows adenocarcinoma in corpus mucosa. Scale bar: 100 m (first and second columns and top image fourth column); 50 m (third column and bottom image fourth column). (C) Immunoblots of mouse GKN2 protein. GAPDH verifies protein integrity. Two GKN2 bands represent unprocessed precursor (20-kDa) and secreted mature (18-kDa) protein, respectively. Oes, oesophagus; Duo, duodenum; PSI, proximal small intestine; MSI, middle small intestine; DSI, distal small intestine. (D) Immunofluorescent localization of mouse GKN2 protein in corpus and antrum mucosa. Scale bar: 50 m (first and third image) and 25 m (second and fourth image). (E) QRT-PCR analysis of Gkn2 mRNA in H. pylori SS1– infected WT (C57BL/6) mouse corpus, antrum, or whole stomach at 7 days (7 d), 2 months (2 mo), or 12 months (12 mo). Box plots show median mRNA fold change relative to uninfected mice. (F) QRT-PCR analysis of mouse genetic models described in B. (E and F) In box-and-whisker plots, horizontal bars indicate the medians, boxes indicate 25th to 75th percentiles, and whiskers indicate 10th and 90th percentiles. P values were determined using a 2-tailed Student’s t test: *P < 0.05; ***P < 0.001.

12- and 30-week-old animals (Figure 3, A and B, and Supplemen- remained significantly elevated in 30-week-old Gkn2–/– mice (Fig- tal Figure 4). Mucosal defects, including inflammation, glandular ure 3C). Overall corpus mucosal thickness in Gkn2–/– mice was not atrophy, mucus neck cell (MNC) hyperplasia, and replacement of significantly different than that of age-matched WT mice (Figure periodic acid–Schiff–stained (PAS-stained) neutral mucin with 3D). Nonetheless, corpus mucosal defects, and lesion areas in Alcian blue–stained acidic mucin in SMC (SMC metaplasia), were particular, were associated with an increased epithelial prolifera- all significantly increased in the corpus mucosa of 6- and 12-week- tion rate in 6- and 12-week-old but not 30-week-old Gkn2–/– mice old Gkn2–/– mice, while MNC hyperplasia and SMC metaplasia (Figure 3E). By contrast, the antral mucosa of Gkn2–/– mice had a

jci.org Volume 126 Number 4 April 2016 1385 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

Figure 2. Targeted deletion of the mouse Gkn2 locus. (A) Strategy used to target the mouse Gkn2 locus. Red arrowheads denote primer pairs used to amplify WT and targeted alleles by PCR. Scale bar: 1 kbp. (B) PCR genotyping strategy. WT and targeted alleles generate 442-bp and 214-bp bands, respectively. Upper and lower bands show 500 and 200 bp, respec- tively. M, molecular weight marker of the 100-bp ladder. (C) Immunoblot showing GKN2 protein expression in WT, Gkn2+/–, and Gkn2–/– gastric corpus tissues. Molecular weights (kDa) of protein bands are shown. Histograms show densitometry of protein bands/GAPDH (n = 3 per group). P values were determined using a 2-tailed Student’s t test: ***P < 0.001. (D–K) -Gal reporter activity in Gkn2+/– and WT stomachs stained with X-gal (bright blue stain). (D and E) Macroscopic images of X-gal–stained stomachs. Boxed areas are shown at higher magnification in F and G. Scale bar: 5 mm. (F and G) High-magnification images showing (F) proximal and (G) distal extents of -gal staining in Gkn2+/– stomachs. Scale bar: 500 m. Original magnifi- cation, ×2 (inset). (H–K) Histological images of (H and I) corpus and (J and K) antral -gal staining in Gkn2+/– stomachs (dark blue), with hema- toxylin counterstain (pale blue). Scale bar: 50 m (H and J); 20 m (I and K). (L–N) Immunofluorescent colocal- ization of GKN2 and -gal proteins in Gkn2+/– corpus mucosa. Boxed areas are shown at higher magnification in M and N. Scale bar: 50 m (L); 20 m (M); 5 m (N).

normal histological structure, thickness, and epithelial prolifera- quantifying expansion of MNC zone and cellular loss within both tion count (Figure 3, A, B, D, and E). A detailed study of gastric parietal cell and zymogenic cell compartments (Figure 4C). The epithelial markers and cellular changes underlying atrophy and modest reduction in parietal cell number was not associated with metaplasia was performed in 12-week-old Gkn2–/– mice (in which changes in either stomach acid content (Figure 4D and Supple- mucosal lesions and glandular defects are most pronounced). mental Methods) or antral expression of gastrin (Figure 4E), the Expression of the gastric trefoil factor (Tff1, Tff2) and mucin genes principal endocrine stimulator of acid production. Collectively, (Muc1, Muc5ac, Muc6) was not significantly altered, at least in bulk we believe that these results identify GKN2 as a novel regulator of gastric tissue (Figure 4A). However, the SMC metaplasia (show- gastric epithelial homeostasis. ing ectopic Alcian blue staining) was associated with a selective Proximal gastric tumorigenesis in GKN2-deficient gp130F/F loss of MUC5AC, but not TFF1, specifically within lesion areas by mice. Given the role of GKN2 in maintenance of gastric epithelial immunofluorescent staining (Figure 4B). Similarly, MNC hyper- homeostasis, we asked whether GKN2 genetic loss might potenti- plasia and glandular atrophy were, respectively, characterized by ate the effects of oncogenic pathways known to induce gastric epi-

1386 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Figure 3. Gkn2–/– mice display impaired basal gastric epithelial differentiation. (A) Representative images of the gastric mucosa of 6-, 12-, and 30-week-old Gkn2–/– and WT littermate control mice. Boundaries between corpus and antral mucosae are delineated with white dashed lines; hypertrophic mucosal lesions are shown by black dashed lines. Scale bar: 5 mm. (B) Low-power images showing AB-PAS–stained Gkn2–/– hypertrophic lesions compared with nonle- sion and WT corpus mucosa. Scale bar: 200 m. High-power images of corpus and antrum mucosa in 12-week-old Gkn2–/– and WT mice. Scale bar: 50 m. (C) Summary of semiquantitative histopathology scores for corpus inflammation (inflamm), atrophy, MNC hyperplasia (MNC hyp), and SMC metaplasia (SMC met) in 6-, 12-, and 30-week-old WT and Gkn2–/– mice (group sizes as stated in D). (D) Morphometric analysis of corpus and antral mucosal thickness in 6-, 12-, and 30-week-old Gkn2–/– (n = 11, n = 9, n = 7) and WT mice (n = 7, n = 9, n = 8). Histograms show mean mucosal thickness as histological cross-sectional area/ mm2 per mm length of muscularis mucosae. (E) Ki-67 labeling of proliferating cells in corpus mucosa of 6-, 12-, and 30-week-old WT and Gkn2–/– mice and antral mucosa of 12-week-old WT and Gkn2–/– mice (n = 6 per group). Represen- tative images of 12-week-old WT and Gkn2–/– corpus and Gkn2–/– lesion mucosa are shown. Scale bar: 100 m. Error bars represent mean ± SEM. P values were determined using a 2-tailed Student’s t test: *P < 0.05; **P < 0.01; ***P < 0.001.

jci.org Volume 126 Number 4 April 2016 1387 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

Figure 4. Cellular and molecular analysis of gastric epithelial differentiation in Gkn2–/– mice. (A) Expression of gastric trefoil factor and mucin genes in 12-week-old Gkn2–/– (n = 11) and WT (n = 8) corpus by QRT-PCR. (B) Characterization of SMC differentiation in 12-week-old WT and Gkn2–/– corpus and Gkn2–/– lesion mucosa by AB-PAS staining (top row) and immunofluorescent staining for MUC5AC and TFF1 proteins (bottom row). Scale bar: 20 m. (C) Immunofluorescent quantitation of MNCs (MNC, GSII); parietal cells (PC, HK ATPase-); and zymogenic cells (ZC, pepsinogen II) in 12-week-old WT and Gkn2–/– corpus mucosa (n = 6 per group). Scale bar: 20 m. (D) Gastric acidity determined by pH measurement of stomach contents in Gkn2–/– (n = 11) and WT (n = 8) mice. (E) QRT-PCR analysis of gastrin mRNA expression in antral stomachs of Gkn2–/– (n = 11) and WT (n = 8) mice. Error bars represent mean ± SEM. P values were determined using a 2-tailed Student’s t test: *P < 0.05; **P < 0.01; ***P < 0.001.

thelial tumors in mice. The IL-11/g p130/STAT3 axis is a key driver scopic corpus tumor area in Gkn2–/– gp130F/F mice (Figure 5C). His- of GC pathogenesis (15, 16). Mice carrying a knockin mutation at tological analysis of the tumors revealed a poorly differentiated the gp130 cytokine coreceptor locus (gp130F/F) show STAT3 hyper- and hyperplastic epithelium (Figure 5, D and E), contributing to activation and spontaneous tumorigenesis in the antrum, which a significant increase in corpus mucosal thickness overall (Figure progresses to encompass the entire secretory mucosa. In the antral 5F). In contrast, the antral tumor load and mucosal thickness in stomach, gp130/STAT3 activation is dependent on the cytokine Gkn2–/– gp130F/F mice were not significantly different than those of IL-11 (21–23), and the knockin mutant progresses through chronic gp130F/F single mutants (Figure 5, A, C, and F). To further charac- inflammation, metaplasia, and dysplasia to carcinoma in situ, terize the corpus tumor lineage, we examined the -gal reporter phenocopying all but the metastatic stage of human intestinal- expression profile of Gkn2–/– gp130F/F stomach tissues by staining type GC development (16). In contrast to gp130F/F single mutants, with X-gal. Strikingly, while adjacent normal mucosa retained which mainly show antral tumors, Gkn2–/– gp130F/F compound strong reporter expression, corpus (and antral) tumors were com- mutants additionally showed extensive focal tumorigenesis of the prised predominantly by unstained cells (Figure 6, A–E). Consis- corpus and squamous epithelium overlying the limiting ridge of tent with the absence of reporter expression (which marks the the corpus/forestomach junction at 12 weeks of age (Figure 5A). SMC lineage), the tumors also lacked MUC5AC staining, although This phenotype was supported quantitatively by an increase in the TFF1 expression was retained, while both proteins were abun- number of corpus tumor foci (Figure 5B) and an increased macro- dantly expressed in adjacent nontumoral mucosa (Figure 6, F and

1388 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Figure 5. Proximal stomach tumorigenesis in Gkn2–/– gp130F/F compound mutant mice. (A) Representative images of corpus and antral tumor phenotypes in 12-week-old Gkn2–/– gp130F/F compound mutants (n = 13) compared with gp130F/F (n = 5) and Gkn2–/– single mutants (n = 12) and WT (n = 6) littermate control mice. White dashed lines delineate boundaries between corpus and antrum; tumor areas are shown by red (corpus) or black (antral) dashed lines. Scale bar: 5 mm. (B and C) Morphometric analysis of tumor burden in Gkn2–/– gp130F/F compound mutants. (B) Corpus tumor incidence expressed as the number of tumor foci within gastric corpus. (C) Macroscopic area of corpus and antral tumors in mm2. (D) Low-power images showing differential tumor histology (AB-PAS staining) in Gkn2–/– gp130F/F compound mutant and gp130F/F single mutant stomachs. Scale bar: 500 m. (E) High-power histological images (original magnification, ×100 [top row]; ×400 [bottom row]) of corpus mucosal defects in Gkn2–/– gp130F/F mice stained with AB-PAS. Scale bar: 50 m. (F) Morphometric analysis of corpus and antral mucosal thickness in Gkn2–/– gp130F/F compound mutants. Error bars represent mean ± SEM. P values were determined using a 2-tailed Student’s t test: *P < 0.05.

H). We found no evidence of mucus metaplasia within the tumor gastric epithelial hyperplasia progressing to antral tumorigenesis at masses, as shown by a lack of TFF2/Griffonia simplicifolia lectin 3 to 6 months of age (17); (b) TFF1 shows closely overlapping cellu- II (TFF2/GSII) staining, although clusters of TFF2/GSII-positive lar expression with GKN2 (13), raising the possibility of potentiation cells were seen at the tumor margins and in adjacent nontumoral of individual pathological outcomes; (c) GKN2 and TFF1 have been mucosa (Figure 6, G and I). Similarly, none of the Gkn2–/– gp130F/F reported to form heterodimers (14), suggesting cooperative func- tumors showed evidence of true intestinal metaplasia, as evi- tion. Compound mutant Gkn2–/– Tff1–/– mice showed no differences denced by absence of CDX2 expression (Figure 6, I and J). in tumor incidence, mucosal thickness, or temporal progression at Absence of synergistic phenotypes in compound mutant Gkn2–/– Tff1–/– 12 weeks of age compared with single mutant Tff1–/– or Gkn2–/– mice mice. We examined the effect of GKN2 genetic deficiency in the Tff1–/– (Supplemental Figure 5). Therefore, GKN2 deficiency does not sig- gastric tumor model. Our rationale was 3-fold: (a) Tff1–/– mice show nificantly influence tumorigenesis in Tff1–/– mice and vice versa,

jci.org Volume 126 Number 4 April 2016 1389 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

Figure 6. Analysis of gastric and intestinal differentiation in Gkn2–/– gp130F/F proximal stomach tumors. (A–C) -Gal reporter gene expression in Gkn2–/– gp130F/F gastric corpus tumors. Representative Gkn2–/– gp130F/F stomach shown (A) before and (B) after X-gal staining. Tumor areas are shown by red (corpus) or (A) black or (B) green (antral) dashed lines. Scale bar: 5 mm. (C) Lateral images of X-gal–stained and sagittally bisected Gkn2–/– gp130F/F stomach tissues. Red (corpus) and green (antral) arrows indicate tumor masses. Scale bar: 3 mm. (D and E) Histological images of X-gal–stained Gkn2–/– gp130F/F tumors in (D) corpus and (E) antrum. Scale bar: 100 m. (F and G) Low-power image of (F) MUC5AC and TFF1 double immunofluorescent staining and (G) TFF2, GSII, and CDX2 triple staining in corpus tumors and adjacent nontumoral mucosa of Gkn2–/– gp130F/F mice. Scale bar: 200 m. (H and I) High-power images showing staining patterns at tumor margin for (H) MUC5AC and TFF1 and (I) TFF2, GSII, and CDX2. Scale bar: 100 m. (J) CDX2 staining in colonic epithelium (positive control). Scale bar: 50 m.

