Dna Barcoding of Some Indian Coelogyne (Epidendroideae
Total Page：16
File Type：pdf, Size：1020Kb
J. Orchid Soc. India, 30: 65-73, 2016 ISSN 0971-5371 DNA BARCODING OF SOME INDIAN COELOGYNE (EPIDENDROIDEEEAE, ORCHIDACEEEAAAE)E)E) J Ramudu and S M Khasim Department of Botany and Microbiology, Acharya Nagarjuna University, Nagarjuna Nagar - 522 510, Guntur, Andhra Pradesh, India Abstract Sub-tribe Coelogyninae (Epidendroideae, Orchidaceae) comprises 16 genera; study of one of these genera, i.e., Coelogyne Lindl. reveals sectional relationships with Pholidota. Present study was undertaken to develop DNA barcodes of sub-tribe Coelogyninae using rbcL (Rubisco large sub unit). The rbcL from chloroplast genome tested for as effective barcode. The inter-specific divergence values and species discrimination rates were calculated by Kimura 2 parameter (K2P) using MEGA 4.0. The rbcL with average inter-specific divergence values yielded 72.72% species resolution, thus, could distinguish all the species of Coelogyne and Pholidota. Invariably, the genus Pholidota showed close affinity with Coelogyne, supporting thereby the inclusion of genus Pholidota in the sub-tribe Coelogyninae under tribe Coelogyneae. Introduction Garden and Research Institute (TBGRI), Pallode (Kerala) and National Orchidarium, Yercaud (Tamil Nadu). THE ORCHIDACEAE is one of the largest families of flowering plants. It comprises about 779 genera and Isolation of Genomic DNA 22,500 species (Mabberley, 2008). In India, with 1,229 The genomic DNA was isolated using CTAB (N-acetyl- species spreading over 184 genera, it represents N,N,N-trimethyl-ammonium bromide) technique (Doyle second largest flowering plant family and contributes and Doyle, 1987). Leaf tissue (100 mg) grounded to about 10% of Indian Flora (Kumar and Manilal, 1994). powder to which was added 600 ml of cold extraction The orchid genus Coelogyne Lindl. is distributed buffer (3% CTAB, 1.42 M NaCl, 20 mM EDTA, 100 throughout South East Asia, Sumatra and Himalayas mM Tris-HCl, pH 8.0, 2% polyvinylepyrrolidone, 5 mM (Butzin, 1992); with most of the species growing as ascorbic acid); the tissue was further homogenized epiphytes, some species grow as lithophytes or even for 3 min. The entire homogenization process was terrestrial plants (Comber, 1990). In India, most of performed in liquid nitrogen. These homogenized the orchid habitats are dwindling in state due to many samples were then treated at 65o C for 15 min. and anthropogenic activities, such as habitat destruction then extracted once with chloroform-isoamyl alcohol and fragmentation, landscape development, river valley (24:1, v/v) to obtain clear supernatant. This projects and other infrastructural developments. Except supernatant was centrifuged at 12,000 rpm for 5 min. for a few publications in recent past (Chaudhary et This supernatant containing plant genomic DNA was al., 2012; Khasim and Ramesh, 2010; Parab and transferred to fresh test-tube to which added a one- Krishnan, 2008; Ramudu et al., 2012), no extensive fifth volume of 5% CTAB solution in 0.7 M NaCl, and work has been done on molecular characterization of extracted again with chloroform-isoamyl alcohol. The Indian orchids. In view of above background, the DNA was precipitated from the supernatant by the molecular characterization of some Indian orchids addition of two volumes of cold absolute ethanol, belonging to sub-family Epidendroideae was analyzed, incubated at –80oC for 15 min. and the DNA in the present investigation. centrifuged at 12,000 rpm for 20 min at 4oC. After Materials and Methods rinsing the DNA pellet in cold 70% ethanol, the DNA was dried under vacuum. The dried DNA was For molecular studies, plant materials (one population resuspended in 100 µl of distilled water. DNA each) belonging to the tribe Coelogyninae, Sub-tribe concentration was determined by measuring the Coelogyneae, subfamily Epidendroideae of family absorbance at 260 nm. The DNA quality was assessed Orchidaceae, were collected from different by using 1% agarose gel electrophoresis. geographical locations of Southern India i.e., Andhra Amplification of rbcl and Sequencing Pradesh, Tamil Nadu and Kerala (Table 1; Fig. 1). Some species were also procured from Tropical Botanical The universal primers downloaded from Kew website Received: July 5, 2016; Accepted: November 23, 2016 J. ORCHID SOC. INDIA (DECEMBER 30, I. Shevroy Hills, Yercaud (TN); II. Dodabetta, Ooty (TN); III. National Orchidarium, Yercaud (TN); IV. Paderu (AP); V. Chinthapalli (AP); VI. Giddaluru (AP); VII. Lthugadda (AP); VIII. Karumancode (KE); IX. TBGRI, Pallode (KE); X. Pallode (KE).) Fig. 1. India map with marked places of collection of orchid plant material. 