2020.05.07.082867V1.Full.Pdf
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Confirmation of Pathogenic Mechanisms by SARS-Cov-2–Host
Messina et al. Cell Death and Disease (2021) 12:788 https://doi.org/10.1038/s41419-021-03881-8 Cell Death & Disease ARTICLE Open Access Looking for pathways related to COVID-19: confirmation of pathogenic mechanisms by SARS-CoV-2–host interactome Francesco Messina 1, Emanuela Giombini1, Chiara Montaldo1, Ashish Arunkumar Sharma2, Antonio Zoccoli3, Rafick-Pierre Sekaly2, Franco Locatelli4, Alimuddin Zumla5, Markus Maeurer6,7, Maria R. Capobianchi1, Francesco Nicola Lauria1 and Giuseppe Ippolito 1 Abstract In the last months, many studies have clearly described several mechanisms of SARS-CoV-2 infection at cell and tissue level, but the mechanisms of interaction between host and SARS-CoV-2, determining the grade of COVID-19 severity, are still unknown. We provide a network analysis on protein–protein interactions (PPI) between viral and host proteins to better identify host biological responses, induced by both whole proteome of SARS-CoV-2 and specific viral proteins. A host-virus interactome was inferred, applying an explorative algorithm (Random Walk with Restart, RWR) triggered by 28 proteins of SARS-CoV-2. The analysis of PPI allowed to estimate the distribution of SARS-CoV-2 proteins in the host cell. Interactome built around one single viral protein allowed to define a different response, underlining as ORF8 and ORF3a modulated cardiovascular diseases and pro-inflammatory pathways, respectively. Finally, the network-based approach highlighted a possible direct action of ORF3a and NS7b to enhancing Bradykinin Storm. This network-based representation of SARS-CoV-2 infection could be a framework for pathogenic evaluation of specific 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; clinical outcomes. -
Patterning of the Third Pharyngeal Pouch Into Thymus/Parathyroid by Six and Eya1
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 293 (2006) 499–512 www.elsevier.com/locate/ydbio Genomes & Developmental Control Patterning of the third pharyngeal pouch into thymus/parathyroid by Six and Eya1 ⁎ Dan Zou a, Derek Silvius a, Julie Davenport a, Raphaelle Grifone b, Pascal Maire b, Pin-Xian Xu a, a McLaughlin Research Institute for Biomedical Sciences, Great Falls, MT 59405, USA b Institut Cochin-INSERM 567, CNRS UMR 8104, Université Paris V, 24 Rue du Faubourg Saint Jacques, 75014 Paris, France Received for publication 27 May 2005; revised 17 November 2005; accepted 6 December 2005 Available online 10 March 2006 Abstract Previous studies have suggested a role of the homeodomain Six family proteins in patterning the developing vertebrate head that involves appropriate segmentation of three tissue layers, the endoderm, the paraxial mesoderm and the neural crest cells; however, the developmental programs and mechanisms by which the Six genes act in the pharyngeal endoderm remain largely unknown. Here, we examined their roles in pharyngeal pouch development. Six1−/− mice lack thymus and parathyroid and analysis of Six1−/− third pouch endoderm demonstrated that the patterning of the third pouch into thymus/parathyroid primordia is initiated. However, the endodermal cells of the thymus/parathyroid rudiments fail to maintain the expression of the parathyroid-specific gene Gcm2 and the thymus-specific gene Foxn1 and subsequently undergo abnormal apoptosis, leading to a complete disappearance of organ primordia by E12.5. This thus defines the thymus/parathyroid defects present in the Six1 mutant. -
The Role of Inhibitors of Differentiation Proteins ID1 and ID3 in Breast Cancer Metastasis
The role of Inhibitors of Differentiation proteins ID1 and ID3 in breast cancer metastasis Wee Siang Teo A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy St Vincent’s Clinical School, Faculty of Medicine The University of New South Wales Cancer Research Program The Garvan Institute of Medical Research Sydney, Australia March, 2014 THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Teo First name: Wee Siang Abbreviation for degree as given in the University calendar: PhD (Medicine) School: St Vincent’s Clinical School Faculty: Faculty of Medicine Title: The role of Inhibitors of Differentiation proteins ID1 and ID3 in breast cancer metastasis Abstract 350 words maximum: (PLEASE TYPE) Breast cancer is a leading cause of cancer death in women. While locally-confined breast cancer is generally curable, the survival of patients