sion of zymogenic cell and parietal cell lineage mark- ers Mist1 and HK, respectively (Figure 7D). Infected Gkn2–/– mice also had lower H. pylori colonization lev- els (Figure 7E), which were inversely correlated with gastritis severity (Figure 7F), suggesting preferential immune-mediated reduction in bacterial load and/ or loss of niche due to mucosal damage. Collectively, these results demonstrate a previously undescribed antiinflammatory function of GKN2, which sup- presses H. pylori–related inflammation and premalig- nant disease progression in the stomach. Hyperactivated Th1 immunity in H. pylori–infected Gkn2–/– mice. H. pylori–related gastritis is typically driven by a dual T helper cell type 1 (Th1) and Th17 immune response, while Th1 and Th17 pathways are modulated by Th2 and Treg cytokine responses. To arguing that GKN2-TFF1 heterodimers are not, at least in mice, better understand mechanisms underlying augmented inflam- required for individual component suppressive function. matory responses in Gkn2–/– mice, we first measured levels of H. pylori–infected Gkn2–/– mice show accelerated progression to anti–H. pylori IgG antibody subclasses. Relative to that in WT mice, atrophic gastritis and metaplasia. Having shown that GKN2 restrains infected Gkn2–/– mice presented with an antibody response that the progression of cytokine-driven proximal gastric tumorigene- was skewed toward the IgG2c subclass, which is consistent with an sis, we investigated Gkn2 genetic loss in the context of H. pylori– increased Th1 immune response (Figure 8A). To consolidate this dependent gastritis, a key premalignant lesion of GC (24). Three finding, we quantified by QRT-PCR expression levels of cytokines independent cohorts of 6- to 8-week-old Gkn2–/– and WT control and transcription factors that are markers for Th1, Th2, Th17, and mice were orally infected with H. pylori SS1 (25), sacrificed at 2 Tregs as well as markers of associated M1- and M2-type macro- MPI (Figure 7A), and examined for gastric histopathology. Infected phage responses. Infected Gkn2–/– mice expressed higher mRNA Gkn2–/– mice showed increased severity of atrophic gastritis and levels of proinflammatory Th1 markers Ifng and Tbet (Figure 8B) as pervasive frequent Alcian blue–positive mucus metaplasia (con- well as the M1-associated Il1b, Il6, Il11, and Cxcl2 (Figure 8C) and sistent with spasmolytic polypeptide expressing metaplasia; ref. antimicrobial peptide genes Dmbt1 and Reg3g (Figure 8D) com- 26). By contrast, infected WT mice showed relatively mild inflam- pared with infected WT or uninfected controls. Il10 and Foxp3 were matory pathology, infrequent atrophy, and metaplasia (Figure 7B), also preferentially induced, consistent with an attempt by Foxp3+ consistent with the known temporal progression of this infection in Tregs to limit inflammatory damage ensuing from the elevated Th1 C57BL/6 mice (25). Accordingly, infected Gkn2–/– mice had higher response (Figure 8E). By contrast, neither Th2 (Figure 8F) nor Th17 scores of corpus polymorphonuclear and mononuclear infiltrate, lineage markers (Figure 8G) showed broad expression differences glandular atrophy, and mucus metaplasia, while antral inflamma- in infected Gkn2–/– mice compared with infected WT mice. There- tory scores, though increased from uninfected levels, were similar fore, neither Th2 nor Th17 immunity was differentially activated in Gkn2–/– and WT mice (Figure 7C). Consistent with the severity in infected Gkn2–/– mice. However, M2-related arginase 1 (Arg1), of atrophy and metaplasia, infected Gkn2–/– mice showed increased a key suppressor of T cell responses (27), showed significantly corpus expression of mucin 6 (Muc6) mRNA and decreased expres- decreased expression in infected Gkn2–/– mice (Figure 8F), again

1390 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Figure 7. Accelerated progression to atrophic gastritis and mucus metaplasia in Gkn2–/– mice after 2-month H. pylori infection. (A) Strategy used for 2-month H. pylori SS1 infections. (B) Macroscopic and histological images of Gkn2–/– and WT littermate stomachs infected for 2 months and uninfected control stomachs. White dashed lines delineate corpus/antrum boundaries. Arrows show the region of corpus hypertrophy in the infected Gkn2–/– stomach macroscopic photo. Scale bar: 5 mm (macroscopic images); 50 m (histological images). (C) Semiquantitative histological assessment of gastric histopathology: inflammatory infiltrate (polymorphonuclear cells [PMN]; mononuclear cells [MN]), atrophy (degree of parietal/zymogenic cell loss), and mucus metaplasia (Met). Histograms show mean pathology scores for each parameter (range 0–4). (D) QRT-PCR analysis of metaplasia (Muc6) and glandular atrophy–related (Mist1 and HK) genes in Gkn2–/– mice after 2 months of H. pylori infection. Histograms show mean mRNA fold change relative to WT uninfected mice. (E) H. pylori SS1 colonization levels in stomachs after 2 months of infection, as assessed by Q-PCR (Supplemental Methods). Histograms show mean colonization level (104 H. pylori genomes per 105 Gapdh copies). (F) Linear regression analysis of corpus inflammation score and colonization level. The correlation coefficient (r2) value is shown. Error bars represent mean ± SEM. P values were determined using a 2-tailed Student’s t test (C) or 2-tailed Mann Whitney U test (D and E). Statistical significance compared with WT uninfected control mice: #P < 0.05. Statistical significance between treatment groups: *P < 0.05; **P < 0.01; ***P < 0.001.

consistent with the proinflammatory phenotype of this model. Figure 6). These results indicate that GKN2 restrains gastric immu- Given that effects of GKN2 deficiency are predominantly on cor- nopathology by modulating Th1, but not Th17, immunity. pus pathology, none of the above immune markers were differen- Inflammatory phenotype of Gkn2–/– mice is unrelated to chemo- tially expressed in the antra of infected Gkn2–/– mice (Supplemental kine production by GECs. Chemokine secretion by epithelial cells

jci.org Volume 126 Number 4 April 2016 1391 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

Figure 8. Differential expression of cytokines and immune transcription factors in Gkn2–/– mice after 2-month H. pylori infection. (A) ELISA detection of serum IgG antibody responses in Gkn2–/– mice infected for 2 months. Box plots show median (horizontal bars), interquartile range (boxes) and 10th/90th percentile (error bars) titers of individual anti–H. pylori IgG2c (Th1) and IgG1 (Th2) and combined IgG2c/IgG1 ratio. (B–F) QRT-PCR cytokine/chemokine/ transcription factor expression profiles of Gkn2–/– mice infected for 2 months. (B) Th1 markers (Ifng, Tbet); (C) M1 markers (Il1b, Cxcl2, Il6, Il11); (D) antimi- crobial lectins (Reg3g, Dmbt1); (E) Treg markers (Il10, Foxp3); (F) Th2/M2 markers (Arg1, Il4, Il5, Fizz1, Ym1, Il1rn); and (G) Th17 markers (Rorc, Il17a, Il17f). Histograms show mean mRNA fold change relative to WT uninfected mice. Error bars represent mean ± SEM. P values were determined using a 2-tailed Student’s t test: *P < 0.05; **P < 0.01.

is a key mechanism driving myeloid cell recruitment to the gas- Gkn2–/– cultures, respectively (Supplemental Figure 7B). Unstim- tric mucosa and plays a pivotal role in triggering the host innate ulated Gkn2–/– and WT GECs showed no differences in secretion response to H. pylori infection (28). We hypothesized that GKN2 of 23 chemokines/cytokines at baseline, and, while GECs coincu- genetic loss might enhance chemokine release from GECs. To bated with live H. pylori for 24 hours showed increased production address this, we compared the chemokine/cytokine secretory of CCL3, CCL4, IL-1, IL-1, TNF-, IL-6, and IL-10, these out- responses of primary GECs derived from Gkn2–/– and WT mice puts were similar in Gkn2–/– and WT cultures (Supplemental Figure in a H. pylori SS1 coculture assay (Supplemental Figure 7A). Pri- 7C). Therefore, the proinflammatory phenotype of Gkn2–/– mice is mary GEC cultures were prepared using established methods unrelated to chemokine secretion by GECs. (29). Purity of the epithelial cultures was confirmed by staining for Gkn2–/– mice show heightened mucosal innate immunity and pan-cytokeratin and absence of CD45 (immunocytes) and smooth impaired myeloid-derived suppressor cell responses. To elucidate muscle actin (mesenchymal cells). The presence of (GKN2-secret- mechanisms initiating Th1 inflammatory responses in Gkn2–/– ing) SMCs was verified by staining for GKN2 or -gal in WT and mice, we examined the early phase of immune activation at 7 days

1392 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Figure 9. Analysis of gastric mucosal cytokines and immune cell populations in Gkn2–/– mice after 7-day H. pylori infection. (A) Strategy used for 7-day H. pylori SS1 infections. (B) Q-PCR analysis of H. pylori SS1 colonization levels in 7-day infected Gkn2–/– and WT stomachs (n = 7 per group). Histograms show mean colonization level (104 H. pylori genomes per 105 Gapdh copies). (C–E) Luminex array analysis of cytokine/chemokine protein levels in corpus homogenates from 7-day infected Gkn2–/– and WT (n = 7 per group) and uninfected control mice (n = 8 per group): (C) TNF-, IL-1, IL-6, CXCL1, and CCL4; (D) IL-10; and (E) IFN-. Histograms show mean normalized levels (pg cytokine/100 mg total protein). (F–H) Flow cytometry analysis of myeloid/lymphoid cells in stomachs of 7-day infected Gkn2–/– mice and uninfected controls (n = 5 per group): (F) macrophage (CD11b+F4/80+Gr1–) and DC (CD11c+); (G) Treg (CD4+CD25+Foxp3+); and (H) total MDSC, monocytic MDSC (Mo-MDSC) (CD11b+Ly6ChiLy6G–CD49d+), and granulocytic MDSC (Gr-MDSC) (CD11b+Ly6Clo Ly6G+CD49d–) subsets. Histograms show mean cellular prevalence (percentage of total gastric leukocytes). (I) QRT-PCR expression profiles of MDSC differ- entiation (Ccr2, IL4ra) and activation (S100a8, S100a9, Arg1, Arg2, Tgfb1, Tgfb2) genes in 7-day infected Gkn2–/– mice. Error bars represent mean ± SEM. P values were determined using a 2-tailed Student’s t test or 2-tailed Mann Whitney U test (I, only). Statistical significance compared with WT uninfected control mice: #P < 0.05; ##P < 0.01. Statistical significance between treatment groups: *P < 0.05; **P < 0.01; ***P < 0.001.

after infection with H. pylori (ref. 30 and Figure 9A). H. pylori col- decreased bacterial density occurs prior to the establishment of onization levels were again reduced in Gkn2–/– mice infected for overt gastritis. To exclude impaired bacterial adhesion to GECs as 7 days (Figure 9B and Supplemental Figure 8) in the absence of a mechanism of decreased colonization, we quantified the adhe- evident inflammation. Therefore, the Gkn2–/– gastric niche appears sion of live H. pylori to MKN28 GECs transfected with inducible less receptive, even to acute H. pylori colonization, suggesting that GKN2 expression constructs (Supplemental Methods) and found

jci.org Volume 126 Number 4 April 2016 1393 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

Figure 10. Generation of human GKN2/GKN1-overexpressing BAC transgenic mice. (A) Structure of the 152-kb human BAC transgene showing relative locations of the GKN1 and GKN2 genes (white boxes), with their transcriptional orientation shown in expanded images. The nonexpressed GKN3 pseu- dogene is shown as a solid black box. (B) QRT-PCR analysis of human GKN1 (hGKN1) and GKN2 mRNA expression in stomach (Stom) and spleen (Spl) tissues from line 5 and line 9 BACTg and WT littermate control mice (n = 3 per group). (C) Immunoblot analysis of human GKN2 protein in gastric corpus (Crp), antrum (Ant), and spleen (Spl) tissues of line 5 and line 9 BACTg and WT littermate control mice. Protein molecular weights (kDa) are shown. (D) Immunofluorescent localization of human GKN2 protein in gastric corpus and antrum of line 5 BACTg and WT littermate control mice. Sections were counterstained with DAPI. Scale bar: 50 m. (E) Corpus and antrum mucosal histopathology in line 5 and line 9 BACTg mice. Scale bar: 5 mm (macropho- tographs); 50 m (histological images). that H. pylori adhesion was not regulated by GKN2 (Supplemen- proinflammatory cytokines), which rapidly breaks down upon tal Figure 9). To characterize immune profiles associated with this H. pylori challenge, allowing enhanced priming of Th1 immunity. host response, we assessed cytokine levels in stomachs of unin- We next investigated whether the altered gastric cytokine fected mice and mice infected for 7 days by luminex array analysis profile of Gkn2–/– mice was due to effects in epithelial or immune (Supplemental Methods). TNF-, IL-6, IL-1, CXCL1, and CCL4 cells. To address this question, we isolated gastric epithelial and were elevated specifically in corpus (but not antrum) tissues of immune cell populations from stomachs of uninfected WT and uninfected Gkn2–/– mice, showing no additional increase at 7 days Gkn2–/– mice by FACS (Supplemental Methods) and analyzed their after H. pylori infection (Figure 9C and Supplemental Figure 10). cytokine expression by QRT-PCR. The results showed that Il1a, Gkn2–/– mice also had basally increased IL-10, which decreased Il6, Tnfa, and Ccl4 mRNA were specifically localized within gas- to WT levels at 7 days after infection (Figure 9D), concomitant tric immune cells, not epithelial cells (Supplemental Figure 11). with increased production of IFN- (Figure 9E). These results are To identify specific immune cell subsets, we next assessed gastric consistent with basal immunoregulation (to counteract elevated mucosal myeloid and lymphoid populations by flow cytometry (full