66 2016) RAMUDU AND KHASIM – DNA BARCODING Table 1. List of species taken for molecular studies S.No. Species Place of collection and elevation Habitat and host tree Voucher No. Sub family Epidendroideae Tribe Coelogyneae Subtribe Coelogyninae 1 Coelogyne breviscapa Lindl. Shevroy Hills, Yercaud (TN), 1800 m Epi & Alnus nepalensis ANUH 1001 2 C. corymbosa Lindl. Dodabetta (TN), 2200 m Epi & Mangifera indica ANUH 1002 3 C. cristata Lindl. Shevroy Hills, Yercaud (TN), 1800 m Epi & Terminalia alata ANUH 1025 4 C. flaccida Lindl. Dodabetta, Ooty (TN), 2200 m Epi & Castanopsis indica ANUH 1003 5 C. nervosa A. Rich. Dodabetta (TN), 2100 m Epi & Schima wallichii ANUH 1004 6 C. nitida Lindl. National Orchidarium, Yercaud, (TN) _____ ANUH 1005 7 C. ovalis Lindl. Dodabetta, Ooty (TN), 2200 m Epi & Terminalia bellirica ANUH 1006 8 C. prolifera Lindl.. Dodabetta, Ooty (TN), 2200 m Epi & Terminalia alata ANUH 1007 9 C. trinervis Lindl. TBGRI,Pallode (KE) _____ ANUH 1026 10 Pholidota articulata Lindl. TBGRI,Pallode (KE) _____ ANUH 1027 11 P. pallida Lindl. Shevroy Hills, Yercaud (TN), 1800 m Epi & Mangifera indica ANUH 1009 aligned with chloroplast genome of some orchids and mixture. The removal of these two components is some changes towards 5’ end were taken as new necessary as these can cause hindrance in Sanger’s primers for amplification of rbcL locus. The new di-deoxy sequencing reaction. A total of 2 µl of enzyme primers were obtained from Helini Biomolecules, mixture, consisting of 0.5 µl of exonuclease I, 1 µl of Chennai, Tamil Nadu, India (Table 2). shrimp alkaline phosphatase and 0.5 µl of MQ was Table 2. Primers used for amplification of rbcL DNA barcodes. S.No. Locus Primer name Primers sequence 1. rbcL rbcL_F 5’ ATGTCACCACAAACAGAGACTAAAGC 3’ rbcL_R 5’ GAAACGGTCTCTCCAACGCAT 3’ The PCR reaction mixture contained 1 unit of Pfu DNA used to clean 8 µl of PCR product making it a total of polymerase, 2 µl each of 10X PCR buffer with MgSO4, 10 µl of reaction mixture. The mixture was then 2 mM of each of the dNTPs, 10 µM forward and incubated at 37°C for 15 min, 85°C for 15 min, and reverse primers and 20-30 ng of template DNA. The finally held at 4°C in a thermal cycler. The cleaned up final volume was made to 20 µl with autoclaved MQ. PCR products were stored at -20°C. The purified PCR For amplification of rbcL locus from the chloroplast product was subjected to bi-directional Sanger’s di- genome the thermal cycle followed was: one cycle of deoxy sequencing (Sanger et al., 1977) using BigDye 5 min at 94°C; 35 cycles of 30 sec each at 94°C, 40 terminator v3.1 cycle sequencing kit on ABI Prism sec at 50°C, 1 min at 72°C with a final extension of 3700 DNA Analyzer (Applied Biosystems Inc., USA). 7 min at 72°C. The PCR products were The sequencing reaction mixture contained 0.5 µl electrophoresed in 1% TAE agarose gel, containing 5 BigDye v3.1 ready reaction mixture, 3 µl PCR product, mg/ml EtBr and visualised on a UV trans-illuminator. 2 µl 5X sequencing buffer, 1 µl either forward or The PCR products are cleaned by Exo-SAP method::: reverse primer (10 µM) and 3.5 µl autoclaved MQ The samples that yielded single band of amplicon were making the final volume of 10 µl. The thermal cycle cleaned using mixture of two enzymes - exonuclease for sequencing was 30 cycles of 10 sec each at 96°C, and shrimp alkaline phosphatase (Exo-SAP method). 5 sec at 50°C and 4 min at 60°C. The cleaning up of The enzymes treatment degrades the unused primers sequencing products was carried out using 1 ml of left after the amplification and removes the phosphate 0.5M Na2 EDTA (pH 8.0) diluted with 11 ml of MQ. 15 group from all the left over dNTPs in the reaction µl of this solution along with 81 µl of absolute ethanol 67 J. ORCHID SOC. INDIA (DECEMBER 30, was added to each well of the PCR plate and mixed sequence was taken as the representative sequence thoroughly by inverting the sealed plate. Thereafter, for that particular species. The sequences were it was kept in dark for 10 min at room temperature submitted to GenBank, NCBI and accession numbers and centrifuged at 3220g for 30 min at 18°C. The were obtained for each sequence (Table. 3). The plate was decanted on a tissue paper and centrifuged representative sequence of each of the selected in an inverted position at 50g for 1 min. Thereafter, species for a particular locus was pasted in a notepad 150 µl of 70% ethanol was added to each well and (.txt) file in fasta format and saved to particular the plate was centrifuged at 3220g for 10 min at 18°C. location on the hard disk drive. The same notepad file The plate was again decanted on a tissue paper and was opened in the Bio Edit version 7.0.9.0 software centrifuged in inverted position at 50g for 1 min. The which is freely available on the internet. The sequences pellets were air-dried for 10 min in dark and 10 µl of were then aligned using CLUSTAL W, a tool for multiple the highly deionised formamide to each well was added sequence alignment.