with metastatic breast cancer is very poor. Treatment for metastatic breast cancer is palliative not curative due to the lack of targeted therapies. Metastasis is a complex process that still remains poorly understood, thus a detailed understanding of the biological complexity that underlies breast cancer metastasis is essential in reducing the lethality of this disease. The Inhibitor of Differentiation proteins 1 and 3 (ID1/3) are transcriptional regulators that control many cell fate and developmental processes and are often deregulated in cancer. ID1/3 are required and sufficient for the metastasis of breast cancer in experimental models. However, the mechanisms by which ID1/3 mediate metastasis in breast cancer remain to be determined. Little is known about pathways regulated by ID1/3 in breast cancer as well as their functional role in the multiple steps of metastatic progression. -
A SIX1/EYA2 Small Molecule Inhibitor Disrupts EMT and Metastasis Hengbo Zhou1,2, Melanie A
Author Manuscript Published OnlineFirst on April 27, 2020; DOI: 10.1158/0008-5472.CAN-20-0435 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A SIX1/EYA2 small molecule inhibitor disrupts EMT and metastasis Hengbo Zhou1,2, Melanie A. Blevins3, Jessica Y. Hsu1, Deguang Kong1, Matthew D. Galbraith1, Andrew Goodspeed1,4, Rachel Culp-Hill3, Michael UJ. Oliphant1, Dominique Ramirez5, Lingdi Zhang3, Jennyvette T. Pineiro3, Lesley Mathews Griner6, Rebecca King6, Elena Barnaeva6, Xin Hu6, Noel T. Southall6, Marc Ferrer6, Daniel L. Gustafson4,5, Daniel P. Regan4,5, Angelo D’Alessandro3, James C. Costello1,4,, Samarjit Patnaik6, Juan Marugan6, Rui Zhao3,* and Heide L. Ford1,4,* 1. Department of Pharmacology, University of Colorado Anschutz Medical Campus, Auro- ra, Colorado, USA 2. Cancer Biology Program, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA 3. Department of Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA 4. University of Colorado Cancer Center, University of Colorado Anschutz Medical Cam- pus, Aurora, Colorado, USA 5. Flint Animal Cancer Center, Colorado State University, Fort Collins, Colorado, USA 6. Early Translation Branch, National Center for Advancing Translational Sciences, Nation- al Institutes of Health, Rockville, Maryland, USA * Co-corresponding authors. Corresponding authors: Heide L. Ford, University of Colorado Anschutz Medical Campus, 12800E. 19th Ave, P18-6115, Mail Stop 8303, Aurora, CO 80045. Phone: 303-724-3509; Email: [email protected]. Rui Zhao, University of Colorado Anschutz Medical Campus, 12801 E. 17th Ave, L18-9111B, Mail Stop 8101, Aurora, CO 80045. Phone: 303- 724-3269; Email: [email protected]. -
Rap1-Mediated Chromatin and Gene Expression Changes at Senescence
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2019 Rap1-Mediated Chromatin And Gene Expression Changes At Senescence Shufei Song University of Pennsylvania Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons, and the Cell Biology Commons Recommended Citation Song, Shufei, "Rap1-Mediated Chromatin And Gene Expression Changes At Senescence" (2019). Publicly Accessible Penn Dissertations. 3557. https://repository.upenn.edu/edissertations/3557 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/3557 For more information, please contact [email protected]. Rap1-Mediated Chromatin And Gene Expression Changes At Senescence Abstract ABSTRACT RAP1-MEDIATED CHROMATIN AND GENE EXPRESSION CHANGES AT SENESCENCE The telomeric protein Rap1 has been extensively studied for its roles as a transcriptional activator and repressor. Indeed, in both yeast and mammals, Rap1 is known to bind throughout the genome to reorganize chromatin and regulate gene transcription. Previously, our lab published evidence that Rap1 plays important roles in cellular senescence. In telomerase-deficient S. cerevisiae, Rap1 relocalizes from telomeres and subtelomeres to new Rap1 target at senescence (NRTS). This leads to two types of histone loss: Rap1 lowers global histone levels by repressing histone gene transcription and it also results in local nucleosome displacement at the promoters of the activated NRTS. Here, I examine mechanisms of site-specific histone loss by presenting evidence that Rap1 can directly interact with histone tetramers H3/H4, and map this interaction to a three-amino-acid-patch within the DNA binding domain. Functional studies are performed in vivo using a mutant form of Rap1 with weakened histone interactions, and deficient promoter clearance as well as blunted gene activation is observed, indicating that direct Rap1-H3/H4 interactions are involved in nucleosome displacement. -