1394 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Figure 11. Reduced antral tumor growth in human GKN2/GKN1-overexpressing BACTg gp130F/F mice. (A) Representative images of stomachs from line 5 and line 9 BACTg gp130F/F compound transgenic mice and gp130F/F single mutant littermate controls are shown; black dashed lines delineate tumor margins. Scale bar: 5 mm. (B) Weight of fresh stomach in grams. (C) Macroscopic area of antral tumors in mm2. (D) Weight of fresh spleen in grams in line 5 and line 9 BACTg gp130F/F compound transgenic (n = 16/n = 16) mice, gp130F/F single mutants (n = 12/n = 12), BACTg mice (n = 7/n = 14), and WT (n = 5/n = 12) littermate controls. (E) Tumor histology in representative BACTg gp130F/F compound transgenic mice and gp130F/F single mutants. Scale bar: 200 m. (F) Morphometric analysis of antral mucosal thickness. Histograms show the mean mucosal thickness as the histological cross section area in mm2 per unit length of muscularis mucosae. Biological replicates per group as stated for D. Error bars represent mean ± SEM. P values were determined using a 1-tailed Mann Whitney U test (B and D) or 1-tailed Student’s t test (C and F): *P < 0.05; **P < 0.01.

gating strategy shown in Supplemental Figure 12). An increased infected Gkn2–/– mice could be due to APC-mediated skewing away prevalence of CD11b+F4/80+Gr1– macrophages and CD11c+ DCs from a tolerogenic Treg response toward a proinflammatory Th1 was found in Gkn2–/– mice compared with that in WT mice (Figure response. However, in fact, uninfected Gkn2–/– mice had a higher 9F and Supplemental Figure 13), suggesting that tissue-resident gastric mucosal prevalence of CD4+CD25+Foxp3+ Tregs, which APCs might play a role in shaping the temporal onset, magnitude, was sustained in mice infected for 7 days (Figure 9G). Therefore, and specific polarity of inflammatory responses in Gkn2–/– mice. the proinflammatory phenotype of Gkn2–/– mice is independent of Induction of immune tolerance to H. pylori via recruitment of gastric Treg responses. CD4+CD25+Foxp3+ Tregs occurs during the initial phases of infec- Myeloid-derived suppressor cells (MDSCs) are a mixed popu- tion, leading to delayed onset of inflammatory pathology (31). We lation of immature myeloid lineages, including granulocyte, mac- hypothesized that accelerated onset and severity of gastritis in rophage, and DC progenitors (27). MDSCs dampen proinflamma-

jci.org Volume 126 Number 4 April 2016 1395 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation tory T cell responses (including Th1 immunity against H. pylori; Antral tumor growth was significantly reduced in 12-week-old ref. 32) via production of arginase, inducible nitric oxide synthase, BACTg gp130F/F compound mutants, as assessed by reduced total and immunosuppressive cytokines (27). In mice, monocytic and stomach weight (Figure 11B) and macroscopic area of the tumor granulocytic MDSC subsets can be discriminated by CD11b+ mass (Figure 11C) compared with gp130F/F single mutant control Ly6ChiLy6G–CD49d+ and CD11b+Ly6CloLy6G+CD49d– surface mice. Interestingly, the splenomegaly that is typically observed phenotypes, respectively (33). We assessed MDSCs in stomachs of in gp130F/F mice was significantly reduced in BACTg gp130F/F com- uninfected Gkn2–/– mice and Gkn2–/– mice infected for 7 days by flow pound mutants, consistent with an effect of the reduced tumor cytometry. The total number of MDSCs was significantly reduced load on systemic immunity (Figure 11D). Reduced tumor mass in in uninfected Gkn2–/– mice, due to specific deficiency in the mono- BACTg gp130F/F mice was particularly evident in histological analy- cytic MDSC subset (Figure 9H and Supplemental Figure 13), an sis, with both compound transgenic lines showing decreased over- effect that was sustained after H. pylori infection. These data were all thickness of the antral mucosa compared with gp130F/F single corroborated by reduced gastric mRNA expression of the MDSC mutants (Figure 11, E and F). These results establish restoration markers Ccr2 and IL4ra (33) in uninfected Gkn2–/– stomachs com- of human GKNs as a potential therapeutic approach to suppress pared with WT stomachs (Figure 9I). We surmised that enhanced gastric tumor growth. inflammatory responses in Gkn2–/– mice could therefore be linked to compromised MDSC responses. Consistent with this expectation, Discussion markers of MDSC activation and expansion, S100a8 and S100a9, In a knockout mouse model, we have demonstrated an unexpected were upregulated in WT stomachs infected for 7 days but conversely antiinflammatory function for the gastric mucus cell–associated were downregulated in infected Gkn2–/– stomachs. Similarly, argin- protein, GKN2 (8). We have presented in vivo evidence that GKN2 ase genes (Arg1 and Arg2) and immunosuppressive cytokines (Tgfb1 loss, in the context of chronic inflammation induced by H. pylori and Tgfb2) were upregulated (or trended toward increased expres- infection, or cytokine-directed tumorigenesis plays a causal role in sion) in WT stomachs infected for 7 days but were either unchanged GC progression. Using a transgenic approach, we have additionally or downregulated in infected Gkn2–/– stomachs (Figure 9I). These shown that dual overexpression of GKN2 and GKN1 can signifi- data suggest that impaired activation of MDSCs and breakdown cantly restrain gastric tumor growth in vivo. This study provides the of IL-10–mediated immunoregulation, combined with recipro- first major in vivo functional analysis of any of the GKN family pro- cal enrichment of APCs (macrophages and DCs), contribute to an teins to our knowledge. The findings highlight the potential clinical enhanced Th1 response in H. pylori–infected Gkn2–/– mice. application of these epithelial-derived secreted factors to subdue Overexpression of human GKNs restrains gastric tumor growth in gastric inflammation and consequent malignant progression. vivo. Having established that GKN2 loss can promote GC patho- GKN2 was first linked to GC more than a decade ago, fol- genesis, we asked whether restoration of GKN2 expression in vivo lowing its initial discovery as a protein downregulated in gastric might suppress disease progression. We reasoned that because adenocarcinomas (8, 34). Subsequent studies have shown GKN2 GKN2 is normally expressed at unusually high levels, in a discrete expression loss to be one of the most frequent alterations in both and lineage-restricted manner, clinically meaningful outcomes adenocarcinomas (6, 13, 35, 36) and gastric tumor cell lines (6, 35), might only be achieved if overexpression to restore GKN2 is driven while, conversely, GKN2 overexpression inhibits proliferation, at a sufficiently high level and in the appropriate cellular context, migration, and invasion of cell lines and tumor xenografts (8, 34, i.e., specifically in gastric SMCs. We addressed this problem by 35). GKN2 therefore appeared to satisfy several of the requisite cri- engineering a large (152-kb) BAC transgene encompassing the teria of a TSG, ostensibly being expressed in normal cell lineages entire human GKN2 and GKN1 genomic region (Figure 10A). This (GECs) giving rise to cancer, imposing restraint on proliferation, strategy, resulting in combined human GKN2 and GKN1 expres- and showing absence from tumor cells. Nevertheless, for a gen- sion, was necessary to include sufficient flanking sequence (i.e., uine TSG function to be formally ascribed, a causal link between containing all native regulatory elements) to drive an amplitude expression loss/protein inactivation in a tumor progenitor cell and and lineage specificity of overexpression that cannot be accom- subsequent oncogenic transformation of derived lineages must be plished using conventional transgenic approaches. Two BAC unequivocally established. We instead found that GKN2 loss, in transgenic (BACTg) founder lines with a high level of transgene isolation from oncogenic or inflammatory drivers, is insufficient expression, line 5 and line 9, were identified by QRT-PCR and for cell-autonomous transformation, since Gkn2–/– mice lacked immunoblotting studies (Figure 10, B and C). As surmised above, spontaneous tumor growth or significant epithelial hyperplasia, the BAC transgene directed human GKN2 (and GKN1) mRNA/ even at advanced (>30 weeks) age. protein expression exclusively to the stomach, with absolute spec- Previous studies have focused exclusively on a putative and, ificity to gastric SMCs (Figure 10D), thus replicating their endoge- now debatable, “classical TSG” function for GKN2 (reviewed in nous expression. BACTg mice displayed normal gastric mucosal ref. 6) but have not considered alternative roles. Our findings here histology at 12 weeks of age (Figure 10E), showing that overex- reveal previously undescribed antiinflammatory and mucosal pression of human GKNs does not alter basal gastric homeostasis. homeostatic activities as the principal in vivo functions of GKN2. To investigate the impact of human GKN overexpression on gas- Effects of GKN2 deficiency were relatively mild at baseline, char- tric tumorigenesis, we generated two independent BACTg gp130F/F acterized mainly by impaired gastric epithelial differentiation. compound mutant strains using BACTg mice from line 5 and line However, loss of GKN2 was found to profoundly exacerbate gas- 9, respectively. Representative stomachs collected from both tric immunopathology when placed in context of an inflamma- BACTg gp130F/F compound mutant strains are shown in Figure 11A. tory challenge, namely H. pylori infection or genetically induced

1396 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

hyperactivation of oncogenic gp130/STAT3 signaling. Interest- Ifng–/– mice do not develop gastritis (40), while transgenic overex- ingly, Gkn2+/– heterozygous mice (not described in Results sec- pression of IFN- is sufficient for induction of atrophic gastritis tion), though phenotypically normal at baseline (Supplemental and metaplasia independently of H. pylori infection (41). Thus, Figure 14), showed increased susceptibility to H. pylori–dependent elevated IFN- is likely central to the premalignant phenotype of immunopathology, which is of intermediate severity to that dis- infected Gkn2–/– mice, especially given that Th17 cytokines were played by WT and Gkn2–/– mice (Supplemental Figure 15). These not differentially induced. The localization of immunopatholog- data argue that even partial loss of GKN2, as typically seen from ical responses in the corpus in Gkn2–/– mice is highly reminiscent the onset of premalignant disease, may be clinically significant. of that associated with corpus-predominant gastritis in humans, Genetic loss of GKN2 in gp130F/F mice elicited rapid tum- which is similarly characterized by a Th1-skewed response and origenesis of the corpus mucosa but, interestingly, did not alter carries high risk of progression to advanced metaplasia, dyspla- antral tumor growth. However, GKN2 expression is already sub- sia, and intraepithelial tumor growth (42). Our data indicate that, stantially reduced in gp130F/F antral tumors, such that loss of the even partial GKN2 expression loss, particularly in the context of residual expression in Gkn2–/– gp130F/F mice would have had little Th1-type cytokine gene polymorphisms (43, 44), may strongly additional impact on tumor growth. As such, these contrasting influence premalignant outcomes in H. pylori–infected individuals effects of GKN2 deficiency in corpus and antrum likely relate to with corpus-predominant disease. the preexisting gp130F/F antral pathology and should not necessar- In short-term (7-day) infection studies, we found that Th1 ily be taken as evidence of preferential GKN2 activity in the corpus. immune bias in Gkn2–/– mice may relate to heightened basal innate Indeed, our BAC transgenic studies suggest that GKN2 has similar immunity. Gkn2–/– mice showed mucosal enrichment of proin- antitumor activity in antral mucosa. Our dual GKN1/GKN2 trans- flammatory cytokines and increased prevalence of macrophages genic strategy has not allowed explicit attribution of the tumor and DCs, which likely prime an exaggerated IFN- response upon inhibition to GKN2. However, the clear dosage effects of GKN2 exposure to H. pylori. Both macrophages and DCs, via professional shown here (Supplemental Figure 15) argue that transgenic excess antigen-presenting capabilities, are known to initiate adaptive of GKN2 would have likely contributed to the reduced tumor load responses against H. pylori, in part by secretion of Th1-polarizing in some manner. It is noteworthy that GKN1 and GKN2 display (and Th17-polarizing) cytokines, IL-12 (and IL-23), respectively identical expression in normal gastric SMCs and show coordinate (45–48). Basally increased IL-10 (and mucosal Tregs) may also expression loss in GC (7). As such, our tumor rescue data affirm explain why Gkn2–/– mice resist pathological progression when the translational rationale for combined GKN1/GKN2 overexpres- unchallenged. Another factor contributing to the Gkn2–/– phenotype sion in GC. Additionally, these studies provide functional valida- may have been MDSCs, which inhibit T cell proliferation in mouse tion for earlier clinical associations of higher level GKN1/GKN2 models of GC (19) and suppress effector T cells, which drive gas- expression and better outcome in human GC (37). tric immunopathology (49, 50). Impaired gastric MDSC responses Strikingly, corpus and antral tumors induced in Gkn2–/– to H. pylori infection may have contributed to the accelerated T gp130F/F mice lacked expression of the Gkn2-lacZ reporter allele, cell–driven immunopathology in this model. Although MDSCs yet regions of adjacent nontumoral mucosa retained reporter have been widely described to exacerbate cancer progression via expression. These observations could suggest inactivation of suppression of CD8+ T cell–mediated antitumor immunity and pro- GKN2 within a tumor progenitor cell but are equally consistent motion of angiogenesis (27), recent work suggests that MDSCs, via with expansion of tumors from immature epithelial lineages lack- secretion of IL-10, may also participate in the resolution of bacterial ing GKN2 expression. Long-lived gastric epithelial progenitor inflammation (51). Proinflammatory roles of MDSCs in established cells and bone marrow–derived cells, neither of which express H. pylori infections have been proposed by others (32, 52). Our data GKN2, have been implicated in the origin of GC (37, 38). Evidence argue that immunosuppressive functions of MDSCs are required also exists to support transdifferentiation of mitotically quiescent to dampen early gastric responses to H. pylori infection. Given that zymogenic cells (zymogenic cell) into a metaplastic lineage that gastric SMCs are the sole physiological source of GKN2 (see Figure ultimately gives rise to GC (39). On the other hand, the current 1D; Figure 2, D–N; refs. 6, 9, and literature cited therein), it is rea- literature does not support an origin of GC from short-lived gas- sonable to argue that altered gastric mucosal immune profiles of tric SMCs, the sole GKN2-expressing gastric lineage. We therefore Gkn2–/– mice relate to paracrine deficiency of secreted GKN2 pro- propose that GKN2 may not be “inactivated” in a tumor progen- tein. Understanding the molecular basis of GKN2 paracrine activ- itor but rather that the epithelial progenitors to GC have never ity toward specific myeloid cell subsets, including MDSCs, will be a expressed GKN2, thereby explaining its absence in gastric tumors. priority if its clinical potential is to be realized. Accordingly, GKN2 may instead act non–cell autonomously as an Functional effects of GKN2 loss have been firmly established antiinflammatory paracrine signal that maintains homeostatic here, yet a key question not addressed by this study is what trig- epithelial turnover and prevents malignant transformation. gers GKN2 loss (or decreased expression) in the first place? Nei- Our finding of accelerated immunopathology in H. pylori– ther cytogenetic aberrations encompassing chromosome 2p13.3 infected Gkn2–/– mice supports an antiinflammatory role for GKN2. (where the GKNs are located) nor GKN2 somatic mutations have Infected Gkn2–/– mice showed enhanced mucosal Th1 responses, been reported in GC (53–55), while epigenetic silencing of GKN2 as evidenced by markedly elevated Ifng and Tbet mRNA, concom- applies to only a minority of gastric tumors (55). Together, these itant skewing toward the IgG2c subclass in the H. pylori antibody studies argue that mechanisms other than cytogenetic or epi- humoral response, and reduced H. pylori colonization. IFN- is a genetic anomalies are mainly responsible for GKN2 expression key determinant of H. pylori–related pathology; H. pylori–infected loss. Our findings of decreased Gkn2 mRNA in Il1b and Gm-CSf

jci.org Volume 126 Number 4 April 2016 1397 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

transgenic overexpressing mice or following IL-11/g p130/STAT3 genic mice, BACTg line 5 and BACTg line 9 mice (C57BL/6) were each hyperactivation (see Figure 1F) suggest a mechanism of negative independently crossed with gp130F/F mice (C57BL/6). transcriptional regulation via proinflammatory cytokine signal- Mice. Mouse strains, including the gp130F/ F mutant (a gift from Mat- ing. This is corroborated by earlier work showing transcriptional thias Ernst, Olivia Newton John Cancer Research Institute, Melbourne, repression of a GKN2 promoter-reporter construct induced by Australia; ref. 15), HK–/– (a gift from Ian van Driel, Bio21 Molecular exogenous IL-1, IL-6, and TNF- treatment or NF-B cotrans- Science and Biotechnology Institute, Melbourne, Australia; ref. 62), fection in cultured GECs (56). The appropriate expression dos- TgCMV-cre1Cgn transgenic (CMV-CreTg; a gift from Ursula Lichtenberg, age of GKN2 protein (and associated antiinflammatory activity) University of Cologne, Cologne, Germany; ref. 20), Tff1–/– (17), Gkn2–/– may therefore be governed by promoter cis elements, function- (generated in-house), and human GKN2/GKN1 BAC transgenic mice ing collectively as a cytokine-responsive “transcriptional rheo- (generated in-house), were maintained on a C57BL/6 genetic back- stat.” Such a mechanism could explain the progressive loss of ground. All strains were housed under specific pathogen–free condi- GKN2, in concert with worsening inflammation, as well as the tions. Gastric tissues from HK promoter Gm-CSf transgenic (Gm-CSf Tg) recovery of GKN2 expression after H. pylori eradication and res- mice (BALB/c strain background) (63) were a gift from Ian van Driel. toration of mucosal homeostasis (12). Gastric tissues were also obtained from HK promoter IL1 transgenic In summary, we demonstrate an antiinflammatory role for (IL1Tg) mice that have been described previously (19). All experiments the gastric epithelial-secreted protein, GKN2. We provide the first involving the above strains used matched WT littermate controls. in vivo functional evidence to our knowledge that loss of GKN2 H. pylori infection in mice. Mouse-adapted H. pylori SS1 (vacA+, expression, leading to deregulated Th1 immunity and exacer- cagPAI dysfunctional; ref. 25) was grown in brain-heart infusion broth bation of inflammatory pathology, plays a causal role in GC pro- (Oxoid) containing 5% horse serum (JRH Biosciences) and 0.02% gression. Critically, we have also shown that restoration of human amphostat (Invitrogen), under microaerophilic conditions for 24 GKN expression can interrupt gastric tumor growth in vivo. Cur- hours at 37°C. Mice were infected intragastrically with a single dose rent preventative therapy for GC is based on antibiotic eradication of 107 H. pylori SS1 CFU suspended in 100 l brain-heart infusion of H. pylori (57). Our findings suggest complementation of GKN2 broth as described previously (64). H. pylori colonization levels were function as an alternative disease management strategy, particu- subsequently quantified by TaqMan quantitative PCR assay on stom- larly in the approximately 20% of infected individuals for whom ach extracts (full details provided in the Supplemental Methods) or by antibiotic treatment fails (57) or in those presenting with irrevers- CFU assay as described previously (64). ible premalignant disease (58). Histopathology. Stomach tissues were collected at necropsy, fixed in 4% paraformaldehyde in PBS overnight, and processed for stan- Methods dard paraffin wax histology. Slides were stained for presence of neu- Human tissues. H. pylori–infected and disease-free human gastric epi- tral (gastric-type) and acidic (intestinal-type) mucins with Alcian blue thelial tissues, GCs, and premalignant “adjacent-to-cancer” tissues PAS (AB-PAS) reagent and scored for pathology on a scale of 0 to 4 with intestinal metaplasia were obtained endoscopically (59, 60). by a blinded observer as described previously (65), with modifications Gene targeting. Embryonic stem cell clones (C57BL/6NTac genetic (full details, including criteria for individual scores, are provided in the background) carrying a VelociGene lacZ reporter/loxP-flanked neo- Supplemental Methods). mycin selection cassette (61) at the Gkn2 locus were purchased from Immunohistochemistry and immunofluorescence. Immunohisto- the Knockout Mouse Project repository (https://www.komp.org/). chemistry was performed as described previously (9). Bound immu- Injection of targeted embryonic stem cell clones into BALB/c recipi- nocomplexes were detected using Vectastain ABC reagents (Vec- ent blastocysts and backcrossing (C57BL/6) of resulting chimeric mice tor Laboratories), and staining was visualized by incubation in 3, to generate Gkn2+/– mice was performed at the Australian Phenomics 3-diaminobenzidine tetrahydrochloride reagent (Sigma-Aldrich). Network laboratories, Monash, Clayton, Victoria, Australia (http:// Immuno fluorescence in cultured cells was performed as described www.australianphenomics.org.au/). previously (9). Primary antibodies and lectins used are as follows: Generation of BAC transgenic mice. A 152-kb DNA fragment con- rabbit polyclonal anti-mouse GKN2 (R771-B3) and anti-human GKN2 taining the human GKN1 and GKN2 genomic region was excised from (R779-B3; custom generated, see Supplemental Methods), each a BAC clone (RP11-H2112) by NotI digestion and then purified from diluted 1:500; mouse monoclonal anti-human Ki67 (Abcam) diluted the vector backbone by pulsed field gel electrophoresis through a 1% 1:500; lectin GS-II from Griffonia simplicifolia (EY Labs) used at 10 g/ agarose, Tris/borate/EDTA gel. Purified BAC DNA was subjected ml; sheep polyclonal anti-human pepsinogen II (Abcam) diluted 1:100; to tube dialysis against 500 volumes TE buffer (10 mM Tris, 1 mM mouse monoclonal anti–H+K+ ATPase subunit (Abcam, ab2866) EDTA) overnight at 4°C, followed by microdialysis on 0.05-m filters diluted 1:2,000; rabbit polyclonal anti-TFF1 and TFF2 (custom gen- (Millipore) against 100 volumes microinjection buffer (10 mM Tris- erated) (60) diluted 1:750 and 1:1,000, respectively; mouse monoclo- HCl, pH 7.5, 100 mM NaCl, 0.1 mM EDTA, 30 M spermine, 70 M nal anti-MUC5AC-biotin conjugate (Abcam, ab79082) diluted 1:400; spermidine) overnight at 4°C. Dialyzed BAC DNA was diluted to a con- rabbit monoclonal anti-CDX2-Alexa Fluor 488 conjugate (Abcam, centration 0.5 ng/l and then used for microinjection into C57BL/6J × ab195007) diluted 1:200; and chicken polyclonal anti--gal (Abcam, DBA/2J F2 hybrid zygotes. BACTg founder animals were identified by ab9361) diluted 1:200. Immunofluorescent detection of bound pri- PCR and Southern blotting analysis. Two founder lines (lines 5 and 9) mary antibodies was achieved using the following secondary antibody with high-level expression of human GKNs were selected and back- conjugates: donkey anti-rabbit IgG-Alexa Fluor 594, goat-anti mouse crossed to the C57BL/6 strain for 6 generations prior to commence- IgG Alexa Fluor 488, streptavidin-Alexa Fluor 488, streptavidin-Alexa ment of experiments. To generate BACTg gp130F/F compound trans- Fluor 568, and anti-sheep IgG Alexa Fluor 594 (all from Invitrogen

1398 jci.org Volume 126 Number 4 April 2016 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

The Journal of Clinical Investigation RESEAR CH AR TICLE

Molecular Probes) and goat anti-chicken IgY-DyLight 488 (Abcam, data or a Mann-Whitney U test for nonparametric data. P values of ab96947). Samples were mounted in Pro-Long Gold medium contain- 0.05 or lower were considered statistically significant. ing DAPI counterstain (Invitrogen). Fluorescence images were cap- Study approval. Mouse experiments were approved by the Murdoch tured using a Zeiss LSM 780 laser scanning confocal microscope and Children’s Research Institute Animal Ethics Committee (approval no. processed using ZEN software (Zeiss). A693, A700, and A713). Approval for experiments on human tissues was Flow cytometry. Cell suspensions were prepared from whole stom- obtained from the Royal Melbourne Hospital Human Research Ethics ach tissue using Gentle MACS lamina propria dissociation reagents Committee (approval no. 2004.176) and the Kanazawa University Eth- and protocols (Miltenyi Biotech). Total leukocytes were purified from ics Committee for Human Genome Research (approval no. 174.2008). cell suspensions by Percoll (GE Healthcare) density gradient centrifu- Written informed consent was obtained for all study participants. gation (40%/80% Percoll interface) and then resuspended in 2% FBS, 2 mM EDTA in HBSS. Purified leukocytes were stained for presence of Author contributions surface markers specific to macrophages, DCs, and MDSCs using the TRM and LOC performed most of the experiments and data anal- following anti-mouse monoclonal antibodies: CD11b (Brilliant Violet ysis. YTC, MS, LMJ, JD, BNR, GZN, SJ, AC, DEO, BK, and SM 421 101235 [1:1,000]; PE 557397 [1:500]), CD49d (FITC, 103605 contributed to experiments. LMJ, JD, and MS contributed to data [1:1,000]), Gr1 (PerCP-Cy5.5, 552093 [1:1,000]), Ly6C (PerCP, analysis. JGF, TCW, TM, and RLF contributed reagents, materials, 128028 [1:1,000]), F4/80 (Alexa Fluor 700, 123130 [1:1,000]), Ly6G or protocols. TRM, PS, LMJ, and ASG conceived of, designed, and (APC/Cy7, 127624 [1:500]), and CD45 (V500, 561487 [1:500]) (all led the study. TRM wrote the manuscript. TRM, PS, LMJ, ASG, JD, Biolegend) and CD11c (APC, 17-0114-82 [1:1,000]) (eBioscience). TM, and RLF edited/revised the manuscript. Tregs were detected using the Mouse Regulatory T Cell Staining Kit (eBioscience, 88-8111-40): CD4 (FITC [1:500]), CD25 (APC [1:500]), Acknowledgments and Foxp3 (PE [1:200]). CountBright absolute counting beads (Molec- We thank the Australian Phenomics Network for assistance with ular Probes) were used to determine total cell number per sample. Cell generation of Gkn2–/– mice and Elizabeth Williams for pronuclear viability was assessed by propidium iodide dye exclusion. Leukocytes injections of BAC DNA and generation of transgenic mice at the were gated based on forward and side scatter properties, with subse- Transgenic Animal Service of Queensland, University of Queens- quent gating on specific myeloid cell markers as described above (gat- land, St. Lucia, Australia. We thank Matthew Burton, the Flow ing strategies are shown in Supplemental Figure 12). Data collection Cytometry and Imaging Facility, Murdoch Children’s Research was performed on a BD LSR II Flow Cytometer, and analysis was per- Institute, for advice and assistance with flow cytometry analysis. formed using FACSDiva software (both BD Biosciences). This study was supported by a project grant (1047208) from the Gene expression. QRT-PCR was performed as described previously National Health and Medical Research Council (NHMRC); research (66). Primer sequences were designed using the primer3 tool (http:// fellowships awarded to T.R. Menheniott (1026674), A.S. Giraud frodo.wi.mit.edu/primer3/) and are listed together with cycling (607330), L.M. Judd (1008776) and P. Sutton (1020387) by the parameters in the Supplemental Methods. Relative gene expression NHMRC; a fellowship (DFG DA1161/5-1) awarded to J. Däbritz by was normalized to expression of internal reference gene GAPDH the German Research Foundation; and the Victorian Government’s (human) or Rpl32 (mouse) using the –2Ct method, where –2Ct = Medical Research Operational Infrastructure Support Program. Ct sample – Ct calibrator (67). Statistics. Data were analyzed with GraphPad Prism V5.1 soft- Address correspondence to: Trevelyan R. Menheniott, Murdoch ware. Data are presented as the mean ± SEM. Statistical analysis was Children’s Research Institute, The Royal Children’s Hospital, 50 performed by 1-way analysis of variance, with 2-group comparisons Flemington Road, Parkville, Victoria, 3052, Australia. Phone: tested post hoc, using a 1- or 2-tailed Student’s t test for parametric 61.3.9936.6265; E-mail: [email protected].