SIX1 Gene SIX Homeobox 1
SIX1 gene SIX homeobox 1 Normal Function The SIX1 gene is part of a group of similar genes known as the SIX gene family. Genes in this family provide instructions for making proteins that bind to DNA and control the activity of other genes. Based on this role, SIX proteins are called transcription factors. The SIX1 protein interacts with several other proteins, including the protein produced from the EYA1 gene, to regulate the activity of genes that are important for normal development. Before birth, these protein interactions appear to be essential for the normal formation of many tissues. These include the second branchial arch, which gives rise to tissues in the front and side of the neck; the ears; the kidneys; the nose; a gland called the thymus that is part of the immune system; and muscles used for movement ( skeletal muscles). Health Conditions Related to Genetic Changes Branchiootorenal/branchiootic syndrome At least nine mutations in the SIX1 gene have been identified in people with branchiootorenal (BOR) syndrome, a condition that disrupts the development of tissues in the neck and causes malformations of the ears and kidneys. A few SIX1 gene mutations have also been found to cause branchiootic (BO) syndrome, which includes many of the same features as BOR syndrome except for kidney (renal) malformations. The two conditions are otherwise so similar that researchers often consider them together (BOR/BO syndrome or branchiootorenal spectrum disorders). In some cases, the same SIX1 gene mutation causes BOR syndrome in some members of a family and BO syndrome in others. Most of the known SIX1 gene mutations change single protein building blocks (amino acids) in the SIX1 protein. -
Interplay of Retinal Determination Gene Network with TGF-Β Signaling
Review Article Page 1 of 7 Interplay of retinal determination gene network with TGF-LOGO &β STYLE GUIDE signaling pathway in epithelial-mesenchymal transition 31 December 2012 Yu Liu1, Deguang Kong2, Hua Wu3, Xun Yuan3, Hanxiao Xu3, Cuntai Zhang1, Gaosong Wu2, Kongming Wu3 1Department of Geriatrics, 2Department of Thyroid and Breast Surgery, 3Department of Oncology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, 1095 Jiefang Avenue, Wuhan 430030, China 1 Correspondence to: Kongming Wu. Department of Oncology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Building 303, 1095 Jiefang Avenue, Wuhan 430030, China. Email: [email protected]. Abstract: As a fundamental event in the generation of tissues and organs during embryogenesis, the epithelial-mesenchymal transition (EMT) has also been implicated in cancer progression by its ability to alter the plasticity of epithelial cells to acquire invasive properties. Evidence is mounting that ectopic activation of transforming growth factors β (TGF-β)/bone morphogenetic protein (BMP) superfamily members to enhance tumorigenesis and metastasis. In this respect, the Retinal Determination Gene Network (RDGN), which was identified to govern the normal initiation of the morphogenetic furrow in Drosophila, has now been found to be de-regulated in various types of cancers, and the key members of this network, DACH, SIX, and EYA, have emerged as novel co-regulators of TGF- signaling during EMT. Understanding the molecular mechanism by which RDGN regulates TGF-β/BMP signaling to influence EMT may lead to novel strategies for targeted therapies. Keywords: Transforming growth factors β (TGF-β)/bone morphogenetic protein (BMP) signaling; epithelial- mesenchymal transition (EMT); DACH1; SIX1; EYA1 Received: 29 March 2015; Accepted: 25 May 2015; Published: 09 June 2015. -
Alternatively Constructed Estrogen Receptor Alpha-Driven Super-Enhancers Result in Similar Gene Expression in Breast and Endometrial Cell Lines