1. Ferlay J, et al. Cancer incidence and mortal- roles. Am J Physiol Gastrointest Liver Physiol. thelium, down-regulated in gastric carcinoma, ity worldwide: sources, methods and major 2013;304(2):G109–G121. and shows high evolutionary conservation. patterns in GLOBOCAN 2012. Int J Cancer. 7. Martin TE, et al. A novel mitogenic protein that J Pathol. 2004;203(3):789–797. 2015;136(5):E359–E386. is highly expressed in cells of the gastric antrum 12. Resnick MB, et al. Global analysis of the human 2. Correa P, Haenszel W, Cuello C, Tannenbaum S, mucosa. Am J Physiol Gastrointest Liver Physiol. gastric epithelial transcriptome altered by Archer M. A model for gastric cancer epidemiol- 2003;285(2):G332–G343. Helicobacter pylori eradication in vivo. Gut. ogy. Lancet. 1975;2(7924):58–60. 8. Du JJ, et al. [Down-regulated full-length novel 2006;55(12):1717–1724. 3. Schier S, Wright NA. Stem cell relationships and gene GDDR and its effect on gastric cancer]. 13. May FE, Griffin SM, Westley BR. The trefoil the origin of gastrointestinal cancer. Oncology. Zhonghua Yi Xue Za Zhi. 2003;83(13):1166–1168. factor interacting protein TFIZ1 binds the trefoil 2005;69(suppl 1):9–13. 9. Menheniott TR, et al. A novel gastrokine, Gkn3, protein TFF1 preferentially in normal gastric 4. Hoffmann W. Self-renewal of the gastric epithe- marks gastric atrophy and shows evidence of mucosal cells but the co-expression of these lium from stem and progenitor cells. Front Biosci adaptive gene loss in humans. Gastroenterology. proteins is deregulated in gastric cancer. Int J Bio- (Schol Ed). 2013;5:720–731. 2010;138(5):1823–1835. chem Cell Biol. 2009;41(3):632–640. 5. Hedlund J, Johansson J, Persson B. BRICHOS 10. Geahlen JH, et al. Evolution of the human gas- 14. Westley BR, Griffin SM, May FE. Interaction – a superfamily of multidomain proteins with trokine locus and confounding factors regarding between TFF1, a gastric tumor suppressor trefoil diverse functions. BMC Res Notes. 2009;2:180. the pseudogenicity of GKN3. Physiol Genomics. protein, and TFIZ1, a brichos domain-containing 6. Menheniott TR, Kurklu B, Giraud AS. Gas- 2013;45(15):667–683. protein with homology to SP-C. Biochemistry. trokines: stomach-specific proteins with 11. Oien KA, et al. Gastrokine 1 is abundantly and 2005;44(22):7967–7975. putative homeostatic and tumor suppressor specifically expressed in superficial gastric epi- 15. Tebbutt NC, et al. Reciprocal regulation of gas-

jci.org Volume 126 Number 4 April 2016 1399 Downloaded from http://www.jci.org on April 7, 2016. http://dx.doi.org/10.1172/JCI82655

RESEAR CH AR TICLE The Journal of Clinical Investigation

trointestinal homeostasis by SHP2 and STAT- derived suppressor cells. Nat Rev Cancer. cells produce IL-10 and efferocytose apoptotic mediated trefoil gene activation in gp130 mutant 2013;13(10):739–752. neutrophils with relevance in resolution of mice. Nat Med. 2002;8(10):1089–1097. 34. Du JJ, et al. [Study on novel gene GDDR related bacterial pneumonia. Mucosal immunology. 16. Judd LM, et al. Gastric cancer development in to gastric cancer]. Zhonghua Wai Ke Za Zhi. 2013;6(1):189–199. mice lacking the SHP2 binding site on the IL-6 2005;43(1):10–13. 52. Ng GZ, et al. The Muc1 mucin protects against family co-receptor gp130. Gastroenterology. 35. Dai J, Zhang N, Wang J, Chen M, Chen J. Gas- Helicobacter pylori pathogenesis in mice by 2004;126(1):196–207. trokine-2 is downregulated in gastric cancer regulation of the NLRP3 inflammasome [pub- 17. Lefebvre O, et al. Gastric mucosa abnormalities and its restoration suppresses gastric tum- lished online ahead of print April 8, 2015]. Gut. and tumorigenesis in mice lacking the pS2 trefoil origenesis and cancer metastasis. Tumour Biol. doi:10.1136/gutjnl-2014-307175. protein. Science. 1996;274(5285):259–262. 2014;35(5):4199–4207. 53. Chetty R, Naidoo R, Tarin M, Sitti C. Chromo- 18. Oshima H, Matsunaga A, Fujimura T, Tsukamoto 36. Moss SF, et al. Decreased expression of gastro- some 2p, 3p, 5q and 18q status in sporadic gastric T, Taketo MM, Oshima M. Carcinogenesis in kine 1 and the trefoil factor interacting protein cancer. Pathology. 2002;34(3):275–281. mouse stomach by simultaneous activation of TFIZ1/GKN2 in gastric cancer: influence of 54. Panani AD. Cytogenetic and molecular aspects of the Wnt signaling and prostaglandin E2 pathway. tumor histology and relationship to prognosis. gastric cancer: clinical implications. Cancer Lett. Gastroenterology. 2006;131(4):1086–1095. Clin Cancer Res. 2008;14(13):4161–4167. 2008;266(2):99–115. 19. Tu S, et al. Overexpression of interleukin-1 37. Houghton J, et al. Gastric cancer originating 55. Yoon JH, et al. Inactivation of the Gastrokine 1 induces gastric inflammation and cancer and from bone marrow-derived cells. Science. gene in gastric adenomas and carcinomas. mobilizes myeloid-derived suppressor cells in 2004;306(5701):1568–1571. J Pathol. 2011;223(5):618–625. mice. Cancer Cell. 2008;14(5):408–419. 38. Barker N, et al. Lgr5(+ve) stem cells drive self- 56. Baus-Loncar M, Lubka M, Pusch CM, Otto 20. Schwenk F, Baron U, Rajewsky K. A cre-transgenic renewal in the stomach and build long-lived gas- WR, Poulsom R, Blin N. Cytokine regulation of mouse strain for the ubiquitous deletion of loxP- tric units in vitro. Cell Stem Cell. 2010;6(1):25–36. the trefoil factor family binding protein GKN2 flanked gene segments including deletion in germ 39. Nam KT, et al. et al. Mature chief cells are cryptic (GDDR/TFIZ1/blottin) in human gastroin- cells. Nucleic Acids Res. 1995;23(24):5080–5081. progenitors for metaplasia in the stomach. Gas- testinal epithelial cells. Cell Physiol Biochem. 21. Howlett M, et al. The interleukin-6 family troenterology. 2010;139(6):2028–2037. 2007;20(1–4):193–204. cytokine interleukin-11 regulates homeo- 40. Smythies LE, Waites KB, Lindsey JR, Harris PR, 57. Selgrad M, Malfertheiner P. Treatment of static epithelial cell turnover and promotes Ghiara P, Smith PD. Helicobacter pylori-induced Helicobacter pylori. Curr Opin Gastroenterol. gastric tumor development. Gastroenterology. mucosal inflammation is Th1 mediated and exac- 2011;27(6):565–570. 2009;136(3):967–977. erbated in IL-4, but not IFN-, gene-deficient 58. Genta RM, Rugge M. Gastric precancerous 22. Ernst M, et al. STAT3 and STAT1 mediate mice. J Immunol. 2000;165(2):1022–1029. lesions: heading for an international consensus. IL-11-dependent and inflammation-associated 41. Syu LJ, et al. Transgenic expression of interfer- Gut. 1999;45(suppl 1):I5–I8. gastric tumorigenesis in gp130 receptor mutant on-gamma in mouse stomach leads to inflam- 59. Jackson CB, et al. Augmented gp130-mediated mice. J Clin Invest. 2008;118(5):1727–1738. mation, metaplasia, and dysplasia. Am J Pathol. cytokine signalling accompanies human gastric 23. Howlett M, et al. Differential regulation of gastric 2012;181(6):2114–2125. cancer progression. J Pathol. 2007;213(2):140–151. tumor growth by cytokines that signal exclusively 42. Miehlke S, et al. Severe expression of corpus gas- 60. Peterson AJ, et al. Helicobacter pylori infection through the coreceptor gp130. Gastroenterology. tritis is characteristic in gastric cancer patients promotes methylation and silencing of trefoil 2005;129(3):1005–1018. infected with Helicobacter pylori. Br J Cancer. factor 2, leading to gastric tumor develop- 24. Correa P, Piazuelo MB. The gastric precancerous 1998;78(2):263–266. ment in mice and humans. Gastroenterology. cascade. J Dig Dis. 2012;13(1):2–9. 43. El-Omar EM, et al. Interleukin-1 polymorphisms 2010;139(6):2005–2017. 25. Lee A, O’Rourke J, De Ungria MC, Robertson associated with increased risk of gastric cancer. 61. Valenzuela DM, et al. High-throughput engineer- B, Daskalopoulos G, Dixon MF. A standardized Nature. 2000;404(6776):398–402. ing of the mouse genome coupled with high- mouse model of Helicobacter pylori infection: 44. Hou L, et al. Polymorphisms in Th1-type cell- resolution expression analysis. Nat Biotechnol. introducing the Sydney strain. Gastroenterology. mediated response genes and risk of gastric can- 2003;21(6):652–659. 1997;112(4):1386–1397. cer. Carcinogenesis. 2007;28(1):118–123. 62. Scarff KL, Judd LM, Toh BH, Gleeson PA, Van 26. Weis VG, Goldenring JR. Current understanding 45. Guiney DG, Hasegawa P, Cole SP. Helicobacter Driel IR. Gastric H(+),K(+)-adenosine triphos- of SPEM and its standing in the preneoplastic pylori preferentially induces interleukin 12 (IL- phatase beta subunit is required for normal process. Gastric Cancer. 2009;12(4):189–197. 12) rather than IL-6 or IL-10 in human dendritic function, development, and membrane struc- 27. Gabrilovich DI, Nagaraj S. Myeloid-derived sup- cells. Infect Immun. 2003;71(7):4163–4166. ture of mouse parietal cells. Gastroenterology. pressor cells as regulators of the immune system. 46. Kranzer K, et al. Induction of maturation and cytok- 1999;117(3):605–618. Nat Rev Immunol. 2009;9(3):162–174. ine release of human dendritic cells by Helicobacter 63. Biondo M, Nasa Z, Marshall A, Toh BH, Alderuccio 28. Peek RM Jr, Fiske C, Wilson KT. Role of innate pylori. Infect Immun. 2004;72(8):4416–4423. F. Local transgenic expression of granulocyte mac- immunity in Helicobacter pylori-induced gastric 47. Mitchell P, et al. Chronic exposure to Helico- rophage-colony stimulating factor initiates auto- malignancy. Physiol Rev. 2010;90(3):831–858. bacter pylori impairs dendritic cell function immunity. J Immunol. 2001;166(3):2090–2099. 29. Viala J, et al. Nod1 responds to peptidoglycan and inhibits Th1 development. Infect Immun. 64. Wee JL, et al. Protease-activated receptor-1 delivered by the Helicobacter pylori cag pathoge- 2007;75(2):810–819. down-regulates the murine inflammatory and nicity island. Nat Immunol. 2004;5(11):1166–1174. 48. Khamri W, et al. Helicobacter pylori stimulates humoral response to Helicobacter pylori. Gas- 30. Thompson LJ, et al. Chronic Helicobacter pylori dendritic cells to induce interleukin-17 expres- troenterology. 2010;138(2):573–582. infection with Sydney strain 1 and a newly identi- sion from CD4+ T lymphocytes. Infect Immun. 65. Fox JG, et al. Accelerated progression of gastritis fied mouse-adapted strain (Sydney strain 2000) 2010;78(2):845–853. to dysplasia in the pyloric antrum of TFF2–/– in C57BL/6 and BALB/c mice. Infect Immun. 49. Stummvoll GH, et al. Th1, Th2, and Th17 effector C57BL6 × Sv129 Helicobacter pylori-infected 2004;72(8):4668–4679. T cell-induced autoimmune gastritis differs mice. Am J Pathol. 2007;171(5):1520–1528. 31. Kao JY, et al. Helicobacter pylori immune escape in pathological pattern and in susceptibility to 66. Kurklu B, et al. Lineage-specific RUNX3 is mediated by dendritic cell-induced Treg skew- suppression by regulatory T cells. J Immunol. hypomethylation marks the preneoplastic ing and Th17 suppression in mice. Gastroenterol- 2008;181(3):1908–1916. immune component of gastric cancer. Oncogene. ogy. 2010;138(3):1046–1054. 50. Quiding-Jarbrink M, Lundin BS, Lonroth H, Sven- 2014;34(22):2856–2866. 32. Zhuang Y, et al. A pro-inflammatory role for Th22 nerholm AM. CD4+ and CD8+ T cell responses 67. Livak KJ, Schmittgen TD. Analysis of relative cells in Helicobacter pylori-associated gastritis. in Helicobacter pylori-infected individuals. Clin gene expression data using real-time quantita- Gut. 2015;64(9):1368–1378. Exp Immunol. 2001;123(1):81–87. tive PCR and the 2(-C(T)) Method. Methods. 33. Talmadge JE, Gabrilovich DI. History of myeloid- 51. Poe SL, et al. STAT1-regulated lung MDSC-like 2001;25(4):402–408.