International Journal of Molecular Sciences Article Alternatively Constructed Estrogen Receptor Alpha-Driven Super-Enhancers Result in Similar Gene Expression in Breast and Endometrial Cell Lines 1,2, 3, 1, Dóra Bojcsuk y , Gergely Nagy y and Bálint László Bálint * 1 Genomic Medicine and Bioinformatic Core Facility, Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Debrecen, 4032 Debrecen, Hungary; [email protected] 2 Doctoral School of Molecular Cell and Immune Biology, Faculty of Medicine, University of Debrecen, 4032 Debrecen, Hungary 3 Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Debrecen, 4032 Debrecen, Hungary; [email protected] * Correspondence: [email protected] These authors contributed equally to this work. y Received: 22 January 2020; Accepted: 25 February 2020; Published: 27 February 2020 Abstract: Super-enhancers (SEs) are clusters of highly active enhancers, regulating cell type-specific and disease-related genes, including oncogenes. The individual regulatory regions within SEs might be simultaneously bound by different transcription factors (TFs) and co-regulators, which together establish a chromatin environment conducting to effective transcription. While cells with distinct TF profiles can have different functions, how different cells control overlapping genetic programs remains a question. In this paper, we show that the construction of estrogen receptor alpha-driven SEs is tissue-specific, both collaborating TFs and the active SE components greatly differ between human breast cancer-derived MCF-7 and endometrial cancer-derived Ishikawa cells; nonetheless, SEs common to both cell lines have similar transcriptional outputs. These results delineate that despite the existence of a combinatorial code allowing alternative SE construction, a single master regulator might be able to determine the overall activity of SEs. -
Sixth Sense Techniques — to Create Mice Harbour- 728–735 (2003) Ing Transgenes That Encode Mutant FURTHER READING Blanton, R
HIGHLIGHTS the left inferior frontal gyrus and the right lateral sulcus were found to be shifted anteriorly in the patient group. In view of developmental data that Mighty mouse point to a posterior shifting with age of the inferior frontal gyrus, Levitt et al. Murine models that exhibit one of speculate that anterior displacements the pathological lesions that charac- in autism could reflect delayed or terize Alzheimer’s disease have been incomplete maturation, at least in the available for some time. Now, the first frontal lobe. Further studies will be triple transgenic mouse to develop required to identify the root of sulcal both amyloid-β (Aβ) plaques and displacements in autism, and to estab- tangles of hyperphosphorylated tau lish whether such changes represent protein in AD-relevant brain regions causes or consequences of the disorder. has been unveiled in the 31 July issue Rebecca Craven, of Neuron. Senior Subeditor,Nature Frank LaFerla’s team used micro- injection of single-cell embryos — References and links ORIGINAL RESEARCH PAPER Levitt, J. G. et al. rather than standard cross-breeding Cortical sulcal maps in autism. Cereb. Cortex 13, Sixth sense techniques — to create mice harbour- 728–735 (2003) ing transgenes that encode mutant FURTHER READING Blanton, R. et al. Mapping cortical asymmetry and complexity patterns in The mammalian auditory system is comprised of the outer, forms of human amyloid precursor normal children. Psychiatry Res. 107, 29–43 (2001) middle and inner ears, and is responsible for both hearing and protein (APP), tau and presenilin-1. WEB SITE Encyclopedia of Life Sciences: http://www.els.net/ balance. -
Identification of Putative Master Regulators in Rheumatoid Arthritis Synovial Fibroblasts Using Gene Expression Data and Network
Identification of putative master regulators in rheumatoid arthritis synovial fibroblasts using gene expression data and network inference Naouel Zerrouk, Quentin Miagoux, Aurelien Dispot, Mohamed Elati, Anna Niarakis To cite this version: Naouel Zerrouk, Quentin Miagoux, Aurelien Dispot, Mohamed Elati, Anna Niarakis. Identifica- tion of putative master regulators in rheumatoid arthritis synovial fibroblasts using gene expression data and network inference. Scientific Reports, Nature Publishing Group, 2020, 10 (1), pp.16236. 10.1038/s41598-020-73147-4. hal-02958928 HAL Id: hal-02958928 https://hal.archives-ouvertes.fr/hal-02958928 Submitted on 3 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License www.nature.com/scientificreports OPEN Identifcation of putative master regulators in rheumatoid arthritis synovial fbroblasts using gene expression data and network inference Naouel Zerrouk1, Quentin Miagoux1, Aurelien Dispot2, Mohamed Elati2 & Anna Niarakis 1* Rheumatoid arthritis (RA) is a systemic autoimmune disease that afects the synovial joints of the body. Rheumatoid arthritis fbroblast-like synoviocytes (RA FLS) are central players in the disease pathogenesis, as they are involved in the secretion of cytokines and proteolytic enzymes, exhibit invasive traits, high rate of self-proliferation and an apoptosis-resistant phenotype.