1400 jci.org Volume 126 Number 4 April 2016 Chromosome 2 (p13.3) 21 p12 34 35

Scale: 20 kb chr2: 69,150,000 69,160,000 69,170,000 69,180,000 69,190,000 69,200,000 69,210,000

UCSC Genes (RefSeq, UniProt, CCDS, Rfam, tRNAs & Comparative Genomics) GKN3 GKN2 GKN1

GKN2

Multiz Alignments (Mammalian Conservation) Mouse Rat Rabbit Pig Dolphin Cow Horse Cat Dog Microbat Hedgehog Elephant Armadillo Opossum Tasmanian_devil Wallaby

Figure S1. Mammalian conservation of GKN2. (A) UCSC genome browser output for the human GKN gene cluster (GKN1-3) with expanded view of the human GKN2 structural gene on chromosome 2p13.3 (GRCh37 Hg19; http://genome.ucsc.edu/). Mammalian conservation is shownin the ‘Multiz Alignment’ track. The degree of conservation, as shown in the grayscale density plot, uses blocks of darker values to indicate higher conservation. Human GC progression:

NORMAL H. PYLORI INTESTINAL GASTRIC GASTRITIS METAPLASIA CANCER Tumor Helicobacter pylori Goblet cells Mucus layer Gastric epithelium

Submucosa

Inflammatory cells

Mouse models: H. pylori gastritis HpSS1 7d 2m 12m Autoimmune gastritis GmcsfTg

Atrophy/hypertrophy HK-/-

Tumorigenesis (antrum) gp130F/F

Tumorigenesis (corpus) IL1Tg

Figure S2. Comparison of human and mouse GC progression. Schematic showing correspondence between stages of human GC as defined by Correa (Correa P et al. Lancet. 1975. 2(7924): 58-60) and five well characterised mouse models of gastric pathology: infection of C57BL/6 with mouse adapted H. pylori Sydney strain 1 (HpSS1); granulocyte-macrophage colony stimulating factor transgenic overexpression (GmcsfTg) model of autoimmune gastritis; H+K+ ATPase beta subunit knockout (HK-/-) model of corpus atrophy and hypertrophy; gp130Y757F cytokine co-receptor knock-in model of antral tumorigenesis (gp130F/F); interleukin-1 beta transgenic overexpression model of corpus tumorigenesis (IL1Tg). A B WT 10 WT Gkn2-/- Gkn2+/- e 8 z i s

Gkn2-/- 151 r

e 6 t t i l

274 e

g 4 a r e

124 v 2 a 0 Birth Weaning

Figure S3. Gkn2-/- mice show normal viability and fertility. (A) Pie chart shows genotype frequencies of progeny resulting from Gkn2+/- heterozygous pair matings. (B) Histogram shows mean litter sizes at birth and weaning from Gkn2-/- × Gkn2-/- matings compared to WT× WT matings. Error bars (SEM). A B 3 WT 8 Gkn2-/- *** *** 6 2

4 1 2 Macroscopic lesion area as % of gastric mucosa area Number of corpus lesions 0 0

Figure S4. Quantitative morphometric analysis of corpus mucosal lesion number and macroscopic area. (A) Number of lesion foci per corpus stomach; (B) macroscopic lesion mucosa area as % of total gastric mucosal area in 12 week old Gkn2-/- (n=17) and WT littermate control (n=9) mice. Histograms show the mean. Error bars (+SEM).- P values were determined using a 2-tailed Student’s t test: ***(P<0.001).

A WT Gkn2 -/- Tff1-/- Gkn2 -/- /Tff1-/-

B C 0.4 0.4 ) h ) h t t WT g m g m n n -/-

m Gkn2 m e e ( ( l l ns

/ / -/- ) ) 0.3 0.3 Tff1 a a 2 2 s s -/- -/- o o Gkn2 /Tff1 m m c c ns u m u m ( (

0.2 0.2 m m

a a s s e i i e r r r r a a a a l l u u 0.1 0.1 c c s s u u Antral m m

Corpus 0.0 0.0

Figure S5. Morphometric analysis of gastric epithelial lesions in Gkn2-/-/Tff1-/- mice. (A) Representative images of fundic and antral lesions in 12-week old Gkn2-/-/Tff1-/- compound mutant mice. Boundaries between fundic and antral mucosae are delineated with a white broken line; lesion areas are demarcated with either red (fundic) or green (antral) dotted outlines. Scale bar shows 5mm. (B-C) Histograms show the mean mucosal cross section (microscopic) area of fundic (B) and antral (C) mucosae. Error bars (+SEM).- Abbreviations: ns; non-significant comparison in 2-tailed Student’s t test.

A 30 Gkn2-/- uninfected (4)

e 25 WT H. pylori (13) g

n 20 -/- a Gkn2 H. pylori (18) h

c 15

d 6 l o f

A 4 N R

m 2

0 Dmbt1 RegIII B C D 150 100 15

100 80 e e 10 g 50 g n n 1/M1 genes)

a 60 a h h H c c

10 d d l l

e (T 40 5 o o f f g

n A A a N N h 5 20 c R R

d m m l 0 o f 0 0 A N R

m -5 Ifn IL1 Tnf Cxcl2 IL6 IL11 -20 IL17f -5 IL10 Foxp3

Figure S6. Lack of differential expression of cytokines and immune-related transcription factors in antral stomach of H. pylori-infected Gkn2-/- mice. QRT-PCR analysis of anti-microbial peptides Dmbt1 and RegIII (A); Th-1/M1 cytokines (B), Th-17 cytokines (C) and Treg markers (D). Histograms show the mean mRNA fold change relative to WT uninfected control mice. Error bars + SEM. A WT Primary GECs co-cultured with (n=7) 1 x 107 cfu live H. pylori SS1

Gkn2-/- (n=9) WT GECs Gkn2-/- GECs B WTWT WT Pan-CK

50m 20m 50m 20m GKN2 WT Gkn2-/- Nuc F’blasts Pan-CK CD45 gal

50m -/- 50m 20m SMA GEC Macs Gkn2

C 30000 25000 * * 20000 WT uninfected 15000 -/- * *

L Gkn2 uninfected 10000 m * * / 5000 WT H. pylori

g * * p 4000 Gkn2-/- H. pylori * * 3000 * * 2000 * * * * 1000 1000 800 600 * * * *

Cytokine level 400 200 0 F 1 -5 -6 0 3 3 4 5 - -1 L L -1 -1 L L L N IL L I I L L C C C T I I I C C C

Figure S7. Enhanced gastric immunity in Gkn2-/- mice is not cell autonomous to GECs. (A) Schematic showing the strategy used for co-culture of primary mouse GEC and H. pylori SS1. (B) Immunofluorescent co-localization of epithelial cells (pan-cytokeratins; Pan-CK), Gkn2-/- and WT mice. Absence of contaminating immunocytes and mesenchymal cells was verified by CD45 and SMA staining respectively. Primary mouse embryonic fibroblasts (F’blasts) and peritoneal macrophage (Macs) cultures show corresponding positive controls for SMA and CD45. (C) Luminex bead array analysis of cytokines/chemokines in Gkn2-/- and WT GEC culture supernatants after co-culture with H. pylori for 24 hours. Histograms show mean levels (pg/mL). Error bars (+SEM). P values were determined using a 2-tailed Student’s t test. Statistical significance relative to WT uninfected controls: *P<0.05. There were no differences in chemokine/cytokine production between H. pylori-stimulated Gkn2-/- and WT GECs. 6 h c a m o t s / 4 U F C

2 * H. pylori

5 0

1 0 WT Gkn2-/-

Figure S8. Confirmatory analysis of H. pylori colonisation in Gkn2-/- mice by colony forming unit (CFU) assay. Histograms show mean H. pylori CFU counts per stomach at 7 days post infection. Error bars (+SEM).- P values were determined using a 2-tailed Student’s t test: *(P<0.05). The CFU assay provides independent verification of QPCR data showing lower gastric colonisation levels in Gkn2-/- compared to WT mice. A WT26: 0 50 200 500 100

DOX (ng/mL) 1000

GKN2 (HA) GAPDH

WT31: 0 50 200 500 100

DOX (ng/mL) 1000

GKN2 (HA) GAPDH

0.08 B m WT26 WT31 Empty Vector n

0 ns

45 0.06 ns A /

n ns o i s

e 0.04 h d a

i r 0.02 o l y

p * * * * * . *

H 0.00 GKN2 (DOX): - + - + - + - + - + - + H. pylori strain : J99 babA/ J99 babA/ J99 babA/ sabA sabA sabA

Figure S9. GKN2 is dispensable for H. pylori adhesion to GECs. (A) Stable transfected, GKN2-HA (C-terminal haemagglutinin epitope tagged) inducible MKN28 gastric epithelial cell lines were created using Tet-ON Advanced/TRE- tight expression vectors. Doxycycline (DOX) dependent induction of GKN2-HA expression was verified in two indepdent clones (WT26, WT31) by immunoblotting cell lysates with anti-HA antibodies. GAPDH blots confrim protein integrity. (B) ELISA-based detection of H. pylori J99 (WT strain) and babA/sabA (adhesion- deficient isogenic mutant strain used as control) adherence to GKN2-HA inducible MKN28 gastric epithelial cells. Histograms show mean adhesion (absorbance units at 450nm (A450). Error bars (+SEM).- P values were determined using a 2-tailed Student’s t test: *(P<0.05). H. pylori J99 adhesion was unaffected by GKN2 expression (non-significant; ns). 600 WT uninfected 500 Gkn2 -/- uninfected n i 400 e

t WT H. pylori * o

r 300 Gkn2 -/- H. pylori p

g 200

m 200 0

0 150 1 / g

p 100 50 nd nd 0 TNF IL-1 IL-6 CXCL1 CCL4 IFN IL-10

Figure S10. Antral cytokine protein expression in 7 day H. pylori-infected Gkn2-/- mice. Histograms show mean levels of pro- and anti-inflammatory cytokines measured by Luminex bead array in 7 day infected mice and uninfected controls (n=6 or 7/group). Error bars (+- SEM). P values were determined using a 2-tailed Student’s t test: *P<0.05. Abbreviations: nd; not detected. A WT Gkn2-/- CD45+ CD45+

CD45 E-Cad+ E-Cad+

E-Cadherin B 20 WT 1200 60 Gkn2-/- 15 800 40 10 400 20 5 mRNA fold change mRNA mRNA fold change mRNA mRNA fold change mRNA

0 0 0 Cd45 Cdh1

E-Cad CD45 E-Cad CD45 Muc5ac E-Cad CD45 C 25000 WT 3000 8000 20000 Gkn2-/- 20000 6000 15000 2000 15000 4000 10000 10000 1000 5000 5000 2000 mRNA fold change mRNA mRNA fold change mRNA mRNA fold change mRNA mRNA fold change mRNA

0 IL6 0 0 IL1a 0 Ccl4 Tnfa E-Cad CD45 E-Cad CD45 E-Cad CD45 E-Cad CD45

Figure S11. Cell sorting and cytokine expression analysis of gastric epithelial and immune cells. (A) Representative FACS plots showing isolation of gastric epithelial (E-Cadherin+) and immune cell (CD45+) populations from WT and Gkn2-/- stomachs (n=3/group). (B) QRT-PCR validation of sorted cell populations for Cdh1 (E-Cadherin) and Cd45 mRNA expression. Analysis of Muc5ac mRNA confirms presence of SMC within the gastric epithelial population. (C) QRT-PCR analysis of pro-inflammatory cytokine expression in sorted gastric epithelial and immune cell populations. IL1a, Tnfa, IL6 and Ccl4 mRNA showed specific enrichment in gastric immune cells and were undetected in the epithelial cells. Error bars (+SEM)._ A Macrophages DC

CD11b+ CD11c+ Gr1-

Leukocytes

SSC - Gr1 CD11b+ F4/80+ Ly6G

CD11b - Gr1 CD11b

FSC Ly6C F4/80 CD11c

B Mo-MDSC CD11b+

CD11b+ Ly6CHi Leukocytes - + CD11b+ CD49d+ Ly6G CD49d SSC Ly6G Ly6G CD11b

FSC F4/80 CD49d Ly6C

Figure S12. Flow cytometric gating strategy to resolve gastric mucosal myeloid cell populations. Initial gating on viable cells by propidium iodide dye exclusion (not shown). Subsequent gating was on total gastric leukocytes- (forward/side scatter) for (A) macrophages, dendritic cells (DC) and (B) monocytic myeloid derived suppressor cells (Mo-MDSC) are shown. WT uninfected Gkn2 -/- uninfected WT H. pylori Gkn2 -/- H. pylori - Macs CD11b+ F4/80+ Gr1

4.6 12.1 3.9 9.5 CD11b F4/80

DC CD11b+ CD11c+ 3.4 7.0 3.2 5.7 CD11b CD11c

Mo-MDSC - CD11b+ Ly6CHi Ly6G CD49d+

10.9 2.7 8.7 2.8 Ly6G Ly6C

Figure S13. Flow cytometric analysis of gastric mucosal immune cells in 7 day H. pylori infected Gkn2-/- mice. Representative flow plots showing key myeloid cell subsets in stomachs of 7 day infected Gkn2-/- mice and uninfected controls (n=5/group): macrophages (Macs; CD11b+F4-80+Gr1-),dendritic cells (DC; CD11c+), monocytic (Mo)-MDSC (CD11b+Ly6ChiLy6G-CD49d+). A WT Gkn2+/- Gkn2-/-

B WT Gkn2+/- Gkn2-/- Corpus Antrum

C D h d

t Corpus Antrum ) Corpus n g 0.5 0.3 30 a m n WT l * WT e g m l /

( +/- * +/- / s Gkn2 Gkn2 l ) 0.4 l a 2 e s Gkn2-/- Gkn2 -/- c m o 0.2 20 c e m 0.3 u ( v i

t m i a

s e s r i 0.2 o r a 0.1 p

10

a l 7 u 6

c 0.1 - i s u K

m 0.0 0.0 0 % Mucosal

Figure S14. Baseline gastric phenotype of Gkn2+/- mice. (A) Macroscopic images of stomachs from 12 week old mice. White broken lines delineate boundaries of corpus and antral mucosae. Scale bar 5 mm. (B) Histology of AB-PAS stained corpus and antrum mucosa in 12 week old mice. Scale bars 50 m. (C) Morphometric analysis of corpus and antral mucosal thickness in 12 week old WT (n=8); Gkn2+/- (n=4); Gkn2-/- (n=11) mice. (D) Ki-67 labelling of proliferating cells in corpus mucosa of 12 week old +/- -/- WT (n=6); Gkn2 (n=4) and Gkn2 (n=6) mice. Error bars (+SEM).- P values were determined using a 2-tailed Student’s t test: *(P<0.05). Gkn2+/- mice show a normal gastric phenotype in macroscopic appearance, mucosal histology/thickness and epithelial proliferation. A * B 1.5 WT WT H. pylori (n=13) Gkn2 +/- H. pylori -/- +/- Oral delivery of copies 1.0 Gkn2 H. pylori Gkn2 genomes/ * (n=24) 1 x 10 7 cfu H. pylori SS1 Sacrifice -/- Gkn2 0.5 . pylori (n=18) Gapdh 5 0 2 H 4

(6 - 8 weeks old) 10 0 0

Infection timecourse/months 1

C WT H. pylori Gkn2 + / - H. pylori Gkn2 - /- H. pylori D 2.5 * -/- * * Gkn2 uninfected * # * # WT H. pylori e # # # r 2.0 # # *

o +/- # Gkn2 H. pylori c

S # -/- 1.5 # # Gkn2 H. pylori y #

g # o l # o 1.0 # h t a

P 0.5

0.0 PMN MN Atrophy Met PMN MN Corpus Antrum E * *

8 e # 30 120 * e 40 8 250 e * * e -/-

e # ** g Gkn2 uninfected g g e # # g g n

n * n # g n n 25 a a # a n # a 200 WT H. pylori a 6 h h a h h h c # c 30 6 h c

c #

+/- c # 20 # Gkn2 H. pylori c # # d d l

d 80 150 d l

l # l d # l o d # 4 o l o f o -/- f

o 15 f

f Gkn2 H. pylori

o f

f # # 20 4 A 100

A # A A A N A 10 N N 2 N N R N R R R

R 40 50 R m m

5 m m m

10 2 m

0 0 0 IL6 Ifng IL17f IL10 IL1b

-5 -2 0 Cxcl2 0 0 -50

Figure S15. Gastric immunopathology in H. pylori infected Gkn2+/- mice. (A) Schematic showing strategy used for 2 month H. pylori infections and treatment group sizes. (B) QPCR analysis of H. pylori SS1 colonisation levels in 2 month infected gastric homogenates. (C) Macroscopic and corresponding histological views gastric corpus from 2 month H. pylori infected mice. Scale bars: 5 mm (macro); 50 m (histology). (D) Summary of semi-quantitative gastric histopathology. (E) QRT-PCR analysis of TH1/proinflammatory (Ifng, IL1b, IL6, Cxcl2), anti-inflammatory (IL10), TH17 (IL17f) cytokine mRNA expression in 2 month infected gastric corpus. Error bars (+SEM). P values were determined using- a 2-tailed Mann Whitney U test (Figure S12B) or a 2-tailed Student’s t test (Figure S12D-E). Statistical significance compared to WT uninfected control mice: #(P<0.05). Statistical significance between treatment groups: *(P<0.05); **(P<0.01). Table S2. Gkn2-/- mice show normal fertility. Shown are average litter sizes at birth and weaning produced by Gkn2-/- × Gkn2-/- matings compared to WT × WT matings. P value (Pval) significance levels from unpaired t-tests are shown. Litter sizes resulting from Gkn2-/- matings did not differ significantly from those resulting from WT matings.

Parents Litters (n) Av. litter size Pval Av. litter size Pval genotype (at birth) (at weaning)

WT 28 7.39 0.408 4.64 0.820

Gkn2-/- 44 6.86 4.44

Table S1. Gkn2 null alleles show normal Mendelian inheritance. Shown are observed versus expected genotype frequencies for progeny produced by matings between Gkn2+/- heterozygous pairs, chi-squared (2) statistic and P value (Pval) significance level. Observed genotypes did not deviate significantly from expected Mendelian ratios.

Genotype Observed % of Total 2 (deg. freedom) Pval (((Expected)

WT 151 (137) 27.5 2.668 (2) 0.26

Gkn2+/- 274 (275) 49.9

Gkn2-/- 124 (137) 22.6

Supplemental Methods Loss of Gastrokine-2 drives premalignant gastric inflammation and tumor progression

Trevelyan R. Menheniott, Louise O’Connor, Yok Teng Chionh, Jan Däbritz, Michelle Scurr, Benjamin N. Rollo, Garrett Z. Ng, Shelley Jacobs, Angelique Catubig, Bayzar Kurklu, Stephen Mercer, Toshinari Minamoto, David E. Ong, Richard L. Ferrero, James G. Fox, Timothy C. Wang, Philip Sutton, Louise M. Judd, Andrew S. Giraud

Taqman Q-PCR based determination of H. pylori colonisation level Genomic (g)DNA was extracted from H. pylori-infected mouse stomach tissue using Trizol reagent (Invitrogen) and diluted 1:10 in 10 mM Tris-HCl buffer. Diluted gDNA was analysed by Q-PCR quantitation of H. pylori SS1 genome copies (16S rRNA gene) relative to mouse Gapdh copies as described (1) using a ABI 7500 Fast Real Time PCR analyser (fast cycling) and ABI Taqman fast reagents (Applied Biosystems) in 12 µL reactions. Cycling parameters and sequences of oligonucleotide primer pairs/fluorogenic hybridisation probes were as follows:

Initial denaturation: 95˚C for 10 mins

40 cycles: 95˚C for 3 secs 60˚C for 30 secs (fluorescence data capture)

Primer name Sequence (5’ fluorochrome and 3’ quencher dyes) 16S rRNA-F TTTGTTAGAGAAGATAATGACGGTATCTAA C 16S rRNA-R CATAGGATTTCACACCTGACTGACTATC 16S rRNA-Probe FAM-5'-CGTGCCAGCAGCCGCGGT-3'-TAMRA Gapdh-F TGCACCACCAACTGCTTAG Gapdh-R GGATGCAGGGATGATGTTC Gapdh-Probe FAM-5'-CAGAAGACTGTGGATGGCCCT-3'-TAMRA

ELISA-based detection of anti-H. pylori antibodies in mouse serum Levels of circulating anti-H. pylori antibodies were quantified by standard direct enzyme-linked immunosorbent assay (ELISA) as described (2). Briefly, Maxisorp Immunoplates (Nunc, Roskilde, Denmark) were coated overnight with 10 μg/well of H. pylori SS1 lysate in 100 μL of bicarbonate buffer (pH 9.6). After being washed three times with tap water then one time with 0.05% (v/v) Tween 20 in PBS, wells were blocked with 1% (w/v) bovine serum albumin in PBS (PBS-BSA) for 1 hr at room temperature. Blocker was washed off as above then mouse serum samples were serially diluted 1:100 to 1:108 in PBS-BSA and 100 μL added to duplicate wells before incubation at room temperature for 30 min. After further washing, 100

μL of either horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin G1 (IgG1) diluted 1/6,000 (Southern Biotech, Birmingham, AL, USA) or HRP-conjugated goat anti-mouse IgG2c (Immunology Consultants Laboratory, Portland, OR, USA) diluted 1/5,000 in PBS-BSA was added to each well and the plates incubated at room temperature for 1 hr. Following additional washes color was developed by addition of 100 μL tetramethylbenzidine (Zymed, CA) and the reaction stopped by addition of 100 μL of 2M H2SO4. Absorbance was read at 450 nm and end point titers calculated. The observed end point titer is the highest serum dilution that yielded an optical density (OD) greater than the value that defined the cutoff between positive and negative results. The cutoff value is determined by calculating the mean of the OD of the negative control wells (PBS- BSA only) for each plate + 2 standard deviations (IgG1) or 3 standard deviations (IgG2c). Titer is expressed as the reciprocal dilution of the OD cutoff value for each sample. Where the observed values failed to reach the OD of the lowest dilution (1:100) the titer was assigned the minimum dilution value of 100.

ELISA-based determination of H. pylori adhesion to cultured human GECs MKN28 gastric epithelial cells were cultured in 96-well plates at 37°C and 5% CO2 for 48 hrs. Growth medium was aspirated and the cells co-incubated with 107 cfu H. pylori J99 (3) or adhesion defective H. pylori J99 babA/sabA isogenic mutant (gifts of Michael McGuckin, Mater Medical Research Institute, Brisbane, Australia; ref. (4)) in Dulbecco’s modified Eagle medium (DMEM) and the plate gently agitated for 30 min at 37°C. Cells were fixed with 1% paraformaldehyde in PBS for 10 min. Positive controls (maximal H. pylori binding to wells) comprised wells with no gastric cells, to which bacteria were added and allowed to adhere to the plastic before fixation. Negative controls contained neither gastric cells nor bacteria. After washing, cells were blocked for 30 min with PBS-BSA and bacterial adhesion determined by ELISA using hyperimmune mouse serum (generated in house) and a goat anti-mouse IgG-HRP secondary antibody (Pierce; 1/10,000) for detection. Binding was visualized by addition of 100 μL tetramethylbenzidine (TMB) substrate per well, with absorbance read at 450 nm.

Generation of polyclonal antiserum Antibodies were prepared essentially as described (5). To generate anti-mouse GKN2 antibodies, a custom immunizing peptide 12-mer corresponding to the C- terminus of mouse GKN2 was synthesized (sequence: ILGVSICGGIH; molecular weight 1068 Daltons; Auspep, Australia) at >95% purity. To generate anti-human GKN2 antibodies a custom 10-mer corresponding to the C-terminus of human GKN2 was synthesized (sequence: GISICADIHV; molecular weight 1030 daltons; Auspep, Australia) at >95% purity. Mouse and human GKN2 immunising peptides were respectively coupled to key-hole limpet haemocyanin (KLH; Sigma) with 5% glutaraldehyde using 1 mg immunising peptide, 2 mg KLH and 80 µL glutaraldehyde in 1 mL PBS for 1 hr. The conjugate was dialysed overnight against PBS using 6000MW pore dialysis tubing to remove free peptide and glutaraldehyde, then frozen in aliquots for immunization. New Zealand white rabbits (two pairs; Walter and Eliza Hall Institute (WEHI) Antibody Facility, Bundoora, Victoria, Australia) were bled from a marginal ear vein (pre- immunization antibody titer) then immunized intramuscularly with 100 nM human or mouse GKN2-KLH conjugate emulsified in two volumes of complete Freund’s 2

adjuvant (Sigma). Five weeks later rabbits were boosted with 50 nM GKN2-KLH conjugate in incomplete Freund’s adjuvant (Sigma) and bled 7-10 days later (5-20 mL volumes). Two subsequent immunizations and bleeds were carried out at intervals depending on antibody titer using incomplete Freund’s adjuvant. The final bleeds (anti-mouse GKN2-R771 B3; anti-human GKN2-R779 B3) was used in all subsequent experiments at a final dilution of 1:500 (immunohistochemistry and immunofluorescence cytochemistry) and 1:3000 (immunoblotting).

Co-culture of primary gastric epithelial cells with H. pylori Primary mouse gastric epithelial cell (GEC) cultures were derived as described (6). Briefly, stomachs from 3 week old mice were dissected, opened and contents rinsed away with sterile PBS. Stomachs were transferred to 0.2% w/v bovine serum albumin (BSA) in Hanks buffered salts solution (HBSS; Sigma), chopped into ~1 mm3 pieces then digested by incubation in 0.4 mg/mL collagenase A (Roche) in HBSS at 37°C for 1 hr. Digested tissue was resuspended in DMEM Glutamax medium supplemented with 20% FBS, 2 mM non-essential amino acids, 50 IU penicillin, 50 ug/mL streptomycin (Invitrogen), disaggregated by repeated pipetting and seeded into 24-well plates. After one hr at 37°C with 5% CO2/air to allow for the attachment of contaminating fibroblasts, the unattached fraction (enriched for GECs) was aspirated, seeded in fresh 24-well plates and incubated for a further 48 hrs to allow for GEC attachment. Cells were co-cultured with 1 × 107 cfu live H. pylori SS1 for 24 hrs as described (7) after which culture supernatants were harvested for cytokine analysis.

Genotyping assay for the Gkn2-(lacZ) knock-in allele Mice were genotyped by end point PCR from ear punch biopsies using the following cycling parameters and multiplexed oligonucleotide primer sequences:

Initial denaturation: 95˚C for 3 mins

35 cycles: 95˚C for 30 secs 60˚C for 1 min 72C for 1 min

Final extension: 72C for 5 min

Primer name Sequence Gkn2-(WT)-F1 CAGTCCTGATAAGGGAGTTTGC

Gkn2-(WT)-R1 CCCTCACAAAGTGATGAGAAGG Gkn2-(lacZ)-R2 ATTCTCCCAATCTCTCCTCTGC

Products were analysed by electrophoresis through 1.5% agarose, Tris-borate EDTA (TBE) gels. Gkn2-(WT)-F1 and Gkn2-(WT)-R1 primers amplify a 442 bp product from the Gkn2 WT allele, Gkn2-(WT)-F1 and Gkn2-(lacZ)-R2 primers amplify a 214 bp product from the Gkn2-lacZ knock-in allele. WT, Gkn2-/- and 3

Gkn2+/- mice were respectively discriminated by amplification of either 442 bp, 214 bp or both 442/214 bp products (see Figure 2B, main text).

Generation of inducible human GKN2 expressing gastric epithelial cell lines To generate MKN28 gastric epithelial cell lines with an inducible GKN2 protein expression cassette we used the Tet-ON Advanced/TRE-tight binary vector system (Clontech). A full length human GKN2 cDNA was amplified from human gastric antrum cDNA with simultaneous engineering of a C-terminal haemagglutinin (HA) epitope tag and flanking NotI-SalI restriction sites by PCR mutagenesis. Oligonucleotide primer sequences are shown in the table below with color coding used to indicate HA-tag sequence, NotI and SalI restriction sites; stop codons. Kozak consensus (bold type); GKN2 coding sequence (underlined).

Primer name Sequence

NotI-GKN2-F 5’-GCGGCCGCACCATGAAAATACTTGTGGCATTTCTGG-3’

5’-GTCGACTCACTAAGCGTAATCTGGAACATCGTATGGG- SalI-stop/stop-HA-GKN2-R -TAAACATGAATGTCTGCACAGATTGAAATTCC-3’

Initial denaturation: 95C for 3 mins

30 cycles: 95C for 30 secs 55C for 1 min 72C for 1 min

Final extension: 72C for 5 min

PCR-engineered GKN2-HA cDNA product (750 bp) was purified by electrophoresis through a 1% agarose, Tris-acetate EDTA (TAE) gel, subcloned into the pGEM-T- easy vector and correct mutagenesis verified by sequencing using BigDye_v3.1 chemistry (Applied Biosystems). The GKN2-HA cDNA was excised by double digestion with NotI and SalI then directionally ligated into the NotI-SalI sites of the pTRE-tight expression vector.

MKN28 cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 50 IU/mL penicillin, 50 g/mL streptomycin (Invitrogen) at 37C with 5% v/v CO2/air (5). MKN28 cells were transfected with 2 g linearised pTet-ON Advanced vector DNA using FuGENE HD (Roche), incubated for 48 h, then subcultured (1:10 split) and stable transgenic clones selected with 300g mL-1 G418 (Sigma) for two weeks. G418-resistant colonies were trypsinised and cloned by single cell deposition into 96-well plates using a Mo-Flo sorter (Beckman- Coulter). MKN28 Tet-ON clones with inducible potential were identified by supertransfection with pTRE-tight-luciferase in the presence and absence of 1 µg/mL doxycycline (DOX) inducer. Two clones (F6 and G6) showing robust DOX- dependent luciferase induction/repression were expanded into stable Tet-ON cell

4

lines. MKN28 Tet-ON F6/G6 cells were transfected 2 g linearised pTRE-tight- GKN2-HA as described above and double stable transgenic clones selected with 150 g/mL G418 (maintenance dose) and 200 g/L hygromycin for two weeks. G418- hygromycin double resistant colonies were single cell cloned as described above and expanded into MKN28 Tet-ON/TRE-tight-GKN2-HA continuous cell lines. Two clones (WT26 and WT31) showing appropriate DOX-dependent induction of GKN2-HA expression were used in all experiments.

Gene expression (QRT-PCR) cycling parameters and primer sequences QRT-PCR was performed using an ABI 7500 Fast Real Time PCR analyser (Applied Biosystems) in standard cycling mode and Go-Taq SYBR-green reagents (Promega) in 20 µL reactions. Cycling parameters and oligonucleotide primer sequences used for mouse and human gene expression analysis were as follows:

Initial denaturation: 50˚C for 2 mins 95˚C for 10 mins

40 cycles: 95˚C for 15 secs 60˚C for 1 min (fluorescence data capture)

Dissociation curve analysis: 60˚C 95˚C 1% increment/30secs

Human primer sequences:

Gene Forward Primer Sequence Reverse Primer Sequence GAPDH GACATCAAGAAGGTGGTGAAGC GTCCAACCCTGTTGCTGTAG GKN1 GGCCTGATGTACTCAGTCAACC TTTAGTTCTCCACCGTGTCTCC GKN2 TGCAGGATCATGCTCTTCTAC TGGTCCATCTTCAGGATAAAG

Mouse primer sequences:

Gene Forward Primer Sequence Reverse Primer Sequence Rpl32 GAGGTGCTGCTGATGTGC GGCGTTGGGATTGGTGACT Gkn2 GAGACAGTGACCATCGACAACC GAGACAGTGACCATCGACAACC Muc6 GCTGTGTATGACAAGTCGGGTTAC AATTTTGTCCTTCTTGGACAGATACAT Mist1 CCAGGGTGCTCCTTCTTTTG GGCGGAAGTTCACCATCCTT HKβ CCGGTGGGTGTGGATCAG GCAAAGAGCCCGGTCATG Ifn CCAGGACCCATATGTAAAAGAAGC TCATGTCTTCCTTGATGGTCTCC IL1β ATGACCTGAGCACCTTCTTTCC CTTGTTGCTCCATATCCTGTCC Tnfα GTAGCCCACGTCGTAGCAAA ACAAGGTACAACCCATCGGC Cxcl2 AGTGAACTGCGCTGTCAATG TTCAGGGTCAAGGCAAACTT IL6 ACAAAGCCAGAGTCCTTCAGAGA CTGTTAGGAGAGCATTGGAAATTG

5

IL11 TCATTCAGGGAGGCTAAGGA ACAGGGTTTTGCCATGTCTC Dmbt1 GCTCCACAAGCACAGATTCC TGCCATCTCATTGTTCTTGG RegIII ACGAATCCTTCCTCTTCCTCAG GTCTTCACATTTGGGATCTTGC IL10 TGATGCCCCAGGCAGAGA CACCCAGGGAATTCAAATGC Foxp3 TTCACCTATGCCACCCTT ATCC TTTCTGAAGTAGGCGAACATGC IL4 GTCATCCTGCTCTTCTTTCTCG TCACTCTCTGTGGTTCTTCG IL5 TTGACAAGCAATGAGACGATGAG GCCCCTGAAAGATTTCTCCAA Fizz1 CCTGCTGGGATGACTGCTACT CTCCACTCTGGATCTCCCAAGAT Ym1 TCTGGTGAAGGAAATGCGTAAA GCAGCCTTGGAATGTCTTTCTC IL1RN CATAGTGTGTTCTTGGGCATCC TCAGAGCGGATGAAGGTAAAGC IL17a TCTGTGTCTCTGATGCTGTTGC ACATTCTGGAGGAAGTCCTTGG IL17f AAAACCAGGGCATTTCTGTCC ACCAGGATTTCTTGCTGAATGG Ccr2 AAGTTCAGCTGCCTGCAAAGAC GCCGTGGATGAACTGAGGTAAC IL4ra GTGCCACATGGAAATGAATAGG TGTGAGGTTGTCTGGAGCTAGG S100a8 GTCCTCAGTTTGTGCAGAATATAAA GCCAGAAGCTCTGCTACTCC S100a9 CTCTTTAGCCTTGAAGAGCAAG TTCTTGCTCAGGGTGTCAGG Arg1 AAAGCTGGTCTGTGGAAAA ACAGACCGTGGGTTCTTCAC Arg2 ACCCTTGCGGCTCACACA AGCAGGATTGCAGACACTGAAA Tgfb1 GGTGTGGTCTATGCCATCAA CCTCTCCAGTAACCGCTGAT Tgfb2 CTTCACCACAAAGACAGGAACC CCATCAATACCTGCAAATCTCG RoRt GAGTTTGCCAAGCGGCTTT TCCATTGCTCCTGCTTTCAGT Tbet TCCAAGAGACCCAGTTCATTGC CGTATCAACAGATGCGTACATGG Tff1 AGAGGTTGCTGTTTTGATG AGTCTGAGGGGTTGAACTG Tff2 CCCCACAACAGAAAGAAC GGGCACTTCAAAGATCAG Muc1 CACACTCACGGACGCTACGT TACCTGCCGAAACCTCCTCAT Muc5ac GCAGTTGTGTCACCATCATCTGTG GGGGCAGTCTTGACTAACCCTCTT

Quantitative morphometry Quantitative morphometry was performed by a blinded observer in all cases. At least six representative photographs per animal (n≥5) of standard histological or immunohistochemistry sections were captured using a Nikon Eclipse 80i light microscope equipped with a DS Ri1 imaging system (Nikon). To generate morphometric measurements, lengths, areas or relevant cells were manually outlined within images using ImageJ software for Windows v1.44p (http://rsb.info.nih.gov/ij/index.html). All measurements were converted from image pixels to mm (lengths) or mm2 (areas) by comparison with a calibrated graticule.

Determination of gastric acid content For determination of gastric acid content in mice, stomachs were dissected and clamped at the oesophagus and duodenum prevent leakage of contents. Stomachs were injected with 2mL normal saline (0.9% w/v NaCl), incubated at room temperature for 5 mins with agitation, then cut open and the contents collected in

6

sterile tubes. The pH of the stomach contents was determined immediately using a pre-calibrated pH meter (3510, Jenway).

Definitions of gastric histopathology Corpus and antral inflammation was defined by sub-mucosal and mucosal presence of polymorphonuclear and mononuclear cells. Defects in gastric epithelial differentiation were assessed by several criteria. Corpus glandular atrophy was defined as loss of parietal and zymogenic cells. Mucus neck cell (MNC) hyperplasia was defined as expansion of the neutral mucin-secreting MNC zone, without ectopic presence of acidic mucins. MNC hyperplasia is a low grade lesion that may precedes the emergence of mucus metaplasia (see below). Surface mucus cell (SMC) metaplasia describes a lineage having the morphological characteristics of SMC, but showing loss of typical neutral mucins and ectopic gain of Alcian blue-stained acidic mucins. This atypical metaplastic phenotype was frequently found in Gkn2-/- mice, particularly in association with MNC hyperplasia, but has not been widely described elsewhere. Mucus metaplasia was defined as the ectopic presence of Alcian blue stained acidic mucins associated with the acquisition of an elongated antral glandular structure within corpus glands. This metaplasia is a premalignant change, commonly observed in chronic H. pylori infections of humans and mice, as well as some mouse models of GC.

Scoring criteria for semi-quantitative gastric histopathology Inflammation (corpus and antrum) was scored according to the extent of immune cell infiltration within the fundic mucosa: 0, no immune cells were detected in the submucosa and mucosa; 0.5, few immune cells located within the submucosa only; 1, immune infiltration of the submucosa with or without infiltration at the very base of the mucosa; 2, immune infiltration of the submucosa and the bottom half of the mucosa; 3, immune infiltration of the submucosa and greater than 50% of the mucosa; 4, transmural infiltration of immune cells. Glandular atrophy was scored based on the estimated percentage of parietal cell loss and chief cell loss within the corpus: 0, no visible parietal cell and chief cell loss; 1, 25% parietal cell loss and 50% chief cell loss; 2, 50% parietal cell loss and greater than 75% chief cell loss; 3, 75% parietal cell loss and 100% chief cell loss; 4, greater than 75% parietal cell loss and 100% chief cell loss. Mucus neck cell (MNC) hyperplasia was scored according to the approximate percentage of corpus mucosa encompassed by glandular units with an expanded MNC zone: 0, 0% of mucosa affected; 1, 25% of mucosa affected; 2, 50% of mucosa affected; 3, 75% of mucosa affected; 4, 100% of mucosa affected. Surface mucus cell (SMC) metaplasia severity was scored according to the proportion of surface mucus cells affected: 0, no visible surface mucus cell metaplasia; 1, small foci were affected; 2, up to one-third of SMC were affected; 3, one-third to two-thirds of SMC were affected; 4, greater than two-thirds of SMC were affected. Mucus metaplasia (H. pylori infected mice only) was scored based on the approximate percentage of the corpus mucosa showing replacement of oxyntic glands with elongated Alcian-blue stained glands reminiscent of antral mucosa: 0, no visible mucus metaplasia; 1, small foci were present; 2, up to one-third of the corpus was affected; 3, one to two thirds of the corpus were affected; 3, greater than two thirds of the corpus were affected. 7

Immunoblotting and multiplex cytokine array analysis Tissue protein extracts, cell lysates and culture supernatants were size fractionated by 15% SDS-PAGE, transferred to nitrocellulose membranes (GE Healthcare) and blocked in 5% non-fat milk powder/Tris-buffered saline (TBS) pH 7.4, 0.1% Tween- 20. Membranes were incubated with primary antibodies overnight at 4C. Detection was performed with anti-rabbit/ anti-mouse IgG-HRP conjugates (DAKO) and enhanced chemiluminescence reagents (GE Healthcare). Sources of primary antibodies: rabbit polyclonal anti-mouse GKN2 (R771-B3) diluted 1:3000; and anti- human GKN2 (R779-B3) diluted 1:3000 (custom generated, see above); rabbit polyclonal anti-human GAPDH (Abcam, #ab9485) diluted 1:3000. Cytokine protein content of mouse stomach tissues and cell culture supernatants was determined using Bio-Plex Pro Mouse 23-plex cytokine bead arrays (Bio-Rad) according to the manufacturer’s protocols. In brief, stomach tissues were homogenized in ice cold BHI supplemented with complete mini protease inhibitor cocktail (Roche), homogenates cleared by centrifugation, supernatants collected and diluted 1:4 in BHI prior to analysis. Cell culture supernatants were centrifuged to remove cell debris. A nine point standard curve was generated by serial dilution of normalized cytokine standard in diluents specific to each assay (i.e. BHI broth or RPMI/DMEM culture medium) to ensure that the matrix used for assay calibration matched that of the samples. Samples were added in 50µL volumes either diluted 1:4 (stomach homogenates) or undiluted (culture supernatants). Plates were scanned on a Luminex 200 analyzer using xPONENT software (Luminex Corporation).

Whole mount staining for β-galactosidase in situ Stomach tissue expression of the lacZ reporter gene was assessed by histochemical staining for encoded β-galactosidase activity as described (8). Stained tissues were post fixed in 4% paraformaldehyde (Sigma) in PBS overnight at room temperature and then processed for standard paraffin histology as described (9).

Supplemental Methods References

1. Roussel Y, Harris A, Lee MH, and Wilks M. Novel methods of quantitative real- time PCR data analysis in a murine Helicobacter pylori vaccine model. Vaccine. 2007;25(15):2919-29. 2. Chionh YT, Ng GZ, Ong L, Arulmuruganar A, Stent A, Saeed MA, Wee JL, and Sutton P. Protease-activated receptor 1 suppresses Helicobacter pylori gastritis via the inhibition of macrophage cytokine secretion and interferon regulatory factor 5. Mucosal immunology. 2015;8(1):68-79. 3. Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, Smith DR, Noonan B, Guild BC, deJonge BL, et al. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 1999;397(6715):176-80. 4. Mahdavi J, Sonden B, Hurtig M, Olfat FO, Forsberg L, Roche N, Angstrom J, Larsson T, Teneberg S, Karlsson KA, et al. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science. 2002;297(5581):573-8. 5. Menheniott TR, Peterson AJ, O'Connor L, Lee KS, Kalantzis A, Kondova I, Bontrop RE, Bell KM, and Giraud AS. A novel gastrokine, Gkn3, marks gastric atrophy and shows evidence of adaptive gene loss in humans. Gastroenterology. 2010;138(5):1823-35. 8

6. Viala J, Chaput C, Boneca IG, Cardona A, Girardin SE, Moran AP, Athman R, Memet S, Huerre MR, Coyle AJ, et al. Nod1 responds to peptidoglycan delivered by the Helicobacter pylori cag pathogenicity island. Nat Immunol. 2004;5(11):1166- 74. 7. Wee JL, Chionh YT, Ng GZ, Harbour SN, Allison C, Pagel CN, Mackie EJ, Mitchell HM, Ferrero RL, and Sutton P. Protease-activated receptor-1 down- regulates the murine inflammatory and humoral response to Helicobacter pylori. Gastroenterology. 2010;138(2):573-82. 8. Charalambous M, Menheniott TR, Bennett WR, Kelly SM, Dell G, Dandolo L, and Ward A. An enhancer element at the Igf2/H19 locus drives gene expression in both imprinted and non-imprinted tissues. Dev Biol. 2004;271(2):488-97. 9. Howlett M, Chalinor HV, Buzzelli JN, Nguyen N, van Driel IR, Bell KM, Fox JG, Dimitriadis E, Menheniott TR, Giraud AS, et al. IL-11 is a parietal cell cytokine that induces atrophic gastritis. Gut. 2012;61(10):1398-409.

9